INFLUENZA M2 PROTEIN MUTANT VIRUSES AS LIVE INFLUENZA ATTENUATED VACCINES |
|||||||
申请号 | US15292595 | 申请日 | 2016-10-13 | 公开(公告)号 | US20170096645A1 | 公开(公告)日 | 2017-04-06 |
申请人 | Wisconsin Alumni Research Foundation (WARF); | 发明人 | Tokiko Watanabe; Yoshihiro Kawaoka; | ||||
摘要 | A method to prepare recombinant influenza viruses comprising a mutant M2 protein which has a deletion of two or more residues in the cytoplasmic tail and is attenuated in vivo, is provided, as well the resulting virus and vaccines with the virus. | ||||||
权利要求 | |||||||
说明书全文 | This application is a continuation of U.S. patent application Ser. No. 12/214,414, filed Jun. 18, 2008, which application claims the benefit of the filing date of U.S. application Ser. No. 60/944,680, filed on Jun. 18, 2007, the disclosures of which are incorporated by reference herein. This invention was made with government support under AI044386 awarded by the National Institutes of Health. The Government has certain rights in the invention. Generally, influenza vaccines have been prepared from live, attenuated virus or killed virus which can grow to high titers. Live virus vaccines activate all phases of the immune system and stimulate an immune response to each of the protective antigens, which obviates difficulties in the selective destruction of protective antigens that may occur during preparation of inactivated vaccines. In addition, the immunity produced by live virus vaccines is generally more durable, more effective, and more cross-reactive than that induced by inactivated vaccines. Further, live virus vaccines are less costly to produce than inactivated virus vaccines. However, the mutations in attenuated virus are often ill-defined. In 1997, a highly pathogenic avian influenza virus (H5N1 subtype) was transmitted from chickens to humans in Hong Kong, killing 6 of 18 people infected (Claas et al., 1998; Subbarao et al., 1998). The recent H5N1 outbreaks in poultry, which began in late 2003, affected more than 10 Asian countries, and viruses have now been isolated from wild birds and poultry in Asia. Europe, and Africa (Li et al., 2004; WHO, 2006). The continued circulation of H5N1 viruses in birds provides ample opportunity for them to infect humans. Indeed, human cases of H5N1 infections have been observed in several countries since late 2003, with a total of 321 confirmed cases and 194 fatalities as of 16 Aug. 2007, resulting in a fatality rate of approximately 60% (http.//www.who.int/csr/diseaseiavian intluenza/country/cases_table_2007_08 16/en/index.html). Concern over the pandemic potential of H5N1 viruses is thus clearly warranted. Although antiviral drugs, such as matrix protein 2 (M2) (adamantanes) and neuraminidase (NA) (oseltamivir and zanamivir) inhibitors, are currently available for prophylaxis and treatment of influenza virus infection, some of the H5N1 viruses isolated from humans are resistant to the adamantanes (Cheung et al., 2006; Hxushina et al., 2005; Puthavathana et al., 2005). In addition, some H5N1 viruses are resistant to oseltamivir (de Jung et al., 2005; Le et al., 2005). For the existing seasonal human influenza, both inactivated virus vaccine and live attenuated virus vaccine are available. In April 2007, the U.S. Food and Drug Administration (FDA) announced the first approval of an inactivated vaccine for humans against the H5N1 virus. However, the available data indicate that inactivated H5 influenza vaccines are suboptimal in their immunogenicity, and a large amount of hemagglutinin (HA) glycoprotein or coadministration of an adjuvant is required to achieve an adequate immune response (Bressen et al., 2006; Lin et al., 2006; Nicholson et al.; 2005; Stephenson et al., 2003; Treanor et al.; 2006). The wild-type influenza A virus M2 protein consists of three structural domains: a 24-amino-acid extracellular domain, a 19-amino-acid transmembrane domain, and a 54-amino-acid cytoplasmic tail domain (Lamb et al., 1985; Zebedee et al., 1985). The M2 transmembrane domain has ion channel activity, which functions at an early stage of the viral life cycle between the steps of virus penetration and uncoating (Helenius, 1992; Pinto et al., 1992). Recently, it was reported that the M2 cytoplasmic tail domain also has an important role in viral assembly and morphogenesis (lwatsuki-Horimoto et al., 2006; McCown et al., 2006; McCown et al., 2005). The invention provides an isolated recombinant influenza virus comprising a mutant M2 protein having a deletion of one or more residues of the cytoplasmic tail of M2, which virus replicates in vitro. e.g., producing titers that are substantially the same or at most 10, 100 or 1,000 fold less than a corresponding wild-type influenza virus, but is attenuated in vivo. In one embodiment, the deletion includes 2 or more residues and up to 21 residues of the cytoplasmic tail of M2. In one embodiment, the deletion of M2 includes 21 or more residues and up to 54 residues, i.e., the entire cytoplasmic tail, of the cytoplasmic tail of M2. In one embodiment of the invention, the mutant M2 protein may also comprise at least one amino acid substitution relative to a corresponding wild-type M2 protein. The substitution(s) in the M2 protein may be in the extracellular domain, the transmembrane (TM) domain, or the cytoplasmic domain, or any combination thereof. For example, substitutions in the TM domain may be at residues 25 to 43 of M2, e.g., positions 27, 30, 31, 34, 38, and/or 41 of the TM domain of M2. In another embodiment of the invention, the mutant M2 protein may also comprise a deletion in at least a portion of the extracellular domain and/or the TM domain, e.g., a deletion of residues 29 to 31, relative to a corresponding wild-type M2 protein. In yet another embodiment of the invention, the mutant M2 protein further comprises a heterologous protein, e.g., the cytoplasmic domain of a heterologous protein (a non-influenza viral protein), which may have a detectable phenotype, fused to the cytoplasmic tail or extracellular domain of M2, forming a chimeric protein. In one embodiment, a cytoplasmic domain of a heterologous protein is fused to the remaining residues of the cytoplasmic tail of the deleted M2 protein. In one embodiment, the presence of one or more substitutions, deletions, or insertions of heterologous sequences, or any combination thereof, does not substantially alter the properties of the recombinant influenza virus of the invention. e.g., the presence of one or more substitutions, deletions, or insertions of heterologous sequences does not result in virus titers in vitro that are more than about 1.5 to 2 logs lower, and/or does not result in virus that is substantially less attenuated in vivo, than the recombinant influenza virus of the invention comprising a mutant M2 protein having a deletion of one or more residues of the cytoplasmic tail of M2. As described hereinbelow, the feasibility of using M2 tail mutants as live attenuated vaccines against H5N1 virus was tested. First, a series of highly pathogenic H5N1 (A/Vietnam/1203/04 [VN1203]) M2 cytoplasmic tail deletion mutants, e.g., having a deletion of 5 or more residues of the cytoplasmic tail of M2, was generated and their growth properties in vitro and in vivo examined. Unexpectedly, two of the mutant M2 viruses replicated as efficiently as the wild-type virus in vitro, although their growth was attenuated in mice. For instance, one mutant, which contains an 11-amino-acid deletion from the C terminus (M2del11 virus), grew as well as the wild-type virus but replicated in mice less efficiently. The attenuated growth of these mutant M2 viruses in vivo, but not in vitro, indicates that these mutant viruses may be useful in the development of live influenza vaccines. As also described herein, a recombinant VN1203M2del11 virus was generated whose hemagglutinin (HA) gene was modified by replacing sequences at the cleavage site with those of an avirulent type of HA (M2del11-HAavir virus). M2dell 1-HAavir virus was highly attenuated as compared with M2del11 virus in mice. Moreover, M2del11-HAavir virus was able to induce strong serum and mucosal antibody response in the immunized mice, indicating that M2del11-HAavir virus is a potential candidate for a vaccine for H5N1 virus infection. Further, M2del11-HAavir virus protected mice against challenge with lethal doses of homologous (VN 1203; clade 1) and antigenically distinct heterologous (A/Indonesia/7/2005; clade 2) H5N1 viruses. Surprisingly, a low dose of the virus, e.g., a dose of 100 to 1,000 PFU, resulted in strong immunity relative to a mutant M2 virus with a deletion in the TM domain (the dose of the recombinant influenza virus of the invention was 100 to 1,000 fold lower). That suggests that M2 cytoplasmic tail mutants have potential as live attenuated vaccines against H5N1 influenza virus, as well as other influenza virus strains. In one embodiment, the live attenuated influenza virus of the invention elicits both systemic and mucosal immunity at the primary portal of infection. Thus, the invention provides a live, attenuated vaccine or immunogenic composition comprising the recombinant virus of the invention, and a method of using the vaccine or immunogenic composition to immunize a vertebrate, e.g., an avian or a mammal, or induce an immune response in a vertebrate, respectively. Also provided is a method of preparing a recombinant influenza virus comprising a mutant M2 protein having a deletion of one or more residues of the cytoplasmic tail of M2. The method comprises contacting a host cell with a plurality of influenza vectors, including a vector comprising the mutant M2 sequence, so as to yield recombinant virus. For example, the host cell is contacted with vectors for vRNA production including a vector comprising a promoter operably linked to an influenza virus PA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB1 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB2 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus HA DNA linked to a transcription termination sequence, a vector comprising promoter operably linked to an influenza virus NP DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus NA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus M DNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to an influenza virus NS DNA linked to a transcription termination sequence, wherein the M DNA comprises mutant M2 DNA for a M2 protein having at least one mutation that results in a deletion of one or more residues of the cytoplasmic tail of M2; and vectors for mRNA (protein) production including a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector comprising a promoter operably linked to a DNA segment encoding a M2 protein. e.g., a mutant M2 protein, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NS. In one embodiment, separate vectors for M1 and M2 vRNA, and/or for NS1 and NS2 vRNA, in place of vectors for M vRNA and/or NS vRNA, are provided and employed. In one embodiment, the promoter in a vRNA vector includes but is not limited to a RNA polymerase I (PolI) promoter, e.g., a human RNA PolI promoter, a RNA polymerase II (PolII) promoter, a RNA polymerase Ill promoter, a SP6 promoter, a T7 promoter, or a T3 promoter. In one embodiment, one or more vRNA vectors include a PolII promoter and ribozyme sequences 5′ to influenza virus sequences and the same or different ribozyme sequences 3′ to the influenza virus sequences. In one embodiment, the mutant M2 gene is in a vector and is operably linked to a promoter including, but not limited to, a RNA PolI promoter, e.g., a human RNA PolI promoter, a RNA PolII promoter, a RNA polymerase Ill promoter, a SP6 promoter, a T7 promoter, or a T3 promoter. In one embodiment, the vRNA vectors include a transcription termination sequence including, but not limited to, a PolI transcription termination sequence, a PolII transcription termination sequence, or a PolIII transcription termination sequence, or one or more ribozymes. In one embodiment, the host cell is not contacted with the NA vector, and the resulting virus is further attenuated. In one embodiment, the M vector has further attenuating mutations in the M2 sequence, e.g., one or more substitutions or deletions in the TM domain. In one embodiment, one or more vectors for vRNA production are on the same plasmid (see, e.g., U.S. published application No. 20060166321, the disclosure of which is incorporated by reference herein). In one embodiment, one or more vectors for mRNA production are on the same plasmid (see. e.g., U.S. published application No. 2006/0166321). In another embodiment, the method includes contacting a host cell with a vector having a PolI promoter linked to a PolI transcription termination sequence linked to an influenza virus PA DNA linked to a PolI promoter linked to a PolII transcription termination sequence (a bidirectional cassette), a vector having a PolII promoter linked to a PolI transcription termination sequence linked to an influenza virus PB1 DNA linked to a PolI promoter linked to a PolI transcription termination sequence, a vector having a PolII promoter linked to a PolI transcription termination sequence linked to an influenza virus PB2 DNA linked to a PolI promoter linked to a PolII transcription termination sequence, a vector having a PolII promoter linked to a PolI transcription termination sequence linked to an influenza virus HA DNA linked to a PolI promoter linked to a PolII transcription termination sequence, a vector having a PolII promoter linked to a PolI transcription termination sequence linked to an influenza virus NP DNA linked to a PolI promoter linked to a PolII transcription termination sequence, a vector having a PolI promoter linked to a PolI transcription termination sequence linked to an influenza virus NA DNA linked to a PolI promoter linked to a PolII transcription termination sequence, a vector having a PolIII promoter linked to a PolI transcription termination sequence linked to an influenza virus M DNA linked to a PolI promoter linked to PolI transcription termination sequence, and a vector having a PolII promoter linked to a PolI transcription termination sequence linked to an influenza virus NS DNA linked to a PolI promoter linked to PolI transcription termination sequence, wherein the M DNA comprises mutant M2 DNA for a M2 protein having at least one mutation that results in a deletion of one or more residues of the cytoplasmic tail of M2. Also provided is a method of preparing a recombinant influenza virus comprising a mutant M2 gene for a M2 protein having a deletion of one or more residues of the cytoplasmic tail. The method comprises contacting a host cell with a plurality of influenza vectors, including a vector comprising a PolI promoter operably linked to an influenza virus PA DNA linked to a PolI transcription termination sequence, a vector comprising a PolI promoter operably linked to an influenza virus PB1 DNA linked to a PolI transcription termination sequence, a vector comprising a PolI promoter operably linked to an influenza virus PB2 DNA linked to a PolI transcription termination sequence, a vector comprising a PolI promoter operably linked to an influenza virus HA DNA linked to a PolI transcription termination sequence, a vector comprising PolI promoter operably linked to an influenza virus NP DNA linked to a PolI transcription termination sequence, a vector comprising a PolI promoter operably linked to an influenza virus DNA NA linked to a PolI transcription termination sequence, a vector comprising a PolI promoter operably linked to an influenza virus M DNA linked to a PolI transcription termination sequence, and a vector comprising a PolI promoter operably linked to an influenza virus NS DNA linked to a PolI transcription termination sequence, wherein the sequence of the DNA for M comprises a M2 sequence for a mutant M2 having at least one mutation that results in a deletion of one or more residues in the cytoplasmic domain; and a vector comprising a PolII promoter operably linked to a DNA segment encoding influenza virus PA, a vector comprising a PolII promoter operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a PolII promoter operably linked to a DNA segment encoding influenza virus PB2, a vector comprising a PolII promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a PolII promoter operably linked to a DNA segment encoding influenza virus HA, a vector comprising a PolII promoter operably linked to a DNA segment encoding influenza virus NA, a vector comprising a PolII promoter operably linked to a DNA segment encoding influenza virus M and a vector comprising a PolII promoter operably linked to a DNA segment encoding influenza virus NS. In one embodiment, separate vectors for M1 and M2 vRNA, and/or for NS1 and NS2 vRNA, in place of vectors for M vRNA and/or NS vRNA, are provided and employed. In one embodiment, the PolI promoter is a human PolI promoter. In one embodiment, the PolI promoter for each PolI containing vector is the same. In one embodiment, the PolI promoter for each PolII containing vector is the same. In one embodiment, the PolI promoter for two or more, but not all, of the PolII containing vectors, is the same. In one embodiment, the PolII promoter for each PolII containing vector is different. In one embodiment, the deletion in the cytoplasmic domain of M2 includes 2, 3, 4, 5 or more, e.g., 11, 12, 13, 14, or 15 residues, but less than 22 residues, of the C-terminus of the cytoplasmic tail of M2. In one embodiment, the deletion is 2 up to 10 residues, including any integer in between. In one embodiment, the deletion is from 1 up to less than 8 residues, including any integer in between. In one embodiment, the deletion is from 5 up to 21 residues, including any integer in between. In one embodiment, the deletion is from 5 up to less than 28 residues, including any integer in between. In one embodiment, the deletion is from 9 up to 15 residues, including any integer in between. In one embodiment, the deletion is from 9 up to 23 residues, including any integer in between. In one embodiment, the deletion in the cytoplasmic domain of M2 includes 22, 23, 24, 25 or more, e.g., 41, 42, 43, 44, or 45 residues, but less than 54 residues, of the C-terminus of the cytoplasmic tail of M2. In one embodiment, the deletion is from 22 up to 35 residues, including any integer in between. In one embodiment, the deletion is from 29 up to 35 residues, including any integer in between. In one embodiment, the deletion is from 35 up to 45 residues, including any integer in between. In one embodiment, the deletion is from 9 to less than 28 residues, including any integer in between. The invention further provides a composition having one or more of the vectors described above, and a host cell contacted with such a composition, e.g., so as to yield infectious virus. The host cell may be contacted with each vector, or a subset of vectors, sequentially. One or more of the vectors may be on plasmids. The compositions and host cells of the invention may also include another vector for vRNA production or protein production that includes heterologous sequences, e.g., for a marker gene, or a therapeutic or prophylactic gene, e.g., an immunogen for a cancer associated antigen or for a pathogen such as a bacteria, a noninfluenza virus, fungus, or other pathogen. In one embodiment of the invention, the mutant M2 gene also encodes at least one amino acid substitution relative to the corresponding wild-type M2 protein. In one embodiment, fewer than 10%, e.g., 5% or fewer, of the residues are substituted. In one embodiment, at least one substitution is in the TM domain. In another embodiment, the mutant M2 has one or more substitutions in the extracellular domain. In yet another embodiment, the mutant M2 gene comprises a deletion of one or more residues in the TM domain. In one embodiment, the mutant M2 comprises a deletion of one or more residues, or an insertion of one or more residues, in the extracellular domain. In one embodiment, the recombinant virus of the invention includes one or more genes from influenza A virus. In another embodiment, the recombinant virus of the invention may include one or more genes from influenza B virus, e.g., an influenza B HA gene. In yet another embodiment, the recombinant virus of the invention may include one or more genes from influenza C virus. In one embodiment, the influenza DNA in a vector is a DNA with a native (naturally occurring) influenza virus sequence. In one embodiment, the influenza DNA is a DNA that has been manipulated in vitro, e.g., by inserting, deleting or substituting, or a combination thereof, one or more nucleotides in, for example, the coding region. The HA sequences in a recombinant virus of the invention may be any one of the sixteen influenza A HA sequences, a chimeric HA sequence or any non-native HA sequence. The NA sequences in a recombinant virus of the invention may be any one of the nine influenza A NA sequences, a chimeric NA sequence or any non-native NA sequence. In one embodiment, other attenuating mutations may be introduced to the vectors, e.g., a mutation in a HA cleavage site that results in a site that is not cleaved. As used herein, the terms “isolated and/or purified” refer to in vitro preparation, isolation and/or purification of a nucleic acid molecule such as a vector, plasmid of the invention or a virus of the invention, so that it is not associated with in vivo substances, or is substantially purified from in vitro substances. An isolated virus preparation is generally obtained by in vitro culture and propagation and is substantially free from other infectious agents. As used herein, “substantially free” means below the level of detection for a particular infectious agent using standard detection methods for that agent. A “recombinant” virus is one which has been manipulated in vitro, e.g., using recombinant DNA techniques, to introduce changes to the viral genome, or otherwise artificially generated. As used herein, the term “recombinant nucleic acid” or “recombinant DNA sequence or segment” refers to a nucleic acid, e.g., to DNA, that has been derived or isolated from a source, that may be subsequently chemically altered in vitro, so that its sequence is not naturally occurring, or corresponds to naturally occurring sequences that are not positioned as they would be positioned in the native genome. An example of DNA “derived” from a source, would be a DNA sequence that is identified as a useful fragment, and which is then chemically synthesized in essentially pure form. An example of such DNA “isolated” from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering. The life cycle of viruses generally involves attachment to cell surface receptors, entry into the cell and uncoating of the viral nucleic acid, followed by replication of the viral genes inside the cell. After the synthesis of new copies of viral proteins and genes, these components assemble into progeny virus particles, which then exit the cell (reviewed by Roizman and Palese, 1996). Different viral proteins play a role in each of these steps. The influenza A virus is an enveloped negative-strand virus with eight RNA segments encapsidated with nucleoprotein (NP) (reviewed by Lamb and Krug, 1996). The eight single-stranded negative-sense viral RNAs (vRNAs) encode a total of ten to eleven proteins. The influenza virus life cycle begins with binding of the hemagglutinin (HA) to sialic acid-containing receptors on the surface of the host cell, followed by receptor-mediated endocytosis. The low pH in late endosomes triggers a conformational shift in the HA, thereby exposing the N-terminus of the HA2 subunit (the so-called fusion peptide). The fusion peptide initiates the fusion of the viral and endosomal membrane, and the matrix protein (M1) and RNP complexes are released into the cytoplasm. RNPs consist of the nucleoprotein (NP), which encapsidates vRNA, and the viral polymerase complex, which is formed by the PA, PB1, and PB2 proteins. RNPs are transported into the nucleus, where transcription and replication take place. The RNA polymerase complex catalyzes three different reactions: synthesis of an mRNA with a 5′ cap and 3′ polyA structure, of a full-length complementary RNA (cRNA), and of genomic vRNA using the cDNA as a template. Newly synthesized vRNAs, NP, and polymerase proteins are then assembled into RNPs, exported from the nucleus, and transported to the plasma membrane, where budding of progeny virus particles occurs. The neuraminidase (NA) protein plays a crucial role late in infection by removing sialic acid from sialyloligosaccharides, thus releasing newly assembled virions from the cell surface and preventing the self aggregation of virus particles. Although virus assembly involves protein-protein and protein-vRNA interactions, the nature of these interactions is largely unknown. Although influenza B and C viruses are structurally and functionally similar to influenza A virus, there are some differences. For example, the M segment of influenza B virus encodes two proteins, M1 and BM2, through a termination-reinitiation scheme of tandem cistrons, and the NA segment encodes the NA and NB proteins from a bicistronic mRNA. Influenza C virus, which has 7 vRNA segments, relies on spliced transcripts to produce M protein; the product of the unspliced mRNA is proteolytically cleaved to yield the CM2 protein. In addition, influenza C virus encodes a HA-esterase (HEF) rather than individual HA and NA proteins. Spanning the viral membrane for influenza A virus are three proteins: hemagglutinin (HA), neuraminidase (NA), and M2. The extracellular domains (ectodomains) of HA and NA are quite variable, while the ectodomain domain of M2 is essentially invariant among influenza A viruses. The M2 protein which possesses ion channel activity (Pinto et al., 1992), is thought to function at an early state in the viral life cycle between host cell penetration and uncoating of viral RNA (Martin and Helenius, 1991; reviewed by Helenius, 1992; Sugrue et al., 1990). Once virions have undergone endocytosis, the virion-associated M2 ion channel, a homotetrameric helix bundle, is believed to permit protons to flow from the endosome into the virion interior to disrupt acid-labile M1 protein-ribonucleoprotein complex (RNP) interactions, thereby promoting RNP release into the cytoplasm (reviewed by Helenius, 1992). In addition, among some influenza strains whose HAs are cleaved intracellularly (e.g., A/fowl plagues/Rostock/34), the M2 ion channel is thought to raise the pH of the trans-Golgi network, preventing conformational changes in the HA due to conditions of low pH in this compartment (Hay et al., 1985; Ohuchi et al., 1994; Takeuchi and Lamb, 1994). Evidence that the M2 protein of influenza virus has ion channel activity was obtained by expressing the protein in oocytes of Xenopus laevis and measuring membrane currents (Pinto et al., 1992; Wang et al., 1993; Holsinger et al., 1994). Specific changes in the M2 protein transmembrane (TM) domain altered the kinetics and ion selectivity of the channel, providing strong evidence that the M2 TM domain constitutes the pore of the ion channel (Holsinger et al., 1994). In fact, the M2 TM domain itself can function as an ion channel (Duff and Ashley, 1992). M2 protein ion channel activity is thought to be essential in the life cycle of influenza viruses, because amantadine hydrochloride, which blocks M2 ion channel activity (Hay et al., 1993), inhibits viral replication (Kato and Eggers. 1969; Skehel et al., 1978). The invention provides recombinant influenza viruses useful in vivo. In one embodiment, the invention provides an isolated recombinant influenza virus comprising a mutant M2 protein which has a deletion of at least one residue, e.g., 2 or more residues, of the C-terminus of the cytoplasmic tail, wherein the replication of the virus in vitro is not substantially altered but the recombinant virus is attenuated in vivo relative to a corresponding virus without the deletion. In one embodiment, the deletion is at least 3 but no more than 20 residues of the C-terminus of the cytoplasmic tail. In one embodiment, the deletion is at least 5 but no more than 20 residues of the C-terminus of the cytoplasmic tail. In another embodiment, the deletion is at least 2 but less than 8 residues of the C-terminus of the cytoplasmic tail. In yet another embodiment, the deletion is at least 10 but no more than 25 residues of the C-terminus of the cytoplasmic tail. In another embodiment, the deletion is at least 10 but no more than 20 residues of the C-terminus of the cytoplasmic tail. In a further embodiment, the deletion is at least 9 but less than 25 residues of the C-terminus of the cytoplasmic tail. The isolated virus may further include another attenuating mutation in addition to the deleted M2 protein. In one embodiment, the mutant M2 protein further comprises a heterologous protein at the C-terminus. In one embodiment, the mutant M2 protein further comprises at least one amino acid substitution, e.g., in the transmembrane domain of the M2 protein. In one embodiment, the mutant M2 protein further comprises a deletion in the transmembrane domain, e.g., a deletion that includes residues 29 to 31. In one embodiment, the recombinant virus comprises influenza A HA, for instance, H5 HA. In one embodiment, the HA is not H3 HA. Also provided is a method of preparing a recombinant influenza virus comprising a mutant M2 protein. The method includes contacting a host cell with a plurality of influenza vectors so as to yield recombinant influenza virus. The plurality of vectors includes: vectors for vRNA production including a vector comprising a promoter operably linked to an influenza virus PA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB1 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB2 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus HA DNA linked to a transcription termination sequence, a vector comprising promoter operably linked to an influenza virus NP DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus NA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus M DNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to an influenza virus NS DNA linked to a transcription termination sequence, wherein the M DNA comprises mutant M2 DNA having at least one mutation that results in a deletion of one or more residues of the cytoplasmic domain; and b) vectors for protein production including a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector comprising a promoter operably linked to a DNA segment encoding an ion channel protein, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NS. Virus which replicates in vitro but is attenuated in vivo is isolated from the host cells. In one embodiment, the vector for vRNA production of HA comprises H5 DNA, e.g., one with a mutant cleavage site associated with reduced virulence. In one embodiment, the promoter in the vectors for vRNA production is a PolI promoter. In one embodiment, the vector for vRNA production of HA comprises influenza A HA DNA. Further provided are compositions with one or more vectors of the invention. In one embodiment, a composition includes a plurality of influenza vectors, for instance, vectors for vRNA production including a vector comprising a promoter operably linked to an influenza virus PA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB1 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus PB2 DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus HA DNA linked to a transcription termination sequence, a vector comprising promoter operably linked to an influenza virus NP DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus NA DNA linked to a transcription termination sequence, a vector comprising a promoter operably linked to an influenza virus M DNA linked to a transcription termination sequence, and a vector comprising a promoter operably linked to an influenza virus NS DNA linked to a transcription termination sequence, wherein the M DNA comprises mutant M2 DNA having at least one mutation the results in a deletion of one or more residues of the cytoplasmic tail of M2: and vectors for mRNA production including a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB1, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus PB2, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NP, and optionally a vector comprising a promoter operably linked to a DNA segment encoding influenza virus HA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NA, a vector comprising a promoter operably linked to a DNA segment encoding influenza virus M1, a vector comprising a promoter operably linked to a DNA segment encoding an ion channel protein, and a vector comprising a promoter operably linked to a DNA segment encoding influenza virus NS. In one embodiment, the composition further includes a vector comprising a promoter operably linked to a heterologous DNA sequence of interest, e.g., wherein the vector comprises a DNA sequence for an immunogenic polypeptide or peptide of a pathogen or wherein the vector comprises a DNA sequence for a therapeutic protein. In one embodiment, two or more of the vectors for vRNA production are on the same plasmid. In one embodiment, two or more of the vectors for mRNA production are on the same plasmid. A vaccine of the invention may comprise immunogenic proteins including glycoproteins of any pathogen, e.g., an immunogenic protein from one or more bacteria, viruses, yeast or fungi. Thus, in one embodiment, the influenza viruses of the invention may be vaccine vectors for influenza virus or other viral pathogens including but not limited to lentiviruses such as HIV, hepatitis B virus, hepatitis C virus, herpes viruses such as CMV or HSV or foot and mouth disease virus. A complete virion vaccine is concentrated by ultrafiltration and then purified by zonal centrifugation or by chromatography. It is inactivated before or after purification using formalin or beta-propiolactone, for instance. A subunit vaccine comprises purified glycoproteins. Such a vaccine may be prepared as follows: using viral suspensions fragmented by treatment with detergent, the surface antigens are purified, by ultracentrifugation for example. The subunit vaccines thus contain mainly HA protein, and also NA. The detergent used may be cationic detergent for example, such as hexadecyl trimethyl ammonium bromide (Bachmever, 1975), an anionic detergent such as ammonium deoxycholate (Laver & Webster, 1976; Webster et al., 1977); or a nonionic detergent such as that commercialized under the name TRITON X100. The hemagglutinin may also be isolated after treatment of the virions with a protease such as bromelin, then purified by a method such as that described by Grand and Skehel (1972). A split vaccine comprises virions which have been subjected to treatment with agents that dissolve lipids. A split vaccine can be prepared as follows: an aqueous suspension of the purified virus obtained as above, inactivated or not, is treated, under stirring, by lipid solvents such as ethyl ether or chloroform, associated with detergents. The dissolution of the viral envelope lipids results in fragmentation of the viral particles. The aqueous phase is recuperated containing the split vaccine, constituted mainly of hemagglutinin and neuraminidase with their original lipid environment removed, and the core or its degradation products. Then the residual infectious particles are inactivated if this has not already been done. Inactivated Vaccines. Inactivated influenza virus vaccines of the invention are provided by inactivating replicated virus of the invention using known methods, such as, but not limited to, formalin or 3-propiolactone treatment. Inactivated vaccine types that can be used in the invention can include whole-virus (WV) vaccines or subvirion (SV) (split) vaccines. The WV vaccine contains intact, inactivated virus, while the SV vaccine contains purified virus disrupted with detergents that solubilize the lipid-containing viral envelope, followed by chemical inactivation of residual virus. In addition, vaccines that can be used include those containing the isolated HA and NA surface proteins, which are referred to as surface antigen or subunit vaccines. In general, the responses to SV and surface antigen (i.e., purified HA or NA) vaccines are similar. An experimental inactivated WV vaccine containing an NA antigen immunologically related to the epidemic virus and an unrelated HA appears to be less effective than conventional vaccines (Ogra et al., 1977). Inactivated vaccines containing both relevant surface antigens are preferred. Live Attenuated Virus Vaccines. Live, attenuated influenza virus vaccines, can also be used for preventing or treating influenza virus infection, according to known method steps. Attenuation is preferably achieved in a single step by transfer of attenuated genes from an attenuated donor virus to a replicated isolate or reassorted virus according to known methods (see, e.g., Murphy, 1993). Since resistance to influenza A virus is mediated by the development of an immune response to the HA and NA glycoproteins, the genes coding for these surface antigens must come from the circulating wild-type strains. The attenuated genes are derived from the attenuated parent. In this approach, genes that confer attenuation preferably do not code for the HA and NA glycoproteins. Otherwise, these genes could not be transferred to reassortants bearing the surface antigens of the clinical virus isolate. Many donor viruses have been evaluated for their ability to reproducibly attenuate influenza viruses. As a non-limiting example, the A/Ann Arbor(AA)/6/60 (H2N2) cold adapted (ca) donor virus can be used for attenuated vaccine production (see, e.g., Edwards, 1994; Murphy, 1993). Reassortant progeny are then selected at 25° C. (restrictive for replication of virulent virus), in the presence of an H2N2 antiserum, which inhibits replication of the viruses bearing the surface antigens of the attenuated A/AA/6/60 (H2N2) ca donor virus. A large series of H1N1 and H3N2 reassortants have been evaluated in humans and found to be satisfactorily: (a) infectious, (b) attenuated for seronegative children and immunologically primed adults, (c) immunogenic and (d) genetically stable. The immunogenicity of the ca reassortants parallels their level of replication. Thus, the acquisition of the six transferable genes of the ca donor virus by new wild-type viruses has reproducibly attenuated these viruses for use in vaccinating susceptible adults and children. Other attenuating mutations can be introduced into influenza virus genes by site-directed mutagenesis to rescue infectious viruses bearing these mutant genes. Attenuating mutations can be introduced into non-coding regions of the genome, as well as into coding regions. Such attenuating mutations can also be introduced, for example, into the PB2 polymerase gene (Subbarao et al., 1993) or the NS gene. Thus, new donor viruses can also be generated bearing attenuating mutations introduced by site-directed mutagenesis, and such new donor viruses can be used in the production of live attenuated reassortant H1N1 and H3N2 vaccine candidates in a manner analogous to that described above for the A/AA/6/60 ca donor virus. It is preferred that such attenuated viruses maintain the genes from the virus that encode antigenic determinants substantially similar to those of the original clinical isolates. This is because the purpose of the attenuated vaccine is to provide substantially the same antigenicity as the original clinical isolate of the virus, while at the same time lacking infectivity to the degree that the vaccine causes minimal change of inducing a serious pathogenic condition in the vaccinated mammal. The virus can thus be attenuated or inactivated, formulated and administered, according to known methods, as a vaccine to induce an immune response in an animal. e.g., a mammal. Methods are well-known in the art for determining whether such attenuated or inactivated vaccines have maintained similar antigenicity to that of the clinical isolate or high growth strain derived therefrom. Such known methods include the use of antisera or antibodies to eliminate viruses expressing antigenic determinants of the donor virus; chemical selection (e.g., amantadine or rimantidine); HA and NA activity and inhibition; and DNA screening (such as probe hybridization or PCR) to confirm that donor genes encoding the antigenic determinants (e.g., HA or NA genes) are not present in the attenuated viruses. See, e.g., Robertson et al., 1988; Kilboume, 1969; Aymard-Henry et al., 1985; Robertson et al., 1992. Pharmaceutical compositions of the present invention, suitable for inoculation or for parenteral or oral administration, comprise attenuated or inactivated influenza viruses, optionally further comprising sterile aqueous or non-aqueous solutions, suspensions, and emulsions. The compositions can further comprise auxiliary agents or excipients, as known in the art. See, e.g., Berkow et al., 1987; Avery's Drug Treatment. 1987; Osol, 1980. The composition of the invention is generally presented in the form of individual doses (unit doses). Conventional vaccines generally contain about 0.1 to 200 μg, preferably 10 to 15 μg, of hemagglutinin from each of the strains entering into their composition. The vaccine forming the main constituent of the vaccine composition of the invention may comprise a virus of type A, B or C, or any combination thereof, for example, at least two of the three types, at least two of different subtypes, at least two of the same type, at least two of the same subtype, or a different isolate(s) or reassortant(s). Human influenza virus type A includes H1N1, H2N2 and H3N2 subtypes. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and/or emulsions, which may contain auxiliary agents or excipients known in the art. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption. Liquid dosage forms for oral administration may generally comprise a liposome solution containing the liquid dosage form. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water. Besides the inert diluents, such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents. See, e.g., Berkow et al., 1992; Avery's, 1987; and Osol, 1980. When a composition of the present invention is used for administration to an individual, it can further comprise salts, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition. For vaccines, adjuvants, substances which can augment a specific immune response, can be used. Normally, the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the organism being immunized. Examples of materials suitable for use in vaccine compositions are provided in Osol (1980). Heterogeneity in a vaccine may be provided by mixing replicated influenza viruses for at least two influenza virus strains, such as 2-50 strains or any range or value therein. Influenza A or B virus strains having a modern antigenic composition are preferred. According to the present invention, vaccines can be provided for variations in a single strain of an influenza virus, using techniques known in the art. A pharmaceutical composition according to the present invention may further or additionally comprise at least one chemotherapeutic compound, for example, for gene therapy, immunosuppressants, anti-inflammatory agents or immune enhancers, and for vaccines, chemotherapeutics including, but not limited to, gamma globulin, amantadine, guanidine, hydroxybenzimidazole, interferon-α, interferon-β, interferon-γ, tumor necrosis factor-alpha, thiosemicarbarzones, methisazone, rifampin, ribavirin, a pyrimidine analog, a purine analog, foscamet, phosphonoacetic acid, acyclovir, dideoxynucleosides, a protease inhibitor, or ganciclovir. The composition can also contain variable but small quantities of endotoxin-free formaldehyde, and preservatives, which have been found safe and not contributing to undesirable effects in the organism to which the composition is administered. The administration of the composition (or the antisera that it elicits) may be for either a “prophylactic” or “therapeutic” purpose. When provided prophylactically, the compositions of the invention which are vaccines, are provided before any symptom of a pathogen infection becomes manifest. The prophylactic administration of the composition serves to prevent or attenuate any subsequent infection. When provided prophylactically, the gene therapy compositions of the invention, are provided before any symptom of a disease becomes manifest. The prophylactic administration of the composition serves to prevent or attenuate one or more symptoms associated with the disease. When provided therapeutically, an attenuated or inactivated viral vaccine is provided upon the detection of a symptom of actual infection. The therapeutic administration of the compound(s) serves to attenuate any actual infection. See. e.g., Berkow et al., 1992; and Avery, 1987. When provided therapeutically, a gene therapy composition is provided upon the detection of a symptom or indication of the disease. The therapeutic administration of the compound(s) serves to attenuate a symptom or indication of that disease. Thus, an attenuated or inactivated vaccine composition of the present invention may thus be provided either before the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection. Similarly, for gene therapy, the composition may be provided before any symptom of a disorder or disease is manifested or after one or more symptoms are detected. A composition is said to be “pharmacologically acceptable” if its administration can be tolerated by a recipient patient. Such an agent is said to be administered in a “therapeutically effective amount” if the amount administered is physiologically significant. A composition of the present invention is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient, e.g., enhances at least one primary or secondary humoral or cellular immune response against at least one strain of an infectious influenza virus. The “protection” provided need not be absolute, i.e., the influenza infection need not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population or set of patients. Protection may be limited to mitigating the severity or rapidity of onset of symptoms of the influenza virus infection. A composition of the present invention may confer resistance to one or more pathogens, e.g., one or more influenza virus strains, by either passive immunization or active immunization. In active immunization, an inactivated or attenuated live vaccine composition is administered prophylactically to a host (e.g., a mammal), and the host's immune response to the administration protects against infection and/or disease. For passive immunization, the elicited antisera can be recovered and administered to a recipient suspected of having an infection caused by at least one influenza virus strain. A gene therapy composition of the present invention may yield prophylactic or therapeutic levels of the desired gene product by active immunization. In one embodiment, the vaccine is provided to a mammalian female (at or prior to pregnancy or parturition), under conditions of time and amount sufficient to cause the production of an immune response which serves to protect both the female and the fetus or newborn (via passive incorporation of the antibodies across the placenta or in the mother's milk). The present invention thus includes methods for preventing or attenuating a disorder or disease, e.g., an infection by at least one strain of pathogen. As used herein, a vaccine is said to prevent or attenuate a disease if its administration results either in the total or partial attenuation (i.e., suppression) of a symptom or condition of the disease, or in the total or partial immunity of the individual to the disease. As used herein, a gene therapy composition is said to prevent or attenuate a disease if its administration results either in the total or partial attenuation (i.e., suppression) of a symptom or condition of the disease, or in the total or partial immunity of the individual to the disease. At least one inactivated or attenuated influenza virus, or composition thereof, of the present invention may be administered by any means that achieve the intended purposes, using a pharmaceutical composition as previously described. For example, administration of such a composition may be by various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, oral or transdermal routes. Parenteral administration can be by bolus injection or by gradual perfusion over time. A preferred mode of using a pharmaceutical composition of the present invention is by intramuscular or subcutaneous application. See, e.g., Berkow et al., 1992; and Avery, 1987. A typical regimen for preventing, suppressing, or treating an influenza virus related pathology, comprises administration of an effective amount of a vaccine composition as described herein, administered as a single treatment, or repeated as enhancing or booster dosages, over a period up to and including between one week and about 24 months, or any range or value therein. According to the present invention, an “effective amount” of a composition is one that is sufficient to achieve a desired biological effect. It is understood that the effective dosage will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect wanted. The ranges of effective doses provided below are not intended to limit the invention and represent preferred dose ranges. However, the most preferred dosage will be tailored to the individual subject, as is understood and determinable by one of skill in the art. See, e.g., Berkow et al., 1992; Avery's, 1987; and Ebadi, 1985. The dosage of an attenuated virus vaccine for a mammalian (e.g., human) or avian adult organism can be from about 103-107 plaque forming units (PFU)/kg, or any range or value therein. The dose of inactivated vaccine can range from about 0.1 to 200, e.g., 50 μg of hemagglutinin protein. However, the dosage should be a safe and effective amount as determined by conventional methods, using existing vaccines as a starting point. The dosage of immunoreactive HA in each dose of replicated virus vaccine can be standardized to contain a suitable amount, e.g., 1-50 μg or any range or value therein, or the amount recommended by the U.S. Public Heath Service (PHS), which is usually 15 μg, per component for older children □3 years of age, and 7.5 μg per component for older children <3 years of age. The quantity of NA can also be standardized, however, this glycoprotein can be labile during the processor purification and storage. Each 0.5-ml dose of vaccine preferably contains approximately 1-50 billion virus particles, and preferably 10 billion particles. The invention will be further described by the following non-limiting examples. Cells and Viruses. 293T human embryonic kidney cells and Madin-Darby canine kidney cells (MDCK) were maintained in Dulbecco=s modified Eagle medium (DMEM) supplemented with 10% fetal calf serum and in modified Eagle=s medium (MEM) containing 5% newborn calf serum, respectively. All cells were maintained at 37° C. in 5% CO2. Influenza viruses A/WSN/33 (H1N1) and A/PR/8/34 (H1N1) were propagated in 10-day-old eggs. Construction of Plasmids. To generate RNA polymerase I constructs, cloned cDNAs derived from A/WSN/33 or APR/8/34 viral RNA were introduced between the promoter and terminator sequences of RNA polymerase I. Briefly, the cloned cDNAs were amplified by PCR with primers containing BsmBI sites, digested with BsmBI, and cloned into the BsmBI sites of the pHH21 vector which contains the human RNA polymerase I promoter and the mouse RNA polymerase I terminator, separated by BsmBI sites ( Generation of Infectious Influenza Particles. 293T cells (1 H 106) were transfected with a maximum of 17 plasmids in different amounts with use of Trans IT LT-1 (Panvera. Madison, Wis.) according to the manufacturers instructions. Briefly, DNA and transfection reagent were mixed (2 μl Trans IT-LT-1 per μg of DNA), incubated at room temperature for 45 minutes and added to the cells. Six hours later, the DNA-transfection reagent mixture was replaced by Opti-MEM (Gibco/BRL, Gaithersburg, Md.) containing 0.3% bovine serum albumin and 0.01% fetal calf serum. At different times after transfection, viruses were harvested from the supernatant and titrated on MDCK cells. Since helper virus was not required by this procedure, the recovered transfectant viruses were analyzed without plaque purification. Determination of the Percentage of Plasmid-Transfected Cells Producing Viruses. Twenty-four hours after transfection, 293T cells were dispersed with 0.02% EDTA into single cells. The cell suspension was then diluted 10-fold and transferred to confluent monolayers of MDCK cells in 24-well plates. Viruses were detected by the hemagglutination assay. Immunostaining Assay. Nine hours after infection with influenza virus, cells were washed twice with phosphate-buffered saline (PBS) and fixed with 3.7% paraformaldehyde (in PBS) for 20 minutes at room temperature. Next, they were treated with 0.1% Triton X-100 and processed as described by Neumann et al. (1997). Generation of Infectious Virus by Plasmid-Driven Expression of Viral RNA Segments, Three Polymerase Subunits and NP Protein. Although transfection of cells with a mixture of RNPs extracted from purified virions results in infectious influenza particles, this strategy is not likely to be efficient when used with eight different in vitro generated RNPs. To produce infectious influenza viruses entirely from cDNAs, eight viral RNPs were generated in vivo. Thus, plasmids were prepared that contain cDNAs for the full-length viral RNAs of the A/WSN/33 virus, flanked by the human RNA polymerase I promoter and the mouse RNA polymerase I terminator. In principle, transfection of these eight plasmids into eukaryotic cells should result in the synthesis of all eight influenza vRNAs. The PB2, PB1, PA and NP proteins, generated by cotransfection of protein expression plasmids, should then assemble the vRNAs into functional vRNPs that are replicated and transcribed, ultimately forming infectious influenza viruses ( Efficiency of Influenza Virus Production with Coexpression of all Viral Structural Proteins. Although expression of the viral NP and polymerase proteins is sufficient for the plasmid-driven generation of influenza viruses, it was possible that the efficiency could be improved. In previous studies, the expression of all influenza virus structural proteins (PB2, PB1, PA, HA, NP, NA, M1, M2, and NS2) resulted in VLPs that contained an artificial vRNA encoding a reporter chloramphenicol-acetyltransferase gene (Mena et al., 1996). Thus, the availability of the entire complement of structural proteins, instead of only those required for viral RNA replication and transcription, might improve the efficiency of virus production. To this end, 293T cells were transfected with optimal amounts of viral protein expression plasmids (as judged by VLP production; unpublished data): 1 μg of pcDNA762(PB2) and pcDNA774(PB1); 0.1 μg of pcDNA787(PA); 1 μg of pEWSN-HA, pCAGGS-WSN-NP0/14, and pCAGGS-WNA15; 2 μg of pCAGGS-WSN-M1-2/1; 0.3 μg of pCA-NS2; and 0.03 μg of pEP24c (for M2), together with 1 μg of each RNA polymerase I plasmid (Experiment 2, Table 1). A second set of cells was transfected with the same set of RNA polymerase I plasmids, with the exception of the PB1 gene, for which pPolI-PR8/34-PB1 was substituted in an effort to generate a reassortant virus, together with plasmids expressing only PA, PB1, PB2, and NP (Experiment 3, Table 1) or those expressing all the influenza structural proteins (Experiment 4, Table 1). Yields of WSN virus did not appreciably differ at 24 hours (Experiments 1 and 2, Table 1) or at 36 hours (data not shown) post-transfection. However, more than a 10-fold increase in yields of the virus with PR/8/34-PB1 was found when all the influenza viral structural proteins were provided (Experiments 3 and 4, Table 1). Negative controls, which lacked one of the plasmids for the expression of PA, PB1, PB2, of NP proteins, did not yield any virus (Experiments 5-8, Table 1). Thus, depending on the virus generated, expression of all influenza A virus structural proteins appreciably improved the efficiency of the reverse genetics method. Next, the kinetics of virus production after transfection of cells was determined using the set of plasmids used to generate a virus with the A/PR/8/34-PB1 gene. In two of three experiments, virus was first detected at 24 hours after transfection. The titer measured at that time, >103 pfu/ml, had increased to >106 pfu/ml by 48 hours after transfection (Table 2). To estimate the percentage of plasmid-transfected cells that were producing viruses, 293T cells were treated with EDTA (0.02%) at 24 hours after transfection to disperse the cells, and then performed limiting dilution studies. In this experiment, no free virus was found in the culture supernatant at this time point. The results indicated that 1 in 103.3 cells was generating infectious virus particles. Recovery of Influenza Virus Containing the FLAG Epitope in the NA Protein. To verify that the new reverse genetics system allowed the introduction of mutations into the genome of influenza A viruses, a virus containing a FLAG epitope (Castrucci et al., 1992) in the NA protein was generated. 293T cells were transfected with an RNA polymerase I plasmid (pPolI-WSN-NA/FL79) that contained a cDNA encoding both the NA protein and a FLAG epitope at the bottom of the protein=s head, together with the required RNA polymerase I and protein expression plasmids. To confirm that the recovered virus (PR8-WSN-FL79) did in fact express the NA-FLAG protein, immunostaining assays of cells infected with PR8-WSN-FL79 or A/WSN/33 wild-type virus was performed. A monoclonal antibody to the FLAG epitope detected cells infected with PR8-WSN-FL79, but not those infected with wild-type virus ( Generation of Infectious Influenza Virus Containing Mutations in the PA Gene. To produce viruses possessing mutations in the PA gene, two silent mutations were introduced creating new recognition sequences for restriction endonucleases (Bsp120I at position 846 and PvuII at position 1284 of the mRNA). Previously, it was not possible to modify this gene by reverse genetics, because of the lack of a reliable selection system. Transfectant viruses, PA-T846C and PA-A1284 were recovered. The recovered transfectant viruses were biologically cloned by two consecutive limiting dilutions. To verify that the recovered viruses were indeed transfectants with mutations in the PA gene, cDNA for the PA gene was obtained by reverse transcriptase-PCR. As shown in The reverse genetics systems described herein allows one to efficiently produce influenza A viruses entirely from cloned cDNAs. Bridgen and Elliott (1996) also used reverse genetics to generate a Bunyamwera virus (Bunvaviridae family), but it contains only three segments of negative-sense RNA, and the efficiency of its production was low, 102 pfu/106 cells. Although the virus yields differed among the experiments, consistently >10 pfu/106 cells was observed for influenza virus, which contains eight segments. There are several explanations for the high efficiency of the reverse genetics system described hereinabove. Instead of producing RNPs in vitro (Luytjes et al., 1989), RNPs were generated in vive through intracellular synthesis of vRNAs using RNA polymerase I and through plasmid-driven expression of the viral polymerase proteins and NP. Also, the use of 293T cells, which are readily transfected with plasmids (Goto et al., 1997), ensured that a large population of cells received all of the plasmids needed for virus production. In addition, the large number of transcripts produced by RNA polymerase I, which is among the most abundantly expressed enzymes in growing cells, likely contributed to the overall efficiency of the system. These features led to a correspondingly abundant number of vRNA transcripts and adequate amounts of viral protein for encapsidation of vRNA, formation of RNPs in the nucleus, and export of these complexes to the cell membrane, where new viruses are assembled and released. Previously established reverse genetics systems (Enami et al., 1990; Neumann et al., 1994; Luytjes et al., 1989; Pleschka et al., 1996) require helper-virus infection and therefore selection methods that permit a small number of transfectants to be retrieved from a vast number of helper viruses. Such strategies have been employed to generate influenza viruses that possess one of the following cDNA-derived genes: PB2 (Subbarao et al., 1993), HA (Enami et al., 1991; Horimoto et al., 1994). NP (Li et al., 1995), NA (Enami et al., 1990), M (Castrucci et al., 1995; Yasuda et al., 1994), and NS (Enami et al., 1991). Most of the selection methods, except for those applicable to the HA and NA genes, rely on growth temperature, host range restriction, or drug sensitivity, thus limiting the utility of reverse genetics for functional analysis of the gene products. Even with the HA and NA genes, for which reliable antibody-driven selection systems are available, it is difficult to produce viruses with prominent growth defects. In contrast, the reverse genetics system described herein does not require helper virus and permits one to generate transfectants with mutations in any gene segment or with severe growth defects. This advantage is demonstrated in Although inactivated influenza vaccines are available, their efficacy is suboptimal due partly to their limited ability to elicit local IgA and cytotoxic T cell responses. Clinical trials of cold-adapted live influenza vaccines now underway suggest that such vaccines are optimally attenuated, so that they will not cause influenza symptoms, but will still induce protective immunity (reviewed in Keitel & Piedra, 1998). However, preliminary results indicate that these live virus vaccines will not be significantly more effective than the best inactivated vaccine (reviewed in Keitel. & Piedra, 1998), leaving room for further improvement. One possibility would be to modify a cold-adapted vaccine with the reverse genetics system described above. Alternatively, one could start from scratch by using reverse genetics to produce a Amaster@ influenza A strain with multiple attenuating mutations in the genes that encode internal proteins. The most intriguing application of the reverse genetics system described herein may lie in the rapid production of attenuated live-virus vaccines in cases of suspected pandemics involving new HA or NA subtypes of influenza virus. This new reverse genetics system will likely enhance the use of influenza viruses as vaccine vectors. The viruses can be engineered to express foreign proteins or immunogenic epitopes in addition to the influenza viral proteins. One could, for example, generate viruses with foreign proteins as a ninth segment (Enami et al., 1991) and use them as live vaccines. Not only do influenza viruses stimulate strong cell-mediated and humoral immune responses, but they also afford a wide array of virion surface HA and NA proteins (e.g., 15 HA and 9 NA subtypes and their epidemic variants), allowing repeated immunization of the same target population. Influenza VLPs possessing an artificial vRNA encoding a reporter gene have been produced by expressing viral structural proteins and vRNA with the vaccinia-T7 polymerase system (Mena et al., 1996). Using reverse genetics, one can now generate VLPs containing vRNAs that encode proteins required for vRNA transcription and replication (i.e., PA, PB1, PB2, and NP), as well as vRNAs encoding proteins of interest. Such VLPs could be useful gene delivery vehicles. Importantly, their lack of genes encoding viral structural proteins would ensure that infectious viruses will not be produced after VLP-gene therapy. Since the influenza virus genome is not integrated into host chromosome, the VLP system would be suitable for gene therapy in situations requiring only short-term transduction of cells (e.g., for cancer treatment). In contrast to adenovirus vectors (Kovesdi et al., 1997), influenza VLPs could contain both HA and NA variants, allowing repeated treatment of target populations. The family Orthomyxoviridae comprises influenza A, B, and C viruses, as well as the recently classified Thogotovirus. The strategy for generating infectious influenza A viruses entirely from cloned cDNAs described herein would apply to any orthomvxovirus, and perhaps to other segmented negative-sense RNA viruses as well (e.g., Bunyaviridae, Arenaviridae). The ability to manipulate the viral genome without technical limitations has profound implications for the study of viral life cycles and their regulation, the function of viral proteins and the molecular mechanisms of viral pathogenicity. Cells and Viruses. 293T human embryonic kidney cells and Madin-Darby canine kidney cells (MDCK) were maintained in DMEM supplemented with 10% FCS and in MEM containing 5% newborn calf serum, respectively. The 293T cell line is a derivative of the 293 line, into which the gene for the simian virus 40 T antigen was inserted (DuBridge et al., 1987). All cells were maintained at 37° C. in 5% CO2. Influenza virus A/Udorn/307/72 (H3N2) (Udom) was propagated in 10-day-old eggs. Construction of Plasmids. The cDNA of Udom virus was synthesized by reverse transcription of viral RNA with an oligonucleotide complementary to the conserved 3′ end of viral RNA, as described by Katz et al. (1990). The cDNA was amplified by PCR with M gene-specific oligonucleotide primers containing BsmBI sites, and PCR products were cloned into the pT7Blueblunt vector (Novagen, Madison, Wis.). The resulting construct was designated pTPol1UdM. After digestion with BsmBI, the fragment was cloned into the BsmBI sites of the pHH21 vector, which contains the human RNA polymerase I promoter and the mouse RNA polymerase I terminator, separated by BsmBI sites (Neumann et al., 1999), resulting in pPolIUdM. Plasmids derived from pHH21 for the expression of vRNA are referred to as APolI@ constructs in this report. The M mutants were constructed as follows. pTPolIIUdM was first amplified by inverse PCR (Ochman et al., 1988) using the back-to-back primers M2104R (5′-AAGAGG GTCACITGAATCG-3′; SEQ ID NO: 1) and M2V27T (5′-ACTGTTGCTGCGAGTATC-3′; SEQ ID NO:2) and M2A30P (5′-GTTGITGCTCCAACTATC-3′; SEQ ID NO:3) and M2S31N (5′-GTIGTTGCTGCGAACATC-3′; SEQ ID NO:4) and M2del29-31 (5′-GTGTATCATTGGGATCTTGC-3′; SEQ ID NO:5), and the back-to-back primers M2128R (5′-CCCAATGATACTCGCAGC-3′; SEQ ID NO:6) and M2W41A (5′-ATCTIGCACTTGATATIGGCAATTC-3′; SEQ ID NO:7), and the back-to-back primers M2HATMR(5′-CACCAGTGAACTGGCGACAGTTGAGTAGATCGCCAGAATGTCACTTG AATCGTTGCATCTGC-3′; SEQ ID NO:8) and M2HATM (5′-CTTTTGGTCTCCCTGGGGGCAATCAGTTTCTGGATGGATCGTCTTTT TCAAATGC-3′; SEQ ID NO:9), and M2NATMR (5′-GCTIAGTATCAATGTATTCCA1TTATGATTGATATCCAAATGCTGTC ACTTGAATCGTTGCATCTGC-3′SEQ ID NO: 10) and M2NATM (5′-ATTATAGGAGTCGTAATGTGTATCTCAGGGATTACCATAATAGATCGT CTTTTTTTCAAATGC-3′; SEQ ID NO: 11). The PCR products were phosphorylated, self-ligated, and propagated in E. coli strain DH5α, and then digested with BsmBI and cloned into the BsmBI sites of the pHH21 vector. The resulting constructs were designated pPo 1M2V27T, pPolIM2A30P, pPolIM2S31N, pPolIM2del29-31, pPolIM2W41A, pPolIM2HATM, and pPolIM2NATM. All of the constructs were sequenced to ensure that unwanted mutations were not present. The plasmids for the expression of the HA (pEWSN-HA), NP (pCAGGS-WSN-NP0/14), NA (pCAGGS-WNA15), M1 (pCAGGS-WSN-M1-2/1) proteins of AWSN/33 (H1N1) virus, and the M2 (pEP24c), NS2 (pCANS2), PB1 (pcDNA774), PB2 (pcDNA762), and PA (pcDNA787) of A/Puerto Rico/8/34 (H1N1) virus are described in Neumann et al. (1999). Plasmid-Driven Reverse Genetics. Transfectant viruses were generated as reported in Neumann et al. (1999). Briefly, 17 plasmids (8 PolI constructs for 8 RNA segments and 9 protein-expression constructs for 9 structural proteins) were mixed with transfection reagent (2 μl of Trans IT LT-1 (Panvera, Madison, Wis.) per μg of DNA), incubated at room temperature for 15 minutes, and added to 1×106 293T cells. Six hours later, the DNA-transfection reagent mixture was replaced by Opti-MEM (GIBCO/BRL) containing 0.3% BSA and 0.01% FCS. Forty-eight hours later, viruses in the supernatant were plaque-purified in MDCK cells once and then inoculated into MDCK cells for the production of stock virus. The M genes of transfectant viruses were sequenced to confirm the origin of the gene and the presence of the intended mutations and to ensure that no unwanted mutations were present. In all experiments, the transfection viruses contained only the M gene from Udom virus and the remaining genes from A/WSN/33. Replicative Properties of the Transfectant Viruses. MDCK cells in duplicate wells of 24-wells plates were infected with wild-type and mutant viruses at a multiplicity of infection (MOI) of 0.001 plaque-forming units (PFU) per cell, overlaid with MEM medium containing 0.5 μg of trypsin per ml, and incubated at 37° C. At different times, supernatants were assayed for infectious virus in plaque assays on MDCK cells. To investigate the amantadine sensitivity of mutant viruses, the viruses were titrated in MDCK cells in the presence of different concentrations of the drug. M2 Incorporation into Viruses. Transfectant viruses were grown in MDCK cells containing 0.5 μg of trypsin per ml. Viruses were purified through six-step sucrose gradients (20, 30, 35, 40, 45, and 50%) for 2.5 hours at 50,000 g at 4° C. Virus was resuspended in PBS and stored in aliquots at −80° C. Purified virus was resuspended in the lysis buffer (0.6 M KCl, 50 mM Tris-CI [pH 7.5]. 0.5% Triton X-100). The viral lysates were placed on 15% SDS-polyacrylamide gels, which then were electrotransferred to polyvinylidene difluoride (PVDF) membrane. The membrane was blocked overnight at 4° C. with 5% skimmed milk in PBS, and then incubated with the 14C2 anti-M2 monoclonal antibody (kindly provided by Dr. R. Lamb) and anti-WSN-NP monoclonal antibody for 1 hour at room temperature. The membrane was washed three times with PBS containing 0.05% Tween-20. Bound antibodies were detected with a VECTASTAIN ABC kit (Vector) and the Western immunoblot ECL system (Amersham). Signal intensities were quantified with an Alpha Imager 2000 (Alpha Innotech Corporation). Experimental Infection. Five-week-old female BALB/c mice, anesthetized with isoflurane, were infected intranasally with 50 μl (5.0×103 PFU) of virus. Virus titers in organs were determined 3 days after infection with MDCK cells, as described (Bilsel et al., 1993). Generation of Influenza A Viruses Containing Mutations in the M2 Protein. The TM domain of the M2 protein is modeled to have an a helical structure (Duff et al., 1992; Sugrue and Hay, 1991; Sansom and Kerr, 1993). Mutations at residues V-27, A-30, S-31, G-34, and L-38, all of which are located on the same face of the a helix, alter the properties of the M2 ion channel (Grambas et al., 1992; Pinto et al., 1992; Wang et al., 1993). To determine whether the ion channel activity of M2 is essential for viral replication, five plasmids were constructed and used to generate mutant viruses possessing changes in the M2 TM domain ( To generate mutant viruses by plasmid-driven reverse genetics (Neumann et al., 1999), 293T cells were transfected with nine protein-expression plasmids and eight others for the production of viral RNA segments that encoded all A/WSN/33 (H1N1) viral genes except the M gene, which was derived from the A/UJdor/307/72 (H3N2) (Udom) virus (wild-type). The corresponding transfectant viruses were designated M2V27T, M2A30P, M2S31N, M2W41A, M2del29-31, and WSN-UdM, for the virus containing the parental Udorn M gene. To determine the efficiency of virus generation, viruses were titrated in the culture supernatant of 293T cells at 48 hours post-transfection using MDCK cells. As shown in Table 3, more than 105 transfectant viruses with the wild-type or mutant M gene were present. Thus, all viruses bearing M2 mutations and the virus possessing the wild-type Udom M gene were generated with similar efficiency. The transfectant viruses were plaque-purified once in MDCK cells and then inoculated into MDCK cells to make virus stocks. The stability of the introduced mutations was analyzed by sequencing the M gene segments of the transfectant viruses after ten passages in MDCK cells. No revertants were found. Growth Properties of M2 Mutant Viruses in Tissue Culture. Next, the growth properties of M2 ion channel mutants and wild-type WSN-UdM virus in MDCK cells were compared ( To assess the amantadine sensitivity of these viruses, the M2 mutants and wild-type WSN-UdM viruses were plaqued in MDCK cells in the presence of different concentrations of amantadine. In cell culture, amantadine produces two discrete concentration-dependent inhibitory actions against viral replication. A nonspecific action at concentrations >50 μM, resulting from an increase in the pH of endosomes, inhibits activation of HA membrane fusion activity involved in endocytosis (Daniels et al., 1985); whereas at lower concentrations, 0.1-5 μM, the drug selectivity inhibits viral replication (Appleyard, 1977). As shown in Generation of Transfectant Viruses in which the M2 TM Domain was Replaced with that from the HA or NA. Although the M2A30P, M2W41A, and M2del29-31 mutants do not have functional ion channel activity, as assayed by a two-electrode voltage-clamp procedure (Holsinger et al., 1994), they all replicated as well as the wild-type virus in MDCK cells ( To determine whether M2 channel ion activity is not essential for viral replication, chimeric mutant viruses were generated in which the M2 TM domain was replaced with that from the HA or NA of the A/WSN/33 virus ( Growth Properties of the M2HATM Mutant in Tissue Culture. Because the titers of the M2NATM virus stock did not exceed 104 PFU/ml, the M2HATM virus was employed for further analysis, first by examining the time course of progeny virus production by M2HATM versus wild-type WSN-UdM viruses in MDCK cells ( Incorporation of Mutant M2 Molecules into Virions. Conceivably, the M2 point and chimeric mutants possessed some residual ion channel activity, so that increased incorporation of the M2 protein into virions could compensate for any defect in this function. Therefore, the efficiency of incorporation of the wild-type and mutant M2s into influenza virions was compared using Western blot analysis after standardization based on the intensity of NP ( Replication of M2 Mutant Viruses in Mice. To determine the role of M2 ion channel activity in vivo, mice were infected with each of the six mutant viruses (Table 4), which replicated in the lungs as well as or more efficiently than the wild-type WSN-UdM virus, although the titer of the M2del29-31 virus was a log lower than that of the wild-type virus. By contrast, the mutants showed different replicative potentials in nasal, turbinates, with neither the M2A30P nor M2del29-31 virus recovered from such samples in any of the infected mice. M2HATM virus was not recovered from either the lungs or the nasal turbinates. These results indicate that M2 ion channel activity is necessary for efficient viral replication in vivo. Further, the serum of the infected mice have antibodies which bind to the immunizing virus (see Example 3). A reverse-genetics system (Neumann et al., 1999) was used to generate transfectant influenza A viruses with changes in the M2 protein TM domain that are known to block ion channel activity. Despite this functional defect, all of the mutant viruses replicated as efficiently as the wild-type WSN-UdM virus in vitro. The dispensability of M2 ion channel activity in viral replication was reinforced by experiments in which the TM domain of the M2 protein was replaced with that from the HA or NA. Thus, in in vitro studies, influenza A viruses did not require M2 ion channel activity for efficient replication. M2 ion channel activity is believed to function at an early stage in the viral life cycle, between the steps of host cell penetration and uncoating of viral RNA. Zhimov et al. (1990) reported that low pH induces the dissociation of M protein from viral RNPs in vitro. This observation lead others to suggest that the introduction of protons into the interior of virions through M2 ion channel activity in the endosomes is responsible for M dissociation from RNP (reviewed by Helenius. 1992). If so, how could this process occur in the absence of M2 ion channel activity or the M2 TM domain? Immunoelectron microscopy of the HA protein in virosomes exposed to low pH demonstrated that, in the absence of target membranes, the N-terminal fusion peptide of the HA2 subunit was inserted into the same membrane site where HA was anchored (Wharton et al., 1995). Therefore, one possibility is that the fusion peptide of the HA maybe inserted into the viral envelope, forming pores in the viral membrane that permit the flow of protons from the endosome into virus interior, resulting in disruption of RNP-M1 interaction. Alternatively, M1 may be able to dissociate from RNP by an entirely different mechanism, including ion channel activity by the TM regions of other viral membrane proteins, such as the HA, the NA or both. What is the origin of the M2 ion channel? The M2 ion channel activity was originally discovered with A/fowl plague/Rostocki/34 (FPV Rostock) strain, which has intracellularly cleavable HA (Sugreu et al., 1990; Ohuchi et al., 1994; Takeuchi and Lamb, 1994). In this strain, the HA undergoes a low pH-induced conformational change in the trans-Golgi network in the absence of M2 ion channel activity, which raises the pH in this compartment. Hence, in the past, influenza A viruses may have been equipped with an M2 protein that promoted an increase in the pH of the trans-Golgi network, to a level above which conformational changes occur in the intracellularly cleavable HA. As influenza A viruses without intracellularly cleavable HAs began to appear, there was less selective pressure to maintain high ion channel activity associated with the M2 protein. Consequent decreases in this activity may have been sufficient to allow dissociation of M1 from RNP. Indeed, ion channel activity differs markedly among the M2 proteins of currently recognized viruses: for example, fivefold more M2 protein from human Udom virus (containing intracellularly uncleavable HA) is needed to produce the same ion channel activity displayed by an equivalent amount of M2 from FPV Rostock virus (containing intracellularly cleavable HA) (Takeuchi and Lamb, 1994). Conversely, the HAs of some influenza A viruses have changed from intracellularly uncleavable to cleavable during replication in chickens (Kawaoka et al., 1984; Horimoto and Kawaoka, 1995; Horimoto et al., 1995), suggesting that M2 protein with limited ion channel activity could acquire greater activity once a switch to intracellularly cleavable HA has occurred. The M2 ion channel knock-out and M2HATM viruses replicated reasonably well in tissue culture, but were highly attenuated in mice, raising the possibility for their use as live vaccines. Cold-adapted live vaccines, now in clinical trials (reviewed by Maasab and Bryant, 1999), hold considerable promise for use in the general population (Sears et al., 1988; Steinhoff et al., 1991; Steinhoff et al., 1990). The major concern is that the limited number of attenuating mutations in such vaccines (Cox et al., 1988; Herlocher et al., 1993) could permit the generation of revertant viruses. Abolishing the M2 ion channel activity, for example, by replacing the M2 TM domain with that from the HA, would greatly reduce the likelihood of the emergence of revertant viruses. Thus, using our new reverse-genetics system, the generation of influenza viruses with modified viral genes could lead to the production of safe live influenza vaccines. To date, four viral proteins have been reported to act as ion channels: M2 of influenza A virus, NB or influenza B virus, and Vpu and Vpr of human immunodeficiency virus type 1 (HIV-1) (Ewart et al., 1996; Piller et al., 1996; Pinto et al., 1992; Schubert et al., 1996; Sunstrom et al., 1996). Since the replication strategies of influenza type A and B viruses are very similar, the NB ion channel activity is also thought to play a role at an early stage of the viral life cycle, although NB still lacks a demonstrated function in viral replication. Although the Vpu protein of HIV-1 enhances the release of virus particles from cells (Schubert et al., 1995; Strebel et al., 1988; Terwilliger et al., 1989), its gene can be deleted without completely abrogating HIV-1 replication in vitro (Cohen et al., 1988; Klimkait et al., 1990; Strebel et al., 1988, 1989). Vpr, another HIV-1 auxiliary protein, is likewise not essential for replication in tissue culture (Dedera et al., 1989). Finally, here, it was shown that M2 ion channel activity is not essential for the life cycle of influenza A viruses. Therefore, ion channel activities of viral proteins may be an auxiliary function in general, although they can promote more efficient viral replication under certain conditions such as in vivo, as shown hereinabove. Cells and Viruses. 293T human embryonic kidney cells and Madin-Darby canine kidney (MDCK) cells were maintained in DMEM supplemented with 10% FCS and in MEM containing 5% newborn calf serum, respectively. The 293T cell line is a derivative of the 293 line, into which the gene for the simian virus 40 T antigen was inserted (Dubridge et al., 1987). All cells were maintained at 37EC in 5% CO2. M2del29-31 and WSN-UdM (wild-type) viruses were propagated in MDCK cells. A/WSN/33 (H1N1) virus was propagated in 10-day-old embryonated chicken eggs. Immunization and Protection Tests. BALB/c mice (4-week-old female) were intranasally immunized with 50 μl of 1.1×105 PFU per ml of M2del29-31 or wild-type WSN-UdM viruses. On the second week, four mice were sacrificed to obtain sera, trachea-lung washes, and nasal washes. Two weeks and one or three months after the vaccination, immunized mice were challenged intranasally, under anesthesia, with 100 LD50 doses of the wild-type WSN virus. For determination of virus titers, lungs were harvested at day 3 and were homogenized and titrated on MDCK cells. The remaining animals were observed for clinical signs and symptoms of infection for 14 days after challenge. Detection of Virus-Specific Antibody. Serum samples were examined for antibody by ELISA. In this assay, the wells were coated with purified WSN virus after treatment with 0.05 M Tris-HCl (pH 7.8) containing 0.5% Triton X-100 and 0.6 M KCl at room temperature and diluted in PBS. After incubation of virus-coated plates with test serum samples, bound antibody was detected with rabbit anti-mouse IgA (Kirkegaard & Penrry Laboratories Inc., Gaithersburg, Md.) and goat anti-mouse IgG (Boehringer Mannheim, Germany) conjugated to horseradish peroxidase. In the second week after immunization, virus-specific IgG and IgA was found in nasal washes, lung washes and sera of immunized mouse. Notably, virus specific IgG was found in greater levels in mice immunized with M2del29-31 virus in all three sample types, and virus-specific IgA was found in lung washes from M2del29-31-immunized mice but was undetectable in lung washes from WSN-UdM-immunized mice. The mice were challenged with wild-type virus two weeks, one month or two months after immunization and body weights determined for up to 2 weeks ( The lungs from some of the mice were harvested at day 3 after challenge to determine virus titers (Table 5). Only mice that were immunized with wild-type virus and challenged with wild-type virus had detectable virus in the lungs. The lack of the presence of virus in lung of immunized mice which were challenged correlated with survival after challenge. Cells. 293T human embryonic kidney cells and Madin-Darby canine kidney (MDCK) cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and in minimal essential medium (MEM) containing 5% newborn calf serum, respectively. All cells were maintained at 37° C. in 5% CO2. Hygromycin-resistant MDCK cells stably expressing M2 protein from A/Puerto Rico/8/34 (H1N1) were established by cotransfection with plasmid pRHyg, containing the hygromycin resistance gene, and plasmid pCAGGS/M2, expressing the full-length M2 protein, at a ratio of 1:1. The stable MDCK cell clone (M2CK) expressing M2 was selected in medium containing 0.15 mg/mL of hygromycin (Roche, Mannheim, Germany) by screening with indirect immunostaining using an anti-M2 (14C2) monoclonal antibody. The M2CK cells were cultured in MEM supplemented with 10%/o fetal calf serum and 0.15 mg/mL of hygromycin. In M2CK cells, the expression levels and localization of M2 were similar to those in virus-infected cells (data not shown). Plasmid Construction. The cDNA of A/Vietnam/1203/04 (VN1203) virus was synthesized by reverse transcription of viral RNA with an oligonucleotide complementary to the conserved 3′ end of the viral RNA, as described by Katz et al. (1990). The cDNA was amplified by PCR with M gene-specific oligonucleotide primers containing BsmBI sites, and PCR products were cloned into the pGEM vector. The resulting construct was designated pGEM-VN 1203M. After digestion with BsmBI the fragment was cloned into the BsmBI sites of the pHH21 vector, which contains the human RNA polymerase I promoter and the mouse RNA polymerase I terminator, separated by BsmBI sites, resulting in pPolIUdM. Plasmids derived from pHH21 for the expression of viral RNA are referred to as “PolI” constructs herein. The M mutants were constructed as follows. pGEM-VN1203M was first amplified by inverse PCR (Ochmann et al., 1988) using the back-to-back primers M987stopF (5′-gtgaATAGAATTGGAGTAAAAAACTACC-3′; SEQ ID NO:35) and M987stopR (5′-tcaAAAATGACCATCGTCAACATCCAC-3′; SEQ ID NO:36), M969stopF (5′-gtgaGATGGTCATITTGTCAACATAGAA-3′; SEQ ID NO:37) and M969stopR (5′-tcaATCCACAGCACTCTGCTGTTCCTG-3′; SEQ ID NO:38), M936stopF (5′-gtgaCGGCAGGAACAGCAGAGTGCTG-3′; SEQ ID NO:39) and M936stopR (5′-tcaTrCCCTCATAGACTCAGGTACC-3′; SEQ ID NO:40), M903stopF (5′-gtgaGCAGGGGTACCTGAGTCTATG-3′; SEQ ID NO:41) and M903stopR (5′-tcaAGGCCCTCTUTTCAAACCGTA-3′; SEQ ID NO:42), M870stopF (5′-CTTAAATACGGTTTGAAAAGAGGGCCTGC-3′; SEQ ID NO:43) and M870stopR (5′-tcactcaATAAATGCATTTGAAGAAAAGACGATC-3′; SEQ ID NO:44), and M783stopF (5′-TTGTTGTTGCCGCAAATATCATTGGG-3′; SEQ ID NO:45) and M783stopR (5′-TtcactcaACTTGAATCGCTGCATCTGC-3′; SEQ ID NO:46). Nucleotide changes to introduce stop codons are indicated by lowercase letters. The PCR products were then phosphorylated, self-ligated, propagated in Escherichia coli strain DH5a, and then digested with BsmBI and cloned into the BsmBI sites of the pHH21 vector. The resulting constructs were designated pPolI-VN1203M2del5, pPolI-VN1203M2del11, pPolI-VN1203M2del22, pPolI-VN1203M2del33, pPolI-VN1203M2del44, and pPolI-VN1203delM2, each of which contained two stop codons at nucleotide positions 972 to 974, 939 to 941, 906 to 908, 873 to 875, and 786 to 788 of the M segment, which resulted in the deletion of 5, 11, 22, 33, 44, and 70 residues from the C terminus of the M2 protein, respectively ( Plasmid-Driven Reverse Genetics. All of the viruses were generated by the introduction of plasmids expressing eight viral RNA segments and three polymerase proteins plus NP, as described by Neumann et al. (1999). At 48 hours posttransfection, viruses were harvested and used to inoculate M2CK cells for the production of stock viruses. The M genes of transfectant viruses were sequenced to confirm the origin of the gene and the presence of the intended mutations and to ensure that no unwanted mutations were present. All experiments with live viruses and with transfectants generated by reverse genetics were performed in a biosafety level 3 containment laboratory approved for such use by the CDC and the U.S. Department of Agriculture. Replicative Properties of the Transfectant Viruses in Cell Culture. MDCK cells were infected in duplicate wells of 24-well plates with the wild-type or mutant viruses at a multiplicity of infection (MOI) of 0.001, overlaid with MEM containing 0.5 μg of trypsin per mL, and incubated at 37° C. At select time points, supernatants were assayed for infectious virus in plaque assays on M2CK cells (Iwatsuki-Horimoto et al., 2006). Experimental Infection. Five-week-old female BALB/c mice, anesthetized with isoflurane, were infected intranasally with 50 μL (100 PFU) of virus. Virus titers in organs were determined 3 days after infection by use of MDCK cells, as described in Bilsel et al. (1993). Immunization and Protection. BALB/c mice (4-week-old females) were intranasally immunized with 100 or 1,000 PFU/50 μL of the M2del11-HAavir virus. Three weeks later, four mice were sacrificed to obtain sera, trachea-lung washes, and nasal washes. One month after vaccination, immunized mice were challenged intranasally, under anesthesia, with 3.8×102 PFU or 5×104 PFU of the wild-type VN1203 or A/Indonesia/7/05 virus, which was equivalent to 100 50% minimal lethal doses (MLD50) (dose required to kill 50% of infected mice), respectively. To determine virus titers in mice, organ samples were harvested at day 3 postchallenge and were homogenized and titrated on MDCK cells. The remaining animals were observed for clinical signs and symptoms of infection for 14 days postchallenge. Virus-Specific Antibody Detection. Immunoglobulin G (IgG) and IgA antibody titers were measured in sera, trachea-lung washes, and nasal washes of the immunized mice by use of an enzyme-linked immunosorbent assay (ELISA) (Kida et al., 1982). In this assay, the wells were coated with purified A/Vietnam/1194/05 virus after treatment with 0.05 M Tris-HCl (pH 7.8) containing 0.5% Triton X-100 and 0.6 M KCl at room temperature for 1 hour and then diluted in phosphate-buffered saline (PBS). After incubation of virus-coated plates with test serum samples for 1 hour, bound antibody was detected with a rabbit anti-mouse IgA (Kirkegaard & Perry Laboratories Inc., Gaithersburg. Md.) and a goat anti-mouse IgG (Boehringer, Mannheim, Germany) conjugated to horseradish peroxidase. Neutralizing antibody titers in serum samples of the immunized mice were also evaluated. The sera were treated with receptor-destroying enzyme (Accurate Chemical and Scientific Corp.) to destroy inhibitors of influenza virus replication. After inactivation of the receptor-destroying enzyme by treatment at 56° C. for 30 minutes, VN1203 and A/Indonesia/7/05 viruses were each incubated with twofold serial dilutions of serum (starting at a 1:10 dilution) at 37° C. for 1 hour. Viral infectivity was determined by titration of the samples in a plaque assay on MDCK cells. The neutralizing titer was defined as the reciprocal titer of serum required to neutralize at least 50% of each virus. In Vitro 2Growth Properties of VN1203 Viruses Possessing M2 Cytoplasmic Tail Deletion Mutations. A series of M2 cytoplasmic tail deletion mutants of a highly pathogenic H5N1 (VN1203) virus was generated by reverse genetics as described in Neumann et al. (1999). Transfectant viruses were harvested at 48 hours posttransfection and used to inoculate M2CK cells to propagate stock viruses. The stock virus titers were comparable to that of the wild-type virus: 6.2×108 PFU/mL for VN1203M2del44, 6.8×108 PFU/mL for VN1203M2del33, 6.3×108 PFU/mL for VN1203M2del22, 5.4×108 PFU/mL for VN1203M2dl11, 6.1×108 PFU/mL for VN1203M2del5, and 2.4×108 PFU/mL for the wild-type virus. The only exception was VN1203delM2 (6.0×106 PFU/mL). Next, the growth properties of the VN1203M2 tail mutant viruses were compared with those of wild-type VN1203 virus in MDCK cells ( In Vivo Growth Properties of VN1203 M2 Tail Deletion Mutants. To determine the virulence of the M2 tail mutants, their growth properties in mice were examined. Mice were infected with 100 PFU of M2 mutant or wild-type viruses. On day 3 postinfection, organs were taken from the infected mice for virus titration. As shown in Table 6, the wild-type VN1203 virus replicated well in all organs examined. Mutants possessing deletions of more than 22 amino acids were not recovered from any of the infected mice. Of interest, replication of the VN1203M2del5 and -M2del11 viruses was more than 1 log lower in the lungs, 2 logs lower in nasal turbinates, and 2 logs lower in the kidneys of infected mice than that of wild-type virus. Moreover, no virus was detected from the brain samples of mice infected with the VN1203M2del11 virus. These results indicate that the VN1203M2del11 virus was attenuated in mice, despite replicating as well as the wild-type virus in MDCK cells. Generation of a Recombinant VN1203 Virus that Possesses M2del11 and an Avirulent HA. Since the VN1203M2del11 virus was attenuated in mice, the feasibility of using it for an H5N1 vaccine was tested. To improve the safety of an H5N1 virus vaccine, vaccine candidates should have multiple attenuating mutations in the viral genes. Therefore mutations were introduced into the cleavage site of the VN1203M2del11 virus HA, a virulence determinant of influenza viruses in birds and mammals (Halta et al., 2001; Klenk et al., 1994; Steinhauer et al., 1999). In general, low-pathogenicity viruses do not contain a series of basic amino acids at the HA cleavage site (Klenk et al., 1994; Senne et al., 1996; Steinhauer, 1999), restricting cleavage and viral replication to a limited number of organs (i.e., these viruses cause localized infections). By contrast, the HAs of highly pathogenic H5N1 avian influenza viruses contain a series of basic amino acids at this site (Bosch et al., 1981; Garten et al., 1981; Senne et al., 1996; Suarez et al., 1995), which allow HA to be cleaved not only by trypsin but also by ubiquitous cellular proteases (Horimoto et al., 1994; Stieneke-Grober et al., 1992), thereby allowing viral replication in a variety of organs, including brain (i.e., these viruses cause systemic infections). To ensure the safety of the vaccine strains, a mutant HA was constructed in which the amino acid sequence at the HA cleavage site, PQRERRRKKR/G (SEQ ID NO:47), was converted to the sequence in a typical avirulent avian virus, PQ-RETR/G (dashes indicate deletions; SEQ ID NO:48). A recombinant virus possessing this avirulent HA and M2del11 mutations (designated M2del11-HAavir) was generated. Stock virus was amplified on M2CK cells, and the virus titer was 2.0×106 PFU/mL. Characterization of the Recombinant M2del11-HAavir Virus In Vitro and In Vivo. To characterize the M2del11-HAavir virus, its trypsin dependency in vitro was examined. Plaque assays were performed on M2CK cells in the presence or absence of trypsin. With the M2del11-HAavir virus, clear plaques were visible only in the presence of trypsin, whereas the M2del11 virus formed plaques in both the presence and absence of trypsin (data not shown). Next, to investigate the virulence of the M2del11-HAavir virus in vivo, mice were infected with various doses of the virus and monitored for 14 days ( Antibody Responses of Mice Immunized with the M2del11-HAavir Virus. To test the efficacy of the M2del11-HAavir virus as a vaccine, mice were intranasally administered with 100 or 1,000 PFU of the M2del11-HAavir virus. Three weeks later, IgG and IgA levels in sera, trachea-lung washes, and nasal washes of immunized mice were measured by means of an ELISA ( To examine whether or not the antibodies detected by ELISA contribute to neutralization of the H5N1 virus infectivity, the infectivity-neutralizing activity of the samples against VN1203 (homologous virus; clade 1) and A/Indonesia/7/2005 (Indonesia 7) (heterologous virus; clade 2), whose HA homology is 96.5% at the amino acid level was tested. Immunization with 1,000 PFU of M2del11-HAavir virus did not elicit neutralizing antibody efficiently, and the reciprocal titers of serum required to neutralize 50% of VN1203 and Indonesia 7 were only 31 and 23, respectively (datanot shown). Moreover, no neutralizing antibody was detectable in sera from mice immunized with 100 PFU of M2del11-HAavir virus (data not shown), indicating that only a limited level of neutralizing antibody was elicited upon immunization of mice with the M2del11-HAavir virus despite high levels of protection upon lethal challenge and high levels of IgG detected by ELISA. Protective efficacy of the M2del11-HAavir virus in mice. Mice immunized with the M2del11-HAavir virus were challenged 1 month after immunization with 100 MLD50 of the wild-type VN1203 virus (clade 1) or Indonesia 7 (clade 2). Unlike control mice, all M2del11-HAavir-immunized mice survived a lethal challenge with either of the highly pathogenic H5N1 viruses (data not shown) and did not show any symptoms, including weight loss, after the challenge. By contrast, all of the control mice died or had to be euthanized due to their symptoms by day 8 postchallenge (data not shown). The virus titers in several organs of the mice challenged with the VN1203 or Indonesia 7 virus (Table 8) was also determined. High titers of viruses were recovered from all organs of the control group. No virus was detected from any of the organs in the M2del11-HA virus vaccine group challenged with VN1203, though a limited amount of virus was detected in the nasal turbinates of one of the immunized mice challenged with the Indonesia 7 virus (Table 7). Taking the results together, it was concluded that the M2del11-HAavir virus can confer protective immunity to mice against lethal challenge with highly pathogenic H5N1 virus. The influenza A virus M2 is a multifunctional protein. It has ion channel activity in its transmembrane domain (Pinto et al., 1982), which is thought to function at an early stage of replication (acidification of the virion interior) (Helenius, 1992; Martin et al., 1991; Sugrue et al., 1991) and at a late stage (protection of an acid-mediated conformational change of cleaved HA) (Hay et al., 1985; Ohuchi et al., 1994; Takeuchi et al., 1991). In addition, its cytoplasmic tail is important for viral assembly (Itwasuki-Horimoto et al., 2006; McCown et al., 2006; McCown et al., 2005). In this study, a series of M2 tail deletion mutants was generated and their growth properties in vitro and in vivo examined. Deletions of 5 or 11 amino acids from the C terminus of M2 were found to not affect virus replication in cell culture but inhibited virus growth in mice. Previously it was shown that even one amino acid deletion from the M2 C terminus attenuated influenza virus in ferrets (Castrucci et al., 1995). Those findings indicate that the M2 cytoplasmic tail has a vital role(s) in virus replication in animals and that M2 tail mutants could be good vaccine candidates for influenza virus infection. Here, it was demonstrated that H5N1 M2del11-HAavir virus, which has an 11-amino-acid deletion from the C terminus of its M2 protein and an avirulent HA, protected mice from a lethal challenge with H5N1 viruses, indicating its considerable potential as a live virus vaccine against highly pathogenic H5N1 viruses. Recently, Suguitan et al. (2006) tested the vaccine efficacy in mice and ferrets of live attenuated, cold-adapted virus vaccine candidates that possess the modified avirulent type of HA and the NA from H5N1 strains, together with the internal genes from cold-adapted A/Ann Arbor/6/60 (H2N2). They demonstrated that a single dose of the vaccine protected animals from lethality but did not fully protected them from replication of the challenge H5N1 viruses, indicating limited efficacy for single-dose vaccination of these cold-adapted viruses. This incomplete protection may stem from unmatched antigenicity between the internal proteins of the cold-adapted virus (i.e., derived from H2N2 virus) and the challenge virus. Here, it was shown that the M2del11-HAavir virus, whose eight genes are derived from an H5N1 virus, protects mice almost completely from replication of heterologous H5N1 virus as well as homologous virus (Table 7). Despite its complete protection, the M2del11-HAavir virus did not elicit neutralizing antibody against either homologous or heterologous viruses efficiently, whereas it elicited high levels of antibodies detected by ELISA ( For live attenuated H5N1 virus vaccines to be clinically useful, the binding specificity of H5 HA for α-2,3-linked sialic acid (SA) receptors, which are preferentially recognized by avian influenza virus and rarely present in the upper respiratory tract of humans (Conner et al., 1994; Rogers et al., 1989; Rogers et al., 1983), must be considered. To address this problem, one could modify the H5 HA to alter its specificity for SA receptors. Recently, Auewarakul et al., 2007. Yamada et al., 2006; Yang et al., 2007 have determined specific amino acids in the avian H5 HA that alter its receptor-binding specificity toward α-2,6-SA (human-type receptor) recognition. This strategy may allow the generation of a recombinant H5N1-based vaccine that recognizes human-type α-2,6-SA receptors and efficiently replicates in the upper respiratory tract in humans.
All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention. |