Expression of carcinoscorpius rotundicauda factor C in eukaryotes

RELATED APPLICATIONS

The present application is a Continuation-In-Part of application U.S. Ser. No. 08/296,014, filed Aug. 19, 1994, now U.S. Pat. No. 5,716,834 the entire contents of which are hereby incorporated by reference.

FIELD OF THE INVENTION

The present application relates to recombinant Factor C of the horseshoe crab Carcinoscorpius rotundicauda (CrFC), especially with respect to its expression in eukaryotes. The present application also relates to the use of the CrFC as an affinity reagent for binding of endotoxin. Endotoxin bound by CrFC can be removed from materials in instances where it is desirable to prepare a material free of endotoxin.

BACKGROUND OF THE INVENTION

Articles of the scientific periodical and patent literature are cited throughout the specification. Each such article is hereby incorporated by reference in its entirety by such citation.

Gram negative bacterial endotoxin is a widespread contaminant of materials employed in biomedical arts, both research and clinical. All pharmaceutical solutions used for parenteral or injection administration must be certified as to endotoxin levels. Also, media used for tissue culture applications are typically tested for the presence of endotoxin. It is of great importance, therefore, to be able to produce a reliably reproducible test for the presence of endotoxin in a sample. Also, it would be an advance in the art to provide materials and methods for removing Gram negative bacterial endotoxins from formulations intended for pharmaceutical or other uses requiring preparations substantially free of endoltoxin.

Factor C is a component of the Limulus amoebocyte lysate (LAL) assay that is presently the standard method for testing for endotoxin. Factor C is a serine protease proenzyme that is the first protein in a cascade that leads to coagulation of the LAL upon contact with endotoxin. Factor C is the protein that actually binds to the endotoxin; upon binding of endotoxin, the serine protebase activity of Factor C becomes activated. The activated Factor C initiates a chain of proteolytic steps culminating in formation of a solid clot of protein from the LAL. The time for forming the LAL clot and the degree of gelation is indicative of the amount of endotoxin in a sample (Ho, B., Kim, J. C., and Ding, J. L., 1993, Biochem. Mol. Biol. Intl. 29, 687-694). However, this gelation assay is subjective, and variable in its sensitivity of detection of endotoxin due to batch-to-batch variation in the amoebocyte lysate preparation. It is therefore desirable to express recombinant Factor C which could be standardized for use in an assay for endotoxin detection.

There are other endotoxin tests presently known, for example, the United States Pharmacopeia (USP) rabbit pyrogen assay (Tomasulo, P. A., Levin, J. Murphy, P. A. & Winkelstein, J. A. 1977. J. Lab. Clin. Met. 89, 308-315) However, the USP rabbit pyrogen test is not only time consuming, it is also expensive and often gives variable results in detecting endotoxin in pharmaceuticals and parentals (Muller-Calgon, H., pp. 343-356; "Endotoxins and their Detection with the LAL test," S. Watson et al., ed., c. 1982 by Alan R. Liss, New York N.Y.).

Enzyme-linked-immunosorbent assay (ELISA) has been developed for testing evoked secretion of interleukin-6 from monocytic cell lines in response to pyrogen or endotoxin (Taktak, Y. S., Selkirk, S., Bristow, A. F., Carpenter, A., Ball, C., Rafferty, B., & Poole, S., J. Pharm. Pharmacol. 43, 578-582 (1991)). However, this test is probably more suited for research purposes.

One other form of endotoxin detection involves its localization in tissues of experimental animals during induced endotoxemia. An immunohistochemical method utilizes native Factor C (purified from T. tridentatus) to specifically bind the endotoxin. The Factor C-endotoxin complex is then revealed by labelled anti-Factor C antibody (Takeuchi, M. et al., Pathol. Res. Pract. 190(12): 1123-1133 (1994); Nakao, A. et al., Eur. Surg. Res. 27(4): 216-221 (1995)). This study indicates another utility for Factor C. It is therefore within the embodiment of this application to obtain truncated recombinant constructs (e.g., pHILD2/CrFC21/EE containing the 5' end of CrFC cDNA insert flanked by EcoR1 sites).

cDNAs encoding Factor C proteins from Carcinoscorpius rotundicauda have been previously described (U.S. Ser. No. 08/296,014 and J. L. Ding, A. A. Navas III and B. Ho, Mol. Marine Biol. and Biotech. 4:90-103 (1995)). Recombinant Factor C from Carcinoscorpius rotundicauda (rCrFC) has been produced in vitro by coupled transcription/translation systems (U.S. Ser. No. 08/296,014 and S. D. Roopashree et al. Biochem. and Mol. Biol. Int'l. 35:841-849 (1995)). However, the present invent-on resides partly in the development of in vivo systems, especially using yeasts as a host cell, for efficient production of rCrFC by expression of cloned DNA.

Also, the protection of rCrFC from activation and subsequent self-proteolysis by binding of endotoxin which may be present in solutions used in isolation of the protein is described in U.S. Ser. No. 08/296,014. Basically, dimethylsulfoxide (Me₂ SO, DMSO) is added to solutions which are used during the purification process. Even greater protection of the rCrFC is achieved by also adding an agent effective for chelating divalent metal ions to the purification solutions.

As a means to circumvent difficulties in determining endotoxin in plasma due to endogenous interfering factors, a chromogenic LAL assay was modified to include a specific step to adsorb the plasma endotoxin using immobilized histidine. Endotoxin in samples was separated from interfering factors by chromatography through immobilized histidine in which endotoxin was specifically adsorbed and, subsequently quantified by fluorimetric LAL assay (Nawata, M., Minobe, S., Hase, M., Watanabe, T., Sato, T. & Tosa, T., J. Chromatogr., 597: 415-424 (1992); Minobe, S., Nawata, M., Shigemori, N. & Watanabe, T., Eur. J. Clin. Chem. Clin. Biochem., 32(10): 797-803 (1994). However, this method of endotoxin adsorption is limited only to small volumes of 0.5-1 ml, and there is no report on the use or feasibility of this method for removing endotoxin from large preparations. It has so far only been reported as an improved method of endotoxin assay, albeit one limited by infeasibility of chromogenic assay of the endotoxin bound to the column.

More recently, Qiagen (US) has marketed a `Qiagen` kit for purification of endotoxin-free plasmids (See, Qiagen News Issue No. 1, 1996). This may involve a specific (proprietary) reagent that removes endotoxin from the plasmid preparation.

SUMMARY OF THE INVENTION

Purified CrFC is found to be a useful protein, both as a component of a test for endotoxins and as an affinity reagent for removal of endotoxins from other materials. Thus, one object of the present invention is to provide purified recombinant CrFC. The present invention is also embodied in vectors for expressing recombinant CrFC in eukaryotic host cells, such as mammalian cells and yeasts. The present invention is further embodied by eukaryotic host cells expressing recombinant CrFC and methods for purifying recombinant CrFC which utilize cells transformed with DNA cloned in a eukaryotic expression vector to synthesize the recombinant CrFC protein (rCrFC). In particular, it is an object of the present invention to express CrFC in host cells that do not produce bacterial endotoxin and are capable of expressing large quantities of CrFC.

cDNAs appropriate for expression in the presently-described system can be cDNAs encoding Factor C of any horseshoe crab. Two representative nucleotide sequences are presented as SEQ. I.D. NO. 1 and SEQ. I.D. NO. 3. A cDNA encoding the Factor C of Tachypleus tridentatus is disclosed by Muta et al. (The Journal of Biol. Chem. 266(10):6554-6561 (1991)).

In many instances, it is desirable to prepare materials, such as culture media or injection formulations or the like, that are substantially free of endotoxin contamination. Thus, it is a further object of the invention to provide affinity reagents for removing endotoxin from materials It is another object of the present invention to provide methods for removing endotoxin from materials, wherein such methods employ an affinity reagent comprising CrFC.

The present methods for testing for endotoxin in a sample have many drawbacks, but two principal drawbacks are lot-to-lot variation of LAL preparations and the somewhat subjective nature of the test. Thus, the present invention, by providing tests for endotoxin that rely only upon the use of Factor C, rather than upon clotting of a LAL, eliminate these drawbacks. In particular, it is an object of the present invention to provide affinity assay methods for detection and quantitation of endotoxin in a sample. Because the assays utilize rCrFC of consistent composition, they are less subject to lot-to-lot variation. Because the assays are performed in a format that is quantitative, the assays are more objective than assays that rely upon a determination that a clot has formed in a LAL.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the construct pCIneo/CrFC21, where the NotI flanking CrFC21 cDNA from pBluescript SK (pBSK/CrFC21) was cloned into the NotI site of pCIneo (Promega Corp., Madison, Wis.).

FIG. 2 shows the construct pCDNA1/CrFC21. The EcoRI-NotI fragment of CrFC21 derived from pGEM11Zf(+)/CrFC21 (see FIG. 13 of U.S. Ser. No. 08/296,014) was inserted into EcoRI-NotI digested parent vector pCDNA1 (InVitrogen Corp., San Diego, Calif.) to yield the construct pCDNA1/CrFC21EN. This was further digested with EcoRI to facilitate the inclusion of EcoRI flanking fragment of CrFC21 from pGEM11Zf(+)/CrFC21, thus recreating the full-length CrFC21 cDNA in the construct pCDNA1/CrFC21.

FIG. 3 shows the construct pPIC9/CrFC21NAS. The P. pastoris secretion vector, pPIC9 (InVitrogen Corp., San Diego, Calif.), was linearized with AvrII. The construct pET3b/CrFC21 (see FIG. 15 of U.S. Ser. No. 08/296,014) contains the BglII-EcoRV fragment of CrFC21 cDNA. (pET3b is commercially available from Novagen, Madison, Wis.). This cDNA was excised using NheI of the pET3b vector (upstream of the BglII/BamHI start) and SpeI (in the 3' untranslated region of CrFC21), giving a 3035 bp insert which was then fused in frame with the S. cerevisiae α mating factor signal peptide in the linearized pPIC9. The resultant construct is termed as pPIC9/CrFC21NAS. A short stretch of 11 amino acids belonging to the phage T7 gene 10 sequence (from E. coli expression vector pET3b, pAR3039) precedes the CrFC sequence.

FIG. 4 shows the construct pHILD2/CrFC21. The EcoRI flanking fragment of CrFC21 from pGEM11Zf(+)/CrFC21 was ligated to the EcoRI linearized P. pastoris expression vector, pHILD2 (InVitrogen Corp., San Diego, Calif.), to generate the intermediate construct pHILD2/EE21. This construct was linearized with XhoI to accommodate the XhoI flanking portion of the cDNA from the plasmid pCDNA1/CrFC21 (see FIG. 1) to result in pHILD2/CrFC21. This construct contains 3448 bp of CrFC21 cDNA.

FIG. 5A shows Northern hybridization of Factor C transcripts from clone #8 containing pHILD2/CrFC21. The EcoRI flanking fragment of CrFC21 was ³² P-labelled to high specific activity and used as a probe. The level of transcription was monitored over close time intervals of induction with methanol which was added at time zero (at the start) and at 24 h. CrFC mRNA appeared as early as 1 hour with peak accumulation at 5 hours after induction. No further increase in CrFC mRNA was seen after the second methanol induction.

FIG. 5B shows Northern hybridization of Factor C transcripts from induced transformants (mut⁺) of P. pastoris (GS115) containing pHILD2/CrFC21. The EcoRI-EcoRI flanking fragment of CrFC21 was ³² P-labelled to high specific activity and used as probe for the Northern blot. The level of transcription was studied in 4 different clones at various time intervals of induction with 0.5% methanol.

Lanes:

1, 4, 7 & 10 show 48 hours of induction;

2, 5, 8 & 11 show 26 hours of induction;

3, 6, 9 & 12 show 8 hours of induction;

13 shows expression of negative control DNA.

FIG. 6 shows Western blot analysis of rCrFC from methanol-induced P. pastoris containing pHILD2/CrFC21. Clones No. 8 and No. 55 (harboring CrFC21 full-length cDNA) and clones No. 40 and No. 48 (harboring CrFC21EE, a truncated CrFC21 fragment flanked by EcoR1 sites) were induced for up to 48 hours on minimal media, and subjected to glass bead treatment followed by electrophoresis of 100 μg of each sample on reducing SDS/β-mercaptoethanol polyacrylamide gel. The electroblotted proteins were probed with anti-Factor C antibodies. Clone #8 yielded the highest level of rCrFC which was found to have a molecular weight of ˜135 kDa. Based on the 991 amino acid sequence of the insert, the expected size of the protein would have been about 109 kDa. The difference in the size of the Factor C could be attributable to glycosylation of the recombinant product in the yeast host. Clones No. 40 and No. 48 produced smaller truncated rCrFC proteins of 100 kDa. The results show that the maximal level of rCrFC expression occurred within 8 hours after the start of methanol induction.

FIG. 7 shows rCrFC produced from P. pastoris clone #8 over a time course of methanol-induction at 30° C. The culture was induced twice with 0.5% methanol at time zero and 24 hours. Cell samples were collected at the time period indicated. After glass bead treatment, the cell homogenate was centrifuged at 12,000×g for 30 min. The supernatant was kept separately. The pellets were resuspended in breaking buffer (1:10 v/v) Aliquots of the suspension were boiled in SDS/β-mercaptoethanol and resolved by electrophoresis on 10% acrylamide gels containing SDS. From such close time points of sampling, we confirm that the maximal synthesis of rCrFC occurred at 8 hours. The molecular weight markers (MW) were obtained from BioRad (Kaleidoscope) of sizes 208, 144, 87, 44.1, 32.7 and 17.7 kDa.

FIGS. 8A, 8B show detergent solubilization of rCrFC obtained from transformed P. pastoris (clone #8: PHILD2/CrFC21). After overnight solubilization with increasing concentrations of the detergents, the homogenate was centrifuged and 100 μg soluble protein of each supernatant was analyzed by Western blot. FIG. 8A shows that solubilization was effective from 1% SDS to higher concentrations. FIG. 8B shows that solubilization was achieved from 1% of sarkosyl to higher concentrations. MW is the molecular weight markers (BioRad Kaleidoscope), of 208, 144, 87, 44.1, 32.7, and 17.7 kDa. Lane Tp contains the total protein used for solubilization. 1M NaCl did not solubilize rCrFC.

FIG. 9A-9B show the construction plasmids for expression of CrFC26 cDNA deletion derivatives lacking the 5' untranslated region (UTR) and portions of the leader peptide using two S. cerevisiae expression vectors, YepSec1 (secretion) and pEMBLyex4 (non-secretion). The EcoRI-EcoRI (EE) fragment and the EcoRI-NotI (EN) fragments of CrFC26 cDNA were isolated from recombinant phage clones and inserted individually into the vector PGEM11Zf(+), giving PEE26 and PEN26, respectively. The entire 5' UTR and various lengths of the sequences coding for the leader peptide of CrFC26 were deleted by performing 5'-3' Exo III deletion mutagenesis on pEE26. From the deletion library, two mutants, CrFC6a/9a, also designated FC26Δ6a, and FC26Δ9a (see FIG. 9) were selected for expression studies. The EN fragment of CrFC 26 was excised from pEN26 with EcoRI and HindIII and inserted into the vector pGEM7Zf(+) to give p7EN26. From p7EN26, the same fragment was isolated using the flanking XhoI and HindIII sites and inserted into SalI/HindIII digested YepSec1 or pEMBLyex4, giving YFC26EN or pFC26EN, respectively. The SphI-EcoRI fragments from FC26Δ6a and FC26Δ9a, viz., CrFC61/91 deletion subclones in pGEM11Zf(+) were isolated and inserted through an intermediate step, into the SphI and EcoRI sites of p7EE_RV 26. The insert is thus flanked by EcoRI (E) and EcoRV (E_RV) sites. The resultant full-length deletion mutants in p7SE_RV Δ6a/9a were subcloned into pGEM11Zf(+)a, a derivative of pGEMIIZf(+) (see FIG. 10B) The SmaI-PstI fragments were subsequently isolated from these subclones and inserted into SmaI/PstI digested pFC26EN to give the plasmids pFC26Δ6a and pFC26Δ9a. The same fragments were inserted into YFC26EN, creating in-frame protein fusions to the K. lactis killer toxin signal sequence, to yield YFC26Δ61 an YPC26Δ9a.

FIG. 10 shows a schematic diagram illustrating the different gene fragments from CrFC26 cDNA cloned into the S. cerevisiae expression vector, YepSec1 (Baldari, C., et al. Embo J. 6:229-234 (1987)). The complete CrFC26 cDNA (top) has been included for reference. Key: open box, untranslated region; shaded box, sequence coding for the leader peptide; hatched box, coding region. ExoIII nuclease deletion mutagenesis was carried out on CrFC26 cDNA to yield the deletion mutants FC26Δ9a and FC26Δ6a which contain 5' deletions up to nucleotide positions 721 and 761, respectively. Further deletions were carried out on FC26Δ9a and 6a by removing all of the nucleotides downstream of an internal HindIII site at nucleotide position 1278 to give FC26Δ9a-H3 and FC26Δ6a-H3, respectively. A 1902 bp internal SalI/PstI fragment of CrFC26 cDNA was inserted directly into YepSec1 in-frame with the Kluyveromyces lactis killer toxin signal sequence.

FIGS. 11A, 11B. FIG. 11A shows sequences at the junction between K. lactis killer toxin signal peptide (in YepSec1) and CrFC26 deletion mutants 6a and 9a. The K. lactis killer toxin signal peptide is linked in-frame to CrFC26 deletion mutants 6a and 9a by a short stretch of polylinker sequence derived from pGEM7Zf(+) and pGEM11Zf(+). This polylinker sequence contains an ATG codon (boxed) which would serve as a translation initiation codon in YFC26Δ6a and 9a. FIG. 11B shows construction of pGEM11Zf(+)a, a derivative of pGEM11Zf(+). A ClaI/SalI stuffer DNA fragment (shaded) was inserted into pBluescript II SK-. This fragment was then isolated by BamHI/SalI digestion and inserted into pGEM11Zf(+), effectively introducing a SmaI site into the multiple cloning site of pGEM11Zf(+). The resultant plasmid was digested with SmaI and religated, removing a 300 bp SmaI fragment to give pGEM11Zf(+)a.

FIGS. 12A, 12B show the construction of CrFC21 and CrFC26 hybrid cDNA and its deletion mutants in the yeast expression plasmid, pEMBLyex4 (Caserini, G. and Murray, J. A. H., pp. 135-154 in "Genetic Engineering, Principles and Methods, vol. 9, eds. J. K. Setlow and A. Hollander, c. 1987 by Plenum Publishing Corp., New York, N.Y.; vector DNA was kindly provided by J. A. H. Murray). In FIG. 12A, the 1003 bp EcoRI/SalI fragment (containing the ribosomal binding site and initiation codon) of CrFC21 cDNA was excised from the EcoRI-flanking fragment of pCrFC21EE (also referred to as pEE21, U.S. Ser. No. 08/296,014 at FIG. 13) and cloned into the EcoRI and SalI sites of the plasmid pBluescript II SK- yielding the plasmid pBES21. This fragment was excised from pBES21 using SmaI and SalI digestion and introduced into SmaI/SalI digested pFC26Δ9a (pEMBLyex4/CrFC26Δ9a--see U.S. Ser. No. 08/296,014) to give pFC21/26. FIG. 12B shows the deletion mutant pFC21/26-H3 which was created by digesting pFC21/26 with HindIII, thus removing 2286 bp of 3' sequences, followed by religation of the plasmid. Internal deletion of 2257 bp fragment by double digestion of pFC21/26 with BglII and XbaI, and subsequent ligation of their filled ends produced the deletion mutant, pFC21/26-BX.

FIG. 13 shows Northern analysis of Factor C transcripts from S. cerevisiae. Varying sizes of the Factor C cDNAs were inserted into both pEMBLyex4 and YepSec1 vectors (see FIG. 9 and Table 1) with a view to investigating the relationship of the size of the inserts in the constructs to transcription level and mRNA structure in the S. cerevisiae host. RNA isolated from various clones after 18 hours of galactose induction were electrophoresed, blotted and hybridized with ³² P-CrFC probes:

______________________________________Lane  Construct         size (bp) mRNAs (kNt)______________________________________1     Yepsec1 DNA (control)                   --        --2     YFC26SP           1902      2.1, 1.33     YFC26Δ6a    3447      3.5, 1.34     YFC26Δ9a    3492      3.5, 1.35     YFC26Δ6a-H3 543       0.96     YFC26Δ9a-H3 588       0.97     pEMBLyex4 DNA (control)                   --        --8     pFC26Δ6a    3447      3.5, 1.39     pFC26Δ9a    3492      3.5, 1.310    pFC21/26          3448      3.5, 1.311    pFC21/26-H3       535       0.912    pFC21/26-B/X      1191      1.2______________________________________

FIG. 14 shows the Western analysis of rCrFC from various S. cerevisiae clones containing (1) YepSec1 vector, (2) YFC26SP, (3) YFC26Δ6a, (4) YFC26Δ9a, (5) YFC26Δ6a-H3, (6)YFC26Δ9a-H3, (7) DNA from untransformed S. cerevisiae and (9) pFC21/26 hybrid clone. The molecular weight markers (215, 137, 71, 42, 31, 17.9 kDa) are in lane 8. The yeast cells were lysed directly in 50 mM Tris-Cl, pH 8.0, containing 0.1M NaCl and 1% SDS.

FIG. 15 shows the Western analysis of rCrFC from a S. cerevisiae clone containing pEMBLyex4/CrFC21. The rCrFC is ˜130 kDa. Treatment of particulate rCrFC with SDS at 0% (lanes 1,2); 0.5% (lane 3) and 1% (lanes 4 & 5) showed increasing solubilization of rCrFC with increasing SDS concentration.

FIGS. 16A, 16B. FIG. 16A shows solubilization of rCrFC in SDS; FIG. 16B shows solubilization of rCrFC in Triton X-100. Induced pFC21/26 yeast transformants were lysed in 0.1M NaCl, 50 mM Tris-Cl, pH 8.0 containing (1) 0%, (2) 0.5%, (3) 1.0%, (4) 2.0%, (5) 3.0%, (6) 4.0%, and (7) 5.0% SDS. The same transformants were lysed in (1) 0%, (2) 0.05%, (3) 0.1%, (4) 0.5%, (5) 1.0%, (6) 2.0%, (7) 4.0%, (8) 5.0% Triton X-100. For comparison, lane (9) contained 1.0% SDS-solubilized lysate. Molecular weight markers are in lanes 8 and 10, respectively, of gels shown in FIGS. 16A and 16B.

FIG. 17 shows evidence for the binding of SDS-solubilized rCrFC (from both full-length and truncated CrFC constructs in P. pastoris and S. saccharomyces to endotoxin that has been immobilized on a PVDF membrane. LPS-strips were obtained by electrophoresis of LPS (10 μg per lane) on SDS-polyacrylamide gels (15%). After electroblotting, the membrane was cut into strips (hence, LPS-strips), and each strip was incubated overnight at 37° C. with 200 μg (total crude protein) of the respective protein sample. A band of ˜90-100 kDa is seen in rCrFC samples, corresponding to that of Carcinoscorpius rotundicauda amoebocyte lysate (that contains Factor C) that has complexed with endotoxin on the LPS strip. The LPS-strips incubated with the rCrFCs showed a lower band which was not present on the LPS-strips incubated with the negative controls (P. pastoris, #151 and S. cerevisiae harboring only the vector, pEMBLyex4).

DETAILED DESCRIPTION OF THE INVENTION

The present invention resides in part in the development of efficient systems for production of rCrFC in vivo. The present inventors have found that rCrFC is effectively produced in eukaryotic cells, especially yeasts. In particular, yeasts of the genus Saccharomyces and Pichia are shown to be effective cells for expressing cDNA encoding CrFC

The rCrFC of the present invention can be purified from cultures of recombinant eukaryotic cells expressing the protein by solubilizing the rCrFC, then proceeding essentially as described in co-pending application U.S. Ser. No. 08/296,014. The solubilization is preferably performed using a detergent solution. The detergent used is preferably anionic or non-ionic.

Alternatively, the rCrFC can be purified by affinity methods using an anti-Factor C antibody or gram-negative LPS as the affinity reagent. Methods for affinity purification of proteins are well-known in the art. General protein purification methods are also described in the art. The practitioner is referred to, for example, the "Guide to Protein Purification, published as volume 182 of Methods in Enzymology, M. P. Deutscher, editor, c. 1990 by Academic Press, Inc., San Diego, Calif.

For preservation of the rCrFC in the proenzyme state, Me₂ SO is preferably added to media used in the purification. Also, it is sometimes advantageous to add chelators of divalent metal ions, especially such as citrate, EDTA or EGTA.

The rCrFC of the present invention can be used in a method for removing endotoxin from a liquid sample, such as a parenteral preparation or a medium for in vitro culture of cells, by immobilizing the rCrFC on a suitable insoluble substrate to form immobilized rCrFC. The immobilized rCrFC is then contacted with the liquid sample under conditions favorable to binding of endotoxin in the sample to the immobilized rCrFC, thereby forming bound endotoxin. The bound endotoxin is then separated from the sample to provide a preparation from which the endotoxin has been removed.

It is expected that gram-negative bacterial endotoxin will bind to rCrFC under conditions of moderate pH, such that neither the rCrFC nor the endotoxin is denatured. The pH will preferably range from 6 to 9, most preferably at pH 7 to 8. Furthermore, it is expected that the binding of rCrFC to endotoxin can occur over a wide range of ionic strength, at least up to that equal to a 0.5M NaCl solution. Preferably, the ionic strength is equal to a solution of salt in the range of 0.010 to 0.2M, most preferably in the range of 0.050M to 0.2M. Because the rCrFC retains its immunoreactivity with anti-Factor C antibody even in the presence of substantial amounts of detergent, it is expected that endotoxin will bind to rCrFC even in the presence of low concentrations of chaotropic agents. Also, the rCrFC-endotoxin complex formation is not disrupted by the presence of substantial amounts of non-specific proteins in the solution. The sample is treated with sufficient immobilized endotoxin and for such time as necessary to remove the endotoxin to provide a sample substantially free of endotoxin. The amount of endotoxin removed is most preferably 99.9% of the endotoxin initially present. However for some applications, it will suffice to remove 85 to 99% of the endotoxin initially present in the sample. In still other applications, it might suffice to remove 80 to 90% of the endotoxin from the sample.

The rCrFC can be attached to an insoluble substrate by any of the methods for covalent attachment of a protein to insoluble substrates well-known in the art, for example by reaction with cyanogen-bromide activated agarose beads. Also, non-covalent methods can be used for immobilizing the rCrFC, for example by conjugation with biotin and subsequent immobilization on an avidin-conjugated bead.

For use in batch extraction procedures, immobilization on a bead is preferred. For use in continuous processing formats, immobilization in hollow fibers or on membranes, for stacking into cartridge formats, is preferred.

The rCrFC of the present invention also provides a method for specific detection of endotoxin in a sample by a method similar to ELISA or other immunoassay. For such an assay, the proteins in the sample are immobilized, for example by electroblotting to a membrane after separation by SDS-PAGE, or non-specific binding of proteins to a plastic substrate such as a microplate, and then endotoxin in the sample is detected by binding rCrFC to the immobilized endotoxin and subsequent detection of the rCrFC-endotoxin complex. The complex is detected either by measuring the serine protease activity of the bound rCrFC, for example by use of a chromogenic substrate assay, or by immunodetection with an anti-Factor C antibody. The endotoxin-rCrFC complexation step of such an assay can be performed under conditions similar to those for forming the complex for removing endotoxin from a sample as described above.

Although rCrFC is immunoreactive, and also capable of binding LPS (in an in vitro assay), its endotoxin-triggered enzymatic activity can be assessed by the following methodology.

Detergent (SDS, Triton X-100 or sarkosyl) solubilized rCrFC can be immobilized, preferably onto a membrane (e.g., IMMOBILON PVDF, Pall NYTON, nitrocellulose, ULTRABIND), followed by stepwise, gradual removal of the detergent from the membrane while allowing rCrFC to remain bound. This concurrently exposes the catalytic site of the Factor C enzyme. Removal of the detergent (the presence of which can interfere with the biological activity) enables the subsequent assay of endotoxin-activated serine protease activity of the rCrFC either by fluorometric or calorimetric methods.

This method is based on the rationale that detergents like SDS and Triton X-100 at certain percentage have been reported to inhibit LPS-activated serine protease activity of Factor C (Nakamura, T., Tokunaga, F., Morita, T. and Iwanaga, S., J. Biochem. 103:370-374 (1988)).

The invention being thus generally described, preferred embodiments of the invention are set forth in the Examples below. The Examples are not limiting of the invention. The scope of the invention is limited only by the claims recited below.

EXAMPLE 1

Cloning of CrFC21 cDNA into the mammalian expression vectors pCDNA1 and pCIneo

The CrFC21 cDNA cloned into a pCIneo vector provides a construct referred to as pCIneo/CrFC21 (FIG. 1). In this vector, constitutive expression in vivo of CrFC21 is driven by a CMV promoter. In vitro transcription can also be performed using the T7 promoter resident in the vector.

The CrFC21 cDNA was also cloned into pCDNA1, and henceforth referred to as pCDNA1/CrFC21 (FIG. 2). This construct was later used as an intermediate vector for construction of pHILD2/CrFC21 in P. pastoris expression system (see FIG. 4).

The pCIneo/CrFC21 and pCDNA1/CrFC21 constructs can be transfected into mammalian cell lines such as Chinese Hamster Ovary (CHO) cells, or mouse fibroblast cells such as NIH/3T3 cells, or Cos-1 cells or Hela cells, and used for expression of rCrFC. Transformation of the vectors into mammalian cells can be accomplished by means well-known in the art, for example, transfection by electroporation, or liposome-mediated gene transfer. Also, methods for culturing mammalian cells are generally well-known. Recovery of rCrFC produced by cultured mammalian cells can be performed substantially as described for purification from yeast cells, except that the physical disruption steps can be omitted, as mammalian cells lack a cell wall. Rather, intracellular rCrFC can be recovered by lysing the mammalian cells with detergents.

EXAMPLE 2

Expression of CrFC21 in Pichia pastoris

Constructs

The CrFC21 cDNA was inserted into two expression vectors of P. pastoris. The first is a secretory vector, pPIC9, where the CrFC cDNA was fused to the signal sequence of the a mating factor of Saccharomyces cerevisiae to yield the construct, pPIC9/CrFC21NAS (FIG. 3). This recombinant clone relies on the ATG codon present in PIC9 as the start codon. In PHILD2/CrFC21, the vector second is a non-secretory vector, pHILD2 providing the construct pHILD2/CrFC21 (FIG. 4). The host cell utilizes the native ATG of the CrFC cDNA insert as the start codon. In both cases, expression of the CrFC cDNA is driven by the AOX1 promoter, which is inducible by methanol.

Transformation of P. pastoris, strain GS115 with CrFC constructs

The pPIC9/CrFC21NAS was digested with StuI or BglII. The pHILD2/CrFC21 was digested with StuI. These linearized expression vectors were then transformed into P. pastoris, strain GS115 by the spheroplasting method (Cregg, J. M. et al., Mol. Cell Biol. 5x:, 3376-3385 (1985)). Isolation of mut^s or mut⁺ transformants was done according to described protocols (Clare, J. J. et al, Bio/Technology 9-455-460 (1991)).

Expression of immunoreactive recombinant Factor C in P. Pastoris

The expression of CrFC21 constructs was studied in P. pastoris at the levels of transcription and translation. RNAs were purified from the cells after methanol-induction To examine the production of recombinant Factor C (rCrFC) in the heterologous hosts, the transformants were cultured in shake-flasks, with ample aeration.

(i) Northern analysib of pHILD2/CrFC21 expression in P. pastoris

Various P. pastoris transformants of high gene-copy number were grown at 30° C. for 18 hours in 50 ml MGY medium (1.34% yeast nitrogen base, 1% glycerol, 4×10^-5 % biotin to accumulate cell mass. The OD₆₀₀ reached 4 Units. The transformants were then transferred into 200 ml of MM medium (1.34% yeast nitrogen base, 0.5% methanol, 4×10^-5 % biotin) giving an initial OD₆₀₀ of 1 Unit.

To examine the optimum transcription efficiency during methanol induction, replicate cultures of P. pastoris containing pHILD2/CrFC21 were induced for varying lengths of time and harvested by centrifugation at 3000×g for 10 minutes the cells were used for isolation of RNA under standard RNase-free conditions and Northern analysis was carried out (FIG. 5).

(ii) Western analysis of rCrFC obtained from P. pastoris clone #8 (pHILD2/CrFC21)

The methanol-induced cells were pelleted and resuspended in 1:10 (v/v) with breaking buffer (0.05M Tris-HCl, pH 8.0, containing 0.1M NaCl) and added with an equal volume of chilled, acid-washed glass beads (0.45 mm diameter, Sigma). The cells were lysed by vortexing for 1 min and chilled on ice for 3 min. This process was repeated 9 times or until complete breakage of the cells was observed. The soluble and insoluble fractions were separated by centrifugation at 10,000×g for 30 min. at 4° C. After resuspending the pellet in breaking buffer containing SDS ranging in concentration from 0.5-5%, overnight extraction was carried out at 4° C. on a rotary platform The soluble intracellular fraction, the SDS-solubilized cell extract, and the supernatant derived from the culture media of pHILD2/CrFC21 clones were resolved on 10% PAGE gels under reducing conditions of SDS/β-mercaptoethanol, and electroblotted for Western analysis. FIG. 6 shows that the clones produced rCrFC during the 8 hours after methanol induction. The rCrFC was produced within the host cell in an insoluble form, and was solubilized optimally by 1% SDS.

With clone #8 (pHILD2/CrFC21) studied over closer time points it was confirmed that 8 hours post-induction was the optimum timing of rCrFC protein synthesis (FIG. 7).

(iii) Detergent solubilization of rCrFC from P. pastoris (pHILD2/CrFC21, Slone #8)

Triton X-100, SDS and sarkosyl were used at a range of concentrations to solubilize rCrFC from the recombinant P. pastoris clones. Cells from clone #8 were harvested after 8 hours of methanol induction, centrifuged, and the cell pellet was treated with glass beads (as described earlier). Cell homogenates were made up to their respective (w/v) percentage of detergent, and solubilized overnight at 4° C. by rotation on an angular rotator. The lysate was cleared by centrifugation. The supernatant which contains solubilized rCrFC constitutes approximately 30-50% of the total rCrFC. The pellet still contains a large amount of insoluble rCrFC. Western analysis showed maximal solubilization of rCrFC at 1% SDS (FIG. 8A), and 1% sarkosyl (FIG. 8B). These detergent-solubilized rCrFC's have retained their immunoreactivity.

EXAMPLE 3

Expression of recombinant Factor C in Saccharomyces cerevisiae

Constructs

By manipulation of the 5' end of CrFC26, truncated constructs containing this cDNA are expressed by S. cerevisiae to give immunoreactive rCrFC. The rCrFC produced from both CrFC21 and CrFC26 constructs is solubilized by Triton X-100 and SDS, and found to be immunoreactive. Solubilized rCrFC could thus be purified as a proenzyme and reversibly protected from activation by addition of Me₂ SO (see U.S. Ser. No. 08/296,014).

The full-length CrFC26 cDNA has earlier been cloned into both YepSec1 and pEMBLyex4 expression vectors of S. cerevisiae (see U. S. Ser. No. 08/296,014 at FIG. 16). Updated nomenclature of the CrFC26 cDNA constructs in these two vectors are shown in FIG. 9A-9B and Table 1. The long 5' untranslated region (UTR) of CrFC26 suggests that it may play a role in regulating the expression of the gene at the translational level. Studies using a coupled in vitro transcription and translation system surprisingly showed no expression of rCrFC from CrFC26. On the other hand CrFC21, which lacks the long 5' non-coding sequence, expressed rCrFC at high levels (see, FIG. 18 of U.S. Ser. No. 08/296,014). This indicates that the 5' non-coding sequence serves to down-regulate the translation of CrFC26. In order to express CrFC26 in a heterologous system, it is preferred that the 5' UTR be removed, at least to the point where its translation-attenuating activity is reduced or eliminated. A deletion mutant library made by 5'-3' ExoIII deletion mutagenesis of the EcoRI-EcoRI (EE) fragment yielded two subclones designated FC26Δ6a and FC26Δ9a (FIG. 10) Further deletions of these subclones at HindIII (position 1278) removed sequences downstream, giving rise to FC26Δ6a-H3 and FC26Δ9a-H3, respectively. These deletion mutant were cloned into the YepSec1 vector and the constructs were transformed into S. cerevisiae for expression analyses. These subclones were selected based on the creation of an open reading frame, which is attained upon religation of the deleted ends to the vector (FIGS. 11A, 11B). The DNA sequences at the junctions between the vectors and FC26Δ6a and 9a were verified by sequencing, and found to be in-frame (FIG. 11A). These constructs will utilize the ATG codon within the SphI site of the vector for translation initiation.

FIG. 12A shows a hybrid cDNA consisting of the 5' portion of CrFC21 and the 3' portion of CrFC26, inserted into pEMpLyex4. This was done by substituting the SmaI-SalI fragment of pFC26Δ9a (pEMBLyex4/CrFC26Δ9a) with the SmaI-SalI fragment isolated from pBES21 to give pFC21/26 (pEMBLyex4/CrFC21/26). At the amino acid level, the fusion gene product would be expected to be identical to the product encoded by CrFC21 except for a single Arg to Ser substitution at residue 427 of CrFC21. Translation initiation in pFC21/26 would rely on the cognate ATG codon of CrFC21. FIG. 12B shows deletion mutant constructs of this hybrid cDNA.

Various fragments of CrFC26 cDNA (FIG. 10) were also subcloned into the S. cerevisiae secretory expression vector, YepSec1. Also the CrFC21 and CrFC26 hybrid cDNAs and deletion mutants thereof were recloned in the yeast expression plasmid, pEMBLyex4 (FIG. 12). Expression of cDNA from pEMBLyex4 is expected to result in intracellular accumulation of the product. The S. cerevisiae host strain, S150-2B was used as a host cell for the constructs. Table 1 summarizes the CrFC cDNA constructs in pEMBLyex4 and YepSec1 vectors.

                                  TABLE 1__________________________________________________________________________Carcinoscorpius rotundicauda Factor C gene constructs in the S.cerevisiaeexpression plasmid vectors, YepSec 1 (secretory) and pEMBLyeX4(non-secretory)                          Yeast Host StrainsVector Construct Name         Insert           Transformed and Conserved__________________________________________________________________________YepSec1 YepSec1 Nil              150-2B YFC26Δ6a         Deletion clone CrFC26 6a                          150-2B YFC26Δ9a         Deletion clone CrFC26 9a                          150-2B YFC26Δ6a-H3         Deletion clone CrFC26 6a - Hind III                          150-2B YFC26Δ9a-H3         Deletion clone CrFC26 9a - Hind III                          150-2B YFC26SP Sal I-Pst I of CrFC26                          150-2BpEMBLyex4 pEMBLyex4         Nil              150-2B pFC26Δ6a         Deletion clone CrFC26 6a                          150-2B pFC26Δ9a         Deletion clone CrFC26 9a                          150-2B pFC21/26         CrFC21-CrFC26 Hybrid                          150-2B p21/26-B/X         CrFC21-CrFC26 Hybrid - Bgl II/Xba I                          150-2B p21/26-H3         CrFC21-CrFC26 Hybrid - Hind III                          150-2B__________________________________________________________________________

Transformation of S. cerevisiae, strain S150-2B with CrFC cDNA constructs

The S. cerevisiae strain S150-2B (leu2 his3 ura3 trp1) was used for transformation by a modified lithium acetate procedure (Schiestl, R. H. and Gietz, R. D., 1989. Current Genetics 16:339-346 (1989)). Transformed yeast cells were recovered by selection on uracil-deficient synthetic complete medium (SC-ura) (Sherman, F. et al, in "Methods in Yeast Genetics" c. 1979 by Cold Spring Harbor Laboratory, Cold Spring, Harbor, N.Y.) containing 2% glucose and 0.67% yeast nitrogen base (YNB) without amino acids (Difco) and supplemented with the required amino acids.

Expression of rCrFC in S. cerevisiae

(i) Induction of Factor C synthesis

Yeast cells harboring secretory plasmids were cultured at 30° C. in complex YPD medium (1% yeast extract, 2% peptone and 2% glucose) to late log phase upon which the cells were induced by supplementing the medium with 2% galactose. For the induction of intracellular Factor C expression, recombinant yeasts were first cultured in SC-ura medium supplemented with 40 μg/ml leucine. At late log phase, cells were harvested and resuspended in fresh SC-ura medium containing 60 μg/ml leucine and 2% galactose. The induced cells were harvested for protein analyses following 24 hours growth at 25° C.

(ii) Transcription of recombinant CrFC cDNA in S. cerevisiae

Total yeast RNA was prepared from induced yeast cells. RNA samples were denatured with glyoxal and dimethyl sulfoxide, and fractionated on a 1.2% agarose gel. Following transfer to nylon filters, the RNA was hybridized against pooled ³² P-labelled CrFC/EE21 and CrFC/EN21 fragments. Hybridized filters were subjected to autoradiography (FIG. 13).

FIG. 13 shows the results of the Northern blot analysis. Varying sizes of the Factor C cDNAs were inserted into both pEMBLyex4 and YepSec1 vectors (see FIG. 10 & Table 1) with a view to investigating the size limitation of the constructs to transcription level in the S. cerevisiae. RNA isolated from various clones after 18 hours galactose induction were electrophoresed, blotted and hybridized with 32P-CrFC probes:

Transcription of the constructs does not appear to be limited by the size of the insert in the construct. In fact, the constructs having larger, more full length inserts exhibit two transcripts. The larger, major transcript of 3.5 kb (lanes 3, 4, 8, 9 & 10) corresponds to the expected full length CrFC mRNA. The smaller, minor mRNA of 1.3 kb could be CrFC transcript expressed via the use of internal alternative polyadenylation signal (lanes 2, 3, 4, 8, 9 & 10) or internal transcription initiation. Internal TATA boxes are present in both CrFC21 and 26. With CrFC21, two of these elements, located at regions corresponding to nucleotide positions 1823-1827 and 3105-3110 could have yielded the ˜1.3 kb transcript when induced in yeast cells.

(iii) extraction of rCrFC and western analyses

Yeast cells were collected from 10 ml induced cultures and respended in 0.2 ml of disruption buffer, containing 25 mM Tris-Cl, ph 8.0 and 0.1M NaCl with or without SDS or Triton X-100. For solubilization of insoluble proteins, (a) SDS was added to the samples to a final concentration of 0.5, 1, 2, 3, 4, and 5%; and (b) Triton x-100 was added at 0.05, 0.1, 0.5, 1, 2, 4 and 5%. An equal volume of chilled, acid washed glass beads (0.45 mm, Sigma) was added to the cell suspension. Cells were disrupted by vortexing 5 times for 1 min each, with 5 minute intervals of chilling in between vortexing. Cells were checked for complete lysis by examination under the microscope. Lysates were clarified by centrifugation at 17,600×g for 1 h. Protein extracts were electrophoresed on denaturing SDS/10% polyacrylamide gel, and blotted onto pvdf membrane (Millipore) by electrotransfer. Rabbit anti-Factor C antibody was used as the primary antibody. The immunoblot was developed with horseradish peroxidase conjugated goat anti-rabbit antibody using 4-chloro-1-naphthol and hydrogen peroxide as substrates.

(iv) Expression of rCrFC from YepSec1 plasmid constructs

With YFC26sp, YFC26Δ6a and YFC26Δ9a transformants, cell lysates prepared by glass bead disruption showed substantial amounts of immunoreactive recombinant protein in the soluble, intracellular fractions (FIG. 14). It is evident from the results that the K. lactis killer toxin signal sequence did not direct the secretion of the recombinant product. No immunoreactive band was detected in YFC26Δ6a-H3 and YFC26Δ9a-H3.

Although transcripts were found for these deletion mutant (shortened) constructs (see FIG. 13), no translational products were evident (see FIG. 14). Three explanations may be given for this observation: (a) the transcripts were defective for translation, (b) the truncated rCrFC proteins were unstable, and underwent rapid in situ degradation, or (c) the truncated rCrFCs were synthesized but not immunoreactive that is, the deletions have removed the major epitopes of Factor C, thus abolishing immunoreactivity.

(v) Expression of rCrFC from pEMBLYex4 plasmid constructs

A single immunoreactive band with an apparent size of ˜135 kDa was observed for cell lysates of pEMBLyex4/CrFC21 transformants only (FIG. 15). This recombinant protein is approximately 11 kDa larger than the calculated size based on the cDNA insert length. This may be attributable to glycosylation of the protein. In eukaryotic cells, glycosylation is usually coupled to secretion of the product. However, it has been found that in horseshoe crabs, the amoebocyte Factor C is glycosylated, but not secreted. Rather, the glycosylated Factor C is found in intracellular granules. Immunogold electron microscopy studies are being performed to confirm the localization of the rCrFC produced by the pEMBLyex4/CrFC21 transormants. Contrary to full length CrFC cDNA clones, no detectable immunoreactive protein was observed in lysates from partial subclones such as pFC21/26-H3 and pFC21/26-BX transformants (FIG. 12B).

Increasing SDS concentration provided better solubilization up to 1% SDS. SDS at 1% appears to yield maximum solubilization. Further increase in SDS concentrations up to 5% did not improve the yield of the recombinant protein (FIG. 16A). Similar efficiency of solubilization of rCrFC was observed with Triton X-100 (FIG. 16B).

EXAMPLE 4

Endotoxin-binding of rCrFC derived from PHILD2/CrFC21 and pHILD2/CrFC21EE

Endotoxin-binding activity of rCrFC is shown as described herein. 10 μg of E. coli LPS (Sigma, St. Louis, Mo. (E. coli 055B)) is electrophorectically separated on SDS-PAGE (15%) followed by electroblotting of the resolved LPS onto to a PVDF membrane. The membrane blot was blocked by incubating in 50 mM Tris-HCl, pH 8 containing 0.2M NaCl (Tris buffered saline, TBS) with 30 mg/ml BSA for 30 min. at 37° C. The membrane was cut into strips (LPS strips) and each strip was separately incubated overnight with slight agitation at 37° C. with 200 μm total protein of crude solubilisate of rCrFC. The strips were then washed 3× for 5 min. each with TBS before incubation for 3 h at 37° C. with anti-Factor C antibody diluted 500× in TBS containing 1 mg BSA. Subsequently, the strips were washed with TBS followed by incubation for 1 h at 37° C. with peroxidase-conjugated goat anti-rabbit IgG in TBS with 1 mg/ml BSA. After rinsing extensively, the strips were stained with 60 μl H₂ O₂ and 60 mg chloro-1-napthol (Sigma) in 20% methanol (v/v).

FIG. 17 shows evidence for the binding capability of SDS-solubilized rCrFC (derived from PHILD2/CrFC21, clone #8) for endotoxin as compared with that of the Carcinoscorplus rotundicauda amoebocyte lysate (CAL which contains native Factor C).

The invention being thus described, various modifications of the materials and methods used in practice of the invention will be readily apparent to one of ordinary skill in the art. Such modifications are considered to be encompassed by the scope of the invention as it is described in the claims below.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 4(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 4182 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Carcinoscorpius rotundicauda(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 569..3817(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GTATTTAATGTCTCAACGGTAAAGGTTTCATTGTAGCTAATATTTAACTTCCTCCCTGTG60CCCCAAATCGCGAGTATGACGTCAGTTAAGACTTCGTATTTTAAGAGTTAAACACGAGCC120TTAAAGAGCGATATTTTTTTTGTTAAACACTTCCAACTTAATACAATTGGCAAACTTTCA180AAAATAAAGTGGAAAAGGAGGTAAAAAAGATGAAAAAAATTCGCATACAATAGAATACAA240TAAAATGTGTTGTCTTTACTGTCAACACTTACTGTTCGTTCGGTCACAGCTGTGAATCGG300GGTGACTTTATGTTTGTAGTGGTCTTAAAAACGGGTACTTGGTTGTTTTGAAAATTTTAA360AACCTACATATGATTCTCCTAAAATTTTGTTTATAAATTAGCACCATTTGCGACCTAAAT420CTTTTTTGTAGTCTTAAGTTTAGTTGACATAAAAACAAAATTTGTAACAACACACGGTAT480AAACTAAATAGCTTCAGATGGGTCGTATGACAAGGAAACTTTTAAATAATTATGAAAGTT540TTTTTAAAATTTGACTAAGGTTTAGATTATGTGGGTGACATGCTTCGACACG592MetTrpValThrCysPheAspThr15TTTCTTTTTGTTTGTGAAAGTTCAGTTTTCTGTTTGTTGTGTGTGTGG640PheLeuPheValCysGluSerSerValPheCysLeuLeuCysValTrp101520AGGTTTGGTTTCTGTAGGTGGCGTGTTTTCTACAGTTTTCCATTCGTT688ArgPheGlyPheCysArgTrpArgValPheTyrSerPheProPheVal25303540AAGTCAACAGTTGTTTTATTACAGTGTTACCATTACTCTCTCCACAAT736LysSerThrValValLeuLeuGlnCysTyrHisTyrSerLeuHisAsn455055ACCTCAAAGTTCTACTCTGTGAATCCTGACAAGCCAGAGTACATTCTT784ThrSerLysPheTyrSerValAsnProAspLysProGluTyrIleLeu606570TCAGGTTTAGTTCTAGGGCTACTAGCCCAAAAAATGCGCCCAGTTCAG832SerGlyLeuValLeuGlyLeuLeuAlaGlnLysMetArgProValGln758085TCCAAAGGAGTAGATCTAGGCTTGTGTGATGAAACGAGGTTCGAGTGT880SerLysGlyValAspLeuGlyLeuCysAspGluThrArgPheGluCys9095100AAGTGTGGCGATCCAGGCTATGTGTTCAACATTCCAGTGAAACAATGT928LysCysGlyAspProGlyTyrValPheAsnIleProValLysGlnCys105110115120ACATACTTTTATCGATGGAGGCCGTATTGTAAACCATGTGATGACCTG976ThrTyrPheTyrArgTrpArgProTyrCysLysProCysAspAspLeu125130135GAGGCTAAGGATATTTGTCCAAAGTACAAACGATGTCAAGAGTGTAAG1024GluAlaLysAspIleCysProLysTyrLysArgCysGlnGluCysLys140145150GCTGGTCTTGATAGTTGTGTTACTTGTCCACCTAACAAATATGGTACT1072AlaGlyLeuAspSerCysValThrCysProProAsnLysTyrGlyThr155160165TGGTGTAGCGGTGAATGTCAGTGTAAGAATGGAGGTATCTGTGACCAG1120TrpCysSerGlyGluCysGlnCysLysAsnGlyGlyIleCysAspGln170175180AGGACAGGAGCTTGTGCATGTCGTGACAGATATGAAGGGGTGCACTGT1168ArgThrGlyAlaCysAlaCysArgAspArgTyrGluGlyValHisCys185190195200GAAATTCTCAAAGGTTGTCCTCTTCTTCCATCGGATTCTCAGGTTCAG1216GluIleLeuLysGlyCysProLeuLeuProSerAspSerGlnValGln205210215GAAGTCAGAAATCCACCAGATAATCCCCAAACTATTGACTACAGCTGT1264GluValArgAsnProProAspAsnProGlnThrIleAspTyrSerCys220225230TCACCAGGGTTCAAGCTTAAGGGTATGGCACGAATTAGCTGTCTCCCA1312SerProGlyPheLysLeuLysGlyMetAlaArgIleSerCysLeuPro235240245AATGGACAGTGGAGTAACTTTCCACCCAAATGTATTCGAGAATGTGCC1360AsnGlyGlnTrpSerAsnPheProProLysCysIleArgGluCysAla250255260ATGGTTTCATCTCCAGAACATGGGAAAGTGAATGCTCTTAGTGGTGAT1408MetValSerSerProGluHisGlyLysValAsnAlaLeuSerGlyAsp265270275280ATGATAGAAGGGGCTACTTTACGGTTCTCATGTGATAGTCCCTACTAC1456MetIleGluGlyAlaThrLeuArgPheSerCysAspSerProTyrTyr285290295TTGATTGGTCAAGAAACATTAACCTGTCAGGGTAATGGTCAGTGGAAT1504LeuIleGlyGlnGluThrLeuThrCysGlnGlyAsnGlyGlnTrpAsn300305310GGACAGATACCACAATGTAAGAACTTAGTCTTCTGTCCTGACCTGGAT1552GlyGlnIleProGlnCysLysAsnLeuValPheCysProAspLeuAsp315320325CCTGTAAACCATGCTGAACACAAGGTTAAAATTGGTGTGGAACAAAAA1600ProValAsnHisAlaGluHisLysValLysIleGlyValGluGlnLys330335340TATGGTCAGTTTCCTCAAGGCACTGAAGTGACCTATACGTGTTCGGGT1648TyrGlyGlnPheProGlnGlyThrGluValThrTyrThrCysSerGly345350355360AACTACTTCTTGATGGGTTTTGACACCTTAAAATGTAACCCTGATGGG1696AsnTyrPheLeuMetGlyPheAspThrLeuLysCysAsnProAspGly365370375TCTTGGTCAGGATCACAGCCATCCTGTGTTAAAGTGGCAGACAGAGAG1744SerTrpSerGlySerGlnProSerCysValLysValAlaAspArgGlu380385390GTCGACTGTGACAGTAAAGCTGTAGACTTCTTGGATGATGTTGGTGAA1792ValAspCysAspSerLysAlaValAspPheLeuAspAspValGlyGlu395400405CCTGTCAGGATCCACTGTCCTGCTGGCTGTTCTTTGACAGCTGGTACT1840ProValArgIleHisCysProAlaGlyCysSerLeuThrAlaGlyThr410415420GTGTGGGGTACAGCCATATACCATGAACTTTCCTCAGTGTGTCGTGCA1888ValTrpGlyThrAlaIleTyrHisGluLeuSerSerValCysArgAla425430435440GCCATCCATGCTGGCAAGCTTCCAAACTCTGGAGGAGCGGTGCATGTT1936AlaIleHisAlaGlyLysLeuProAsnSerGlyGlyAlaValHisVal445450455GTGAACAATGGCCCCTACTCGGACTTTCTGGGTAGTGACCTGAATGGG1984ValAsnAsnGlyProTyrSerAspPheLeuGlySerAspLeuAsnGly460465470ATAAAATCCGAAGAGTTGAAGTCTCTTGCCCGGAGTTTCCGATTCGAT2032IleLysSerGluGluLeuLysSerLeuAlaArgSerPheArgPheAsp475480485TATGTCAGTTCCTCCACAGCAGGTAAATCAGGATGTCCTGATGGATGG2080TyrValSerSerSerThrAlaGlyLysSerGlyCysProAspGlyTrp490495500TTTGAGGTAGACGAGAACTGTGTGTACGTTACATCAAAACAGAGAGCC2128PheGluValAspGluAsnCysValTyrValThrSerLysGlnArgAla505510515520TGGGAAAGAGCTCAAGGTGTGTGTACCAATATGGCTGCTCGTCTTGCT2176TrpGluArgAlaGlnGlyValCysThrAsnMetAlaAlaArgLeuAla525530535GTGCTGGACAAAGATGTAATTCCAAATTCATTGACTGAGACTCTACGA2224ValLeuAspLysAspValIleProAsnSerLeuThrGluThrLeuArg540545550GGGAAAGGGTTAACAACCACGTGGATAGGATTGCACAGACTAGATGCT2272GlyLysGlyLeuThrThrThrTrpIleGlyLeuHisArgLeuAspAla555560565GAGAAGCCCTTTATTTGGGAGTTAATGGATCGTAGTAATGTGGTTCTG2320GluLysProPheIleTrpGluLeuMetAspArgSerAsnValValLeu570575580AATGATAACCTAACATTCTGGGCCTCTGGCGAACCTGGAAATGAAACT2368AsnAspAsnLeuThrPheTrpAlaSerGlyGluProGlyAsnGluThr585590595600AACTGTGTATATATGGACATCCAAGATCAGTTGCAGTCTGTGTGGAAA2416AsnCysValTyrMetAspIleGlnAspGlnLeuGlnSerValTrpLys605610615ACCAAGTCATGTTTTCAGCCCTCAAGTTTTGCTTGCATGATGGATCTG2464ThrLysSerCysPheGlnProSerSerPheAlaCysMetMetAspLeu620625630TCAGACAGAAATAAAGCCAAATGCGATGATCCTGGATCACTGGAAAAT2512SerAspArgAsnLysAlaLysCysAspAspProGlySerLeuGluAsn635640645GGACACGCCACACTTCATGGACAAAGTATTGATGGGTTCTATGCTGGT2560GlyHisAlaThrLeuHisGlyGlnSerIleAspGlyPheTyrAlaGly650655660TCTTCTATAAGGTACAGCTGTGAGGTTCTCCACTACCTCAGTGGAACT2608SerSerIleArgTyrSerCysGluValLeuHisTyrLeuSerGlyThr665670675680GAAACCGTAACTTGTACAACAAATGGCACATGGAGTGCTCCTAAACCT2656GluThrValThrCysThrThrAsnGlyThrTrpSerAlaProLysPro685690695CGATGTATCAAAGTCATCACCTGCCAAAACCCCCCTGTACCATCATAT2704ArgCysIleLysValIleThrCysGlnAsnProProValProSerTyr700705710GGTTCTGTGGAAATCAAACCCCCAAGTCGGACAAACTCGATAAGTCGT2752GlySerValGluIleLysProProSerArgThrAsnSerIleSerArg715720725GTTGGGTCACCTTTCTTGAGGTTGCCACGGTTACCCCTCCCATTAGCC2800ValGlySerProPheLeuArgLeuProArgLeuProLeuProLeuAla730735740AGAGCAGCCAAACCTCCTCCAAAACCTAGATCCTCACAACCCTCTACT2848ArgAlaAlaLysProProProLysProArgSerSerGlnProSerThr745750755760GTGGACTTGGCTTCTAAAGTTAAACTACCTGAAGGTCATTACCGGGTA2896ValAspLeuAlaSerLysValLysLeuProGluGlyHisTyrArgVal765770775GGGTCTCGAGCCATTTACACGTGCGAGTCGAGATACTACGAACTACTT2944GlySerArgAlaIleTyrThrCysGluSerArgTyrTyrGluLeuLeu780785790GGATCTCAAGGCAGAAGATGTGACTCTAATGGAAACTGGAGTGGTCGG2992GlySerGlnGlyArgArgCysAspSerAsnGlyAsnTrpSerGlyArg795800805CCAGCGAGCTGTATTCCAGTTTGTGGACGGTCAGACTCTCCTCGTTCT3040ProAlaSerCysIleProValCysGlyArgSerAspSerProArgSer810815820CCTTTTATCTGGAATGGGAATTCTACAGAAATAGGTCAGTGGCCGTGG3088ProPheIleTrpAsnGlyAsnSerThrGluIleGlyGlnTrpProTrp825830835840CAGGCAGGAATCTCTAGATGGCTTGCAGACCACAATATGTGGTTTCTC3136GlnAlaGlyIleSerArgTrpLeuAlaAspHisAsnMetTrpPheLeu845850855CAGTGTGGAGGATCTCTATTGAATGAGAAATGGATCGTCACTGCTGCC3184GlnCysGlyGlySerLeuLeuAsnGluLysTrpIleValThrAlaAla860865870CACTGTGTCACCTACTCTGCTACTGCTGAGATTATTGACCCCAATCAG3232HisCysValThrTyrSerAlaThrAlaGluIleIleAspProAsnGln875880885TTTAAAATGTATCTGGGCAAGTACTACCGTGATGACAGTAGAGACGAT3280PheLysMetTyrLeuGlyLysTyrTyrArgAspAspSerArgAspAsp890895900GACTATGTACAAGTAAGAGAGGCTCTTGAGATCCACGTGAATCCTAAC3328AspTyrValGlnValArgGluAlaLeuGluIleHisValAsnProAsn905910915920TACGACCCCGGCAATCTCAACTTTGACATAGCCCTAATTCAACTGAAA3376TyrAspProGlyAsnLeuAsnPheAspIleAlaLeuIleGlnLeuLys925930935ACTCCTGTTACTTTGACAACACGAGTCCAACCAATCTGTCTGCCTACT3424ThrProValThrLeuThrThrArgValGlnProIleCysLeuProThr940945950GACATCACAACAAGAGAACACTTGAAGGAGGGAACATTAGCAGTGGTG3472AspIleThrThrArgGluHisLeuLysGluGlyThrLeuAlaValVal955960965ACAGGTTGGGGTTTGAATGAAAACAACACCTATTCAGAGACGATTCAA3520ThrGlyTrpGlyLeuAsnGluAsnAsnThrTyrSerGluThrIleGln970975980CAAGCTGTGCTACCTGTTGTTGCAGCCAGCACCTGTGAAGAGGGGTAC3568GlnAlaValLeuProValValAlaAlaSerThrCysGluGluGlyTyr9859909951000AAGGAAGCAGACTTACCACTGACAGTAACAGAGAACATGTTCTGTGCA3616LysGluAlaAspLeuProLeuThrValThrGluAsnMetPheCysAla100510101015GGTTACAAGAAGGGACGTTATGATGCCTGCAGTGGGGACAGTGGAGGA3664GlyTyrLysLysGlyArgTyrAspAlaCysSerGlyAspSerGlyGly102010251030CCTTTAGTGTTTGCTGATGATTCCCGTACCGAAAGGCGGTGGGTCTTG3712ProLeuValPheAlaAspAspSerArgThrGluArgArgTrpValLeu103510401045GAAGGGATTGTCAGCTGGGGCAGTCCCAGTGGATGTGGCAAGGCGAAC3760GluGlyIleValSerTrpGlySerProSerGlyCysGlyLysAlaAsn105010551060CAGTACGGGGGCTTCACTAAAGTTAACGTTTTCCTGTCATGGATTAGG3808GlnTyrGlyGlyPheThrLysValAsnValPheLeuSerTrpIleArg1065107010751080CAGTTCATTTGAAACTGATCTAAATATTTTAAGCATGGTTATAAACGTC3857GlnPheIleTTGTTCCTATTATTGCTTTACTGGTTTAACCCATAAGAAGGTTAACGGGGTAAGGCACAA3917GGATCATTGTTTCTGTTTGTTTTTACAAATGGTTCTTTTAGTCAGTGAATGAGAATAGTA3977TCCATTGGAGACTGTTACCTTTTATTCTACCTTTTTATATTACTATGCAAGTATTTGGGA4037TATCTTCTACACATGAAAATTCTGTCATTTTACCATAAATTTGGTTTCTGGTGTGTGTGT4097TAAGTCCACCACTAGAGAACGATGTAATTTTCAATAGTACATGAAATAAATATAGAACAA4157ATCTATTATAAAAAAAAAAAAAAAA4182(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1083 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetTrpValThrCysPheAspThrPheLeuPheValCysGluSerSer151015ValPheCysLeuLeuCysValTrpArgPheGlyPheCysArgTrpArg202530ValPheTyrSerPheProPheValLysSerThrValValLeuLeuGln354045CysTyrHisTyrSerLeuHisAsnThrSerLysPheTyrSerValAsn505560ProAspLysProGluTyrIleLeuSerGlyLeuValLeuGlyLeuLeu65707580AlaGlnLysMetArgProValGlnSerLysGlyValAspLeuGlyLeu859095CysAspGluThrArgPheGluCysLysCysGlyAspProGlyTyrVal100105110PheAsnIleProValLysGlnCysThrTyrPheTyrArgTrpArgPro115120125TyrCysLysProCysAspAspLeuGluAlaLysAspIleCysProLys130135140TyrLysArgCysGlnGluCysLysAlaGlyLeuAspSerCysValThr145150155160CysProProAsnLysTyrGlyThrTrpCysSerGlyGluCysGlnCys165170175LysAsnGlyGlyIleCysAspGlnArgThrGlyAlaCysAlaCysArg180185190AspArgTyrGluGlyValHisCysGluIleLeuLysGlyCysProLeu195200205LeuProSerAspSerGlnValGlnGluValArgAsnProProAspAsn210215220ProGlnThrIleAspTyrSerCysSerProGlyPheLysLeuLysGly225230235240MetAlaArgIleSerCysLeuProAsnGlyGlnTrpSerAsnPhePro245250255ProLysCysIleArgGluCysAlaMetValSerSerProGluHisGly260265270LysValAsnAlaLeuSerGlyAspMetIleGluGlyAlaThrLeuArg275280285PheSerCysAspSerProTyrTyrLeuIleGlyGlnGluThrLeuThr290295300CysGlnGlyAsnGlyGlnTrpAsnGlyGlnIleProGlnCysLysAsn305310315320LeuValPheCysProAspLeuAspProValAsnHisAlaGluHisLys325330335ValLysIleGlyValGluGlnLysTyrGlyGlnPheProGlnGlyThr340345350GluValThrTyrThrCysSerGlyAsnTyrPheLeuMetGlyPheAsp355360365ThrLeuLysCysAsnProAspGlySerTrpSerGlySerGlnProSer370375380CysValLysValAlaAspArgGluValAspCysAspSerLysAlaVal385390395400AspPheLeuAspAspValGlyGluProValArgIleHisCysProAla405410415GlyCysSerLeuThrAlaGlyThrValTrpGlyThrAlaIleTyrHis420425430GluLeuSerSerValCysArgAlaAlaIleHisAlaGlyLysLeuPro435440445AsnSerGlyGlyAlaValHisValValAsnAsnGlyProTyrSerAsp450455460PheLeuGlySerAspLeuAsnGlyIleLysSerGluGluLeuLysSer465470475480LeuAlaArgSerPheArgPheAspTyrValSerSerSerThrAlaGly485490495LysSerGlyCysProAspGlyTrpPheGluValAspGluAsnCysVal500505510TyrValThrSerLysGlnArgAlaTrpGluArgAlaGlnGlyValCys515520525ThrAsnMetAlaAlaArgLeuAlaValLeuAspLysAspValIlePro530535540AsnSerLeuThrGluThrLeuArgGlyLysGlyLeuThrThrThrTrp545550555560IleGlyLeuHisArgLeuAspAlaGluLysProPheIleTrpGluLeu565570575MetAspArgSerAsnValValLeuAsnAspAsnLeuThrPheTrpAla580585590SerGlyGluProGlyAsnGluThrAsnCysValTyrMetAspIleGln595600605AspGlnLeuGlnSerValTrpLysThrLysSerCysPheGlnProSer610615620SerPheAlaCysMetMetAspLeuSerAspArgAsnLysAlaLysCys625630635640AspAspProGlySerLeuGluAsnGlyHisAlaThrLeuHisGlyGln645650655SerIleAspGlyPheTyrAlaGlySerSerIleArgTyrSerCysGlu660665670ValLeuHisTyrLeuSerGlyThrGluThrValThrCysThrThrAsn675680685GlyThrTrpSerAlaProLysProArgCysIleLysValIleThrCys690695700GlnAsnProProValProSerTyrGlySerValGluIleLysProPro705710715720SerArgThrAsnSerIleSerArgValGlySerProPheLeuArgLeu725730735ProArgLeuProLeuProLeuAlaArgAlaAlaLysProProProLys740745750ProArgSerSerGlnProSerThrValAspLeuAlaSerLysValLys755760765LeuProGluGlyHisTyrArgValGlySerArgAlaIleTyrThrCys770775780GluSerArgTyrTyrGluLeuLeuGlySerGlnGlyArgArgCysAsp785790795800SerAsnGlyAsnTrpSerGlyArgProAlaSerCysIleProValCys805810815GlyArgSerAspSerProArgSerProPheIleTrpAsnGlyAsnSer820825830ThrGluIleGlyGlnTrpProTrpGlnAlaGlyIleSerArgTrpLeu835840845AlaAspHisAsnMetTrpPheLeuGlnCysGlyGlySerLeuLeuAsn850855860GluLysTrpIleValThrAlaAlaHisCysValThrTyrSerAlaThr865870875880AlaGluIleIleAspProAsnGlnPheLysMetTyrLeuGlyLysTyr885890895TyrArgAspAspSerArgAspAspAspTyrValGlnValArgGluAla900905910LeuGluIleHisValAsnProAsnTyrAspProGlyAsnLeuAsnPhe915920925AspIleAlaLeuIleGlnLeuLysThrProValThrLeuThrThrArg930935940ValGlnProIleCysLeuProThrAspIleThrThrArgGluHisLeu945950955960LysGluGlyThrLeuAlaValValThrGlyTrpGlyLeuAsnGluAsn965970975AsnThrTyrSerGluThrIleGlnGlnAlaValLeuProValValAla980985990AlaSerThrCysGluGluGlyTyrLysGluAlaAspLeuProLeuThr99510001005ValThrGluAsnMetPheCysAlaGlyTyrLysLysGlyArgTyrAsp101010151020AlaCysSerGlyAspSerGlyGlyProLeuValPheAlaAspAspSer1025103010351040ArgThrGluArgArgTrpValLeuGluGlyIleValSerTrpGlySer104510501055ProSerGlyCysGlyLysAlaAsnGlnTyrGlyGlyPheThrLysVal106010651070AsnValPheLeuSerTrpIleArgGlnPheIle10751080(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3448 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: both(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Carcinoscorpius rotundicauda(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 18..3074(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GTGAAGGTAACTTAAGTATGGTCTTAGCGTCGTTTTTGGTGTCTGGTTTA50MetValLeuAlaSerPheLeuValSerGlyLeu1510GTTCTAGGGCTACTAGCCCAAAAAATGCGCCCAGTTCAGTCCAAAGGA98ValLeuGlyLeuLeuAlaGlnLysMetArgProValGlnSerLysGly152025GTAGATCTAGGCTTGTGTGATGAAACGAGGTTCGAGTGTAAGTGTGGC146ValAspLeuGlyLeuCysAspGluThrArgPheGluCysLysCysGly303540GATCCAGGCTATGTGTTCAACATTCCAGTGAAACAATGTACATACTTT194AspProGlyTyrValPheAsnIleProValLysGlnCysThrTyrPhe455055TATCGATGGAGGCCGTATTGTAAACCATGTGATGACCTGGAGGCTAAG242TyrArgTrpArgProTyrCysLysProCysAspAspLeuGluAlaLys60657075GATATTTGTCCAAAGTACAAACGATGTCAAGAGTGTAAGGCTGGTCTT290AspIleCysProLysTyrLysArgCysGlnGluCysLysAlaGlyLeu808590GATAGTTGTGTTACTTGTCCACCTAACAAATATGGTACTTGGTGTAGC338AspSerCysValThrCysProProAsnLysTyrGlyThrTrpCysSer95100105GGTGAATGTCAGTGTAAGAATGGAGGTATCTGTGACCAGAGGACAGGA386GlyGluCysGlnCysLysAsnGlyGlyIleCysAspGlnArgThrGly110115120GCTTGTGCATGTCGTGACAGATATGAAGGGGTGCACTGTGAAATTCTC434AlaCysAlaCysArgAspArgTyrGluGlyValHisCysGluIleLeu125130135AAAGGTTGTCCTCTTCTTCCATCGGATTCTCAGGTTCAGGAAGTCAGA482LysGlyCysProLeuLeuProSerAspSerGlnValGlnGluValArg140145150155AATCCACCAGATAATCCCCAAACTATTGACTACAGCTGTTCACCAGGG530AsnProProAspAsnProGlnThrIleAspTyrSerCysSerProGly160165170TTCAAGCTTAAGGGTATGGCACGAATTAGCTGTCTCCCAAATGGACAG578PheLysLeuLysGlyMetAlaArgIleSerCysLeuProAsnGlyGln175180185TGGAGTAACTTTCCACCCAAATGTATTCGAGAATGTGCCATGGTTTCA626TrpSerAsnPheProProLysCysIleArgGluCysAlaMetValSer190195200TCTCCAGAACATGGGAAAGTGAATGCTCTTAGTGGTGATATGATAGAA674SerProGluHisGlyLysValAsnAlaLeuSerGlyAspMetIleGlu205210215GGGGCTACTTTACGGTTCTCATGTGATAGTCCCTACTACTTGATTGGT722GlyAlaThrLeuArgPheSerCysAspSerProTyrTyrLeuIleGly220225230235CAAGAAACATTAACCTGTCAGGGTAATGGTCAGTGGAATGGACAGATA770GlnGluThrLeuThrCysGlnGlyAsnGlyGlnTrpAsnGlyGlnIle240245250CCACAATGTAAGAACTTGGTCTTCTGTCCTGACCTGGATCCTGTAAAC818ProGlnCysLysAsnLeuValPheCysProAspLeuAspProValAsn255260265CATGCTGAACACAAGGTTAAAATTGGTGTGGAACAAAAATATGGTCAG866HisAlaGluHisLysValLysIleGlyValGluGlnLysTyrGlyGln270275280TTTCCTCAAGGCACTGAAGTGACCTATACGTGTTCGGGTAACTACTTC914PheProGlnGlyThrGluValThrTyrThrCysSerGlyAsnTyrPhe285290295TTGATGGGTTTTGACACCTTAAAATGTAACCCTGATGGGTCTTGGTCA962LeuMetGlyPheAspThrLeuLysCysAsnProAspGlySerTrpSer300305310315GGATCACAGCCATCCTGTGTTAAAGTGGCAGACAGAGAGGTCGACTGT1010GlySerGlnProSerCysValLysValAlaAspArgGluValAspCys320325330GACAGTAAAGCTGTAGACTTCTTGGATGATGTTGGTGAACCTGTCAGG1058AspSerLysAlaValAspPheLeuAspAspValGlyGluProValArg335340345ATCCACTGTCCTGCTGGCTGTTCTTTGACAGCTGGTACTGTGTGGGGT1106IleHisCysProAlaGlyCysSerLeuThrAlaGlyThrValTrpGly350355360ACAGCCATATACCATGAACTTTCCTCAGTGTGTCGTGCAGCCATCCAT1154ThrAlaIleTyrHisGluLeuSerSerValCysArgAlaAlaIleHis365370375GCTGGCAAGCTTCCAAACTCTGGAGGAGCGGTGCATGTTGTGAACAAT1202AlaGlyLysLeuProAsnSerGlyGlyAlaValHisValValAsnAsn380385390395GGCCCCTACTCGGACTTTCTGGGTAGTGACCTGAATGGGATAAAATCG1250GlyProTyrSerAspPheLeuGlySerAspLeuAsnGlyIleLysSer400405410GAAGAGTTGAAGTCTCTTGCCCGGAGTTTCCGATTCGATTATGTCCGT1298GluGluLeuLysSerLeuAlaArgSerPheArgPheAspTyrValArg415420425TCCTCCACAGCAGGTAAATCAGGATGTCCTGATGGATGGTTTGAGGTA1346SerSerThrAlaGlyLysSerGlyCysProAspGlyTrpPheGluVal430435440GACGAGAACTGTGTGTACGTTACATCAAAACAGAGAGCCTGGGAAAGA1394AspGluAsnCysValTyrValThrSerLysGlnArgAlaTrpGluArg445450455GCTCAAGGTGTGTGTACCAATATGGCTGCTCGTCTTGCTGTGCTGGAC1442AlaGlnGlyValCysThrAsnMetAlaAlaArgLeuAlaValLeuAsp460465470475AAAGATGTAATTCCAAATTCGTTGACTGAGACTCTACGAGGGAAAGGG1490LysAspValIleProAsnSerLeuThrGluThrLeuArgGlyLysGly480485490TTAACAACCACGTGGATAGGATTGCACAGACTAGATGCTGAGAAGCCC1538LeuThrThrThrTrpIleGlyLeuHisArgLeuAspAlaGluLysPro495500505TTTATTTGGGAGTTAATGGATCGTAGTAATGTGGTTCTGAATGATAAC1586PheIleTrpGluLeuMetAspArgSerAsnValValLeuAsnAspAsn510515520CTAACATTCTGGGCCTCTGGCGAACCTGGAAATGAAACTAACTGTGTA1634LeuThrPheTrpAlaSerGlyGluProGlyAsnGluThrAsnCysVal525530535TATATGGACATCCAAGATCAGTTGCAGTCTGTGTGGAAAACCAAGTCA1682TyrMetAspIleGlnAspGlnLeuGlnSerValTrpLysThrLysSer540545550555TGTTTTCAGCCCTCAAGTTTTGCTTGCATGATGGATCTGTCAGACAGA1730CysPheGlnProSerSerPheAlaCysMetMetAspLeuSerAspArg560565570AATAAAGCCAAATGCGATGATCCTGGATCACTGGAAAATGGACACGCC1778AsnLysAlaLysCysAspAspProGlySerLeuGluAsnGlyHisAla575580585ACACTTCATGGACAAAGTATTGATGGGTTCTATGCTGGTTCTTCTATA1826ThrLeuHisGlyGlnSerIleAspGlyPheTyrAlaGlySerSerIle590595600AGGTACAGCTGTGAGGTTCTCCACTACCTCAGTGGAACTGAAACCGTA1874ArgTyrSerCysGluValLeuHisTyrLeuSerGlyThrGluThrVal605610615ACTTGTACAACAAATGGCACATGGAGTGCTCCTAAACCTCGATGTATC1922ThrCysThrThrAsnGlyThrTrpSerAlaProLysProArgCysIle620625630635AAAGTCATCACCTGCCAAAACCCCCCTGTACCATCATATGGTTCTGTG1970LysValIleThrCysGlnAsnProProValProSerTyrGlySerVal640645650GAAATCAAACCCCCAAGTCGGACAAACTCGATAAGTCGTGTTGGGTCA2018GluIleLysProProSerArgThrAsnSerIleSerArgValGlySer655660665CCTTTCTTGAGGTTGCCACGGTTACCCCTCCCATTAGCTAGAGCAGCC2066ProPheLeuArgLeuProArgLeuProLeuProLeuAlaArgAlaAla670675680AAACCTCCTCCAAAACCTAGATCCTCACAACCCTCTACTGTGGACTTG2114LysProProProLysProArgSerSerGlnProSerThrValAspLeu685690695GCTTCTAAAGTTAAACTACCTGAAGGTCATTACCGGGTAGGGTCTCGA2162AlaSerLysValLysLeuProGluGlyHisTyrArgValGlySerArg700705710715GCCATCTACACGTGCGAGTCGAGATACTACGAACTACTTGGATCTCAA2210AlaIleTyrThrCysGluSerArgTyrTyrGluLeuLeuGlySerGln720725730GGCAGAAGATGTGACTCTAATGGAAACTGGAGTGGTCGGCCAGCGAGC2258GlyArgArgCysAspSerAsnGlyAsnTrpSerGlyArgProAlaSer735740745TGTATTCCAGTTTGTGGACGGTCAGACTCTCCTCGTTCTCCTTTTATC2306CysIleProValCysGlyArgSerAspSerProArgSerProPheIle750755760TGGAATGGGAATTCTACAGAAATAGGTCAGTGGCCGTGGCAGGCAGGA2354TrpAsnGlyAsnSerThrGluIleGlyGlnTrpProTrpGlnAlaGly765770775ATCTCTAGATGGCTTGCAGACCACAATATGTGGTTTCTCCAGTGTGGA2402IleSerArgTrpLeuAlaAspHisAsnMetTrpPheLeuGlnCysGly780785790795GGATCTCTATTGAATGAGAAATGGATCGTCACTGCTGCCCACTGTGTC2450GlySerLeuLeuAsnGluLysTrpIleValThrAlaAlaHisCysVal800805810ACCTACTCTGCTACTGCTGAGATTATTGACCCCAATCAGTTTAAAATG2498ThrTyrSerAlaThrAlaGluIleIleAspProAsnGlnPheLysMet815820825TATCTGGGCAAGTACTACCGTGATGACAGTAGAGACGATGACTATGTA2546TyrLeuGlyLysTyrTyrArgAspAspSerArgAspAspAspTyrVal830835840CAAGTAAGAGAGGCTCTTGAGATCCACGTGAATCCTAACTACGACCCC2594GlnValArgGluAlaLeuGluIleHisValAsnProAsnTyrAspPro845850855GGCAATCTCAACTTTGACATAGCCCTAATTCAACTGAAAACTCCTGTT2642GlyAsnLeuAsnPheAspIleAlaLeuIleGlnLeuLysThrProVal860865870875ACTTTGACAACACGAGTCCAACCAATCTGTCTGCCTACTGACATCACA2690ThrLeuThrThrArgValGlnProIleCysLeuProThrAspIleThr880885890ACAAGAGAACACTTGAAGGAGGGAACATTAGCAGTGGTGACAGGTTGG2738ThrArgGluHisLeuLysGluGlyThrLeuAlaValValThrGlyTrp895900905GGTTTGAATGAAAACAACACCTATTCAGAGACGATTCAACAAGCTGTG2786GlyLeuAsnGluAsnAsnThrTyrSerGluThrIleGlnGlnAlaVal910915920CTACCTGTTGTTGCAGCCAGCACCTGTGAAGAGGGGTACAAGGAAGCA2834LeuProValValAlaAlaSerThrCysGluGluGlyTyrLysGluAla925930935GACTTACCACTGACAGTAACAGAGAACATGTTCTGTGCAGGTTACAAG2882AspLeuProLeuThrValThrGluAsnMetPheCysAlaGlyTyrLys940945950955AAGGGACGTTATGATGCCTGCAGTGGGGACAGTGGAGGACCTTTAGTG2930LysGlyArgTyrAspAlaCysSerGlyAspSerGlyGlyProLeuVal960965970TTTGCTGATGATTCCCGTACCGAAAGGCGGTGGGTCTTGGAAGGGATT2978PheAlaAspAspSerArgThrGluArgArgTrpValLeuGluGlyIle975980985GTCAGCTGGGGCAGTCCCAGTGGATGTGGCAAGGCGAACCAGTACGGG3026ValSerTrpGlySerProSerGlyCysGlyLysAlaAsnGlnTyrGly9909951000GGCTTCACTAAAGTTAACGTTTTCCTGTCATGGATTAGGCAGTTCATT3074GlyPheThrLysValAsnValPheLeuSerTrpIleArgGlnPheIle100510101015TGAAACTGATCTAAATATTTTAAGCATGGTTATAAACGTCTTGTTTCCTATTATTGCTTT3134ACTAGTTTAACCCATAAGAAGGTTAACTGGGTAAGGCACAAGGATCATTGTTTCTGTTTG3194TTTTTACAAATGGTTATTTTAGTCAGTGAATGAGAATAGTATCCATTGAAGACTGTTACC3254TTTTATTCTACCTTTTTATATTACTATGTAAGTATTTGGGATATCTTCTACACATGAAAA3314TTCTGTCATTTTACCATAAATTTGGTTTCTGGTGTGTGCTAAGTCCACCAGTAGAGAACG3374ATGTAATTTTCACTAGCACATGAAATAAATATAGAACAAATCTATTATAAACTACCTTAA3434AAAAAAAAAAAAAA3448(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1019 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetValLeuAlaSerPheLeuValSerGlyLeuValLeuGlyLeuLeu151015AlaGlnLysMetArgProValGlnSerLysGlyValAspLeuGlyLeu202530CysAspGluThrArgPheGluCysLysCysGlyAspProGlyTyrVal354045PheAsnIleProValLysGlnCysThrTyrPheTyrArgTrpArgPro505560TyrCysLysProCysAspAspLeuGluAlaLysAspIleCysProLys65707580TyrLysArgCysGlnGluCysLysAlaGlyLeuAspSerCysValThr859095CysProProAsnLysTyrGlyThrTrpCysSerGlyGluCysGlnCys100105110LysAsnGlyGlyIleCysAspGlnArgThrGlyAlaCysAlaCysArg115120125AspArgTyrGluGlyValHisCysGluIleLeuLysGlyCysProLeu130135140LeuProSerAspSerGlnValGlnGluValArgAsnProProAspAsn145150155160ProGlnThrIleAspTyrSerCysSerProGlyPheLysLeuLysGly165170175MetAlaArgIleSerCysLeuProAsnGlyGlnTrpSerAsnPhePro180185190ProLysCysIleArgGluCysAlaMetValSerSerProGluHisGly195200205LysValAsnAlaLeuSerGlyAspMetIleGluGlyAlaThrLeuArg210215220PheSerCysAspSerProTyrTyrLeuIleGlyGlnGluThrLeuThr225230235240CysGlnGlyAsnGlyGlnTrpAsnGlyGlnIleProGlnCysLysAsn245250255LeuValPheCysProAspLeuAspProValAsnHisAlaGluHisLys260265270ValLysIleGlyValGluGlnLysTyrGlyGlnPheProGlnGlyThr275280285GluValThrTyrThrCysSerGlyAsnTyrPheLeuMetGlyPheAsp290295300ThrLeuLysCysAsnProAspGlySerTrpSerGlySerGlnProSer305310315320CysValLysValAlaAspArgGluValAspCysAspSerLysAlaVal325330335AspPheLeuAspAspValGlyGluProValArgIleHisCysProAla340345350GlyCysSerLeuThrAlaGlyThrValTrpGlyThrAlaIleTyrHis355360365GluLeuSerSerValCysArgAlaAlaIleHisAlaGlyLysLeuPro370375380AsnSerGlyGlyAlaValHisValValAsnAsnGlyProTyrSerAsp385390395400PheLeuGlySerAspLeuAsnGlyIleLysSerGluGluLeuLysSer405410415LeuAlaArgSerPheArgPheAspTyrValArgSerSerThrAlaGly420425430LysSerGlyCysProAspGlyTrpPheGluValAspGluAsnCysVal435440445TyrValThrSerLysGlnArgAlaTrpGluArgAlaGlnGlyValCys450455460ThrAsnMetAlaAlaArgLeuAlaValLeuAspLysAspValIlePro465470475480AsnSerLeuThrGluThrLeuArgGlyLysGlyLeuThrThrThrTrp485490495IleGlyLeuHisArgLeuAspAlaGluLysProPheIleTrpGluLeu500505510MetAspArgSerAsnValValLeuAsnAspAsnLeuThrPheTrpAla515520525SerGlyGluProGlyAsnGluThrAsnCysValTyrMetAspIleGln530535540AspGlnLeuGlnSerValTrpLysThrLysSerCysPheGlnProSer545550555560SerPheAlaCysMetMetAspLeuSerAspArgAsnLysAlaLysCys565570575AspAspProGlySerLeuGluAsnGlyHisAlaThrLeuHisGlyGln580585590SerIleAspGlyPheTyrAlaGlySerSerIleArgTyrSerCysGlu595600605ValLeuHisTyrLeuSerGlyThrGluThrValThrCysThrThrAsn610615620GlyThrTrpSerAlaProLysProArgCysIleLysValIleThrCys625630635640GlnAsnProProValProSerTyrGlySerValGluIleLysProPro645650655SerArgThrAsnSerIleSerArgValGlySerProPheLeuArgLeu660665670ProArgLeuProLeuProLeuAlaArgAlaAlaLysProProProLys675680685ProArgSerSerGlnProSerThrValAspLeuAlaSerLysValLys690695700LeuProGluGlyHisTyrArgValGlySerArgAlaIleTyrThrCys705710715720GluSerArgTyrTyrGluLeuLeuGlySerGlnGlyArgArgCysAsp725730735SerAsnGlyAsnTrpSerGlyArgProAlaSerCysIleProValCys740745750GlyArgSerAspSerProArgSerProPheIleTrpAsnGlyAsnSer755760765ThrGluIleGlyGlnTrpProTrpGlnAlaGlyIleSerArgTrpLeu770775780AlaAspHisAsnMetTrpPheLeuGlnCysGlyGlySerLeuLeuAsn785790795800GluLysTrpIleValThrAlaAlaHisCysValThrTyrSerAlaThr805810815AlaGluIleIleAspProAsnGlnPheLysMetTyrLeuGlyLysTyr820825830TyrArgAspAspSerArgAspAspAspTyrValGlnValArgGluAla835840845LeuGluIleHisValAsnProAsnTyrAspProGlyAsnLeuAsnPhe850855860AspIleAlaLeuIleGlnLeuLysThrProValThrLeuThrThrArg865870875880ValGlnProIleCysLeuProThrAspIleThrThrArgGluHisLeu885890895LysGluGlyThrLeuAlaValValThrGlyTrpGlyLeuAsnGluAsn900905910AsnThrTyrSerGluThrIleGlnGlnAlaValLeuProValValAla915920925AlaSerThrCysGluGluGlyTyrLysGluAlaAspLeuProLeuThr930935940ValThrGluAsnMetPheCysAlaGlyTyrLysLysGlyArgTyrAsp945950955960AlaCysSerGlyAspSerGlyGlyProLeuValPheAlaAspAspSer965970975ArgThrGluArgArgTrpValLeuGluGlyIleValSerTrpGlySer980985990ProSerGlyCysGlyLysAlaAsnGlnTyrGlyGlyPheThrLysVal99510001005AsnValPheLeuSerTrpIleArgGlnPheIle10101015__________________________________________________________________________