The present invention relates to a derivative of a mitogen-activated protein (MAP) kinase kinase and the use of said derivative for increasing disease resistance and enhanced stress tolerance in plants.

BACKGROUND OF THE INVENTION

Signaling mechanisms that mediate plant defense responses may be strongly conserved among plants. This is supported by the observation that several classes of R genes confer disease resistance when expressed in heterologous plant species. For instance, the tomato disease resistance gene, Cf-9, was shown to confer responsiveness to the fungal avirulence gene product Avr9 in transgenic tobacco and potato (Hammond-Kosack et al., 1998). Although Cladosporium fulvum is exclusively a fungal pathogen of tomato, a rapid hypersensitive response (HR) was induced in transgenic tobacco and potato by experimentally allowing these specific interactions to occur which then induced signaling pathways that could be common to the plants. Furthermore, the tomato disease resistance gene, Pto, which specifies race-specific resistance to the bacterial pathogen Pseudomonas syringae pv tomato carrying the avrPto gene, also increased the resistance of tomato to Xanthomonas campestris pv vesicatoria and Cladosporium fulvum when over expressed (Tang et al., 1999). Clearly, it is the recognition of the pathogen that is unique to most plant species; whereas, the defense response is similar among them.

Considerable progress has now been made in understanding the signal transduction pathways following perception of biotic and abiotic stresses and the information is being used to develop strategies for modifying transgenic plants. Separate manipulations of the G protein pathway (Xing et al., 1996, 1997) may elevate pathogen resistance or induce defense reactions in transgenic tobacco (Beffa et al., 1995) and increase resistance to tobacco mosaic virus infection (Sano et al., 1994). Multiple roles for MAPK (mitogen-activated protein kinase) in plant signal transduction have also been shown, including responsiveness to pathogens, wounding and other abiotic stresses, as well as plant hormones such as ABA, auxin and ethylene (Hirt, 1997; Kovtun et al., 1998). MAPKK (mitogen-activated protein kinase kinase) from Arabidopsis (AtMEK1) and tomato (LeMEK1) have been shown to be induced by wounding (Morris et al., 1997; Hackett et al., 1998), and the maize (ZmMEK1) gene was induced by high salinity and cold (Hardin and Wolniak, 1998). These enzymes interact within MAP kinase pathways that are extensively used for transcytoplasmic signaling to the nucleus. In the MAPK signal transduction cascade, MAPKK (MAP kinase kinase) is activated by upstream MAPKKK (mitogen-activated protein kinase kinase kinase) and in turn activates MAPK. The transcription of specific genes is induced by MAPK through phosphorylation and activation of transcription factors. This pathway has not yet been manipulated in plants.

SUMMARY OF THE INVENTION

The present invention relates to a derivative of a mitogen-activated protein (MAP) kinase kinase and the use of said derivative for increasing disease resistance and enhanced stress tolerance in plants.

According to the present invention it was determined that mutagenesis of a core phosphorylation site of a member of the MAPK cascade can create a permanently-active form, which stimulates both pathogen- and wound-inducible genes when introduced into plant cells.

Thus, according to the present invention there is provided a nucleic acid sequence encoding a derivative of a mitogen-activated protein kinase kinase gene from plants, wherein said derivative contains a negative charge in a core phosphorylation site of said protein kinase kinase gene.

Further according to the present invention there is provided a derivative of a mitogen-activated protein kinase kinase gene from plants, wherein said derivative contains a negative charge in a core phosphorylation site of said protein kinase kinase gene.

In a further embodiment of the present invention there is provided a cloning vector comprising a nucleic acid sequence encoding a derivative of a mitogen-activated protein kinase kinase gene from plants, wherein said derivative contains a negative charge in a core phosphorylation site of said protein kinase kinase gene.

The present invention also includes a transgenic plant comprising a nucleic acid sequence encoding a derivative of a mitogen-activated protein kinase kinase gene, wherein said derivative contains a negative charge in a core phosphorylation site of said protein kinase kinase gene.

Further, according to the present invention there is provided a method of increasing disease resistance or enhancing stress tolerance in a plant by introducing into said plant a nucleic acid sequence encoding a derivative of a mitogen-activated protein kinase kinase gene, wherein said derivative contains a negative charge in a core phosphorylation site of said protein kinase kinase gene.

BRIEF DESCRIPTION OF THE DRAWINGS

These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:

FIGURE 1 shows sequence analysis of tMEK2. FIGURE 1a shows the DNA (SEQ ID NO:1) and deduced amino acid sequence (SEQ ID NO: 2). Roman numerals under the sequence indicate the 11 subdomains found in protein kinases. The asterisk indicates stop codon. FIGURE 1b shows the alignment of the deduced amino acid sequences from catalytic domains of MAPKK subfamily members (SEQ ID NO: 3 to 21). FIGURE 1c shows the alignment of amino acid sequences of tMEK2 with other MAPKKs between subdomain VII and VIII. Dashes represent gaps introduced for maximum matching. The amino acid residues in bold and italics between subdomain VII and VIII show putative phosphorylation sites.

FIGURE 2 shows the autophosphorylation and substrate phosphorylation activity of tMEK2. FIGURE 2a shows the autophosphorylation of tMEK2^WT and tMEK^MUT. Recombinant GST-tMEK2^WT or GST-tMEK2^MUT proteins were incubated in vitro without any protein kinase substrate followed by SDS-PAGE and autoradiography. FIGURE 2b shows the phosphorylation of myelin basic protein (MBP) by tMEK2^WT and tMEK^MUT. Recombinant GST-tMEK^WT or GST-tMEK2^MUT proteins were incubated in vitro with MBP followed by SDS-PAGE and transfer to nitrocellulose. The upper panel is the autoradiography of the nitrocellulose filter. The lower panel is the immunoblot with anti-GST antibody.

FIGURE 3 shows the constructs of tMEK2^WT or tMEK^MUT driven by the constitutive promoter tCUPΔ or control plasmid showing GUS gene driven by the constitutive promoter tCUPΔ.

FIGURE 4 shows the expression of tMEK2 in tomato leaf mesophyll protoplasts. The effect was analysed by quantitative RT-PCR following transient expression of tMEK2 in protoplasts. C1, no electroporation; C2, electroporation of control plasmid; MEK2^WT, electroporation of plasmid with tMEK2^WT driven by the tCUPA promoter, electroporation of plasmid with tMEK2^MUT driven by tCUPΔ promoter. The pathogenesis-related genes PR1b1, PR3 and Twil were tested. Tomato actin was used as an internal standard.

FIGURE 5 shows the activation of ER5 by tMEK2. FIGURE 5a shows RNA gel blot analysis of total RNA (15 µg) from leaves following wounding for the indicated time in hours, showing wound-induced activation of tMEK2 and ER5 genes. FIGURE 5b shows the activation of ER5 gene by tMEK2. The effect was analysed by quantitative RT-PCR following transient expression of tMEK2 in protoplasts. Lane settings are as described in Figure 4. Tomato actin was used as an internal standard.

FIGURE 6 shows the effect of MAPK inhibitors on tMEK2^MUT-induced gene activation. Kinase inhibitors at the concentration of 1 µM for staurosporine, 350 nM for SB 202190 and 1 µM for PD 98059, SB 203580 and SB 202474 were included in the proteoplast incubation buffer.

FIGURE 7 shows the comparison of disease symptoms on a leaf from a wild type plant and on a leaf from tMEK2^MUT transformed plant.

DESCRIPTION OF PREFERRED EMBODIMENT

According to the present invention there is provided a derivative of a mitogen-activated protein kinase kinase (MAPKK). The present invention also relates to a method for increasing disease resistance and enhanced stress tolerance in plants using said derivative.

When used herein the term derivative means a modified MAPKK protein, wherein said modification includes the replacement of one or more amino acids of the wild type MAPKK with one or more other amino acids. Therefore said derivative is a non-naturally occurring variant of the wild type MAPKK.

MAPK signaling cascades are ubiquitous among eukaryotes from yeast to human (Guan, 1994) and mediate a large array of signal transduction pathways in plants (Hirt, 1997; Mizoguchi et al., 1997). The cascades utilize the reversible phosphorylation of regulatory proteins to achieve rapid biochemical responses to changing external and internal stimuli. A specific MAPK is rapidly activated by pathways responding to cold, drought, mechanical stimuli and wounding (Bogre et al., 1997; Jonak et al., 1996; Seo et al., 1995; Usami et al., 1995). MAPKs are also rapidly activated by pathways responding to pathogen elicitors (Ligterink et al., 1997; Suzuki and Shinshi, 1995). Other factors such as salicylic acid which is a signaling molecule in the pathogen response, may intervene in the signal cascade by transiently activating a MAPK in tobacco cells (Zhang and Klessig, 1997). MAPKK, which activates MAPK by phosphorylation in the signal cascade has been identified in Arabidopsis, tobacco, maize and tomato (Mizoguchi et al., 1997; Shibata et al., 1995; Hardin and Wolniak, 1998). Although phosphorylation of MAPKK by MAPKKK is the primary mechanism for initiating the signal cascade, regulation at the level of gene expression has also been implied. For instance, transcriptional activity of an Arabidopsis MAPKK, MEK1 (Morris et al., 1997), and a tomato MAPKK, tMEKI (Hackett et al., 1998), was increased by wounding. Transcriptional activity of ZmMEK1, a maize MAPKK, was slightly increased in roots by high salinity and was substantially decreased by cold (Hardin and Wolniak, 1998). In this study, tomato tMEK2 mRNA accumulation was also induced by wounding of leaves but transient expression in protoplasts did not result in the activation of the target gene ER5. This observation supported the view that biochemical activation of MAPKK by phosphorylation was the primary factor in signal transduction and that transcriptional control plays a secondary role.

Yeast and animal MAPKK are activated when serine and serine/threonine residues in the SxAxS/T motif, located upstream of the subdomain VIII are phosphorylated by MAPKKK. The putative consensus motif for characterised plant MAPKK is a S/TxXXxxS/T signature. This motif contains two additional residues when compared with the motif SxAxS/T detected in other eukaryotes. Thus, according to the present invention the use of a plant gene encoding the MAPKK is preferred to that of the yeast and animal genes, as the plant gene provides additional sites for manipulation. The plant genes also provide additional combinations of sites that can be modified according to the present invention. Thus, according to the present invention one or multiple sites of the plant gene can be modified.

According to the present invention, by creating a negative charge around a core phosphorlyation site the activation by MAPKKK was not needed for MAPKK activity.

According to the present invention possible core phosphorlyation sites include: serine and/or threonine sites located upstream of the subdomain VIII.

According to the present invention the creation of a negative charge around one of said core phosphorlyation sites includes replacement of one or more amino acids with an amino acid selected from the group consisting of: any negatively charged amino acids. In one embodiment of the present invention said negatively charged amino acids include glutamic acid and aspartic acid.

In one embodiment of the present invention MAPKK gene, from various sources can be modified, as described above. As noted earlier MAPK signalling cascades are ubiquitous among eukaryotes from yeast to human. Suitable examples of a suitable gene that can be used according to the present invention include Lycopersicum esculentum cv Bonny Best, tMEK2, together with other genes available in the art, as exemplified by the following:

• Arabidopsis thaliana, AtMAP2Kα, (Jouannic S., Hamal A., Kreis M., Henry Y. 1996, Molecular cloning of an Arabidopsis thaliana MAP kinase kinase-related cDNA. Plant Physiol. 112:1397)
• A. thaliana, AtMKK4, (Genbank accession number AB015315)
• A. thaliana, AtMEK1, (Morris P.C., Cuerrier D., Leung L., Giraudat J. 1997, Cloning and characterisation of MEK1, an Arabidopsis gene encoding a homologue of MAP kinase kinase. Plant Mol. Biol. 35: 1057-1064)
• L. esculentum tomato c.v. Alisa Craig, LeMEK1, (Genbank accession number AJ000728)
• Zea mais, ZmMEK1, (Genbank accession number U83625)
• A. thaliana, AtMAP2Kβ, (Genbank accession number AJ006871)
• N. tabucum, NPK2, (Shibata W., Banno H., Hirano YIK., Irie K. Machida SUC., Machida Y. 1995, A tobacco protein kinase, NPK2, has a domain homologous to a domain found in activators of mitogen-activated protein kinasis (MAPKKs). Mol. Gen. Genet. 246: 401-410)
• A. thaliana, AtMKK3, (Genbank accession number AB015314)
• D. discoideum, DdMEK1, (Nakai K., Kanehisa M. 1992, A knowledge base for predicting protein localisation sites in eukaryotic cells. Genomics 14:897-911.)
• Leischmania donovani, LPK, (Li S., Wilson ME., Donelson JE. 1996, Leishmania chagasi: a gene encoding a protein kinase with a catalytic domain structurally related to MAP kinase kinase. Exp. Parasitol. 82: 87-96.)
• Drosophila melanogaste, HEP, (Glise B., Bourbon H., Noselli S. Hemipterous encodes a novel Drosophila MAP kinase kinase, required for epithelial cell sheet movement. 1995, Cell 83: 451-461.)
• Homo sapiens, MEK1, (Zheng C., Guan K. 1993, Cloning and characterisation of two distinct human extracellular signal-regulated kinase activator kinases MEK1 and MEK2. J. Biol. Chem. 268: 11435-11439)
• R. norvegicus, MEK5, (English JM., Vanderbilt CA., Xu S., Marcus S., Cobb MH. 1995, Isolation of MEK5 and differential expression of alternatively spliced forms. J. Biol. Chem. 270: 28897-28902.)
• H. sapiens, MKK3, (Derijard B., Raingeaud J., Barrett T., Wu IH., Han J., Ulevitch RJ., Davis RJ. 1995, Independent human MAPkinase signal transduction pathways difined by MEK and MKK isoforms. Science 267:682-685.)
• Saccharomyces cerevisiae, PBS2, (Boguslawaki G., Polazzi JO. 1987, Complete nucleotide sequence of a gene conferring polymyxin B resistance on yeast: similarity of the predictied polypeptide to protein kinases. Proc. Natl. Acad. Sci. USA 84: 5848-5852.)
• S. cerevisiae, STE7, (Teague MA., Chaleff DT., Errede B. 1986, Nucleotide sequence of the yeast regulatory gene STE7 predicts a protein homologous to protein kinases. Proc. Natl. Acad. Sci. USA 83: 7371-7375.)
• Candida albicans, FIST 7, (Clark KL., Feldmann PJ. Dignard D. 1995, Constitutive activation of the Saccharomyces cerevisiae mating response pathway by a MAP kinase kinase from Candida albicans. Mol. Gen. Genet. 249: 609-621.)
• S. cerevisiae, MKK1, (Irie T., Takase MKS., Lee KS., Levin DE., Araki H., Matsumoto K., Oshima Y. 1993, MKK1 and MKK2, encoding Saccharomyces cerevisiae MAP kinase kinase homologues function in the pathway mediated by protein kinase C. Mol. Cell. Biol. 13:3076-3083.)

In a further embodiment of the present invention putative phosphorylation activation sites are selected from the group consisting of:

• Lycopersicum esculentum c.v. Bonny Best, tMEK 2: 219serine, 220threonine, 221serine and 226threonine;
• Arabidopsis thaliana, AtMAP2Kα: 220threonine, 226serine and 227serine;
• A. thaliana. AtMKK4: 220threonine, 226serine and 227serine;
• A. thaliana, AtMEK1: 219serine, 220threonine, 221serine, 222serine and 226serine;
• L. esculentum, LeMEK1: 219serine, 220threonine, 221serine and 226threonine;
• Zea mais, ZmMEK1: 219serine, 220serine and 226threonine;
• A. thaliana. At MAP2Kβ: 218threonine, 220threonine and 226threonine;
• N. tabucum, NPK2: 219serine, 220serine and 226threonine;
• A. thaliana, AtMKK3: 220serine and 226threonine;
• D. discoideum, DdMEK1, 220threonine, 222serine and 226threonine;
• Leischmania donovani, LPK: 220threonine, 224serine, 225serine and 226threonine;
• Drosophila melanogaste, HEP: 220serine and 226threonine;
• Homo sapiens, MEK1: 220serine and226serine;
• R. norvegicus, MEK5: 220serine and 226threonine;
• H. sapiens, MKK3: 220serine and 226threonine;
• Saccharomyces cerevisiae, PBS2: 220serine and 226threonine;
• S. cerevisiae, STE7: 220serine and 226threonine;
• Candida albicans. HST 7: 220serine and 226threonine; and
• S. cerevisiae, MKK1: 220serine, 225threonine and 226threonine;

In one further embodiment of the present invention, there is provided a derivative of a mitogen-activated protein kinase kinase gene from tomato cv. Bonny Best, wherein the amino acids serine221 and threonine226 have been replaced with aspartic acid.

Methods of modifying amino acid sequences are well known in the art. In general terms two primers, one for the 3' end and one for the 5' end are used to amplify the coding region. PCR-based site-directed mutagenesis was then done using the procedure as described by Higuchi (1989). Based on the sequence of the PCR product two PCR reactions are used for its mutagenesis. In PCR reaction 1, a primer containing the appropriate base substitution was used together with the 5' primer to amplify the 5' end of the coding region. In PCR reaction 2, a further primer with the appropriate base substitution was used together with the 3' primer to amplify the 3' end of the coding region. Products from both reactions were then purified and combined for 3' extension. The resulting mutant was then amplified with the original 3' and 5' primers.

The present invention also includes a suitable cloning vector containing the nucleic acid sequence encoding the derivative of the MAPK gene for transforming suitable plant recipients to increase disease resistance and enhance stress tolerance in plants. Suitable cloning vectors include any cloning vectors, Ti plasmid-derived and standard viral vectors well known in the art.

The cloning vectors can include various regulatory elements well known in the art. For example the cloning vector of the present invention can further comprise a 3' untranslated region. A 3' untranslated region refers to that portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid tracks to the 3' end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5' AATAAA-3' although variations are not uncommon.

Examples of suitable 3' regions are the 3' transcribed non-translated regions containing a polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes, such as the nopaline synthase (Nos gene) and plant genes such as the soybean storage protein genes and the small subunit of the ribulose-1, 5-bisphosphate carboxylase (ssRUBISCO) gene.

The cloning vector of the present invention can also include further enhancers, either translation or transcription enhancers, as may be required. These enhancer regions are well known to persons skilled in the art, and can include the ATG initiation codon and adjacent sequences. The initiation codon must be in phase with the reading frame of the coding sequence to ensure translation of the entire sequence. The translation control signals and initiation codons can be from a variety of origins, both natural and synthetic. Translational initiation regions may be provided from the source of the transcriptional initiation region, or from the structural gene. The sequence can also be derived from the promoter selected to express the gene, and can be specifically modified so as to increase translation of the mRNA.

To aid in identification of transformed plant cells, the constructs of this invention may be further manipulated to include plant selectable markers. Useful selectable markers include enzymes which provide resistance to chemicals such as an antibiotic such as gentamycin, hygromycin, kanamycin, or herbicides such as phosphirothycin, glyphosate, chlorsulturam and the like. Similarly, enzymes providing for production of a compound identifiable by colour change such as GUS (β-glucuronidase), or luminescence, such as luciferase are useful.

A promoter, included in the cloning vector of the present invention, can include a constitutive promoter, which will ensure continued expression of the gene. The nucleic acid sequence encoding the derivative of the MAPK gene can also be under the control of a inducible promoter. Said inducible promoter is triggered by an induction response.

Generally speaking, an inducible promoter is a promoter that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically the protein factor, that binds specifically to an inducible promoter to activate transcription, is present in an inactive form which is then directly or indirectly converted to the active form by the inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible promoter may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods.

A constitutive promoter directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development. Examples of known constitutive promoters include those derived from the CaMV 35S and Agrobacterium Ti plasmid opine synthase gene (Sanders et al., 1987) or ubiquitin (Christensen et al., 1992). Additionally the constitutive promoter described in WO 97/28268 published August 7, 1997.

Also considered part of this invention are transgenic plants containing the variant of the present invention. Methods of regenerating whole plants from plant cells are known in the art, and the method of obtaining transformed and regenerated plants is not critical to this invention. In general, transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be used to establish repetitive generations, either from seeds or using vegetative propagation techniques.

Besides viral cloning vectors, transformation can also be accomplished by particle bombardment using the nucleic acid sequence encoding the derivative of the MAPK gene. Bondardment is a DNA delivery technique using foreign DNA particles delivered to various plant cells, tissues and species using biolistic device such as gun powder-driven biolistic device (Dupont, Wilmington, DE), gas-driven particle delivery system, microtargeting particle accelator, an air gun apparatus (Daniell, 1997), helium blasting (Pareddy et al., 1997) and instruments based on electric discharge. Transformation can also be achieved by direct uptake of Agrobacterium that contained foreign DNA sequence into plants via stomato in the leaves of stem or roots (Clough et al., 1998).

A further aspect of the present invention is directed to the use of said nucleic acid sequence encoding the derivative of the MAPK gene to increase disease resistance or to enhance stress tolerance in plants. In this aspect of the invention the nucleic acid is introduced into the plant using any of the methods described above.

Pathogenesis-related (PR) proteins are intra- and extracellular proteins that accumulate in plant tissues or cultured cells after pathogen attack or elicitor treatment (Bowles, 1990). Using PR gene expression as a marker for the plant defence response, both PR1b1 and the chitinase gene were induced by the derivative of the MAPK gene of the present invention.

Furthermore, according to the present invention, the transcription of the tomato ER5 gene, ZG (ABA). drought and wounding (Zegzouti et al., 1997) was induced by the derivative of the MAPK gene of the present invention.

Thus, according to the present invention the derivative of the MAPK gene of the present invention can activate both pathogen- and wound-related genes.

The use of said nucleic acid sequence encoding the derivative of the MAPK gene can also be used in combination with other methods to increase disease resistance or to enhance stress tolerance in plants. These other methods could include modification of downstream components for example transcription factors and transcriptional activators. The modification of transcription factors was proven to be an effective means to improve plant stress tolerance. Overexpression of a single stress-inducible transcription factor DREB1A isolated from Arabidopsis improved plant drought, salt, and freezing tolerance (Masuga et al., 1999). Overexpression of CBF1, an Arabidopsis transcriptional activator, enhanced freezing tolerance (Jaglo-Ottosen et al., 1998). There is potential that modification of transcription factors or transcriptional activators downstream of MAPK in our system will enhance disease resistance and stress tolerance.

In addition there are some parallel pathways that could contribute to increased disease resistance or to enhanced stress tolerance in plants if used in combination with the modified MAPK pathway of the present invention. An example of another parallel pathway would be calcium dependent protein kinase (CDPK) (Sheen, 1996). CPDK has also been shown to act as a key mediator for cold, salt, drought, dark and ABA stresses. In addition CDPK is involved in primary defence response to pathogen attack. Overexpression of either of two different CDPKs (ATCDPK1 and ATCDPK1a) in maize protoplasts active stress signalling (Sheen, 1996). Thus the co-manipulation of the two pathways should further strengthen the defence ability of the plant.

The present invention is illustrated by the following examples, which are not to be construed as limiting.

EXAMPLES

Example 1: Isolation and Modification of tMEK2.

RNA was extracted with Extact-A-Plant™ RNA Isolation Kit (CloneTech Laboratories, Inc.) from four-week-old tomato leaves. Reverse transcription was as described in Sambrook et al. (1989). Cloning was carried out by PCR using Taq DNA polymerase (Life Technologies Inc.). A MAPKK gene, tMEK2, was isolated from tomato cv. Bonny Best by PCR (Figure la) using published MAPKK gene sequences of tomato cv. Ailsa Craig and other plant species. It shares a high level of sequence homology with MAPKKs from other species and tomato cultivars (Figure 1b) but compared with MAPKKs from mammals and yeast, tMEK2 and other plant MAPKKs have two more potential core phosphorylation sites between subdomains VII and VIII (Figure 1c).

Using PCR-assisted, site-directed mutagenesis, amino acids serine221 and threonine226 were replaced with aspartic acid (Figure 1c) creating a negative charge around the core phosphorylation site so that phosphorylation of MAPKK by upstream MAPKKK is no longer necessary for activity. Two primers (5'-end and 3'-end) that span the coding region of tomato cv Ailsa Craig LeMEK1 were used for the amplification of the MAPKK coding sequence in tomato cv Bonney Best. PCR-based site-directed mutagenesis was carried out as described before (Higuchi, 1989). Based on the sequence of the PCR product, two PCR reactions were run for its mutagenesis. In PCR reaction 1. a primer containing the base substitutions (5'GTATGTGCCGACAAA GTCATTGGCCAGTCCATCTGTGCTTGCTAGTACTGCACTCACAC3'.SEQ ID NO: 22) was used together with 5'-end primer to amplify a 692 bp fragment corresponding to the 5' region of the cloned MAPKK. In PCR reaction 2, a primer containing the base substitutions (5'GTACTAGCAAGCACAGATGGACTGGCCA ATGACTTTGTCGGCACATACAACTATATGTC3', SEQ ID NO:23) was used together with 3'-end primer to amplify a 429 bp fragment corresponding to the 3' region of the cloned MAPKK. Products from PCR reaction 1 and 2 were then purified and combined for 3' extension. Mutant tMEK2 was amplified with the original 5'-end primer containing BamHI and NcoI restriction sites, and 3'-end primer containing Sall and SmaI restriction sites. The wild type and mutagenized PCR products were purified from an agarose gel using Elu-Quik DNA Purification Kit (Schleicher & Schuell) and ligated into pre-digested pGEM-T Easy vector. The inserts were digested using NcoI/SmaI and ligated into pTZ19 tCUPA-GUS-nos3'. This derivative of tCUP promoter was created by the following modifications to the original tCUP: mutation of the sequence, 3' deletion of the sequence, nucleotide addition to the sequence, deletion of an upstream out-of-frame ATG methionine initiator codon from the sequence, deletion of the fusion protein encoded by the tobacco genomic DNA from the sequence, addition of restriction sites to the sequence. In detail, exact nucleotide changes are (numbered relative to the tCUP sequence or to the tCUPΔ ( sequence as noted): 2084 CATATGA 2090 (NdeI recognition site beginning at 2084 underlined) in the tCUP sequence mutated to 2084 CATAGATCT 2092 (BgIII recognition site beginning at 2087 underlined) in the tCUPΔ sequence deleting one restriction site and one upstream out-of-frame ATG methionine initiator codon while adding another restriction site and two nucleotides; 2171 AATACATGG 2179 in the tCUP sequence mutated to 2173 CCACCATGG 2181 in the tCUPΔ sequence adding a Kozak consensus motif for translational initiation and an Ncol recognition site at 2176 underlined); 2181 to 2224 (relative to tCUP sequence) of tobacco genomic DNA removed from tCUPA (2183 to 2226 relative to tCUPA), deleting the 3' end of the tCUP sequence and the N-terminal fusion peptide encoded by the tobacco genomic DNA. The tCUPΔ-GUS-nos construct was created by fusion of the tCUPA sequence with a GUS gene and nos terminator having the sequence 2183 CTCTAGAGGAT CCCCGGGTGGTCAGTCCCTT 2213 3' (SEQ ID NO:24) to the GUS ATG at 2214 on the tCUPΔ sequence (see Figure 3).

Example 2: Expression and Phosphorylation Analysis of Recombinant tMEK2

For in-frame cloning with GST into the BamHI/SalI sites in the pGEX-4T-3 vector (Amersham Pharmacia) subcloned PCR products in pGEM-T Easy vector were digested by BamHI/SalI and ligated into pGEX-4T-3 cut with the same enzymes. Sequences of cloned products were confirmed by DNA sequencing. The proteins were expressed as glutathione-S-transferase fusions (GST) and purified by glutathione-agarose (Sigma) affinity chromatography essentially as described in manufacturer's protocol. Protein concentration was determined with a Bio-Rad detection system (Bio-Rad).

Autophosphorylation assay contained 1µg of GST-tMEK2^WT or GST-tMEK2^MUT in 30 mM Hepes (pH 7.5), 5 mM of MgSO₄, 5 mM of MnSO₄, and 1mM CaCl₂, 10 mM ATP, and 3 µCi γ-³²P-ATP (specific activity 222 TBq/mmol) in a total volume of 15 µl. The reaction mixture was incubated at 30°C for 45 min and the reaction was stopped by boiling 3 min in SDS sample buffer. As shown in Figure 2a, both wild type and mutant forms of the tMEK2 enzyme showed autophosphorylation activity.

Substrate phosphorylation assays contained 1 µg of GST-tMEK2^WT or GST-tMEK2^MUT, 2 µg of myelin basic protein (MBP, Life Technologies Inc.), 30 mM Hepes (pH 7.5), 5 mM MgSO₄ and 5 mM MnSO₄. Reactions were carried out at 30°C for 30 min. Phosphorylated products were separated by 10% SDS-PAGE, transferred to nitrocellulose and autoradiographed. Both the wild type and mutant forms of the tMEK2 enzyme phosphorylated myelin basic protein (MPB) in vitro (Figure 2b). Protein immunoblotting was performed as described previously (Xing et al., 1996) using antiGST antibody (Amershan Pharmacia) and alkaline phosphatase-conjugated secondary antibody.

Example 3: Activation of pathogen- and wound-related genes by tMEK2

To examine the effects of tMEK2^WT and tMEK2^MUT on the activation of pathogenesis-related (PR) or other pathogen-inducible genes a tomato protoplast transient expression system was developed. Chimeric genes, tCUPA -tMEK2^WT-nos and tCUPΔ-tMEK2^MUT-nos, were constructed using the strong constitutive promoter, tCUPΔ, which was derived from the tCUP promoter as by modification of the mRNA leader sequence described above. After electroporation, transient expression of potential target genes was detected by quantitative RT-PCR. The genes analysed included PR1b1, which is activated by tomato mosaic virus (Tornero et al., 1997); PR3 (chitinase), which is activated during an incompatible C. fulvam-tomato interaction (Danhash et al., 1993); and Twi, which is a pathogen- and would-inducible gene recently identified in tomato (O'Donnell, et al., 1998).

The following procedures were used.

Protoplast isolation and transformation

Tomato (Lycopersicon esculentum cv Bonny Best) were grown at 80% relative humidity in peat soil in growth cabinets programmed for 16 hr days at 25°C and 8 hr nights at 22°C. Light intensity was controlled at 25 pE m-2 S-1 emitted from "cool white" fluorescent lamps (Philip Canada, Scarborough, Ontario). The youngest fully expanded leaves were surface sterilized for 5 min in 4% sodium hypochlorite and rinsed three times with sterile water. The lower epidermis was gently rubbed with Carborundum, rinsed with sterile water and leaf fragments of ca. 1cm² were floated with exposed surface facing an enzyme solution containing 0.15% macerozyme R₁₀ (Yakult Honsha Co., Japan), 0.3% Cellulase "Onozuka" Rio (Yakult Honsha Co., Japan), 0. 4 M sucrose in K3 medium (Maliga et.al., 1973). After overnight incubation at 30 °C, the enzyme-protoplast mixture was filtered through a 100 µm nylon sieve, centrifuged at 500 g for 5 min. and floated protoplasts were collected and washed twice with W5 medium (Maliga et.al., 1973). The protoplasts were kept on ice in W5 medium for 2 hr before transformation.

The protoplasts were resuspended in electroporation buffer containing 150mM MgCl₂ and 0.4 M mannitol at a density of 1x10⁶ protoplasts/ml and co-electroporated with 12-15 g of pTZ19 carrying tMEK2 gene and pJD300 carrying luciferase gene in a total volume of 500 µl as described by Leckie (1994) with some modifications. Electroporation was performed at 200 volts and 100 µF (Gene Pulser II, Bio-Rad). Protoplasts were then allowed to recover on ice in the dark for 10 min followed by centrifugation at 500 g for 5 min. After removal of the supernatant, the protoplast pellet, with about 500 µl of buffer, was supplemented with another 500 µl protoplast incubation buffer. Protoplasts were incubated in the dark at 30°C for 24 hr.

Kinase inhibitors (CalBiochem, San Diego, CA) at the concentration of 1 µM for staurosporine, 350 nM for SB 202190 and 1 µM for PD 98059, SB 203580 and SB 202474, when applicable, were included in the protoplast incubation buffer. The inhibitors did not change protoplast viability (data not shown).

Luciferase assay

Luciferase activity in protoplasts co-electroporated with the constructs under study and luciferase DNA as an internal control were determined for evaluation of transformation efficiency. Protoplasts were lysed in 200 µL of LUC extraction buffer (100 mM KPO₄, 1mM EDTA, 10% glycerol, 0.5% Triton X-100 and 7 mM β-merceptoethanol, pH 7.8). After microfuge centrifugation, the supernatant was collected and a 200 µL aliquot of LUC assay buffer (25mM Tricine, 15 mM MgCl₂, 5mM ATP, BSA 1mg/ml, and 5 µl β-merceptoethanol, pH 7.8) was added to each 20 µL aliquot followed by 100 µL of luciferin (0.5 mM) as substrate. The reaction was assayed in a luminometer as described (Matthews et. al., 1995).

Quantitative RT-PCR

RT-PCR was as described above. The number of PCR cycles corresponded to the high end of the range in which a linear increase in products could he detected (generally 14-16 cycles were used). Reaction products were separated on 1.0 % agarose gels. Southern blot analysis was used to estimate levels of specific amplified products. Equivalence of cDNA in different samples was verified using PCR reactions for actin. Primers were designed for PCR according to published sequences for tomato PR-lbl, chitinase, Twit, ER5 and actin (Tornero et al., 1997; Danhash et al., 1993; O'Donnell et al., 1998; Zegzouti et al. 1997; Moniz de Sa and Drouin, 1996).

Our results indicated that tomato PR1b1, chitinase and Twil genes were activated by tMEK2^MUT. This indicates that tMEK2 can mediate both pathogen and wound signals. Transient expression of the native tMEK2^WT gene had no effect on the expression of the three target genes (Figure 4), indicating that it is not errantly activated in the protoplast system.

Example 4: Induction of the Wound-inducible Gene ER5

Since MAPK may be the point of convergence of the signal transduction pathways for fungal elicitors and mechanical stress (Romeis et al., 1999) we also examined the induction of the wound-inducible gene, ER5 (Zegzouti et al., 1997). Wounding was carried out by crushing leaves across the lamina and mid-vein using a blunt forceps. RNA was extracted after wounding for the indicated period of time. Fifteen µg of RNA was separated per lane on a denaturing formaldehyde gel. Following transfer to nylon membranes, the blot was hybridized with radio labeled fragment of tMEK2 coding region or fragment of ER5 coding region. Autoradiography was applied to visualize the hybridization signals (Sambrook et al., 1989).

Wounding of tomato leaves induced both resident tMEK2 and ER5 genes, mRNA accumulation was detectable in 30 min and lasted for at least 4 hrs (Figure 5a). Transient expression of the mutant tMEK2^MUT gene in tomato protoplasts also activated ER5 (Figure 5b); however, tMEK2^WT did not (Figure 5b), showing that elevated transcription of tMEK2 alone was not sufficient for transmitting the wound signal to ER5.

Example 5: Different MAPKs downstream of tMEK2

To study divergence of the signal pathways downstream of tMEK2 the influence of tMAPK2^MUT expression in tomato protoplasts was examined in the presence of a broad protein kinase inhibitor (staurosporine) and inhibitors specific to the p38 class MAPK (SB 202190 or SB 203580). Staurosporine inhibited all four genes that were previously activated by tMEK2^MUT; whereas, inhibitors of p38 class MAPK inhibited the PR3 and ER5 genes but not PR1b1 or Twi1. Furthermore, no effects were observed with SB202474, an inert compound acting as a negative control for MAP kinase inhibition studies, or PD 98059, an inhibitor of the MAP kinase cascade which binds to MAPKKK at a site that blocks access to activating enzymes (Alessi et al., 1995). The results, shown in Figure 6, are consistent with the divergence of signal pathway downstream of tMEK2. One of these pathways could include a p38 class MAPK.

Example 6: Disease Resistance

Tomato bacterial pathogen Pseudomonas syringae pv tomato was infiltrated into tomato leaves and the effect of inoculation was recorded 7 days after inoculation. A representative comparison of disease symptoms on a leaf from a wild-type plant and on a leaf from tMEK2^MUT transformed plant is shown in Figure 7.

References

Alessi, D.R., Cuenda, A., Cohen, P., Dudley, D.T, and Saltiel, A.R. (1995) PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo J. Biol. Chem. 270, 27489-27494.

Beffa, R., Szell, M., Menwly, P., Pay, A., Vogeli-Lange, R., Metraux, J.P., Meins, F. and Nagy, F. 1995. Cholera toxin elevates pathogen resistance and induces defense reactions in transgenic tobacco plants. EMBO Journal 14, 5753-5761.

Bogre, L., Zwerger, K., Meskiene, I., Binarova, P., Csizmadia, V., Planck, C., Wagner, E., Hirt, H. and Heberle-Bors, E. (1997) The cdc2Ms kinase is differently regulated in the cytoplasm and the nucleus. Plant Physiol. 113, 841-852.

Bowles, D.J. (1990) Defense-related proteins in higher plants. Annul Rev. Biochem. 59, 873907.

Christensen AH., Sharrock RA., Quail PH. 1992, Maize polyubiquitin genens: Structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol. Biol. 18, 675-689.

Clough SJ. Bent AF. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735-743.

Danhash, N., Wagemakers, C.A., van Kan, J.A. and De Wit, P.J. (1993) Molecular characterizatin of four chitinase cDNAs obtained from cladosporium fulvum-infected tomato. Plant Mol. Biol. 22, 1017-1029.

Daniell H. 1997. Transformation and foreign gene expression in plants mediated by microprojectile bombardment. Methods in Mol. Biol. 62 Recombinant Gene Expression Protocols (Tuan R., Ed), Humana Press Inc. Tolowa NJ.

Guan, K.L. (1994) The nitogen activated protein kinase signal transduction pathway: From the cell surface to the nucleus. Cell. Signal. 6, 581-589.

Hackett, R.M., Oh, S.A., Morris, P.C. and Grierson, D. (1998) A tomato MAP kinase kinase gene (Accession No AJ000728) differentially regulated during fruit development, leaf senescence and wounding (PGR98-151). Plant Physiol. 117, 1526-1526.

Hammond-Kosack, K.E., Tang, S., Harrison, K. and Jones J.D.G. (1998) The tomato Cf-9 disease resistance gene functions in tobacco and potato to confer responsiveness to the fungal avirulence eene Product Avr9. Plant Cell 10. 1251-1266.

Hardin, S.C. and Wolniak, S.M. (1998) Molecular cloning and characterization of maize ZmMEK1, a protein kinase with a catalytic domain homologous to mitogen- and streeactivated protein kinase kineses. Planta 206, 577-584.

Higuchi, R. (1989) Using PCR to engineer DNA. In: PCR Technology: Principles and Applications for DNA Amplification (ea. Erlich HA). Stockton Press, New York.

Hirt, H. (1997) Multiple roles of MAP kineses in plant signal transduction. Trends Plant Sci. 2, 11-15.

Jaglo-Ottosen KR., Gilmour SJ., Zarka DG., Schabenberger O., Thomashow MF. 1998, Arabidopsis CBF1 overexpression induced COR genes and enhances freezing tolerance. Science 280, 104-106.

Jonak, C., Kiegerl, S., Ligterink, W., Barker, P.J., Huskisson, N.S. and Hirt, H. (1996)

Stress signaling in plants: A mitoegen-activated protein kinase pathway is activated by cold and drought. Proc. Natl. Acad. Sci. USA 93, 11274-11279.

Kasuga M., Liu Q., Miura S., Yamaguchi-Shinozaki K., and Shinozaki K. 1999, Improving plant drought, salt, and freezing tolerance by gene transfer of a single stress-inducible transcription factor. Nature Biotechnology 17, 287-291.

Kovtun, Y., Chiu, W-L., Zeng W. and Sheen J. (1998) Suppression of auxin signal transduction by a MAPK cascade in higher plants. Nature 395, 716-720.

Ligterink, W., Kroj, T., Nieden, U.Z., Hirt, H. and Scheel D. (1997) Receptor-mediated activation of a MAP kinase in pathogen defense of plants. Science 276, 2054-2057.

Maliga, P.S., Breznovitis, A. and Marton, L. (1973) Streptomycin-resistant plants from callus culture of haploid tobacco. New Biol. 244, 29-30.

Matthews, B.F., Saunders, J.A., GeLhardt, J.S., Lin, J.J. and Koehle, S.M. (1995) Reporter genes and transient assays for plants. Methods Mol. Biol. 55, 147-162.

Mizoguchi, T., Ichimura, K., and Shinozaki, K. (1997) Environmental stress response in plants: the role of mitogen-activated protein kineses. Trends Biotech. 15, 15-19.

Moniz de Sal, M., and Drouin, G. (1996) Phylogeny and substitution rates of angiosperm actin genes. Mol. Biol. Evol. 13, 1198-1212.

Morris, P.C., Guerrier, D., Leung, J., and Giraudat J. (1997) Cloning and characterisation of MEK1, an Aarabidopsis gene encoding a homologue of MAP kinase kinase. Plant Mol. Biol. 35, 1057-1064.

O'Donnell, PJ., Truesdale, M.R., Calvert, C.M., Dorans, A., Roberts, M.R., and Bowles, D.J. (1998) A novel tomato gene that rapidly responds to wound- and pathogenrelated signals. Plant J. 14, 137-142.

Pareddy D., Petolino J., Skokut T., Hopkins N., Miller M., Welter M., Smith K., Clayton D., Pescitelli S., Gould A. 1997. Maize transformation via helium blasting. Maydica 42, 143-154.

Romeis, T., Piedras, P., Zhang, S., Klessig, D., Hirt, H., and Jones, J.D.G. (1999) Rapid Avr9- and Cf-9-dependent activation of MAP kineses in tobacco cell cultures and leaves: convergence of resistance gene, elicitor, wound, and salicylate responses. Plant Cell II, 273287.

Sambrook, J., Fristch, E.F., and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.

Saunder, P.R., Winter, J.A., Barnason, A.R., Rogers, S.G., Fraley, R.T. (1987), Comparison of cauliflower mosaic virus 35S and noplaline synthase promoters in transgenic plants. Nucleic Acids Res. 25, 15, 1543-1558.

Sano, H., Seo, S., Orudgev, E., Youssefian, S., Ishizuka, K., and Ohashi, Y. (1994) Expression of the gene for a small GTP binding protein in transgenic tobacco elevates endogenous cytokinin levels, abnormally induces salicylic acid in response to wounding and increases resistance to tobacco mosaic virus infection. Proc. Natl. Acad. Sci. 91, 1055610560.

Seo, S., Okamoto, M., Seto, H., Ishizaka, K., Sano, H., and Ohashi, Y. (1995) Tobacco MAP kinase: a possible mediator in wound signal transduction pathways, Science 270, 19881992.

Sheen, J. (1996) Ca2+-Dependent Protein Kinases and Stress Signal Transduction in plants. Science 274, 1900-1902.

Shibata, W., Banno H., Ito Y., Hirano K., Irie K., Usami S., Machida C., and Machida, Y. (1995) A tobacco protein kinase, NPK2, has a domain homologous to a domain found in activators of mitogen-activated protein kineses (MAPKKs). Mol. Gen. Genet. 246, 401-410.

Suzuki, K., and Shinshi, H. (1995) Transient activation and tyrosine phosphorylation of a protein kinase in tobacco cells treated with a fungal elicitor. Plant Cell 7, 639-647.

Tang, X., Xie, M., Kin, Y.J., Zhou, J., Klessig, D.F., and Martin, G.B. (1999) Overexpression of Pto activates defense responses and confers broad resistance. Plant Cell 11, 15-29.

Teague, M.A., Chaleff, D.T., and Errede, B. (1986) Nucleotide sequence of the yeast regulatory gene STE7 predicts a protein homologous to protein kineses. Proc. Natl. Acad. Sci. USA 83, 7371-7375.

Tornero, P., Gadca, J., Coejero, V., and Vera, P. (1997) Two PR-1 genes from tomato are differentially regulated and reveal a novel mode of expression of a pathogenesis-related gene during the hypersensitive response and development. Mol. Plant-Microbe Interact. 10, 624634.

Usami S., Banno H., Ito Y., Nishiha∼na R., Machida Y. (1995) Cutting activates a 46-kilodalton protein kinase in plants. Proc. Natl. Acad. Sci. USA 92, 8660-8664.

Xing, T., Higgins, V.J., Blumwald, E. (1996) Regulation of plant defense responses to fungal pathogens: two types of protein kineses in the reversible phosphorylation of the hostplasma membrane H+-ATPase. Plant Cell 8, 555-564.

Xing, T., Higgins, V.J., and Blumwald, E. (1997) Identification of G proteins in mediating elicitor-induced dephosphorylation of plasma membrane H+-ATPase in host plant. J. Exp.Bot. 48, 229-238.

Zegzouti, H., Jones, B., Marty, C., Lelièvre, J-M., Latché, A., Pech, J-C., and Bonzayen, M. (1997) ER5, a tomato cDNA encoding an ethylene-responsive LEA-like protein: characterization and expression in response to drought, ABA and wounding. Plant Mol. Biol. 35, 847-854.

Zhang, S., and Klessig, D.F. (1997) Salicylic acid activates a 48-kD MAP kinase in tobacco. Plant Cell 9, 809-824.

Zheng, C.F., and Guan, K.L. (1993) Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kineses MEK1 and MEK2. J. Biol. Chem. 268, 11435-11439.

Zheng, C.F, and Guan, K.L. (1994) Activation of MEK family kineses requires phosphorylation of two conserved Ser/Thr residues. EMBO J 13, 1123-1131.

All scientific publications and patent documents are incorporated herein by reference.

The present invention has been described with regard to preferred embodiments. However, it will be obvious to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as described in the following claims.