PROTEIN HAVING GLYCOALKALOID BIOSYNTHASE ACTIVITY, AND GENE ENCODING SAME |
|||||||
申请号 | EP10812057.7 | 申请日 | 2010-08-30 | 公开(公告)号 | EP2471927B1 | 公开(公告)日 | 2015-12-23 |
申请人 | Kirin Holdings Kabushiki Kaisha; | 发明人 | UMEMOTO Naoyuki; SASAKI Katsunori; | ||||
摘要 | |||||||
权利要求 | |||||||
说明书全文 | The present invention relates to the production of glycoalkaloid compounds characteristic of a solanaceous plants such as a potato, a glycoalkaloid biosynthetic enzyme, DNA encoding the glycoalkaloid biosynthetic enzyme, a method for breeding or selecting a novel solanaceous plant such as a potato using the DNA, and a solanaceous plant such as a potato that produces no glycoalkaloid. Glycoalkaloids are members of plant-derived compounds and are said to be steroidal alkaloids. It has been reported that the glycoalkaloid structure has an N atom and is an isoprenoid having 27 carbon chains, and there are 422 compounds of glycoalkaloids from plants belonging to the genus Solanum (Non-Patent Literature 1: Chapter 7.8). In addition to solanaceous plants belonging to the genus Solanum, plants belonging to the family Liliaceae are known to contain glycoalkaloids. Important glycoalkaloids are chaconine and solanine from potatoes (Solanum tuberosum) belonging to the genus Solanum of the family Solanaceae and tomatine from tomatoes (Solanum lycopersicum). The potato is the world' s forth largest crop produced, following maize, rice, and wheat. It is well known that buds sprouting from the tubers and aerial parts of the potato contain chaconine and solanine, which are toxic substances. Chaconine and solanine cause toxic symptoms such as abdominal pain, dizziness, and mild disturbances of consciousness. Also, chaconine and solanine are likely to accumulate in tubers as a result of damage or exposure to sunlight. Therefore, there is the risk of accidental poisoning as a result of a failure in tuber management. Accidental glycoalkaloid poisoning sometimes occurs. In a recent case, accidental glycoalkaloid poisoning occurred in an elementary school in Nara city in Japan on July 16, 2009 (reported by Asahi.com). The glycoalkaloid levels in potato tubers are controlled at 20 mg/100 g or lower by, for example, storing the tubers in dark places. Thus, in general, potato tubers are safe food products. However, in consideration of the risk of accidental poisoning described above, reduction of potato glycoalkaloid content is a key issue for those involved in breeding, production, storage, transportation, distribution, or purchasing in the potato-related industry. However, reduction of potato glycoalkaloid content has not been achieved thus far. This is because there is no wild-type potato line free from glycoalkaloids, the glycoalkaloid biosynthesis pathway has not been elucidated (Non-Patent Literature 1 (figs. 7.24 A and B) and Non-Patent Literature 2), and there has been little progress in identification of genes involved in the biosynthesis pathway. It is known that glycoalkaloids have medicinal properties such as anticancer activity, liver-protecting effects, antispasmodic effects, immune-system-promoting effects, antifungal effects, antiprotozoal effects, and molluscicide activity, in addition to poisonous properties such as anticholinesterase activity and membrane disruption effects (Non-Patent Literature 1). It has been reported that esculeoside A, which is a glycoalkaloid metabolite, shows anti-arteriosclerotic effects in tomatoes (Non-Patent Literature 3). However, since the biosynthesis pathway has not been elucidated, there has been substantially no advance in research and development to suppress or efficiently produce metabolites. In recent years, there have been some reports on genes involved in the glycosylation after transfer of a sugar to aglycone (Non-Patent Literature 4-6). Non-Patent Literature 4 reports that a UDP-galactosyltransferase gene is involved in the pathway of formation of γ-solanine from solanidine (aglycone), and it also reports a strain in which the gene is suppressed. However, suppression of chaconine has been never achieved (Non-Patent Literature 4 ( There is a report of an attempt to reduce glycoalkaloid through overexpression of genes involved in biosynthesis of plant sterols and plant hormones (Non-Patent Literature 7). However, in such case, it was merely possible to reduce the glycoalkaloid content up to almost half the initial amount (Non-Patent Literature 7 (
An object of the present invention is to provide a glycoalkaloid biosynthetic enzyme, DNA encoding the glycoalkaloid biosynthetic enzyme, transformants, into which such DNA has been introduced, methods for detecting the existence of a mutation and/or polymorphism of a gene encoding a glycoalkaloid biosynthetic enzyme in a plant, methods for selecting a plant having such a mutation and/or polymorphism, and solanaceous plants lacking glycoalkaloids. The present inventors conducted intensive studies in order to achieve the above object. First, the present inventors focused on the process prior to aglycone formation. Then, the present inventors searched in silico for candidate genes involved in the biosynthesis pathway and suppressed expression of endogenous candidate genes by causing expression of parts of the candidate genes to induce RNAi. As a result, the present inventors succeeded in obtaining a potato having remarkably reduced glycoalkaloid content from the transformants and identifying the glycoalkaloid biosynthetic enzyme gene. In addition, the present inventors demonstrated that it is possible to obtain a solanaceous plant such as a potato lacking glycoalkaloids by selecting a plant in which the expression of the above gene is suppressed. Further, the present inventors demonstrated that it becomes possible to produce a novel glycoalkaloid compound by expression of the gene, and it also becomes possible to analyze polymorphisms by comparing the genomic sequence of the gene with the genomic sequences of different solanaceous plants such as potatoes, thereby making it possible to establish a newly bred solanaceous plant variety such as a potato variety. This has led to the completion of the present invention. Similarly, the present inventors succeeded in producing a tomato having reduced glycoalkaloid content by suppressing the endogenous gene in the above manner. Specifically, the present invention is defined in the claims. According to the present invention, it is possible to regulate expression of the activity of a protein having glycoalkaloid compound biosynthesis activity characteristic of a solanaceous plant such as a potato and that of a gene encoding the protein. Specifically, a method for producing a plant in which activity of such gene is regulated and a solanaceous plant such as a potato that produces no glycoalkaloid are provided. The present invention enables breeding of a solanaceous plant such as a potato having the feature of containing a glycoalkaloid compound. The use of the enzyme of the present invention allows the mass production of glycoalkaloid compounds that exhibit a variety of useful physiological activities at low prices.
The present invention is described in detail below, as well as [0030] embodiments representing background art which are useful for understanding the invention (the subject matter of which is defined in the claims.) The protein/enzyme described herein is a glycoalkaloid biosynthetic enzyme contained in a solanaceous plant (Solanaceae) such as a potato. Plants such as potatoes belonging to the family Solanaceae include potatoes (Solanum tuberosum), tomatoes (Solanum lycopersicum), eggplants (Solanum melongena), and capsicums (Capsicum annum). In addition, the enzyme is a membrane-bound cytochrome P450 monooxidase. Examples of glycoalkaloids obtained using the enzyme include a glycoalkaloid synthesized by a solanaceous plant such as a potato. Examples thereof include glycoalkaloids such as chaconine and solanine contained in potatoes and glycoalkaloids such as tomatine contained in tomatoes. Examples of a preferable steroid compound that can be used as a substrate for the glycoalkaloid biosynthetic enzyme include cholesterols. Examples of cholesterols include cholesterol, sitosterol, campesterol, stigmasterol, and brassicasterol. The glycoalkaloid biosynthetic enzyme is a hydroxylation enzyme that transfers a hydroxyl group to any of the above cholesterols. The full-length amino acid sequence of the enzyme is shown in SEQ ID NO: 1 or 3 (gene C) or SEQ ID NO: 18 or 20 (gene D). Further, the protein includes a protein having glycoalkaloid biosynthetic enzyme activity and comprising an amino acid sequence substantially identical to the amino acid sequence shown in SEQ ID NO: 1 or 3 or the amino acid sequence shown in SEQ ID NO: 18 or 20. Here, an example of such a substantially identical amino acid sequence is an amino acid sequence that has a deletion, substitution, insertion, and/or addition of one or several amino acids (1 to 10 amino acids, preferably 1 to 7 amino acids, more preferably 1 to 5 amino acids, further preferably 1 to 3 amino acids, and even further preferably 1 amino acid or 2 amino acids) with respect to the above amino acid sequence. Alternatively, it is an amino acid sequence having at least 85% or more, preferably 90% or more, more preferably 95% or more, and particularly preferably 97% or more sequence identity to the above amino acid sequence when the sequence identity is calculated using, for example, BLAST (the Basic Local Alignment Search Tool at the National Center for Biological Information) (based on, for example, default (i.e., initial setting) parameters). The glycoalkaloid biosynthetic enzyme described herein includes a natural glycoalkaloid biosynthetic enzyme isolated from a plant and a recombinant glycoalkaloid biosynthetic enzyme produced by a gene engineering technique. The gene described herein is a gene encoding a glycoalkaloid biosynthetic enzyme having activity of binding a hydroxyl group to a steroid compound, and it also encodes a protein having the above glycoalkaloid biosynthetic enzyme activity. The DNA nucleotide sequence of the gene is the nucleotide sequence shown in SEQ ID NO: 2 or 4 or the nucleotide sequence shown in SEQ ID NO: 19 or 21. Further, the DNA includes: DNA that hybridizes under stringent conditions to DNA comprising a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 2 or 4 or the nucleotide sequence shown in SEQ ID NO: 19 or 21; DNA having at least 85% or more, preferably 90% or more, more preferably 95% or more, and particularly preferably 97% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 2 or 4 or the nucleotide sequence shown in SEQ ID NO: 19 or 21 when the sequence identity is calculated using, for example, BLAST (the Basic Local Alignment Search Tool at the National Center for Biological Information) (based on, for example, default (i.e., initial setting) parameters); and DNA that encodes a protein comprising an amino acid sequence that has a deletion, substitution, insertion, and/or addition of one or several amino acids (1 to 10 amino acids, preferably 1 to 7 amino acids, preferably 1 to 5 amino acids, more preferably 1 to 3 amino acids, and further preferably 1 amino acid or 2 amino acids) with respect to the amino acid sequence of a protein encoded by the above DNA and comprises a protein having glycoalkaloid biosynthetic enzyme activity. Here, the term "stringent conditions" refers to, for example, conditions comprising "1 1 X SSC, 0.1% SDS, 37°C." More stringent conditions comprise "0.5 X SSC, 0.1% SDS, 42°C." Further stringent conditions comprise "0.2 X SSC, 0.1% SDS, 65°C." In addition, the gene includes DNA comprising a degenerate isomer of the nucleotide sequence shown in SEQ ID NO: 3 or 4. The vector described herein is a recombinant vector into which DNA shown in SEQ ID NO: 2 or 4 or DNA shown in SEQ ID NO: 19 or 21 has been inserted. As such vector, a wide range of known vectors for yeasts, plant cells, insect cells, and the like can be used. Examples of known vectors for yeasts include pDR196, pYES-DEST 52, Yip5, Yrpl7, and Yep24. Examples of known vectors for plant cells include the pGWB vector, pBiE12-GUS, pIG121-Hm, pBI121, pBiHyg-HSE, pBI19, pBI101, pGV3850, and pABH-Hm1. Examples of known vectors for insect cells include pBM030, pBM034, and pBK283. A vector used in the present invention incorporates components involved in gene expression or suppression such as a promoter, a terminator, and an enhancer. If necessary, the vector contains selection markers (e.g., a drug-resistant gene, an antibiotic-resistant gene, and a reporter gene). It is preferable for the components involved in gene expression or suppression to be incorporated into a recombinant vector in a manner such that they can independently function in accordance with their properties. A person skilled in the art can adequately carry out procedures of such incorporation. The transformant described herein is a transformant having the recombinant vector described herein. Such transformant can be obtained by introducing a recombinant vector into which a gene encoding an enzyme has been inserted into a host in a manner such that the gene of interest is expressed therein. A host appropriate for a vector can be used. Examples of hosts include yeasts, plant cells, insect cells (e.g., Sf9), and plant viruses. Preferable examples thereof include yeasts, plant cells, and plant viruses. A method for introducing a recombinant vector is not particularly limited as long as it is a method for introducing DNA into a microorganism. Examples of such method include a method using calcium ions ( The glycoalkaloid biosynthetic enzyme described herein is a membrane-bound cytochrome P450 monooxidase, and it can be collected from a general plant (e.g., The glycoalkaloid biosynthetic enzyme described herein can be expressed in the form of a highly active protein using such system. Therefore, a glycoalkaloid compound can be produced with the addition of the substrate of the glycoalkaloid biosynthetic enzyme to a transformed yeast or insect cell culture liquid. For example, a hydroxylated cholesterol can be efficiently mass-produced by administering, as a substrate, a cholesterol to a transformed yeast culture liquid. It has been reported that yeast has a pathway of biosynthesis of DMAPP in cytosol (mevalonate pathway), and a precursor or substrate can be produced by introducing a mevalonate pathway into Escherichia coli ( The present disclosure provides a method for detecting the existence of a glycoalkaloid biosynthetic enzyme gene mutation, a polymorphism such as a single nucleotide polymorphism (SNP), or a gene expression mutation in a plant. A mutant may be obtained via radiation, chemical treatment, UV irradiation, or natural mutation. The above method comprises: a step of isolating genomic DNA or RNA from a mutant plant, a plant of a different variety or breeding line and carrying out reverse transcription for cDNA synthesis if RNA is isolated; a step of amplifying a gene fragment containing a glycoalkaloid biosynthetic enzyme gene from DNA using a DNA amplification technique; and a step of determining the existence of a mutation in the DNA. A commercially available kit (e.g., DNeasy or RNeasy (QIAGEN)) can be used in a method for extracting DNA or RNA. Also, a commercially available kit (e.g., a SuperScript First-Strand System (Invitrogen)) can be used for cDNA synthesis. For example, techniques such as the so-called PCR and LAMP techniques can be used as methods for amplifying a gene fragment using a DNA amplification technique. Such techniques are included in a group of techniques involving the use of a polymerase so as to amplify (i.e., to increase the number of copies of) a specific DNA sequence in a continuous polymerase reaction. Such reaction can be employed instead of cloning. In such case, nucleic acid sequence information is the only requirement for the reaction. In order to carry out DNA amplification, primers complementary to a DNA sequence to be amplified are designed. Then, the primers are produced via automatic DNA synthesis. DNA amplification methods are known in the art, and thus a person skilled in the art can readily carry out such a method based on teachings and instructions described herein. Some PCR methods (and related techniques) are described in, for example, In the step of determining the existence of a polymorphism or mutation in DNA, a detection method using homology between a mutant gene and a normal gene may be used. Examples of such method include the nucleotide sequence determination method (Applied Biosystems) and the TILLING method comprising detecting a mutant using an enzyme capable of cleaving one member of a mismatch pair ( In the step of determining a difference in the mRNA amount, the above cDNA is subjected to quantitative PCR which may be, for example, real-time PCR (with, for example, a LightCycler® (Roche Diagnostics)) with the use of primers produced based on the nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4 or the nucleotide sequence shown in SEQ ID NO: 19 or 21. Then, a difference in the mRNA amount can be determined based on a comparison of the obtained result and the cDNA amount derived from the variety, "Sassy" . In a particularly preferable embodiment, the above defined method for determining the existence of a mutation of a glycoalkaloid biosynthetic enzyme gene is applied to a material obtained from a potato (Solanum tuberosum), which is a solanaceous plant (Solanaceae). According to the above mutation and/or polymorphism determination method, a mutation or polymorphism of a gene encoding a glycoalkaloid biosynthetic enzyme can be identified at the nucleotide level. In addition, a plant in which a gene encoding a glycoalkaloid biosynthetic enzyme has a mutation and/or polymorphism can be selected. In addition, by determining a mutation or polymorphism or differences in the mRNA amount and by analysing a glycoalkaloid content described below, a plant in which the ability to express a gene encoding a glycoalkaloid biosynthetic enzyme or the activity of a glycoalkaloid biosynthetic enzyme has been altered can be selected. Here, " alteration of the ability to express a gene encoding a glycoalkaloid biosynthetic enzyme or the activity of a glycoalkaloid biosynthetic enzyme" refers to a modification of the ability to express a gene or glycoalkaloid biosynthetic enzyme activity caused by mutation such as artificial mutation, and an alteration in the ability to express a gene or glycoalkaloid biosynthetic enzyme activity due to the existence of a polymorphism. "Modification of the glycoalkaloid biosynthetic enzyme activity in a plant caused by mutation" refers to modification of such activity in an existing variety of a plant species of interest. Such existing varieties include wild-type varieties. However, even if a wild-type variety is a naturally occurring variety, it is not included among the existing varieties if it is not an existing industrially applicable variety. The existing varieties include all varieties that have been confirmed to exist when a plant in which the glycoalkaloid biosynthetic enzyme activity has been modified has been obtained. A variety produced by artificial manipulation such as hybridization or gene manipulation is also included. In addition, in the case of modification of the activity, alteration in the activity does not necessarily take place compared to all existing varieties. If the activity in a specific existing variety is modified, the modified variety can be included among " plants having modified glycoalkaloid biosynthetic enzyme activity. " Such "plants having modified glycoalkaloid biosynthetic enzyme activity" also include plants in which activity has been modified via spontaneous mutation without artificial manipulation. By the method disclosed herein, a plant in which activity has been altered spontaneously can be selected and established as a new variety. In addition, in a case in which an existing variety is subjected to mutagenesis treatment so as to produce a plant having modified glycoalkaloid biosynthetic enzyme activity, the plant compared with the produced plant may be an existing variety identical to the variety subjected to mutagenesis treatment. Alternatively, it may be a different existing variety. Further, it is also possible to obtain a novel plant variety in which the mutation in the gene is fixed and the ability to express a glycoalkaloid biosynthetic enzyme gene or glycoalkaloid biosynthetic enzyme activity has been modified. Such plants can be obtained by crossing plants selected from nature or produced by mutagenesis treatment, and having a mutation or polymorphism in the gene encoding a glycoalkaloid biosynthetic enzyme. If a plant is a potato (Solanum tuberosum), examples of existing varieties thereof include "Cynthia," "Sassy," "Cherie," "Irish Cobbler (i.e., Danshaku)," "May Queen," and "Sayaka (Norin registration number: Norin No. 36)." Here, "a plant in which the ability to express a gene encoding a glycoalkaloid biosynthetic enzyme or glycoalkaloid biosynthetic enzyme activity has been modified compared with an existing variety" refers to a plant in which the ability to express a gene encoding a glycoalkaloid biosynthetic enzyme has been enhanced or reduced compared with an existing variety. It further refers to a plant in which glycoalkaloid biosynthetic enzyme activity has increased or decreased compared with an existing variety. The present disclosure also relates to a plant in which the ability to express a gene encoding a glycoalkaloid biosynthetic enzyme or glycoalkaloid biosynthetic enzyme activity has been modified compared with an existing variety. A plant in which the activity of biosynthetic enzyme of a glycoalkaloid that is a toxic substance has decreased is particularly preferable. In such plant, the amount of a glycoalkaloid biosynthetic enzyme synthesized is low or a glycoalkaloid biosynthetic enzyme cannot be synthesized. Also, the glycoalkaloid biosynthetic enzyme content is low or a glycoalkaloid biosynthetic enzyme is absent in the plant. Alternatively, the glycoalkaloid biosynthetic enzyme activity is low or nonexistent in the plant. Accordingly, the plant has low glycoalkaloid content or lacks glycoalkaloids. For instance, if the plant is a potato, a glycoalkaloid such as chaconine or solanine is not synthesized, and thus the amount of a synthesized or existing glycoalkaloid such as chaconine or solanine in the potato tubers is low. In addition, if the plant is a tomato, a glycoalkaloid such as tomatine is not synthesized, and thus the amount of a synthesized or existing glycoalkaloid such as tomatine in tomato fruits is low. If the plant in which the glycoalkaloid biosynthetic enzyme activity is low or nonexistent is a potato, a glycoalkaloid such as chaconine or solanine is not synthesized in tubers, or the amount of a glycoalkaloid such as chaconine or solanine synthesized in tubers is lower than that in an existing variety described above. Also, in such a case, the content of a glycoalkaloid such as chaconine or solanine present in tubers may be low. Known glycoalkaloid content analysis methods and glycoalkaloid purification methods using liquid chromatography have been disclosed by, for example, Any column can be used as a column in the above method as long as it is an excellent alkali-resistant column. An example of an excellent alkali-resistant column that can be used is an ethylene-crosslinked column. Preferably, a column with the brand name of Xbridge (trademark) (Waters) is used. Particularly preferably, the Waters XBridge™ Shield RP18 (Waters) and the Waters XBridge™ C18 are used. According to the method of the present invention, the XBridge™ Shield RP18 column is advantageous in that the time required for treatment of a single sample is short. Meanwhile, the Waters XBridge™ C18 column is advantageous in that it has good durability. An alkaline buffer can be used as a mobile phase for liquid chromatography. Preferably, a volatile alkaline buffer is used. When a sample purified by liquid chromatography is subjected to mass spectrometry, it is convenient to use a volatile alkaline buffer as a mobile phase so as to prevent the alkaline buffer from remaining in the sample. Examples of a volatile alkaline buffer that can be used include triethylamine and ammonium hydrogen carbonate. However, ammonium hydrogen carbonate having excellent buffering effects is preferably used. The concentration of ammonium hydrogen carbonate used as a mobile phase is 5 to 20 mM, preferably 5 to 15 mM, and more preferably 10 mM. The pH of ammonium hydrogen carbonate can be adjusted to preferably pH 9.0 to 11.0 and more preferably the pH 10.0. If the pH of a mobile phase is adjusted to 10.0, the buffering performance of ammonium hydrogen carbonate can be further improved. GAs may be eluted into a mobile phase using an alkaline buffer and an organic solvent with an isocratic method or a gradient method. However, it is preferable to carry out elution with an isocratic method, which is convenient in terms of operation. Examples of an organic solvent that can be used for a mobile phase include, but are not limited to, methanol, ethanol, tetrahydrofuran (THF), and acetonitrile (MeCN). Preferably, MeCN is used. In an isocratic method, an alkaline buffer and an organic solvent, which are preferably an ammonium hydrogen carbonate solution and MeCN, are adequately used at a ratio of 30:70 to 70:30 and preferably 40:60 to 60:40 depending on the type of the GA of interest. For instance, if the GA of interest is α-solanine or α-chaconine, an alkaline buffer and an organic solvent, which are preferably an ammonium hydrogen carbonate solution and MeCN, are used at a ratio of 40:60. If the GA of interest is α-tomatine, an alkaline buffer and an organic solvent, which are preferably an ammonium hydrogen carbonate solution and MeCN, are used at a ratio of 60:40. Liquid chromatography can be carried out using a commercially available HPLC apparatus. Column equilibration and flow rate can be adequately determined depending on the column size or sample volume. Fractions obtained by liquid chromatography can be analyzed using mass spectrometry, a UV or multi-wavelength detector, or the like described below. Preferably, a plant-derived sample is pretreated as described below prior to liquid chromatography for crude purification. A plant-derived sample contains GAs and various polymers as foreign substances (e.g., starch, proteins, and cellulose). Thus, it is necessary to remove polymers contained as foreign substances in a sample and subject GAs to crude purification and washing in order to achieve efficient purification and high-precision analysis of GAs. As a method for removing polymers as foreign substances, a general method used by a person skilled in the art such as an alcohol precipitation method can be used. Ethanol or methanol can be used as alcohol. However, methanol is preferable. In such case, acid is added to alcohol so as to extract GAs in salt form with good efficiency. Examples of acids that can be used include, but are not limited to, acetic acid, hydrochloric acid, and formic acid. Preferably, formic acid is added. The amount of acid added to alcohol is adequately determined so that the GA of interest is not damaged. If formic acid is used, it is added to alcohol so as to result in a concentration of 0.1 % to 2% (v/v) and preferably 0.1% (v/v). If an acid other than formic acid is used, it can be added until the concentration thereof reaches the level equivalent to the above normality of added formic acid. In the case of a conventional sample preparation method (see After alcohol precipitation, the supernatant containing GAs is diluted with acid such as 0.1% to 2% (v/v) formic acid or acetic acid and preferably 0.1% (v/v) formic acid. The dilution is subjected to liquid chromatography under the above conditions. Fractions purified via liquid chromatography can be further subjected to mass spectrometry. In such case, mass spectrometry may be carried out by LC-MS, which is a technique that combines liquid chromatography with mass spectrometry. Mass spectrometry can be carried out by sector field mass spectrometry, double-focusing sector field mass spectrometry, quadrupole mass spectrometry, quadrupole ion trap mass spectrometry, time-of-flight mass spectrometry, ion-cyclotron mass spectrometry (Fourier transform mass spectrometry), or the like. Examples of a method for ionizing a sample for mass spectrometry that can be used include an EI (electron ionization) method, a CI (chemical ionization) method, a DEI (desorption electron ionization) method, a DCI (desorption chemical ionization) method, an FAB (fast atom bombardment) method, an FRIT-FAB (FRIT-fast atom bombardment) method, an ESI (electrospray ionization) method, and an MALDI (matrix-assisted laser desorption ionization) method. Mass spectrometry conditions are specifically described in the Examples. However, a person skilled in the art can adequately determine conditions depending on the type of GA used as an analyte. It is possible to analyze reference analytes of GAs using LC-MS to create a calibration curve according to a general method used by a person skilled in the art. β-D-glucosamine pentaacetate can be used as an internal reference substance for a potato-derived sample, particularly in an α-solanine or α-chaconine analysis system. However, it is preferable to use brassinolide having a steroid skeleton similar to that of α-solanine or α-chaconine. Meanwhile, a water-soluble amine is preferably used for a tomato-derived sample, particularly in an α-tomatine analysis system. Examples of a water-soluble amine that can be used as an internal reference substance include serinemethyl ester and alanine methyl ester. However, alanine methyl ester is particularly preferable because sufficient retention in a column is achieved. Therefore, the reliability of quantitative analysis can be significantly improved using brassinolide for a potato-derived sample and alanine methyl ester for a tomato-derived sample. According to the method of the present invention, a column with a size widely used for HPLC can be used. The conditions used herein can be directly applied to analysis using a UV or multi-wavelength detector. Examples mRNA was extracted from sprouts of a potato (Solanum tuberosum) variety, " Sassy" using RNeasy (QIAGEN). Total cDNA synthesis was carried out using a SuperScript First-Strand System (Invitrogen). It is said that aglycone of a glycoalkaloid is formed with cholesterol, but this has not been proved (Non-Patent Literature 1). However, assuming that the aglycone is formed with a cholesterol-related compound, there must be some steps of hydroxylation. In this case, at least three types of enzymes (i.e., cytochrome P450 monooxygenase, dioxygenase, and/or NADPH-flavin reductase) are probably involved in the steps of hydroxylation. Of these, cytochrome P450 monooxygenase was designated herein as a target. As a gene expressed in a potato, the TC135549 gene, for which many EST clones have been isolated from sprouts, was selected based on the information disclosed in Release 11.0 of the DFCI Potato Gene Index (http://compbio.dfci.harvard.edu/tgi/plant.html). PCR was performed based on the above sequence using primers (U841: GCTTGCTCTGTTCTTGTACATCTC (SEQ ID NO: 6); and U842: TGAAAAGCAGAATTAGCAGCA (SEQ ID NO: 7)) (PCR conditions: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 3 minutes; and 72°C for 10 minutes). The amplification product was subjected to cloning using a TOPOTA cloning kit for sequencing (Invitrogen). Further, the nucleotide sequence was determined using an AB1310 (Applied Biosystems). The sequence comprising the ORF region is shown in SEQ ID NO: 2 and the amino acid sequence of an enzyme encoded by the cDNA sequence is shown in SEQ ID NO: 1. The homologous gene of tomato used herein corresponds to TC192845 in the DFCI Tomato Gene Index as in the above case. The sequence comprising the ORF region is shown in SEQ ID NO: 4 and the amino acid sequence of an enzyme encoded by the cDNA sequence is shown in SEQ ID NO: 3. As a result of a comparison of the nucleotide sequences of these genes, homology therebetween was found to be 95% ( Genomic DNA was extracted from " Sassy " using RNeasy (QIAGEN). PCR was performed using the primers used in Example 1 for determination of the nucleotide sequence of the full-length genomic DNA (SEQ ID NO: 5). The DNA was found to contain four introns. The above gene was suppressed through transformation by a method comprising inducing expression of a gene fragment of a reverse complementary strand structured to be driven by a powerful promoter (which is generally referred to as an RNAi method for plants) ( The vector prepared in Example 3 was introduced into the Agrobacterium tumefaciens GV3110 strain by the electroporation method ( Transformation of a potato was carried out according to a conventional method ( In vitro stems of the 28 lines obtained in Example 4 were allowed to grow for one month after subculture. Two to four stems were collected to adjust the weight to approximately 100 mg. The glycoalkaloid content was determined by the method comprising liquid chromatography using an alkali-resistant reversed-phase chromatography column (which has been disclosed in Japanese Patent Application No. In vitro stems of the 28 individuals obtained in Example 4 were allowed to grow for one month after subculture. Two to four stems were collected to adjust the weight to approximately 100 mg. 80% MeOH aq. (990 µL) containing 0.1% formic acid and brassinolide (Brassino Co.,Ltd.) (10 µg/10 µL) used as an internal reference were added thereto, followed by disruption using a mixer mill (1/25 sec, 5 min, 4°C). The obtained disruptant was centrifuged (10,000 rpm, 5 min), followed by alcohol precipitation. Then, a portion of the supernatant (25 µL) was collected and adjusted to 500 µL with a 0.1 % formic acid solution. The thus obtained sample was subjected to LC-MS under the conditions described below. LCMS-2010EV (Shimadzu Corporation) was used as an LC-MS apparatus. An ethylene-crosslinked column (XBridge™ Shield RP18-5 (φ 2.1 x 150 mm, Waters)) having excellent alkali resistance was employed for the LC system. The following mobile phases were used at a ratio of A : B = 40:60 with the above sample solvent under isocratic conditions : mobile phase A: 10 mM ammonium hydrogen carbonate solution (pH 10); and mobile phase B: MeCN. Other conditions applied herein are described below. Flow rate: 0.2 mL/min Column oven: 40°C First, the MS spectrum for each component was confirmed via scan mode (see Other MS conditions used herein are described below.
α-solanine (Wako Pure Chemical Industries, Ltd.) (2 mg) and α-chaconine (Sigma-Aldrich) (2 mg) were separately dissolved in a 0.1% (v/v) formic acid solution (1 mL) (so as to obtain a 2 µg/µL solution for each product). Equivalent volumes of the two different solutions were mixed so as to prepare a solution containing α-solanine and α-chaconine at a concentration of 1 µg/µL (= 1000 ng/µL). The solution was diluted 10 times with a 0.1% (v/v) formic acid solution in a stepwise manner, followed by LC-MS. Thus, calibration curves were created. In addition, measurable limits of the both substances were obtained. Brassinolide (Brassino Co.,Ltd.) (1 mg) was dissolved in an MeOH solution (1 mL) (1 µg/µg). The resulting solution was diluted 10 times with 50% (v/v) aqueous MeOH in a stepwise manner, followed by LC-MS. Thus, a calibration curve was created. Meanwhile, good linearity was confirmed within the range of 2 to 200 ng for brassinolide (see Each sample prepared in 1 above (10 µL or 20 µL) was injected into an LC-MS system under the above conditions. The recovery rate of brassinolide used as an internal reference was found to be 50% to 110%. Correction was carried out based on the quantitative value of brassinolide, followed by quantitative determination of the amounts of α-solanine and α-chaconine in each sample based on the above calibration curves. The amounts of α-solanine and α-chaconine per 100 mg (FW) of each sample were calculated. The amounts of accumulated glycoalkaloids were found to be low with good reproducibility in 4 lines (#20, #35, #45, and #67) selected from among 28 lines. Therefore, as described above, in vitro stems of the 4 lines were disrupted in liquid nitrogen. A half portion of each disruptant was used for determination of the glycoalkaloid content. The other half portion thereof was subjected to mRNA extraction using RNeasy (QIAGEN). Total cDNA synthesis was carried out using a SuperScript First-Strand System (Invitrogen). The amounts of accumulated glycoalkaloids in individual of these lines were found to be remarkably lower than those in a non-transformant (2 individuals) ( Further, the epidermis of the center portion of each of three harvested tubers of each line was peeled to result in thicknesses of approximately 1 mm. Then, the glycoalkaloid content was analyzed in the above manner. As a result, surprisingly, it was confirmed that the glycoalkaloid content in tubers was extremely low, having a value that was lower than that determined in the same manner for "Sayaka," which is a variety known to have low glycoalkaloid content ( Tomato transformation was carried out according to a conventional method ( Leaves were collected from 10 individuals of an in vitro plant obtained by subjecting a potato variety ( "Sassy" ) to mutation treatment involving particle beam irradiation (an NIRS-HIMAC irradiation apparatus; a 0.1 Gy to 3 Gy argon ion beam (500 MeV/nucleon), a 0.2 Gy to 3 Gy neon ion beam (400 Mev/nucleon), or a 0.5 Gy to 5Gy carbon ion beam (290 MeV/nucleon)) (provided by Dr. Okamura (chief researcher), Kirin Agribio Company, Limited.). Then, genomic DNA was obtained using DNeasy. The structural gene of the genomic DNA was subjected to PCR (PCR conditions: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 5 minutes; and 72°C for 10 minutes) using primers (U841: GCTTGCTCTGTTCTTGTACATCTC (SEQ ID NO: 16); and U842: TGAAAAGCAGAATTAGCAGCA (SEQ ID NO: 17)). Thus, the gene region was obtained. In addition, cloning was carried out using a TOPOTA cloning kit for sequencing. Further, the nucleotide sequence was determined using ABI310. As a result, it was found that a line having a mutated gene was not included among 10 stocks provided herein. However, it is possible to obtain a plant having a mutated gene by repeatedly carrying out the above procedures using a plant subjected to sufficient mutation treatment. mRNA was extracted from sprouts of a potato (Solanum tuberosum) variety, " Sassy" using RNeasy (QIAGEN). Total cDNA synthesis was carried out using a SuperScript First-Strand System (Invitrogen). It is said that aglycone of a glycoalkaloid is formed with cholesterol, but this has not been proved (Non-Patent Literature 1). However, assuming that the aglycone is formed with a cholesterol-related compound, there must be some steps of hydroxylation. In this case, at least three types of enzymes (i.e., cytochrome P450 monooxygenase, dioxygenase, and NADPH-flavin reductase) are probably involved in the steps of hydroxylation. Of these, cytochrome P450 monooxygenase was designated herein as a target. As a gene expressed in a potato, the TC141445 gene, for which many EST clones have been isolated from sprouts, was selected based on the information disclosed in Release 11.0 of the DFCI Potato Gene Index (http://compbio.dfci.harvard.edu/tgi/plant.html). PCR was performed based on the above sequence using primers (U883: AGCAATCAAACATGGGTATTG (SEQ ID NO: 23); and U876: TGATGTGAACTTGAGATTGGTG (SEQ ID NO: 24)) (PCR conditions: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 3 minutes; and 72°C for 10 minutes). The amplification product was subjected to cloning using a TOPOTA cloning kit for sequencing (Invitrogen). Further, the nucleotide sequence was determined using an ABI310 (Applied Biosystems). The sequence comprising the ORF region is shown in SEQ ID NO: 19 and the amino acid sequence of an enzyme encoded by the cDNA sequence is shown in SEQ ID NO: 18. The homologous gene of tomato used herein corresponds to SGN-U567668 in the Lycopersicon Combined (Tomato) Unigenes in the sol genomics network (http://solgenomics.net/). The sequence comprising the ORF region is shown in SEQ ID NO: 21 and the amino acid sequence of an enzyme encoded by the cDNA sequence is shown in SEQ ID NO: 20. As a result of a comparison of the nucleotide sequences of these genes, homology therebetween was found to be 95% ( Genomic DNA was extracted from " Sassy " using RNeasy (QIAGEN). PCR was performed using the primers used in Example 1 for determination of the nucleotide sequence of the full-length genomic DNA (SEQ ID NO: 22). The DNA was found to contain four introns. The above gene was suppressed through transformation by a method comprising inducing expression of a gene fragment of a reverse complementary strand structured to be driven by a powerful promoter (which is generally referred to as an RNAi method for plants) ( The vector prepared in Example 10 was introduced into the Agrobacterium tumefaciens GV3110 strain by the electroporation method ( Transformation of a potato was carried out according to a conventional method ( Thirty one lines obtained in Example 11 were subjected to glycoalkaloid content measurement in the manner used in Example 5. The amounts of accumulated glycoalkaloids were found to be low with good reproducibility in 4 lines (#9, #28, #45, and #59) selected from among 31 lines. Therefore, as described above, in vitro stems of the 4 lines were disrupted in liquid nitrogen. A half portion of each disruptant was used for determination of the glycoalkaloid content. The other half portion thereof was subjected to mRNA extraction using RNeasy (QIAGEN). Total cDNA synthesis was carried out using a SuperScript First-Strand System (Invitrogen). The amounts of accumulated glycoalkaloids in individuals of these lines were found to be remarkably lower than those in a non-transformant (2 individuals) ( Further, the epidermis of the center portion of each of three harvested tubers of each line was peeled to result in thicknesses of approximately 1 mm. Then, the glycoalkaloid content was analyzed in the above manner. As a result, surprisingly, it was confirmed that the glycoalkaloid content in tubers was extremely low, having a value that was lower than that determined in the same manner for " Sayaka," which is a variety known to have low glycoalkaloid content ( Tomato transformation was carried out according to a conventional method ( Leaves were collected from 10 individuals of an in vitro plant obtained by subjecting a potato variety ( "Sassy" ) to mutation treatment involving particle beam irradiation (an NIRS-HIMAC irradiation apparatus; a 0.1 Gy to 3 Gy argon ion beam (500 MeV/nucleon), a 0.2 Gy to 3 Gy neon ion beam (400 Mev/nucleon), or a 0.5 Gy to 5Gy carbon ion beam (290 MeV/nucleon)) (provided by Dr. Okamura (chief researcher), Kirin Holdings Company, Limited.). Then, genomic DNA was obtained using DNeasy. The structural gene of the genomic DNA was subjected to PCR (PCR conditions: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 5 minutes; and 72°C for 10 minutes) using primers (U883: AGCAATCAAACATGGGTATTG (SEQ ID NO: 27); and U876: TGATGTGAACTTGAGATTGGTG (SEQ ID NO: 28)). Thus, the gene region was obtained. In addition, cloning was carried out using a TOPOTA cloning kit for sequencing. Further, the nucleotide sequence was determined using AB1310. As a result, it was found that a line having a mutated gene was not included among 10 stocks provided herein. However, it is possible to obtain a plant having a mutated gene by repeatedly carrying out the above procedures using a plant subjected to sufficient mutation treatment. The glycoalkaloid biosynthetic enzyme and the organism production/detection method using the gene of the present invention are useful for the development of production of glycoalkaloid compounds using organisms such as plants and selection of solanaceous plant varieties such as potatoes. Primers: SEQ ID NOS: 6 to 17 and 23 to 28
|