最新美国发明专利第2021-08-24期 - 专利汇|PatentHub专利检索|专利查询网|发明专利查询分析

Document	Document Title
US11097278B2	Molecular analysis system and use thereof A molecular testing device comprises a heating and cooling module having a thin-film thermoelectric heating and cooling device, and a removable test module having a combined amplification and hybridization reaction chamber. The reaction chamber comprises a thermo-conductive exterior surface and a microarray on an interior surface. The thin-film thermoelectric heating and cooling device has a heat transfer surface that is adapted to make contact with the thermo-conductive exterior surface of the reaction chamber. The molecular testing device may be used to perform a PCR in the reaction chamber.
US11097271B2	Actuated microfluidic structures for directed flow in a microfluidic device and methods of use thereof A microfluidic device can comprise a plurality of interconnected microfluidic elements. A plurality of actuators can be positioned abutting, immediately adjacent to, and/or attached to deformable surfaces of the microfluidic elements. The actuators can be selectively actuated and de-actuated to create directed flows of a fluidic medium in the microfluidic (or nanofluidic) device. Further, the actuators can be selectively actuated and de-actuated to create localized flows of a fluidic medium in the microfluidic device to move reagents and/or micro-objects in the microfluidic device.
US11097270B2	Microfluidic filtering system A microfluidic filtering system may include a first microfluidic channel, a first pump to move fluid along the first microfluidic channel in a first direction, a second microfluidic channel, a second pump to move fluid along the second microfluidic channel in a second direction opposite to the first direction and a filter channel extending between and interconnecting the first microfluidic channel and the second microfluidic channel.
US11097268B2	Microfluidic flow control A device includes a microfluidic channel structure on a substrate with a first fluid actuator and a second fluid actuator within the microfluidic channel structure. One of the fluid actuators is selectively employable to at least partially reverse fluid flow within at least a portion of the microfluidic channel structure in response to a blockage or to prevent a blockage.
US11097264B2	Desulfation method for SCR catalyst The present invention provides methods for low temperature desulfating sulfur-poisoned SCR catalysts, and emission control systems adapted to apply such desulfating methods, in order to regenerate catalytic NOx conversion activity. The methods are adapted for treating an SCR catalyst to desorb sulfur from the surface of the SCR catalyst and increase NOx conversion activity of the SCR catalyst, the treating step including treating the SCR catalyst with a gaseous stream comprising a reductant for a first treatment time period and at a first treatment temperature, wherein the first treatment temperature is about 350° C. or less, followed by a second treatment time period and a second treatment temperature higher than the first treatment temperature, wherein the molar ratio of reductant to NOx during the treating step is about 1.05:1 or higher.
US11097263B2	Aromatization catalyst, preparation method, regeneration method thereof, and aromatization method The present disclosure provides an aromatization catalyst, a preparation method, a regeneration method and an aromatization method thereof. The preparation method comprises steps of: mixing a zeolite molecular sieve with a binder to obtain a catalyst precursor; the catalyst precursor is successively subjected to an ion exchange modification and a first modification treatment, and then subjected to a hydrothermal treatment, and further subjected to active metal loading and a second modification treatment, to obtain the aromatization catalyst. The aromatization catalyst has good carbon deposition resistance and high aromatization activity, and enables an aromatization reaction to be completed under mild conditions, and has high aromatic selectivity, and the liquid yield is above 98.5%.
US11097257B2	Catalytic hydrocarbon dehydrogenation A catalyst for dehydrogenation of hydrocarbons includes a support including zirconium oxide and Linde type L zeolite (L-zeolite). A concentration of the zirconium oxide in the catalyst is in a range of from 0.1 weight percent (wt. %) to 20 wt. %. The catalyst includes from 5 wt. % to 15 wt. % of an alkali metal or alkaline earth metal. The catalyst includes from 0.1 wt. % to 10 wt. % of tin. The catalyst includes from 0.1 wt. % to 8 wt. % of a platinum group metal. The alkali metal or alkaline earth metal, tin, and platinum group metal are disposed on the support.
US11097255B2	Procedure for obtaining a catalytic formulation for the production of ultra low sulfur diesel, obtained product and application thereof The present invention relates to a catalytic formulation used in the hydroprocessing of light and middle oil fractions, preferably in hydrodesulfurization and hydrodenitrogenation reactions to obtain diesel with ultra low sulfur content less than or equal to 15 ppm in weight. The catalytic formulation, object of the present invention, consists of at least one metal of Group VI B and at least one metal of Group VIII B and one element of Group V A of the periodic table deposited on a support based on surface modified alumina with an inorganic oxide of a metal of Group II A, IV A and/or IV B. And containing an impregnated organic compound containing at least one hydroxyl group and at least one carboxyl group and that can contain or not at least one sulfide group in its structure. The catalytic formulation, object of the present invention, allows processing of the oil fractions with initial and final boiling temperatures between 150 and 450° C., with initial nitrogen and sulfur content between 1 and 3% by weight and 200 to 600 ppm, respectively, reducing sulfur content to concentrations lower or equal to 15 ppm and nitrogen concentrations to lower than 1 ppm.
US11097253B2	Catalyst and method for preparing liquid fuel and light olefins by direct conversion of syngas Direct conversion of syngas produces liquid fuels and light olefins. The catalytic reaction is conducted on a fixed bed or a moving bed. The catalyst comprises A and B components. The component A is composed of active metal oxides, and the active ingredients of the component B are zeolites with a MEL structure. The distance between the geometric centers of catalyst A and catalyst B particles is 2 nm-10 mm; a weight ratio of the catalyst A to the catalyst B is 0.1-20. The pressure of the syngas is 0.1-10 MPa; reaction temperature is 300-600° C.; and space velocity is 300-10000 h−1. The reaction mainly produces gasoline with high octane number, and co-generates light olefins. Meanwhile, the selectivity for a methane byproduct is low (less than 10%).
US11097249B2	Method and device for treating solid-fluid mixtures A laminar stream reactor for the production of hydrochar of a solid-fluid mixture of water and a carbon-containing component, wherein the solid-fluid mixture is treated at a temperature of 100-300° C. and a pressure of 5-70 bar, consists of tubular reactor units of largely vertical holding sections (1,3) and direction-changing diverters (2,4). The holding sections are thereby flown through slower by the solid-fluid mixture than the remaining tube distances, as they have larger diameters.
US11097248B1	Polylactic acid devolatilization evaporator The present invention relates to the field of devolatilization, and discloses a polylactic acid devolatilization evaporator, which comprises: a container comprising a cylinder; an agitating shaft coaxial with the cylinder; an agitating belt connected to the agitating shaft and arranged in a spiral shape around the central axis of the cylinder, comprising an outer belt surface facing the inner circumferential surface of the cylinder and spaced apart from the inner circumferential surface of the cylinder. With the above technical scheme, the agitating belt makes the materials distributed more uniformly on the inner circumferential surface of the cylinder and form a thin layer in uniform thickness, thereby avoids agglomeration of the materials, facilitates uniform heating of the materials, avoids deterioration (e.g., darkened color) of the materials owing to non-uniform heating of the materials and excessive retention time in a high-temperature environment, and improves product quality.
US11097236B2	Magnetic mixers The system and method of the invention pertains to an axial flux stator is implemented to replace the drive-end magnets and the drive motor. The axial flux stator comprises a control circuit to control the voltage and current provided to the stator, to measure the torque and speed of rotation, and to measure the magnetic flux and magnetic flux density produced by the axial flux stator and impeller magnets, individually or in combination. The axial flux stator comprises a plurality of current carrying elements to produce magnetic flux in an axial direction and drive the impeller.
US11097224B2	Fluid separating element and telescoping prevention plate This fluid separating element comprises: a spiral wound body formed by winding a separating membrane and a raw water flow passage material in a spiral shape; an outside shell provided on an outer periphery of the spiral wound body; and telescoping prevention plates provided at both ends of the spiral wound body and the outside shell, wherein the telescoping prevention plate comprises at least a second annular portion capable of holding the outside shell, and a third annular portion which is formed on an axially outer side of the second annular portion and comprises an annulus having a greater outer diameter than that of the second annular portion, and at least one depression is provided in a side surface on the spiral wound body side of the third annular portion.
US11097223B2	Apparatus and method for reverse osmosis An apparatus for reverse osmosis, the apparatus comprising: a single-stage reverse osmosis (SSRO) unit; and a counter-current membrane cascade with recycle (CMCR) unit comprising a plurality of stages of reverse osmosis including at least a first stage and a second stage wherein permeate from the first stage is configured to be introduced as feed to the second stage; wherein retenate from the SSRO unit is configured to be introduced as feed to the first stage, and wherein product obtained using the apparatus comprises permeate from the SSRO unit and permeate from a last stage of the CMCR unit.
US11097222B2	Thermal- and photo-assisted aftertreatment of nitrogen oxides Systems and methods for treating automotive vehicle emissions on board an automotive vehicle include the use of waste heat recovery, electrochemical water splitting, phototcatalytic water splitting, and selective catalytic reduction. Waste heat recovery is used to power electrochemical water splitting, or photocatalytic water splitting. Photons collected from a solar panel are used in photocatalytic water splitting, or in photo-assisted selective catalytic reduction. Hydrogen gas generated by water splitting is used in conjunction with catalytic reduction units to catalytically reduce NOx in an engine exhaust gas.
US11097214B2	In-line swirl vortex separator An in-line swirl vortex separator to separate solids, liquids, particulate from a vapor stream. The swirl vortex separator includes a swirl element and a vortex element. The vortex element creates pairs of vortices that are substantially equal and opposite in direction.
US11097212B2	Tailing pond remediation Various embodiments of the present disclosure can include a system for filtering of contaminated fluid. The system can include a fiber manufacturing plant. The system can include a filter system which utilizes a fiber filter produced in the fiber manufacturing plant to clean and recycle a contaminated fluid.
US11097209B2	Separation method, and production method for (meth)acrylate An object of the present invention is to provide a separation method capable of efficiently separating a light liquid and a heavy liquid from a mixed liquid containing the light liquid, the heavy liquid, and an emulsion liquid of the light liquid and the heavy liquid, such as an emulsion-layer extraction liquid in a vicinity of an interface in an extraction column. The present invention relates to a separation method for continuously separating a light liquid and a heavy liquid having a specific gravity larger than that of the light liquid from a mixed liquid containing the light liquid, the heavy liquid, and an emulsion liquid of the light liquid and the heavy liquid by introducing the mixed liquid into a separation tank, in which a specific separation layer is used for the separation tank.
US11097208B2	Vise for column and column system for chromatography A vise for column, for attaching a plug to a column tube of a column for chromatography comprising the column tube and the plug to be attached to one end of the column tube, is provided. The vise comprises a column supporter configured to be able to support a part of the column for chromatography, a main body configured to be connected to the column supporter and extending from the column supporter by a predetermined distance, and a column presser configured to be supported at another end of the main body opposite to one end to which the column supporter is connected, and configured to be movable toward and away from the column supporter, and configured to be able to press the plug against the column tube.
US11097203B1	Low energy ejector desalination system A system to treat and desalinate wastewater using a low energy ejector desalination system (LEEDS), which employs a static liquid-gas ejector and maximum heat integration in the water treatment system.
US11097202B2	Energy recovery in a method for preparing 1,3,5-trioxane The present invention relates to a process for energy recovery in a process for the preparation of 1,3,5-trioxane.
US11097200B2	Apparatus and method for separation of components with different volatility in a mixed fluid The invention concerns an apparatus (10) for separation of components with different volatility in a mixed fluid, said apparatus (10) comprising: a first heat exchanging unit (100) provided with first and second flow path structures (131, 132) forming separate flow paths for a first and a second fluid flow through the first heat-exchanging unit (100); an inlet (118) for feeding the mixed fluid to the apparatus (10); an inlet (119) for feeding steam to the apparatus (10); an arrangement for feeding a cooling medium through the apparatus (10), wherein said arrangement comprises at least one cooling medium inlet (105, 106, 107, 108). The invention is characterized in that the apparatus (10) comprises a second heat-exchanging unit (200) provided with third and fourth flow path structures (233, 234) forming separate flow paths for a first and a second fluid flow through the second heat-exchanging unit (200), wherein the cooling medium arrangement comprises at least one cooling medium inlet (205, 206, 207, 208) arranged in fluid communication with the fourth flow path structure (234) and wherein the first and third flow path structures (131, 233) are arranged in fluid communication with each other.
US11097198B2	Pop mechanism and device for revealing a winner A pop sensor and device for revealing a winner for use in battle or sword-type games, A device for revealing a winner comprises a bladder, a pop mechanism, a pop mechanism support structure, and a bladder destruction apparatus. The device for revealing a winner is coupled to a pop sensor system comprising a pop sensor. Activating the pop sensor causes the player's pop mechanism to activate and cause the bladder to destroy, instantly disengaging the losing player while revealing the winning player.
US11097195B2	Rotating play device The present invention relates to a rotating play device, such as may be mounted to a play surface of an outdoor playground. The rotating play device includes a central post and an upper framework, e.g. upper ring, rotatably mounted to the central post. The device further includes a lower ring suspended from the upper framework by a plurality of cords. During rotation about the central post, the device is configured such that one or more children may (i) stand on the lower ring and hold the upper ring, (ii) sit on the lower ring and hold one or more of the plurality of cords, or (iii) both (i) and (ii). In some embodiments, at least one of the lower ring and the upper ring may be angled to provide a varying distance between the two rings and/or the cords may be flexible such that a user may modify the distance between the lower ring and upper framework at a given riding location.
US11097194B2	Shared augmented reality game within a shared coordinate space Described herein is a system and method for sharing an AR game within a shared coordinate space created between devices with initially disjoint relative coordinate spaces. Once the shared coordinate space is created, an AR video game can provide a first mode in which the users engage in game play action that have consequences according to pre-established game rules. The AR video game can provide a second mode (“sandbox mode”) in which users engage in non-destructive game play actions that do not have consequences once the second mode has been terminated. Further described herein is a system and method of using geolocation information within an AR session in which a virtual action can be initiated by a user that causes a corresponding virtual action to be displayed on a map of a virtual environment that parallels a physical environment displayed on a user gaming device of another user.
US11097189B2	Contextually aware communications system in video games In response to receiving user input command for sending a contextually aware communication, a computer system is configured to use game state data to determine a target location that a player is focusing on in a virtual environment in a video game, identify a unit that the player likely wants to communicate about based on at least priorities of unit types and proximities of units to the target location, and select a communication action for performance. Different communication actions can be performed in response to the same user input command when the game state data indicates different game states.
US11097180B1	Braces friendly mouth guard A mouth guard that can be used with elastic band in place on braces provided. In one example, a mouth guard for protecting teeth during athletic activities is provided that includes a generally u-shaped base coupled to inner and outer flanges to form a teeth receiving pocket. A first slot is formed through a left side the outer flange and open though a top of the outer flange. A second slot is formed through a right side the outer flange and open though a top of the outer flange.
US11097177B1	Repulsion-based swim system and methods for use thereof In one aspect, a swim system may include a reverse thrust system worn by a swimmer proximate the frontal upper torso. The system provides a variable amount of reverse thrust such that the user can swim-in-place or make gradual forward progress. Importantly, this may enable a user to effectively “extend” a small residential pool to serve the same function as a twenty-five meter pool typically found at commercial or government facilities. The system also provides laminar current under the user while swimming, which solves the problems of “leg drop,” the need to “out-kick” the arm stroke, and turbulence and wave action around the head associated with conventional swim-in-place devices. Still further, in certain embodiments the system provides a relatively strong current in the region of the arm stroke moving away from the swimmer which provides enhanced “resistance” for proficient swimmers.
US11097172B2	Weighting system for putter type golf club A weight system for a putter type golf club that creates a balance point close to a golfer's hands when the putter is used in a normal manner for execution of a putting stroke. The putter is formed of a putter head, an elongated, constant ¼ inch diameter solid metal shaft; and a weighted, cylindrical adapter attached to an upper section of the elongated shaft between an overlying golf grip and the shaft.
US11097161B2	Golf ball A golf ball having a cover with a plurality of dimples on the surface thereof is provided with a coat of mutually differing properties on dimple areas of the surface and on land areas between the dimples. The dimple areas are formed with a coat having a low coefficient of friction, do not affect the spin performance when the ball is struck and are not prone to staining. The land areas are formed with a coat having a high coefficient of friction, enabling a lower spin rate to be achieved and thus increasing the distance traveled by the ball, particularly when struck with a middle iron, and also help impart a high spin rate and a good controllability on approach shots.
US11097160B2	Belaying lanyard equipped with improved swivel connection Lanyard having at least one belaying strap connected with a swivel connection which comprises two assembly parts able to rotate with respect to one another with a relative rotational movement. The two assembly parts of tubular shape are engaged coaxially in one another, the first outer part having a larger diameter than that of the second inner part. At least one of the parts is provided with a slot or hole for fitting securing means designed to secure the two parts in rotation in the engaged state.Applications: safety and securing lanyards for via ferrata, caving, mountaineering.
US11097159B2	Device for general and sports physiotherapy and its use A device for general and sport physiotherapy, facilitating the performance of stretching and relaxation exercises on the muscles of the entire body. One innovative aspect of this device lies in the configuration of its guidance mechanism, the configuration of the mechanism for regulating the device's height, the configuration of the mechanism facilitating the rotation of the transverse carrier bar with its self-locking rotatable coupling around the axle of the transverse carrier bar, and in the configuration of the device as a whole, which provides the user with the choice of a new range of prophylactic and preventive health care exercises and appropriate therapies. The patent request at hand is being lodged for both the manual as well as the electronic operation mechanism of the device.
US11097156B2	Wearable athletic activity monitoring methods and systems A method for monitoring an individual engaged in an athletic activity includes detecting movement of the individual at a first time, using a sensor module coupled to the individual, determining that the movement of the individual corresponds to a predetermined activation movement, entering an active state of the sensor module in response to the determination that the movement of the individual corresponds to the predetermined activation movement, and detecting movement of the individual at a second time, using the sensor module in the active state.
US11097153B1	Adjustable balance board An exercise device that allows users to exercise in a manner that strengthens their core and improve their balance with respect to rotation. The device includes a base for placing on the ground and a board on which the user stands and a mechanism for adjusting a restoring force to a neutral position. The device may also include a mechanism for limiting the range of rotational motion of the board.
US11097152B2	Exercise board An exercise board includes a main body and an elastic body configured on an upper surface of the main body. The upper surface of the main body is provided with at least one cavity, the cavity at least includes a first cavity part and a second cavity part, the first cavity part is located above the second cavity part, and a diameter of the first cavity part is less than that of the second cavity part. A lower surface of the elastic body is provided with at least one protrusion connected to the cavity, the protrusion at least includes a first protrusion part and a second protrusion part, the first protrusion part is located above the second protrusion part, and shapes of the first protrusion part and the second protrusion part match with shapes of the first cavity part and second cavity part.
US11097151B2	Locking device for recumbent stepper A locking device for an exercise system may include a locking member having a contact portion and configured to move between a first position and a second position. When in the first position, the contact portion of the locking member is not in mechanical communication with the resistance mechanism of the exercise system, thereby allowing movement of the at least one moveable assembly. When in the second position, the contact portion of the locking member is in mechanical communication with the resistance mechanism of the exercise system, thereby preventing movement of the at least one moveable assembly.
US11097148B2	Fitness machine An exercise device having a stowed configuration and a deployed configuration, in which in the stowed configuration, the exercise device is aesthetically pleasing and suitable for most rooms due to front and side panels that hide the framing of the exercise device, and in the deployed configuration, the side panels are opened to expose the arms, which can be deployed, moved up and down to adjust the height, and used to perform exercises based on a pulley system. Pneumatic cylinders may be operatively connected to the pulley system to provide the resistance for the exercises. Handles having gas actuators may be operatively connected to the pneumatic cylinders to adjust the resistance.
US11097142B2	Exercise device The exercise device of the present invention has a first assembly with a first strap configured to encircle a user's first bodily appendage, such as a thigh or a foot, with the first strap having a first attachment ring. The exercise device also has a second assembly with a second strap configured to encircle a user's second bodily appendage, such as a foot, with the second strap having a plurality of second attachment rings. The exercise device also has one or more elastic resistance bands configured for connecting at one end to the first attachment ring and at an opposite second end to one of the plurality of second attachment rings. Exercises with the device have the user moving between starting positions and finishing positions against the resistance of the bands.
US11097140B2	Processes for remediation of a contaminated material Methods to remediate a contaminated material are provided. In one embodiment, a biocatalyst that digests hydrocarbon contaminants is activated with a nutrient and the activated biocatalyst is combined with the contaminated material and water to form a mixture. The mixture is incubated for a period of time, and the level of contaminant in the mixture is determined to ascertain whether to incubate further, add additional biocatalyst mix, or provide the remediated material for further processing. In one embodiment, the remediated material is provided for reuse or recycling with a second material, such as a construction aggregate. The method is particularly suited for remediation of drill cuttings, mine tailings, hydrocarbon-contaminated soil, and the like.
US11097136B2	High load descender with adaptive release linkage A high load descender for rope access and rescue has a ratcheting sheave mounted to a pivoting arm, which translate with rope tension against a fixed shoe. The ratcheting sheave has a groove that grips rope during descent while allowing free rotation for ascent and progress capture. An adaptive release linkage enhances ease of operation and control while maintaining convenient handle position in a variety of conditions.
US11097135B2	Rope type elevating device The present invention relates to a rope type elevating device, and more particularly, to a rope type elevating device that can mechanically and safely control the falling speed even if a breakage occurs in the brake being electrically controlled during the elevating and descending operation.The rope type lifting device of the present invention comprising an electronic braking device for winding a conveying rope to move the rope up and down by using power, and a mechanical braking device for mechanically moving the conveying rope up and down, characterizes in that the mechanical braking device comprises: an unlocking lever being rotated by an external force within a predetermined rotation range; a connecting portion connected to the unlocking lever and moving forward by a predetermined amount in conjunction with the rotation of the unlocking lever; a rotating body that rotates by the amount of advancement of the connecting portion and adjusts a pressing force applied to the conveying rope; and a stopper for limiting the rotation range of the rotating body and supporting the pressing force applied to the rope by the rotating body.
US11097133B2	Method and system for combined energy therapy profile A method and system for treating tissue with a combined therapy profile is disclosed. In one exemplary embodiment, ultrasound energy is used to treat numerous depths of tissue within a region of interest and the spatial and temporal properties of the ultrasound energy are varied for more effective treatment. The method and system of the present invention are configured to treat all of the tissue from the surface on down and not spare intervening tissue.
US11097128B2	Radiotherapy treatment plans using differentiable dose functions Techniques for generating a radiotherapy treatment plan parameter are provided. The techniques include receiving radiotherapy treatment plan information; processing the radiotherapy treatment plan information to estimate one or more radiotherapy treatment plan parameters based on a process that depends on the output of a subprocess that estimates a derivative of a dose calculation; and generating a radiotherapy treatment plan using the estimated one or more radiotherapy treatment plan parameters.
US11097123B1	Electro-magnetic stimulation device An electro-magnetic stimulation device that alleviates the pain felt by a user when the device is placed on the user's body part that requires pain mitigation. The electro-magnetic stimulation device comprises of a leather chamois, a 99.99% led free copper plate that is attached to the leather chamois, a plurality of staggered magnetically connected magnets that are attached to the 99.99% led free copper plate, and an ionic solution that hydrates the leather chamois.
US11097116B2	Systems and methods for performing cardiac resynchronization therapy (CRT) using leadless pacemakers Embodiments of the present technology described herein are directed to implantable systems for performing cardiac resynchronization therapy (CRT), methods for use therewith, and leadless pacemakers for use therewith. Such a system can include a first leadless pacemaker configured to be implanted in or on the right atrial (RA) chamber and selectively pace the RA chamber, a second leadless pacemaker configured to be implanted in or on the right ventricular (RV) chamber and selectively pace the RV chamber, and a third leadless pacemaker configured to be implanted in or on the left ventricular (LV) chamber and selectively pace the LV chamber, wherein one of the leadless pacemaker is designated a master leadless pacemaker. In certain embodiments, the master leadless pacemaker determines a VV delay and an AV delay and coordinates CRT using such delays.
US11097115B2	Implantable pulse generator with suture holes and methods for implanting the same An implantable pulse generator is provided that includes a power source, a wireless communication component configured to facilitate wireless communication with a non-implanted device and pulse-generating circuitry connected to the power source. The pulse-generating circuitry can be configured to identify, based on wireless communication with the non-implanted device, temporal and amplitude characteristics for electrical pulse stimuli and to trigger electrical output stimuli having the temporal and amplitude characteristics. The implantable pulse generation can further include one or more lead connections—each being shaped to engage a lead and electrically connected to the pulse-generating circuitry to enable the lead to deliver at least part of the electrical output stimuli triggered by the pulse-generating circuitry. The implantable pulse generator can further include one or more suture-engagement components, each including one or more holes each having a diameter that is at least 0.1 mm and less than 5 mm.
US11097114B2	Modified implantation tool tip configuration for the improved installation of leadless pacemakers with short tine-based anchors A system and method for installing/implanting a leadless implant can include a leadless implant with shortened tine-based anchors and an implantation tool with a modified tip. The tines can extend from a surface of the leadless implant and may include a preformed curve or other shape to enable the tine to hook into or grapple tissue. The implantation tool may be provided with a modified tip to assist with proper alignment, insertion, and anchoring of the shortened tines. A tip of the implantation tool can have a reduced inner diameter to cause the tine tips to be approximately normal to the surface of the tissue to which the implant is being anchored. Upon deployment of the leadless implant, the tines of the anchoring mechanism are appropriately aligned for proper insertion so that robust anchoring is achieved.
US11097106B2	Implantable neurostimulator-implemented method for managing tachyarrhythmia through vagus nerve stimulation An implantable neurostimulator-implemented method for managing tachyarrhythmias through vagus nerve stimulation is provided. An implantable neurostimulator, including a pulse generator, is configured to deliver electrical therapeutic stimulation in a manner that results in creation and propagation (in both afferent and efferent directions) of action potentials within neuronal fibers of a patient's cervical vagus nerve. Operating modes of the pulse generator are stored. A maintenance dose of the electrical therapeutic stimulation is delivered to the vagus nerve via the pulse generator to restore cardiac autonomic balance through continuously-cycling, intermittent and periodic electrical pulses. A restorative dose of the electrical therapeutic stimulation is delivered to prevent initiation of or disrupt tachyarrhythmia through periodic electrical pulses delivered at higher intensity than the maintenance dose. The patient's normative physiology is monitored via a physiological sensor, and upon sensing a condition indicative of tachyarrhythmia, is switched to delivering the restorative dose to the vagus nerve.
US11097105B2	Pulse current generation circuit for neural stimulation, charge compensation circuit and method, and implantable electrical retina stimulator A pulse current generation circuit (100) for neural stimulation includes an analogue signal receiving device (101) for receiving an analogue signal; an analogue-to-digital converter (102) for converting the analogue signal into a digital control signal; a current signal controller (103) for producing, according to the digital control signal, pulse current parameters for generating bidirectional pulse current signals; and a current generator (104) for generating, according to the pulse current parameters, bidirectional pulse current signals for neural stimulation, and the current generator can generate pulse currents of different precisions according to the pulse current parameters. In addition, the present invention further relates to a charge compensation circuit, a charge compensation method, and an implantable electrical retina stimulator using the pulse current generation circuit or the charge compensation circuit.
US11097104B2	Electroporation device and a method for controlling an electroporation device The present invention provides an electroporation device and a method for controlling an electroporation device for facilitating delivering active substances into skin such as stratum corneum while minimizing discomfort of a user by modulating applied voltage pulses. The electroporation device according to the present invention comprises: a measurement unit being configured to provide multiple outputs of one or more resistance measurement voltage pulses for measuring a resistance of skin of a user at a predetermined interval; and an output unit being configured to provide an output of one or more electroporation voltage pulses to the skin of the user based on the resistance of the skin of the user per each output of the one or more resistance measurement voltage pulses.
US11097103B2	Sensor band for multimodal sensing of biometric data A resilient fabric band providing a sensor platform for a wearer in order to sense a plurality of biometric data, the band comprising: a pair of ECG sensors coupled to an interior surface of a body of the band, each of the pair of ECG sensors located on either side of a front to back centerline of the body; a pair of bio impedance sensors coupled to the interior surface of the body of the band, each of the pair of bio impedance sensors located on either side of the front to back centerline; a strain gauge sensor coupled to the body of the band; a computer device mounted on the body of the band via a housing, the computer device including a power source, a computer processor, a memory for storing instructions for execution by the computer processor, and a network interface for transmitting data sensed by the sensors; and a plurality of communication pathways connecting the computer device to each of the sensors, the communication pathway for sending power from the power supply to the sensors as controlled by the computer processor and for receiving sensed data from the sensors by the computer processor.
US11097101B2	Temperature measurement in arrays for delivering TTFields TTFields therapy is a proven approach for treating tumors using electric fields. This application describes systems and methods for measuring the temperature at the electrode elements of the transducer arrays that are used to apply the TTFields to a subject. A distal circuit is positioned adjacent to each transducer array, and the distal circuit interfaces with temperature sensors in the transducer array to obtain temperature readings. Those temperature readings are transmitted to a central hub. In some embodiments, temperature measurements from all of the distal circuits occur simultaneously.
US11097100B2	Needle tip mounted on skin treatment apparatus, and skin treatment apparatus Disclosed are a needle tip mounted in a cartridge form (in a replaceable manner) to a hand piece of the skin treatment apparatus and allowing a drug to be injected deeply into an invaded potion, and a skin treatment apparatus having the needle tip mounted thereon. The needle tip includes a casing hollow in a vertical direction; a needle unit disposed in the casing and reciprocating in the vertical direction; and at least one sealing member disposed between the casing and the needle unit, wherein the needle unit includes: a housing disposed inside the casing; and at least one needle electrode disposed in the housing of the needle unit and extending in the vertical direction, wherein the at least one sealing member closes a space between the casing and the housing of the needle unit in the vertical direction.
US11097097B2	System amd method for individualizing neuromodulation A system for individualizing neuromodulation includes a neurostimulation device having a set of electrodes, and an application executing on a user device. Additionally or alternatively, the system can include any or all of: a sensor system, a head-securing mechanism, a remote server, storage, an accessory device, and any other suitable component. A method for individualizing neuromodulation includes determining a task of interest to a user; determining a user skill level associated with the task; determining a set of goals; determining an individualized neuromodulation program comprising a neurostimulation pattern; and delivering the neurostimulation pattern to the user. Additionally or alternatively, the method can include any or all of: determining user progress; displaying user progress; receiving user feedback; determining and/or adapting neuromodulation program based on user progress and/or user feedback; and any other suitable process.
US11097096B2	Stimulation apparatus A medical apparatus for a patient comprises an external system and an implantable system. The external system is configured to transmit one or more transmission signals, each transmission signal comprising at least power or data. The implantable system is configured to receive the one or more transmission signals from the external system, and to deliver stimulation energy to the patient. Methods of delivering stimulation energy are also provided.
US11097095B2	Cochlear implants, magnets for use with same and magnet retrofit methods A cochlear implant exomagnet that includes a magnet apparatus and a magnet mount configured to secure the magnet apparatus to a cochlear implant in such a manner that the magnet apparatus is not located within the internal magnet pocket of the cochlear implant.
US11097093B2	Method for managing a cardiac pump In a method for managing a cardiac pump intended to assist the heart of a patient, the cardiac pump sends pressurized blood at a flow rate proportional to the speed of rotation Vrpm of the pump through the aortic valve of the heart. The steps, during a same ventricular systole, include: detecting mitral valve closure, rotational speed Vrpm of the pump being strictly less than a maximum value Vrpm max, increasing Vrpm of the pump such that, at time t2, after the time t corresponding to the closing of the mitral valve, the speed of rotation of the pump is equal, or substantially equal, to the maximum value Vrpm max of the speed of rotation, and keeping the speed of rotation Vrpm of the pump at this maximum value Vrpm max for at least a portion of the time period T during which the aortic valve is open.
US11097091B2	Implantable pump system having a coaxial ventricular cannula An implantable cardiovascular blood pump system is provided, suitable for use as a left ventricular assist device (LVAD) system, having an implantable cardiovascular pump, an extracorporeal battery and a controller coupled to the implantable pump, and a programmer selectively periodically coupled to the controller to configure and adjust operating parameters of the implantable cardiovascular pump. The implantable cardiovascular blood pump includes a coaxial inflow cannula and outflow cannula in fluid communication with one another and with a pumping mechanism. The pumping mechanism may be a vibrating membrane pump which may include a flexible membrane coupled to an electromagnetic actuator assembly that causes wavelike undulations to propagate along the flexible membrane to propel blood through the implantable cardiovascular pump. The implantable cardiovascular pump may be programmed to operate at frequencies and duty cycles that mimic physiologic flow rates and pulsatility while avoiding thrombus formation, hemolysis and/or platelet activation.
US11097090B2	Mechanical assist device Methods and apparatuses relate to an implantable device for providing contractile assistance to an organ. The device may include an actuator and anchors located on either side of the actuator. The anchors engage with oppositely positioned tissue walls of an organ chamber, and provide contractile assistance to the organ, repeatedly, at appropriate times. For example, the device may be implanted within the right ventricle, anchored to the right ventricular free wall and the ventricular septum. The device may function to bring the opposing walls of the ventricle toward one another, synchronized with the pacing of the heart, resulting in an improved ejection fraction of blood from the chamber. In some embodiments, the actuator includes a bladder that is configured to contract upon receiving an inflow of pressurized fluid therein. When the fluid exits therefrom, the bladder relaxes back to an initial, extended state.
US11097085B2	Computerized oral prescription administration devices and associated systems and methods Computerized oral prescription administration (COPA) devices, systems, and methods are provided. In one embodiment, a method of dispensing a substance to an intended user is provided. The method comprises identifying an intended user based on a biological marker of the intended user; determining whether a unique dentition of the intended user is positioned within a recess of a mouthpiece based on a comparison to data associated with the intended user's unique dentition being positioned within the recess; and dispensing a substance from a reservoir coupled to the mouthpiece in response to identifying the intended user and determining that the intended user's unique dentition is positioned within the recess of the mouthpiece.
US11097080B2	Classical conditioning tool kit for attitude change used in the provision of psychological support The invention relates to psychology and is used in psychological correction of mental states and dependencies and correction of social behavior in methods aimed at attitude change. Provided is a classical conditioning tool kit for changing problematic attitude to positive attitude while providing psychological support by using tools of pleasant classical conditioning affecting all sensory channels of information perception of a human. The kit includes at least one flavoring food additive, at least one aromatic essential oil, at least one mineral, auto-training text for audio listening, and an image with a suggestive formula to change a problematic attitude to a positive attitude. One image with a selected suggestive formula for changing the attitude includes one or more linguistic phrases targeting kinesthetic sensations, and another image includes linguistic persuasions that assist with forming a new attitude. All tools evoke pleasant feelings in a patient.
US11097079B2	Cognitively inducing sleep cycles by leveraging wearables A computer-implemented method, system, and computer program product to optimize sleep quality by inducing sleep stages. The method includes: determining a total sleep time; calculating, using the total sleep time, a cycle duration for a sleep cycle, where the sleep cycle includes a first, second, third, fourth, and fifth sleep stage; calculating a first, second, third, fourth, and fifth stage time for the first, second, third, fourth, and fifth sleep stages respectively; generating a first, second, third, fourth, and fifth external parameter for the first, second, third, fourth, and fifth sleep stages respectively, where the external parameters are parameters to facilitate a transition between sleep stages; and executing the first, second, third, fourth, and fifth external parameters upon reaching the calculated stage time for the corresponding sleep stages.
US11097078B2	Method and system for facilitating the transition between a conscious and unconscious state A system and method for facilitating and maintaining various states of a user consciousness, including the transition between a conscious and unconscious state, is provided. The system and method include use of a smart device having a user interface, a biometric sensor coupled to a user and configured to transmit the user's biometric data to the smart device and an environmental sensor configured to transmit environmental data to the smart device. The smart device controls one or more environmental systems proximate the user and an audio/visual device proximate the user to facilitate transitioning the state of the user.
US11097077B2	Patient interface and aspects thereof A patient interface can have a frame supporting a sealing member. Various features of the sealing member can improve comfort and sealing performance in the context of forming seals with the nares of a user, as well as contact with other facial surfaces. The sealing member can include convex portions, concave portions and thickness variations for providing various sealing, comfort, and deformability effects.
US11097076B2	Blower for breathing apparatus This invention relates to a blower for a breathing apparatus. The blower comprising a bottom support with a stub axle, a top support with a stub axle, a motor core comprising a motor stator and rotor, and an impeller coupled to the motor core via a shaft, the shaft is rotatably coupled at a first end to the stub axle on the top support and at a second end via the stub axle on the bottom support.
US11097075B2	Aerosol delivery device and method utilizing a flavoring reservoir Disclosed herein is a device configured to impart flavoring to an airstream admitted the device prior to the airstream reaching an aerosol generator of the device, the device thereby operable to deliver a flavored aerosol from an outlet.
US11097070B2	Infusion pump apparatus, method and system An infusion pump system is disclosed. The infusion pump system includes an infusion pump and a controller device in wireless communication with the infusion pump, wherein the controller including instructions for controlling the infusion pump, wherein the instructions may be synchronized with a secure web portal.
US11097066B2	Apparatus for mounting a pen needle assembly A storage device (30) for storing a pen needle assembly (10) includes a housing (30) having first wells (44) with a dimension for receiving the pen needle assembly and second wells (46) for receiving an inner shield (24) of the pen needle assembly. The second wells (46) have a diameter less than a diameter of the first wells (44). An ejector (40) in the housing (34) can be actuated to eject the used needle hub (16) and outer covers (22) from the first well (44) and the inner shield (24) from the second well (46) for disposal. A method of coupling a pen needle delivery device to a needle hub is also provided.
US11097063B2	Syringe device with a dose limiting mechanism and an additional safety mechanism A syringe device for ejecting a dose of a medicament, the syringe device comprising: a dose limiting mechanism arranged to interact with a dose ejecting mechanism to prevent ejection of a dose exceeding a set dose, and a safety mechanism, which is arranged such with respect to the dose ejecting mechanism that, if the dose limiting mechanism fails, the safety mechanism prevents ejection of a dose exceeding the set dose.
US11097061B2	Systems, kits and methods for loading and delivering a small volume dose from a syringe A kit is disclosed for accurately loading a small volume dose of a medication within a syringe and for delivering the small volume dose of the medication at a treatment site. The kit generally includes a loading and delivery system in accordance herewith, a syringe, and a medication. The loading and delivery system includes a syringe delivery ring and a syringe loading guide, which may be used for example, to administer a small volume dose of a medication at the end of an ocular surgery.
US11097060B2	Infusion device drive unit with blocking device Disclosed is an infusion device drive unit that includes a pump drive configured to operatively mechanically couple to a dosing unit to control operation of the dosing unit. The infusion device drive unit further includes a blocking member that is movable between a blocking configuration and a enabling configuration, the blocking member enabling the establishing and/or the releasing of an operative mechanical coupling between the pump drive and the dosing unit in the enabling configuration and preventing the establishing and/or the releasing of an operative mechanical coupling between the pump drive and the dosing unit in the blocking configuration. The infusion device drive unit controls the blocking member to take on the enabling configuration if the pump drive is in at least one pre-determined configuration and to take on the blocking configuration if the pump drive is in a configuration different from a pre-determined configuration.
US11097054B2	Cartridge with flexible bag for injecting a pharmaceutical solution and method for manufacturing the cartridge A cartridge (10) for injecting a pharmaceutical solution includes at least one flexible small bag (18, 22) made of thin film walls, having a chamber (12, 14) containing a pharmaceutical substance (S, P, L) and having a head surface (37) being outwardly convex. A syringe (100) for injecting a pharmaceutical solution (S) includes a body (102) extended along a main axis (X), an accommodating space (120) to accommodate a cartridge (10), and a plunger (110) with a head (113) being dome-shaped and convex towards the space (120), preferably asymmetrical with respect to the main axis (X). An injection kit for injecting a pharmaceutical solution including a syringe (100) and at least one cartridge (100).
US11097051B2	Methods and apparatus for detecting and reacting to insufficient hypoglycemia response A method for providing blood glucose data is provided. In response to a suspension of a continuous basal insulin delivery, by an insulin delivery pump, the method identifies a condition indicating continuing hypoglycemia that continues when basal insulin delivery is suspended; and performs an action, by the insulin delivery pump, based on identifying the condition.
US11097043B2	Filter and device including the same A filter and a device including the filter may include a filter and a plurality of pores arranged two-dimensionally on the filter. The plurality of pores may include a plurality of first pores having a longer structure in a certain direction and a plurality of second pores having a longer structure in a direction different from that of the first pore. The first and second pores may have a two-dimensional arrangement in order to suppress or prevent the occurrence of cracks in the filter due to stress.
US11097037B2	Systems and methods for leukoreducing a red blood cell-containing fluid and concentrated red blood cells Systems and methods are provided for separating a red blood cell-containing fluid into separated red blood cells and another fluid constituent. A suitable system includes a disposable fluid flow circuit and a durable, reusable separation system, with the circuit being mounted onto or otherwise associated with the separation system. The circuit includes a membrane separator for separating the fluid into its constituent parts, as well as a leukoreduction filter. The leukoreduction filter may be used before or after the red blood cell-containing fluid has been passed into the membrane separator. The red blood cell-containing fluid (if the leukoreduction filter is positioned upstream of the membrane separator) or the separated red blood cells (if the leukoreduction filter is positioned downstream of the membrane separator) may also be passed through a microaggregate filter prior to passing through the leukoreduction filter.
US11097035B2	Compositions and methods for altering the rate of hydrolysis of cured oil-based materials Disclosed herein is the correlation of chemical properties of oils with the physical properties of a resulting cured oil composition. Also disclosed are biocompatible materials and coatings for medical devices prepared using enriched oils and methods for enhancing or modifying the physical and chemical characteristics of cured oils by enriching such oils with fatty acid alkyl esters. Methods of tailoring the properties of biocompatible materials and coatings to deliver one or more therapeutic agents are also provided.
US11097033B2	Photoactivated crosslinking of a protein or peptide A method of crosslinking a protein or peptide for use as a biomaterial, the method comprising the step of irradiating a photoactivatable metal-ligand complex and an electron acceptor in the presence of the protein or peptide, thereby initiating a cross-linking reaction to form a 3-dimensional matrix of the biomaterial.
US11097030B2	Additive compositions for pigmented disinfection and methods thereof The invention provides to a powdered composition of additives and a method of use thereof for increasing the visibility, potency and coverage of disinfectant solutions, such as bleach.
US11097024B1	Systems and methods for providing ultraviolet sterilization, disinfection and decontamination of gaming machines and associated equipment Systems and methods for providing ultraviolet (UV) sterilization, disinfection and decontamination of electronic gaming machines (EGMs), gaming chips, dice, playing cards, currency, TITO tickets, etc. The ultraviolet sterilization, disinfection and decontamination may include a singular or plurality of UV lamps of any type or style or UV LEDs or RGB-UV LEDs or any type or style of UV LEDs of at least such wavelengths to be effective in at least partially reducing or eliminating viruses or the like. The UV sources are mounted on, in or proximate to a variety of gaming devices or equipment such as EGMs, mechanical gaming machines, chip trays, chippers, dice holders, automatic card shufflers, bill validators, currency counting devices, currency dispensing devices, printers, magnetic card readers, playing card and currency sterilization, disinfection or decontamination storage mechanisms, ATMs, redemption machines, promotional kiosks, etc., or similar devices used in other industries.
US11097022B2	Microwave plasma sterilisation system and applicators therefor A sterilization system having a controllable non-ionizing microwave radiation source for providing microwave energy for combining with a gas to produce atmospheric low temperature plasma for sterilizing biological tissue surfaces or the like. A plasma generating region may be contained in a hand held plasma applicator. The system may include an impedance adjustor e.g. integrated in the plasma applicator arranged to set a plasma strike condition and plasma sustain condition. The gas and microwave energy may be transported to a plasma generating region along an integrated cable assembly. The Integrated cable assembly may provide a two way gas flow arrangement to permit residual gas to be removed from the surface. Invasive surface plasma treatment is therefore possible. The plasma applicator may have multiple plasma emitters to produce a line or blanket of plasma.
US11097018B2	Organomedicinals for imaging and treatment of neurodegenerative disorders Provided herein are compounds for the imaging and treatment of TDP43-mediated disorders. The compounds disclosed bind TDP43 aggregates and may be used to diagnose and treat amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).
US11097017B2	Gadolinium-based contrast agents for sensitive detection of Zn2+with MRI In some aspects, the present disclosure provides novel ligands, which may be used to make novel MRI contrast agents for the detection of zinc. In further aspects, by the present disclosure also provides methods of using as imaging agents and compositions thereof.
US11097015B2	Disulfide bond stabilized polypeptide compositions and methods of use Provided herein are polypeptides comprising one or more non-native cysteine residues that form a disulfide bridge between non-native cysteines within the protein or between non-native cysteines of two monomers of the protein. Such modified human polypeptides are useful in treatment of genetic diseases via enzyme replacement therapy and/or gene therapy.
US11097013B2	Anti-HER2 antibody-maytansine conjugates and methods of use thereof The present disclosure provides anti-HER2 antibody-maytansine conjugate structures. The disclosure also encompasses methods of production of such conjugates, as well as methods of using the same.
US11097008B2	Colloidal microcrystalline cellulose compositions, their preparation and products The present invention is directed colloidal microcrystalline compositions, particularly for suspending particles in low viscosity fluids, produced by co-attrition of a mixture of microcrystalline cellulose and at least a polysaccharide in the presence of acidic attrition aid; their preparation; and, products made therewith.
US11097005B2	Use of cadherin-11 antagonists to treat metabolic disorders and/or increase insulin sensitivity Provided herein are methods and pharmaceutical compositions for the treatment of obesity-associated conditions using cadherin-11 antagonists.
US11097000B2	Klebsiella pneumoniae capsule polysaccharide vaccines The disclosure provides various immunogens comprising a repeat unit of saccharide of Klebsiella pneumoniae CPS, which has a formula selected from the group consisting of Formulae (I) to (VI) as described herein. Also provided are vaccines including one or more immunogens selected from Formula (I) to (VI) and methods of eliciting an immune response against a Klebsiella pneumoniae and preventing infection of Klebsiella pneumoniae by using an immunogen of the invention.
US11096999B2	Treatment and prevention of malaria There are provided antigens, vectors encoding the antigens, and antibodies and other binding compounds to the antigens and uses thereof in the prevention or treatment of malaria. In particular, compositions are provided comprising fragments of Reticulocyte-binding protein Homologue 5 (PfRH5). In particular, the invention provides fragments of PfRH5 rationally designed on the basis of the PfRH5 crystal structure, wherein said fragments which lack disordered regions, particularly the flexible N-terminal region and/or flexible central linker.
US11096998B2	Chimeric antigen receptors comprising BCMA-specific fibronectin type III domains and uses thereof BCMA-specific fibronectin type III (FN3) domains, BCMA-targeting chimeric antigen receptors (CARs) comprising the FN3 domains, and engineered BCMA-targeting immune cells expressing the CARs are described. Also described are nucleic acids and expression vectors encoding the FN3 domains and the CARs, recombinant cells containing the vectors, and compositions comprising the engineered immune cells. Methods of making the FN3 domains, CARs, and engineered immune cells, and methods of using the engineered immune cells to treat diseases including cancer are also described.
US11096988B2	CD80 variant immunomodulatory proteins and uses thereof Provided herein are variant CD80 polypeptides, immunomodulatory proteins comprising variant CD80 polypeptides, and nucleic acids encoding such proteins. The immunomodulatory proteins provide therapeutic utility for a variety of immunological and oncological conditions. Compositions and methods for making and using such proteins are provided.
US11096986B2	Use of a neurofilament peptide for targeting neural stem cells The present invention shows that the isolated NFL-TBS40-63 peptide is highly specific for neural stem cells. It is therefore presented here for use in a method for detecting these cells in vitro or in vivo, for addressing chemical compounds or biological materials to said cells, or for treating neurodegenerative disorders or brain tumours.
US11096985B2	Antimicrobial peptides, their variants and uses The present invention relates to novel antimicrobial peptide and variants thereof. The invention further relates to method of killing or inhibiting growth of microbes and use of the peptide here disclosed as a medicament, feed additive, preservative or surfactant.
US11096980B2	Method of using glycyrrhiza plant-based preparation to reduce toxic effect of polypeptide fungitoxin A method of using at least one Glycyrrhiza plant preparation selected from the group of flour of a whole, dried Glycyrrhiza plant, flour of the leaves of the dried Glycyrrhiza plant, flour of roots of the dried Glycyrrhiza plant, aqueous dry extract of the Glycyrrhiza plant, aqueous/ethanolic dry extract of the Glycyrrhiza plant, aqueous extract of the Glycyrrhiza plant, optionally together with at least one excipient, for reducing the toxic effect of at least one polypeptide fungitoxin in agrarian products.
US11096977B2	Development of a standardized and effect-optimized herbal extract of Wedelia chinensis and its use for treating disease A composition including a standardized Wedelia chinensis extract and a method of treating an androgen-stimulated disorder with such a composition. Also provided are a method for qualifying a standardized preparation of a Wedelia chinensis extract for treating an androgen-stimulated disorder and a method for treating said disorder with a thus qualified preparation.
US11096973B2	Herbal decarboxylation and infusion system A system for decarboxylating and infusing an organic material includes a decarboxylation and infusion apparatus is provided. The apparatus includes a heated reservoir in operable communication with a user interface whereon a user selects decarboxylation and infusion settings. The heated reservoir has a mixing element to agitate an organic material and solvent disposed therein as well as a filter to filter the organic material following the infusion.
US11096969B2	Composition for injection which can be used for treatment of heart diseases and contains fibroblasts, and method for producing fibroblast for therapy use The present invention aims to provide a method which has not been established yet and which is useful for achieving long-term and fundamental cure of a necrotic cardiac tissue region to allow recovery of functionality of the heart.The present invention provides an injectable composition for treatment of a cardiac disease, the composition comprising fibroblasts, wherein the fibroblasts contain CD106-positive fibroblasts, preferably contain CD90-positive fibroblasts, and the fibroblasts do not form colonies.
US11096963B2	Cryoprecipitate compositions and methods of preparation thereof Provided herein are compositions and kits including a pathogen-inactivated cryoprecipitate suitable for infusion into a subject at least 1 day after thawing. The methods are useful in the efficient preparation of cryoprecipitates with desirable characteristics, including pathogen-inactivated cryoprecipitates that are suitable for infusion into a subject at least 1 day after thawing.
US11096962B2	Nanoparticles for use as a therapeutic vaccine The present invention relates to the field of human health and more particularly concerns nanoparticles for use as a therapeutic vaccine in the context of radiotherapy in a subject suffering of a cancer, in particular of a metastatic cancer or of a liquid cancer.
US11096961B2	Pharmaceutical composition for suppressing spinal cord ischemic disorder To provide a gaseous pharmaceutical composition for suppressing spinal cord ischemic disorder, comprising carbon dioxide.
US11096959B2	Microenvironment hydrogen-supplying breathable layer and applications thereof A hydrogen-supplying breathable layer in the present disclosure comprises: a thin layer wrapping a hydrogen-producing formula inside, having an airtight outer side as well as an air-permeable inner side on which a plurality of micro pores are opened and featuring a monolayer or a composite layer; a hydrogen-producing formula wrapped inside the thin layer and not dissipated but absorbing moistures in air or liquid water for generation of hydrogen; hydrogen permeating a plurality of micro pores and released to skin and intra-corporal parts. The hydrogen-producing formula in the hydrogen-supplying breathable layer comprises metal peroxides (metal hydroxides or metal hydrides) and aluminum powders (or silica powders); the breathable layer is applicable to a dressing pack or other sanitary paraphernalia in daily lives for relieving non-bacteria inflammations and promoting health care effects.
US11096956B2	Antisense oligomers and uses thereof Provided herein are methods and compositions for increasing the expression of a protein, and for treating a subject in need thereof, e.g., a subject with deficient protein expression or a subject having a disease described herein.
US11096955B2	Synthetic promoters and uses thereof The present invention relates to the treatment and/or prevention of a retinal disease by using a polynucleotide promoter wherein the polynucleotide or a variant thereof consists of the sequence (hRHOs-wt; SEQ ID NO. 1) TCCTCCTAGTGTCACCTTGGCCCCTCTTAGAAGCCAATTAGGCCCTCAG TTTCTGCAGCGGGGATTAATATGATTATGAACACCCCCAATCTCCCAGA TGCTGATTCAGCCAGGAGCTTAGGAGGGGGAGGTCACTTTATAAGGGTC TGGGGGGGTCAGAACCCAGAGTCATCCAGCTGGAGCCCTGAGTGGCTGA GCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCACGGGTCAGCCA CAAGGGCCACAGCC wherein the fragment TGAACACCCCCAATCTCCCAGATGCT which is the sequence from nucleotide 77 to nucleotide 102 of SEQ ID NO. 1, is substituted. The invention is also directed to the use of relative vector, vector systems, host cells and pharmaceutical compositions.
US11096942B2	Heterocyclic compounds and uses thereof The present invention provides compounds, pharmaceutically acceptable compositions thereof, and methods of using the same.
US11096938B2	Device and kit for dosing and dispensing non-liquid medicine A kit comprising a device for dosing and dispensing a dose of a non-liquid medicine that is readily dispersible in an aqueous solution suitable for oral administration, preferably a temozolomide formulation that can be titrated readily and accurately.
US11096930B2	Substituted imidazopyridine compounds as inhibitors of indoleamine 2,3-dioxygenase and/or tryptophan-2,3-dioxygenase Disclosed herein are substituted imidazopyridine compounds of formula (I) which are inhibitors of indoleamine 2,3-dioxygenase (IDO) and/or tryptophan-2,3-dioxygenase (TDO) enzymes: (I). Also disclosed herein are uses of the compounds in the potential treatment or prevention of an IDO- and/or TDO-associated disease or disorder. Also disclosed herein are compositions comprising these compounds. Further disclosed herein are uses of the compositions in the potential treatment or prevention of an IDO- and/or TDO-associated disease or disorder.
US11096927B2	Anti-flavivirus compounds and methods of use The present invention concerns the use of compounds and compositions for the treatment or prevention of Flavivirus infections, such as dengue virus infections and Zika virus infections. Aspects of the invention include methods for treating or preventing Flavivirus virus infection, such as dengue virus and Zika virus infection, by administering a compound or composition of the invention, to a subject in need thereof; methods for inhibiting Flavivirus infections, such as dengue virus and Zika virus infections, in a cell in vitro or in vivo; pharmaceutical compositions; packaged dosage formulations; and kits useful for treating or preventing Flavivirus infections, such as dengue virus and Zika virus infections.
US11096919B2	Esters for treatment of ocular inflammatory conditions The present invention relates to ophthalmic compositions and methods for the treatment of dry eye and other inflammatory ocular conditions. In particular, the present invention relates to a composition comprising an esterified anti-inflammatory lipid mediator, which is an ester of an anti-inflammatory lipid mediator that is a reaction product of the anti-inflammatory lipid mediator and a monohydric alcohol or an amide wherein the majority of the anti-inflammatory lipid mediator is present in an ester form. In this way, the compositions are substantially free of an acid form of the anti-inflammatory lipid mediators. This composition can be topically delivered to the ocular surface via a preparation, solution, gel, ointment, and/or strip and/or a contact lens.
US11096916B2	Use of nicotinic acetylcholine receptor alpha 7 activators The invention concerns the use of a nicotinic acetylcholine receptor alpha 7 activators for the treatment, prevention or delay of progression of dyskinesia associated with dopamine agonist therapy in Parkinson's Disease.
US11096915B2	Methods for the preparation of a levothyroxine solution Described is a method for the preparation of an oral levothyroxine composition, comprising the steps of combining levothyroxine or a salt thereof, a water-miscible organic solvent or a sugar alcohol and water, adjusting the pH to at least 8 providing a basic aqueous medium, dissolving the levothyroxine in the basic aqueous medium to yield a levothyroxine solution, and lowering the pH of the levothyroxine solution to between 3.5-4.9. also described is an oral levothyroxine composition obtainable by the said method and its use as a medicament.
US11096914B2	Amino acid compositions and methods for the treatment of liver diseases This disclosure provides pharmaceutical compositions comprising amino acid entities and uses thereof. Methods for improving liver function and for treating liver diseases comprising administering an effective amount of the compositions to a subject in need thereof are also disclosed.
US11096911B2	Hierarchical siliceous mesosilicalite nanocarrier A mesosilicalite nanocarrier having a hierarchical silicalite characterized by a molar ratio of aluminum to silica in a range of 1:3000 to 1:1000. The hierarchical silicalite includes mesopores of a hexagonal structure, and micropores of silicalite structure with a microporous volume in the range of 0.05 cc/g to 0.1 cc/g. The nanocarrier has a mesophase content in the range of 30 wt % to 70 wt %, a microphase content in the range of 30 wt % to 70 wt %, and a mean pore diameter in the range of 1.5 nm to 5.5 nm. A method of preparing the stable mesosilicalite nanocarrier with hierarchical micro/mesopores to load an antioxidant or drug for targeted drug delivery is also described.
US11096909B2	Compounds for use in the treatment of cancer It is an aim of the present invention to provide inhibitors of human diphtheria toxin-like ADP-ribosyltransferases, such as ARTD10, for use as a medicine. It is another aim of the invention to provide compounds for use as human mono-ADP-ribosyltransferase (mARTD) inhibitors in vitro. In the present invention, it has been discovered that human ARTD10, which belongs to an enzyme family linked to cancer biology, can be specifically inhibited by the benzamide comprising compounds disclosed in the invention, such as 4,4′-oxydibenzamide.
US11096907B2	Phytonadione compositions and related methods Stable Phytonadione compositions for parenteral administration are provided which comprise (E) isomer of phytonadione at or greater than 97% w/w as the active ingredient, and is substantially free of (Z) isomer. Said compositions are stable, sterile, and particulate-free. Further, said compositions reduce or avoid allergic reactions to benzyl alcohol and polysorbate. In some aspects, the compositions are free or substantially free of benzyl alcohol and/or reduced amounts of polysorbate. Methods of manufacture and methods of administration also provided.
US11096906B2	Pharmaceutical composition for preventing or treating Alzheimer's disease The present disclosure relates to a use of a phloroglucinol-based compound and its salt for preventing and treating Alzheimer's disease. The pharmaceutical composition for preventing or treating Alzheimer's disease of the present disclosure fundamentally suppresses the cause of β-amyloid formation, thereby exerting a remarkable effect of allowing ultimate treatment of Alzheimer's disease. The present disclosure provides the use of the single substance, which has been isolated from Dryopteris crassirhizoma and identified, for preventing or treating Alzheimer's disease for the first time.
US11096905B2	Use of cannabinoids in the treatment of epilepsy The present disclosure relates to the use of cannabidiol (CBD) for the treatment of atonic seizures. In particular the CBD appears particularly effective in reducing atonic seizures in patients suffering with etiologies that include: Lennox-Gastaut Syndrome; Tuberous Sclerosis Complex; Dravet Syndrome; Doose Syndrome; Aicardi syndrome; CDKL5 and Dup15q in comparison to other seizure types. The disclosure further relates to the use of CBD in combination with one or more anti-epileptic drugs (AEDs).
US11096903B2	Use of pinocarveol The present invention relates to a pharmaceutical composition comprising pinocarveol for preventing or treating metabolic diseases, and functional food composition using the pharmaceutical composition for improving or alleviating metabolic diseases. Pinocarveol according to the present invention reduces weight, visceral fat, and cholesterol concentration, improves blood liver function index, reduces blood sugar, and additionally inhibits a metabolic inflammation reaction, and thus can be effectively used ultimately as a medical or functional food composition exhibiting prevention or treatment activities for metabolic diseases selected from the group consisting of obesity, diabetes, dyslipidemia, and syndromes of fatty liver and insulin-resistance.
US11096899B2	Bacterial membrane nanoparticles as an immunotherapy system for cancer treatment Provided herein are nanoparticles comprising a polyplex core comprising one or more pH-responsive polymers and one or more anionic immune adjuvants, wherein each pH-responsive polymer comprises ionizable amine groups; and a shell of bacterial cell membrane components at least partially coating the polyplex core, wherein the bacterial cell membrane components comprise TLR 2 and/or TLR 4 agonists. Also provided are methods of stimulating an immune response in a mammal using the nanoparticle.
US11096896B2	Tablet dosage form for buccal absorption of active ingredients The invention relates to a tablet dosage form for buccal absorption of active ingredients comprising a population of particles and an active ingredient to be released in the oral cavity for absorption through the oral mucosa, the population of particles comprising directly compressible (DC) and non-directly compressible (non-DC) sugar alcohol particles, the non-DC particles providing the tablet with a plurality of discrete non-DC areas.
US11096894B2	Oral tablet for induced saliva generation The invention relates to an oral tablet suitable for active pharmaceutical ingredients comprising a population of particles, the population of particles comprising directly compressible (DC) and non-directly compressible (non-DC) sugar alcohol particles, the non-DC particles providing the tablet with a plurality of discrete non-DC areas, and the non-DC areas resulting in induced saliva generation upon mastication of the tablet.
US11096892B2	High loading and fast disintegration film for fast drug absorption A film forming composition comprises a film forming component and a solvent, wherein the film forming component comprises 0-50 wt % of a first water soluble polymer, 0.3-40 wt % of a second water soluble polymer, 0-15 wt % of plasticizer and 50-70 wt % of active ingredient. The first and second water soluble polymers have a Tg of −52° C. to 216° C., and difference of Tg values of the first and second water soluble polymer is 62-268° C. The film formed by the film forming composition capable to load high content of active ingredient and lead to fast absorption of active ingredient is provided.
US11096888B2	Long acting drug delivery device and its use in contraception The invention relates to a method for altering the release characteristics of a long acting drug delivery device containing at least two drugs in different segments, wherein the segments are arranged to a specific sequence. The invention furthermore relates to a drug delivery device with reduced initial burst containing two different drugs in different segments. The invention further relates to a delivery device manufactured according to the a.m. method and its use in contraception and gynecological therapies.
US11096887B2	Extended release, abuse deterrent pharmaceutical compositions Pharmaceutical compositions comprising at least one active pharmaceutical ingredient or a pharmaceutically acceptable salt thereof, at least one hydrophilic plastomer, at least one hydrophilic elastomer, and at least one deliquescent plasticizer, wherein the pharmaceutical compositions provide extended release of the API and have abuse deterrent properties. Methods for preparing the pharmaceutical compositions in which the components of the composition are humidified such that the deliquescent plasticizer deliquesces, thereby plasticizing the hydrophilic polymers.
US11096886B2	Oat lipid extract A substantially solvent-free oat lipid extract containing neutral and polar lipid fractions, a method of manufacturing a substantially solvent-free oat lipid extract and compositions containing it.
US11096882B2	Anhydrous deodorant compositions with absorber combination I The present disclosure relates to anhydrous cosmetic compositions which contain a combination of a strongly swelling and a low-swelling water-absorbing component, an odor-absorbing component and a deodorant active ingredient. These compositions have an outstanding deodorizing effect and improved sensory features and additionally result in a minimization of sweat spots on textiles. Furthermore, the present disclosure relates to a cosmetic product containing these anhydrous compositions and the use of this composition or product for reduction of the body odor released by perspiration. Finally, the present disclosure relates to the use a strongly swelling water-absorbing component in combination with an odor-absorbing component to improve the sensory characteristics of anhydrous deodorant compositions.
US11096881B2	Use of thiophosphate derivatives as skin depigmenting agents The present invention relates to a skin depigmentation composition comprising (i) at least one thiophosphate derivative and (ii) acceptable carriers for topical, oral and/or parenteral administrations to human. The present invention further relates to the cosmetic and medical treatment uses thereof for reducing skin and/or hair pigmentation.
US11096875B2	Delivery particle The present application relates to encapsulated benefit agents, compositions comprising such encapsulated benefit agents and processes for making and using compositions comprising such encapsulated benefit agents. Such encapsulated benefit agents eliminate or minimize one or more of the drawbacks of current encapsulated benefit agents and thus provide formulators with additional perfume delivery opportunities.
US11096870B2	Pacifier with milk dispenser A pacifier for dispensing a liquid such as milk, the pacifier including a nipple, including a milk entering aperture disposed at a first end of the nipple, a milk expelling aperture disposed at a second end of the nipple opposite from the first end of the nipple, and a milk holding portion to hold milk therein and to receive the nipple, the milk receiving portion including a milk supplying aperture to correspond to the milk entering aperture of the nipple to supply milk from the milk holding portion to the nipple.
US11096866B2	Container consisting of plastic material, and method for producing a container of this type A container of plastic material is produced using the blow, fill and seal method, with the filler material, enclosed by a container wall (15, 20) that can be autoclaved. At least one shape (19, 21, 23, 25, 29, 33) is provided in the container wall (15, 20) that ensures, despite a low relative air volume in the container, that when administering the filler material by infusion, the container wall (15, 20) collapses at least partially reducing the volume, without aeration of the container.
US11096862B2	Systems and methods for providing network connectivity and remote monitoring, optimization, and control of pool/spa equipment Systems and methods for providing network connectivity and remote monitoring, optimization, and control of pool/spa equipment are provided. “Internet-of-Things” (IoT) functionality is provided for pool and spa equipment in a flexible and cost-effective manner. Network connectivity and remote monitoring/control of pool and spa equipment is provided by various components such as a network communication and local control subsystem installed in pool/spa equipment, and other components. Also disclosed are various control processes (“pool logic”) which can be embodied as software code installed in any of the various embodiments of the present disclosure.
US11096861B2	Systems and methods for gravity-assisted cardiopulmonary resuscitation and defibrillation Increasing blood circulation, lowering intracranial pressure, and increasing cerebral perfusion pressure during the administration of cardiopulmonary resuscitation by gravity-assist due to elevation of one or both of the torso and head of an individual.
US11096855B2	Rehabilitation training apparatus for ankle joint Provided is a rehabilitation training apparatus for an ankle joint. The rehabilitation training apparatus comprises a working platform, a Z-axis rotating mechanism, a Y-axis rotating mechanism, an X-axis rotating mechanism, and a pedal. The Y-axis rotating mechanism includes an annular bracket vertically fastened to a driving arm of the Z-axis rotating mechanism, an annular sliding cover slidably disposed on one side wall of the annular bracket, a Y-axis driving mechanism for driving the annular sliding cover to rotate around the axis of the annular bracket, and a sliding block for locating the annular sliding cover. The Y-axis driving mechanism synchronously rotates with the annular sliding cover and the X-axis rotating mechanism is fastened to one side of the annular sliding cover.
US11096853B2	Surgical patient support for accommodating lateral-to-prone patient positioning According to the present disclosure, a surgical patient support provides support to a patient. The surgical patient support may include configuration to accommodate various patient body positions to provide a variety of access to the patient's body.
US11096850B2	Patient support apparatus control systems A patient support apparatus comprising a patient support deck, a touchscreen, and a controller. The patient support deck comprises a patient support surface. The touchscreen comprises a screen, an input surface arranged adjacent to the screen, and a touch sensor configured to generate an electric field within an envelope defined adjacent to the input surface to sense conductive objects interacting with the electric field. The touch sensor is operable at a first sensitivity level to detect conductive objects approaching the input surface, and a second sensitivity level to detect conductive objects engaging the input surface. The controller is in communication with the touchscreen to operate the touch sensor at the first sensitivity level during an absence of conductive objects interacting with the electric field, and to operate the touch sensor at the second sensitivity level in response to conductive objects interacting with the electric field within the envelope.
US11096847B2	Exoskeleton wheelchair system An exoskeleton wheelchair system includes a base, one or more wheels coupled to the base, a body support connected to the base. The body support includes a back support, and one or more leg supports pivotally coupled to the back support. The exoskeleton wheelchair system also includes an actuator linked with the one or more leg supports and configured to rotate the one or more leg supports, a processor, a memory module, and machine readable instructions that, when executed by the processor, cause the processor to rotate the one or more leg supports with the actuator. The one or more leg supports pivot about a first axis when the back support is in a standing position mode, and the first axis is maintained at a fixed position when the one or more leg supports pivot about the first axis while the back support is in the standing position mode.
US11096845B2	Wheelchair suspension Wheeled vehicles, such as wheelchairs, that are adapted to traverse obstacles are provided. The wheeled vehicles include a frame, drive wheels, front anti-tip wheels positioned in front of the drive wheels and rear anti-tip wheels positioned behind the drive wheels. One exemplary vehicle includes front anti-tip wheels supported by rigid arms that are fixed to the frame and drive assemblies that are independently suspended from the frame. Another exemplary vehicle includes a linkage that links the front and rear anti-tip wheels, such that movement of one of the front or rear anti-tip wheel relative to the frame causes movement of the other wheel relative to the frame.
US11096844B2	Drive control system for powered wheelchair A powered wheelchair is operated by sensor-based control pads that include force transducers to produce a variable output signal that is proportional to a varying force applied. The control pad provides an analog-type output that provides a variable speed signal to a controller to operate the wheelchair at a variable speed in both forward/reverse directions and in right or left turning directions.
US11096843B2	Vehicle wheelchair lift A wheelchair lift includes a base, and an arm slideably supported by the base. A chair support is rotatably supported by the arm. A linkage is supported by the arm and is extendable relative to the chair support from a coiled position to a straightened position. A motor is supported by the arm and is connected to the linkage. The linkage is coiled about the motor in the coiled position.
US11096833B2	Method and apparatus for drying inks printed on heat sensitive absorbent article components The present disclosure relates to methods and apparatuses for printing and drying inks on substrates. Printing systems may include a metering device positioned between a printing station and a light source. During operation, the printing station deposits ink onto a substrate to define a printed region. And the light source directs infrared light onto the substrate to define an illumination zone. The printed region is advanced from the printing station to the metering device and from the metering device through the illumination zone, wherein the ink is dried with infrared light traveling from the light source, which also heats the substrate and changes the modulus of elasticity of the substrate. In turn, the metering device isolates the printing station from the change in the modulus of elasticity to help reduce phase shifts caused by changes in the modulus of elasticity resulting from heat in the substrate.
US11096831B2	Negative pressure wound therapy device activation and control Embodiments of negative pressure wound therapy systems and methods are disclosed. In one embodiment, an apparatus includes a wound dressing, negative pressure source, user interface, sensor, and control circuitry. The user interface can receive an activation input. The sensor can detect whether the wound dressing is positioned over a wound. The control circuitry can cause supply of negative pressure in response to receipt of the activation input and a determination that the sensor detects that the wound dressing is positioned over the wound. In addition, the control circuitry can prevent supply of negative pressure in response to a determination that the sensor does not detect that the wound dressing is positioned over the wound.
US11096830B2	Dressing with increased apposition force In some embodiments, a dressing assembly may include a dressing bolster, an interface seal, and a base layer. The dressing bolster may include a first side, a second side, and a periphery. The interface seal may be coupled at the periphery of the dressing bolster. The base layer may include a base layer flange configured to be coupled to the dressing and to extend beyond the periphery of the dressing bolster. The dressing assembly may be suitable for treating a tissue site with reduced pressure and for creating an apposition force between a first portion of the tissue site and a second portion of the tissue site. Other systems, apparatus, and methods are disclosed.
US11096825B2	Apparatus for working on eye tissue by means of a pulsed laser beam For the purposes of working on eye tissue, an ophthalmological apparatus comprises a laser source that is configured to produce a pulsed laser beam, a focusing optical unit that is configured to focus the pulsed laser beam into the eye tissue, a scanner system for deflecting the pulsed laser beam onto work target points in the eye tissue, and a measurement system for optically capturing structures in the eye tissue. A circuit controls the measurement system in such a way that the latter captures a cut first outer face of a lenticule to be cut. The circuit controls the scanner system in such a way that the latter guides the pulsed laser beam onto work target points on a second outer face, positioned in relation to the captured first outer face, of the lenticule to be cut, in order to cut the second outer face of the lenticule.
US11096820B2	Tissue retention devices and systems and methods for implanting and using them Systems and methods are provided for treating snoring or sleep apnea of a patient that include an implantable device and a retainer. The device includes an elongate filament sized for introduction into or through a patient's tongue and including a distal end and a proximal end, a connection member on the proximal end, and one or more securing elements on or adjacent the distal end. The retainer includes a body configured to be removably engaged with one or more teeth within a patient's mouth, and a connector port for removably engaging the connection member to support the patient's tongue relative to the retainer.
US11096817B2	Therapy tape to aid patient recovery Various embodiments are directed to a therapy tape configured to enable a tensile force to be applied to one or more surfaces (e.g., a patient's skin). In various embodiments, the therapy tape may comprise a backing layer having a top surface and a bottom surface. An adhesive layer configured to secure the therapy tape to a surface may be secured relative to the bottom surface of the backing layer. Moreover, one or more handles may be secured to the top side of the backing layer. The one or more handles may be configured to enable a tensile force to be applied to the therapy tape and the surface to lift a portion of the surface while maintaining adherence between the therapy tape and the surface.
US11096816B2	Orthopedic device An orthopedic device, first and second struts, and a range-of-motion limiting pivot assembly connecting to the first and second struts. The pivoting assembly having an engagement member linked to a tab disposed and arranged for pulling radially outward away from a central axis of the pivoting assembly for adjusting the range of motion of the pivoting assembly.
US11096815B2	Material including elongate strap support A material includes a support layer comprising a woven fiber layer less than 30 mils thick. The support layer includes an elongate strap support. The support layer has a ratio of elongation to tensile strength (lb/in-width) that is less than 0.9 in a first direction and greater than 0.9 in a perpendicular second direction. The material additionally includes an adhesive layer on said support layer for adhesive attachment of said support layer to the outer skin surface of a user and a removable cover layer on said adhesive layer. Methods of use of the material and elongate strap support(s) to a human body include providing anatomical support or therapeutic effects.
US11096812B2	Delivery system and method for loading a self-expanding collapsible heart valve A delivery system has a delivery capsule with a detachable portion including first and second open ends with a tapered wall extending therebetween to compress and guide a collapsible heart valve into the delivery capsule. The detachable portion may be detached from the delivery capsule after loading the collapsible heart valve to leave a smooth distal surface on the delivery capsule. Detachment of the detachable portion may occur by breaking or removing a frangible member interposed between the detachable portion and the delivery capsule.
US11096811B2	Deployment handle for an introducer A handle for an implant deployment device converts rotational movement into longitudinal movement in order to provide controlled release of one or more trigger wires. The handle also allows the trigger wire to be withdrawn into the device so that it does not need to be separately removed. A preferred handle includes a rotatable portion and a slidable portion. Releasable locks ensure that the handle is used to carry out implant deployment steps in a specific order.
US11096809B2	Anatomic needle system A needle system for providing fluidic and/or instrument access to an internal body structure. Exemplary embodiments may include non-linear needles having anatomically appropriate lengths and curvatures. Some exemplary embodiments may include a pivotable base, which may assist in stabilizing the needle system with respect to a body structure and/or may be reconfigurable into a safety guard position. Exemplary needle systems may include expandable conduits providing fluidic and/or instrument pathways into internal body structures.
US11096808B2	Biodegradable intravascular shape memory stent Biodegradable self-expanding polymer stent has an outer diameter of 0.25-40 mm, length of 5-250 mm, and closed-cell wall structure formed by struts, where ratio of inner diameter values before crimping and after crimping is in a range of 3 to 5, and made of a copolymer obtained from L-lactide, D-lactide, D,L-lactide, meso-lactide, glycolide, ε-caprolactone, trimethylene carbonate, p-dioxanone and compounds comprising functional groups capable of photopolymerization; supramolecular structure of the copolymer is oriented substantially circularly in a transversal cross section of the stent. Method of manufacturing includes extruding a tube of a polymer material; annealing the extruded polymer tube; laser cutting the extruded polymer tube to form a stent workpiece; heating the stent to above glass transition temperature of the polymer, crimping the stent workpiece uniformly over the entire outer surface thereof, and quenching at about minus 20 degrees Celsius; placing the quenched stent on a delivery means.
US11096803B2	Movable joint for use in a prosthetic or orthopedic system A movable joint for use in a prosthetic or orthopedic system includes first and second joint sections arranged to rotate relative to one another. At least one shaft member is attached to and arranged to rotate relative to the first or second joint sections. A translating member is attached to the at least one shaft member. Translation of the translating member along a length of the at least one shaft member drives rotation of at least the first joint section and the second joint section.
US11096802B2	Intervertebral trial with marker In one embodiment, an intervertebral trial includes a front surface, a top surface, a bottom surface, a first side surface and a second side surface that collectively define an internal space. The internal space includes at least one marker structure attached to at least one of the top surface, the bottom surface, the first side surface and the second side surface. The at least one marker structure indicates a dimension of the intervertebral trial. Additionally, the at least one marker structure is spatially representative of the dimension when measured relative to one of the front surface, the top surface, the bottom surface, the first side surface or the second side surface.
US11096795B2	Standalone interbody implants Stand-alone interbody fusion devices for engagement between adjacent vertebrae. The stand-alone interbody fusion devices may include a spacer and one or more inserts or members coupled to the spacer. The inserts or members may be configured and designed to provide the apertures which are designed to retain bone fasteners, such as screws, and secure the implant to the adjacent vertebrae.
US11096794B2	In-situ formed intervertebral fusion device and method An orthopedic device for implanting between adjacent vertebrae comprising: an arcuate balloon and a hardenable material within said balloon.In some embodiments, the balloon has a footprint that substantially corresponds to a perimeter of a vertebral endplate. An inflatable device is inserted through a cannula into an intervertebral space and oriented so that, upon expansion, a natural angle between vertebrae will be at least partially restored. At least one component selected from the group consisting of a load-bearing component and an osteobiologic component is directed into the inflatable device through a fluid communication means.
US11096792B2	Shoulder prosthesis with variable inclination humeral head component Methods and devices are disclosed for joint (e.g., shoulder) arthroplasty. In one aspect, there is provided a device for determining inclination and/or version of a prosthetic head with respect to a prosthetic stem. In another aspect, there is provided a joint (e.g., shoulder) prosthesis. In another aspect, there is provided a method for setting an inclination angle and/or a version angle of a prosthetic head with respect to a stem implanted or to be implanted in a bone of a joint (e.g., shoulder).
US11096791B2	Artificial prosthesis for knee arthroplasty The present disclosure discloses an artificial femoral prosthesis (100) for knee arthroplasty, a tibial prosthesis (150), a medial femoral unicompartmental prosthesis (201), a lateral femoral unicompartmental prosthesis (301), and a femoral trochlear prosthesis (401). The femoral prosthesis (100) comprises: a medial condyle portion (51) and a medial trochlear portion (131), wherein an articular surface of the medial condyle portion appears in a sagittal section as an arc of a first ellipse (38), and an articular surface of the medial trochlear portion appears in the sagittal section as an arc of a second ellipse or circle (40); and lateral members (91, 141), comprising a lateral trochlear portion (141) and a lateral condyle portion (91), wherein an articular surface of the lateral trochlear portion appears in the sagittal section as an arc of a third ellipse or circle (80), and an articular surface of the lateral condyle portion appears in the sagittal section as an arc of a fourth ellipse (78). The prostheses according to the above embodiments of the present disclosure can better conform to geometric shapes of normal femoral condyles of humans, thereby simplifying greatly design of parameter values for different models of femoral prostheses.
US11096787B2	Magnetic locking mechanism (MLM) for joint arthroplasty A method of implanting a joint prosthesis assembly for joint arthroplasty using a coupling mechanism is disclosed. The method includes exposing a joint of a patient, resecting a portion of the joint, inserting a second prosthesis of the joint prosthesis assembly into a medullary canal, and inserting a first prosthesis of the joint prosthesis assembly from a lateral side of the joint. The joint prosthesis assembly includes a magnet. The magnet is configured to lock the first prosthesis of the joint prosthesis assembly to the second prosthesis of the joint prosthesis assembly. The first prosthesis of the joint prosthesis assembly includes a recess. The second prosthesis of the joint prosthesis assembly includes a protrusion. The recess is configured to house the protrusion. Alternatively, the first prosthesis and the second prosthesis may be assembled in a direct line using the magnet for secure coupling of the components.
US11096786B2	Elbow arthroplasty apparatus, system, and method The present disclosure generally relates to an elbow arthoplasty prosthesis that includes an ulnar component, a humeral component, one or more articulation liners, and a retention trap. The ulnar component includes a spherical bearing head that can be inserted into the humeral component in a number of orientations. The articulation liners and the retention trap are operatively engaged to the humeral component to retain the ulnar component within a humeral socket. The present disclosure also relates to methods of assembling and implanting the prosthetic device.
US11096785B2	Modular augment component Disclosed is a central augment. The central augment can include a body and a protrusion. The body can include a first curved surface shaped to interface with a central portion of a bone and a second surface opposite the first curved surface and defining a recess sized to receive a portion of a prosthetic component. The protrusion can extend from the second surface within the recess.
US11096782B2	Frame features for prosthetic mitral valves Prosthetic heart valves are described herein that can provide clearance to the left ventricle outflow tract (LVOT), reduce the possibility of undesirable outflow gradients, and/or limit or prevent LVOT obstructions when implanted in the heart. In some embodiments, a prosthetic heart valve can include an outer frame having a cuff portion that is disposed at an angle (e.g., 80 degrees) relative to the vertical axis of a body portion of the outer frame, so that the prosthetic valve can seat securely in the annulus while not obstructing the ventricular outflow tract of the heart. In some embodiments, a prosthetic heart valve can alternatively, or additionally, include subvalvular components having a short profile, such that the prosthetic valve can seat securely in the annulus while not obstructing the ventricular outflow tract of the heart.
US11096781B2	Prosthetic heart valve A prosthetic heart valve can include a radially collapsible and expandable annular frame having a plurality of struts defining openings. The prosthetic heart valve can further include a plurality of leaflets that regulate the flow of blood through the frame. The prosthetic heart valve can also include a sealing member mounted on the frame and having an inner layer and an outer layer. At least the outer layer is mounted on the outside of the frame, and the inner layer covers at least the openings in the frame between adjacent cusp portions of adjacent leaflets and the inner layer does not cover one or more openings in the frame at locations facing the outflow surfaces of the leaflets to permit retrograde blood to flow through the one or more uncovered openings in the frame and into space between the outer layer and the frame.
US11096780B2	Paravalvular leak resistant prosthetic heart valve system A paravalvular leak resistant prosthetic heart valve system including a stent frame, a valve structure and a sealing mechanism. The stent frame has a surface. The valve structure is associated with the stent frame. The sealing mechanism at least partially extends over the surface of the stent frame. The sealing mechanism includes at least one semi-permeable membrane and an osmotic gradient driving material.
US11096776B2	Composite scaffold for the repair, reconstruction, and regeneration of soft tissues A composite scaffold having a highly porous interior with increased surface area and void volume is surrounded by a flexible support structure that substantially maintains its three-dimensional shape under tension and provides mechanical reinforcement during repair or reconstruction of soft tissue while simultaneously facilitating regeneration of functional tissue.
US11096772B1	Biomedical patches with aligned fibers A structure of aligned (e.g., radially and/or polygonally aligned) fibers, and systems and methods for producing and using the same. One or more structures provided may be created using an apparatus that includes one or more first electrodes that define an area and/or partially circumscribe an area. For example, a single first electrode may enclose the area, or a plurality of first electrode(s) may be positioned on at least a portion of the perimeter of the area. A second electrode is positioned within the area. Electrodes with rounded (e.g., convex) surfaces may be arranged in an array, and a fibrous structure created using such electrodes may include an array of wells at positions corresponding to the positions of the electrodes.
US11096768B1	Brush head of an electric toothbrush A brush head includes a connecting member detachably mounted in a brush head body, and an elastic element mounted on an outer surface of the connecting member and including a connecting portion with a slot and two clamping portions. A through opening is formed in the connecting member and the middle of each clamping portion is bent inwardly to form an abutting arch capable of deforming elastically in a radial direction of the slot. When the abutting arches are not stressed, the distance between vertex ends of the abutting arches is smaller than a radial thickness of the driving shaft of the electric toothbrush. After the driving shaft is inserted into the slot, the two abutting arches penetrating through the through openings is deformed and directly abut against the driving shaft so that the brush head and the driving shaft are connected stably. The brush head is simple in structure.
US11096759B2	Operating a medical image recording device Operating a medical image recording device in the context of an image recording routine for a patient is provided. The image recording routine serves an image recording purpose. The image recording device is controlled based on operating parameters implemented by a controller of the image recording device. The operating parameters are identified completely automatically by an identification algorithm from input data describing at least the patient in the form of a patient model and/or the image recording purpose, and from a registration of the patient with a coordinates system of the image recording device. The operating parameters are used to control the image recording device. An examination region that is to be recorded for the patient and the image recording purpose are derived based on the registration.
US11096758B2	Surgical guidance systems, devices, and methods A guidance device may include a base member, a support coupled to the base member via at least one leg, thereby defining a passage configured to receive an accessory device between the base member and the support, and a guide coupled to the support. The guide may be movable relative to the base member and may include a through hole extending therethrough.
US11096754B2	Sterile drape assembly for surgical robot A sterile drape assembly for a surgical robot having a robotic arm, a cart coupled to the robotic arm, and optical tracking elements coupled to the robotic arm. The sterile drape assembly includes a surgical drape having an arm drape portion adapted to be disposed over the robotic arm. The sterile drape assembly also includes a drape holder cooperating with the surgical drape to cover the optical tracking elements located on the robotic arm.
US11096747B2	Surgical robotic devices and systems for use in performing minimally invasive and natural orifice transluminal endoscopic surgical actions Example embodiments relate to surgical systems and methods. System includes an end-effector assembly and arm assembly. End-effector assembly includes an instrument assembly and wrist assembly. Instrument assembly includes an instrument and instrument driven portion. Instrument driven portion includes an instrument connection portion and instrument driven gear. Instrument connection portion connects the instrument driven gear to the instrument. Wrist assembly includes a wrist driven gear and wrist body, which connects the wrist driven gear to the instrument assembly. Arm assembly includes a wrist connector portion and integrated motors. Arm assembly attaches to and detaches from the wrist assembly. When the arm assembly is attached to the wrist assembly, the instrument driven gear and wrist driven gear are drivable to rotate by the integrated motors. When the arm assembly is detached from the wrist assembly, the instrument driven gear and wrist driven gear are not drivable to rotate by the integrated motors.
US11096743B2	Remote control switch for a laser system A laser system for use in an environment is disclosed. The laser system may include a base unit including a laser, a controller operatively coupled to the laser, and a first antenna operatively coupled to the controller. The laser system may further include a laser energy delivery system having a first end which receives laser energy from the laser and a second end which delivers the laser energy to the environment. The laser system may further include a switch unit located remote from the base unit and including a switch controller, a second antenna operatively coupled to the switch controller, and a user operable switch. The switch unit may be connected to the base unit through a tether. The controller may determine when the laser energy is provided to the laser energy delivery system based on a signal from the switch unit, the signal being sent wirelessly to the controller from the second antenna of the switch unit to the first antenna of the base unit.
US11096742B2	Irrigated ablation electrode having smooth edges to minimize tissue char The invention relates to ablation catheter electrodes that solve in part the problem of tissue charring during radiofrequency ablation. The electrode assemblies of the invention include passageways that lead from the inner lumen of the assemblies to the surface of the assemblies, wherein the passageways have a smooth conjunction with the outer surface. These smooth conjunctions comprise rounded edges or are chamfered. In the case of rounded edges, the rounded edges can have fixed radii of about 0.002″ to about 0.008″.
US11096740B2	Electrode arrangement for a bipolar resectoscope, and resectoscope An electrode arrangement according to the invention for a bipolar resectoscope (50) comprises an elongate electrode carrier (2), an active electrode disposed at a distal end of the electrode carrier (2) and a neutral electrode, wherein a distal end section of the electrode carrier (2) is embodied as an electrode body (4, 40) through which a supply line (20) of the active electrode is guided and wherein the neutral electrode is formed by the electrode body (4, 40) or a portion of the electrode body (4, 40). The invention also relates to a resectoscope (50).
US11096739B2	Flexible neck for surgical instruments Methods and devices for allowing articulation of an end effector on a surgical instrument are provided. In one embodiment, a surgical device can include a flexible neck portion having an end effector coupled to a distal end thereof. The flexible neck portion is configured to bend to as to allow the end effector to articulate. The flexible neck portion can include a monolithic flexible outer shell defining an inner lumen extending therethrough. At least one flexible divider can be disposed within the inner lumen such that it separates the outer shell into elongate pathways configured to receive articulation members extending through the shaft assembly and the flexible neck and coupled to the end effector to cause articulating movement thereof.
US11096738B2	Treatment of spinal tissue A method of treating an intervertebral disc without piercing the disc involves navigating a treatment element to the intervertebral disc and contacting the treatment element with an exterior of the intervertebral disc. The method further involves applying an energy-based treatment to the exterior of the intervertebral disc to modify a property of a target tissue of the intervertebral disc. The target tissue may be, for example, annulus fibrosus and/or nucleus pulposus tissue. The treatment element is then removed, and the property remains modified after the treatment element is removed and the target tissue heals, thereby treating the intervertebral disc.
US11096733B2	Devices and methods for minimally invasive immediate implant stabilization A system for the amelioration of a recess (56) in a porous material, said system comprising an element (2) for coupling in mechanical energy, and a cylindrical collar (4, 40) having a central recess (44,45) for a guide pin (8), wherein the pin (8), having a cannulation (35), is provided to be inserted as far as the bottom of the recess (56) using a wire (52), wherein the pin (8) is surrounded by an amelioration sleeve (7), wherein the external cylindrical jacket surface of the sleeve (7) has substantially the same external diameter as the collar (4, 40), and wherein the pin (8) is received movably in the central recess (44,45) such that, when mechanical energy is applied, the collar (4,40) can be moved relative to the guide pin (8) in the direction toward the bottom of the recess (8) while liquefying and displacing the material of the sleeve (7).
US11096724B2	Minimally invasive splitable pedicle screw extender The present application provides a tool for minimally invasive surgical procedures. The tool includes a first and second portion where each portion has an outer blade and an inner blade that is slidable along the outer blade. A removable connector connects the first and second portions. When removed, the first and second portions are separated by a gap extending the length of the tool.
US11096723B2	Uniplanar screw A spinal stabilization system for surgical implantation in the spine having a bone fastener. The bone fastener is provided with a head portion and a shaft portion. A housing is also provided with a recess defined by sidewalls and an opening for receiving the head portion of the bone fastener. A seating element is disposed within the housing and positioned over the head portion of the bone fastener. An elongate rod is positioned on the seating element within the recess of the housing. The system also includes a cap capable of engaging with a top portion of the housing and capturing the elongate rod within the recess of the housing when the cap is rotated. The bone fastener articulates in a single plane with respect to the housing and the seat element.
US11096722B2	Anatomic external fixation system for the ankle An external fixator system includes a proximal frame configured to restrict motion in a lower extremity of a subject, and a frame connector assembly. The proximal frame includes a first, second, and third component. The first component can support a first clamp to secure a first pin inserted within a bone extending between a foot and a knee of the lower extremity. The third component extends from a second end of the second component. The first, second and third components have longitudinal axes that are substantially coplanar. The third component includes an extension to extend over a dorsal portion of the foot of the subject and to support a second clamp to secure a second pin inserted within a bone of the foot. The frame connector assembly extends from the second component to support a third clamp to secure a third pin inserted within a third bone of the foot.
US11096720B2	Cannula for a surgical instrument This disclosure relates to a cannula for a surgical instrument used for cutting selected tissue in a body cavity while under visual inspection. A kit containing the cannula and methods for performing surgical procedures using the cannula are also described.
US11096715B2	Medical device and treatment method A treatment method and medical device are disclosed for cutting a substance inside a body lumen. The medical device for cutting substances inside a body lumen including a rotatable tubular drive shaft; an expanding part connected to a distal side of the drive shaft; a cutting part covering the expanding part; and an elongated tube extending through the drive shaft and connected to the expanding part, wherein a distal end of the expanding part is placed distal to a distal end of the cutting part.
US11096712B2	Aspiration thrombectomy system and methods for thrombus removal with aspiration catheter A vacuum aspiration control system for use with a vacuum source and an aspiration catheter includes a connecting tube configured to connect the vacuum source with a lumen of an aspiration catheter. An on-off valve is operatively coupled to the connecting tube, and a sensing unit is configured to detect flow within the connecting tube and provide a signal representative of flow. A controller receives the signal to decide whether to open or close the valve. The controller may automatically close the valve to stop flow when flow through the connecting tube is unrestricted, or according to a predetermined timing sequence. The controller can further periodically open a closed valve to determine whether flow has entered an acceptable range. The controller can still further engage pulsed aspiration with a pressure manipulation assembly when flow is restricted or occluded.
US11096705B2	Medical device and procedure method A medical device to be inserted into a blood vessel for effectively removing an object flowing in a biological lumen while reducing the burden on the living body includes an elongated shaft portion, and an expansion portion which is an elastically deformable cylindrical body having a plurality of gaps and in which a proximal portion or a distal portion of the cylindrical body is interlocked with the shaft portion. The expansion portion has a ring-shaped or annular bent portion which protrudes toward a proximal side position radially outside the expansion portion in a bent state of being bent along an axial direction, and an axial length of a second portion from the bent portion to a proximal end of the expansion portion is shorter than an axial length of a first portion from the bent portion to the distal end of the expansion portion.
US11096702B2	Reentry catheter A reentry catheter having a catheter body having a lumen extending axially through a length of the catheter body, a distal port in communication with the lumen, and a flexible distal tip positioned at a distal end of the catheter body. The distal tip can have a first planar surface and a second planar surface that are angled to form a tapered portion in the distal tip. A thickness of the tapered portion in a first direction can decrease along the length of the tapered portion and can be less than a width of the tapered portion in a second direction at every point along the length of the tapered portion such that the tapered portion of the tip is more flexible when bent in the first direction than in the second direction, the second direction being normal to the first direction.
US11096696B2	Occlusive medical device An example occlusive implant is disclosed. The example occlusive implant includes an expandable framework configured to shift between a collapsed configuration and an expanded configuration, an occlusive member disposed along at least a portion of the expandable framework and a sealing member disposed along the occlusive member, wherein the occlusive member includes at least a first cellular tissue growth pathway.
US11096693B2	Adjustment of staple height of at least one row of staples based on the sensed tissue thickness or force in closing A surgical stapling instrument is disclosed. The surgical stapling instrument includes an anvil configured to clamp a tissue, a circular stapling head assembly comprising a first row of staples and a second row of staples, a first staple driver configured to drive the first row of staples, a second staple driver configured to drive the second row of staples, wherein the first and second staple drivers are independently actuatable. A motor is coupled to the anvil. The motor is configured to move the anvil between a first position and a second position. A control circuit coupled to the motor. The control circuit is configured to set a stroke length for the first and second staple drivers to a first length, detect a malformed staple in the first row of staples, and set the stroke length for the second staple driver to a second length.
US11096689B2	Shaft assembly comprising a lockout An end effector is disclosed comprising a cartridge channel, a staple cartridge positionable in the cartridge channel, and a firing assembly configured to lock itself if the staple cartridge is not positioned in the cartridge channel. Moreover, the firing assembly is configured to lock itself if the staple cartridge has been at least partially spent.
US11096683B2	Powered endoscopic suturing device An endoscopic stitching device includes an actuation shaft, a tool assembly, and a drive assembly. The tool assembly includes a suture needle and a pair of jaws transitionable between open and closed positions. Each jaw includes a needle engaging blade slidably supported thereon. Each needle engaging blade is transitionable between an extended position in which the needle engaging blade engages the suture needle and a retracted position in which the needle engaging blade is disengaged from the suture needle. The drive assembly includes first, second, and third electrical actuators. The first actuator is operatively coupled with the actuation shaft to cause axial displacement of the actuation shaft. The axial displacement of the actuation shaft causes opening and closing of the pair of jaws. The second and third actuators are operatively coupled with the needle engaging blades to provide axial displacement of the needle engaging blades.
US11096682B2	Surgical instrument for manipulating and passing suture A suture manipulating instrument for passing and retrieving suture through a tissue includes a handle mechanism, an elongate shaft extending from the handle, and a working distal end. The working distal end includes a needle body, a lumen defined by the needle body, a tissue penetrating distal tip, and a lateral slot. A preformed inner member is movably disposed within the lumen of the needle. The handle mechanism is used to extend the wire from the lateral slot of the needle, and to retract the wire into the lateral slot, allowing the working end of the instrument to grasp and manipulate suture by pinning and/or trapping the suture against the needle. In embodiments the inner member is further retracted within the needle lumen, drawing a length of suture into the needle lumen. The suture is subsequently ejected from the needle lumen to form a suture loop.
US11096681B2	All-suture suture anchor systems and methods An all-suture suture anchor system includes an all-suture anchor, an inserter, and a specially designed drill. The drill is used to enlarge the hole and create a pocket under the bone surface from the pre-drilled hole. The created pocket is intended to accommodate the expansion of the anchor when deployed into the bone, generating a true mechanical interference under the bone surface. The anchor is loaded on the inserter and placed at full length vertically inside the drilled hole. While holding the inserter on top of the drilled hole, so that a feature on the inserter keeps the anchor to a desired depth below the bone surface, tension is applied to the suture limb that is connected to the bottom end of the anchor. This tensioning step causes the length of the anchor to contract vertically and the anchor is simultaneously expanded circumferentially to fill the pocket previously created by the drill. Since the pocket created by the drill is intended to contain the deployed anchor, the deployed position of the anchor is consistently predictable.
US11096677B2	Regions of varying physical properties in a compressible cell collection device Methods, apparatuses and systems for collecting cells from a body lumen are described. The system may include a cell collection device and a capsule configured to releasably retain the cell collection device. The cell collection device may comprise a plurality of distinct regions, each region comprising one or more material properties. In some instances, at least one material property of at least one distinct region differs from at least one material property of at least one other distinct region. The distinct regions may comprise different materials or may comprise the same material where at least one of the distinct regions is mechanically or chemically altered to yield the at least one differing material property.
US11096675B2	System for the asservation of hair samples A system for asservation of at least one hair including a hair root and a hair shaft are disclosed. In some embodiments, the system includes transport and/or storage containers, or cultivation containers. Also disclosed are methods for transporting and/or storing hair, for culturing keratinocytes from hair, and for generating induced pluripotent stem cells from keratinocytes.
US11096673B2	Ultrasound imaging system with a transmit pulse sequence generator circuit A transmit signal generator is provided. The transmit signal generator has an n−1 bit comparator having a first set of n−1 input lines and a second set of n−1 input lines and an output line, the n−1 bit comparator operable to compare signals of the first set of n−1 input lines and signals of the second set of n−1 input lines and provide the output of the n−1 bit comparator based on the comparison, and an n-bit binary counter having a clock signal input line, a reset signal input line, a clock enable line connected to the output line of the n−1 bit comparator, and n output lines. One of the n output lines provides a sequence of pulse as an output of the transmit signal generator.
US11096671B2	Sparkle artifact detection in ultrasound color flow Sparkle in color flow imaging is detected. Color flow data is estimated with different pulse repetition frequency (PRF). By correlating the color flow data estimated with different PRFs, sparkle is identified. Color flow images may be filtered to reduce motion while maintaining the sparkle region (e.g., kidney stone imaging) or reduce the sparkle region while maintaining motion (e.g., remove sparkle as system noise).
US11096668B2	Method and ultrasound apparatus for displaying an object An ultrasound apparatus includes a touch screen configured to display, on an ultrasound image, a touch recognition region of an object used as a measurement mark; and a controller configured to move the object and the touch recognition region, in response to an input for touching and dragging the touch recognition region, to detect, from a portion of the ultrasound image which corresponds to the touch recognition region, a line formed by connecting points at which a brightness variation of a pixel is greater than a threshold value, and to move the object to a position of the detected line by using coordinates of the detected line.
US11096667B2	Ultrasound imaging apparatus and method of controlling the same A method of controlling an ultrasound imaging apparatus includes setting a region of interest on a contrast-enhanced image or an ultrasound image that is registered and displayed; obtaining feature information of the contrast-enhanced image or the ultrasound image from the set region of interest; detecting at least one region, in which feature information similar to the feature information of the region of interest is obtained; and displaying the at least one region that is detected.
US11096666B2	Ultrasound apparatus having switches An ultrasound apparatus includes transducers, switches, a pulser, receiver, and processing unit, each transducer connected to the pulser and receiver via one switch and a single communications channel; the processing unit includes a memory and processor, is connected to the pulser and receiver, and identifies a first number that indicates a first aperture size, generates responses from the transducers, and processes the responses to produce image data; and the processor generates each response by selecting contiguous or non-contiguous transducers, the number being equal to the first number, for each switch connected to a selected transducer, sending a signal instructing the switch to connect the transducer to the communications channel, sending instructions to simultaneously fire selected transducers, with a pulse provided simultaneously to each selected transducer via the communications channel, and receiving a single response via the communications channel and receiver, which is the combination of outputs of the selected transducers.
US11096661B2	Coherent spread-spectrum coded waveforms in synthetic aperture image formation Techniques, systems, and devices are disclosed for synthetic aperture ultrasound imaging using spread-spectrum, wide instantaneous band, coherent, coded waveforms. In one aspect, a method includes synthesizing a composite waveform formed of a plurality of individual orthogonal coded waveforms that are mutually orthogonal to each other, correspond to different frequency bands and including a unique frequency with a corresponding phase; transmitting an acoustic wave based on the composite waveform toward a target from one or more transmitting positions; and receiving at one or more receiving positions acoustic energy returned from at least part of the target corresponding to the transmitted acoustic waveforms, in which the transmitting and receiving positions each include one or both of spatial positions of an array of transducer elements relative to the target and beam phase center positions of the array, and the transmitted acoustic waveforms and the returned acoustic waveforms produce an enlarged effective aperture.
US11096660B2	Ultrasound devices methods and systems Ultrasound methods, devices, and systems are described which support a useful compromise in terms of spatial resolution and temporal resolution for capturing motion in tissue structures. Tissue engineering articles, methods, systems, and devices which employ ultrasound to deliver biological agents to selected regions of a tissue scaffold, deliver mechanical stimulation to cells growing in a tissue scaffold, and enhance the perfusion of fluids through tissue scaffolds.
US11096657B2	Laser light source for instrument tip visualization A laser light source transmits laser light to a tip of an interventional instrument such as a needle via an optical fiber. The laser light is absorbed at the distal tip of the instrument and generates a photoacoustic signal. The laser light source is configured to receive a trigger signal from an ultrasound machine when a laser pulse is to be produced. The light source signals the ultrasound machine when an optical connector is connected to the laser light source to automatically begin a needle tip (NTV) visualization mode. If the optical connector is removed from the laser light source, the laser light source stops producing laser light pulses.
US11096651B2	Systems and methods for mechanically calibrating a multidetector of a nuclear medicine imaging system Methods and systems are provided for calibrating a nuclear medicine imaging system having more than 5 detector heads. In one embodiment, a method includes obtaining residual center of gravity determinations corresponding to each of a plurality of detector units based on point source projections acquired over a series of detector unit rotational steps, obtaining center of gravity determinations for each of the plurality of detector units based on point source projections acquired over a series of detector unit sweep angles, obtaining a fit of the center of gravity determinations for each of the plurality of detector units, and determining a sweep offset for each of the plurality of detector units based on the residual center of gravity determinations and the fit of the center of gravity determinations for each of the plurality of detector units. In this way, a sweep axis zero degree position for each of the plurality of detector units is determined.
US11096644B2	X-ray mammography with tomosynthesis A method and system for producing tomosynthetic images of a patient's breast. An x-ray source that delivers x-rays through a breast immobilized and compressed between a compression paddle and a breast platform and form an image at a digital x-ray receptor panel. Multiple x-ray images are taken as the x-ray source and the receptor move relative to the immobilized breast. In one preferred embodiment, the x-ray source travels from −15° to +15°. The source can travel in an arc around the breast while the receptor travels linearly while remaining parallel and at the same distance from the breast platform. The sets of x-ray image data taken at different angles are combined to form tomosynthetic images that can be viewed in different formats, alone or as an adjunct to conventional mammograms.
US11096643B2	Medical image processing apparatus, method, and program An image acquisition unit acquires a brain image of a subject. A cisternal region extraction unit extracts a cisternal region from the brain image by performing registration between a standard brain image and the brain image. Then, a bleeding region specifying unit specifies a bleeding region based on a first signal value distribution, which is the signal value distribution of the cisternal region extracted from the brain image, and a second signal value distribution, which is the signal value distribution of a cisternal region of the standard brain image.
US11096642B2	Methods and systems for X-ray tube conditioning Various methods and systems are provided for x-ray tube conditioning for a computed tomography imaging method. In one embodiment, a scout scan may be carried out prior to a diagnostic to warmup the x-ray tube to a desired temperature for the diagnostic scan. A scout scan parameter optimizing algorithm may be used to determine scout scan parameters based on a selected patient absorbed dose range and an amount of energy to be imparted to an x-ray tube during the scout scan preceding a diagnostic scan. By using a hardening filter in the path of the x-ray beam, radiation absorbed dose of the subject being scanned may be limited to the selected patient absorbed dose range.
US11096637B2	X-ray imaging apparatus and patient support safety mechanism The invention concerns an X-ray imaging apparatus for imaging a skull or a partial area of the skull, which apparatus comprises between the X-ray source and detector a patient support means (17). The patient support means (17) comprise a rear rest structure (170) containing a support part (171) arranged to get positioned at occipital area and a safety mechanism (173) in an area between its mounting point to the X-ray imaging apparatus (10) and said support pan (171). The safety mechanism (173) is arranged to go off when a force greater titan predetermined is acting on said support pan (171) and to release said support part (171) from its patient support position.
US11096636B2	Method and apparatus to obtain limited angle tomographic images from stationary gamma cameras A nuclear imaging system and method for performing three-dimensional imaging of anatomical structures. The system and method includes two or more gamma ray detectors each used in combination with a variable-slant hole collimator. The detectors are positioned in close proximity to, or in contact with, the structure being imaged. The detectors remain in a stationary position during the data collection process. An imaging or reconstruction method is then used to reconstruct a three-dimensional image from the data derived from the detectors.
US11096622B2	Measuring muscle exertion using bone conduction Concepts and technologies are disclosed herein for measuring user exertion via bone conduction. According to one aspect, a device can generate a measurement signal. The device can cause a transducer to transmit the measurement signal through a body of a user. The device can receive, via the transducer, a modified measurement signal. The modified measurement signal can include the measurement signal as modified by the body of the user. The device can compare the modified measurement signal to a modified baseline signal. The device can determine, based on a result of comparing the modified measurement signal to the modified baseline signal, a level of exertion experienced by the user while the measurement signal was transmitted through the body of the user.
US11096621B2	Detection of BRCA and other high risk carriers in breast tissue A method and system for detecting the presence of BRCS carriers in breast tissue, comprises obtaining spectral data from breast tissue using a magnetic resonance spectroscopy device and producing spectral data by said device which provides chemical markers to enable detection of whether the breast tissue contains BRCA carriers.
US11096619B2	Neural analysis and treatment system A neural analysis and treatment system includes a computing device with a memory for storing an application that is executable on a processor to receive amplitude-integrated electroencephalography (aEEG) and range-EEG (rEEG) measurements associated with a patient. The systems determine a spectral edge frequency (SEF) measurement from the received EEG measurements, and determine one or more neural characteristics of the patient according to the determined SEF, aEEG, and rEEG measurements. These neural characteristics may then be used to identify and implement an appropriate therapeutic treatment.
US11096612B2	Methods of personalized microfiltration to detect cells from blood The present application provides a Capillary number-based method of isolating circulating rare cells from a blood sample from a subject using filtration parameters determined based on the measurement of hemorheological parameters of the sample. The present application also provides a method for determining filtration parameters in a microfluidic elasto-filtration process for isolating circulating rare cells from a blood sample from a subject. The present application further provides a device for isolating circulating rare cells from a blood sample from a subject and a non-transitory computer storage medium for performing methods described in the present application.
US11096611B2	Method for providing a signal quality degree associated with an analyte value measured in a continuous monitoring system A method providing a signal quality degree associated with an analyte value measured in a continuous monitoring system is disclosed. The method includes: receiving a measured analyte value from a biosensor; determining at least two impact parameters, wherein each of the impact parameters is influenced by an operational status of the continuous monitoring system and wherein each of the impact parameters is capable of exerting an influence on the signal quality of the biosensor and wherein the influence of each of the impact parameters on the signal quality of the biosensor is expressed by a weight assigned to each of the impact parameters; and determining the signal quality degree associated with the measured analyte value as a function of the weights and the corresponding impact parameters; and providing the signal quality degree associated with the analyte value. A method of calibration using the signal quality degree is also disclosed.
US11096608B2	Device and method for non-invasive measuring of analytes The present disclosure relates to devices and methods for non-invasive measuring of analytes. At least one embodiment relates to a wearable system for non-invasive measuring of a concentration of an analyte in skin tissue. The wearable system includes an integrated circuit that includes a first optical unit. The first optical unit includes a Raman spectrometer. The first optical unit also includes an OCT spectrometer and an interferometer optically coupled to the OCT spectrometer or an infrared (IR) spectrometer. The first optical unit additionally includes a light coupler. The wearable system further includes a first light source for performing Raman spectroscopy. The wearable system additionally includes a second light source for performing OCT spectroscopy or IR spectroscopy. Still further, the wearable system includes read-out electronics to determine an optical model of the skin tissue based on the spectroscopic data and to determine the concentration of the analyte.
US11096605B2	Modular coil assembly In various specific embodiments, a localizer can include a plurality of coil groups, where each coil group includes three coils that are formed around a single center. Each of the three coils can be formed around separate jigs and the jigs can be interconnected to form the coil group. The jigs need not be annular, but may be formed in any appropriate configuration of shape or geometry for forming the final coil group.
US11096604B2	Determining a presence of an object Methods, computing devices, and computer-readable medium are described herein related to producing detection signals configured to induce an excited state of an object. A computing device may receive reflection signals, where the reflection signals correspond to at least one detection signals reflected from the object. Based on the received reflection signals, a presence of the object in the excited state may be determined. Further, an output device may provide an indication of the presence of the object in the excited state.
US11096603B2	Systems and methods using nuclear magnetic resonance (NMR) spectroscopy to evaluate pain and degenerative properties of tissue NMR spectroscopy is performed on intervertebral disc tissue. Extent of degeneration is determined based on the NMR spectroscopy. Correlation between NMR spectral regions and at least one of tissue degeneration and pain are made. Accordingly, NMR spectroscopy is used to determine location and/or extent of at least one of degeneration or pain associated with a region of tissue, such as for example in particular disc degeneration, or discogenic pain. NMR spectral peak ratios, such as between N-Acetyl/cho and cho/carb, are readily acquired and analyzed to predict degree of tissue degeneration and/or pain for: tissue samples using HR-MAS spectroscopy; and larger portions of anatomy such as joint segments such as a spine, using clinical 3T MRI systems with surface head or knee coils; and tissue regions such as discs within spines of living patients using 3T MRI systems with a surface spine coil, thus providing a completely non-invasive diagnostic toolset and method to image and localize degeneration and/or pain.
US11096602B2	Methods and systems for characterizing tissue of a subject utilizing a machine learning Methods and systems for characterizing tissue of a subject include acquiring and receiving data for a plurality of time series of fluorescence images, identifying one or more attributes of the data relevant to a clinical characterization of the tissue, and categorizing the data into clusters based on the attributes such that the data in the same cluster are more similar to each other than the data in different clusters, wherein the clusters characterize the tissue. The methods and systems further include receiving data for a subject time series of fluorescence images, associating a respective cluster with each of a plurality of subregions in the subject time series of fluorescence images, and generating a subject spatial map based on the clusters for the plurality of subregions in the subject time series of fluorescence images. The generated spatial maps may then be used as input for tissue diagnostics using supervised machine learning.
US11096596B2	Body-worn vital sign monitor The invention provides a body-worn monitor featuring a processing system that receives a digital data stream from an ECG system. A cable houses the ECG system at one terminal end, and plugs into the processing system, which is worn on the patient's wrist like a conventional wristwatch. The ECG system features: i) a connecting portion connected to multiple electrodes worn by the patient; ii) a differential amplifier that receives electrical signals from each electrode and process them to generate an analog ECG waveform; iii) an analog-to-digital converter that converts the analog ECG waveform into a digital ECG waveform; and iv) a transceiver that transmits a digital data stream representing the digital ECG waveform (or information calculated from the waveform) through the cable and to the processing system. Different ECG systems, typically featuring three, five, or twelve electrodes, can be interchanged with one another.
US11096594B2	Multi-use endoscope with integrated device-patient monitoring and patient-provider positioning and disassociation system A system having a scope with a longitudinal length extending between a proximal end and a distal end includes a plurality of markers spaced along the longitudinal length. The system also includes a disassociation and positioning device that is configured to enhance unsedated transnasal endoscopic procedures by at least partially occluding the vision of a patient while enabling body cavity access, and optionally record and sense body functions such as temperature, heart rate and oxygenation of the blood stream. The system further includes a sensor integrated into the distraction device, wherein the sensor is configured to detect the markers on the longitudinal length of the scope.
US11096592B2	Sensor module and biological information display system A sensor module includes a light emitter that emits light beams including near-infrared light beams towards a subject; a light receiver that receives light beams having passed through the subject; and a controller that estimates biological information based on signals output from the light receiver. The light emitter includes a plurality of light emitting elements that emit near-infrared light beams having central wavelengths different from each other. The light emitter produces sets of light emissions by causing the plurality of light emitting elements to sequentially and intermittently emit the near-infrared light beams. In given two consecutive sets of light emissions produced by the light emitter, a second non-light-emission period of time T4 is longer than a first non-light-emission period of time T2. The controller estimates the biological information in a processing period of time T41 that is set in correspondence with the second non-light-emission period of time T4.
US11096590B2	Patch-based physiological sensor The invention provides a body-worn patch sensor for simultaneously measuring a blood pressure (BP), pulse oximetry (SpO2), and other vital signs and hemodynamic parameters from a patient. The patch sensor features a sensing portion having a flexible housing that is worn entirely on the patient's chest and encloses a battery, wireless transmitter, and all the sensor's sensing and electronic components. It measures electrocardiogram (ECG), impedance plethysmogram (IPG), photoplethysmogram (PPG), and phonocardiogram (PCG) waveforms, and collectively processes these to determine the vital signs and hemodynamic parameters. The sensor that measures PPG waveforms also includes a heating element to increase perfusion of tissue on the chest.
US11096589B2	Bio-information output device, bio-information output method and program The reliability of calculated bio-information of a subject is determined. When the reliability of the bio-information is determined to be high, the bio-information is output, whereas when the reliability of the bio-information is determined to be low, the bio-information is not output. Thus, among the calculated bio-information, only the bio-information of high reliability may be output, or distinctive display may be performed depending on the reliability, whereby it is possible to provide a bio-information output device and the like capable of easily determining bio-information of high reliability.
US11096585B2	Non-invasive optical measurement system and method for neural decoding A non-invasive optical measurement system comprises an optical source for generating source light, and an interferometer for splitting the source light into sample light and reference light, delivering the sample light into an anatomical structure, resulting in physiological-encoded signal light that exits the anatomical structure, and combining the signal light and the reference light into at least three phase-modulated interference light patterns. The optical path lengths of the respective source light and sample light match within a coherence length of the source light. The system further comprises at least three optical detectors configured for respectively detecting the interference light patterns, and a processor configured for determining a time-lapsed complex field of the signal light based on the interference light patterns, determining a decorrelation speed of the time-lapsed complex field of the signal light, and identifying a physiological event in the anatomical structure based on the determined decorrelation speed of the signal light.
US11096582B2	Vascular access devices, systems, and methods for monitoring patient health The present technology relates to vascular access devices, systems, and methods configured to monitor a patient's health. In some embodiments, the vascular access device may include a sensing element, and the system of the present technology may be configured to obtain physiological measurements of the patient via the sensing element, determine at least one physiological parameter based on the physiological measurement, compare the at least one physiological parameter to a predetermined threshold, and, based on the comparison, provide an indication of the patient's health.
US11096577B2	Proactive patient health care inference engines and systems Health care monitoring and alerting systems are presented. Contemplated systems include a rule repository storing rules for sending notifications to interested parties regarding a patient's wellness status. An inference engine correlates actual, possibly real-time, patient wellness information with rule sets. If a patient's wellness status satisfies triggering criteria of a rule sets, the inference engine instructs a communication engine to send a notification to interested parties according to the rules set.
US11096576B2	Tunable-lens-based refractive examination An apparatus, and corresponding method, for determining a refractive property of an eye includes a housing with a port configured to receive an eye and also light from the eye. A tunable lens can be mounted to the housing to apply a variable focal power to the light from the eye and to pass the light along an optical path toward a wavefront sensor within the housing. The wavefront sensor can receive the light via the optical path and measure a wavefront thereof. A determination module can be configured to determine a property of the eye based on the wavefront. Embodiments can be handheld, portable, and open view, while providing objective wavefront aberrometry, subjective phoroptry, and accommodation and presbyoptic evaluation, as well as lensometry functions.
US11096575B2	Rebound tonometer docking station and probe dispenser A docking station for receiving a hand-held rebound tonometer and a probe container carrying disposable tonometer probes has a docking cavity for receiving a portion of the rebound tonometer and a container receptacle for receiving the probe container. The docking station has an actuation feature arranged to move a cover associated with the probe container from a closed position to an open position as the container is inserted into the container receptacle so that tonometer probes in the container are accessible. The actuation feature may include a projection extending into an entryway leading to the container receptacle for engaging the cover but not the container, such that further insertion of the container moves the cover from the closed to the open position. The docking station may also have a storage recess for receiving an empty probe tube and cap after the probe has been removed from the tube for use.
US11096572B2	Scanning optical system and observation apparatus The disclosed technology is directed to placing two galvanometer mirrors in a pupil conjugate relationship and at the same time preventing astigmatism from occurring while preventing images from being degraded by flaws and foreign matter on a lens. A scanning optical system includes two one-dimensional scanning means disposed closely to each other at a spaced interval therebetween in an optical axis direction for scanning a light beam from a light source in two scanning directions. An objective lens for focusing the light beam scanned by the scanning means onto a target. A plurality of optical elements is disposed in positions spaced from an intermediate image plane in the optical axis direction and having different optical powers in the two scanning directions. The positions and the optical powers of the respective optical elements are set to compensate for the spaced interval between the two scanning means in the optical axis direction.
US11096571B2	Anomaloscope having pixels emitting monochromatic light at three wavelengths An anomaloscope comprises a display and a controller of the display. The display has pixels arranged in a plurality of groups, each group containing at least three pixels, each pixel being capable of emitting monochromatic light at a distinct wavelength. The controller of the display causes the display to emit, in at least one of the plurality of groups, light at a first wavelength and causes the display to emit, in at least another one of the plurality of groups, light at two other wavelengths. The controller of the display controls intensities of the light emitted at each of the distinct wavelengths to generate of a pair of metameric colors between the light emitted at the first wavelength and a combination of the light emitted at the two other wavelengths. A method uses the anomaloscope to assess an ability of a subject to discriminate between colors.
US11096570B2	Method and system of enhancing ganglion cell function to improve physical performance A method and a system of enhancing ganglion cell function using a gaming environment corresponding to a physical activity. The method and system may be used to implement one or more processes to improve a person's visual processing profile. In particular, the method and system may be used to improve a player's skill in the corresponding physical activity.
US11096564B2	Curved tube for endoscope and method of manufacturing curved tube for endoscope A curved tube for an endoscope includes: a curved tube body including a locked portion provided on an inner peripheral surface of the curved tube body; an operation wire configured to perform a bending operation of the curved tube body; a pipe member which is press-fitted to the operation wire and is locked to the locked portion of the curved tube body; and particles interposed between an outer peripheral surface of the operation wire and an inner peripheral surface of the pipe member. The particles are higher in hardness than materials forming the operation wire and the pipe member and are buried to dig into the outer peripheral surface of the operation wire and the inner peripheral surface of the pipe member.
US11096563B2	Method of determining the shape of a bendable instrument A method for determining a shape of a bendable instrument can include placing the bendable instrument in a neutral position; moving a first control element a first amount until slack is removed from the first control element; moving a second control element a second amount until slack is removed from the second control element; sensing a position of the first control element after moving the first control element the first amount, the sensed position of the first control element being defined as a first control element calibration position; sensing a position of the second control element after moving the second control element the second amount, the sensed position of the second control element being defined as a second control element calibration position. The method can further include bending the instrument by moving one or both of the first control element and the second control element from the respective first control element calibration position and the second control element calibration position; and determining a resulting shape of the bendable instrument based on a distance one or both of the first control element and the second control element respectively moved from the first control element calibration position and second control element calibration.
US11096562B2	Optical fiber scanning system and endoscope system An optical fiber scanning system includes: an optical fiber with a magnet; four drive coils configured to apply a drive magnetic field generated using a drive power signal to the magnet; four detection coils configured to output a detection signal in response to variation of a magnetic field; a controller configured to perform feedback control of the drive power signal; a signal output circuit configured to output a drive signal; a voltage-current conversion circuit configured to convert the drive signal to the drive power signal; and a correction circuit configured to output a magnet magnetic field signal by removing the drive magnetic field signal from the detection signal, and the controller controls the signal output circuit based on the magnet magnetic field signal.
US11096558B2	Endoscope cover, endoscope, and cover unit An endoscope cover includes: a cylindrical cover main body that is to be attached to a distal framing portion along a longitudinal axis of an insertion section, and that includes an annular portion which is to cover part of an outer periphery of the distal framing portion; and a fragile portion, at least part of which is provided on the annular portion of the cover main body. The cover main body is spaced apart from at least part of the distal framing portion, and forms a gap between the cover main body and the distal framing portion. The fragile portion is broken under application of an intended stress and configured to have a user recognize breakage of the fragile portion in cooperation with the gap.
US11096557B2	Endoscopy system having a miniature closed head An endoscope assembly comprising a handle incorporating a liquid reservoir and injection system, a flexible or rigid cannula attaching to the handle, and a distally attached miniature imaging head. The imaging head is a transparent tubular shaped body having an essentially closed proximal end, and a tubular wall extending from the closed proximal end to the distal open end of the body. An optical source is attached to the closed proximal end, and its emitted illumination directed into the tubular wall of the body, such that said illumination is internally reflected within the tubular walls and is emitted from the distal open end. A detector array is disposed within the inner surfaces of the tubular wall section, and a lens images light reflected back into said imaging head, onto the detector array. The optical source is disposed radially inwards of the outer dimensions of the tubular shaped body.
US11096550B1	Semi-automatic ware washing sprayer system A control box for a sprayer system is provided. The control box may include a wash flow path, a wash flow solenoid disposed in the wash flow path, a detergent supply assembly disposed in wash flow path, a rinse flow path, a rinse flow solenoid disposed in the rinse flow path, a common flow path, a flow switch disposed in the common flow path, an alternating relay, and a connection valve leading to a discharge flow path. The flow switch may be configured to provide a signal to the alternating relay. The alternating relay may be configured to control both the wash flow solenoid and the rinse flow solenoid. The connection valve may receive both the wash flow path and the rinse flow path. In another embodiment, a sprayer system including a control box and a sprayer unit is provided.
US11096547B1	Water discharge control structure of washing bucket capable of separating clean water from dirty water for washing cleaning tool A water discharge control structure of a washing bucket capable of separating clean water from dirty water for washing a cleaning tool includes: a washing bucket body and a water storage tank, wherein the washing bucket body is internally provided with a lifting frame fitted with the cleaning tool, and the lifting frame is driven by the cleaning tool to be lifted and lowered relative to the washing bucket body; the water storage tank is connected to the washing bucket body and has a water outlet directing to the cleaning tool, a discharge of water of the water outlet is controlled by a plug, and when the lifting frame is in a high position, the lifting frame drives the plug to block the water outlet; and when the lifting frame is in a low position, the lifting frame drives the plug in a linked manner to open the water outlet.
US11096546B2	Mop head The present invention provides a mop head comprising: a mop head frame formed with a plurality of concave connecting portion, a narrow connecting portion of each concave connecting portion includes a first set of protruding elements, a first hollow portion, a second set of protruding elements and a second hollow portion; and a cleaning member. The first set of protruding elements and second set of protruding elements of the narrow connecting portion clamp the cleaning member. The first hollow portion and the second hollow portion provide space that allows the cleaning member be firmly punched in concave connecting portion without damaging the narrow connecting portion by a punch.
US11096545B2	Robot cleaner The present application relates to a robot cleaner. The robot cleaner of the present application includes: a main body which forms an external shape; a moving mechanism which moves the main body; a bumper which is positioned to protrude from an outer periphery of the main body; an impact sensor which is positioned obliquely in the main body to detect movement of the bumper; and a pressing unit having a curved end portion which presses the impact sensor, when the bumper moves.
US11096543B2	Surface cleaning apparatus A surface cleaning apparatus includes a housing including an upright handle assembly and a base mounted to the upright handle assembly and adapted for movement across a surface to be cleaned. The surface cleaning apparatus is further provided with a fluid delivery system comprising a fluid dispenser configured to dispense fluid to a brushroll and at least one fluid delivery channel forming a portion of a fluid delivery pathway. The fluid delivery channel can extend adjacent to a portion of the suction nozzle assembly. An interference wiper interfaces with a portion of the brushroll to remove excess liquid from the brushroll.
US11096539B2	Surface cleaning apparatus A surface cleaning apparatus includes a housing including an upright handle assembly and a base mounted to the upright handle assembly and adapted for movement across a surface to be cleaned. The surface cleaning apparatus is further provided with a fluid delivery system comprising a fluid dispenser configured to dispense fluid to a brushroll and at least one fluid delivery channel forming a portion of a fluid delivery pathway. The fluid delivery channel can extend adjacent to a portion of the suction nozzle assembly. An interference wiper interfaces with a portion of the brushroll to remove excess liquid from the brushroll.
US11096532B2	Vacuum cleaner A vacuum cleaner is provided with a cleaner main body having an electric blower and a handle. The handle is shaped such that a gravity center position of the cleaner main body remains substantially unchanged in a state in which any one region is gripped.
US11096529B1	Toothpaste rolling assembly A toothpaste rolling assembly for squeezing toothpaste from a tube of toothpaste includes a key that has a slot extending therethrough to receive an end of a toothpaste tube thereby facilitating the toothpaste tube to be wrapped around the key. A gear is positionable around the key and a sleeve is slidable over the key. The sleeve has a slot therein to accommodate the toothpaste tube when the sleeve is slid over the key. The sleeve has a pair of lobes thereon and each of the lobes releasably engages the gear for retaining the sleeve at various points of rotation about the key. In this way the sleeve can be continually rotated on the key for squeezing toothpaste out of the toothpaste tube.
US11096527B2	Illuminated shower handle assembly An illuminated shower handle assembly for dimly illuminating a bathroom at night includes a handle that is positionable in a recess of a shower stall in a residential bathroom. The handle can be gripped during showering and the handle is comprised of a translucent material. A light emitter is integrated into the handle and the light emitter illuminates the handle when the light emitter is turned on. In this way the handle acts as a night light for dimly illuminating the residential bathroom at night.
US11096526B2	Adaptable cooking apparatus A cooking apparatus that combines microwave based heating/cooking with either of blender/mixer grinder functionality and traditional cooking using open flame and/or induction cooking is disclosed. The cooking apparatus comprises a lid and at least one microwave producing device coupled to the lid. A lifting and lowering mechanism carries the lid and microwave producing device at a lower end for enabling vertically raising and lowering the lid along with the coupled microwave producing device. Upper end of lifting and lowering mechanism is slidably configured with a lower side of a chimney. Lid in lowered position gets operatively coupled with a container holding a food item. The container can be one for cooking food using conventional source of heat, or a container for preparatory operations such as blending, stirring, grinding and mixing. Coupling of the lid with the containers enables heating of the contents of the container through the microwaves generated by the at least one microwave producing device.
US11096525B2	Cheese grater A grating device is for grating a substantially solid product capable of being grated. A first housing of the grating device is positioned, shaped and sized for encasing the product to be grated. A second housing is operatively connectable to the first housing, the second housing having a loading section configured for receiving the product to be grated. A grating drum is rotatably mountable about the second housing, and positioned, shaped and sized for grating the product from the loading section of the second housing via rotation of the grating drum against the product. A biasing assembly is operatively cooperable with the first housing for biasing the product to be grated inside the loading section of the second housing towards and against the grating drum.
US11096520B2	Air flow cooking appliance Food cooking appliance comprising: a centrifugal turbine arranged to create an air flow inside a cooking space, a steam extraction window arranged so as to extract, toward the exterior of the appliance, steam present inside the cooking space, wherein the extraction window has, at every point on its passageway surface, a normal direction with at least one non-zero component along a tangential direction to a circle centered on the centrifugal turbine and passing to the center of the extraction window.
US11096519B2	Automatic food preparation apparatus In an embodiment, an automatic food preparation and serving apparatus comprises: a digital electronics storage controller configured to send signals representing an order input; a storage apparatus comprising a plurality of temperature-control regions and configured to hold one or more magazines in the plurality of temperature-control regions, each of the one or more magazines configured to store a plurality of food canisters, and configured to regulate temperature of contents in the plurality of food canisters in the plurality of temperature-control regions; a canister transport mechanism configured to transport the plurality of food canisters away from the storage apparatus; a food dispensing mechanism configured to receive the plurality of food canisters transported away from the storage apparatus and to dispense one or more ingredients stored in one or more of the plurality of food canisters according to the signals from the digital electronics storage controller.
US11096517B2	Selection valve and beverage system including same A selection valve for a beverage preparation machine comprises a valve body with a hot water inlet, an air inlet, and at least a first outlet. A selector member is movably mounted relative to the valve body for movement between a first position in which the hot water inlet is in fluid communication with the at least first outlet, and a second position in which both the hot water inlet and the air inlet are in fluid communication with the at least first outlet. A satellite element has a predefined limited amount of free relative movement relative to the selector member for allowing the satellite element to be independently positioned between the first and second positions of the selector member.
US11096510B2	Self-assembling artificial tree A disclosed artificial tree includes telescoping tubes in series of progressively smaller diameters nested within each other. The telescoping pole is engineered to erect in response to an erecting force. A base is configured to support the telescoping pole orthogonal to a top side of the base parallel to a floor side of the base. The base includes a release control switch for erection and for retraction of the artificial tree. An artificial helical bough encircles the telescoping pole many times. The artificial helical bough is mounted at an outside end to the base and mounted on an inside end to a smallest diameter telescoping tube. The artificial helical bough is preconfigured with an engineered spring force greater than a weight of the bough plus a weight of the telescoping pole to erect the artificial tree based on a state of the release control switch.
US11096509B2	Dual-chambered beverage container assembly A dual-chambered beverage container assembly for separating two beverages includes a shell that defines an interior space. The shell has a top that is open. A wall is coupled to an inner surface of the shell and bisects the interior space from the top to a bottom of the shell to define a first and second chambers. A first beverage that is positioned in the first chamber is separated by the wall from a second beverage that is positioned in the second chamber. Each of a pair of tubes is coupled to a respective opposing side of the wall. A lower end of the tube is positioned proximate to a bottom of the shell and an upper end extends from the top of the shell. The tubes are configured to permit a user to simultaneously draw the first beverage and the second beverage into a mouth of the user.
US11096507B2	Cash wrap greeting card display The present invention provides a flexible greeting card display assembly. The display includes a plurality of adjacent card pockets and flexible attachment plate which allows the display to be attached to various surfaces within a retail environment.
US11096501B2	Bedding retention assembly A bedding retention assembly retains a fitted sheet over a mattress. The bedding retention assembly includes at least one base disposed adjacent the mattress. The base is flat in one embodiment and has a flange extending perpendicularly thereto in a second embodiment. At least one boss extends out from the at least one base. Each of a plurality of lines is partially redirected by the at least one boss. Each of the plurality of lines includes an attachment portion and a tightening portion. A plurality of attachment devices is fixedly secured to each of the attachment portions for attaching a portion of the bedding periphery to the bedding retention assembly.
US11096500B2	Floor-supported graduated lateral rotation apparatus A lateral rotation apparatus includes a first frame, a second frame, and a third frame that are independently rotatable. The first frame, the second frame, and the third frame support a person support surface having head, torso, and leg segments. A first pair of legs is positioned below the first frame to rotate a head segment to a head tilt angle in the range of about 7 to about 30 degrees relative to a horizontal support plane. A second pair of legs is positioned below the second frame to rotate a torso segment to a torso tilt angle that is within a range of about 5 degrees to about 10 degrees less than the head tilt angle.
US11096498B1	Chair with integrated hanger A chair includes a seating portion connected to a back portion and a hanger connected to the back portion. The hanger includes a front plate, a back plate opposing the front plate, and a plate separator defining a lower and an upper gap between the front plate and the back plate. An interior surface of the front plate that at least partially defines the lower gap includes a first concave radius of curvature opening away from the back plate and a sidewall portion angled towards the back plate. An interior surface of the plate separator that at least partially defines the lower gap includes a second concave radius of curvature opening away from the back plate and a sidewall portion angled towards the back plate.
US11096497B2	Seating arrangement A seating arrangement includes an upwardly-extending back arrangement movable between upright and reclined positions, and a seat arrangement that includes a first link member extending horizontally and having forward and rearward portions, a second link member spaced from the first link member, a third link member coupled to the first and second link members and substantially flexible along a majority of a length thereof, and a fourth link member operably coupled to the first and second link members, the fourth link member being substantially rigid along a majority of a length thereof, wherein the link members cooperate to form a four-bar linkage assembly, and wherein the seat arrangement moves in a rearward direction as the back arrangement is moved between the upright position and the reclined position.
US11096496B2	Therapeutic chair with adjustable back and method of using the same A therapeutic chair with an adjustable backrest and cushioned fulcrum pad allows users to extend their thoracic spine over the fulcrum of the adjustable chair back. The device allows the individual to sit on the chair and adjust the height of the backrest so the fulcrum is matched to the patient's need for movement.
US11096494B1	Fixing structure for a foot ring of a chair A fixing structure for a foot ring of a chair includes a hub with a central hole formed with internal threads on an inner surface thereof; and a bush being a cylindrical body having a tapered outer surface with external threads. The bush has a shaft hole penetrating along a longitudinal axis of the bush, a groove penetrating through a wall of the bush, and at least one pad provided on an inner surface of the shaft hole. The bush is assembled with the hub by screwing the external threads of the bush with the internal threads of the hub. A supporting post penetrates through the shaft hole. When the bush rotates toward a first direction, the shaft hole is reduced to clamp and fix the supporting post, and when the bush rotates toward a second direction, the shaft hole is enlarged to release the supporting post.
US11096492B2	Oscillation system for chairs An oscillation system (1) for chairs includes a backrest support (3) oscillating about a rotation axis (4), a first support element (6) of the seat coupled to the frame (2) to assume, in the at rest position of the backrest support (3), a plurality of relative vertical positions with respect to the frame (2) depending on, and by effect of, a weight force applied to the first support element (6). A first elastic element (21) opposes an elastic reaction to the backrest support oscillation with respect to an at rest position of the backrest support (3). A lever (31) connects to the first support element (6) to be rotated by the first support element (6) during variation of the relative position, and connects to the first anchoring end (22) to displace the first anchoring end (22). A fulcrum axis (60) does not coincide with the rotation axis (4).
US11096490B2	Furniture leg sock A furniture leg protective sock is constructed of a stretchable/expandable non-friction material, which forms an outer surface and an inner surface. The furniture leg protective sock includes non-penetrating material to prevent the furniture leg from piercing through the non-friction material.
US11096488B2	Three-section linkage drawer slides apparatus A three-section linkage drawer slides apparatus, includes an upper rail, a middle rail, a fixed rail, an upper linkage rack, and a lower linkage rack, wherein the middle rail is slidably connected to the fixed rail through the lower linkage rack, the upper rail is slidably connected to the middle rail through the upper linkage rack, the upper linkage rack and the lower linkage rack are of separate structures, the upper linkage rack is mounted between the middle rail and the upper rail after being assembled, and the lower linkage rack is mounted between the fixed rail and the middle rail after being assembled. The upper linkage rack and the lower linkage rack are configured as separate structures, the manufacturing process can thus be simplified, so the manufacturing cost is reduced.
US11096482B2	Benching system for vertically adjustable desks A vertically adjustable desk benching system wherein a plurality of desks may be joined together. The vertically adjustable desks may each have a planar work surface and telescoping support legs which are operable to raise and lower the work surface. The vertically adjustable support legs may be telescoping legs. The benching system may include a main bracket which attaches to a plurality of adjoining vertically adjustable desks while a first and a second end bracket may attached front facing desks on either side of the centrally adjoining main bracket.
US11096480B2	Collapsible tray table A collapsible tray table is provided. The collapsible tray table is adapted for use in confined seating situations. The collapsible tray table is movable between a collapsed condition and at least one operable condition. The collapsible tray table may have one or more tray legs and one or more second leg portions that depend from a tray top. The tray legs and second leg portions are interchangeable for providing different operable conditions and thus elevations of the tray table relative from its footing. The tray legs and second leg portions are adapted to removably connect to the underside of the tray table in a collapsed condition, thereby minimizing the low profile of the assembly in crowded seating arrangements. The collapsible tray table may provide handles and a carrying strap for facilitating transportation and manipulation of the tray table while in use.
US11096478B2	Device for filament end-rounding and a method for end-rounding toothbrush filaments An end-rounding device comprises a movable body comprising an abrasive surface; a gearing for transferring a movement from a motor to the movable body; a providing unit for providing a plurality of bristle filament ends to the abrasive surface, wherein the providing unit comprises a clamping unit for clamping a bunch of filaments, wherein the bunch comprises a multiple of filaments of a bristle tuft; wherein the abrasive surface has a diameter from 80 mm to 300 mm and comprises a concave curvature oriented in the direction of the clamping unit; and wherein the clamping unit is movably spaced from the abrasive surface at a distance. A method of smoothening bristle filament ends utilizes the end-rounding device.
US11096477B2	Method and system for determining compliance with a guided cleaning session A method (400) for determining a user's compliance with a guided cleaning session during use of an oral cleaning device (10) includes the steps of: (i) providing (410) an oral cleaning device including a sensor (28), a guidance generator (46), and a controller (30); (ii) providing (420), by the guidance generator, a guided cleaning session to the user; (iii) generating (430), at a first location during the guided cleaning session, sensor data from the sensor indicating a position or motion of the oral cleaning device; (iv) comparing (440) the generated sensor data to expected sensor data for the first location; and (v) generating (450), based on the comparison, an estimate of the user's compliance with the guided cleaning session.
US11096476B2	Personal care appliance with self-adaptive amplitude regulation via actuator non-linearity and active driving adjustment and method thereof A personal care appliance 10 comprises an actuator 14, a current sensor 28 for monitoring a driving current, and a controller 24. The actuator 14, operable according to a non-linear response characteristic 58 of amplitude versus frequency, includes a movable shaft 18 configured for resonant movement 38 in response to a drive signal 25, further for being coupled with a workpiece 20. The controller 24 (i) detects at least one of a plurality of different characteristic load states (100,102,104,106,108,110) in response to a perturbation in the monitored driving current 29 and (ii) actively delivers the drive signal 25 to the actuator 14 selected from at least two different drive signals (66,70) as a function of a detected characteristic load state. In this manner, the controller 24 implements self-adaptive amplitude regulation of the movable shaft's resonant movement 38 among the plurality of difference characteristic load states that include additional loads of force, spring, mass, and/or damping to a given load state of a resonant spring mass system of actuator 14 coupled with workpiece 20.
US11096473B2	Insert for pliable magazine carrier A semi-rigid pocket insert for holding an ammunition magazine or clip within a pliable magazine carrier is provided. The pocket insert comprises opposing walls, a base, and a slip-resistant liner on the interior and exterior surface of the walls. The walls further comprise flared top ends.
US11096468B2	Makeup applicator to deposit a patterned and textured makeup layer An application utensil for transferring a coloring composition in one of many patterns onto skin includes a wheel comprising a pattern of raised and submerged regions on an outer tread surface of the wheel; a wheel well that supports the wheel and allows rotation of the wheel, wherein the wheel is removable from the wheel well; and a manual grip connected to the wheel well. A plurality of different application utensils and wheels are disclosed. Application utensils are interchangeable as are the wheels to allow many combinations according to consumer preference.
US11096464B2	Hair styling flat iron A hairstyling flat iron includes a first arm having a first gripping portion and a first styling portion; a second arm having a second gripping portion and a second styling portion; a biasing member coupled with the first gripping portion and the second gripping portion to move the second arm relative to the first arm; a first heat heating plate located on the first styling portion and facing the second arm, the first heating plate having a first heat transmissive plate and a first coating disposed on the first heat transmissive plate, the first coating having ceramic and lava rock incorporated therein; and a second heat heating plate located on the second styling portion and facing the first arm, the second heating plate having a second heat transmissive plate and a second coating disposed on the second heat transmissive plate, the second coating having ceramic and lava rock incorporated therein.
US11096459B2	Luggage protector assembly A luggage protector assembly includes an article of luggage that has a plurality of rollers thereon. A first enclosure is positionable on the article of luggage when the article of luggage is being loaded onto a vehicle for travel. The first enclosure surrounds respective ones of the rollers thereby protecting the respective rollers from is damaged. A pair of first straps is each wrapped over the article of luggage to retain the first enclosure on the article of luggage. A second enclosure is slidably coupled to the first enclosure. The second enclosure is positionable on the article of luggage when the article of luggage is being loaded onto a vehicle for travel. The second enclosure surrounds respective ones of the rollers thereby protecting the respective rollers from is damaged. A pair of second straps is each wrapped over the article of luggage to retain the article of luggage on the second enclosure.
US11096454B2	Double-sided usable belt buckle and belt thereof The present invention provides a double-sided usable belt buckle, a belt having the double-sided usable belt buckle can be available on both sides. The two ends of the pin shaft can be connected with the buckle and the tail clamp by matching the clamping block arranged on the pin shaft with the clamping groove. The clamping block extends into the pin shaft mounting hole firstly, and after the connecting convex block is clamped into the connecting groove, the clamping block can be clamped into the clamping groove. When it is needed to use the other side of the belt having the double-sided usable belt buckle, simply pressing the pin shaft to make the clamping block slide out of the clamping groove so as to separate the tail clamp from the buckle, and then replace the tail clamp and connect it with the buckle again.
US11096449B2	Clip with side opening A clip includes an inner housing slidably received in an outer housing with a spring housed in the outer housing between a base of the outer housing and the inner housing. Each of the inner and outer housings include a side opening and a main cavity. When a user manipulates the inner housing, the side openings are aligned with one another, such that a user can insert an object through the respective side openings to be secured within the main cavity of the clip. The clip may further include a decorative member coupled to the outer housing, wherein the decorative member includes a design or a safety feature formed on an outerwardly directed surface thereof.
US11096444B2	Particulate foam with partial restriction An article of footwear includes an upper, an outsole attached to the upper, and a midsole disposed between the upper and the outsole. The outsole includes a ground-engaging surface, an inner surface formed on an opposite side of the outsole than the ground-engaging surface, and a wall surrounding a perimeter of the outsole. The wall cooperates with the inner surface to define a cavity. The midsole includes a footbed and a bottom surface disposed on an opposite side of the midsole than the footbed and opposing the inner surface of the outsole. The article of footwear also includes fibers received within the cavity. The fibers cooperate with one another to form a mesh that at least partially fills the cavity. The article of footwear also includes particulate matter disposed within the cavity and received within interstitial spaces of the mesh.
US11096440B2	Multifunctional lens assembly A multifunctional lens assembly includes a functional transparent plate and a layered adhesive body. The functional transparent plate includes spaced apart through holes disposed in an outer peripheral region thereof. Each through hole extends through two opposite surfaces of the outer peripheral region. The layered adhesive body is attached to the functional transparent plate for adhering the functional transparent plate to a face shield of a mobile helmet. The layered adhesive body has a first layer 61 disposed on one of the two opposite surfaces of the outer peripheral region facing toward the face shield, and connection studs respectively extending through the through holes and integrally connecting the first layer.
US11096438B1	All weather electric indoor/outdoor heat exchanger face mask A face mask apparatus is formed with a breathing chamber that provides adjustable warm and humidified air for inhalation. The breathing chamber heats cold air that is breathed in through the face mask during normal breathing, which is worn over the nose and mouth of a person. A temperature gauge monitors temperature for future adjustment of the amount of heat generating current. The air in the chamber is heated for inhalation by a resistive carbon fiber tape. The temperature of the resistive material (and by extension the warm air generated), is regulated/adjusted by increasing or decreasing the current output settings on the power source. Warm and humidified air is produced. The face mask may be part of a balaclava hood or a hat, or to other head gear, or as a stand-alone with straps around the head, optionally with an adjustable solar powered battery.
US11096436B2	Beadings Embodiments of the present invention may include beading for decorating a target member. The beading has a linear member, a leg portion and a colored portion. The linear member has a main portion formed of a light-transmitting material. The linear member has a first end and a second end opposite the first end on an outer periphery thereof. The leg portion extends from the first end of the linear member. The leg portion has a sewn portion that is sewn onto the target member by sewing thread. The colored portion is provided in the linear member or the leg portion. The colored portion has a smaller quantity of transmitting light than that of the main portion. The colored portion is situated and configured to suppress the visibility of the sewing thread when the linear member is seen from above the second end.
US11096435B2	Protective glove A protective glove includes at least a first finger section and a second finger section, each finger section comprising a protective layer configured to be at least partially arranged over a finger part of a user; and a pivot connecting said first finger section and said second finger section. The pivot has a pivot axis that substantially coincides with a finger joint of a user's hand. One of the first and second finger section comprises a rounded protrusion and wherein the other of the first and second finger section comprises a corresponding rounded recess configured to receive said rounded protrusion, said protrusion and recess together forming said pivot connecting said first finger section and said second finger section. The first and second finger section and said pivot define a substantially continuous and flush wall.
US11096434B1	Fast deployment fogless face mask Disclosed is a face mask for filtering inhaled and exhaled air without fogging glasses of the mask wearer by providing superior seal along its upper edge. The mask of the invention also features quick switching between two stable positions on the wearer's face, deployed and stand-by and may be manipulated without touching the filter media. A large breathing chamber of the disclosed mask provides for comfortable wearing without undue touching of the wearer's facial features and for easy breathing by maximizing active filtering area of the filter media. In one preferred embodiment the mask may be constructed as a disposable filter media removably attached to the external frame. In another preferred embodiment a single use disposable mask with a built in wireframe is disclosed.
US11096433B2	Trousers with waist protection belt This disclosure is related to trousers with a waist protection belt. The trousers include the waist protection belt that is detachably attached to a belt cloth of the trousers, a trouser body that includes a stretchable cloth at a position corresponding to a waist part of a back body part of the trousers, and a position adjusting part that is provided at substantially a center of the waist protection belt and is provided at a position on a back surface of the belt cloth corresponding to the waist part of the trouser body. The position adjusting part is configured to adjustably change an attachment position of the waist protection belt in a vertical direction with respect to the trouser body.
US11096432B1	Nursing garment In some embodiments, a nursing garment may include a dress body having a front and a back. The dress body may include a neck opening, a left arm opening, a right arm opening, a legs opening, an upper placket, and a lower placket. The upper placket may include at least one buttonhole. The lower placket may include at least one button operable to couple with the at least one buttonhole. The dress body may further include a first zipper member coupled to either or the upper placket and the front. The dress body may further include a second zipper member coupled to the lower placket. The second zipper member may be operable to couple with the first zipper member. The upper placket and the lower placket may be separable to allow an infant to nurse.
US11096430B2	Reinforced seamed outer garments with hidden support A lower body outer garment, such as a pant or legging or skirt, is provided which has a construction and hidden support which helps to redefine the wearer's appearance. The support is provided in the form of internal mesh re-enforcing panels that lift the buttocks and flatten the tummy. The garment also includes external seaming that provides structure and has a visual effect to re-draw the wearer's outline.
US11096429B2	System and method for wireless charging of smart garments Techniques for wirelessly charging smart textiles, such as smart garments, are provided. Aspects of the present application provide a smart garment device with an array of integrated coils and rectifiers that enable wireless charging of the device from a drawer or other enclosure that produces a roughly uniform AC magnetic field. The smart garment can draw power from the magnetic field once placed within the enclosure, regardless of how the garment is placed in the enclosure. The method can be applied to garments of any shape, and multiple garments can be charged simultaneously by placing the multiple garments into the same magnetic field.
US11096426B2	Infant teething bodysuit Articles for Infant teething bodysuit in accordance with embodiments of the invention are disclosed. In one embodiment, an article of clothing comprising: a first arm portion comprising: a first teething surface wherein the first teething surface is affixed to a distal end of the first arm portion, and the first teething surface curves perpendicular to the length of the first arm portion; and a first water resistant surface attached to an outer surface of the distal end of the first arm portion; and a second arm portion comprising: a second teething surface wherein the second teething surface is affixed to a distal end of the second arm portion; and the second teething surface curves perpendicular to the length of the second arm portion; and a second water resistant surface attached to an outer surface of the distal end of the second arm portion.
US11096422B2	Atomizer and electronic cigarette having same A heating device includes: a liquid storage chamber configured for storing tobacco liquid; the liquid storage chamber comprising a liquid conducting hole; a heating component comprising at least one heating element and a receiving cavity; the at least one heating element being received in the receiving cavity; and between the heating element and the receiving cavity or between the adjacent heating elements including a liquid storage sump; the heating component being connected with the liquid storage chamber; and the heating element being disposed under the liquid conducting chamber and corresponding with the liquid conductive hole; the tobacco liquid in the liquid storage chamber flowing towards the heating element, through the liquid conductive hole, the heating element heating the tobacco liquid for atomization; the liquid storage sump configured for storing some of tobacco liquid leaking from the heating element, the heating element atomizes the tobacco liquid in the liquid storage sump.
US11096420B2	Personal vaporizer with medium and chamber control A personal vaporizer comprises structure enabling a user to control the configuration of the vaporization chamber in which vaporizing media is atomized. In some embodiments, a personal vaporizer has an atomizer module having a heating element and a bowl for receiving vaporizing media. An adapter module is releasably attached to the atomizer module so as to be adjacent the bowl. The adapter module receives and holds a plug that can be advanced toward and away from the heating element so as to selectively change the configuration of the vaporization chamber, which is defined between the heating element and a distal end of the adapter plug.
US11096419B2	Air pressure sensor for an aerosol delivery device An aerosol delivery device is provided. The aerosol delivery device includes a power source, an aerosol production component, a sensor to produce measurements of atmospheric air pressure in an air flow path through at least one housing, and a switch coupled to and between the power source and the aerosol production component. The aerosol delivery device also includes processing circuitry coupled to the sensor and the switch. The processing circuitry determines a difference between the measurements of atmospheric air pressure from the sensor and a reference atmospheric air pressure. Only when the difference is at least a threshold difference, the processing circuitry outputs a signal to cause the switch to switchably connect and disconnect an output voltage from the power source to the aerosol production component to power the aerosol production component for an aerosol-production time period.
US11096415B2	Heated aerosol-generating article with liquid aerosol-forming substrate and combustible heat generating element A heated aerosol-generating article is provided, including a plurality of components assembled in the form of a rod, the article having a mouth end and a distal end upstream from the mouth end, and the article further including a combustible heat-generating element disposed at the distal end of the article and configured to heat air drawn into the article, and a liquid aerosol-forming substrate disposed downstream of the combustible heat-generating element.
US11096412B2	Nicotine pouch composition and pouch comprising such A nicotine pouch composition is disclosed, the pouch composition comprising free-base nicotine and having a water content of at least 15% by weight of said pouch composition. Furthermore, an oral nicotine pouch product comprising the pouch composition and a method for manufacturing the oral nicotine pouch product is disclosed.
US11096411B2	Apparatus for coating a food product with a batter An apparatus for coating a food product with a batter, includes a frame having a conveyor belt mounted on a rotatably driveable belt support member. The coating apparatus has a batter pump for pumping batter from a batter container towards an upper applicator positioned over the conveyor belt to form a stream of batter flow from the applicator to the conveyor belt to provide batter to an upper surface of the food product. The front roller is positioned at the food product entry section to provide a layer of batter on the conveyor belt at the entry section by a thrust on the batter towards the entry section by the front roller and/or the conveyor belt. The coating apparatus comprises a batter overflow device positioned at the entry section and is mounted between the transport run and the return run of the conveyor belt.
US11096402B2	Production of a coffee extract preserving flavour components Disclosed herein is a process for preparing a coffee extract, comprising the steps of: providing a mixture of roasted coffee beans and water, milling the mixture of roast coffee beans and water in a pressurised chamber, and separating the milled mixture in a liquid coffee extract and spent coffee grounds. The coffee extract maintains many of the flavour components of the roasted beans.
US11096400B2	Methods for treating a food product and compositions thereof Disclosed herein is a method for producing a package of cheese shreds. Cheese shreds and anticaking agent are mixed at a load between 2 wt. % and 10 wt. % in relation to the cheese shreds to form anticake-coated cheese shreds. The anticaking agent comprises 15-30 wt. % reducing sugar; 0.2-0.8 wt. % glucose oxidase; and 0.5-2 wt. % salt chosen from sodium chloride, calcium chloride, and magnesium chloride. The anticake-coated cheese shreds are then sealed into a package without modifying the atmosphere in the package or using an inert gas flush.
US11096397B2	Method for highly concentrating aqueous solutions A method for highly concentrating aqueous solutions containing thermally sensitive organic constituents and with or without mineral constituents, wherein firstly, a major portion of the water is extracted by membrane filtration from the solution for pre-concentration and is discharged from the process and the solution which is pre-concentrated is then subjected to a freeze concentration procedure, in which, in the form of separated ice crystallisate, further water is extracted from the solution. To promote results, that concentration may be effected in the freeze concentration procedure until a viscosity of the mother solution of at least 0.0002 m2/s is achieved, and in that the separated ice crystallisate from the freeze concentration with the mother solution adhering thereto as a suspension is returned to the membrane filtration upstream of the membrane filtration or after melting of the ice crystallisate.
US11096395B2	Food discoloration inhibitor A food discoloration inhibitor contains, as an effective ingredient, a low molecular weight lignin having a molecular weight peak in a molecular weight range of 4,000 to 9,500 and/or a high molecular weight lignin having a molecular weight peak in a molecular weight range of 10,000 to 40,000, wherein the molecular weight peak is measured at a wavelength of 254 nm by GPC molecular weight analysis using an UV detector.
US11096393B2	Bakery product The present invention relates to a soft bakery product having a slowly-available-glucose (SAG) content of at least 15 wt % and a water activity of from 0.4 to 0.9, the product comprising a dough-based, baked portion and optionally a coating and/or a filling, the product comprising: cereals in an amount of at least 35 wt %; at least 5 wt % sugars, having a degree of polymerisation of 1 or 2, by weight of the soft bakery product; and from 0.1 to 15 wt % maltitol by weight of the soft bakery product.
US11096387B2	Cryopreservative compositions and methods This disclosure describes a cryopreservative composition and methods for storing cells. Generally, the cryopreservative composition includes a sugar component and a sugar alcohol component, and is effective for storing and recovering cells without requiring dimethyl sulfoxide (DMSO).
US11096382B2	Methods and compositions for determining bovine ovulation rate Described herein are methods and compositions for modulating bovine birth rate by following a breeding scheme based on the presence of the trio haplotype, which is strongly linked to the propensity to give birth to multiple calves in one event.
US11096381B2	Interactive fish tank system, and interaction providing method of the same An interactive fish tank system includes a nozzle array provided in a water tank, wherein a plurality of bubble nozzles from which bubbles are emitted are arranged in the nozzle array; a computing device configured to receive user action information inputted from at least one user action input device, generate bubble conversion information by which characteristics of the user action information are expressed as bubbles generated from at least one of the plurality of bubble nozzles, and generate a control signal for supplying air to emit bubbles corresponding to the bubble conversion information; and an air injection device connected to the plurality of bubble nozzles through hoses, wherein the air injection device supplies air to at least one of the plurality of bubble nozzles based on the control signal.
US11096374B1	Pet house accessory with functions of air purification, sterilization and temperature regulation A pet house accessory with functions of air purification, sterilization and temperature regulation, including a shell, a mounting plate, a thermal conduction device, a semiconductor refrigeration sheet and a sterilization device, wherein a heat dissipating hole is arranged at the center of the bottom of the shell, the thermal conduction device is arranged at the center of the bottom of the mounting plate, the semiconductor refrigeration sheet is fixedly installed at the bottom of the thermal conduction device, and a through hole is defined inside the thermal conduction device. The pet house accessory with functions of air purification, sterilization and temperature regulation provided by the present disclosure is capable of cooling and heating by controlling the semiconductor refrigeration sheet through the control switch to cool down and warm the pet house, and is convenient for pets to live.
US11096373B2	Animal kennel Examples are disclosed that relate to an animal kennel having a door secured to a body of the animal kennel by a plurality of releasable fasteners. One example provides an animal kennel comprising a body defining an enclosed space and an opening into the enclosed space, a door configured to selectively block the opening, and a plurality of releasable fasteners securing the door to the body, the plurality of releasable fasteners positioned such that the door is selectively openable in a vertical direction or in a horizontal direction based upon different combinations of releasable fasteners being released.
US11096372B1	Sifting waste scooper A sifting waste scooper including a rod assembly and a basket assembly is disclosed herein. The rod assembly includes a telescoping rod and a battery. The battery is located at the bottom portion of the telescoping rod. The rod assembly further includes an LED attachment disposed at top portion of the elongated rod. The basket assembly is located the distal top portion of the elongated rod. Furthermore, the basket assembly includes a grated basket having a plurality of holes to allow soil and sand to sift through the basket while collecting waste. The basket assembly further includes a scraper along the outer portion of the grated basket to allow a user to pick up animal waste. The shifting waste scooper allows a user to pick up small objects of waste in soil or sand without having to carry the soil or sand into a waste container.
US11096368B1	Soybean variety 5PYMR85 A novel soybean variety, designated 5PYMR85 is provided. Also provided are the seeds of soybean variety 5PYMR85, cells from soybean variety 5PYMR85, plants of soybean 5PYMR85, and plant parts of soybean variety 5PYMR85. Methods provided include producing a soybean plant by crossing soybean variety 5PYMR85 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PYMR85, methods for producing other soybean varieties or plant parts derived from soybean variety 5PYMR85, and methods of characterizing soybean variety 5PYMR85. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PYMR85 are further provided.
US11096364B2	Soybean cultivar 81111940 A soybean cultivar designated 81111940 is disclosed. The invention relates to the seeds of soybean cultivar 81111940, to the plants of soybean cultivar 81111940, to the plant parts of soybean cultivar 81111940, and to methods for producing progeny of soybean cultivar 81111940. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar 81111940. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar 81111940, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar 81111940 with another soybean cultivar.
US11096357B2	Soybean variety 01073351 The invention relates to the soybean variety designated 01073351. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01073351. Also provided by the invention are tissue cultures of the soybean variety 01073351 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01073351 with itself or another soybean variety and plants produced by such methods.
US11096356B2	Variety corn line LFX6362 The present invention provides an inbred corn line designated LFX6362, methods for producing a corn plant by crossing plants of the inbred line LFX6362 with plants of another corn plant. The invention further encompasses all parts of inbred corn line LFX6362, including culturable cells. Additionally provided herein are methods for introducing transgenes into inbred corn line LFX6362, and plants produced according to these methods.
US11096354B1	Maize inbred 6CWXI1550 A novel maize variety designated 6CWXI1550 and seed, plants and plant parts thereof are provided. Methods for producing a maize plant comprise crossing maize variety 6CWXI1550 with another maize plant are provided. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into 6CWXI1550 through backcross conversion and/or transformation, and to the maize seed, plant and plant part produced thereby are provided. Hybrid maize seed, plants or plant parts are produced by crossing the variety 6CWXI1550 or a locus conversion of 6CWXI1550 with another maize variety.
US11096351B2	Canola inbred G5264590R A novel canola variety designated G5264590R and seed, plants and plant parts thereof. Methods for producing a canola plant that comprise crossing canola variety G5264590R with another canola plant. Methods for producing a canola plant containing in its genetic material one or more traits introgressed into G5264590R through backcross conversion and/or transformation, and to the canola seed, plant and plant part produced thereby. Hybrid canola seed, plant or plant part produced by crossing the canola variety G5264590R or a locus conversion of G5264590R with another canola variety.
US11096350B2	Canola inbred G00555 A novel canola variety designated G00555 and seed, plants and plant parts thereof. Methods for producing a canola plant that comprise crossing canola variety G00555 with another canola plant. Methods for producing a canola plant containing in its genetic material one or more traits introgressed into G00555 through backcross conversion and/or transformation, and to the canola seed, plant and plant part produced thereby. Hybrid canola seed, plant or plant part produced by crossing the canola variety G00555 or a locus conversion of G00555 with another canola variety.
US11096349B2	Cannabis farming systems and methods Methods to produce cannabis plants are described, the methods include growing the cannabis plants in a growing medium within an interior of an enclosure by providing a common reservoir including water, and transferring the water from the common reservoir to the cannabis plants within the interior of the enclosure, the water within the common reservoir includes, fish, treated water, evaporator condensate, and a microorganism. Methods to asexually clone, harvest, trim, grind, and heat the cannabis plants are also described.
US11096340B1	Sprinkler control systems and methods Methods, systems, and devices are described for controlling a sprinkler system, including an apparatus for sprinkler system control that includes a processor, a memory in electronic communication with the processor, and instructions stored in the memory. The instructions are executable by the processor to receive operation instructions for the sprinkler system from a source that is separate from a control panel of the sprinkler system, and operate valves of the sprinkler system independent of instructions from the control panel.
US11096338B2	Agile spectrum LED lighting fixture and control Disclosed are various embodiments of an agile spectrum LED lighting fixture with a control. In one embodiment, a lighting fixture includes a light emitting device comprising multiple channels. Each channel includes one or more light emitting diodes configured to emit light at a respective predominant wavelength. The lighting fixture also includes a control device to control a respective light intensity of each channel based at least in part on a desired spectrum of light and the respective predominant wavelengths of the channels.
US11096337B1	Method and apparatus for a heating, ventilating, and air conditioning system for indoor farming An HVAC system used in a growing room to grow plants, including lighting and other heat producing pieces of equipment, wherein operating parameters are modified over time in response to and anticipation of changes in heat production by the lighting and other heat-producing pieces of equipment and moisture production from the plants and plant growing systems located in or near the growing room. The operating parameters of the system are modified during the growth cycle of the plants to provide environmental conditions appropriate to each phase of the plant growth. Additionally, the system comprises components carrying a load such that energy use can be reduced during times when less than maximum load is required. Algorithms and tables to control airflow, heating, cooling, dehumidification, and chemical composition of the air are included to maximize plant growth. CO2 and other byproducts of heating, cooling, and cogeneration are recycled for use in connection with plant growth.
US11096335B2	Mixed air flow fan for aerating an agricultural storage bin An agricultural storage system including an agricultural storage bin for storing agricultural products therein. At least a mixed air flow fan is connected to the agricultural storage bin for generating an air flow and air pressure and providing the same to the agricultural storage bin.
US11096334B2	Round baler including ultrasonic film sensor A round baler includes a bale chamber in which a round bale can be produced, and a wrapping device with which a completely pressed round bale can be wrapped with a first film in the bale chamber, and a feed device for introducing the first film into the bale chamber. The round baler also includes a feed point at which the first film can be fed to the bale chamber, and an ultrasonic sensor which is arranged at the bale chamber. The ultrasonic sensor is arranged at the bale chamber in such a way that with the ultrasonic sensor it is possible to determine whether the film is present on a surface of the round bale.
US11096331B2	Bale wrap removal device utilizing shape memory wire A wrap removal assembly includes an elongated support member extending along a central longitudinal axis and having an exterior surface. A snagging wire is disposed adjacent the exterior surface of the elongated support member and includes an active material changeable between a first shape and a second shape in response to a control signal. The snagging wire presents a catch spaced outward and away from the exterior surface when disposed in the first shape to snag the wrap material and gather the wrap material around the elongated support member. The snagging wire is positioned substantially flat against the exterior surface of the elongated support member when disposed in the second shape to release the wrap material and allow removal of the wrap material from the elongated support member.
US11096330B2	Retention mechanism for agricultural machinery A fork assembly including a retention mechanism to retain an agricultural machine having a remotely controllable moveable element that is moveable between a number of positions. The retention mechanism includes a control element positioned so that, when engaged with the agricultural machine, the movement of the control element due to movement associated with the remotely controllable moveable element is arranged to cause actuation and deactuation of the retention mechanism.
US11096326B2	Shutter locking assembly for a lawnmower, lawnmower having same, and convertible lawnmower A shutter assembly for a lawnmower can include a cutter housing, a shutter, and a lever. The shutter can be rotatably attached to the cutter housing so as to be movable between (a) a first shutter position in which a blocking panel is positioned such that the blocking panel opens the discharge opening, and (b) a second shutter position in which the blocking panel is positioned such that the blocking panel closes the discharge opening, and the second shutter position corresponds to a mulching position. The lever can be attached to the shutter and extend through the cutter housing slot. The lever can move the shutter between the first shutter position and the second shutter position. The lever can include a handle knob assembly that includes a button that is biased, by a spring, to lock in any one of a plurality of positions on the cutter housing.
US11096325B2	Lawn mower robot A lawn mower robot includes an inner body provided with casters and wheels for moving, a plurality of blades rotatably provided on a bottom surface of the inner body to cut grass, a drive motor mounted on the wheels, respectively, to independently drive the wheels, and an outer cover mounted on and configured to surround an outer side of the inner body to be movable in forward, backward, leftward and rightward directions with respect to the inner body when colliding with an obstacle. A plurality of ultrasonic sensors are provided to sense an obstacle, and an ultrasonic guide unit is formed to be recessed rearward from a front end portion of the outer cover so as to restrict a downward propagation angle of ultrasonic waves generated from the ultrasonic sensors.
US11102920B2	Component mounting device and position recognition method A component mounting device capable of selectively performing a tolerance check mode that recognizes a position of a lead after determining whether the size of a lead region is within a tolerance range, and a non-tolerance check mode that recognizes a position of the lead without performing determination of whether the size of the lead region is within the tolerance range. Therefore, even in cases in which it is difficult to set a tolerance range due to the tip of the lead being covered with a viscous fluid such as solder or plating, the position of the lead is appropriately recognized.
US11102919B2	Management apparatus, mount substrate manufacturing system, and mount substrate manufacturing method A management apparatus is connected to a mount substrate manufacturing line including a print apparatus, a component mounting apparatus, and a reflow apparatus, through a network. The management apparatus instructs at least one of apparatuses that are at a more upstream side than a reflow apparatus in a mount substrate manufacturing line to start production of the mount substrate, based on first data relating to the period of time necessary to complete preparation for the performing of a process by the reflow apparatus.
US11102918B2	Electromagnetic pulse/high altitude electromagnetic pulse (EMP/HEMP) filter system A filter design configured to operate in the medium voltage range of 1000 to 5000 volts, provides protection against Electromagnetic Pulse/High Altitude Electromagnetic Pulse (EMP/HEMP) intentional electromagnetic interference pulses. The filter utilizes no oil filled components to preclude the catastrophic failures (explosions) during operation. Many of the components incorporated in the present design are suited to absorbing harmonics without failing. In addition to mitigating E1 and E2 pulses, the filter is resistant to line harmonics which have proved to cause filter failure in past designs. The filter provides EMP/HEMP conducted pulse protection for downstream electronics inside hardened shelters for medium and high voltage applications.
US11102915B1	Self-sustained, scalable, efficient data center facility and method Systems and methods disclose self-contained data center facility operations, management and build comprising, in the data center facility, installing a plurality of computer servers contained in a corresponding plurality of configurable rack mounted containers, a single or plurality of heat exchangers operatively coupled to the configurable rack mounted containers, and comprised in a thermal heat exchange system which further comprises a closed loop cooling unit. The closed loop cooling unit is caused to absorb heat from the single or plurality of heat exchangers. Additionally, systems and methods disclosed include power management functionality operatively coupled to control functionality, wherein the power management functionality is configured to assess a data center power requirement, and to draw and supply power based on the assessed requirement, and wherein the data center control unit is configured to calculate a data center environment, infrastructure and component condition, and based on the calculated condition, control the environment, infrastructure and component condition for optimal efficiency.
US11102911B2	Inverter device Dew condensation in a housing of an inverter device can be prevented. The inverter device includes: a housing accommodating a power electronic element and an electrolytic capacitor; an opening formed in the housing; a thermal insulator disposed along a periphery of the opening; and a water jacket having a body portion, and a flow-in pipe and a discharge pipe for cooling water, the water jacket being disposed such that a first surface of the body portion closes the opening from an outside of the housing, with the thermal insulator interposed therebetween. The power electronic element is mounted on the first surface of the body portion, and the electrolytic capacitor is mounted in the housing so as to be in contact with an inner surface of the housing.
US11102906B2	Computer component holding apparatus The present disclosure provides a holding apparatus which includes a base tray and an expansion tray. The base tray can hold a first board, and the expansion tray can hold a second board. The expansion tray can fit within the base tray and can have a transition mechanism. The transition mechanism can engage first connectors on the first board to second connectors on the second board, or disengage the first connectors from the second connectors.
US11102903B2	Formed enclosure part and electronic subassembly A formed enclosure part for mounting an electronic component on a printed circuit board includes a receiving side having an enclosure opening for receiving the electronic component in an enclosure interior, a connection side adjoining the receiving side and having connection leadthroughs for electrical connections of the electronic component, and a mounting side having a formed-on mounting profile for positioning the formed enclosure part and holding the formed enclosure part on the printed circuit board without the use of tools. An electronic subassembly, which is also provided, receives a printed circuit board and the formed enclosure part having an electronic component disposed therein.
US11102901B2	Electronics module mounting system An electronics module mounting system includes a baseplate with a main wall, opposite left and right ends spaced apart from each other along an X axis, and opposite first and second spaced-apart edges extending between the left and right ends. The first and second edges are spaced apart along a Y axis. The baseplate includes a first channel that projects outwardly from the main wall and includes a mounting leg that projects outwardly from the main wall and that forms a mounting recess. A module mounting base is connected to the baseplate and includes a mounting tab located in the mounting recess. The mounting base includes a front face to receive and retain an electronics module and a rear face located opposite the front face. A channel recess is located in the rear face and extends between opposite left and right edges of the mounting base. The channel of the baseplate is located in the channel recess. The mounting base includes first and second electrical connectors that are aligned with each other and aligned with the channel recess. A fastener extends through the mounting base at a location aligned with the channel recess such that the fastener is engaged with the channel of the baseplate.
US11102899B2	Electronic device including waterproof structure An electronic device includes a display, an upper housing surrounding at least a portion of a periphery of the display, a lower housing coupled to the upper housing, and a window waterproof member disposed between at least a portion of a periphery of the display and the upper housing to seal an aperture between the upper housing and the display. The window waterproof member includes an inner core having a specific strength, and an outer sheath having a specific elasticity, and an outer peripheral surface of which contacts at least part of the upper housing and an inner peripheral surface of which contacts at least part of the display while the outer sheath surrounding at least a portion of the inner core.
US11102895B2	Electrical junction box Provided is an electrical junction box that enables suppression of entry of water even when the electrical junction box is installed in a vehicle in different orientations. Disclosed is an electrical junction box including a first case having an opening, a second case configured to cover the opening, and an accommodated component that includes a circuit assembly and is housed between the first case and the second case. The second case includes a peripheral wall formed by connecting a plurality of flat faces in a polygonal shape to cover an outer periphery of the first case adjacent to the opening. The first case includes water guard walls extending along at least two of the flat faces to cover a region not covered with the peripheral wall.
US11102893B2	Display device A display device including a display module, a supporting portion disposed below the display module, a plurality of protruding portions protruding from an edge of the supporting portion, and a case containing the display module, the supporting portion, and the protruding portions. The case includes a bottom portion disposed below the supporting portion and a sidewall portion spaced apart from an edge of the display module and extended along the edge of the display module. The protruding portions protrude outward relative to the edge of the display module and are adjacent to the sidewall portion.
US11102889B2	Desmearing method and desmearing device Provided are a desmearing method and a desmearing device which are able to reliably remove a smear derived from any of an inorganic substance and an organic substance, and eliminate the need to use a chemical that requires a waste liquid treatment. The desmearing method of the present invention is directed to a desmearing method for a wiring substrate material that is a laminated body of insulating layers made from resin containing a filler and a conductive layer, and includes an ultraviolet irradiation treatment step for irradiating the wiring substrate material with ultraviolet beams with a wavelength of 220 nm or less, and a physical vibration treatment step for applying physical vibrations to the wiring substrate material which has undergone the ultraviolet irradiation treatment step.
US11102887B2	Electrical connection device An electrical connection device includes a first conductive plate provided with a cutout in a circumferential edge portion of the first conductive plate and a second conductive plate adjacent to the first conductive plate without contacting the first conductive plate. A switching element includes a first terminal connected to the first conductive plate, a second terminal connected to the second conductive plate, and a control terminal, and that is turned on or off according to a voltage of the control terminal, wherein the electrical connection device further includes an insulator embedded in the cutout. A conductive path is provided on the surface of the insulator and that does not contact the first conductive plate, and to which the control terminal is connected.
US11102886B2	Printed circuit board A printed circuit board includes a core layer having a through portion, a magnetic member disposed in the through portion and comprising a magnetic layer, a first coil pattern attached to one surface of the magnetic layer via an adhesive, and a first build-up layer covering at least a portion of the core layer, at least a portion of the magnetic member, and at least a portion of the first coil pattern, and disposed in at least a portion of the through portion.
US11102885B2	Resin multilayer substrate and electronic device A resin multilayer board includes a substrate including a stack of resin layers, and a first metal pin including a first end portion exposed at a first main surface of the substrate and penetrating through at least one of the resin layers in a thickness direction, wherein a gap is provided at a portion of an interface between a lateral side of the first metal pin and the resin layer.
US11102884B2	Optical module An optical module includes: a first substrate with a first surface, the first substrate having some first pads on the first surface; a second substrate with a second surface, the second substrate having some second pads on the second surface, each of the first pads and a corresponding one of the second pads being opposed to each other and constituting an opposed pair of pads; a first insulation wall between an adjacent pair of the first pads, and in contact with the first surface of the first substrate; and a second insulation wall between an adjacent pair of the second pads, and in contact with the second surface of the second substrate. The first insulation wall and the second insulation wall overlap with none of the opposed pair of pads and are adjacent to each other in a direction along the first surface and the second surface.
US11102882B2	PCB optical isolation by nonuniform catch pad stack A Printed Circuit Board (PCB) includes a via extending through at least one layer of the PCB. The PCB may also include a first catch pad connected to the via and located within a first metal layer of the PCB. The first catch pad may have a first size. The PCB may further include a second catch pad connected to the via and located within a second metal layer of the PCB. The second catch pad may have a second size greater than the first size. The second catch pad may overlap horizontally with a portion of a metallic feature in the first metal layer to obstruct light incident on a first side of the PCB from transmission to a second side of the PCB through a region of dielectric material near the via.
US11102881B2	Flat harness A flat harness includes a plurality of flat circuit bodies that are stacked to each other. A mark is provided on a side surface of each of the plurality of flat circuit bodies. A position of the mark in a length direction of the flat circuit body is provided so as to be different for each type of the flat circuit body.
US11102880B2	High-frequency board, high-frequency package, and high-frequency module A high-frequency board includes an insulating substrate, a first line conductor, a second line conductor, a capacitor, a first bond, and a second bond. The insulating substrate has a recess on its upper surface. The first line conductor extends from an edge of the recess on the upper surface of the insulating substrate. The second line conductor faces the first line conductor across the recess on the upper surface of the insulating substrate. The capacitor overlaps the recess. The first bond joins the capacitor to the first line conductor. The second bond joins the capacitor to the second line conductor, and is spaced from the first bond.
US11102878B1	High-speed trace breakout methods and systems A high-speed transmission circuit design reduces or eliminates the presence of unwanted stub-effects and avoids uncontrolled line impedances that in existing circuits cause impedance mismatches that give rise to unwanted reflections and, ultimately, degrade signal integrity, e.g., in belly-to-belly configurations involving Quad Small Form-Factor Pluggable Double Density (QSFP DD) connectors. In various embodiments, by preventing overcrowding of signal lines, the circuit design further reduces crosstalk and increases signal integrity.
US11102877B2	Apparatus and methods for deactivating microorganisms with non-thermal plasma An array of non-thermal plasma emitters is controlled to emit plasma based on application of an electric current at desired frequencies and a controlled power level. A power supply for an array controller includes a transformer that operates at the resonant frequency of the combined capacitance of the array and the cable connecting the array to the power supply. The power into the array is monitored by the controller and can be adjusted by the user. The controller monitors reflected power characteristics, such as harmonics of the alternating current, to determine initiation voltage of the plasma and/or resonant frequency plasma emitters. The array of non-thermal plasma emitters may be used in therapeutic, diagnostic, and/or medical sanitization applications, such as to prevent, limit, and/or treat the development of diseases caused in humans by infectious agents.
US11102869B2	Automated system for lighting control In some embodiments, a method includes receiving a signal indicating that a timeout timer associated with a space has crossed a threshold. If a motion sensor is disposed within the space, the method includes sending a signal to a wireless controller operatively coupled to a light source such that the wireless controller reverts to a default state. If (1) a motion sensor is not disposed within the space and (2) a light sensor is disposed within the space, the method includes sending a signal to the wireless controller such that the wireless controller is controlled by the light sensor.
US11102868B2	Automatic configuration of a load control device A load control system for controlling an electrical load may include a sensor, a remote control, and a load control device. The remote control may comprise a button and may be configured to wirelessly transmit a digital message in response to an actuation of the button. The load control device may be configured to control the electrical load, be responsive to the sensor, and/or be configured to be associated with the remote control. The load control device may be responsive to the digital message transmitted by the remote control if the remote control is associated with the load control device. The load control device may be configured to automatically operate in a first mode of operation if the remote control is not associated with the load control device, and automatically operate in a second mode of operation if the remote control is associated with the load control device.
US11102867B2	Transitional lighting for entraining biological rhythms A biological lighting system to provide temporally- and spatially-modulated photon flux output and spectral power distributions to plants on a circadian and circannual basis, or circadian and life cycle basis, to maximize effective and efficient growth in a horticultural setting. The photon flux or irradiance output and the spectral power distribution are modulated to match circadian and circannual rhythms, with individual or multiple luminaires controlled through one or more controllers. Different lighting spectra can be employed depending on the direction of illumination. The photon flux or irradiance output and the spectral power distribution may be set as best suited for any particular plant species, and the system is also useful for raising animals.
US11102864B2	Solid-state lighting with remote tests and controls A light-emitting diode (LED) luminaire control system comprising a rechargeable battery and a control and test circuit is adopted to provide an emergency power to operate a luminaire that works only in alternate-current (AC) mains. The luminaire comprises LED arrays and a power supply. The LED luminaire control system further comprises a current-fed converter circuit, a control and test unit, a relay switch, a local controller, a remote controller, and a receiver circuit. When a battery discharging test is initiated by the remote controller with a band-pass signal transmitted, the receiver circuit can detect such a signal and subsequently send a decoded command to the LED luminaire control system to execute such a test by operating the luminaire without uncertainty.
US11102861B1	Long life light emitting diode (LED) luminaires A driver electronics is provided for powering a light engine including light emitting diodes (LEDs). The driver electronics arrangement includes at least two drivers that alternate power to a light engine. By alternating between the two drivers to power the light engine, the service life of the luminaire is increased. In one embodiment, the driver electronics includes at least two drivers, a light engine and a control relay block. The control relay block controls the at least two drivers so that only one of the drivers is powering the light engine at a time.
US11102858B2	Controllable micro light emitting diode system and method A variable geometry light source and related method for illumination comprises a dense array of micro light emitting diodes (LED) incorporated within a printed circuit board and controlled by an incorporated microcontroller. The microcontroller receives user input and causes the dense array to illuminate according to the input. A tunable lens operates to focus the LED illumination toward one or more specific target subjects creating a variable geometry light projection. The microcontroller is configured with instructions which cause the dense array to produce a variety of shapes, intensities, and color temperatures tailored to the individual installation. The microcontroller causes the dense array to create a light projection suitable for illumination of a subject as well as a dynamic projection animated for a communication to the viewer.
US11102853B2	Microwave heating system having improved frequency scanning and heating methods A microwave heating system includes: a power supply; a first semiconductor module configured to receive power from the power supply and to generate a first microwave; a second semiconductor module configured to receive power from the power supply and to generate a second microwave; a heating chamber that is configured to accommodate an object at an inside of the heating chamber and that allows transmission of the first microwave and the second microwave to the inside of the heating chamber; and a control unit. The control unit is configured to control operation of each of the first semiconductor module and the second semiconductor module, and to control at least one of a frequency, a phase, or a magnitude of each of the first microwave and the second microwave to increase a heating uniformity of the object.
US11102848B2	Variable pitch resistance coil heater A resistance element includes a resistance coil having a first end and a second end opposite the first end. The resistance coil defines a plurality of first portions defining a first constant diameter and a plurality of second portions defining a second constant diameter smaller than the first diameter. At least one of the first portions and the second portions has a continuously variable pitch. The resistance coil may also further define two third portions, each third portion being disposed adjacent to a corresponding first or second end. The resistance element may be disposed between first and second conducting pins in a heater.
US11102847B2	Interface setup between cellular communication system and WLAN Communication apparatus for a cellular communication system are disclosed. The communication apparatus comprises a controller and a transceiver. The controller is operable to control the transceiver to communicate with communication apparatus of a wireless local area network (WLAN) in pursuance of an interface setup procedure to setup an interface between the communication apparatus for the cellular communication system and the communication apparatus of the WLAN. As part of the interface setup procedure, the controller controls the transceiver to transmit an interface setup request message to the communication apparatus of the WLAN and receive, responsive to the interface setup request message, an interface setup response message including information identifying an access mode of at least one access point (AP) of the WLAN. The controller sets up the interface at the communication apparatus for the cellular communication system based on the interface setup procedure.
US11102841B2	Apparatus and method for managing radio resource in wireless communication system The present disclosure relates to a pre-5th-Generation (5G) or 5G communication system to be provided for supporting higher data rates Beyond 4th-Generation (4G) communication system such as Long Term Evolution (LTE). Embodiments herein provide a method implemented in a User Equipment (UE). The method includes receiving, from a Mobility Management Entity (MME), a bearer resource modification reject message with a cause value, in response to a bearer resource modification request message sent to the MME. Further, the method includes deactivating an Evolved Packet System (EPS) bearer context information.
US11102837B2	Radio communication system, radio station, radio terminal, communication control method, and non-transitory computer readable medium A radio terminal (3) can perform carrier aggregation using a first cell (10) of a first radio station (1) and a second cell (20) of a second radio station (2). The first radio station (1) performs, with the radio terminal (3), radio resource control for the first cell (10) and the second cell (20) in order to perform the carrier aggregation. At least one of the second radio station (2) and the radio terminal (3) is configured to transmit, to the first radio station (10), information about a problem occurring in a radio link in the second cell (20) between the second radio station (20) and the radio terminal (30) while the carrier aggregation of the first cell (10) and the second cell (20) is being performed.
US11102834B2	Systems and methods for improving wireless mesh networks Disclosed herein is a system comprising a first backhaul node, a second backhaul node, and multiple sites that each comprise a respective node configured to maintain a first communication link with the first backhaul node and a second communication link with the second backhaul node, operate in a first mode in which the respective node engages in communication with the first backhaul node over the first communication link and does not engage in communication with the second backhaul node over the second communication link, detect a triggering event associated with the first communication link, and in response to detecting the triggering event, dynamically switch from operating in the first mode to operating in a second mode in which the respective node engages in communication with the second backhaul node over the second communication link and does not engage in communication with the first backhaul node over the first communication link.
US11102833B2	Apparatus for switching communication mode and method thereof A communication mode switching apparatus installed in a vehicle is connected to a user terminal and a server system for providing a vehicle sharing service. The apparatus is configured to perform operations including: supporting communication based on communication modes and communicating with the server system, determining, according to a communication state between a communication unit and the server system, whether the server system or a mobile communication network has failed, selecting at least one communication mode in response to the determined result, and operating the communication unit in the selected communication mode. The communication modes include a first communication mode for communicating with the user terminal via a vehicle to pedestrian (V2P) protocol and a second communication mode for communicating with the server system via the mobile communication network. The apparatus calculates a position where the V2P communication with the user terminal is possible in the first communication mode.
US11102832B2	Method and wireless communication system for handling offloading of DRBs to WLAN carrier A method by a wireless local area network (WLAN) termination (WT) node in a second radio access technology (RAT) is provided. The method includes receiving, from a base station in a first RAT, a WT addition request message including quality of service (QoS) parameters for at least one bearer; identifying access category information for the at least one bearer, based on the QoS parameters received from the base station; transmitting, to the base station, a WT addition request acknowledge message including an identity of admitted bearer among the at least one bearer and access category information of the admitted bearer based on the admitted bearer being an uplink bearer, the access category information of the admitted bearer being forwarded from the base station to a terminal; and receiving, from the terminal, data based on the access category information.
US11102829B2	Charge-based peripheral device selection A primary wireless communication device includes: an output assembly; a short-range communications assembly; a pairing controller configured to: send a discovery request for detection by a secondary wireless communication device; responsive to sending the discovery request, receive a discovery response from the secondary wireless communication device, the discovery response containing an identifier of the secondary wireless communication device and charge data for the secondary wireless communication device; control the output assembly to present the identifier of the secondary wireless communication device and a charge indicator for the secondary wireless communication device; obtain an instruction to establish a paired communication link with the secondary wireless communication device; and responsive to obtaining the instruction, initiate a pairing stage to establish the paired communication link.
US11102828B2	User plane function selection for isolated network slice Systems, apparatuses, and methods are described for wireless communications. A first message indicating a request to select a user plane function (UPF) device may comprise a network slice isolation information parameter and a network slice identifier associated with a wireless device. A second message comprising an identifier of a UPF device may be received.
US11102827B2	Information notification method and mobile communication system A mobile communication system is a mobile communication system that controls a connection with a slice which is a virtual network generated on a network infrastructure, and includes a request receiving unit 12 that receives a request for a connection with a slice of a control target of an AMF 100 from a UE 140 used by a user and a selection information transmitting unit 14 that controls, in response to the reception of the request, the connection of the UE 140 with the slice, acquires selection information for selecting a slice of a control target of another AMF 100x different from the AMF 100, and transmits the selection information to the terminal.
US11102823B2	Beam configuration of a smart MMW repeater for forwarding RACH message 1 Various aspects include methods for receiver (RX) beam sweep configuration of a millimeter wave (MMW) repeater during random access channel (RACH) procedures. Various embodiments may include determining two or more different RX beam sweep configurations for one or more RACH occurrences (ROs) associated with a synchronization signal block (SSB), generating a RACH configuration message indicating the two or more different RX beam sweep configurations for the one or more ROs, and sending the RACH configuration message to an MMW repeater. Various embodiments may also include receiving a RACH configuration message indicating two or more different RX beam sweep configurations for one or more ROs associated with an SSB, and controlling one or more RX antennas of the MMW repeater to perform RX beam sweeping during the one or more ROs according to the RACH configuration message to receive a RACH message 1 from a computing device.
US11102822B2	Cross carrier random access procedure for wireless communication Wireless communications systems and methods related to communications in a network that supports data transmitted in an unlicensed frequency band and a licensed frequency band are provided. A first wireless communication device transmits in a first frequency band, a first system information signal indicating a first random access configuration for a second frequency band. The first wireless communication device transmits in a third frequency band, a second system information signal indicating a second random access configuration for the second frequency band. The first and third frequency bands are different frequency bands. Additionally, the first wireless communication device performs with a second wireless communication device, a random access procedure based on at least one of the first random access configuration or the second random access configuration.
US11102819B2	Joint low-band and high-band operation in NR-SS A joint low-band and high-band operation is disclosed for use in new radio (NR) shared spectrum (NR-SS) networks. In such networks, uplink and downlink communications may occur over separate bands, selected based on performance or quality characteristics. A user equipment (UE) may search each of one or both of a low-band spectrum and a high-band spectrum for system information signal that includes both a low-band random access configuration and a high-band random access configuration. The UE transmits a random access request on one of the bands and receives the random access response from one or more cells on the other band. The UE continues the random access procedure, transmitting the uplink message based on the random access response on the first band to a selected cell. The UE would then receive the contention resolution message from the selected cell on the second band.
US11102813B2	Method and apparatus for performing contention-based access in a mobile communication system The present invention relates to a method and apparatus in which a terminal performs contention-based access in a mobile communication system, wherein the method comprises: a sensing step of sensing whether or not contention-based access is allowed for at least one logical channel; a receiving step of receiving a contention-based reverse grant from a base station; and a transmitting step of transmitting data to the base station through the logical channel for which the contention-based access is allowed. According to the present invention, contention-based access can be efficiently performed, and the reliability of transmission can be ensured.
US11102812B2	Method of transmitting uplink signal from user equipment in a wireless communication system supporting unlicensed band and apparatus supporting the same Disclosed herein is a method of transmitting a UL signal from a user equipment (UE) in a wireless communication system supporting an unlicensed band and apparatuses for supporting the same. More specifically, the present invention provides an embodiment in which the UE performs autonomous uplink transmission and scheduled uplink transmission through the unlicensed band, a method of adjusting contention window size when the UE perform the autonomous uplink transmission through the unlicensed band, and an embodiment of performing the autonomous uplink transmission based on the method.
US11102809B2	Relay systems and methods for wireless networks In one embodiment, a method is performed by a wireless station. The method includes determining that a wireless network provides relay service. The wireless network includes an access point and one or more relay nodes. The method further includes transmitting a relay-service desirability indication to the access point. The method also includes receiving a relay-service confirmation from the access point. The wireless station is operable to transmit at a first station-transmission power level during a first time period and a second station-transmission power level during a second time period. The second station-transmission power level is a reduced station-transmission power level as compared to the first station-transmission power level. In addition, the method includes transmitting an uplink transmission at the second station-transmission power level responsive to the relay-service confirmation from the access point.
US11102806B2	Method for multiplexing uplink control information in wireless communication system, and apparatus using same A base station of a wireless communication is disclosed. A wireless communication base station comprises a communication module and a processor. The processor receives DCI of a physical downlink control channel (PDCCH) for scheduling a physical uplink shared channel (PUSCH) transmission over a plurality of slots and multiplexes hybrid automatic repeat request (HARQ)-ACK information to the PUSCH transmission by applying a value in a downlink assignment index (DAI) field of the DCI to each slot where the HARQ-ACK information is multiplexed to the PUSCH transmission over the plurality of slots.
US11102805B2	Method for transmitting and receiving downlink control information and apparatus therefor Disclosed is a method for a terminal to receive downlink control information (DCI) in a wireless communication system. In particular, the method comprises: receiving information related to a mapping relation between a blind decoding candidate index and a redundancy version (RV) for DCI; detecting DCIs repeatedly transmitted in a plurality of blind decoding candidates; acquiring an RV value of the DCI on the basis of the information and the index of the blind decoding candidate in which the DCI has been detected, and acquiring data scheduling information included in the DCI on the basis of the RV value.
US11102803B2	Apparatus and method for uplink scheduling in wireless communication system The present disclosure is related to a pre-5th-Generation (5G) or 5G communication system to be provided for supporting higher data rates beyond 4th-Generation (4G) communication system such as Long Term Evolution. A method for operating a base station includes transmitting, to a terminal, configuration information for measuring a channel blockage status indicating a degree by which an unlicensed band is occupied by an interference node, receiving information regarding the channel blockage status measured based on the configuration information, transmitting, to the terminal, scheduling information regarding uplink resources generated based on the information regarding the channel blockage status, and receiving data from the terminal based on the scheduling information, wherein the configuration information comprises at least one of information regarding a measurement duration for measuring the channel blockage status, information regarding uplink resources allocated to measure the channel blockage status, and information regarding a channel occupancy time of the base station.
US11102802B2	Cross transmission opportunity (TxOP) scheduling Technology for a user equipment (UE) operable to process scheduled uplink (UL) transmissions is disclosed. The UE can process one or more uplink (UL) grants received from an eNodeB on a downlink (DL) subframe in a first transmission opportunity (TxOP). The UE can determine, based on the one or more UL grants, one or more UL subframes in at least one subsequent TxOP for an UL transmission from the UE. The UE can process the UL transmission for communication on the one or more UL subframes in the at least one subsequent TxOP.
US11102800B2	Reserving resources in device to device communication The method includes determining a time interval during which at least one other user equipment is to transmit a data transmission; generating a scheduling signal indicative of the data transmission; and transmitting the scheduling signal during the determined time interval.
US11102798B2	Method and device in UE and base station used for wireless communication The present disclosure provides a method and a device in a User Equipment (UE) and a base station used for wireless communication. The UE in sequence receives a first radio signal in a first time interval, conducts blind decoding for the first radio signal in a second time interval and receives a second radio signal in a third time interval, and receives a third radio signal in a fourth time interval. The second radio signal and the third radio signal are transmitted by the same antenna port. The end time of the second time interval is behind the start time of the third time interval, and the fourth time interval is behind the third time interval. The present disclosure reduces the delay in beam scheduling, improves the efficiency of transmission and improves the flexibility of system scheduling.
US11102796B2	Information transmission processing method and device, node, storage medium and processor Provided is an information transmission processing method and device, a node, storage medium and processor. The information transmission processing method comprises: a first predefined pattern of a first network node is determined, where the first predefined pattern comprises a link direction of a system resource of the first network node and a priority of the link direction; and information transmission according to the first predefined pattern is processed.
US11102795B2	Data generation method, method for configuring logical channel, terminal device and chip A data generation method, a method for configuring logical channel, a terminal device, and a chip are provided. The terminal device has m logical channels and a plurality of carriers, each of the m logical channels is configured with a priority, each of the plurality of carriers is correlated to a priority of at least one of the m logical channels, and m>0. The method comprises: receiving RLC data on n logical channels, wherein the n logical channels belong to the m logical channels, and m≥n>0; determining k logical channels in the n logical channels according to priorities of the n logical channels and a priority correlated to a first carrier in the plurality of carriers, wherein n≥k>0; and generating a MAC protocol data unit PDU, wherein the MAC PDU comprises RLC PDUs on the k logical channels. The terminal device can determine a carrier for transmitting the MAC PDU.
US11102793B2	Method and apparatuses for controlling quality of experience based on UE-assisted feedback The disclosure is directed to a method and apparatuses for controlling quality of experience (QoE) based on UE assisted feedback. In one aspect, the method would include not limited to: receiving an enable indicator which indicates a first feedback signaling to be transmitted; performing a quality of experience (QoE) evaluation for fulfilling a performance requirement; and transmitting the first feedback signaling including a first preferred configuration of licensed wireless connection in response to performing the QoE evaluation, wherein the wireless connection comprises a licensed wireless connection and a licensed-assisted access connection.
US11102791B2	TV whitespace relay for public safety A method and system for establishing a Television Whitespace (TVWS) relay for public safety is presented. The method and system utilize a multi Radio Access Technology (multi-RAT) base station and a TVWS relay in communication with the multi-RAT base station. The TVWS relay provides a backhaul channel to an IP network in a public safety environment.
US11102786B2	Methods and apparatus for enhanced spectral efficiency and reliability of transmission without grant Methods and devices for enhancing the spectral efficiency and/or reliability of uplink transmission without grant are provided. Uplink transmissions without grant are transmitted by UEs or received by base stations in accordance with resource groups that map initial uplink transmissions without grant and non-zero numbers of re-transmissions without grant to sub-regions of a grant-free region of a time-frequency resource.
US11102785B2	Apparatus and method selecting a base station in a network An apparatus configured to operate in a network comprises: control circuitry configured to perform a selection operation to select a preferred base station from one or more base stations in the network, each base station having a backhaul connection; connection circuitry configured to connect to the preferred base station; and communication circuitry configured to receive characteristic data of the backhaul connection of each of the one or more base stations. The control circuitry is configured to perform the selection operation in dependence on the characteristic data.
US11102783B2	System and method for supporting beamformed sounding reference signals A method for operating a user equipment (UE) includes receiving, by the UE from a transmit-receive point (TRP), a sounding reference signal (SRS) configuration for a SRS resource, determining, by the UE, at least one transmit beam for transmitting a SRS, wherein the at least one transmit beam is determined in accordance with TRP receive beam information and the SRS configuration, and transmitting, by the UE, the SRS on the SRS resource using the at least one transmit beam in accordance with the SRS configuration.
US11102782B2	Techniques for beacon-assisted multi-tier spectrum sharing Various aspects described herein relate to techniques of spectrum sharing in beacon-assisted multi-tier wireless communications systems (e.g., 5G New Radio). A method of spectrum sharing in multi-tier wireless communications is provided that may include generating, at a first apparatus, a beacon signal including information of spectrum usage, wherein the information includes at least one or more of a pilot reference, resources allocation, one or more usage entities, or one or more sharing parameters, and sending the beacon signal to at least a second apparatus, wherein the first apparatus and the second apparatus are in a same tier or different tiers.
US11102781B2	Frequency or radio access technology (RAT) selection based on slice availability Embodiments of the present disclosure relate to frequency or RAT selection based on slice availability. In one aspect, a core network function is provided for determining information for RAT and/or frequency selection based on knowledge of network slices and providing that information to a RAN node, which may provide that information to a UE. The information may be a RFSP index or other index parameter, which may be set based on subscription related information or other information. Slice knowledge may include knowledge of availability of network slices at the network, active slices for the UE, slices to which the UE is registered or connected, and/or slices to which the UE is allowed access. In another aspect, a RAN node performs mapping to mobility policies for UE active or idle mobility based on the determined information along with slice or subscription information provided by a CN node.
US11102780B2	Media access control for punctured/aggregated communication channels in WLAN A first communication device generates a plurality of media access control (MAC) layer data units to be transmitted to a second communication device via a communication channel that includes a first frequency segment and a second frequency segment separated by a gap in frequency. The first communication device generates one or more physical layer (PHY) data units that include the plurality of MAC layer data units, and simultaneously transmits i) a first frequency portion of the one or more PHY data units via the first frequency segment, and ii) a second frequency portion of the one or more PHY data units via the second frequency segment, including transmitting a first MAC layer data unit in the first frequency portion, and ii) transmitting a second MAC layer data unit in the second frequency portion.
US11102775B2	Resource block channelization for OFDM-based numerologies Systems and methods for transmitting and receiving resource blocks using OFDM-based signals are provided. The OFDM-based signal has a number of sub-bands, and employs a respective numerology in each sub-band. Each numerology has a respective subcarrier spacing and OFDM symbol duration. For a given receiver, content is mapped to resource blocks within an assigned one of the sub-bands, using the sub-carrier spacing of the sub-band.
US11102773B2	Setting HARQ timing for PDSCH with pending PDSCH-to-HARQ-timing-indicator Methods and systems for setting Hybrid Automatic Repeat Request (HARQ) timing for Physical Downlink Shared Channel (PDSCH) with a pending PDSCH-to-HARQ-timing-indicator (PHTI) are provided. In one aspect, a method performed by a wireless device comprises: receiving a first Downlink Control Information (DCI) associated with a first Downlink (DL) data transmission, the first DCI comprising a non-numerical PHTI; receiving the first DL data transmission; determining a HARQ feedback for the first DL data transmission; receiving a second DCI associated with a second DL data transmission, the second DCI comprising a numerical PHTI indicating a location for HARQ feedback associated with the second DL data transmission; setting the location of HARQ feedback associated with the first DL data transmission to be the same as the location of HARQ feedback associated with the second DL data transmission; and transmitting the HARQ feedback associated with the first DL data transmission at the set location.
US11102767B2	Uplink data retransmission method and terminal The present application discloses an uplink data retransmission method and terminal. The method comprises: a terminal determining whether to spontaneously retransmit first uplink data; and if the terminal determines to spontaneously retransmit the first uplink data, the terminal retransmitting the first uplink data on a physical resource that is pre-configured on a network side. The application adopts the above technical solution to resolve the technical problem in which, for a URLLC service, if a retransmission mechanism is based on a conventional HARQ mechanism, a certain time interval is required between two adjacent transmissions of uplink data, which may result in retransmission being unsupported for a certain time delay requirement and configuration, and as a result a reliability requirement for the URLLC service cannot be met.
US11102766B2	Uplink control channel transmission in unlicensed communication spectrum A network node configured to operate in an unlicensed communication spectrum includes a processor and a transceiver, the processor being configured to determine an identifier for subframe for an uplink control channel transmission, the uplink control channel transmission comprising at least HARQ-ACK information, wherein the subframe for the uplink control channel transmission is a function of at least an index of a subframe in a downlink control channel that is configured to transmit the identifier, and the identifier; and wherein the transceiver is configured to transmit the identifier in the downlink control channel.
US11102764B2	Minimization of padding and resource wastage in message 3 (MSG3) for early data transmission (EDT) User equipment (UE) includes processing circuitry. To configure the UE for early data transmission (EDT), the processing circuitry is to encode a physical random access channel (PRACH) preamble for transmission to a base station as a PRACH procedure Message 1 (MSG1), the PRACH preamble including a request for EDT. A random-access response (RAR) message is decoded, the RAR message received from the base station as a PRACH procedure Message 2 (MSG2) and including an uplink (UL) grant for the EDT with a transmission block size (TBS) indicator. A TBS is selected from a plurality of available TBSs corresponding to the TBS indicator. UL data is encoded for the EDT to the base station as a PRACH procedure Message 3 (MSG3) using the UL grant and the selected TBS.
US11102763B2	Techniques for multiplexing of uplink channels in a shared radio frequency spectrum band Methods, systems, and devices for wireless communications are described for multiplexing of uplink channels in a shared radio frequency spectrum band. Techniques may provide for segmenting uplink resources into multiple different sets of uplink resources, each set of uplink resources having one or more associated uplink control channel resources. A base station or user equipment (UE) may select a set of uplink resources from the multiple sets of uplink resources for uplink transmissions from the UE based on a location of the uplink control channel resources of the set of uplink resources relative to other allocated uplink resources of the UE. Uplink control information (UCI) may be multiplexed with one or more uplink shared channel transmissions of a UE for transmission to a base station in certain circumstances.
US11102757B2	Resource mapping method and user equipment This application discloses a resource mapping method and an apparatus. The method includes the following steps: receiving, by user equipment, a first resource message sent by a base station, where the first resource message includes a transmission time unit and an offset value corresponding to the transmission time unit; and determining, by the user equipment, a time-frequency resource location of a physical channel or a physical signal in the transmission time unit based on the transmission time unit and the offset value. The technical solutions provided in this application have an advantage of avoiding interference between two carriers.
US11102753B2	Method, first network node, computer program and carrier for handling paging of wireless devices A method and a first network node (200) of a wireless network, for handling paging of a wireless device. A Radio Access Network Area, RANA, which is supported by the first network node (200), is registered (2:1) in a database (202) by network nodes IN supporting the RANA, including the first network node (200). The network nodes (204) that support the RANA are then identified (2:3) in the database (202). When it is detected (2:2) that a wireless device (D1) needs to be paged in the RANA, e.g. for receiving data, a paging message is distributed (2:4) to the identified set of network nodes (204) as an instruction to perform radio transmission of the paging message. Further, which is available to the network nodes throughout the wireless network. Thereby, any network node in the wireless network, such as the first network node (200), is able to perform distribution of a paging message to all network nodes that support a particular RANA, as registered in the database (202).
US11102752B2	Receiving a paging message Apparatuses, methods, and systems are disclosed for reception of a paging message. One apparatus includes a processing unit and a transceiver that receives one or more paging occasion configurations in a system information block. The processing unit determines a paging frame and a paging occasion identity within the paging frame based on at least one of: a UE identity and a discontinuous reception cycle length and selects a paging occasion configuration from the received one or more paging occasion configurations, wherein the selected paging occasion configuration is associated with the determined paging occasion identity. The processing unit also determines a paging slot and a paging symbol within the determined paging slot based on the selected paging occasion configuration and decodes a physical downlink control channel (“PDCCH”) carrying paging downlink control information (“DCI”) on the determined paging symbol within the determined paging slot of the determined paging frame.
US11102749B2	Method and apparatus for acquiring ranging information by terminal in wireless communication system supporting device to device communication Various embodiments provide a method and an apparatus for acquiring ranging information by a terminal in a wireless communication system supporting device to device (D2D) communication. Specifically, disclosed are a method and an apparatus for acquiring ranging information by a terminal, the method comprising the steps of: receiving, from a road side unit (RSV), a ranging signal including location information of the RSU; transmitting a feedback signal to the RSU, in a resource region determined on the basis of geographic information of the terminal; and receiving a response signal from the RSU, as a response to the feedback signal, and acquiring ranging information on the basis of the received response signal, wherein the response signal further includes ranging information of another terminal which has received the ranging signal and transmitted a feedback signal.
US11102748B2	Inter network cell relationship mapping The present disclosure relates to a method, performed in a network node of a first network, for designating one or more cells of a second network as neighbouring cells to the first network. The method comprises selecting a set of carriers employed in the second network and transmitting information for the selected set of carriers to a wireless device served by the first network. Measurement reports are received for respective carriers from the wireless device. The network node determines neighbour cell relations between the first network and one or more cells of the second network based on the received measurement reports.
US11102744B2	Downlink synchronization method, and apparatus and system cross-reference to related applications Embodiments of the present disclosure provide a downlink synchronization method, an apparatus, and a system, and relate to the communications field, so as to reduce downlink synchronization complexity and improve downlink synchronization efficiency. According to the downlink synchronization method, abase station sends downlink synchronization reference information to UE by using dedicated signaling or a system message, where the downlink synchronization reference information is used to instruct the UE to perform downlink synchronization in a second cell by referring to a downlink synchronization channel of a first cell; and the base station sends, in the second cell according to location information of the UE, a beam including a downlink synchronization channel to the UE, where the first cell and the second cell include an overlapped coverage area. The embodiments of the present disclosure are applied to synchronization channel sending.
US11102742B2	Using a cell as a pathloss or timing reference Information is communicated indicating whether a cell on a first carrier of a first type is to be used as a reference cell, wherein the reference cell is at least one selected from among a pathloss reference cell and a timing reference cell, and wherein the first carrier of the first type is part of a carrier aggregation that further includes at least a second carrier of a second, different type.
US11102740B2	System and method for providing a synchronized mode for WLAN operation in a WLAN band A method for providing a mode of wireless local area network (WLAN) operation includes: sending beacons from an access point (AP) in a discovery channel; sending an association request from a wireless station (STA) to the AP over the discovery channel; receiving an association response from the AP at the STA over the discovery channel in response to the association request; and after associating with the AP, switching between the discovery channel and a scheduled access channel to provide wireless communication between the AP and the STA based on a traffic condition and a bandwidth requirement.
US11102737B2	Methods and apparatuses for transmitting and receiving synchronization signal, and transmission system Embodiments of the disclosure provide methods and apparatuses for transmitting and receiving a synchronization signal, and a transmission system. A method includes that, a base station determines one or more sets of system parameters, each set of the system parameters including at least one of the following information of a carrier: frequency information, or a frame structure parameter; the base station constructs a synchronization signal of a predetermined structure according to the system parameters; and the base station transmits the synchronization signal to the terminal; the one or more sets of system parameters corresponding to the same predetermined structure. With the embodiments of the disclosure, the problem of excessive complexity in detection of the synchronization signal in the related technology is solved.
US11102734B2	Method for controlling transmit power in wireless communication system and apparatus therefor Disclosed is a method for determining transmit power in a wireless communication system according to one embodiment of the present invention. The method, which is performed by a terminal, comprises the steps of: receiving a semi-persistent scheduling (SPS) setting of a short transmission time interval (sTTI); receiving control information for SPS-related transmit power control according to the received setting; and determining an SPS-related transmit power by using a transmit power control (TPC) command included in the received control information, wherein the control information may include a TPC command for each of a plurality of TTI lengths, which includes an SPS-related TPC command of the sTTI.
US11102730B2	Method and apparatus for determining per carrier additional maximum power reduction for dual carrier operation A method and apparatus is provided for determining a per carrier additional maximum power reduction needed to meet emission requirements for dual carrier operation of adjacent carriers. A per carrier allowed additional maximum power reduction for a worst case allocation is determined for the dual carrier operation of the adjacent carriers of the different radio access technologies in absence of the shared scheduling information. The determination for each of the carriers for use with the different radio access technologies includes determining a total power reduction allowed for meeting emission requirements for each of one or more respective allocation ratios, and determining a fraction of a total power allocated to the carrier for each of one or more respective allocation ratios. Where for each of the one or more respective allocation ratios, a per carrier additional power reduction is determined as a sum of the total power reduction allowed for meeting emission requirements and a negative of ten times a base ten logarithm of the fraction of the total power allocated to the carrier. The per carrier additional power reduction of the one or more respective allocations are compared, and the per carrier additional power reduction of the one or more respective allocation ratios, which has a highest value, is selected as the worst case per carrier additional maximum power reduction for each of the associated one of the different radio access technologies.
US11102729B2	Multi-transmission capable data transmission system and method of operating the same A data transmission system may comprise a first transmission chain comprising a first transmission power controller, the first transmission power controller being configured to operate in an open loop power control mode or in a closed loop power control mode; a second transmission chain; and a power control mode selector configured to select the first transmission power controller to operate in the open loop power control mode or in the closed loop power control mode based on at least one quantity indicative of interference induced by the second transmission chain in the first transmission power controller when operating in the closed loop power control mode.
US11102727B2	Uplink control method, apparatus, and system An uplink control method, includes: determining a downlink path loss based on a first reference signal receive power that is of a serving cell in which the terminal device is located and that is obtained through measurement; receiving a first transmit power and a second transmit power that are sent by the base station; and if the first reference signal receive power is greater than or equal to a preset threshold, obtaining, by the terminal, an uplink transmit power of the terminal in a first network; or if the first reference signal receive power is less than a preset threshold, obtaining, by the terminal, an uplink transmit power of the terminal in the first network.
US11102725B2	Access control system with dynamic performance tuning A method of dynamically changing a mode of advertising for at least one of a multiple of access controls, including transmitting advertisements from an access control at a nominal mode; and changing the nominal mode in response to an event.
US11102723B2	Communication apparatus and communication method A communication apparatus of the present disclosure comprises a first receiver which, in operation, receives a downlink data frame from a base station; a decoder which, in operation, decodes data included in the received downlink data frame; a signal generator which, when the decoded data indicates that there is no buffered traffic for the communication apparatus, generates an uplink frame that includes acknowledgement information and a wake-up radio (WUR) mode request indicating a request to transit to the WUR mode from a primary connectivity radio (PCR) mode; and a transmitter which, in operation, transmits the uplink frame to the base station.
US11102722B2	Monitoring for uplink cancellation indication signaling A wireless device may receive a first configuration parameter indicating a CI-RNTI, for cancellation indication, and DRX configuration parameters. The wireless device may monitor a control channel for the CI-RNTI in a time window that is based on a timing of a scheduled uplink transmission and regardless of a DRX procedure, performed by the wireless device based on the DRX configuration parameters, indicating a DRX Active Time or not. The wireless device may receive a cancellation indication DCI, associated with the CI-RNTI, comprising an uplink cancellation indication. The wireless device may cancel the scheduled uplink transmission based on the uplink cancellation indication.
US11102721B2	Transmtting PPDU A method for transmitting a physical layer protocol data unit (PPDU) and a device using the same are provided. The device receives a trigger frame for requesting a transmission of a response PPDU and transmits the response PPDU. A duration of the response PPDU is calculated based on a duration of the trigger frame.
US11102720B2	User equipment battery consumption A method, user equipment (UE) and basestation are provided, wherein the UE is configured to send battery status data to the basestation and, in response, the basestation is adapted to improve the Quality of Service for the UE.
US11102719B2	Method and apparatus for multiple radio access technology antenna front end controller integration A wireless adapter front end for an information handling system comprising a wireless adapter for communicating on a plurality of antennas for connection to a plurality of concurrently operating wireless links, wherein at least one of the plurality of antennas is configurable to have a plurality of antenna radiation patterns and is operating in a first antenna radiation pattern, a controller operating independently from an operating system of the information handling system and executing instructions of a dynamic tuning and power reduction control system to receive a trigger input indicating an operating condition of the plurality of antennas, wherein the trigger input may be selected from one or more indications of a radiation pattern of one or more of the antennas, a shared communication frequency band, a carrier aggregation operation, SAR proximity detection, or operation of a plurality of radio access technologies and to identify an optimal tuning and power reduction configuration associated with the trigger input and the first antenna radiation pattern in a truth table stored in a memory, wherein the optimal tuning and power reduction configuration defines a plurality of transmitting power levels, each of the plurality of transmitting power levels associated with one of the plurality of antennas.
US11102718B2	Communication apparatus, control method, and storage medium A communication apparatus that performs a communication compliant with Wi-Fi NAN standard sets an operation channel of a data communication based on a communication compliant with the Wi-Fi NAN standard which is performed outside a Discovery Window and an operation channel of a data communication based on a communication compliant with a communication standard other than the Wi-Fi NAN standard to be the same.
US11102714B2	Method and apparatus for obtaining system information This application provides a method and an apparatus for obtaining system information SI. The method includes: sending, by a terminal device, a first message to a network device, where the first message includes first request information used to request first system information SI; and detecting, by the terminal device, a second message and obtaining the first SI, where the second message includes information used to respond to the request of the first request information. The terminal device may send the first request information to the network device based on an actual requirement, and detect the second message on a preset time-frequency resource.
US11102710B2	Base stations and user equipments configured to handle on-demand system information in 5G NR The present disclosure provides a user equipment for a mobile telecommunications system, which includes circuitry configured to communicate with a new radio base station. The circuitry is further configured to transmit an on-demand system information request to the new radio base station, wherein the on-demand system information request is transmitted based on a backup resource.
US11102708B2	Method for acquiring changed system information and device supporting the same Provided are a method of acquiring changed system information (SI) and a device supporting the method. According to one embodiment of the present invention, a method for acquiring changed SI in a wireless communication system includes: receiving a first SI message; receiving a notification of SI change; receiving an indication indicating a second SI message, which only contains system information blocks (SIBs) to be modified in the first SI message; and receiving the second SI message according to the indication.
US11102705B2	Communication device, communication method, and program [Object] To provide a communication device capable of efficiently using a NOMA technology by effectively sharing information to be used in NOMA.[Solution] Provided is a communication device including: a setting unit configured to set a predetermined resource pool to be used for transmission and information regarding non-orthogonal multiplexing in a first device; and a transmission processing unit configured to broadcast the information regarding the non-orthogonal multiplexing.
US11102704B2	Communication between terminal and base station, and network access method and apparatus for terminal Communication between a terminal and a base station, and network access methods and apparatuses for a terminal are provided. The communication between the terminal and the base station includes: the terminal sending a network access request frame with a first preamble to a relay device, the relay device being configured to receive the network access request frame according to the first preamble, send the network access request frame with a second preamble to the base station, and receive a network access response frame returned by the base station, a length of the second preamble being smaller than a length of the first preamble; and the terminal receiving the network access response frame sent by the relay device.
US11102703B2	Enhanced handover procedure to facilitate route change in an IAB network An enhanced handover procedure is provided to facilitate communication routing changes in an integrated access and backhaul (IAB) network. In an IAB network a network node can be connected to the core network via multiple different paths, and when the path changes, (e.g., when an intermediate network node performs a handover procedure with another network node), messages can be sent to relevant network nodes informing them of the route change so as to reduce the number of protocol data units (PDUs) that are transmitted to network nodes that are no longer part of the communication path to the target network node. The network node that is no longer part of the communication path can also inform a parent node of which PDUs have been successfully transmitted to the target network node so that the parent node can retransmit the PDUs that were not transmitted successfully.
US11102699B1	Wireless communication relay service over multiple network transceivers A wireless communication relay wirelessly serves User Equipment (UEs) with wireless data services. Relay circuitry tests data throughputs over a Fifth Generation New Radio (5GNR) network Transceiver (XCVR), Long Term Evolution (LTE) network XCVR, and wireline network XCVR. The relay circuitry selects sets of network XCVRs for the user XCVRs based on the data throughput testing. The relay circuitry indicates the selected network XCVRs to the user XCVRs. The user XCVRs wirelessly exchange user data with the wireless UEs and exchange the user data with the selected network XCVRs. The selected network XCVRs exchange the user data with one or more data communication networks.
US11102698B2	Tabu node selection with minimum spanning tree for WSNs A wireless sensor network node selection that efficiently manages active nodes using a Tabu heuristic coupled with minimum spanning tree routing protocol (TNS-MST) is presented. Nodal energy consumption is balanced to ensure all nodes are operating at the same energy level. To balance the energy consumption, nodes with high energy depletion are removed from routing by placing on them a Tabu list, which prevents the most used nodes, such as nodes close to a base station, from draining before their neighbors. The nodes in the Tabu lists are dynamically active according to the energy level of neighboring nodes. The Tabu list combined with Minimum Spanning Tree routing protocol, TNS-MST, greatly increases network lifetime by optimally balancing the energy of the sensor nodes.
US11102696B1	Systems and methods for handover with dynamic quality of service (QoS) in a 5th generation (5G) network Techniques for performing a handover with dynamic Quality of Service (QoS) in a 5th generation (5G) network are described herein. A user equipment (UE) undergoing a handover is communicatively coupled to the 5G network based on a subscription type of the UE. The 5G network modifies policies and determines modified policies with dynamic QoS associated with the UE based on whether the subscription type restricts access for the UE to a public 5G network or allows the UE to access a private 5G network. The modified policies with dynamic QoS are utilized to determine communication parameters associated with the UE, which are provided to the UE based on a policy control create request transmitted to a policy control function (PCF), a policy modification request transmitted by the PCF to a session management function (SMF), a policy modification response transmitted by the SMF and to the PCF, and/or a policy control create response transmitted by the PCF.
US11102690B2	Data sending method, data receiving method, data transmit end, and data receive end A data sending method, a data receiving method, a data transmit end, and a data receive end are provided. The data sending method includes: obtaining a transmission path used for data transmission, where the transmission path currently uses a first physical link group to transmit data; switching, based on a preconfigured link switching policy and transmission information of the transmission path, a physical link used by the transmission path from the first physical link group to a second physical link group; sending a first link switching notification message to a data receive end, where the first link switching notification message includes information indicating that the physical link used by the transmission path is switched from the first physical link group to the second physical link group; and continuing transmitting the data through a transmission path that uses the second physical link group.
US11102688B2	Triggering measurement reporting based on a combined beam reference signal measurement A wireless device receives configuration parameters comprising: first beam identifiers of a first plurality of beams; second beam identifiers of a second plurality of beams; and at least one measurement parameter indicating a measurement reporting event type. The measurement reporting event type is triggered based on a second combined reference signal measurement value of the second plurality of beams exceeding a first combined reference signal measurement value of the first plurality of beams by more than a first offset value. An occurrence of the measurement reporting event type is determined based on monitoring the first plurality of beams and the second plurality of beams. In response to the determination, a measurement report is transmitted. The measurement report comprises: the first combined reference signal measurement value of the first plurality of beams; and the second combined reference signal measurement value of the second plurality of beams.
US11102684B1	Blind handover with adaptive learning based on past failures to trigger handover of beamforming-served devices A method and system for blindly triggering handover based on past failures to trigger handover of beamforming-served devices. A computing system identifies a geolocation area where wireless communication devices (WCDs) that are served with beamforming by a first access node tend to experience radio link failure after having reported to the first access node being within threshold weak coverage of the first access node and threshold strong coverage of a second access node. And, based on the identifying, the computing system then blindly triggers handover of a given WCD from the first access node to the second access node in response to determining that the given WCD is served with beamforming by the first access node while positioned in the identified geolocation area.
US11102683B2	Selective handover or redirection based on interface availability A first radio access network (RAN) accesses information indicating an availability status of an interface between an access and mobility management function (AMF) in a first wireless communication system and a mobility management entity (MME) in a second wireless communication system. The first RAN receives a trigger for a handover of a user equipment between the first RAN and a second RAN. The handover is selectively performed via the interface or a redirect via a network element shared by the first and second wireless communication systems based on the availability status. In some cases, the first RAN receive the information indicating the availability status prior to providing the request for the handover and stores the information in a database associated with the first RAN, which access the information from the database.
US11102681B2	Information transmission method, network apparatus, and terminal apparatus Provided in embodiments of the present application are an information transmission method, network apparatus, and terminal apparatus, enabling flexible distribution of reserved resources, and accordingly improving efficiency of using the reserved resources. The method comprises: a network apparatus sending second instruction information used to configure first instruction information; and the network apparatus sending, according to the configuration of the first instruction information, the first instruction information used to instruct resource reservation.
US11102680B1	Data transfer interface with reduced signaling A wireless data transceiver includes a media access controller (MAC) that receives an inbound packet from an air interface and to buffer that packet for transport to a host, and receives an outbound packet and transfers that packet to the air interface. A host interface receives the inbound packet from the MAC and transfers the inbound packet to the host, and receives the outbound packet from the host for transfer to the MAC. Transport controller circuitry (TCC), including processing circuitry configured to execute instructions, manages the transceiver. Hardware data transport circuitry (HDTC) for transporting packets in either direction between the MAC and the host interface includes a buffer memory having a plurality of slots. The TCC or HDTC issues a start or stop signal to the host interface causing the HDTC and the host interface to begin or end transfer of data between the buffer memory and the host interface.
US11102677B2	Wireless communication method and device Methods and apparatuses for wireless communication are provided. The method includes: when a first terminal device and a second terminal device perform wireless communication via a first network device, the first terminal device measures link quality of a first link, the first link is a link between the first terminal device and the first network device; and the first terminal device performs a reporting process for reporting the link quality of the first link according to the link quality of the first link and a first code rate, the first code rate is determined according to a code rate applicable to the first terminal device, or determined according to a code rate applicable to the second terminal device.
US11102672B2	Transmitting a truncated buffer status report by a wireless device A wireless device receives configuration of logical channels grouped into logical channel groups comprising a first logical channel group. A truncated buffer status report is transmitted. The truncated buffer status report comprises: a presence bit, and a plurality of buffer size fields. The presence bit indicates a presence of a buffer size field for the first logical channel group. The plurality of buffer size fields are for logical channel groups with logical channels having data for transmission following a decreasing order of priority. A number of the plurality of buffer size fields are determined based on a number of padding bits.
US11102671B2	Service data flow sending method and apparatus This application provides a service data flow sending method and apparatus. The method includes: receiving, by a data sending filter of user equipment (UE), a to-be-sent service data flow; obtaining, by the data sending filter, service domain name information corresponding to the to-be-sent service data flow; obtaining, by the data sending filter based on the service domain name information, a data sending pipeline corresponding to the to-be-sent service data flow; and sending, by the data sending filter, the to-be-sent service data flow by using the data sending pipeline. According to the service data flow sending method and apparatus in this application, a sending pipeline of a service data flow is determined in a relatively simple manner, thereby improving service data flow sending efficiency.
US11102666B2	Methods and apparatus to monitor WI-FI media streaming using an alternate access point Methods, apparatus, systems and articles of manufacture are disclosed to monitor WI-FI media streaming using alternate access points. An example apparatus disclosed herein monitor wireless traffic includes an example traffic monitor to identify a connection of a WI-FI client to a primary access point and capture a management frame transmitted from the primary access point to the WI-FI client. The example apparatus further includes an example frame generator to insert a change channel announcement into the captured management frame and a router to cause a wireless interface to transmit the beacon frame to the WI-FI client.
US11102664B2	SON coordination under the occurrence of an anomaly It is provided a method, comprising determining a range of an attribute of an anomaly; checking if the range of the attribute of the anomaly overlaps with a range of a related attribute of a coordinated function instance; triggering to execute a coordination action on the coordinated function instance if the range of the attribute of the anomaly overlaps with the range of the related attribute of the coordinated function instance, wherein the related attribute of the coordinated function instance is the same as the attribute of the anomaly, or the related attribute of the coordinated function instance and the attribute of the anomaly correspond to each other.
US11102660B2	Method for providing an optimized placement of Wi-Fi mesh network extenders A method for determining placement of a wireless, mesh network extender, the method comprising the steps of: establishing a connection with a wireless mesh network comprising a Central Access Point; building (401) a list of points of measurement of signal quality of said wireless, mesh network; outputting (403) a suggestion as to the placement of a new Mesh Access Point on a calculation of potential signal quality derived from said list (401).
US11102656B2	Network access authorization method, related device, and system Embodiments of the present invention disclose a network access authorization method, a related device, and a system. The method includes: when accessing a home network from an unlicensed spectrum access node, sending, by UE, a request message to the home network; performing, by a control plane network element of the home network based on access information and subscription data of the UE, access authorization for the UE that accesses the home network from the unlicensed spectrum access node, that is, determining whether to allow the UE to access the home network from the unlicensed spectrum access node; and sending an authorization result to the UE.
US11102651B2	Method for data transmission, battery management system, and storage medium The embodiments of the present disclosure disclose a method for data transmission, comprising: authenticating, by a target node in a battery management system, a source node in response to a request for data transmission from the source node; selecting, by the target node, any two prime numbers from a pre-stored set of prime numbers if the authentication is passed, generating a public key and a private key according to the two prime numbers, and transmitting the public key to the source node; performing, by the source node, a first encryption byte-by-byte for source data to be transmitted using the public key, performing a second encryption for the first encrypted data using a first encryption algorithm stored by the source node itself, and transmitting the second encrypted data to the target node.
US11102650B2	Secure beacon identity A method may include receiving a beacon from a first intermediate device via a first network, the beacon being received by the first intermediate device from an endpoint device via a second network. The beacon may include a hash value based at least in part on the identity of the endpoint device and a time unit when the beacon was generated. The hash value of the beacon may be validated based on the identity of the endpoint device and the time unit when the beacon was generated. The beacon may be forwarded to a server via a third network in response to the hash value of the beacon being valid.
US11102649B2	Wireless communications A method for operating a User Equipment (UE) is disclosed, wherein the UE is served by a source first network function in a first network and requires to register with a target second network function in a second network. The method comprises generating a registration request with integrity protection for at least a part of the registration request (1200), and sending an integrity protected part of the registration request to the source first network function via the target second network function (1202). Also disclosed are methods of operating first and second network functions.
US11102645B2	Network registration method of internet of things device, and device therefor Disclosed is an external electronic device for enabling an Internet of Things-supporting device to subscribe to a network. The external electronic device, according to the present disclosure, may provide, on a display thereof, an interface enabling the subscription of an Internet of Things device which does not comprise a separate display. In addition, the external electronic device, according to the present disclosure, may perform, via an external server, the subscription of the Internet of Things device to an Internet of Things service provider. In addition, various embodiments are possible as identified in the specification. In addition, various embodiments are possible as identified in the specification.
US11102642B1	System and method for enhanced communications on a wireless mesh network A wireless mesh network may have a plurality of nodes, each of which is able to dynamically establish itself as a gateway when a connection with an end-user device is detected. To route data to an end-user device, each node that is not, itself, a gateway to that device may route traffic along a path to the appropriate gateway. If a node does not have such a path in memory, it may broadcast an inquiry to all nodes with which communicates directly, to determine whether any of those nodes are a gateway to the end-user device, or have a path to the end-user device in memory. Thus, paths to gateways may propagate among the nodes. If multiple paths are available, a node may select the path that provides the best data transmission. Each node may replace pathways that are no longer valid, allowing the network to repair itself if needed.
US11102639B2	Method and device for facilitating handling content in an information centric network (ICN) Method performed by a first network node (111) for handling content in an Information-Centric Network (ICN). The first network node (111) operates in a wireless communications network (100). The first network node (111) obtains (502) an indication about one or more network nodes (130) where a request for a content by a wireless device (151) operating in the wireless communications network (100) is predicted to be received in one or more future time periods. The one or more network nodes (130) operate in the wireless communications network (100) supporting ICN. The first network node (111) then initiates instructing (503) at least a subset of the one or more network nodes (130) to obtain the content prior to the one or more future time periods. Also described are a second network node (112), a third network node (133), and the wireless device (151), for facilitating handling the content in the ICN.
US11102638B2	Power management techniques for increasing battery life in an alert generation system This disclosure provides systems and methods for providing an emergency alert notification. An electronic communication device can receive, from an alert generation device, a low power advertising packet responsive to an action performed on the alert generation device. Before the action is performed, the alert generation device can be in a low power state, such as a sleep state, to conserve battery. The action can cause the alert generation device to transition from the low power state to a second state in which the alert generation device begins transmitting the advertising packet. The electronic communication device can identify at least one emergency contact to receive an alert based on a contact policy and can determine an alert type based on the contact policy. The electronic communication device can generate the alert including a request for assistance and can transmit the alert to the at least one emergency contact.
US11102635B2	Distributed context-sharing networks A computer-implemented method for network management is disclosed and includes broadcasting, from a first sensored wireless transceiver, an availability to accept data from other sensored wireless transceivers; receiving, from one or more other sensored wireless transceivers, requests to subscribe to provide sensor data to the first sensored wireless transceiver; subsequently receiving data that indicates sensor values from the one of more other sensored wireless transceivers; aggregating the data that indicates sensor values; and transmitting the aggregated data to a central service through the Internet.
US11102626B2	Electronic device and communication relaying method thereof According to an embodiment, an electronic device may include a communication circuit, a display, a processor, and a memory. The memory may be store instructions which, when executed, configure the processor to control the electronic device to: control the communication circuit to receive a call from a first external electronic device, identify a receiving phone number of the call, identify a second external electronic device in a communication group set corresponding to the receiving phone number among at least one phone number registered based on information about a user account stored in the memory, and control the communication circuit to relay the call to the identified second external electronic device.
US11102625B2	Method for supporting SMS transmission for user equipment that can receive service from 3GPP 5G system and from EPS in wireless communication system, and apparatus therefor An embodiment of the present invention pertains to a method for a home subscriber server (HSS)+user data management (UDM) supporting a mobile terminated (MT) short message (SM) service for a UE that is registered to both of an evolved packet core (EPC) and a 5G core network (5GC) in a wireless communication system, the method comprising the steps of: the HSS+UDM receiving information for MT SM routing from an access and mobility management function (AMF) and a mobility management entity (MME); determining a priority regarding which one of an SMSF connected to the AMF and the MME an MT SM would be transmitted to first, based on the information; and transmitting routing information including the determined priority to an SMS-related node, wherein the HSS+UDM may determine the priority according to whether a UE to receive the MT SM is in a state of being connected to 5GC or EPC.
US11102624B2	Automated messaging Approaches provide for generating an introductory text message to be delivered to a recipient when a voice-enabled communications device is used to send a message to the recipient for a first time. For example, audio input data that includes an instruction to send a text message can be received and an application can analyze the audio input data to determine an instruction to send a text message, a message body, and an intended recipient of the text message. The application can determine whether a text message has previously been sent to the intended recipient using the voice-enabled communications device or another device associated with the customer's account. In the situation where a text message has been sent, a text message is generated that includes the message body and the application causes the text message to be sent to the intended recipient. In the situation where it is determined that this is the first time a text message is being sent to the intended recipient using the voice-enabled communications device or another device associated with the customer's account, an introductory text message is generated and the application causes the introductory text message and the text message that includes the message body to be sent to the intended recipient.
US11102621B2	Method and system to extend connection time of a talkgroup conversation based on historical talkgroup statistics A method for extending the connection time of talkgroup radios in a talkgroup conversation based on historical talkgroup statistics is provided. A talkgroup conversation request intended for a talkgroup is received from a first mobile unit. A group call grant message is sent to radios that are members of the talkgroup. The group call grant message initiates the talkgroup conversation with a first talkgroup call and includes an extended connection time value. Once it is determined that the first talkgroup call has ended, all radios that are members of the talkgroup are kept in a connected state. An extended connection timer utilizing the extended connection time value is started. Upon expiration of the extended connection timer, all radios that are members of the talkgroup are set to an idle state.
US11102620B2	Event-based interactive device system A computer system for activating an event-based interactive device can be configured to receive, through a data input API, a unique device identifier. The unique device identifier may be associated with the event-based interactive device. Additionally, the system can be configured to receive user information associated with a user of the event-based interactive device. The system can classify event-based interactive devices into groups based upon the user information. Further, the system can be configured to transmit a command to at least one group of event-based interactive devices.
US11102613B2	Server for controlling an information sharing state between a first mobile phone and a second mobile phone via a network A server for controlling an information sharing state between a first mobile phone and a second mobile phone via a network, including: a network interface that communicates with the first mobile phone and the second mobile phone; a memory that stores a predetermined distance data; and circuitry that receives first and second GPS signals, first and second user information, and first and second restriction information from the first and second mobile phones respectively; calculates a distance between the first and second mobile phones; compares the distance with the predetermined distance; changes an information sharing state between the first and second mobile phones from a first state to a second state based on the comparison result; and restricts the change of the information sharing state based on the first restriction information and the second user information.
US11102611B2	Tracking a mobile device In an example implementation, a method of tracking a mobile device includes determining by a tracked device, that a pairing status between the tracked device and a command device has changed from a paired status to an unpaired status. A timer is started on the tracked device in response to determining the unpaired status, and in response to the timer reaching a threshold time, a distress packet is transmitted from the tracked device that indicates the tracked device is lost.
US11102605B2	Audio signal processing apparatus and audio signal processing method An audio signal processing method includes selecting a channel group of at least two channels according to a predetermined reference, from among audio signals of at least three channels; and controlling a gain of the audio signal of each channel of the selected channel group, according to a volume level of the audio signal of each channel of the channel group.
US11102599B2	Acoustic monitoring using a sound masking emitter as a sensor Example embodiments may include one or more of receiving an electrical sound emission signal from a sound controller, interrupting reception of the electrical sound emission signal, by a sound emission interruption circuit connected to a sound emitter, and receiving an electrical ambient sound signal via a sound detection circuit, based on ambient sound sensed by the sound emitter when the reception of the electrical sound emission signal is interrupted by the sound emission interruption circuit.
US11102597B2	Playback device A playback device includes a playback function unit, a data signal monitoring unit configured to output a data change trigger signal based on a change in the data signal, a clock signal monitoring unit configured to output a clock change trigger signal based on a change in the clock signal, an enable signal monitoring unit configured to output an enabled/disabled state signal that indicates a disabled or enabled state of the enable signal, and a determining unit configured to determine whether the data signal, the clock signal, or the enable signal is properly inputted into the playback function unit or not, based on the data change trigger signal, the clock change trigger signal, and the enabled/disabled state signal.
US11102596B2	In-sync digital waveform comparison to determine pass/fail results of a device under test (DUT) Embodiments described herein generally relate to analyzing a signal generated by a device under test (DUT). In particular, the signal generated by the DUT may be compared to a reference signal to determine pass/fail results for the DUT. For example, a method may include: storing, on a computing device, a reference signal from a reference device; receiving a test signal from a device under test (DUT); synchronizing the reference signal and the test signal based on a time-synchronization buffer of each signal; after the synchronization, comparing the test signal and the reference signal to determine a pass or fail result for the DUT; and generating a notification indicating the pass or fail result for the DUT.
US11102593B2	Remotely updating a hearing aid profile Broadly speaking, the embodiments disclosed herein describe replacing a current hearing aid profile stored in a hearing aid. In one embodiment, the hearing aid profile is updated by sending a hearing aid profile update request to a hearing aid profile service, receiving the updated hearing aid profile from the hearing aid profile service, and replacing the current hearing aid profile in the hearing aid with the updated hearing aid profile.
US11102589B2	Hearing aid and method for use of same A hearing aid and method for use of the same are disclosed. In one embodiment, the hearing includes a body that at least partially conforms to the contours of an external ear and is sized to engage therewith. Various electronic components are contained within the body, including an electronic signal processor that is programmed with a respective left ear qualified sound range and a right ear qualified sound range. Each of the left ear qualified sound range and the right ear qualified sound range may be a range of sound corresponding to a preferred hearing range of an ear of the patient modified with a subjective assessment of sound quality according to the patient. Sound received at the hearing aid is converted to the qualified sound range prior to output.
US11102588B2	Hearing aid dryer and disinfection kit A portable airtight electronic component dryer device includes a container having an interior portion for receiving one or more electronic components for drying and a removable lid for the container. A desiccant is disposed in the interior portion of the container. The removable lid contains a disinfecting light source and a power source for providing power to the disinfecting light source. Light generated by the disinfecting light source is directed into the interior portion of the container.
US11102583B1	Current vectoring to electroacoustic output transducers having multiple voice coils An audio power output circuit provides a pair of output signals to an audio output transducer that has two different voice coils. Using a measured or predicted position of the voice coil assembly with respect to the transducer's magnetic field, a processing circuit generates the pair of signals such that a first relationship between a first one of the pair of output signals and an audio input signal and a second relationship between a second one of the pair of the output signals vary with the position of the voice coil. Offset in the Dynamic Mean Position (DMP) can be compensated for without adding low frequency or direct current components that compromise the dynamic range of the transducer. The efficiency, acoustic output power and/or linearity of the acoustic output of the transducer may be optimized by tailoring the first and second relationship to a particular target performance.
US11102580B2	Headset charger node The disclosure includes a headset including one or more earphones and a connector configured to couple data and charge between the headset and a user equipment (UE). The headset also includes a charge node. The charge node includes a charge port for receiving UE charge from a charge source. The charge node also includes a downstream port for coupling audio data toward the earphones. The charge node further includes an upstream port for coupling the audio data toward the earphones via the downstream port and coupling UE charge from the charge port toward the UE via the connector.
US11102571B2	Speaker position determination method, speaker position determination system, and audio apparatus A speaker position determination system includes a server, wherein the server includes: a processor configured to: acquire a first reproduction sound output from a first speaker and a second reproduction sound output from a second speaker at the same timing as the first reproduction sound, which are picked up by a sound pickup device arranged at a position of a speaker to be determined; calculate a first time lag indicating a time lag from an output timing of the first reproduction sound until a pickup timing of the first reproduction sound and a second time lag indicating a time lag from an output timing of the second reproduction sound until a pickup timing of the second reproduction sound; and determine the position of the speaker based on the first time lag and the second time lag.
US11102570B2	Auto-configurable bass loudspeaker The present disclosure is directed to devices and systems for auto configuration of directional sound. The system comprises: a first and second portable bass loudspeaker, each arranged to radiate sound waves responsive to audio signals. Each portable bass loudspeaker has a sensor for determining whether the portable bass loudspeaker is in an aligned state or non-aligned state, wherein in the aligned state, the first portable bass loudspeaker is oriented in a generally parallel and opposite direction relative to the second portable bass loudspeaker. Each portable bass loudspeaker has an equalization device providing a first equalization setting for outputting audio in response to detection of the aligned state, and a second equalization setting for outputting audio in response to detection of the non-aligned state, wherein the first equalization setting is configured to generate a radiating output from the first and second portable bass loudspeaker in a cardioid pattern.
US11102569B2	Methods and apparatus for a microphone system Various embodiments of the present technology comprise a method and apparatus for a microphone system. Various embodiments of the present technology may comprise a first microphone connected to a first high pass filter and a second microphone connected to a second high pass filter. The microphone system may further comprise a frequency controller configured to selectively activate the first high pass filter and the second high pass filter according to detected wind noise. The first and second high pass filters may be arranged to filter sound data from the first and second microphone prior to processing the sound data using beamforming.
US11102568B2	Automatic speech recognition triggering system An automatic speech recognition (ASR) triggering system, and a method of providing an ASR trigger signal, is described. The ASR triggering system can include a microphone to generate an acoustic signal representing an acoustic vibration and an accelerometer worn in an ear canal of a user to generate a non-acoustic signal representing a bone conduction vibration. A processor of the ASR triggering system can receive an acoustic trigger signal based on the acoustic signal and a non-acoustic trigger signal based on the non-acoustic signal, and combine the trigger signals to gate an ASR trigger signal. For example, the ASR trigger signal may be provided to an ASR server only when the trigger signals are simultaneously asserted. Other embodiments are also described and claimed.
US11102567B2	Foldable headphones This disclosure includes several different features suitable for use in circumaural and supra-aural headphones designs. Designs that reduce the size of headphones and allow for small form-factor storage configurations are discussed. User convenience features that include synchronizing earpiece stem positions and automatically detecting the orientation of the headphones on a user's head are also discussed. Various power-saving features, design features, sensor configurations and user comfort features are also discussed.
US11102564B2	Wireless sound device The present invention relates to a wireless sound device comprising: a housing having a sound hole formed on one side thereof; a sound output unit provided to the housing so as to output sound via the sound hole; a substrate provided to the housing so as to be positioned on the other side of the sound output unit; a battery provided to the housing so as to be positioned on the other side of the substrate, and comprising a pair of electrodes; a wireless communication unit provided to the substrate and carrying out wireless communication by supplying an RF signal; a pair of power terminals for connecting the pair of electrodes with the substrate so as to receive power from the battery; and a feed line connected to at least one of the pair of electrodes so as to supply the RF signal from the wireless communication unit to the at least one of the pair of electrodes, wherein the electrode connected to the feed line is an antenna for radiating the RF signal.
US11102563B2	Attachment mechanism for eartips Embodiments describe an attachment mechanism including a wire bent in various directions forming a spring compressible in lateral directions. The wire includes a first wireform feature and a second wireform feature extending from the first wireform feature, where the first wireform feature and the second wireform feature each include: an intermediate segment; a u-shaped segment extending from the intermediate segment; and an end segment extending from the u-shaped segment.
US11102560B2	Apparatus and methods for integrated high-capacity data and wireless IoT (internet of things) services Architectures, methods and apparatus for providing data services (including enhanced ultra-high data rate services and IoT data services) which leverage existing managed network (e.g., cable network) infrastructure, while also providing support and in some cases utilizing the 3GPP requisite NSA functionality. Also disclosed are the ability to control nodes within the network via embedded control channels, some of which “repurpose” requisite 3GPP NSA infrastructure such as LTE anchor channels. In one variant, the premises devices include RF-enabled receivers (enhanced consumer premises equipment, or CPEe) configured to receive (and transmit) OFDM waveforms via a coaxial cable drop to the premises. In another aspect of the disclosure, methods and apparatus for use of one or more required NSA LTE channels for transmission of IoT user data (and control/management data) to one or more premises devices are provided.
US11102558B2	Methods and apparatus for determining audience metrics across different media platforms An example includes a segment collector to: access impression records indicative of media access segments, the media access segments including start times and end times corresponding to media accessed by a panelist; and determine ones of the impression records that include a watermark corresponding to a first media platform presenting the media; a segment classifier to convert a first one of the impression records including the watermark to a converted impression record; and combine the converted impression record corresponding to the first media platform and a second impression record corresponding to a second media platform; and a media creditor to generate audience measurement metrics based on the combined impression records.
US11102555B2	System and method for layered delivery of media content quality A method in a server for providing various Internet Protocol television signal qualities involves an IPTV signal having a first signal quality that is transmitted over a first network connection to a first device. A request to receive the IPTV signal over a second network connection at a second device with the IPTV signal having a second signal quality is received. A determination is made that the second network connection has sufficient bandwidth to transmit the IPTV signal at the second signal quality, and that the second device is capable of receiving IPTV signal. The transmission of the IPTV signal over the first network connection to the first device is ended. An endpoint for the transmission of the IPTV signal to the first device is determined. The IPTV signal is transmitted over the second network connection to the second device at the second signal quality beginning at the determined endpoint.
US11102553B2	Systems and methods for secure playback of encrypted elementary bitstreams Systems and methods for providing multimedia content from one process or component to another process or component over an unsecured connection are provided. One embodiment includes obtaining the cryptographic information, extracting the at least partially encrypted video data from the container file to create an elementary bitstream, enciphering the cryptographic information, inserting the cryptographic information in the elementary bitstream, providing the elementary bitstream to a video decoder, extracting the cryptographic information from the elementary bitstream at the video decoder, deciphering the cryptographic information, decrypting the elementary bitstream with the cryptographic information and decoding the elementary bitstream for rendering on a display device using the video decoder.
US11102552B2	Providing a program listing Systems and methods for providing a program listing include storing user profile data and a user identifier for a user; storing an association of the user identifier with user identifiers for each of the plurality of social contacts of the user; receiving program identifier data representing programs currently being viewed by the social contacts; ranking the program identifier data for each of the plurality of social contacts based at least in part on the user profile data; and sending display data representing the program identifier data for display in an order based on the ranking.
US11102550B2	Method and system for presenting additional content at a media system A media system, receives a received sequence of media content, for presentation at the media system and generates a comparison fingerprint of the received sequence of media content. The comparison fingerprint is for comparison with a plurality of reference fingerprints so as to identify the received sequence of media content. The media system sends a request for identification of additional content to a server system. The request is based at least in part on the comparison fingerprint. The media system receives a response to the request, including information enabling additional content to be selected for display at the media system based at least in part on the identification of the received sequence of media content, and presents a displayed sequence of media content that includes at least a portion of the received sequence of media content and at least a portion of the additional content.
US11102549B2	Selective video overlay A method of providing a video program with overlay content. The method includes receiving a video program and transcoding the received video program into a plurality of segments, by the processor, each segment representing a different period of the video program. In response to receiving an instruction to add overlay content to the video program, a subset of the segments of the video program to which the overlay content is to be added is selected. Overlay content is added to the selected segments and the segments of the video program to which overlay content was added, together with the segments of the video program that were not selected are transmitted to a receiver.
US11102548B2	Systems and methods for providing program suggestions in an interactive television program guide An interactive television program guide application is provided that queries a user regarding the user's interest in television programs and suggests television programs to the user based on the user's responses. The interactive television program guide application identifies a television program that is potentially of interest to the user. The interactive television program guide application then queries the user regarding the user's interest using questions that are formulated based on attributes associated with the identified television program. Using the user's responses to the questions, the interactive television program guide application identifies and suggests one or more television programs to the user.
US11102541B2	Broadcast receiving apparatus A digital broadcast receiving apparatus capable of executing a function with a higher added value is provided. A broadcast receiving apparatus configured to receive contents includes: a receiving unit configured to receive the contents; an interface via which the contents received by the receiving unit is outputted; a control unit configured to control an output state of the contents from the interface. In this case, the control unit is configured to determine the output state of the contents from the interface in accordance with a combination of control information indicating a copy control state of the contents, control information for specifying necessity or not of protection when to output the contents, information indicating resolution of video of the contents, and information indicating transmission characteristics of video of the contents, which are received by the receiving unit together with the contents.
US11102535B1	Adjusting parameter settings for bitrate selection algorithms Techniques are described for adjusting parameter settings for bitrate selection algorithms for different segments of a population of devices streaming content. Streaming sessions are identified according to session characteristics. Within each segment of sessions, control parameter settings are sent to devices corresponding to a subset of each segment. Test parameter settings are sent to devices corresponding to another subset of each segment. If the test parameter settings result in better playback performance relative to the control parameter settings, the test parameter settings become the new control parameter settings, and new test parameter settings are generated.
US11102532B2	High definition television signal compatibility verification A system for providing television (TV) service including high definition television (HDTV) service, and for providing verification that a subscriber has connected an HDTV to the system includes a TV service provider headend and a set top box (STB). The HDTV may have an HDTV digital video interface (DVI) interconnect. The STB may be electrically coupled to the headend and have an STB DVI interconnect. When the HDTV DVI interconnect is initially electrically coupled to the STB DVI interconnect, the HDTV generally presents a data signal to the STB and the STB generally presents the data signal to the headend.
US11102530B2	Adaptive processing and content control system Systems, methods, and non-transitory, machine-readable media to facilitate adaptive processing and content control are disclosed. Content composites may be created and configured according to a computational model that may include a hierarchical ordering of the content composites using a hierarchical data structure. The configured content composites may be presented with a graphical user interface of an endpoint device. Metrics of interactions with interface elements corresponding to the configured content composites may be determined using a processing device that monitors inputs. The computational model may be automatically trained using the metrics of interactions to create an adapted computational model. Adapted content composites may be created and configured according to the adapted computational model that may include a second hierarchical ordering using a second hierarchical data structure. The adapted content composites may be presented with the graphical user interface.
US11102529B2	Echo cancellation in a bidirectional communication system for out of band signaling to a user device Disclosed herein are techniques for bidirectional communication in a network, such as a cable television (CATV) system, for return band with echo cancellation. The techniques result in a minimum loss of available return bandwidth to facilitate forward out of band (OOB) communication to a client device, e.g., set top box (STB), within the extended return band, such as a return band extended beyond a frequency previously used for OOB communications.
US11102527B2	Video distribution apparatus, video reception apparatus, video distribution method, and recording medium A video distribution apparatus includes a holding unit configured to hold a captured video image in a predetermined unit, a reception unit configured to receive a request regarding a segment length which is transmitted from an external reception apparatus, a generation unit configured to generate from the predetermined unit held by the holding unit a segment of the video image of the segment length corresponding to the request received by the reception unit, and a distribution unit configured to distribute to the reception apparatus the segment generated by the generation unit.
US11102526B1	System and method for selectively replacing commercials that are in a video data stream with alternative commercials Systems and methods are provided for selectively replacing commercials that are in a video data stream with alternative commercials. Automatic content recognition (ACR) is performed on the video data stream to detect the identity of each of the commercials played in a commercial block during a commercial break. Commercials in the video data stream which are detected as being displayed on a video display device are stored in a first database, and commercials in the video data stream which are detected as not being displayed on the video display device are stored in a second database. A rules engine defines how commercials in the video data stream should be replaced with other commercials. Commercials in the video data stream that were previously detected as being displayed on the video display device are selectively replaced with commercials that were previously detected as not being displayed on the video display device.
US11102520B2	Image display method and image display apparatus An image display method includes displaying an integrated video in which videos of a scene from different viewpoints are arranged in a frame, the videos including at least one real video and at least one virtual video generated from the at least one real video. A first user interface into which a first operation is input is displayed. Viewpoints of the displayed videos are changed according to the first operation. A second user interface into which a second operation is input is displayed. A playing speed of the displayed videos is changed according to the second operation.
US11102519B2	Centralized architecture for in-vehicle entertainment systems In-vehicle entertainment (IVE) systems can have a centralized architecture to improve heat dissipation characteristics and weight and/or size of the IVE systems. A centralized system for providing in-vehicle entertainment to passengers on a commercial passenger vehicle includes a printed circuit board (PCB) in a housing locatable in a structure in the commercial passenger vehicle and a plurality of display panels and microcontrollers located in a rear portion of the structure. Each microcontroller is communicably connected to one display panel and the PCB. The PCB includes a processor configured to decode audio and/or video content and to operate a plurality of virtual machines that correspond to and perform operations such as playback functionality related to the plurality of display panels.
US11102517B2	Apparatus and method for video encoding and decoding of coding tree unit An apparatus for decoding video data receives a bitstream including a coding tree unit (CTU) of encoded video data and split information related to the CTU of the video data, determines a coding block to be decoded, determines a prediction partition mode for the coding block corresponding to the leaf node of the tree split structure among a plurality of prediction partition modes using mode type information included in the bitstream, the plurality of prediction partition modes including at least one prediction partition mode allowing the coding block to be predicted by being split into two equal-sized triangles of the same size, and decodes the coding block corresponding to the leaf node according to the determined prediction partition mode.
US11102515B2	In loop chroma deblocking filter Chroma deblock filtering of reconstructed video samples may be performed to remove blockiness artifacts and reduce color artifacts without over-smoothing. In a first method, chroma deblocking may be performed for boundary samples of a smallest transform size, regardless of partitions and coding modes. In a second method, chroma deblocking may be performed when a boundary strength is greater than 0. In a third method, chroma deblocking may be performed regardless of boundary strengths. In a fourth method, the type of chroma deblocking to be performed may be signaled in a slice header by a flag. Furthermore, luma deblock filtering techniques may be applied to chroma deblock filtering.
US11102514B2	Conditionally parsed extension syntax for HEVC extension processing A system for signaling extension functions used in decoding a sequence including a plurality of pictures, each picture processed at least in part according to a picture parameter set is disclosed. An extension presence signaling flag is read and used to determine whether flags signaling the performance of extension functions are to be read. The flags are only read if indicated by the extension presence signaling flag.
US11102512B2	Encoder, decoder, encoding method, and decoding method An encoder includes circuitry and memory. The circuitry, using the memory: prohibits a first splitting method when arrangement and shapes of blocks obtained by splitting a first block multiple times by the first splitting method are identical to arrangement and shapes of blocks obtained by splitting the first block multiple times by a second splitting method different from the first splitting method, and when scan order of the blocks obtained by the first splitting method is identical to scan order of the blocks obtained by the second splitting method; and encodes the first block.
US11102505B2	Image encoding apparatus, image encoding method and program, image decoding apparatus, and image decoding method and program An index, indicating a vector representing a spatial relationship between a block to be encoded and at least one block spatially at the periphery of the block to be encoded, is encoded in a case where an coding mode to encode the block to be encoded is a first coding mode, and an index, indicating a vector representing a spatial relationship between the block to be encoded and at least one block spatially at the periphery of the block to be encoded, and a vector correlated with a block within an image that is different from the image to be encoded, is encoded in a case where the coding mode to encode the block to be encoded is a second coding mode.
US11102503B2	Motion information prediction method and apparatus for distortion due to projection formation conversion There is provided a method of decoding an image, the method comprising: decoding information for motion information prediction of a current block from a bitstream, predicting motion information of the current block based on the information, refining motion information of the current block by using the decoded information and the predicted motion information of the current block and reconstructing the current block based on the refined motion information of the current block.
US11102496B2	Adjustments to encoding and decoding when switching color spaces Approaches for encoding or decoding when switching color spaces involve signaling of control information for adaptive color space transformation (“ACT”). For example, an encoder encodes a unit of video to produce encoded data. As part of the encoding, the encoder evaluates a condition for the unit and conditionally signals a syntax element that indicates whether ACT is enabled within the unit. The encoder outputs the encoded data as part of a bitstream. A corresponding decoder receives encoded data as part of a bitstream. The decoder decodes the encoded data to reconstruct a unit of video. As part of the decoding, the decoder evaluates a condition for the unit and conditionally parses a syntax element that indicates whether ACT is enabled within the unit. The syntax element is parsed if the condition is satisfied, but otherwise the parsing of the syntax element is skipped.
US11102492B2	Multi-sensor motion detection Use of multiple sensors to determine whether motion of an object is occurring in an area is described. In one aspect, an infrared (IR) sensor can be supplemented with a radar sensor to determine whether the determined motion of an object is not a false positive.
US11102489B2	Encoder, encoding method, decoder, and decoding method When intra prediction is to be used, an encoder determines whether an adaptive basis selection mode is to be used and whether a size of the current block matches a determined size. When the adaptive basis selection mode is to be used and the size matches the determined size, the encoder fixes the first transform basis for the current block to a first determined transform basis in the adaptive basis selection mode, and generates first transform coefficients by performing first transform of residual signals of the current block using the first determined transform basis; quantizes the first transform coefficients when an intra prediction mode for the current block is a determined mode; and generates second transform coefficients by performing second transform of the first transform coefficients using a second transform basis, and quantizes the second transform coefficients, when the intra prediction mode is not the determined mode.
US11102487B2	Image resampling for DCT based image encoding formats using memory efficient techniques The present disclosure relates to systems, methods, and non-transitory computer readable media for generating digital images of modified resolution by filtering in the frequency domain. For example, the disclosed systems can utilize a tiling procedure to generate discrete cosine transform blocks. The disclosed systems can further filter the quantized data of the discrete cosine transform blocks within the frequency domain using, for example, a Lanczos resampling kernel. In addition, the digital image resolution modification system can utilize sub-band approximation and block composition to generate a modified digital image.
US11102486B2	Adaptive weighting of reference pictures in video encoding A video decoder, encoder, and corresponding methods for processing video data for an image block and a particular reference picture index to predict the image block are disclosed that utilize adaptive weighting of reference pictures to enhance video compression, where a decoder includes a reference picture weighting factor unit for determining a weighting factor corresponding to the particular reference picture index; an encoder includes a reference picture weighting factor assignor for assigning a weighting factor corresponding to the particular reference picture index; and a method for decoding includes receiving a reference picture index with the data that corresponds to the image block, determining a weighting factor for each received reference picture index, retrieving a reference picture for each index, motion compensating the retrieved reference picture, and multiplying the motion compensated reference picture by the corresponding weighting factor to form a weighted motion compensated reference picture.
US11102479B2	Order of rounding and pruning in LAMVR Devices, systems and methods for encoding and decoding digital video historical information such as tables containing coding candidates are described. In a representative aspect, a method for video processing includes maintaining an Advanced Motion Vector Prediction (AMVP) candidate list for a conversion between a video block of a video and a bitstream representation of the video with a motion vector precision of M-Pel or sub-pel selected from multiple available motion vector precisions, M being a positive integer. The method also includes comparing an AMVP candidate associated with the video block with existing AMVP candidates in the AMVP candidate list, adding the AMVP candidate to the AMVP candidate list upon determining that the AMVP candidate is different than the existing candidates, and performing the conversion based on the AMVP candidate list.
US11102470B2	Apparatus and method for providing a graphic representation or graphic representation sequence for detection by a detector For providing an apparatus and method for providing a graphic representation (1) or a graphic representation sequence for detection by a detector (3) which provide a simple and effective variation of a graphic representation (1) or a graphic representation sequence for detection by the detector (3) an apparatus is claimed, comprising: a sequence of graphic representations (1) along an optical axis (2), an optical device (4) for focusing on at least one of the graphic representations (1), so that the at least one of the graphic representations (1) is visible by a detector (3) preferably with a predefinable sharpness, a control unit (5) for defining and providing a focusing sequence on the at least one of the graphic representations (1) by the optical device (4) for providing a change of visibility of the graphic representations (1) or of a part of the graphic representations (1) by the detector (3) in order to allow for the verification of the correct functioning of the detector.
US11102469B2	3D play system A 3D play system which includes a head-mounted/headset device. The head-mounted device includes a supporting structure, a first lens, and a second lens. The supporting structure is configured to support two display devices. The first lens is configured to zoom an image displayed by a first display device and project the zoomed image onto a left eye. The second lens is configured to zoom an image displayed by a second display device and project the zoomed image onto a right eye.
US11102468B2	Light emitting device and image capturing device using same A light emitting device and an image capturing device using the light emitting device. The light emitting device includes a light emitting element, a digital micro mirror (DMD), a reflecting prism, and a housing. The light from the light emitting element is modulated by the DMD into structured light. The reflecting prism is on an optical path of the source light. The reflecting prism guides the source light to the DMD. The housing defines a receiving cavity. The light emitting element, the reflecting prism, and the DMD are received in the receiving cavity. The housing defines a light exit opening, the structured light exits from the light exit opening.
US11102466B2	Derivation of disparity motion vector, 3D video coding and decoding using such derivation A decoding method including: decoding at a current time instant a current image having at least two views respectively representative of a same scene. The decoding includes: deriving a disparity motion vector for a current block; predictively decoding the current block according to the derived disparity motion vector; and during the deriving: constructing a plurality of lists of disparity motion vectors, including at least one list in which at least two disparity motion vectors have been derived respectively according to at least two different estimation methods; applying a first function to the at least two disparity motion vectors of the at least one list, to obtain one disparity motion vector for each of the at least one list, and applying a second function to the disparity motion vectors of the plurality of lists to deliver the derived disparity motion vector.
US11102465B2	Spherical visual content transition First visual information defining first spherical visual content, second visual information defining second spherical visual content, and/or other information may be obtained. Presentation of the first spherical visual content on a display may be effectuated. A spherical transition between the first spherical visual content and the second spherical visual content may be identified. The spherical transition may define a change in presentation of visual content on the display from the first spherical visual content to the second spherical visual content based on a transitional motion within a spherical space and/or other information. A change in presentation of the first spherical visual content on the display to presentation of the second visual content on the display may be effectuated based on the spherical transition and/or other information. The change may be determined based on the transition motion within the spherical space and/or other information.
US11102459B2	3D machine-vision system One embodiment can provide a machine-vision system. The machine-vision system can include a structured-light projector, a first camera positioned on a first side of the structured-light projector, and a second camera positioned on a second side of the structured-light projector. The first and second cameras are configured to capture images under illumination of the structured-light projector. The structured-light projector can include a laser-based light source.
US11102457B1	Audio/video recording and communication doorbell devices An audio/video (A/V) recording and communication doorbell device includes an input port, a switch, a first power supply, a second power supply, a button, a first controller, and a second controller. The switch is electrically coupled across the input port. The first power supply receives power from the input port and powers a first power supply rail, and the second power supply powers a second power supply rail. The button, when pressed, activates a signaling device. The first controller is at least partially powered from the first power supply rail and closes the switch in response to the button being pressed. The second controller is at least partially powered from the second power supply rail.
US11102454B2	Image relaying device and image detecting device An image relaying device comprises a shaft, an objective lens at a distal end of the shaft, an optically transparent window region in a proximal end region of the image relaying device, an optical system in the shaft, the optical system relaying an image produced by the objective lens to the proximal end region in a way that the relayed image can be captured through the window region. The optical system's optical axis at the window region is orthogonal or substantially orthogonal to the optical system's optical axis in the shaft. An optical instrument makes use of a plurality of these image relaying devices and a corresponding plurality of image sensors where the optical path length of each image relaying device may be independently adjusted to correct for optical inconsistencies in the elements of each relaying device.
US11102451B2	Videoconferencing server for providing multi-screen videoconferencing by using a plurality of videoconferencing terminals and method therefor A videoconferencing server for providing a multi-screen video conference by using multiple videoconferencing terminals and a method thereof. The video conferencing server can logically group a plurality of the existing videoconferencing terminals (physical terminals) each having one or two displays to operate like a logical terminal operating as one videoconferencing point. The video conferencing server may process as if the logical terminal supports multiple screens by transmitting videos to the plurality of physical terminals constituting the logical terminal.
US11102450B2	Device and method of displaying images A method for censoring inappropriate images during a video call is disclosed. The method includes: receiving, from a first terminal, a stream including a plurality of images captured by the first terminal; attempting to detect a face in each of one or more sample images selected among the plurality of images included in the stream; determining that the face has not been detected in at least some of the sample images; performing image processing on at least one of the plurality of images included in the stream; and displaying the plurality of images included in the stream.
US11102449B2	Methods and systems for a natural and realistic telepresence experience Embodiments of the present invention are directed towards methods and systems for providing an enhanced telepresence experience to users participating in a videoconferencing session (VCS). In the embodiments a camera is configured and arranged to capture image data covering objects within a substantial portion of the field of view (FOV) of a display device, without capturing image data encoding images displayed on the display device. That is, the camera's FOV is aligned with the display device's FOV. As such, the camera captures image data encoding images in a substantial portion of the display's FOV. According, users within a VCS may approach their display without falling outside their camera's FOV. This provides an enhanced telepresence experience, where the users may interact with each other through what appears to be a transparent window or barrier.
US11102446B2	Arrangement for verification of signal units The present invention relates to an arrangement or a device for transmission and verification of signals in audio visual radio transmitters and receivers, such as TV receivers, set-top boxes, mobile handsets, etc. The receiver may be configured to receive a number of signal units within a frequency range. An identifying unit is configured to identify the signal units. A comparator unit configured to make possible for at least a portion of the signal units to be forwarded or at least partially be blocked with respect to the receiver. A verification unit, which includes a memory configured to store at least a number of signal units, verify that each forwarded signal units that pass the arrangement is being registered by means of a specific signal in a register unit.
US11102445B1	Extending support of Audio Video Transport Protocol by data encapsulation Various embodiments provide for using data encapsulation to extend support of an Audio Video Transport Protocol (AVTP) standard, which can be used in such applications as data network communications between sensors (e.g., cameras, motion, radar, etc.) and computing equipment within vehicles (e.g., smart and autonomous cars).
US11102441B2	Smart television and method for displaying graphical user interface of television screen shot The present disclosure is intended to provide a smart television and a method for displaying a graphical user interface of a television screen shot. The method includes while a display device is displaying currently-played content, in response to receiving an input instruction for capturing a screen shot, acquiring a screen shot image comprising at least one object; and while the display device continues playing, displaying a screen shot content display layer on the display device. The screen shot content display layer is configured to present the screen shot image. The method further includes in response to receiving an input for selecting an object or a keyword matched with the object, displaying recommended content related to the object; in response to receiving a selection for a different object on the screen shot image by moving a focus frame, updating presentation of recommended content based on the selected different object.
US11102437B2	Memory circuit and semiconductor device A memory circuit includes a memory array, a word line, and a bit line. The memory array includes a plurality of memories arranged in a matrix shape in a first direction and a second direction perpendicular to the first direction. The word line extends in the first direction and reads signals from the plurality of memories arranged in the first direction. The bit line includes a digit line connected to the plurality of memories arranged in the second direction and an output line connected to the digit line and extending in the first direction and transmits a signal from a memory corresponding to the word line to the output line as the word line reads a signal.
US11102435B2	Imaging device and method of driving imaging device An imaging device includes a pixel that outputs a signal based on charges generated by photoelectric conversion, a comparator that compares a pixel signal output from the pixel with a reference signal and outputs a signal in accordance with a comparison result, a buffer circuit that buffers a signal output from the comparator, a switch provided at least one of a part between the buffer circuit and a first node supplied with a first power source voltage and a part between the buffer circuit and a second node supplied with a second power source voltage, and a control circuit that controls the switch to a non-conductive state in a period in which the comparator performs a comparison operation to compare the pixel signal with the reference signal.
US11102424B2	Medical observation apparatus and medical observation system A medical observation apparatus includes: a camera including a first imager including a plurality of pixels and configured to image a first medical captured-image in which an observation target is imaged, and a second imager including a plurality of pixels, and configured to image a second medical captured-image in which the observation target is imaged, the second imager including more effective pixels than the first imager; and a display controller configured to cause displays to display the first medical captured-image and an image that corresponds to a region set to the second medical captured-image on a display screen of the respective one of the displays corresponding thereto, wherein one of the first medical captured-image and the second medical captured-image is a medical captured image for a right eye, and another one of the first medical captured-image and the second medical captured-image is a medical captured image for a left eye.
US11102423B2	Image pickup apparatus that performs flicker detection, control method for image pickup apparatus, and storage medium An image pickup apparatus includes an image pickup device that picks up a subject by driving by a rolling shutter method, a memory that stores a set of instructions and at least one processor that executes the instructions to divide, when driving the image pickup device at a second frame rate lower than a first frame rate, a plurality pieces of image data successively acquired by the image pickup device at the second frame rate into predetermined areas to acquire data of divided areas, and perform flicker detection using a predetermined number of pieces of the data of the divided areas successive for a plurality of frames.

1 2 3 4 5 6 7 8 9 10