| Document | Document Title |
|---|---|
| US11099856B2 |
Methods for uninstalling SSD (solid-state disk) cards and apparatuses using the same
The invention introduces a method for uninstalling SSD (Solid-state Disk) cards, performed by a processing unit when loading and executing a driver, including at least the following steps: reading the value of the register of an SSD card on which there is an access attempt according to a data access command in the time period between reception of the data access command from an application and transmission of a data access request corresponding to the data access command to lower layers; and executing an uninstall procedure when detecting that the SSD card has been removed according to a result of the reading. |
| US11099855B2 |
System and method for updating files through a peer-to-peer network
A system and a method for updating files through a peer-to-peer (P2P) network are provided. The system includes a plurality of device nodes, and a link manager. The device nodes are distributed in a peer-to-peer network and respectively have baseboard management controllers (BMCs). The link manager connects to the peer-to-peer network via a management network and includes an update engine. The device nodes include at least a first device node, a second device node and a third device node. The link manager sends an update command to the peer-to-peer network. The update engine arranges a first update from the first device node to the second device node, and arranges a second update from the second device node to the third device node. |
| US11099854B1 |
Pipelined operations in neural networks
An integrated circuit (IC) implements an M by N aperture function over an R by C source array. The IC has an input port receiving an ordered stream of independent input values, an output port producing an output stream, a mass multiplier circuit multiplying inputs by weights, producing streams of products on pathways on the IC, an M by N array of compositor circuits on the IC, single dedicated pathways between compositors, delay circuits, a finalization circuit, and a control circuit operating counters and producing control signals. The compositors combine the values received from product pathways, further combine that result to an initial value or to a value from an adjacent compositor upstream, or to a value from a delay circuit. Upon a last downstream compositor producing a complete composition of values, that value is passed to the finalization circuit, which posts a result to the output port. |
| US11099852B2 |
Apparatus and method for maintaining prediction performance metrics for prediction components for each of a plurality of execution regions and implementing a prediction adjustment action based thereon
An example apparatus comprises instruction execution circuitry and fetch circuitry to fetch, from memory, instructions for execution by the instruction execution circuitry. The fetch circuitry comprises a plurality of prediction components, each prediction component being configured to predict instructions in anticipation of the predicted instructions being required for execution by the instruction execution circuitry. The fetch circuitry is configured to fetch instructions in dependence on the predicting. The apparatus further comprises prediction tracking circuitry to maintain, for each of a plurality of execution regions, a prediction performance metric for each prediction component. The fetch circuitry is configured, based on at least one of the prediction performance metrics for a given execution region, to implement a prediction adjustment action in respect of at least one of the prediction components. |
| US11099846B2 |
Apparatus and method for resynchronization prediction with variable upgrade and downgrade capability
A method and apparatus generates control information that indicates whether to change a counter value associated with a particular load instruction. In response to the control information, the method and apparatus causes a hysteresis effect for operating between a speculative mode and a non-speculative mode based on the counter value. The hysteresis effect is in favor of the non-speculative mode. The method and apparatus causes the hysteresis effect by incrementing the counter value associated with the particular load instruction by a first value or decrementing the counter value by a second value. The first value is greater than the second value. |
| US11099845B2 |
Image edit apparatus for creating synthesized images, and image edit method and recording medium
An image edit apparatus designates not only moving objects based on sequential images at the time intervals initially designated by the user, but also moving object, which was shot at shorter time intervals than the initially designated time intervals and corresponds to a freely selected position designated by the user on the locus (trajectory) of the moving objects as analysis targets of the moving objects. Thus, from the continuously shot sequential images/moving image acquired by shooting a moving object, the user designates an image at a freely selected part which is not a part of the regular time intervals, and can utilize the image for analyzing the moving object. |
| US11099843B2 |
Determining similarity groupings for software development projects
Methods, systems, and apparatus, including computer programs encoded on computer storage media, for generating similarity groupings of software projects. One of the methods includes computing respective values for a plurality of analysis metrics associated with each software development project of a plurality of software development projects, wherein the analysis metrics include snapshot metrics that represent respective properties of the commit history of snapshots in the software development project, functionality metrics that represent respective properties of software elements in the software development project, or both. A similarity grouping is computed for the primary software development project based on the respective computed values for the plurality of analysis metrics for the plurality of software development projects, wherein the similarity grouping for the primary software development project comprises fewer than all of the plurality of software development projects. |
| US11099841B2 |
Annotations for parallelization of user-defined functions with flexible partitioning
Annotations can be placed in source code to indicate properties for user-defined functions. A wide variety of properties can be implemented to provide information that can be leveraged when constructing a query execution plan for the user-defined function and associated core database relational operations. A flexible range of permitted partition arrangements can be specified via the annotations. Other supported properties include expected sorting and grouping arrangements, ensured post-conditions, and behavior of the user-defined function. |
| US11099834B2 |
Software builds using a cloud system
The examples include methods and apparatuses to build software using a cloud system. Building software can include receiving a number of events from a software repository reporting a change to the software repository and, based on receiving the number of events, trigger a software build. Building software can also include, based on triggering the software build, synchronizing the software repository on a cloud system to generate a synchronized software repository, instructing the cloud system to perform the software build using the synchronized software repository, and receiving and publishing an artifact generated by the software build. |
| US11099830B2 |
Software updating apparatus, vehicle, and software updating method
A software updating apparatus includes an update control section that performs a software update for each of a plurality of electronic control units mounted in a vehicle, by using new versions of software supplied via a network, and an update mode determining section that selectively determines an update mode used when performing the software update, from among a parallel update mode and a serial update mode. The update control section performs the software update for each of the plurality of electronic control units based on the update mode determined by the update mode determining section. |
| US11099827B2 |
Networking-device-based hyper-coverged infrastructure edge controller system
A networking-device-based HCI edge controller system includes a networking device coupled to a master controller system via a network, as well as locally to an HCI node system including HCI node(s). The networking device and the HCI node system are provided at an edge location in a network, and the networking device operates to identify HCI node components that are included in the HCI node(s) in the HCI node system, and retrieve respective software inventory information for each of the HCI node component in the HCI node(s). The networking device receives first updated software from the master controller system via the network, determines that the respective software inventory information for at least one of the HCI node components does not comply with the first updated software for those HCI node components and, in response, provides the first updated software on those HCI node components. |
| US11099824B2 |
Policy-driven management of application traffic for providing services to cloud-based applications
Provided are methods and systems for transition between a current cloud-based code environment and an updated cloud-based code environment. A method for transition between a current cloud-based code environment and an updated cloud-based code may commence with generating a steering policy. The steering policy may include a set of rules to guide steering decisions between a current cloud-based code environment and an updated cloud-based code environment. The method may further include sending the steering policy to a steering server. The steering server may make steering decisions to steer, based on the steering policy, service requests between the current cloud-based code environment and the updated cloud-based code environment. The method may continue with receiving feedback concerning actual steering decisions made by the steering server. The method may further include automatically adjusting the steering policy in response to the feedback. |
| US11099822B2 |
System and method for deploying a distributed component-based application
A system and method for deploying a distributed component-based application is disclosed. The system may include a plurality of uniform base components. Each base component of the plurality of uniform base components may host a respective service component, and may include an input port, an output port, a service port, an error, log, and exception port, a monitoring port, and a control port. A first base component may process event messages asynchronously with a second base component and a third base component. The system and method may also support auto-scalability of each base component. |
| US11099817B1 |
Generation of software program repair examples
Operations may include generating a first graphical representation of a buggy version of source code of a software program and generating a second graphical representation of a repaired version of the source code. The buggy version may include an error and the error has been corrected in the repaired version. The operations may also include identifying, as matching nodes, a first node of the first graphical representation and a second node of the second graphical representation that match each other. The operations may additionally include applying a same reduction to the first node and to the second node concurrently to generate a reduced buggy version of the source code and a reduced repaired version of the source code. Further, the operations may include generating a repair example with respect to correcting the error in which the repair example is based on the reduced buggy version and the reduced repaired version. |
| US11099816B2 |
Workflow development system with ease-of-use features
A workflow development system is described that provides a developer with a search utility for finding steps for inclusion in a workflow. The system also automatically generates a meaningful name and/or graphical representation for a workflow. The system also provides a graphical user interface that represents output parameters of a first workflow step as user-interactive objects. These objects can be interacted with to cause the objects to be inserted into a data entry element that is used to specify a value for an input parameter of a second workflow step. When executable logic representing the first and second workflow steps is generated, the insertion of the objects into the data entry element has the effect of causing the value of the input parameter of the second workflow step to be defined to include the values of the output parameters that correspond to the inserted objects. |
| US11099814B2 |
Neural network semiconductor device and system using the same
A semiconductor device capable of performing product-sum operation is provided. The semiconductor device includes a first memory cell, a second memory cell, and an offset circuit. The semiconductor device retains first analog data and reference analog data in the first memory cell and the second memory cell, respectively. A potential corresponding to second analog data is applied to each of them as a selection signal, whereby current depending on the sum of products of the first analog data and the second analog data is obtained. The offset circuit includes a constant current circuit comprising a transistor and a capacitor. A first terminal of the transistor is electrically connected to a first gate of the transistor and a first terminal of the capacitor. A second gate of the transistor is electrically connected to a second terminal of the capacitor. A voltage between the first terminal and the second gate of the transistor is held in the capacitor, whereby a change in source-drain current of the transistor can be suppressed. |
| US11099813B2 |
Memory retention system
The present disclosure generally relates to a computer-implemented system for intelligently retaining and recalling memory data. An exemplary method comprises receiving, via a microphone of an electronic device, a speech input of the user; receiving a text input of the user; constructing a first instance of a memory data structure based on the speech input; constructing a second instance of the memory data structure based on the text input; adding the first instance and the second instance of the memory data structure to a memory stack of the user; displaying a user interface for retrieving memory data of the user; receiving, via the user interface, a beginning of a statement from the user; retrieving a particular instance of the memory data structure from the memory stack based on the beginning of the statement; and automatically displaying a completion of the statement. |
| US11099812B2 |
Device and method for performing functions
Provided is a device including a display, an audio inputter, and a controller. The display displays at least one screen page of an application that is being executed. The audio inputter receives a voice command of a user. The controller performs an operation corresponding to the voice command by using screen page transition information for transition between application screen pages corresponding to the voice command, which is obtained from information about user interface (UI) elements included in the application screen pages of the application. Each of the UI elements performs a predetermined function when selected by the user. |
| US11099811B2 |
Systems and methods for displaying subjects of an audio portion of content and displaying autocomplete suggestions for a search related to a subject of the audio portion
Systems and methods are described herein for displaying subjects of a portion of content and searching for content related to a particular subject in the content. Media data of content is analyzed during playback, and a number of audio signatures are identified. Each audio signature is associated, based on audio characteristics, with a particular subject within the content. The audio signature is stored, along with a timestamp corresponding to a playback position at which the audio signature begins, in association with an identifier of the particular subject. Upon receiving a command, icons representing each of a number of audio signatures at or near the current playback position are displayed. Upon receiving user selection of an icon corresponding to a particular signature, a portion of the content corresponding to the audio signature is played back or a search interface is displayed including autocomplete suggestions related to the subject of the signature. |
| US11099810B2 |
Systems and methods for communicating notifications and textual data associated with applications
Embodiments are provided for communicating notifications and other textual data associated with applications installed on an electronic device. According to certain aspects, a user can interface with an input device to send (218) a wake up trigger to the electronic device. The electronic device retrieves (222) application notifications and converts (288) the application notifications to audio data. The electronic device also sends (230) the audio data to an audio output device for annunciation (232). The user may also use the input device to send (242) a request to the electronic device to activate the display screen. The electronic device identifies (248) an application corresponding to an annunciated notification, and activates (254) the display screen and initiates the application. |
| US11099809B2 |
Display apparatus and control method thereof
Disclosed are a display apparatus comprising: a display; a user input receiver comprising receiving circuitry configured to receive a voice input uttered by a user; and a processor configured to: display at least one first image and text information on a display, the text information being related to a second image which is not displayed on the display, and display the second image on the display based on the voice input corresponding to the text information uttered by the user. |
| US11099805B2 |
Reproduced data output apparatus and computer program product
A reproduced data output apparatus includes: a reproduced data receiver section to receive a reproduced data of a content from an external instrument having a reproduction function of the content; a report determiner section to determine whether an operation status report signal indicating that a status of a present operation of the external instrument is a status of a different operation is reported from the external instrument, in response to that an occurrence of an event is identified during a status of a first operation being identified as a status of a present operation of the external instrument; and a command transmission controller section to transmit a command that requires a re-start of the first operation to the external instrument, in response to that the operation status report signal is determined to be reported from the external instrument. |
| US11099804B2 |
Panel driver interface systems and methods for electronic device displays
Aspects of the subject technology relate to electronic device display circuitry and methods of operating the display. The display circuitry a panel driver interface that decodes digital display data, for each display frame, received from host circuitry of the electronic device. The digital display data includes error correction and detection information for frame and line configuration information distributed in a frame packet and multiple line packets for each display frame. The frame and line configuration information facilitates, efficient, low-error, digital control of various display operational features. |
| US11099803B2 |
Information providing method using mobile device
Provided is a method of providing information through a mobile device, in which an information providing screen is outputted only during the first activation performed within a predetermined time range designated by a user. Therefore, inconvenience resulting from repetitive outputs of the information providing screen can be resolved. |
| US11099798B2 |
Differentiated content delivery system and method therefor
A multi-view display system that detects and locates viewers, establishes a set of characteristics for the viewers, generates or selects personalized content for each viewer based on the characteristics, and displays the personalized content, via at least one multi-view display, to the plurality of viewers simultaneously is disclosed. |
| US11099786B2 |
Signaling for heterogeneous memory systems
A memory controller interfaces with a non-volatile storage class memory (SCM) module over a heterogeneous memory channel, and includes a command queue for receiving memory access commands. A memory interface queue is coupled to the command queue for holding outgoing commands. A non-volatile command queue is coupled to the command queue for storing non-volatile read commands that are placed in the memory interface queue. An arbiter selects entries from the command queue, and places them in the memory interface queue for transmission over a heterogeneous memory channel. A control circuit is coupled to the heterogeneous memory channel for receiving a ready response from the non-volatile SCM module indicating that responsive data is available for a non-volatile read command, and in response to receiving the ready response, causing a send command to be placed in the memory interface queue for commanding the non-volatile SCM module to send the responsive data. |
| US11099784B2 |
Crosspoint memory architecture for high bandwidth operation with small page buffer
Apparatuses and techniques are described for reading crosspoint arrays of memory cells with high bandwidth and a relatively small page buffer. Multiple crosspoint arrays (XPAs) are read in parallel, with one memory cell per XPA being read, in a bank of XPAs. To reduce the read time, a row can be selected for the XPAs, after which memory cells in different columns are read, one column at a time, while the same row is selected. This avoids the need to transmit commands and a row address for re-selecting the row in each successive read operation. The XPAs may be ungrouped, or one XPA may be accessible at a time in a group. In one option, the XPAs are arranged in sets, either individually or in groups, and one set is accessible at a time. |
| US11099782B2 |
Portions of configuration state registers in-memory
Portions of configuration state registers in-memory. An instruction is obtained, and a determination is made that the instruction accesses a configuration state register. A portion of the configuration state register is in-memory and another portion of the configuration state register is in-processor. Processing associated with the configuration state register is performed. The performing processing is based on a type of access and whether the portion or the other portion is being accessed. |
| US11099778B2 |
Controller command scheduling in a memory system to increase command bus utilization
A first command is scheduled on a command bus, where the first command requires use of a data bus resource at a first time period after scheduling the first command. Prior to the first time period, a second command is identified according to a scheduling policy. A determination is made whether scheduling the second command on the command bus will cause a conflict in usage of the at least one data bus resource. In response to determining that scheduling the second command will cause the conflict in usage, a third lower-priority command is identified for which scheduling on the command bus will not cause the conflict in usage. The third command is scheduled on the command bus prior to scheduling the second command, even though it has lower priority than the second command. |
| US11099776B2 |
Memory system having memory device queuing a plurality of commands and operating method thereof
A memory system includes a plurality of memory devices configuring a plurality of ways, and a memory controller communicating with the plurality of memory devices through a channel, wherein each of the plurality of memory devices includes a device queue, and wherein the device queue queues a plurality of controller commands inputted from the memory controller. |
| US11099773B1 |
Memory system for write operation and method thereof
A memory system includes a memory device and a controller. The controller receives data from a host, allocates buffers after a throttling delay, buffers the data in the buffers, provides the buffered data to the memory device for a write operation, generates a response associated with the write operation, and transmits the response to the host. The controller inserts a throttling delay before allocating the buffers and/or transmitting the response. The throttling delay is determined based on a time elapsed since providing previously buffered data to the memory device and the size of the buffered data. The throttling delay is corrected based on the difference of the number of currently allocated buffers and a buffer reserve threshold. |
| US11099769B1 |
Copying data without accessing the data
A system and method for performing copy offload operations. When a copy offload operation from a first volume (pointing to a first medium) to a second volume (pointing to a second medium) is requested, the copy offload operation is performed without accessing the data being copied. A third medium is created, and the first medium is recorded as the underlying medium of the third medium. The first volume is re-pointed to the third medium. Also, a fourth medium is created, the second volume is re-pointed to the fourth medium, and the second medium is recorded as the underlying medium of the targeted range of the fourth medium. All other ranges of the fourth medium have the second medium as their underlying medium. |
| US11099765B2 |
Data protection of container persistent storage with changed block tracking
Embodiments include methods, apparatus, or processors configured to access a tracking enabled storage volume associated with a container; perform a full backup of the storage volume, where performing the full backup includes defining a full backup point; perform a first incremental backup of the storage volume based on the full backup point, where performing the first incremental backup includes defining a current backup point; determine whether a backup termination condition has been met; upon determining that the backup termination condition has not been met: performing a subsequent incremental backup of the storage volume based on the current backup point; and updating the current backup point. Embodiments may restore the tracking enabled storage volume from the full backup and the incremental backups. |
| US11099764B2 |
Method for amending the firmware of a resource constrained device
The present invention relates to a method for amending the firmware of a device with limited resources, the device comprises a memory unit, and a firmware amending software, and the firmware comprises: at least two functional components, wherein the first functional component comprises at least one public function, configured to be called by at least one second functional component different from the first functional component, a functional component table, wherein at least one of the functional components is registered, a call dispatch unit, where each call addressing one of the public functions is dispatched, wherein the firmware amendment comprises the steps for the firmware amending software of: storing a new functional component at a memory location of the memory unit, updating the functional component table with the memory location of said new functional component, and handing over control to the firmware. |
| US11099758B2 |
Memory management of computing devices
In one embodiment, a method includes allocating, by an operating system of a computing device, computer-implemented memory into a discardable portion and a durable portion; receiving, from a computer-executable program, a designation indicator of a particular data file that is associated with the computer-executable program indicating that the particular file is to be stored in the discardable portion of the memory and in response, storing the particular data file in one or more particular pages of the discardable portion of the memory; identifying an occurrence of a computing condition and in response, marking the one or more particular pages that include the particular data file as invalid for the computer-executable program; receiving, from the computer-executable program, a request for the particular data file; and in response to receiving the request, providing, to the computer-executable program, a notification that the particular data file is invalid for the computer-executable program. |
| US11099756B2 |
Managing data block compression in a storage system
An aspect of managing data block compression in a storage system includes performing, for each block written to the storage system: bit-wise traversing the block, searching the block for a pattern indicating a repeating sequence of bits and, upon determining the pattern exists in the block and the repeating sequence of bits in the pattern exceeds a threshold value, removing the repeating sequence of bits from the block thereby yielding a reduced-size block. |
| US11099753B2 |
Method and apparatus for dynamic flow control in distributed storage systems
A method for processing I/O requests that are received at a distributed storage system including a plurality of receiver nodes, a plurality of first nodes, and a plurality of second nodes, the method comprising: receiving, at a receiver node, an I/O request and executing the I/O request by using at least one of the first nodes and at least one of the second nodes; receiving, by the receiver node, one or more latency metrics from each of the first nodes and second nodes that are used to execute the I/O request, and reconfiguring the storage system, by the receiver node, based on any of the received latency metrics. |
| US11099747B2 |
Hierarchical scale unit values for storing instances of data
Techniques are described herein for storing instances of data among nodes of a distributed store based on hierarchical scale unit values. Hierarchical scale unit values are assigned to the respective nodes of the distributed store. A first instance (e.g., a primary instance) of a data module is stored in a first node having a first hierarchical scale unit value. A primary instance of the data module with respect to a data operation is an instance of the data module at which the data operation with respect to the data module is initiated or initially directed. A second instance (e.g., a primary or secondary instance) of the data module is stored in a second node having a second hierarchical scale unit value based on a magnitude of a difference between the first hierarchical scale unit value and the second hierarchical scale unit value. A secondary instance is essentially a “back-up” instance. |
| US11099744B2 |
Method and device for writing stored data into storage medium based on flash memory
Methods, systems, and apparatus, including computer programs encoded on computer storage media, for writing data in one or more storage units. One of the methods includes obtaining an erasing count for each of multiple storage units, wherein the erasing count equals a total count of erasing operations that have been performed on all blocks of the storage unit. The method further includes identifying one or more of the storage units that satisfy one or more conditions associated with writing data, determining a storage unit that has the smallest erasing count among the identified storage units, and writing the data in the determined storage unit. |
| US11099743B2 |
Determining when to replace a storage device using a machine learning module
Provided are a computer program product, system, and method for using a machine learning module to determine when to replace a storage device. Input on attributes of the storage device is provided to a machine learning module to produce an output value. A determination is made whether the output value indicates to replace the storage device. Indication is made to replace the storage device in response to determining that the output value indicates to replace the storage device. |
| US11099740B2 |
Method, apparatus and computer program product for managing storage device
Techniques manage a storage device. Such techniques involve: in response to receiving an I/O request for a storage device comprising a plurality of disks, determining, from the plurality of disks, at least one disk related to the I/O request; allocating, to each of the at least one disk, at least one access credit for completing the I/O request from total access credits of the disk, wherein the total access credits are associated with at least one of a type of the disk, a type of the I/O request and performance of the disk; and in response to respective access credits being allocated to the at least one disk, performing access requested by the I/O request to each of the at least one disk. Such techniques can effectively improve the overall access performance of the storage device. |
| US11099737B2 |
Fast locate using imitation reads on tape drives
A computer-implemented method, according to one embodiment, includes: receiving a read request for data stored on a magnetic tape, the data having multiple portions. For each portion of the requested data determined as not being located in a cache, a determination is made as to whether performing a locate command or performing a read command a plurality of times will retrieve the portions of the requested data that are not located in the cache in a shorter amount of time. The command determined to retrieve the portions of the requested data that are not located in the cache in the shorter amount of time are issued to a tape drive. Moreover, the portions of the requested data that are not located in the cache are combined with portions of the requested data that are located in the cache. Furthermore, the combined portions are used to satisfy the read request. |
| US11099736B2 |
Dynamic processing of storage command based on internal operations of storage system
A device and method dynamically optimize processing of a storage command within a storage system. The device and method execute a rule based on predetermined criteria and internal operation parameters of the storage system. An extended application program interface within the storage system provides internal operation parameters for use in execution of the rule. Based on execution of the rule, the storage system controls processing of the storage command. |
| US11099734B2 |
Method, apparatus and computer program product for managing storage system
Techniques manage a storage system. In such techniques, data types of data in multiple storage devices associated with the storage system are obtained. The multiple storage devices are divided into a first group of storage devices and a second group of storage devices according to the data types. A first processing ability of the first group of storage devices and a second processing ability of the second group of storage devices are determined separately. Data distribution is scheduled among the multiple storage devices on the basis of the first processing ability and the second processing ability. With such techniques, processing abilities of various storage devices in a resource pool may be balanced, so that workloads of various storage devices may be balanced and further overall response speed of the resource pool may be increased. |
| US11099731B1 |
Techniques for content management using a gesture sensitive element
Embodiments of the present invention provide a graphical user interface (GUI) that includes a gesture sensitive element. The gesture sensitive element can be used to display or hide different amounts of GUI control elements, reducing complexity until it is requested and increasing screen area available for content. By including a gesture sensitive element that can be used to invoke various actions and to provide a progressive level of controls, the number and complexity of elements shown in a GUI can be reduced, improving usability and reducing the number of interactions required to perform a desired action which reduces the processing required by the computer device. |
| US11099729B1 |
Methods and systems for displaying content based on a scroll pattern
Disclosed are systems and methods for displaying content on a user device. For example, a method of displaying content on a user device may include: receiving a first set of content data; arranging and displaying the first set of content in a first sequence of consecutive segments; detecting user input indicative of a scroll pattern of the user through the first sequence of consecutive segments; determining a preferred category based on the detected user input; receiving a second set of content data; arranging the second set of content data into a second sequence of consecutive segments based on the preferred category; and displaying the second set of content data in the arranged second sequence of consecutive segments on the display of the user device. |
| US11099727B2 |
Systems and methods for geo-fenced dynamic dissemination
Systems and methods are provided for sharing maps in a collaborative environment using classification-based access control. The generation of and dissemination of maps and/or data within such maps can be governed by classification-based access control, where a user's classification level can determine whether or not maps and/or data within those maps can be seen. In some scenarios, a user may wish to reveal the existence of data and/or additional details within a limited geographical area or subset of a map. The systems and methods further provide a geo-fenced view that can dynamically declassify data (to a specified degree). For example, declassified details can be revealed for moving data sets or objects upon entry into the geo-fenced view, and upon existing the geo-fenced view, the moving data sets or objects are reclassified. |
| US11099724B2 |
Context sensitive magnifying glass
A medical imaging system (100) includes a user interface (110) and a magnifying view engine (130). The user interface displays a view of a medical image on a display device (114) and to provide a moveable indicator (116) identifying a moveable point positioned in the displayed medical image. The magnifying view engine (130) generates a localized enlargement of a region of interest within the displayed medical image in response to selection of an existing end point or an existing contour in the displayed medical image according to a first input by one or more input devices and indicated by a current position of the moveable indicator. |
| US11099723B2 |
Interaction method for user interfaces
An apparatus comprising a display configured to provide a user interface and a processor is provided, wherein the processor is configured to provide at least a first interactive element in a foreground of the user interface, provide at least a second interactive element, the second interactive element being arranged in a background of the user interface, receive an indication of an interaction of a user with the second interactive element in the background and trigger a function determined by the second interactive element based on the indication of the interaction with the second interactive element. Furthermore, a method for operating a user interface is defined. |
| US11099718B2 |
Systems and methods for accelerating user interactions on touchscreen devices
Disclosed systems and methods provide an integrated hypermedia engine (IHE) that monitors and predicts user activity on spawned document windows and spliced network management CLI/GUI sessions. In embodiments, the IHE pro-actively assists a user to efficiently use device-related documentation in an intuitive manner that requires minimal user interaction and, thereby, reduces the likelihood of human error, e.g., when configuring network devices involves multi-tiered, dynamic configuration paths. The IHE may acts as bridge between document windows and spliced network management sessions, for example, to enable seamless transfer of a CLI command from a document window to an inline GUI panel launched by a CLI session when constructing a command line. In embodiments, a context-ware THE may create and take advantage of documentation tags by interpreting relationships between commands to enable auto-navigation of the document. Certain embodiments provide for monitoring and mapping a CLI/GUI output back to the appropriate documentation. |
| US11099717B2 |
Video playback method and apparatus
A video playback method includes: obtaining playback progress information of all sub-files in a video file, where the video file includes at least two sub-files; displaying a playback progress bar list, where the playback progress bar list includes playback progress bars of the at least two sub-files, and a playback progress bar of any sub-file displays playback progress of the any sub-file according to playback progress information of the any sub-file; receiving a user instruction used for selecting, according to the playback progress bars, a target sub-file that needs to be played, where the target sub-file is any sub-file of the at least two sub-files; and playing the target sub-file according to the instruction. |
| US11099711B2 |
Display apparatus and method
A display apparatus and method. A display apparatus including a display control unit configured to display a moving image on a first region of a display screen; and a thumbnail generation unit configured to generate a plurality of thumbnail images based on a plurality of still images related to the moving image, wherein the display control unit is configured to display the plurality of thumbnail images on a second region of the display screen. |
| US11099705B1 |
Automatic dashboard tiles for online tools
Disclosed herein are system, method, and computer program product embodiments for automatically generating tiles. An embodiment operates by detecting a first node of a model has been populated with a first plurality of data values from a first online tool. The embodiment selects a tile logic block corresponding to the first node from a plurality of tile logic blocks. The embodiment generates a first tile associated with the first node by executing the tile logic block based on the first plurality of data values. The embodiment inserts the first tile into a dashboard configured to display a plurality of tiles. The embodiment then sends the dashboard for display. |
| US11099700B1 |
Multi-mode operation method for capacitive touch panel
A multi-mode operation method for a capacitive touch panel is disclosed. The panel has a plurality of touch cells, and detection values of the plurality of touch cells are obtained by mutual capacitance scan. A normal mode and an insulation mode are provided for situations in which the panel is touched by a finger and a glove, respectively. An insulation determination condition is established for automatically determining glove touch to make the panel enter the insulation mode. In the insulation mode, the criteria for determining touch events can be automatically adjusted, or the detection values around the cells touched can be processed to accurately determine the touch effect when the panel is touched by a glove. In the insulation mode, a condition for determining to leave the insulation mode is also established, so that the touch panel can be smoothly switched between the normal mode and the insulation mode. |
| US11099699B2 |
Touch sensor and display device having the touch sensor
A touch sensor including a substrate including an active area and a non-active area, a plurality of first electrodes extending in first direction on the active area, a plurality of second electrodes extending in a second direction crossing the first direction on the active area, a plurality of third electrodes including electrode portions disposed in the first electrodes, respectively, being separated from the first electrodes, and extending in the first direction on the active area, and a sensing circuit including a plurality of signal receivers receiving sensing signals from the first electrodes, respectively, in which each of the signal receivers includes first and second input terminals connected to a pair of first and third electrodes corresponding to each other, respectively, and outputs a signal corresponding to a voltage difference between the first and second input terminals. |
| US11099696B2 |
Touch substrate, touch control display panel, touch control display apparatus, and method of fabricating touch substrate
The present application discloses a touch substrate. The touch substrate includes a base substrate; a first touch electrode layer on the base substrate and including a plurality of first touch electrodes; a second touch electrode layer including a plurality of first coils; and a third touch electrode layer including a plurality of second coils. Each of the plurality of first touch electrodes is electrically connected to one of the plurality of first coils. The third touch electrode layer is insulated from the first touch electrode layer and the second touch electrode layer. |
| US11099694B2 |
Flexible display screen system
A flexible display screen system (100) includes a flexible display screen (10), a sensor (30) and a processor (50), in which the flexible display screen (10) is formed with a first display region (11), the sensor (30) is configured to generate a bending signal when the flexible display screen (10) is bent, and the processor (50) is configured to control the flexible display screen (10) to form a second display region (13) according to the bending signal and the display content of the first display region (11) and control the second display region (13) to display the display content. The flexible display screen system (100) realizes control over the flexible display screen (10) by bending, and may form another display area which facilitates sharing the content of the original display area with others, and is easy and convenient to operate. |
| US11099693B2 |
Touch-sensing display substrate, touch-sensing display apparatus, method of operating touch-sensing display apparatus, and method of fabricating touch-sensing display substrate
A touch-sensing display substrate is provided. The touch-sensing display substrate includes a touch-sensing structure. The touch-sensing structure includes a plurality of first touch-sensing signal lines; a plurality of first touch-sensing electrodes; and a first insulating layer between the plurality of first touch-sensing signal lines and the plurality of first touch-sensing electrodes. A plurality of first vias at least partially extend into the first insulating layer. The plurality of first vias include at least a through-hole via, through which the respective one of the plurality of first touch-sensing signal lines is electrically connected to a corresponding first touch-sensing electrode. The plurality of first vias include at least a blind via partially extending into the first insulating layer in a region where the respective one of the plurality of first touch-sensing signal lines crosses over one of the plurality of first touch-sensing electrodes other than the corresponding first touch-sensing electrode. |
| US11099692B2 |
Sensor device and method
A sensor device has a plurality of electrode portions configured to provide one or more electrical signals and a non-conductive material provided on or over the plurality of electrode portions. The one or more electrical signals are provided in response to a change in capacitance between (i) at least one of the plurality of electrode portions and a conductive object being near to or in contact with the non-conductive material, and/or (ii) at least one of the plurality of electrode portions and at least one other of the plurality of electrode portions. A system comprising the sensor device and method of manufacturing the sensor device are also provided. |
| US11099689B2 |
Receiving device
A receiving device includes an optical detector, a first detection region, and a second detection region. The optical detector detects a position of an object of interest to be detected by receiving, with use of one or more of light-receiving portions, reflected light that occurs when light emitted from one or more of light-emitting portions is reflected by the object of interest to be detected. The first detection region is provided at a position closer to the optical detector, and is for detecting movement of the object of interest to be detected with the use of the optical detector. The second detection region is provided at a position farther from the optical detector than the first detection region, and is for detecting presence of the object of interest to be detected with the use of the optical detector. |
| US11099683B1 |
Touch panel, touch panel module, and method for inspecting touch panel
A touch panel includes a substrate having insulating properties and including a sensing region and a non-sensing region, a plurality of sensor electrodes formed in the sensing region, a plurality of external connection terminals formed in the non-sensing region, and a lead-out wiring line electrically connecting one end of each of the plurality of sensor electrodes to each of the plurality of external connection terminals. The external connection terminal and the lead-out wiring line are continuously divided by a single slit along an extension direction of the external connection terminal and the lead-out wiring line in an entire length, or in a portion of the entire length from which an end portion in a sensor electrode side of the lead-out wiring line is excluded. |
| US11099682B2 |
Binding region connection structure, touch screen and display device
The present disclosure provides a bonding region connection structure, a touch screen, and a display device. The bonding region connection structure for connecting a touch substrate and a flexible printed circuit includes: a plurality of electrode trace pins disposed at the bonding region, wherein the bonding region is between the touch substrate and the flexible printed circuit, each of the plurality of the electrode trace pins being respectively configured to connect to a touch electrode on the touch substrate and an electrode on the flexible printed circuit; and a plurality of dummy pins respectively disposed on both sides of the electrode trace pins, one end of each of the plurality of dummy pins leading to the touch electrode being respectively connected to a corresponding first test point by a lead wire, and configured to measure impedance of the bonding region. |
| US11099669B2 |
Conductive structure, method of manufacturing the same, touch sensor including the conductive structure, method of manufacturing the touch sensor, and touch sensing method
A conductive structure is provided. The conductive structure includes a template including a skeleton and a pore therein and having flexibility, and a conductive material aggregated and formed on the skeleton and in the pore. |
| US11099656B1 |
Low-height key structure
A low-height key structure includes a keycap, a supporting plate, a connecting element, a circuit board and an elastic element. The circuit board is disposed on the supporting plate. A switch element is installed on the circuit board. The connecting element is connected with the keycap and the supporting plate. The keycap is movable upwardly or downwardly relative to the supporting plate through the connecting element. The elastic element is arranged between the keycap and the circuit board. The elastic element includes a contacting part and an elastic support part, which are connected with each other. The contacting part includes a bowl-shaped concave structure. A raised structure is protruded from a middle region of a bottom side of the bowl-shaped concave structure. A top surface of the raised structure is at a level lower than or equal to a top surface of the contacting part. |
| US11099655B2 |
System and method for gesture based data and command input via a wearable device
The present invention relates to an electronic wrist wearable device that uses image and inertia sensors to track motion of hand and wrist of a user, and is able to determine locations and orientation (relative to a stationary object in physical environment) of hand and wrist, and discrete and motion hand gestures. The wearable device can also emulate various data input devices by matching the determined gestures with preregistered gestures and sending the data associated with the matched gesture to a relevant computer device.The wearable device sends the said tracking information of the hand and the wrist to at least one external computer, which can process the received information to simulate hand motion, and to determine discrete and motion hand gestures. The said computer can also emulate various data input devices by matching the determined gestures with preregistered gestures and using the data associated with the matched gesture. |
| US11099652B2 |
Data and user interaction based on device proximity
Architecture that enables the detection of a user by a user device and interaction with content of the user device by the user before the user physically contacts the device. The detection capability can utilize one or more sensors of the device to identify the user and the proximity (distance) of the user to the device. Based on the user identity and the proximity, the device operates/functions in a certain way. Moreover, ongoing interaction can be enabled by recognition of a natural user interface (NUI) gestures, alone or in combination with other recognition techniques (e.g., speech recognition). Device activity can include causing the device to operate in predetermined ways such as power modes, application launching and manipulation to cause control of hardware and other software (local and/or remote) and, obtaining and presenting specific types of content (e.g., advertisements, notifications, messages, reminders, news, incoming communications, etc.). |
| US11099650B1 |
Camera with improved shutter button
According to some embodiments, a portable apparatus is equipped with at least one user control element, at least one sensor, and at least one tactile feedback actuator, such as a camera with a shutter button, an image sensor, and a tactile feedback actuator. Upon the user's actuation of the button, a sensor reading is taken, which may take some amount of time. Successful completion is indicated by the tactile feedback unit. According to some embodiments, the button is a force sensor capable of distinguishing more than two different levels of force with which it is being actuated, and tactile feedback is provided to distinguish between different levels of actuation. Other possibilities are shown and discussed. |
| US11099648B2 |
Tactile sensation providing apparatus
A tactile sensation providing apparatus, so as to reduce an influence by provision of a tactile sensation on detection of a position by a touch sensor, includes a touch sensor 11, a tactile sensation providing unit 12 disposed near the sensor 11 and configured to vibrate the sensor 11, a touch sensor control unit 20 configured to transmit a scanning signal to the sensor 11 and, by receiving the signal from the sensor 11, to detect the position of the contact to the sensor, signal lines 16, 18 configured to transmit the signal between the sensor 11 and the control unit 20, and a tactile sensation control unit 30 configured to, based on the position of the contact detected by the control unit 20, control the providing unit 12 to vibrate the sensor 11. The providing unit 12 is disposed avoiding overlapping with the lines 16, 18. |
| US11099637B2 |
Dynamic adjustment of user interface
Embodiments related to dynamically adjusting a user interface based upon depth information are disclosed. For example, one disclosed embodiment provides a method including receiving depth information of a physical space from a depth camera, locating a user within the physical space from the depth information, determining a distance between the user and a display device from the depth information, and adjusting one or more features of a user interface displayed on the display device based on the distance. |
| US11099633B2 |
Authoring augmented reality experiences using augmented reality and virtual reality
Examples of techniques for augmented reality authoring using virtual reality are disclosed. In one example implementation according to aspects of the present disclosure, a computer-implemented method includes receiving, by a virtual reality processing system, a depth map from an augmented reality processing system, wherein the depth map is a map of a scene. The method further includes authoring, using the virtual reality processing system, an augmented reality experience in a virtual reality environment based at least in part on the depth map. The method further includes transmitting, by the virtual reality processing system, the augmented reality experience to the augmented reality processing system. |
| US11099630B2 |
Drift cancelation for portable object detection and tracking
The technology disclosed can provide capabilities such as using motion sensors and/or other types of sensors coupled to a motion-capture system to monitor motions within a real environment. A virtual object can be projected to a user of a portable device integrated into an augmented rendering of a real environment about the user. Motion information of a user body portion is determined based at least in part upon sensory information received from imaging or acoustic sensory devices. Control information is communicated to a system based in part on a combination of the motion of the portable device and the detected motion of the user. The virtual device experience can be augmented in some implementations by the addition of haptic, audio and/or other sensory information projectors. |
| US11099622B2 |
Response time for mobile IHS bag removal
An IHS Handling System (IHS) may be transported within various types of bags. Upon reaching a new location, a user removes the IHS from the bag and prefers that the IHS is ready for use as quickly as possible. Embodiments reduce response times of an IHS that is transported within a bag. While the IHS is configured in a standby power state, sensor readings are collected from sensors of the IHS. Based on the collected sensor readings, a first likelihood is determined of whether the IHS is located in a computer bag. Further based on the collected sensor readings, a second likelihood is determined of whether the IHS will be removed from the computer bag. The IHS is woken from the standby power state and configured for use based on the first likelihood or the second likelihood. |
| US11099615B2 |
Display panel, manufacturing method thereof and display device
A display panel, a manufacturing method thereof, and a display device are provided. The display panel includes: a display substrate, a COF film disposed on a side of the display substrate; a plurality of signal lines disposed on another side of the display substrate, an insulation layer located between the signal lines and the display substrate, a plurality of connection holes penetrating at least the display substrate, the signal lines and the insulation layer and a conductive material filled in the connection holes. The signal lines are connected to connection terminals disposed on the COF film by the conductive material; the insulation layer has recesses each of which surrounds the respective connection holes. |
| US11099612B2 |
Method for fabricating an apparatus of a variable-torque laptop hinge
A variable torque opening hinge joint for a laptop may comprise a shaft having a protrusion along its axial length and operably connecting to a display chassis inserted through a first hinge joint and a second hinge joint that are operably connected to a base chassis. The first hinge joint may apply a constant torque resistive to a rotation of the shaft throughout a range of angular displacement, and the second hinge joint may apply a variable torque resistive to a rotation of the shaft that increases from a minimum variable resistive torque to a maximum variable resistive torque over a preset subset of the range of angular displacement to reach a maximum variable torque. A leading edge of the protrusion and a trailing edge of the protrusion may be separated by an angle equivalent to the preset subset of the range of angular displacement. |
| US11099611B2 |
Synchronized expandable dual axle hinge and clutch
A portable information handling system housing rotationally couples first and second housing portions with a hinge assembly having first and second axles held in a parallel fixed lateral disposition and selectively engaging with a first or second gear assembly having a first or second gear ratio. A distance between the first and second axles varies based upon the selected gear assembly to adapt the information handling system to accept a keyboard between the first and second housings. |
| US11099608B2 |
Display device
A rollably display device includes a flexible display panel with an active area for displaying images and a non-active area surrounding the active area. A first seal member is disposed in the non-active area on a first portion of a side surface of the display panel and a second seal member is disposed on the first seal member and on a second portion of the side surface of the display panel to reduce the likelihood of occurrence of cracks at the sides of the display panel during rolling and unrolling of the display panel around a roller. |
| US11099607B2 |
Flexible display window and electronic device having the same
A flexible display window and an electronic device having the same are provided. The electronic device includes a housing including a first rigid portion and a flexible portion, at least one outer layer that covers the first rigid portion and the flexible portion, a display device including a screen including a first portion exposed through the first rigid portion and a second portion extended from the first portion and exposed through the flexible portion, at least one processor electrically coupled to the display device, and a memory electrically coupled to the at least one processor, wherein the outer layer includes a polymer layer, a glass layer interposed between the polymer layer and the screen, and an adhesive layer interposed between the polymer layer and the glass layer. |
| US11099606B2 |
Printed circuit board, display device comprising the same, and manufacturing method for the same
The present disclosure relates to a printed circuit board, a display device including the same, and a manufacturing method therefor. The printed circuit board includes a rigid region; and a flexible region comprising a flexible layer having a first surface and a second surface on an opposite side to the first surface, a reinforcing structure disposed on the first surface of the flexible layer, and a conductor pattern disposed on the second surface of the flexible layer. A material of the reinforcing structure has a coefficient of thermal expansion lower than that of a material of the flexible layer. |
| US11099602B2 |
Fault-tolerant clock gating
A method includes obtaining a trigger signal directed to a component in a subset of components of an electronic circuit, and activating a clock corresponding with the subset of components of the electronic circuit for a preliminary period in response to the trigger signal. An active period is determined based on the trigger signal. The clock remains active for the active period. One of a timer or counter is initiated for the active period. A limit is defined for the one of the timer or counter. The active period is dynamically extended for a busy period after the one of the timer or counter is initiated. The clock is deactivated following the active period. |
| US11099600B2 |
Semiconductor integrated circuit and method for controlling semiconductor integrated circuit
To improve a timing error detection accuracy in a semiconductor integrated circuit provided with storage devices operating in synchronization with a clock signal.A delay part delays a data signal by two mutually-different delay times and outputs it as first and second delay signals. A holding part holds the first and second delay signals in synchronization with a timing signal for giving an instruction on a predetermined capture timing. A setup time detection part detects whether or not one of the first and second delay signals held within a setup-time detection period from a predetermined start timing to the predetermined capture timing has changed. A hold time detection part detects whether or not the other of the first and second delay signals held within a hold-time detection period from the predetermined capture timing to a predetermined end timing has changed. |
| US11099599B2 |
Communication device, cascaded network and internal synchronization method
A communication device comprising at least one communication port called reception port and another communication port called forward port, each communication port being associated with a respective clock, the communication device being further configured for computing an offset between the respective clocks associated with the reception and forward ports, and synchronizing the respective clocks based on the computed offset. |
| US11099592B2 |
Current self-checking regulation circuit based on voltage calibration
This invention provides a current self-checking regulation circuit based on voltage calibration including a bandgap reference unit, a self-calibration unit, a detection and regulation unit, current mirror units, and a current mirror control unit. The bandgap reference unit is configured to generate a voltage signal, the self-calibration unit is configured to respond to a digital signal of the detection and regulation unit and calibrate the voltage signal of the bandgap reference unit. The detection and regulation unit samples the reference current signal and a mirror current signal of the regulation group current mirror unit and generate a digital control signal according to the reference current signal. and the reference group current mirror unit responds to the digital control signal and outputs a regulated bias current signal meeting needs of the laser driver. |
| US11099590B2 |
Indirect leakage compensation for multi-stage amplifiers
A linear regulator with indirect leakage compensation is presented. The regulator has a pass device coupled between an input voltage and an output node, a feedback loop for controlling the pass device based on a reference voltage and a feedback voltage that depends on an output voltage, an off-state device that is kept in the off-state, and a leakage compensation circuit for sinking a leakage compensation current from the output node, in dependence on a leakage current of the off-state device. The off-state device is coupled between the leakage compensation circuit and an intermediate voltage level of the linear regulator. The intermediate voltage level is a voltage level between the input voltage level and ground, with a magnitude of the intermediate voltage level being smaller than a magnitude of the input voltage level. A corresponding method of operating a linear regulator with leakage compensation is presented. |
| US11099589B1 |
Digitally programmable, fully differential error amplifier
An error amplifier circuit receives first and second input signals and provides an error amplifier output signal indicative of the difference between the first and second input signals. The error amplifier circuit implements a proportional-integrator-differentiator (PID) circuit having a differential input signal path and including a proportional amplifier circuit, an integrator amplifier circuit, and a differentiator amplifier circuit. The differentiator amplifier circuit receives an AC coupled input signal. The error amplifier circuit sums the output from the proportional amplifier circuit, the integrator amplifier circuit and the differentiator amplifier circuit to provide the error amplifier output signal where the error amplifier output signal is referenced to a first bias voltage. |
| US11099585B2 |
Pipe network evaluation device and method
Provided is a pipe network evaluation device that is capable of calculating a pressure loss in a pipe network and a consumption flow rate of compressed air in each terminal equipment without inputting layout information on devices, even in a case where there are some devices, the layout information about which is difficult to ascertain visually or obtain from a building drawing, or the like. Provided is a pipe network evaluation device that estimates the resistance of a pipe, the layout information about which is unknown, on the basis of pressure data on compressed air in an air tank, flow rate data on compressed air supplied from the air tank, layout unknown-part pipe outlet pressure data, for which layout information is unknown, and layout known-part pipe layout information, for which layout information is known. |
| US11099581B2 |
Position-based control of unmanned aerial vehicles
The position of a UAV within a three-dimensional space is changed based on a change in position of a controller of the UAV. First and second sensor data are produced using sensors of the controller to maintain stable altitude output for the UAV. The first sensor data indicates a geolocation of the controller, and the second sensor data indicates a barometric pressure of an environment in which the controller is located. The first and second sensor data are post-processed using a complementary filter based on respective altitude measurements of the first and second sensor data to determine an altitude of the controller. A position of the controller is determined within a three-dimensional space based on the altitude. Data indicative of the position of the controller within the three-dimensional space is then transmitted to the UAV to cause a change in a position of the UAV within the three-dimensional space. |
| US11099572B2 |
Self-moving device and control method thereof
A self-moving device, including: a housing, provided with a motor; a moving module, including a track, the track, driven by the motor, moving the self-moving device; a working module; a control module, configured to control movement of the moving module and working of the working module; and a first sensor and a second sensor, configured to detect an obstacle in a moving direction of the self-moving device. The first sensor is configured to detect a first area in the moving direction, the second sensor is configured to detect a second area in the moving direction, and the first area and the second area are arranged perpendicular to the moving direction. The control module controls a moving manner of the self-moving device according to sensing results of the first sensor and the second sensor. |
| US11099568B2 |
Self-driving vehicle system with retractable sensor head
A self-driving vehicle system comprising a body having one or more motorized wheels, and a sensor head coupled to the body. The sensor head is movable from a retracted position to an extended position relative to the body. The sensor head comprises one or more proximity sensors and one or more cameras. |
| US11099566B2 |
Systems and methods for providing a vehicle service via a transportation network for autonomous vehicles
Systems and methods for providing a vehicle service are provided. In one example embodiment, a computer-implemented method includes receiving data indicative of a service request to provide a vehicle service for an entity with respect to one or more cargo items designated for autonomous transport. The method includes obtaining a first cargo item among the one or more cargo items, from a representative of the entity at a dedicated first transfer hub proximate to a first location associated with the first cargo item. The method includes controlling a first autonomous vehicle to transport the first cargo item from the first transfer hub to a dedicated second transfer hub proximate to a second location associated with the first cargo item. The method includes providing the first cargo item to a representative of the entity at the second transfer hub, to provide the vehicle service. |
| US11099565B2 |
Method for providing personal stowage using a highly or fully automatically operated vehicle
A method for providing personal stowage using a highly or fully automatically operated vehicle includes receiving a request signal, which includes information about a desired provisioning location for providing a personal stowage, ascertaining the location of the requested personal stowage, and transmitting a provisioning signal to an automatically operated vehicle for providing the personal stowage at the provisioning location using the automatically operated vehicle. |
| US11099561B1 |
Control of an autonomous vehicle in unmapped regions
Autonomous vehicles use accurate maps for navigation. Manually controlling such an autonomous vehicle in certain areas may expand regions the vehicle may service. Such manual control may also be more efficient, safer, and/or reliable, in some instances. Aspects of this disclosure describe techniques for manual control of an autonomous vehicle in unmapped regions. For example, a vehicle may determine and autonomously travel to a mapped location proximate an unmapped destination, and may then be manually controlled from the mapped location to the unmapped destination. In addition, during manual control through the unmapped region, data may be collected using sensors on the autonomous vehicle to map the region. |
| US11099558B2 |
Remote operation of vehicles using immersive virtual reality environments
In various examples, at least partial control of a vehicle may be transferred to a control system remote from the vehicle. Sensor data may be received from a sensor(s) of the vehicle and the sensor data may be encoded to generate encoded sensor data. The encoded sensor data may be transmitted to the control system for display on a virtual reality headset of the control system. Control data may be received by the vehicle and from the control system that may be representative of a control input(s) from the control system, and actuation by an actuation component(s) of the vehicle may be caused based on the control input. |
| US11099555B2 |
Surface treatment robotic system
Provided are a robot, a remote controller, a robotic system and controlling methods for a robot, including a direction sensor determines a reference direction, a control unit determines a moving direction of the robot by using the reference direction as a reference and remote control instructions received from a remote controller and controls the driving unit to drive the robot to move in the moving direction. Different direction sensors are provided in different surface treatment robots to determine the directional references of the robot to determine the walking directions of a robot to enable the buttons on the remote control to correspond to the walking directions; regardless of the movement state of the robot, the robot will automatically walk in the corresponding direction when any button on the remote control is pressed and released or is pressed and held, thus being easy to operate and improving working efficiency. |
| US11099554B2 |
Robotic cleaning device and a method of controlling the robotic cleaning device
A robotic cleaning device having an inertia measurement unit and a controller. The inertia measurement unit is arranged to sense a displacement of the robotic cleaning device and the controller is arranged to determine a characteristic of the displacement of the robotic cleaning device, and to set the robotic cleaning device in an operational mode being associated with the determined characteristic of the displacement. |
| US11099551B2 |
Deep learning architecture for maintenance predictions with multiple modes
Example implementations described herein involve a system for maintenance predictions generated using a single deep learning architecture. The example implementations can involve managing a single deep learning architecture for three modes including a failure prediction mode, a remaining useful life (RUL) mode, and a unified mode. Each mode is associated with an objective function and a transformation function. The single deep learning architecture is applied to learn parameters for an objective function through execution of a transformation function associated with a selected mode using historical data. The learned parameters of the single deep learning architecture can be applied with streaming data from with the equipment to generate a maintenance prediction for the equipment. |
| US11099548B2 |
Suggesting and/or creating agents in an industrial automation system
An automation system, a method and an apparatus for suggesting and/or creating an agent in an industrial automation system that includes automation devices having a framework which is formed to execute the agent and which at least partially includes a data source that collects and/or processes data of the automation devices, and includes a data sink, in which data, in particular status data, of the data sources is saved, wherein an agent suggestion component processes data of the data sink into clusters via a cluster analysis, and wherein the agent suggestion component makes the clusters available at an interface such that a model for the agents becomes creatable by an agent generation component based on at least one selection of the clusters such that it becomes possible to suggest and/or create agents in a simpler and more efficient manner. |
| US11099546B2 |
Scheduler, substrate processing apparatus, and substrate conveyance method
A calculation amount and calculation time for a substrate conveyance schedule are reduced. A scheduler is provided which is incorporated in a control section of a substrate processing apparatus including a plurality of substrate processing sections that process a substrate, a conveyance section that conveys the substrate, and the control section that controls the conveyance section and the substrate processing sections, and calculates a substrate conveyance schedule. The scheduler includes: a modeling section that models processing conditions, processing time and constraints of the substrate processing apparatus into nodes and edges using a graph network theory, prepares a graph network, and calculates a longest route length to each node; and a calculation section that calculates the substrate conveyance schedule based on the longest route length. |
| US11099543B2 |
Numerical controller and device included in industrial machine
An object is to provide a numerical controller and a device included in an industrial machine which manage a control program in the device included in the industrial machine and can reduce the operational burden during the updating of the control programs related to the device. A numerical controller which is connected to a motor drive device so as to be able to communicate therewith and which controls the motor drive device, includes: a program management storage unit which stores a control program that is written into the motor drive device and is executable; a program writing unit which writes the control program stored in the program management storage unit; a data acquisition portion which acquires from the motor drive device a control program that is already stored in the motor drive device; and a storage control unit which stores the acquired control program in the program management storage unit. |
| US11099542B2 |
Input error detection device
An input error detection device can detect an input error based on input values input in the past and the trend of values from the view point of the whole of a control program. In order to detect an error in inputting a value used to control a manufacturing machine, the input error detection device is provided with a histogram creation unit configured to create a histogram, based on a set of values used to control the manufacturing machine, and a determination unit configured, based on the histogram, to determine input errors of the values used to control the manufacturing machine. |
| US11099539B2 |
Multi-sensor agent devices
Apparatus, methods, and systems implementing multi-sensor agent devices are described herein. The agent devices can each include a plurality of sensors for measuring parameters of interest to an entity such as an electric power utility. The sensors can be organized in individually-IP-addressable sensor clusters, with each sensor cluster including an associated microcontroller. The agent devices can be controlled by a control center of the entity to operate in a coordinated manner, such as to gather and transmit data regarding parameters of interest. The agent devices can be transported to desired areas for data collection by unmanned aerial systems such as drones, and the collected data can be stored in a distributed blockchain ledger. |
| US11099538B2 |
Analysis system, controller, and data processing device
An analysis system, controller, and data processing device that are capable of avoiding the influence on control in the case where the names of the constituent elements are changed. The analysis system includes a plurality of constituent elements used for analysis; a controller configured to perform control on a basis of data received from the constituent elements; and a data processing device configured to process data received from the controller. The controller receives the control code, the additional code, and the name information from the plurality of constituent elements to generate an ID code on the basis of the control code and the additional code. The data processing device receives the ID code and the name information from the controller, and performs control on the basis of the control code included in the ID code. |
| US11099536B2 |
Air conditioning system and communication method for wired and wireless message transmission
A wireless terminal performs communication setting processing in response to connection processing from an air conditioning management apparatus. The air conditioning management apparatus sends, to a wireless terminal, a wireless communication electronic message in which an air conditioning communication electronic message is packaged. Upon receipt of the wireless communication electronic message, the wireless terminal converts the content of the communication. Upon receipt of the air conditioning communication electronic message, an air conditioner executes a request command described in the air conditioning communication electronic message. Upon receipt of the air conditioning communication electronic message, the wireless terminal converts the content of the communication. Upon receipt of the wireless communication electronic message, the air conditioning management apparatus performs response reception processing. |
| US11099533B2 |
Controlling a building system based on real time events
Methods and systems are described for controlling parameters in a building. According to at least one embodiment, a method for controlling a building system includes using at least one sensor to detect occupancy in a building over time, determining a predictive schedule based on the occupancy detected with the at least one sensor, and associate real time events that occur simultaneously with an occupancy state of the predictive schedule. |
| US11099528B2 |
Process optimization by grouping mixed integer nonlinear programming constraints
Real-time dynamic optimization of a process model in an online model-based process control computing environment. A mixed integer nonlinear programming (MINLP) solver utilizes grouping of first-principle model units to implement constraints of the underlying process. A group identifier parameter and a group complement parameter enable the grouping behavior through association with the first-principles model units. |
| US11099526B2 |
Cascaded systems and methods for controlling energy use during a demand limiting period
A cascaded control system is configured to control power consumption of a building during a demand limiting period. The cascaded control system includes an energy use setpoint generator and a feedback controller. The energy use setpoint generator is configured to use energy pricing data and measurements of a variable condition within the building to generate an energy use setpoint during the demand limiting period. The feedback controller is configured to use a difference between the energy use setpoint and a measured energy use to generate a control signal for building equipment that operate to affect the variable condition within the building during the demand limiting period. |
| US11099518B2 |
Cartridge and electrophotographic image forming apparatus
A cartridge includes a rotatable member and a cylindrical member operatively connected to the rotatable member. The cartridge also includes a coupling member operatively connected to the cylindrical member and coaxially rotatable with the cylindrical member. The coupling member includes at least one projection for receiving a rotational force provided at one end portion of the coupling member, and a shaft portion elongated along an axis of the coupling member. The coupling member is movable with respect to the cylindrical member in a direction of the axis of the cylindrical member. The cartridge further includes a coil spring pressing the coupling member in the direction of the axis of the cylindrical member. One end portion of the coil spring encompasses a part of the shaft portion of the coupling member, with the one end portion of the coil spring and the part of the shaft portion being accommodated in a hole in the cylindrical member. |
| US11099514B2 |
Image forming apparatus
An image forming apparatus includes a first transport unit, a second transport unit, a cover, a flap, a drive unit for moving the flap, a first sensor for detecting opening and closing of the cover, a second sensor for detecting a position of a sheet, and a controller. The controller switches the drive unit to move the flap to the second position, upon determining it is necessary to move the flap to the second position, subsequent to determining that the cover is opened based on a detection result by the first sensor. The controller switches the drive unit to move the flap from the second position to the first position, upon determining, based on a detection result by the second sensor, that a leading edge of the sheet reaches a position downstream, in a sheet transport direction, of a swing end portion of the flap at the second position. |
| US11099513B2 |
Communication device outputting information on a plurality of printing devices that execute printing operations using printing agent accommodated in cartridge
In a communication device, a processor identifies first and second group printing devices in accordance with device information on each printing device, and outputs device information corresponding to the first and second group printing devices in a distinguishable manner. A printing device having a tank accommodating printing agent greater than or equal to a first reference is identified as the first and second group printing devices. A printing device having a tank accommodating printing agent less than the first reference is identified as the second group printing device. A printing device without tank and in which a cartridge accommodating printing agent less than a second reference and greater than or equal to a third reference is identified as the first group printing device. A printing device without tank and in which the cartridge accommodating printing agent less than the third reference is identified as the second group printing device. |
| US11099510B2 |
Presser, fixing device, and image forming apparatus
A presser presses a pressed object and includes a first rotation shaft and a pressurizing portion that is supported by the first rotation shaft and pivots about the first rotation shaft. A depressurizing portion is supported by a second rotation shaft and pivots about the second rotation shaft with respect to the pressurizing portion. The depressurizing portion includes an engagement. An interlock lever includes an opening that engages the engagement. The depressurizing portion pivots to switch between a pressurization state in which the engagement contacts and presses the opening to cause the pressurizing portion to press the pressed object and a depressurization state in which the pressurization state is released. The depressurizing portion pivots to define a gap between the engagement and the opening in a moving direction in which the engagement moves. |
| US11099506B2 |
Sheet conveying device, fixing device incorporating the sheet conveying device, and image forming apparatus incorporating the sheet conveying device
A sheet conveying device, which is included in a fixing device and an image forming apparatus, includes a sheet contacting body and a lateral relative position shifting body. The sheet contacting body is configured to contact a sheet to be conveyed. The lateral relative position shifting body is configured to shift a passing position of the sheet being conveyed toward the sheet contacting body, in a width direction perpendicular to a sheet conveying direction and a relative position to the sheet contacting body, each time the sheet is conveyed by a number of sheets based on a setting. The setting of the number of sheets varies based on information of the sheet. |
| US11099503B2 |
Image forming apparatus
An image forming apparatus includes a detection member configured to detect a conveyance state of a recording medium, a control unit configured to sequentially execute a first operation for continuously executing a rotation operation of an image bearing member and an intermediate transfer member without stopping them when the detection member detects a failure, and a second operation for stopping the rotation operation of the image bearing member when the surface of the image bearing member is moved by a predetermined distance through the rotation operation of the image bearing member after the failure is detected. |
| US11099502B2 |
Method and apparatus of decorating a metallic container by digital printing to a transfer blanket
An apparatus and methods of decorating a metallic container are provided. More specifically, the present invention relates to apparatus and methods used to provide a decoration or indicia on a predetermined portion of an outer surface of a metallic container body. The decorator includes at least one digital print unit, a transfer blanket, and a support element. The digital print unit transfers a decorating material to the transfer blanket to form a decoration on the transfer blanket. The support element then moves a metallic container into contact with the transfer blanket. In this manner, the decorating material is transferred to an exterior surface portion of the metallic container to decorate the metallic container. In one embodiment, the digital print unit is an electrophotographic system which transfers a toner material to the transfer blanket. In another embodiment, the digital print unit includes an inkjet print head which transfers an ink to the transfer blanket. Optionally, the decorator may include two or more support elements. |
| US11099501B2 |
Toner cartridge having toner memory and attachable to drum cartridge having drum memory
A toner cartridge includes a casing, a developing roller, a holder, a toner memory, an electrical contact and a wiring. The holder is positioned at an outer surface of one side in a first direction of the casing. The electric contact surface is positioned at an outer surface of one side in a second direction of the holder. The second direction crosses the electric contact surface. The electrical contact is positioned on an outer surface of another side in the second direction of the holder. The wiring electrically connects the electrical contact and the electric contact surface. The electric contact surface includes a first electric contact surface and a second electric contact surface. The first electric contact surface electrically is connected to the electrical contact through the wiring. The second electric contact surface electrically is connected to the toner memory. |
| US11099500B2 |
Image forming apparatus having toner replenishment
An image forming apparatus includes a rotatable image bearing member to bear an electrostatic latent image, a developing container to accommodate developer including toner and to allow new developer to be replenished by a developer replenishing container, and a developer bearing member to develop the electrostatic latent image into a toner image by using the developer in the developing container. A transfer roller transfers the toner image born on the image bearing member onto the recording material, and a controller notifies replenishment information for prompting replenishing the developing container with the new developer by the developer replenishing container. The controller notifies the replenishment information in a state in which an index correlated with a ratio of an amount of paper dust mixed in the developer in the developing container to an amount of the developer in the developing container has not exceeded a preset threshold value of the index. |
| US11099494B2 |
Magenta toner
Provided is a magenta toner which is more excellent in durability in a high temperature and high humidity environment than conventional ones. The magenta toner comprises a binder resin, a magenta colorant, a release agent and an external additive. The release agent has a maximum endothermic peak in a range of from 70° C. to 80° C. during temperature increase, in a DSC curve measured by a differential scanning calorimeter. Needle-shaped oxide fine particles having an average long diameter of from 30 nm to 500 nm and an aspect ratio of from 4 to 20 are contained therein. Zinc stearate particles having a number average primary particle diameter of from 0.1 μm to 5 μm are contained at an amount of from 0.01 part by mass to 0.5 part by mass with respect to 100 parts by mass of the colored resin particles, as the external additives. |
| US11099492B2 |
Electrophotographic photoreceptor, process cartridge, and image forming apparatus
An electrophotographic photoreceptor includes a conductive substrate and a photosensitive layer disposed on the conductive substrate. An outermost surface layer of the electrophotographic photoreceptor contains a fluorine-containing resin particle and a fluorine-based graft polymer having a fluorinated alkyl group. A ratio of an amount of a fluorine-based graft polymer separated from the fluorine-containing resin particle to a total amount of the fluorine-based graft polymer in the outermost surface layer is 15% or less. |
| US11099481B2 |
Mask plate, array substrate, and preparation method thereof
The present disclosure provides a mask plate, an array substrate and, a preparation method thereof. The mask plate may include: at least one first light-transmitting region and at least two second light-transmitting regions arranged on the mask plate and spaced apart; the at least two second light-transmitting regions located at two sides of the at least one first light-transmitting region, respectively; an area of one of the at least two second light-transmitting regions being greater than an area of one of the at least one first light-transmitting region in a direction of a surface of the mask plate. |
| US11099479B2 |
Resist composition, method of forming resist pattern, polymeric compound, and copolymer
A resist composition which generates acid upon exposure and exhibits changed solubility in a developing solution under action of acid, and which includes a polymeric compound having a structural unit represented by general formula (a0-1) (wherein R represents a hydrogen atom, an alkyl group of 1 to 5 carbon atoms or a halogenated alkyl group of 1 to 5 carbon atoms; Va0 represents a divalent hydrocarbon group; na0 represents an integer of 0 to 2; Ra00 represents an acid dissociable group represented by general formula (a0-r1-1); Ra01 and Ra02 represents a hydrocarbon group; Ra01 and Ra02 may be mutually bonded to form a ring; Ya0 represents a quaternary carbon atom; Ra031, Ra032 and Ra033 each independently represents a hydrocarbon group, provided that at least one of Ra031, Ra032 and Ra033 is a hydrocarbon group having a polar group). |
| US11099466B2 |
Projection module and electronics apparatus
A projection module and an electronics apparatus are provided. The projection module comprises: a projection chip, having micro semiconductor light emitting devices thereon; and a projection lens unit, wherein the micro semiconductor light emitting devices produce projection light to create a projection image, and the projection lens unit receives the projection image and projects it to a projection surface. |
| US11099465B2 |
Communication stage and display systems
Enterprise communication display systems enable life-like images for videoconferencing and entertainment productions. Life-like images appear in a 3D environment where imaged people are visible through the use of specially configured see-through displays. Imaged people can also be viewed amongst a reflected foreground. A dual mode large high-resolution display is inventively configured for watching and working. Methods for enterprise wide deployments for corporate, healthcare, education, and government communications, including hotel properties and a property management system are shown. The invention further discloses an online production system for events. Further, a black void illusion is described and is applicable to numerous displays including event and live theater stages and movie theaters. Numerous inventive features are described enabling and advancing the black void illusion. Virtual stage lighting is disclosed for simulating stage lights and coordination of virtual stage lights with real stage lights for live and recorded performances. |
| US11099462B1 |
Combination of holder and selfie stick
A combination of a holder and a selfie stick of the present invention includes a case main body; an attachable disk attached to a back surface of the case main body; a case main body supporter formed of an attachable disk coupling part rotatably coupled to the attachable disk, and an extending part configured to extend from the attachable disk coupling part; a folding part hinge-coupled to the case main body supporter to be folded to be spaced apart from the case main body supporter; a folding part supporter elongated in a longitudinal direction of the folding part to support the folding part and serve as a holder and a handle; and a first extendable stick and a second extendable stick configured to space the folding part supporter apart from the folding part to serve as selfie sticks with the folding part and the folding part supporter. |
| US11099460B2 |
Optical element driving mechanism
An optical element driving mechanism is provided. The optical element driving mechanism includes a case, a bottom, a holder, a driving assembly, and a position sensing assembly. The bottom is connected to the case. The holder is disposed on the bottom and holds an optical element with an optical axis. The driving assembly drives the holder to move. The position sensing assembly senses the holder. The position sensing assembly includes a magnetic element, a sensor, and a magnetic-permeable element. The magnetic element is disposed on the holder. The sensor senses the magnetic element. The magnetic-permeable element is disposed adjacent to the sensor. The magnetic element and the sensor are arranged along a first direction. The sensor and the magnetic-permeable element are arranged along a second direction. The first direction is different from the second direction. |
| US11099454B2 |
Optical modulator
A method of operating an optical modulator. The optical modulator having: a rib waveguide which includes a junction which is either a PIN or PN junction, the junction having a breakdown voltage. The method comprising: applying a reverse bias to the junction, so as to operate the optical modulator around the breakdown voltage of the junction; operating the modulator in an avalanche multiplication and/or band-to-band tunnelling mode by increasing the reverse bias past the breakdown voltage. |
| US11099453B1 |
Light modulator, light modulator method and smart glazing
Some embodiments are directed to a light modulator comprising transparent substrates, or a transparent substrate and a reflective or partially reflective substrate, multiple electrodes being applied to the substrates in a pattern across the substrate. A controller may apply an electric potential to the electrodes to obtain an electro-magnetic field between the electrodes providing electrophoretic movement of the particles towards or from an electrode. |
| US11099444B2 |
Display device and thin film transistor array substrate
A display device includes a thin film transistor (TFT) array substrate, an isolation structure, and a front panel laminate (FPL) structure. The TFT array substrate has pixel electrodes. The isolation structure is between the pixel electrodes to form a first resistance between adjacent pixel electrodes. The front panel laminate structure is located on the isolation structure and the pixel electrodes adhesive layer, and has a display medium layer therein. |
| US11099443B2 |
Display panel and display apparatus having a plurality of first wirings and a plurality of second wirings
The present application discloses a display panel having a plurality of wirings in the fan-out area respectively connected to a plurality of signal lines in the display area, each of the plurality of wirings in the fan-out area configured to transmit a signal to one of a plurality of subpixels through one of the plurality of signal lines in the display area; and a plurality of bonding pads respectively connected to the plurality of wirings, configured to bond the plurality of wirings with a driver integrated circuit. The plurality of wirings are grouped into a plurality of groups of wirings comprising a first group of a plurality of first wirings and a second group of a plurality of second wirings. The plurality of first wirings are made of a first conductive material. The plurality of second wirings are made of a second conductive material. The second conductive material has a resistivity greater than that of the first conductive material. |
| US11099435B2 |
Transmittance-variable device
A transmittance-variable device is disclosed herein. In some embodiments, a transmittance-variable device includes first and second guest host layers, the first and second guest host layers are superposed, wherein each of the first and second guest host layers comprise a liquid crystal host and a dichroic dye guest, and wherein the device is capable of switching between a transparent mode and a black mode. The transmittance-variable device can exhibit high transmittance in the transparent state and a high shielding rate in the black state, and can exhibit a high contrast ratio even at the inclination angle, and exhibit excellent viewing angle symmetry in all directions. Such a transmittance-variable device can be applied to various applications including various architectural or automotive materials which need to adjust the transmittance, or eyewear such as goggles for augmented reality experience or sports, sunglasses or helmets. |
| US11099429B2 |
Surface light source device and display device
A surface light source device includes a substrate, a plurality of light emitting devices and a light diffusion plate. Each light emitting device includes a light emitting element and a light flux controlling member. A cross section, perpendicular to the central axis of the light flux controlling member, of the emission surface is line-symmetric with respect to the X-axis and the Y-axis, and the cross section has the shortest length along the X-axis and the longest length along the Y-axis. For the light flux controlling member of one of the light emitting devices that is disposed closest to a corner of the light diffusion plate in plan view, a part having a largest curvature in the emission surface on the cross section of the emission surface is located closer to the X-axis than an intersection point of a light beam with the emission surface is. |
| US11099424B2 |
High color gamut LED bar with side illumination LED package
An illumination device provides illumination as backlight to a liquid crystal display by disposing plural light emitting diode packages on a circuit board having green quantum dot material integrated with a photoresist ink. Each package includes one or more blue light emitting diode integrated circuits enclosed in a silicon filling material that integrates a red phosphor extending above one or more sidewalls of the package so that at least some illumination from the blue light emitting diode is directed towards the green quantum dot material, resulting in generation of high color gamut backlight illumination. |
| US11099421B2 |
Liquid crystal display device and manufacturing method of the same
A liquid crystal display device and a method of manufacturing the same are provided. The LCD device includes a substrate including a display area and a non-display area, a blue light blocking filter on the substrate, a plurality of color pattern layers spaced apart from one another in a plan view, a black matrix among the plurality of color pattern layers in a plan view, a planarization layer on the color pattern layer and the black matrix, and a polarizer on the planarization layer. The color pattern layer includes a red color conversion unit on the blue light blocking filter, which converts a light into a light having a red wavelength and a green color conversion unit on the blue light blocking filter, which converts a light into a light having a green wavelength. The red color conversion unit and the green color conversion unit include wavelength converting particles. |
| US11099412B2 |
Optical waveguide beam splitter with plural partial extraction features for display
An optical device includes a spatial light modulator and an optical waveguide with a plurality of extraction features. The plurality of extraction features is positioned relative to the optical waveguide so that a respective extraction feature receives light, having propagated within the optical waveguide, in a first direction and directs a first portion of the light in a second direction distinct from the first direction to exit the optical waveguide and illuminate at least a portion of the spatial light modulator. The plurality of extraction features is also positioned relative to the optical waveguide so that a respective extraction feature directs a second portion, distinct from the first portion, of the light to undergo total internal reflection, thereby continuing to propagate within the optical waveguide. |
| US11099401B2 |
Birefringent spectral demultiplexer for hyperspectral imaging
A birefringent spectral demultiplexer for hyperspectral imaging includes N birefringent beamsplitting stages arranged along a light propagation path, to produce 2N mutually divergent output light beams. Each of the output light beams differs from every other one of the output light beams in polarization and/or spectral bandwidth. Each birefringent beamsplitting stage includes a retarder for modifying polarization of each light beam received by the birefringent beamsplitting stage, and a Wollaston prism for splitting each light beam into two orthogonally polarized and divergent light beams. The Wollaston prism has a beamsplitting interface arranged at an oblique angle to the light propagation path. The oblique angle of the beamsplitting interface of each Wollaston prism of the series, except for the first one, is smaller than the oblique angle of the beamsplitting interface of each preceding Wollaston prism. The demultiplexer may be configured to accept input light of any polarization. |
| US11099398B2 |
Virtual image display apparatus
A virtual image display apparatus is provided, which includes a case member housing an image element, a lens barrel housing a projection lens serving as an optical system configured to receive imaging light emitted from the image element, and an elastic sealing member that covers a space between the case member and the lens barrel. With the elastic sealing member, position adjustment between the case member and the lens barrel is performed. |
| US11099397B2 |
Overhang rotatable multi-sensory device and a virtual reality multi-sensory system comprising the same
A virtual reality multi-sensory system includes an overhang rotatable multi-sensory device and a head-mounted multi-sensory device. The overhang rotatable multi-sensory device includes a fixed base, a control unit, a rotatable base, a driving device and a multi-sensory module having at least one selecting from the group consisting of a wind module, a hot air module, a heat module, and a liquid mist module. The head-mounted multi-sensory device includes a helmet, a display screen, earphones, a positioning module and an air flow guiding module. The present invention truly simulates image, sound effect, air flow, humidity, temperature, and smell of a specific environment, to stimulate the senses of sight, hearing, smell, and touch etc. of the user, thereby allowing the user to have an immersive experience in the simulated environment and avoiding increasing physical burden on the user's body. |
| US11099395B2 |
Virtual image display device
A virtual image display device includes a video image element that displays an image, and a light-guiding member that guides video image light from the video image element by reflection and transmission at a plurality of light-guiding surfaces. Among the plurality of light-guiding surfaces, with respect to an incident-side light-guiding surface and an emission-side light-guiding surface that are adjacent to each other, and an opposing light-guiding surface that faces the incident-side light-guiding surface and the emission-side light-guiding surface, a thickness from the incident-side light-guiding surface to the opposing light-guiding surface is caused to be smaller than a thickness from the emission-side light-guiding surface to the opposing light-guiding surface. |
| US11099390B2 |
Head-mounted display apparatuses
A head-mounted display apparatus is disclosed. The head-mounted display apparatus includes an optical member having a front surface, a rear surface, and a plurality of side surfaces, a display unit adapted to emit a display image toward one of the side surfaces of the optical member, and a reflective structure disposed inside the optical member to reflect the display image emitted from the display unit and to allow the reflected display image to pass and propagate through the rear surface. The image reflected by the reflective structure and delivered to user's eyes is the same irrespective of the coverage of the user's field of view. |
| US11099387B2 |
Active display alignment for multi-display device
A device disclosed herein includes a display alignment sensing assembly positioned to receive a first signal output from a first display assembly and a second signal output from a second display assembly. A waveguide directs the second signal from the output of the second display assembly to the display alignment sensing assembly where the first signal and the second signal are merged into a combined signal received at an optical sensor. A display alignment tracker detects a positioning disparity between the first signal and the second signal within the combined signal and outputs a rendering position adjustment instruction to correct for the detected positioning disparity. |
| US11099386B1 |
Display device with optical combiner
An optical system may include equipment with a housing that is configured to receive external equipment such as a cellular telephone. The external equipment may have a display mounted on a front face of the external equipment and may have additional components such as a front-facing camera. Communications circuitry in the equipment may support wired and wireless communications with the external equipment. An optical combiner in the equipment may be used to combine display image light emitted from pixels in the display with real-world image light received from external objects. The optical combiner may have a reflector with a concave lens shape that focuses light from the display towards eye boxes in which a viewer's eyes are located. The reflector may be a partial mirror or a reflective polarizer. The reflective polarizer and additional components may be used in implementing a tunable tint layer. |
| US11099384B2 |
Adjusting display settings of a head-mounted display
Apparatuses, methods, systems, and program products are disclosed for adjusting display settings of a head-mounted display. An apparatus includes a processor and a memory that stores code executable by the processor. The code is executable by the processor to receive sensor data from one or more sensors operably connected to a head mounted display (“HMD”) unit while a user wears the HMD unit. The code is executable by the processor to determine a user's cognition level based on the sensor data. The code is executable by the processor to adjust one or more display settings of the HMD unit based on the determined cognition level for the user. |
| US11099382B2 |
Display apparatus, mobile object, and light source device
A display apparatus allows a user to visually recognize a virtual image. The virtual image has luminance characteristics according to which a dependence of luminance on viewing angle changes along a certain direction. |
| US11099374B2 |
Endoscope
An endoscope includes: a light guide fiber having an exit end through which illumination light is emitted; a transparent distal-end element configured to hold the exit end of the light guide fiber and made of a transparent material that allows the illumination light emitted from the exit end to pass therethrough; and an objective optical system inserted through a through-hole provided in the transparent distal-end element, wherein at least a portion of the illumination light enters the objective optical system through a boundary between the transparent distal-end element and the objective optical system, and a refractive index of the transparent material constituting the transparent distal-end element is larger than a refractive index of at least one material in contact with an inner surface of the through-hole. |
| US11099373B2 |
Optical apparatus
An optical apparatus includes an eye width adjustment mechanism that includes a first connecting member configured to connect a connecting portion of the right eyepiece unit on one side of a reference plane and a connecting portion of the left eyepiece unit on the other side of the reference plane to each other where the reference plane is a plane including the rotation center axes of the right and left eyepiece units, and a second connecting member configured to connect the connecting portion of the right eyepiece unit on the other side of the reference plane and the connecting portion of the left eyepiece unit on the one side of the reference plane. |
| US11099372B2 |
Telescope with simplified mounting
A telescope including a fastener plate, a primary mirror carried by a front face of the plate, and a secondary mirror held facing the primary mirror by a support. The primary mirror is connected to the plate by fastener elements each having a bearing receiving a pin as a sliding fit, the pin being adhesively bonded in the bearing by means of a structural adhesive; and in that the pin is provided with a central channel having a first end opening out into a portion of the pin that is accessible when the pin is in position in the holes in order to receive one end of a cannula for injecting adhesive, and a second end opening out at least into a transverse channel having at least one end opening out into the bearing. |
| US11099371B2 |
Telescope bypass mirror mechanism with minimized stow volume
An optical system (e.g., a telescope) comprising an optical assembly that reflects and refracts light rays through a single window about an optical path to a detector. A field-of-view bypass assembly comprises a bypass mirror movably coupled with respect to the optical assembly. The bypass mirror is selectively translatable and tiltable between a bypass configuration and a retracted configuration. In the bypass configuration, the bypass mirror is disposed in and interrupts the primary optical path and oriented to define a secondary optical path to the detector. In the retracted configuration, the bypass mirror is both disposed out of the primary optical path and is properly shielded to prevent stray light reflections. |
| US11099369B2 |
Fully automatic microscopic scanner having flat light source
A fully automatic microscopic scanner, comprising an image acquisition mechanism (IAM) with a line array camera. The IAM and the microscopic scanning mechanism move along X/Y/Z axis under the action of a power control mechanism. The light source mechanism illuminates an area greater than or equal to the total area of the tray and has a flat light source with a condenser, a cooling fan, a water cooling unit. A general control mechanism and a laser pre-focus system connects to the light source mechanism. The fully automatic microscopic scanner links the microscopic scanning mechanism and the IAM with the light source mechanism. Flexible adjustment of lens is achieved by making the lens move forwards and backwards, leftwards and rightwards and up and down. The light source mechanism and laser pre-focus system, the stage and the light source are fixed during the scanning process to achieve real-time accurate and fast focusing. |
| US11099368B2 |
Camera and specimen alignment to facilitate large area imaging in microscopy
A microscope system and method allow for a desired x′-direction scanning along a specimen to be angularly offset from an x-direction of the XY translation stage, and rotates an image sensor associated with the microscope to place the pixel rows of the image sensor substantially parallel to the desired x′-direction. The angle of offset of the x′-direction relative to the x-direction is determined and the XY translation stage is employed to move the specimen relative to the image sensor to different positions along the desired x′-direction without a substantial shift of the image sensor relative to the specimen in a y′-direction, the y′-direction being orthogonal to the x′ direction of the specimen. The movement is based on the angle of offset. |
| US11099365B2 |
Zoom lens and image pickup apparatus
A zoom lens includes, in order from an object side, a positive first unit, a negative second unit, a positive intermediate group consisting of one or two units and including a third unit located on a most object side, a negative unit, and a rear group consisting of one or two units including a positive unit located on a most object side. Conditional expressions are satisfied with respect to amounts of movement of the second and third units from a wide angle end to a telephoto end, a distance at the wide angle end from a most object side surface vertex in the first unit to a most object side surface vertex in the third unit, an Abbe number of a most object side lens in the first unit, a focal length of the second unit, and focal lengths at the wide angle end and at the telephoto end. |
| US11099364B2 |
Zoom lens and imaging apparatus
A zoom lens consists of a positive first lens group that is fixed during zooming, a negative second lens group that moves during zooming, a positive third lens group that moves during zooming, a positive fourth lens group that moves during zooming, and a positive fifth lens group that is fixed during zooming. During zooming from a wide angle end to a telephoto end, the fourth lens group moves from an image side to an object side, the second lens group and a composite group consisting of the third lens group and the fourth lens group pass through points where respective lateral magnifications are −1 at the same time, the fifth lens group consists of a negative fifth A lens group that moves during anti-shake operation, and a positive fifth B lens group that is fixed during the anti-shake operation, and the lateral magnification of the fifth A lens group is negative. |
| US11099363B2 |
Lens device
A lens device consists essentially of a first lens, a second lens, a third lens, a fourth lens, a fifth lens, a sixth lens, and a seventh lens. The first lens is with negative refractive power and includes a convex surface facing an object side and a concave surface facing an image side. The second lens is a biconcave lens with negative refractive power. The third lens is with positive refractive power. The fourth lens includes a concave surface facing the object side. The fifth lens is with refractive power and includes a convex surface facing the object side. The sixth lens is with refractive power. The seventh lens is with positive refractive power. The first, second, third, fourth, fifth, sixth, and seventh lenses are arranged in order from the object side to the image side along an optical axis. The third lens and the fourth lens are cemented. |
| US11099361B2 |
Small lens system comprising five lenses of +—+ refractive powers
A small lens system having five lenses arranged along an optical axis from a focal object side in order of a first, a second, a third, a fourth, and a fifth lens is proposed. A center interval (T12c) of the first and the second lens is T12c<0.2 mm, and an effective outermost interval (T12e) satisfies T12e<0.2 mm. The fifth lens has a positive refractive power, a front surface convex toward the focal object, a rear curvature (C10) satisfying −0.01 |
| US11099354B2 |
Optical lens system and imaging system
The present invention relates to an optical lens system for a camera comprising in an order from an end at the object side to an end at the image side a first lens having a positive refractive power, a second lens having a positive refractive power, a third lens having a positive refractive power, and a fourth lens having a negative refractive power, wherein the second and third lenses are each designed as meniscus lenses, wherein the surface of the second lens at the object side is convex and the surface of the third lens at the object side is concave. The invention further relates to an imaging system having an image sensor that has a plurality of light-sensitive elements arranged in rows and columns and having such an optical lens system. |
| US11099350B2 |
Lens driving device, camera module and optical apparatus
A lens driving device is provided, including: a holder member; a first driving unit disposed at the holder member; a base disposed at a lower side of the holder member and spaced apart from the holder member; a first circuit board disposed at an upper surface of the base; a second circuit board including a second driving unit facing the first driving unit, and disposed at an upper surface of the first circuit board; a support member supporting the holder member with respect to the base; and a guide portion protruded from an upper surface of the base, wherein the guide portion supports the second circuit board. In an embodiment, a coil at the second circuit board and a magnet at the holder member may be assembled at a predetermined interval, such that reliability of the product with respect to performance of handshake compensation device can be enhanced. |
| US11099344B2 |
Fiber cassette
A cassette including a length from a first end of the cassette to a second end of the cassette, and a width from a first side of the cassette to a second side of the cassette. The cassette may include a detent arranged in the first side of the cassette or arranged in the second side of the cassette. The cassette may be arrangeable in a tray such that the at least one detent is engageable with another detent arranged in a wall of the tray. The cassette may include a groove arranged in a bottom surface of the cassette. The cassette may be arrangeable in a tray such that a protrusion of the tray is engageable with the groove of the cassette. |
| US11099343B2 |
Enclosure for use in a fiber optic distribution network
The present disclosure relates to a re-enterable enclosure for a fiber optic network. The enclosure can include features such as a low compression-force perimeter gasket, cable seals constructed to seal effectively seal triple points, multi-function port size reducer plugs and multi-function blind plugs. |
| US11099341B1 |
Active optical cable assembly with multicore fiber
An active optical cable may include a multicore optical fiber, a connector housing, a mateable electrical connector, an array of optoelectronic converter devices in the connector housing, and an optical waveguide structure. The optical waveguide structure is configured to couple optical signals between the fiber cores and the optoelectronic converter devices in the connector housing. |
| US11099340B1 |
Optical interconnect and connector devices
Methods and systems for optical interconnection. |
| US11099338B2 |
Method of forming an hermetic seal on electronic and optoelectronic packages
A method for forming hermetic seals between the cap and sub-mount for electronic and optoelectronic packages includes the formation of metal mounds on the sealing surfaces. Metal mounds, as precursors to a metal hermetic seal between the cap and sub-mount of a sub-mount assembly, facilitates the evacuation and purging of the volume created within cap and sub-mount assemblies prior to formation of the hermetic seal. The method is applied to discrete cap and sub-mount assemblies and also at the wafer level on singulated and non-singulated cap and sub-mount wafers. The method that includes the formation of the hermetic seal provides an inert environment for a plurality of electrical, optoelectrical, and optical die that are attached within an enclosed volume of the sub-mount assembly. |
| US11099331B2 |
Optical adaptor
An optical adaptor for inspection of a desired surface of an optical ferrule is provided. The optical ferrule is disposed in, and has a first position relative to, a housing of the optical ferrule. The optical adaptor includes a front portion including an open front end for insertion into the housing of the optical ferrule from an open mating end of the housing and for receiving at least a portion of the desired surface of the optical ferrule. The front portion includes a receiving surface for receiving at least a portion of the optical ferrule and causing the optical ferrule to change its position from the first position to a different second position. An image forming surface forms an image of the desired surface of the optical ferrule, thereby allowing a viewing of the optical ferrule from an open rear end of the optical adaptor. |
| US11099327B2 |
TE polarizer based on SOI platform
The present application discloses a Transverse Electric (TE) polarizer. The TE polarizer includes a semiconductor substrate having an oxide layer. The TE polarizer further includes a waveguide embedded in the oxide layer. Additionally, the TE polarizer includes a plate structure embedded in the oxide layer substantially in parallel to the waveguide with a gap distance. In an embodiment, the plate structure induces an extra transmission loss to a Transverse Magnetic (TM) mode in a light wave traveling through the waveguide. |
| US11099323B2 |
Surface plasmon-optical-electrical hybrid conduction nano heterostructure and preparation method therefor
The present invention provides a surface plasmon-optical-electrical hybrid conduction nano heterostructure and a preparation method therefor. The structure includes an exciting light source, a semiconductor nano-structure array, a two-dimensional plasmonic micro-nano structure, a sub-wavelength plasmon polariton guided wave, an emergent optical wave, a one-dimensional plasmonic micro-nano structure, a wire, a metal electrode, a conductive substrate, a probe molecule, an atomic-force microscopic conductive probe and a voltage source. The method achieves a semiconductor seed crystal with controllable distribution and density by controlling free metal ions, air, water or oxygen on a metal substrate to achieve highly uniform control of the seed crystal, and then strictly controls a length-to-diameter ratio and distribution of a semiconductor structure by continuous growth. Therefore, a new nano optics platform is provided for studying various novel effects produced by interaction between light and substances. |
| US11099317B2 |
Multi-stage optical waveguide for a luminaire
According to one aspect, an optical waveguide includes a first waveguide portion and a second waveguide portion adjacent to and separate from the first waveguide portion. The waveguide portions include light coupling portions that are at least partially aligned and adapted to receive light developed by a light source. The first waveguide portion further has a first major surface with light direction features and a second major surface opposite the first major surface. The second waveguide portion further has a third major surface proximate the second major surface with an air gap disposed therebetween and a fourth major surface opposite the third major surface wherein the fourth major surface includes a cavity extending therein. |
| US11099315B1 |
Backlight module
The present disclosure discloses a backlight module, which includes a light guide plate and at least one light emitting unit. The light guide plate includes a first side and a second side opposite to each other, at least one accommodating portion and at least one light guide structure. The accommodating portion is adjacent to the first side and has an incident surface faced toward the second side. The light guide structure is disposed between the accommodating portion and the second side, and the light guide structure further comprises a first reflective surface and a second reflective surface. The first reflective surface is toward the first side and close to the accommodating portion. The second reflective surface is adjacent to the first reflective surface, and the second reflective surface is toward the first side and away from the accommodating portion. The light emitting unit is disposed in the accommodating portion. |
| US11099309B2 |
Outward coupling suppression in waveguide display
A pupil replication waveguide for a projector display includes a slab of transparent material for propagating display light in the slab via total internal reflection. A diffraction grating is supported by the slab. The diffraction grating includes a plurality of tapered slanted fringes in a substrate for out-coupling the display light from the slab by diffraction into a blazed diffraction order. A greater portion of the display light is out-coupled into the blazed diffraction order, and a smaller portion of the display light is out-coupled into a non-blazed diffraction order. The tapered fringes result in the duty cycle of the diffraction grating varying along the thickness direction of the diffraction grating, to facilitate suppressing the portion of the display light out-coupled into the non-blazed diffraction order. |
| US11099307B2 |
Optical system
An optical system including a first microstructured surface; and a second microstructured surface; wherein the first microstructured surface is aligned along an axis with the second microstructured surface is provided. An illumination system including a light source and the optical system is also included. A method of diffusing light is included. |
| US11099306B2 |
Fresnel lens with variable draft angle
A Fresnel lens with Fresnel prisms having a first facet, called the main facet, and a second facet, called the draft facet, the draft facet making a draft angle to the optical axis, the draft angle being variable along at least one Fresnel prism, so that the draft angle is higher on one side of the lens than on the other. |
| US11099299B2 |
Optical article provided in a form suitable for direct lamination; method for manufacturing an optical device
An optical article provided in a form suitable for simultaneous lamination of a pressure sensitive adhesive layer and of a thermoplastic film, the said optical article comprising a convex and a concave optical surface, wherein the convex and/or the concave optical surface is a receiving surface intended to receive the pressure sensitive adhesive on which the thermoplastic film is intended to be arranged and wherein the said receiving surface has an arithmetic average profile roughness greater or equal to 0.01 μm and less or equal to 0.3 μm and/or wherein the said receiving surface has a profile roughness root mean square slope greater or equal to 0.2° and less or equal to 1.2°. A method for manufacturing an optical device using said optical article. |
| US11099298B2 |
Collection vessel for collecting, measuring, and aggregrating precipitation accumulation data
Embodiments for controlling precipitation collection vessels to accurately and efficiently collect, measure, and aggregate precipitation accumulation data are disclosed. In one embodiment according to aspects of the present invention, a computer-implemented method includes measuring a frozen precipitation level of the frozen precipitation in a collection vessel. The method further includes heating the collection vessel to convert the frozen precipitation into melted precipitation. The method further includes measuring a melted precipitation level to determine an equivalent water accumulation of the frozen precipitation. |
| US11099293B2 |
System and method for evaluating a formation using a statistical distribution of formation data
A system and method of evaluating a subterranean earth formation using a statistical distribution of formation data. The system comprises a logging tool and a processor in communication with the logging tool. The logging tool comprises a sensor operable to measure formation data and is locatable in a wellbore intersecting the subterranean earth formation. The processor is operable to calculate inversion solutions to the formation data, wherein each inversion solution comprises values for a parameter of the formation, and generate a statistical distribution of the parameter along one or more depths in the subterranean earth formation using the inversion solutions. The processor is also operable to identify peaks within the statistical distribution and select the inversion solutions corresponding to the identified peaks, generate a formation model using the selected inversion solutions; and evaluate the formation using the formation model to identify formation layers for producing a formation fluid. |
| US11099291B2 |
Submarine resource exploration system, transmission device, reception device, signal processing device, signal processing method, electrical exploration method, electromagnetic exploration method, and program
A transmission device of a submarine resource exploration system includes a transmission unit which transmits a predetermined transmission artificial signal transmitted in order to perform exploration of submarine resources in water using water as a medium. A reception device includes a reception unit which receives a composite signal of a received artificial signal representing a signal propagated to the reception device using water as a medium in the transmission artificial signal, and a self-potential propagated to the reception device using water as a medium due to a potential anomaly generated due to submarine resources. A signal processing device includes a signal processing unit which separates the composite signal into the received artificial signal and the self-potential. |
| US11099289B2 |
Multivariate analysis of seismic data, microseismic data, and petrophysical properties in fracture modeling
A multivariate analysis may be used to correlate seismic attributes for a subterranean formation with petrophysical properties of the subterranean formation and/or microseismic data associated with treating, creating, and/or extending a fracture network of the subterranean formation. For example, a method may involve modeling petrophysical properties of a subterranean formation, microseismic data associated with treating a complex fracture network in the subterranean formation, or a combination thereof with a mathematical model based on measured data, microseismic data, completion and treatment data, or a combination thereof to produce a petrophysical property map, a microseismic data map, or a combination thereof; and correlating a seismic attribute map with the petrophysical property map, the microseismic data map, or the combination thereof using the mathematical model to produce at least one quantified correlation, wherein the seismic attribute map is a seismic attributed modeled for the complex fracture network. |
| US11099279B2 |
Processing of a corrected X-ray detector signal
A detector signal is corrected by superimposing the detector signal with a correction signal. For providing a valid correction signal, a sampling pulse is periodically or randomly provided. The sampling pulse serves as the initiator for sampling a process signal. During the sampling, the process signal is observed. In case a pulse at the process signal is detected, the sampling is assumed as not being suitable to correct the detector signal, since the pulse affects the process signal. Otherwise, the process signal is further observed during a validation period to validate whether the sampled process value of the process signal has already been influenced by an upcoming pulse at the process signal. In case the sampling is assumed as valid, the sampled process value is used as a basis for providing the correction signal. |
| US11099278B2 |
Device for optically measuring doses of radiation absorbed by a gel dosimeter by means of polarized light
Disclosed is a device for measuring radiation doses absorbed by a gel dosimeter, including in particular a polarizer for a light beam according to at least two distinct polarization angles, the polarizer being positioned between a light source and an optical detector, a unit for measuring the value of the intensity of the light beam, which intensity is measured by the optical detector, and a unit for calculating the value of a ratio of intensities of the light beam, which intensities are measured by the optical detector, for two distinct polarization angles of the light beam that is selected by the polarizer. |
| US11099274B2 |
Target tracking device comprising a photodetector with quadrants
Device for tracking a target, the device comprising an optical system and a quadrant photodetector, wherein the optical system is configured to project a light beam coming from the target at one spot on at least one of the quadrants, and the photodetector is configured to estimate a current position of the spot by weighting of light energies received by the quadrants. The optical system comprises an optical device configured, when the spot is entirely contained in only one of the quadrants, to enlarge the spot. The invention also relates to a tracking method likely to be implemented by this tracking device. |
| US11099263B2 |
Automatic time gain compensation (TGC) in ultrasound imaging
An ultrasound imaging system (100) includes a transducer array (102) with a plurality of transducer elements (106) configured to transmit an ultrasound signal, receive echo signals produced in response to the ultrasound signal interacting with structure, and generate electrical signals indicative of the echo signals. The system further includes a beamformer (112) configured to process the electrical signals and generate radio frequency data, an in-phase quadrature processor (114) configured to process the radio frequency data and generate in-phase quadrature data, and a frame processor (116) configured to envelope detect and log compress the in-phase quadrature data, producing compressed envelope data. The system further includes a time gain compensation controller (120) configured to continuously process the in-phase quadrature data and the compressed envelope data and continuously and automatically apply time gain compensation data to an envelope data image. The system further includes a rendering engine (124) configured to display, via a display (124), the time gain compensated envelope data image. |
| US11099261B2 |
Scanning device
A scanning device includes a transmitter, a receiver, and a rotor that is configured to be mounted in a rotatable manner about an axis of rotation. The transmitter is configured to at least occasionally emit electromagnetic radiation, and the receiver is configured to sense at least part of the electromagnetic radiation reflected and/or scattered by an object. The transmitter and the receiver are arranged on the rotor in an at least partially axially overlapping manner based on the axis of rotation. |
| US11099259B2 |
Polarization detection improved sensing
A time-of-flight camera module includes a controller, a time-of-flight detector, a laser device, and an optical unit comprising a polarization rotator arranged to rotate a plane of polarized light. The controller is configured to modulate the time-of-flight detector and the laser device in a depth sensing mode. The time-of-flight detector is configured to record depth data of a scene in the depth sensing mode by means of modulated laser light emitted by the laser device and reflected from an object in the scene. The depth data is descriptive of a distance to the object in the scene. The controller is further configured to modulate the time-of-flight detector and the polarization rotator in a surface polarization sensing mode. The time-of-flight detector is configured to record polarization data of the scene in the surface polarization sensing mode by detection light received from the object in the scene after traversing the polarization rotator. |
| US11099256B2 |
Device and method for processing radar signals
A device for processing radar signals is suggested, the device comprising: (i) a memory, which is arranged to store radar data and (ii) an accessor comprising a DMA engine, wherein the accessor is arranged to access data of the memory via the DMA engine, to filter the accessed data, and to forward the filtered data. |
| US11099255B2 |
Radar and antenna built in radar
A radar includes a transmitter antenna unit that includes multiple transmitter antennas arranged at first horizontal distances and first vertical distances from each other, a receiver antenna unit that includes multiple receiver antennas arranged at second horizontal distances and second vertical distances from each other, a transceiver that transmits transmission signals through the transmitter antenna unit and receives return signals reflected from a target object trough the receiver antenna unit, and a processing unit that derives information about the target object by processing the received return signals. |
| US11099246B2 |
Medical image diagnosis system, magnetic resonance imaging apparatus, and image projecting method
A medical image diagnosis system according to one embodiment includes a gantry, a couch, a reflecting plate, and a processing circuitry. The gantry is for medical imaging having a bore. The couch movably supports a top plate. The reflecting plate reflects an image output from an image output device. The processing circuitry, in a first case where the image is shown to an observer not through the reflecting plate, outputs a first image signal relating to a first image to the image output device. While in a second case where the image is shown to the observer through the reflecting plate, The processing circuitry outputs a second image signal relating to a second image to the image output device. |
| US11099243B2 |
Differential magnetic load cells for compact low-hysteresis force and torque measurements
Magnetic load cells that measure force and/or torque are constructed from magnets and one or more arrays of magnetic field sensors. The magnetic field sensors are structured in a tight array where the array is attached to a first portion of a frame. The magnets are operated in pairs polarized in opposition to one-another. In particular, pairs of concentric magnets create sharp field boundaries. The magnets are attached to a second portion of the frame with the magnets separated from the array of field sensors by a small gap. The second portion of the frame is free to displace or rotate in relation to the first portion of the frame when a force or torque is applied to it. The displacement results in a measurable differential change in magnetic field reported by the array that can be sampled and processed to relate to the applied force or torque. |
| US11099241B2 |
Power tool
A power tool includes: a rechargeable battery; a motor; a drive circuit; an operation unit; a battery state detection circuit; a control circuit; and an interruption circuit. The battery state detection circuit detects a battery voltage, and when the detected battery voltage is lower than or equal to a prescribed voltage, the battery state detection circuit outputs a low-voltage signal. The control means outputs a control signal to the drive circuit instructing to drive the motor when the operation unit is operated and halts the output of the control signal to the drive circuit instructing to halt driving the motor in response to the low-voltage signal. The interruption circuit outputs an interruption signal to the drive circuit in response to the low-voltage signal to thereby interrupt the drive circuit and halt driving the motor irrespective of whether or not the control signal is outputted to the drive circuit. |
| US11099237B2 |
Test prioritization and dynamic test case sequencing
Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, for a touchless testing platform employed to, for example, create automated testing scripts, sequence test cases, and implement defect solutions. In one aspect, a method includes receiving a log file and testing results generated from a code base for an application; processing the log file through a pattern-mining algorithm to determine a usage pattern of code modules within the code base; clustering defects from the testing results based on a respective functionality of the application reported within each of the defects; generating testing prioritizations for test cases for the application by assigning weightages to the test cases based on the clusters of defects and the usage pattern of the code modules within the code base; sequencing a set of the test cases based on the test prioritizations; and transmitting the sequence to a test execution engine. |
| US11099234B2 |
False detection method for loading probe card
A method for loading a probe card into a prober is provided. The method includes placing a probe card on a carrier plate and analyzing signals produced by two detection sensors. The detection sensor produces the correct signal when the probe card is placed in a normal state, and produces a false signal when the probe card is placed in an abnormal state. In addition, the method includes sending the probe card into the prober in response to the correct signals produced by both detection sensors. Alternatively, the method includes removing the probe card from the carrier plate and placing the probe card on the carrier plate again after adjustment of the probe card in response to a false signal produced by either of the detection sensors. |
| US11099228B2 |
Test system and method
Presented embodiments facilitate efficient and effective access to a device under test. In one embodiment, a test system comprises: a primitive configured to control testing of a device under test (DUT) and a device interface board (DIB). The device interface board comprises: a loadboard, an environmental control component and a device under test access interface. The loadboard is configured to selectively couple with a device under test and a primitive. The environmental control component is configured to control environmental conditions. The device under test access interface is configured to allow robotic manipulation of the device under test. The manipulation can include selectively coupling the device under test to the loadboard. The device under test access interface can be configured to enable unobstructed access for robotic manipulation of the device under test. |
| US11099224B2 |
Method and circuitry for semiconductor device performance characterization
Performance measuring circuitry, for determining relative operational performance attributes of different types of a class of semiconductor component disposed on a semiconductor die, includes a first oscillator circuit including a plurality of first circuit element modules having a first circuit topology. The first oscillator circuit provides a first performance indication indicative of a collective performance attribute of all types of components in the class. A second oscillator circuit separate from the first oscillator circuit includes a plurality of second circuit element modules having a second circuit topology, and provides a second performance indication responsive to different contributions from different types of components in the class. A comparison circuit receives outputs of the first and second oscillator circuits and determines the relative performance characteristic of the different types of components. Dice may be binned according to performance, for use in assembly of operational circuits with different performance characteristics. |
| US11099223B2 |
Capacitive sensor system
A capacitive sensor system that includes: a sensor arrangement with a plurality of capacitive electrodes, each being connected to a corresponding detector line; and a detector device connected to each detector line and configured to detect the capacitance of each electrode by applying a detector signal. The sensor arrangement includes: at least one electrode group having at least two electrodes, each electrode of an electrode group being connected to another electrode via a resistive element so that all electrodes of this electrode group are connected in series; and a diagnose device that is connected, for each electrode group, at least to a first detector line of a first electrode and to a second detector line of a second detector electrode and is configured to apply a diagnose signal via the first and second detector lines and to detect a conductor break based on a response to the diagnose signal. |
| US11099221B2 |
Dynamic tolerance curves for power monitoring systems
A method for managing power quality events in an electrical system includes processing electrical measurement data captured by an intelligent electronic device (IED) to identify at least one power quality event associated with one or more loads monitored by the IED. The IED and the loads are installed at respective locations in the electrical system. The method also includes determining an impact of the at least one identified power quality event on one or more of the loads, and using the at least one identified power quality event and the determined impact to generate a tolerance curve associated with the one or more of the loads. The tolerance curve characterizes a tolerance level of the loads to certain power quality events. The loads can include one or more loads “downstream” from the IED in the electrical system and/or one or more loads “upstream” from IED in the electrical system. |
| US11099220B2 |
Intelligent electronic device control using wirelessly transmitted electrical measurements
A system is provided for monitoring and protecting an electric power distribution system using intelligent electronic devices that may rely on the communication from wireless electrical measurement devices. A wireless electrical measurement device may obtain electrical measurements on a transmission line and wirelessly transmit messages containing the measurements to an intelligent electronic device. The intelligent electronic device may determine a consistency of wireless communication from the wireless electrical measurement device based at least in part on the received messages. When the wireless communication is determined to be presently consistent, the intelligent electronic device may operate in a first mode. When the wireless communication is determined not to be presently consistent, the intelligent electronic device may operate in a second mode. |
| US11099219B2 |
Estimating the remaining useful life of a power transformer based on real-time sensor data and periodic dissolved gas analyses
During a surveillance mode, the system receives present time-series signals gathered from sensors in the power transformer. Next, the system uses an inferential model to generate estimated values for the present time-series signals, and performs a pairwise differencing operation between actual values and the estimated values for the present time-series signals to produce residuals. The system then performs a sequential probability ratio test on the residuals to produce alarms having associated tripping frequencies (TFs). Next, the system uses a logistic-regression model to compute a risk index for the power transformer based on the TFs. If the risk index exceeds a threshold, the system generates a notification that the power transformer needs to be replaced. The system also periodically updates the logistic-regression model based on the results of periodic dissolved gas analyses for the transformer to more accurately compute the index for the power transformer. |
| US11099217B2 |
Current sensor having a flux concentrator for redirecting a magnetic field through two magnetic field sensing elements
A method can use a current sensor that can include a magnetic flux concentrator along with first and second magnetic field sensing elements disposed proximate to the magnetic flux concentrator, wherein the magnetic flux concentrator is operable to influence a direction of first and second magnetic fields at the first and second magnetic field sensing elements, respectively, the first and second magnetic fields resulting from an electrical current passing through a conductor, the first and second magnetic field sensing elements operable to generate first and second signals, respectively, in response to the first and second magnetic fields, respectively, wherein the current sensor can also include a differencing circuit operable to subtract the first and second signals to generate a difference signal related to the electrical current. |
| US11099216B2 |
Circuit and method for shunt current sensing
Circuits and methods relating to shunt current sensing are provided. A shunt current sensing circuit comprises a shunt resistor for receiving a shunt current. A filtering stage is connected to the shunt resistor and is configured to filter the shunt current. A current sense amplifier is connected to the filtering stage and is configured to receive the filtered shunt current from the filtering stage. The current sense amplifier is configured to sense the filtered shunt current to produce an output voltage. The filtering stage is configured to filter the shunt current such that the output voltage produced by the current sense amplifier (U2) is substantially proportional to the shunt current. |
| US11099208B2 |
System and method for determining whether an electronic device is located on a stationary or stable surface
An embodiment system includes: a first motion sensor configured to generate first sensor data indicative of a first type of movement of an electronic device; a first feature detection circuit configured to determine at least one orientation-independent feature based on the first sensor data; and a classifying circuit configured to determine whether or not the electronic device is located on a stationary surface based on the at least one orientation-independent feature. |
| US11099201B2 |
Device for the automated analysis of solids or fluids
The invention relates to a device (1) for the automated analysis of solids or fluids. Said device comprises a first station (5) having a metering unit (51) for the filling of at least one sample chamber (2) with a specified sample quantity, a second station (6) having at least one measurement device (61) for an analysis of the sample situated in a sample chamber (2) and a third station (7) having an emptying device and cleaning device (71, 72) for the at least one sample chamber (2). Moreover, there is provided a transport device (3) for a revolving transport of the at least one sample chamber (2) from one station to the next until the first station (5) is reached again. According to the invention, the measurement device (61) of the second station (6) is a spherical measurement system, through the interior of which it is possible to guide the at least one sample chamber (2). |
| US11099198B2 |
Quantitation of insulin by mass spectrometry of insulin A chain
Methods are described for determining the amount of insulin in a sample. More specifically, mass spectrometric methods are described for detecting and quantifying insulin in a biological sample utilizing purification methods coupled with tandem mass spectrometric or high resolution/high accuracy mass spectrometric techniques. |
| US11099197B2 |
Alpha-synuclein detection assay and method for diagnosing alpha-synucleinopathies
A method of detecting the presence of alpha-synuclein aggregation in a biological sample is provided whereby a biological sample is mixed with a reaction sample comprising a population of beads, a fluorophore adapted to bind to protein aggregates and to increase fluorescence when bound to protein aggregates, and alpha-synuclein or a fragment or variant thereof to form a reaction mixture, the reaction mixture is illuminated and at the same time incubated with intermittent agitation cycles, wherein a significant increase in the fluorescence of the reaction mixture during incubation is indicative of the presence of aggregates of alpha-synuclein in the biological sample. Method of diagnosing alpha-synucleinopathies such as Parkinson's disease or Dementia with Lewy Bodies. |
| US11099193B2 |
Methods for diagnosing or monitoring muscular dystrophies
The invention relates to a method for prognosing, diagnosing, determining the risk, and monitoring the evolution of a muscular dystrophy. It also relates to a method for evaluating the efficacy of a treatment of a muscular dystrophy in a subject in need thereof. |
| US11099185B2 |
Predictive markers useful in the treatment of wet age-related macular degeneration
The invention is directed to the use of biomarkers to determine responsiveness of an individual with wet AMD to treatment with a VEGF antagonist, to diagnose and distinguish dry and wet AMD and to determine the risk of conversion of a dry AMD disease to a wet AMD disease. |
| US11099184B2 |
Protein sensor and manufacturing method thereof
A manufacturing method of a protein sensor includes the following steps. A hydrophobic material is provided and the hydrophobic material has a surface. An atmospheric pressure plasma process is performed to form a hydrophilic functional group on the surface of the hydrophobic material. A first antibody is immobilized on the surface of the hydrophobic material by the hydrophilic functional group. A mixed solution is prepared. The mixed solution includes a second antibody and an analyte, and the second antibody binds to the analyte. The mixed solution is reacted with the first antibody immobilized on the surface of the hydrophobic material to bind the first antibody to the analyte. Furthermore, a protein sensor manufactured by the above-described manufacturing method of the protein sensor is also provided. |
| US11099183B2 |
Apparatus for collecting and detecting an analyte in a fluid sample
The present invention provides an apparatus for detecting an analyte in a fluid sample, comprising a fluid sample collection element, comprising a fluid sample collection element that comprises an absorbing element; a carrier for accommodating a testing element; and a chamber for accommodating a testing element carrier, wherein the testing element carrier is located in the chamber, and the carrier further comprises an extrusion structure that is in contact with the absorbing element and extrudes the absorbing element. |
| US11099180B2 |
Immunoassay using at least two pegylated analyte-specific binding agents
The disclosure concerns a method and kits for measurement of an analyte in a microparticle-based analyte-specific binding assay. In the assay, the microparticles are coated with the first partner of a binding pair, mixing the coated microparticles and at least two analyte-specific binding agents, each conjugated to the second partner of the binding pair, and a sample suspected of containing the analyte. The second partner of the binding pair is bound to each of the analyte-specific binding agents via a linker comprising from 12 to 30 ethylene glycol units (PEG 12 to 30), thereby binding the analyte via the conjugated analyte-specific binding agents to the coated microparticles. The method also entails separating the microparticles having the analyte bound via the binding pair and the analyte-specific binding agent from the mixture and measuring the analyte bound to the microparticles. |
| US11099179B2 |
Device and method for detecting substances present in biological or chemical samples
The present invention relates to a device and a method for detecting substances which are present in biological or chemical samples, each substance producing an optically detectable signal upon reaction with a reagent. The device further comprises a sample carrier with at least two receptacles for receiving samples and is characterized in that at least part of the receptacle is equipped to receive at least 2 reagents each, and in that a camera for recording an image which shows at least one receptacle filled with at least two reagents for the detection of different substances, and an evaluation device for evaluating the samples which device is designed such as to evaluate each image by analyzing the signals in the image. Said method comprises the following steps: Introducing at least two reagents into one receptacle of a sample carrier, and optionally immobilizing the reagents, adding the sample to the receptacle, recording an image by means of a camera such that the image shows the receptacle which is loaded with at least two reagents, and evaluating the image by analyzing the color spectrum of the samples in the image. |
| US11099176B2 |
Lactate biosensors and uses thereof
The present subject matter provides lactate biosensors as well as compositions, devices, and methods comprising such biosensors. |
| US11099174B2 |
Peripheral diagnostic methods for screening Alzheimer's disease using beta amyloid and intercellular communication
The present disclosure relates to a peripheral diagnostic method for screening Alzheimer's disease in patients based on quantitatively measured complexity of skin-sampled fibroblast networks. |
| US11099171B2 |
Communication interface clip for a handheld medical device
A communication interface apparatus is provided for use with a handheld medical test device. The communication interface apparatus is comprised of an attachment member configured to detachably couple to a housing of the medical test device, where the attachment member substantially overlays a rear side of the medical test device. The communication interface apparatus houses an infrared receiver, a secondary transceiver and a controller. The infrared receiver is arranged such that its input port aligns with an output port of an infrared transmitter in the medical test device when the attachment member is coupled to the medical test device. |
| US11099167B2 |
Methods to determine pressure distribution along a downhole formation and to determine a recipe for materials used in a wellbore
Methods to determine pressure distribution along a downhole formation and methods to determine a recipe for materials used in a wellbore are disclosed. A method to determine pressure distribution along a downhole formation includes overlaying a pressure film on a formation sample of a downhole formation. The method also includes inserting cement, the pressure film and the formation sample in a pressure vessel. The method further includes utilizing the pressure vessel to perform one or more tests of the formation sample. After performing the one or more tests, the method further includes analyzing the pressure film to determine a pressure distribution along the formation sample. |
| US11099164B2 |
Electronic device and method for utilizing gas sensor
An electronic device according to various embodiments of the present invention comprises: a housing; a user interface; a first gas sensor disposed to sense gas outside the housing; a second gas sensor disposed to sense gas outside the housing and spaced apart from the first gas sensor, the second gas sensor being of the same type as the first gas sensor; a processor electrically connected to the use interface, the first gas sensor, and the second gas sensor; and a memory electrically connected to the processor, wherein the memory may store instructions, that when executed, cause the processor to: monitor the gas outside the housing using the first gas sensor to acquire first data; monitor the gas outside the housing using the second gas sensor to acquire second data; compare the first data and the second data; and provide, via the user interface, information associated with at least one of the gas, the first gas sensor and the second gas sensor, at least in part, on the basis of the comparison result. Other embodiments are also possible. |
| US11099160B2 |
Multidimensional gas chromatograph
Lowering of a switching recovery rate is suppressed without degrading separating ability in a second analytical column. A multidimensional GC includes a sample injector for injecting a sample, a first analytical column for separating the sample injected from the sample injector into one or more components, the first analytical column communicating with the sample injector, a detector for detecting the components of the sample separated in the first analytical column, a second analytical column provided separately from the first analytical column, a switching device connected to an outlet side of the first analytical column and configured to lead the sample out of the first analytical column to the detector or to the second analytical column, and a temperature adjuster configured to adjust temperature of the switching device to a predetermined temperature independently of a temperature of the first analytical column and a temperature of the second analytical column. |
| US11099154B2 |
Method and device for separating metabolites or stereoisomers
A method of quantifying the amount of at least two analytes A1 and A2 involving (a) adding at least one salt (S) to at least a portion (P1) of the sample comprising the at least two analytes A1 and A2, (b) ionizing at least a portion of the sample according to (a) thereby forming an analyte flow comprising the analytes A1 and A2 in ionized form, (c) separating the ionized analytes A1 and A2 from each other by using at least one ion mobility separator (124), wherein the analyte flow according to (b) at least partially passes through the ion mobility separator (124), and (d) quantifying the amount of the separated ionized analytes obtained according to (c), wherein A1 is a pharmaceutically active compound C or derivative thereof and A2 is a metabolite or stereoisomer of C. |
| US11099149B2 |
Test element for electrochemically detecting at least one an analyte
A test element for electrochemically detecting at least one analyte in a bodily fluid is disclosed. The test element comprises at least one first electrode and at least one second electrode. The first electrode is designed as a working electrode and the second electrode is designed as a counter electrode. The test element comprises at least one capillary capable of receiving a sample of the body fluid. The first electrode and the second electrode are arranged on opposing sides of the capillary. The first electrode and the second electrode are arranged such that during a capillary filling the first electrode and the second electrode are wetted simultaneously and at an equal rate. |
| US11099146B1 |
Coal mine advanced detection method for heading machine
When the heading machine tunnels, a current generated by a current excitation source enters a coal seam through a movable cutting pick to form a stray current. The stray current collected by a backflow net returns to a negative electrode of a power supply through a transition resistor. When information such as the water content of the coal seam changes, the stray current and a potential difference across the transition resistor also accordingly change, and the coal seam water content information is converted into an electric signal. When the potential difference across the transition resistor is applied to two ends of a piezoelectric ceramic, the piezoelectric ceramic extends or compresses, and the electric signal is converted into a strain signal. A sensing optical fiber converts the strain signal into an optical signal detectable by a photoelectric detector. The optical signal is analyzed to obtain the coal seam water content information. |
| US11099144B2 |
Low sulfur fuel with adequate combustion quality
Fuel compositions that are low sulfur and have adequate combustion quality are disclosed. An example fuel composition that is low sulfur may have the following enumerated properties: a sulfur content of about 0.50% or less by weight of the fuel composition; a calculated carbon aromaticity index of about 870 or less; a density at 15° C. of about 900 kg/m3 to about 1,010 kg/m3; a kinematic viscosity at 50° C. of about 100 centistokes to about 700 centistokes; and an estimated cetane number of about 7 or greater. |
| US11099142B2 |
X-ray based measurements in patterned structure
A method and system are presented for use in X-ray based measurements on patterned structures. The method comprises: processing data indicative of measured signals corresponding to detected radiation response of a patterned structure to incident X-ray radiation, and subtracting from said data an effective measured signals substantially free of background noise, said effective measured signals being formed of radiation components of reflected diffraction orders such that model based interpretation of the effective measured signals enables determination of one or more parameters of the patterned structure, wherein said processing comprises: analyzing the measured signals and extracting therefrom a background signal corresponding to the background noise; and applying a filtering procedure to the measured signals to subtract therefrom signal corresponding to the background signal, resulting in the effective measured signal. |
| US11099140B2 |
Systems and methods for X-ray computed tomography
A system and method for X-ray computed tomography includes a robotic arm that moves an X-ray emitter around a subject in a curvilinear path and an X-ray detector that captures 2-dimensional views while the subject is scanned. Movements of the emitter and detector are coordinated such that the position and angle of the emitter relative to the detector remains substantially constant during scanning. A processor uses computed tomography to reconstruct an image of the subject from the captured 2-dimensional views. The robotic arm varies the pitch of the X-ray emitter during the scan to enhance the spatial resolution of the reconstructed image. The processor generates a projection transformation matrix based on movement of the robotic arm for each captured 2-dimensional view that is applied during reconstruction. |
| US11099135B2 |
Systems and methods for constructing and testing composite photonic structures
Systems and methods are disclosed relating to composite photonic materials used to design structures and detecting material deformation for the purpose of monitoring structural health of physical structures. According to one aspect, a composite structure is provided that includes a base material, an optical diffraction grating and one or more fluorophore materials constructed such that localized perturbations create a measureable change in the structure's diffraction pattern. An inspection device is also provided that is configured to detect perturbations in the composite structure. The inspection device is configured to emit an inspecting radiation into the structure and capture the refracted radiation and measure the change in the diffraction pattern and quantify the perturbation based on the wavelength and the angular information for the diffracted radiation. |
| US11099133B2 |
Flexible paper-based surface-enhanced Raman scattering substrate and method for preparing same
Disclosed are a flexible paper-based surface-enhanced Raman scattering (SERS) substrate and a method of preparing the same, which relate to detection of trace organics. This invention deposits a film of silver nanoparticles on a carrier such as filter paper by oblique-angle deposition to prepare the SERS substrate, which can be used for the detection of trace organics. Silver nanoparticles are closely arranged on the flexible paper, allowing the substrate for good SERS effect due to the interparticle coupling effect. Moreover, compared to the traditional rigid and brittle substrates, the substrate prepared herein can be readily used in the detection of residual organics on complex surfaces in various liquid or solid conditions by dipping, dropwise adding or wiping due to the use of a flexible and absorbent carrier. |
| US11099130B1 |
Light inspection system and method of the surface and inside of a sample
A light inspection system and method of the surface and inside of a sample. The system includes a light source generating a light beam to impinge on a sample; an imaging system obtaining an image of said sample and including a parabolic mirror with a hole to allow the passage of the light beam towards the sample, and the redirection of a scattered light component of the sample towards a light capturing unit comprising a bundle of bifurcated fibers; the bundle of fibers having a central fiber and external fibers, the central fiber receiving scattered light from the surface and the external fibers receiving scattered light from inside the sample; a measuring system measuring a power and/or a spectrum collected in the central and the external fibers. |
| US11099129B2 |
Spatially resolved standoff trace chemical sensing using backwards transient absorption spectroscopy
A system includes a first laser beam including a pulsed laser emanating from the instrument propagates in the air, wherein the first lase beam is tuned to the wavelength at which a target chemical absorbs, its pulses bringing molecules to an excited state, a second laser beam used to probe target chemicals by transient absorption spectroscopy, wherein the second laser beam is pulsed or continuous, and a detector. |
| US11099128B2 |
Optical analysis device, optical analysis method, and optical analysis
In order to analyze a solution component and a scatterer component in a liquid sample more quickly, there is provided an optical analysis device including a light source unit configured to irradiate a liquid sample with light; a first light receiving unit configured to receive transmitted light emitted from the light source unit and transmitted through the liquid sample; a second light receiving unit configured to receive scattered light emitted from the light source unit and scattered by a scatterer in the liquid sample; an ultrasonic irradiation unit configured to irradiate the liquid sample with an ultrasonic wave; a reflection plate configured to reflect the ultrasonic wave that is emitted from the ultrasonic irradiation unit and propagated through the liquid sample; and a control unit configured to control the light source unit, the first light receiving unit, the second light receiving unit, and the ultrasonic irradiation unit. |
| US11099125B2 |
Optical cavity for gas sensor and gas sensor having the same
The present invention provides an optical cavity for a gas sensor having a space defined therein, including: a first parabolic reflective surface formed on one wall surface in the space; a second parabolic reflective surface which is formed at a position facing the one wall surface, and is configured to reflect again a light emitted from a light source disposed at a focus of the first parabolic reflective surface and reflected by the first parabolic reflective surface so as to change a traveling path of the light; and a hyperbolic reflective surface formed so that any one focus of two foci coincides with a focus of the second parabolic reflective surface, and is configured to reflect the light made incident from the second parabolic reflective surface to change the traveling path of the light, and a value of c2−b2 of a hyperbola equation of hyperbola forming the hyperbolic reflective surface is in a range of 0 |
| US11099124B2 |
Gas analysis apparatus, program for gas analysis apparatus, and gas analysis method
A gas analysis apparatus includes a calibration curve data storage section designed to store N types of calibration curve data which are previously created for N types of measurement target components and obtained by correcting influences of other N−1 types of measurement target components with respect to a concentration of each of the measurement target components, and a concentration calculation section designed to calculate a concentration of each of the measurement target components by using the N types of calibration curve data. When there exists a subthreshold component whose concentration calculated by the concentration calculation section is not more than a predetermined threshold value, the concentration calculation section calculates a concentration of each of the measurement target components other than the subthreshold component by using calibration curve data obtained without correcting an influence of the subthreshold component. |
| US11099120B2 |
Analysis cuvette and derivatives with signal amplification
A cuvette in which a fluorescent enzymatic reaction can be carried out that is for analyzing a sample includes at least one vertical wall and a bottom. The cuvette is made of a transparent or translucent material and a portion of the cuvette is partially covered on the outside with a sleeve including an inner coating made of retro-reflective material that is in contact with the cuvette. |
| US11099117B2 |
Apparatus and methods for sample acquisition
Apparatus and methods for sample acquisition, including for example, samples for flow cytometry systems. Certain embodiments include a plurality of plates, valves, and conduits. In particular embodiments, the plates are stacked and the conduits extend through stack of plates, and in specific embodiments each valve is in fluid communication with a conduit. |
| US11099114B2 |
Test device and test method for rotary pressurized filter and method for designing filter
A testing device, a testing method, and a design method for a rotary pressure filter. The device includes a stabilizer tank; a buffer tank connected to the stabilizer tank; a filter frame disposed beneath the buffer tank, and connected to the buffer tank; a liquid receiving tank disposed beneath the filter frame; an electronic balance disposed at bottom of the liquid receiving tank; and a seconds counter. The testing method includes adding a certain calculated amount of testing slurry into the filter frame, introducing a gas with a certain pressure into the stabilizer tank, filling the filter frame through the buffer tank, opening a valve at bottom of the filter frame, measuring a mass of the expelled filtrate expelled from the filter frame, measuring time of the filtering process, sampling and analyzing the filter cake and the expelled filtrate according to actual needs; and perform cleaning and drying processes sequentially. |
| US11099112B2 |
Dust measurement device and method
The present invention relates to a dust measurement device and method which can increase the accuracy of dust measurement by deriving a mass concentration on the basis of a number concentration distribution according to particle sizes. The dust measurement device of the present invention comprises: a charging unit for charging a feed material with electrical charges; a first dust collecting unit including a first and a second dust collecting electrode which are spaced apart from each other, through which the material passes, and to which different voltages are applied; a second dust collecting unit for collecting the material which has passed through the first dust collecting unit; a current measurement unit for measuring current flowing through the second dust collecting unit; and a control unit for calculating a mass concentration of the material by using the value of the current measured by the current measurement unit and adjusting voltages applied to the charging unit and the first dust collecting unit on the basis of the mass concentration. |
| US11099110B2 |
Method of in-situ TEM nanoindentation for damaged layer of silicon
A method of in-situ TEM nanoindentation for a damaged layer of silicon is disclosed. Wet etching and ion beam lithography are used for preparing a silicon wedge sample. An etched silicon wedge is thinned and trimmed by a focused ion beam; thinning uses ion beam of 30 kV: 50-80 nA, and trimming uses ion beam of 5 kV: 1-6 pA; and the top width of the silicon wedge is 80-100 nm. The sample is fixed on a sample holder of an in-situ TEM nanomechanical system by using a conductive silver adhesive. The sample is indented with a tip in the TEM, so that the thickness of the damaged layer of the sample is 2-200 nm; and an in-situ nanoindentation experiment is conducted on the damaged layer of the sample in the TEM. |
| US11099109B2 |
Fixative
A fixative for the preservation of organic tissue and cell aggregates, comprising a hydrophilic denaturant for structural change of the molecules of the organic tissue, a lipophobic solvent, in which said denaturant is dissolved, and an amphiphilic infiltration agent which is dissolved in the solvent for dissolving fats on the surface of the biological tissue in order to accelerate a penetration of the denaturant into the biological tissue. |
| US11099107B2 |
Component testing plan considering distinguishable and undistinguishable components
A component testing plan considers both distinguishable components and undistinguishable components for each of the distinguishable components. In addition to distinguishable and undistinguishable components, inputs to the system include a level of customer demand, using component-based demand forecasting, and what test types are to be performed. The system then determines a set of combinatorial test options for each of the test types and a cycle time for each combinatorial test option. The system then cognitively develops a component testing plan including a listing of combinatorial test(s) of the set of combinatorial test options for each test type to be performed and how many times to perform each combinatorial test(s) on a testing machine with a known capacity in order to minimize a total cycle time for all of the test types and a number of the testing machine needed; and implementing the component testing plan on a set of test components on a production line. |
| US11099105B2 |
Data processing method, data processing device, and non-transitory computer-readable recording medium having recorded thereon data processing program
A data processing method includes a period setting step of obtaining a rising period, a stable period, and a falling period with respect to time series data obtained in a substrate processing apparatus, an evaluation value calculation step of obtaining an evaluation value in the rising period, an evaluation value in the stable period, and an evaluation value in the falling period as an evaluation value of the time series data. In the period setting step, a period from when a control signal changes until the time series data falls within a first range including a target level is obtained as the rising period, a period from when the control signal changes until the time series data falls within a second range including an initial level is obtained as the falling period, and a period between the rising period and the falling period is obtained as the stable period. |
| US11099102B2 |
Misfire detection device for internal combustion engine, misfire detection system for internal combustion engine, data analysis device, and controller for internal combustion engine
A misfire detection device for an internal combustion engine is provided. A mapping takes time series data of instantaneous speed parameters as inputs. Each instantaneous speed parameter corresponds to one of a plurality of successive second intervals in a first interval. The instantaneous speed parameters correspond to the rotational speed of the crankshaft. The first interval is a rotational angular interval of the crankshaft in which compression top dead center occurs. The second interval is smaller than an interval between compression top dead center positions. The mapping outputs a probability that a misfire has occurred in at least one cylinder that reaches compression top dead center in the first interval. The mapping data defining the mapping has been learned by machine learning. |
| US11099098B2 |
Methods and systems for detecting fluidic levels and flow rate and fluidic equipment malfunctions
An improved sensor system is provided that monitors and controls a dendritic fluid system. A dendritic fluid system can include artificial components and/or natural components that carry fluid from a source to a destination through a series of paths. The sensor system can include magnetic field sensors, acoustic sensors, encapsulated sensor systems, pressure regulators, and valve controllers to monitor and control the dendritic fluid system. For example, magnetic field sensors, acoustic sensors, and/or pressure regulators can be used to measure the flow of fluid within a dendritic fluid subsystem and/or to detect potential leaks. The encapsulated sensor systems and/or valve controllers can be used to detect fluid levels in a contained system and control valves to adjust the fluid levels in the contained system to a desired level. |
| US11099093B2 |
Thermally-matched piezoresistive elements in bridges
A micromechanical pressure sensor for measuring a pressure differential includes a diaphragm having an inner region and two edge regions, one opposite the other with respect to the inner region. Two or more piezoresistive resistance devices are on the diaphragm, at least one in each of the inner and edge region, and are configured to be electrically connected in a bridge circuit. The micromechanical pressure sensor is configured so that an operating temperature of the one or more piezoresistive resistance devices in the inner region is substantially the same as an operating temperature of the one or more piezoresistive resistance devices in at least one of the edge regions throughout a full operating range such that an error of the micromechanical pressure sensor output resulting from self-heating is less than if the micromechanical pressure sensor were not configured to maintain the operating temperatures substantially the same. |
| US11099091B2 |
Advanced tire monitoring system
A tire pressure monitoring system comprising a tire pressure monitoring device for mounting on an internal surface of a tire and including a pressure sensor for monitoring the fluid pressure in the tire. The system has an RFID tag located on the tire separately from the tire pressure monitoring device. In response to detecting a tire pressure event from monitoring the fluid pressure of said fluid, the tire pressure monitoring device causes the RFID to transmit data, which is received by the tire pressure monitoring device. |
| US11099088B2 |
Strain torque measurement system
A torque sensor assembly is used with a driveline component. The torque sensor assembly includes a holder, a sleeve, and at least one strain sensor. The holder includes a side wall that has a holder outer surface and a holder inner surface. The holder outer surface is corresponding to and attached to an aperture of the driveline component. The sleeve is corresponding to and attached to the holder inner surface. The strain sensor is attached to the sleeve and used to sense a strain in the driveline component. |
| US11099085B2 |
Optic fibres and fibre optic sensing
Fiber optic cables with improved performance for use in distributed sensing, for instance in distributed acoustic sensors, are disclosed. In one embodiment a fiber optic cable (210) comprises a core (208) and cladding (206) disposed within a buffer material (202) surrounded by a jacket (204) and arranged so that the core is offset from the center of the cable. By offsetting the core from the center of the jacket any bending effects on the core can be maximized compared to the core being located at the center of the cable. |
| US11099077B1 |
Background subtracted spectrometer for airborne infrared radiometry
A background subtracted spectrometer for airborne infrared radiometry. The background subtracted spectrometer may comprise: a filter array, a detector, and a dewar containing liquid nitrogen. The filter array may be configured to selectively pass different spectral bands of infrared radiation. The filter array may comprise: at least one linear variable filter and a plurality of bandpass filters. The detector may comprise a focal plane array configured to receive the different spectral bands of infrared radiation simultaneously transmitted through the filter array. The detector may generate one or more electrical signals indicative of infrared radiation intensity as a function of wavelength. The filter array may be coupled to the focal plane array of the detector, and the filter array and detector may be conductively cooled by the liquid nitrogen to improve signal-to-noise ratio and spectral measurements. The background subtracted spectrometer preferably lacks a circular variable filter and relay lens. |
| US11099071B2 |
Imaging condition evaluation device and imaging condition evaluation method
An imaging condition evaluation device according to the present disclosure includes: a spectrometer configured to capture a spectral image under an arbitrarily set imaging condition; and an evaluation unit configured to set a first region and a second region different from each other in the spectral image, and calculate an evaluation value of the imaging condition based on an optical spectrum of the first region and an optical spectrum of the second region. |
| US11099066B2 |
Light detection systems having input and output modulators, and methods of use thereof
Systems for detecting light (e.g., in a flow stream) are described. Light detection systems according to embodiments include a photodetector, an input modulator configured to modulate signal input into the photodetector and an output modulator configured to modulate signal output from the photodetector. Photodetector arrays having a plurality of light detection systems, e.g., as described, are also provided. Methods for matching output signals from two or more photodetectors (e.g., a plurality of photomultiplier tubes in a photodetector array) are also described. Flow cytometer systems and methods for detecting light from a sample in a flow stream are provided. Aspects further include kits having two or more of the subject light detection systems. |
| US11099063B2 |
Apparatus and method for profiling a beam of a light emitting semiconductor device
Methods and apparatus (100) for profiling a beam of a light emitting semiconductor device. The apparatus comprises a light emitting semiconductor device (102) comprising an active region (108) formed on a substrate (104) and configured to generate light when a suitable electrical current is applied to contacts on an upper surface of the device and a light emitting surface (110) defined by a lower surface of the substrate opposite the contacts. The apparatus further comprises a transmission medium (112) comprising a first surface (114) in contact with at least part of the light emitting surface of the semiconductor device and a diffusion surface (116), opposite the first surface, and configured to diffuse light emitted from the micro-LED and transmitted through the transmission medium. |
| US11099062B2 |
Electronic device
An electronic device includes a device body, a screen, and a photo-sensing module. The screen is mounted on a front side of the device body. The photo-sensing module includes a light emitter and a light receiver. The light emitter is arranged obliquely relative to the screen, and a direction of the emitted light from the light emitter is tilted towards the side with the screen relative to the device body. |
| US11099059B2 |
Intelligent noise mapping in buildings
A method and a system for noise mapping in buildings, wherein a communication device is configured for determining the current noise level of a location in the building by an appropriate sensor of the communication device, wherein the communication device is further configured to communicate the noise level information and the location data to a computer system; wherein the computer system is configured for collecting and analyzing the received noise level information and the corresponding location data, and wherein the computer system is further configured to provide a noise heat map of the building. |
| US11099052B2 |
Low-cost measurement system using time domain reflectometry
A Time Domain Return measurement system for measuring liquid level, linear movement or other measurements which includes a first and second electrode, the second electrode spaced from the first electrode to define a gap, and an electronics assembly connected to the first and second electrodes equipped with a generator for transmitting an electromagnetic signal for propagation along the electrodes. The signal generator has a first analog timing circuit for actuating a slow-rising function of voltage versus time, a second analog timing circuit associated with the first analog timing circuit for actuating a fast-rising function of voltage versus time, and a receive circuit electrically connected to the electrodes, the receive circuit being activated for receiving return echo data associated with the electromagnetic signal transmitted when the fast-rising function is equal or greater than the slow-rising function to determine the position of the second medium with respect to the electrodes. |
| US11099050B2 |
Waveguide coupling for a fill level radar
A waveguide coupling for a fill level radar including a waveguide and a high-frequency chip, which projects at least in part into the waveguide and includes a coupling element for coupling the transmission signal into the waveguide. |
| US11099047B2 |
Liquid observation device
A liquid observation device having a clear body structure 1C which is a disc-like shape which on the top surface has a thumb support member 1A that includes symbol indicator marks 1B thereon, on the opposite side of the clear body structure 1C a mechanical seal surface 2B having a mechanical seal 2A thereto, which has threads 3A extending from the mechanical seal surface 2B to the bottom of the said clear body structure 1C which located on the bottom surface at the center a phosphorescent tube. member 5 having a vent hole 4 at the top, which extends vertically down from the clear body structure 1C, toward the end has tube indicator section 6 that extends in a downwardly-inclined outwardly spiral. The device is attached to the liquid storage vessel 8 by engagement of the threads in a clockwise direction which define matching threads and turned until the mechanical seal 2A is tight between the seal surface 2B and the liquid storage vessel 8, the phosphorescent tube member 5 indicator section 6 provides light and is submerged into the liquid 9, which the liquid 9 enters the tube entrance 7, the air vents out of the vent hole 4 permitting the liquid to rise up the tube that gives the observer visual observation as well as the liquid level in the liquid storage vessel which is observed through the clear body structure 1C, and by which the claimed invention functions. |
| US11099046B2 |
Monitoring apparatus for graphically displaying and indicating a history of integrated flow amount of gas flow meter
To provide an apparatus for monitoring a fluid flow rate, which is capable of performing monitoring without a data deficit, and displays information on a trend of a past history. A monitoring apparatus accepts, from the flow meter, integrated flow amount data for every day-and-time section, and a current flow rate, and graphically displays, on the basis of the integrated flow amount data for every day-and-time section, an integrated flow amount corresponding to each day-and-time section, on the basis of the integrated flow amount data for every day-and-time section including the current day-and-time and for every another plurality of continuous day-and-time sections. |
| US11099045B2 |
Gas flow meter for graphically displaying and indicating a history of integrated flow amount
In a temporally continued plurality of day-and-time sections, history data included in the past day-and-time section is graphically displayed on the basis of the integrated flow amount data stored in the storage unit, as an integrated flow amount in each day-and-time section. In the day-and-time section including the current day-and-time, the integrated flow amount in the day-and-time section based on the current integrated flow amount data is successively updated and graphically displayed. |
| US11099043B2 |
Determining a corrected measured flow rate
A method of determining a corrected measured flow rate is provided. The method includes measuring a flow rate with a first flow meter, measuring a flow rate with a second flow meter, the second flow meter being fluidly coupled to the first flow meter in series, and correcting the measured flow rate of the first flow meter with the measured flow rate of the second flow meter. |
| US11099042B2 |
Clamp-on ultrasonic flowmeter determining flow rate corresponding to phase velocity of low order asymmetric mode from plate wave generation
A clamp-on type ultrasonic flowmeter which is detachably attached to an outer wall of cylindrical piping is provided. An ultrasonic signal is transmitted to the piping from one of the first and the second ultrasonic devices, a plate wave corresponding to the ultrasonic signal is generated, and an ultrasonic signal corresponding to the plate wave is received by the other ultrasonic device. A pipe wall thickness of the piping and a frequency of the ultrasonic signal are in a state in which a plate wave of a low order asymmetric mode is significantly excited in the piping. A flow rate is calculated corresponding to phase velocity characteristics of the low order asymmetric mode. |
| US11099041B2 |
Information processing device and information processing method
An information processing device includes: a memory; and a processor configured to: decide an acquisition method of acquiring data using a sensor node; acquire measurement data measured at the sensor node and performance data relating to performance of the sensor node according to the decided acquisition method; determine a presence or absence of occurrence of an anomaly based on the acquired measurement data and/or the acquired performance data; and divide an appearance range of data values of the performance data into level ranges indicating a degree of quality of the data values and store the level ranges in a storage unit, wherein the processor is configured to decide a level range including a data value of the acquired performance data by referring to the storage unit, and decide the acquisition method based on a combination of the decided level range and the presence or absence of occurrence of the anomaly. |
| US11099038B2 |
Data logger and sampling and encoding methods for use in a data logger
A data logger (1) for logging values of a physical environment parameter (T) as a function of time (t) includes a sampling subsystem (2), which acquires sample values (21) of the physical environment parameter (T) at sampling moments which are separated by sample intervals, an encoding subsystem (3) which defines data records representing groups of one sample value (21) or a number of successive sample values (21) with variations which meet a first stability criterion, each data record including first identifiable bits (b10-b00) defining a representative value (Trep) for the samples values (21) of the corresponding group and second identifiable bits (b15-b12) indicating the number of samples in the corresponding group and a flag bit (b11) indicating the use of either the first or second interval length, and a memory subsystem (4) for storing the sequence of defined data records into a memory (7). |
| US11099037B2 |
Magnetic encoder and production method therefor
A magnetic encoder having a plurality of rows of magnetic tracks and capable of detecting an absolute angle is easily producible with higher accuracy. The magnetic encoder includes: a core member of annular shape having a bending plate portion that bends and extends from an edge of a track formation surface; and two or more rows of magnetic tracks arranged adjacent to each other on a magnetic member provided on the track formation surface, each track having N poles and S poles alternately magnetized thereon. The magnetic tracks include a main track that has a largest number of magnetic poles and is used for calculating an angle, and a sub track used for calculating a phase difference from the main track. The main track is located on a side closer to the bending plate portion than the sub track. |
| US11099036B2 |
360 degree position sensor
An accurate position sensor is presented. The sensor operates over 360-degree motion angular motion and includes a coil structure formed on a substrate and a target mounted to be angularly moved over the coil structure, the target being formed of a conducting material in a shape of a spiral of Archimedes. The coil structure includes coils with an arc sufficient to operate over a 360 degree motion of the target, for example between 120 degrees and 360 degrees. Some embodiments include coils with a 180 degree arc. A method of operating the position sensor includes rotating a target formed of a conducting material in a shape of a spiral of Archimedes over a coil structure and providing a linearized and calibrated response indicating the angular position of the target relative to the coil structure. |
| US11099035B2 |
Scanning unit for scanning an angular scale and angle-measuring device having such a scanning unit
A scanning unit for an angle-measuring device for scanning an angular scale, so that a relative angular position between the scanning unit and the angular scale about an axis of rotation can be determined, includes a substrate having a first surface, a detector configured to generate signals which are dependent on the angular position, evaluation electronics including electronic components surrounded by a potting compound, and an electrical interface configured to create a connection from the evaluation electronics to subsequent electronics. The detector, electronic components and electrical interface are disposed on the first surface of the substrate. The electronic components and the electrical interface are disposed further away from the axis of rotation than the detector. The potting compound is disposed on the first surface of the substrate circumferentially around the axis of rotation. |
| US11099033B2 |
Position detection system
A position detection system includes a first magnet, a first soft ferromagnetic member, and a magnetic detector. The first magnet is magnetized in a first direction and generates a first magnetic field including a first magnetic line. The first soft ferromagnetic member is rectilinearly movable along a second direction and includes a first outer edge having a first outer edge part remote from the first magnet by a first distance in a third direction and a second outer edge part remote from the first magnet by a second distance in the third direction. The first and second outer edge parts are disposed at different positions in the second direction. The magnetic detector is kept at a predetermined constant position relative to the first magnet. The first magnetic line passes through the magnetic detector in the first direction when the first soft ferromagnetic member is at rest. |
| US11099031B2 |
Methods and apparatus for determining the zero rate output of a sensor using a learning algorithm
Methods, apparatus, and systems for calibrating the Zero Rate Offset (ZRO) of a gyroscope are disclosed. |
| US11099025B2 |
Providing street-level imagery related to a ride service in a navigation application
An interactive two-dimensional digital map is provided via a user interface. A request to obtain travel directions to a destination is received. An indication of a ride from a pick-up location to a drop-off location to traverse at least a portion of the route is obtained from a third-party provider of a ride service. Street-level imagery for the pick-up location is obtained and displayed on the digital map. In response to detecting a selection of the street-level imagery via the user interface, the two-dimensional digital map is transitioned to an interactive three-dimensional panoramic display of street-level imagery. |
| US11099024B2 |
Systems and methods for route prediction
Predicting the future location of a user based on predicting the route that the user might take is disclosed. The routes used by the user in the past are indexed to generate a dictionary of routes which can be further augmented with contextual data. The prior routes are encoded within the dictionary such that each term representing a respective one of the prior routes comprises a collection of unique identifiers wherein each of the unique identifiers represents a segment of the respective one of the prior routes. Techniques of text prediction, term frequency for dictionary scores and other language processing techniques are used to predict the further route of the user. |
| US11099023B1 |
Intermediate navigation destinations
Navigation applications may utilize various different data sources to provide route information. In one example, a method of operation may include receiving at least one destination and creating a navigation route from a current location to a final destination, retrieving a plurality of user characteristics and a plurality of user preferences from at least one of a local memory of a user device and a remote memory of a remote device, modifying the navigation route to include intermediate routes based on the plurality of user characteristics and the plurality of user preferences, and transmitting a notification to a user device comprising at least one suggestion for an intermediate route. |
| US11099022B2 |
Vehicle reach area presentation device and vehicle reach area presentation method
A vehicle reach area presentation device sets a unit area in which a start point exists as a start area among unit areas into which a region on map data is divided and extracts pieces of probe data including records of past travels within a certain range from the start area. The device sets the unit areas, including goal points recorded in the extracted pieces of probe data, as reach areas, calculates energy consumptions from the start area to the reach areas by using the pieces of probe data, and presents the reach areas to a user while changing display of the reach areas depending on the calculated energy consumptions. |
| US11099020B2 |
Method and apparatus for optimizing intermodal route computations
An approach is provided for optimizing intermodal route computations. A routing platform retrieves shared vehicle availability data associated with one or more modes of transport for geographic areas. The routing platform further processes the shared vehicle availability data to determine a shared vehicle availability pattern for each geographic area. The routing platform further generates, based on the shared vehicle availability pattern, an intermodal vehicle availability model indicating a combination of modes of transport for each geographic area, wherein the geographic areas are selectively excluded from computations to generate an intermodal route. The routing platform further provides the intermodal vehicle availability model as an output for generating the intermodal route. |
| US11099019B2 |
Network system to compute and transmit data based on predictive information
A method and system for arranging service provider selection are described. A network computer system can establish a set of criteria to determine whether to display, before actually receiving an acceptance from a service provider, an assumed acceptance or a likely service provider to provide on-demand services in response to data corresponding to a request for service sent from a computing device of a user. For example, the network computer system can predetermine a likely service provider or number of matching service providers and display this information to the user in lieu of a “requesting” screen. |
| US11099016B2 |
System and method for generating pedestrian tours
Generating a pedestrian tour includes: receiving a query from a user device via a network, the query indicative of a request for a pedestrian tour and including a location and preferences including a target length for the pedestrian tour; obtaining a graph of a geographical area around the location of the user device, the graph including nodes indicative of path crossings and arcs indicative of paths connecting pairs of the nodes; determining scores for the arcs based on characteristics of the arcs, respectively, and the preferences; selecting connecting ones of the arcs based on the scores of the connecting ones of the arcs, lengths of the selected connecting ones of the arcs, and the target length; adding the selected connecting ones of the arcs to the pedestrian tour to initialize the pedestrian tour; and transmitting the pedestrian tour to the user device via the network for display. |
| US11099015B2 |
Management system of substitute parking service, method of assisting use of substitute parking service, and non-transitory computer-readable storage medium storing management programs
A management system that manages substitute parking service in which a substitute driver parks a vehicle of a service user, in place of the service user, includes a processor configured to generate path information indicating a path from a delivery location of the vehicle to a parking lot in which the vehicle is allowed to be parked, based on information indicating the delivery location, and information indicating a position of the parking lot, and the processor being configured to transmit the path information to a terminal of the service user. |
| US11099014B2 |
Chip module, signal processing method, and electronic equipment
The present technology relates to a chip module, a signal processing method, and electronic equipment that are aimed at enabling a change before and after mounting a module to be debugged and enabling a mounting module to be easily designed. A gyro module includes a MEMS that is formed into a chip and an IC that processes a detection signal from the MEMS, which are arranged above and below. The IC has a temperature sensor and stress sensor that detect an external environment within the IC in plurality and outputs difference values obtained by subtracting reference sensor values that are sensor values of the temperature sensors and the stress sensors at the time of calibration from sensor values detected by a plurality of the temperature sensors and the stress sensors respectively. The present technology can be applied, for example, to the gyro module or the like. |
| US11099011B2 |
Measurement of material dimensions
The invention relates to a method for determining material dimensions of a longitudinal profiled section (2) during a sawing process, in which a saw blade (3) is advanced, the longitudinal profiled section (2) being machined by said saw blade (3) along a saw groove during this time; advancement position data of said saw blade (3) along the advancement path (s) being determined and, during this sawing operation, additional measurement data being determined from the group of sawing force (Fs) or another variable which corresponds to the sawing force (Fs). The invention is characterised in that an actual profile is determined from the advancement position data and said additional measurement data. |
| US11098999B2 |
Cascade Fourier domain optical coherence tomography
A cascaded interferometric system for Fourier domain optical coherence tomography (OCT) in which the output of one sub-system interferometer is directed through a second sub-system interferometer for performing the Fourier transform in hardware. |
| US11098992B2 |
Method of making polymer ammunition cartridge having a two-piece primer insert
The present invention provides ammunition cartridge having a two piece primer insert with a flange, a polymeric middle body extending from the primer insert to a cylindrical middle body coupling region, and a polymeric projectile end having a projectile aperture mated to the polymeric middle body. |
| US11098979B2 |
Retaining mechanism for a holster
A retaining mechanism for a holster includes a body (18) mountable to or integral with a holster, and a hood unit (40) rotatably mounted to the body. The hood unit configured for rotation about a first axis between a retaining condition in which it overlies a service item in the holster to prevent its withdrawal and a retracted condition in which the service item can be withdrawn. A hand-operable lever assembly (60) is rotatably mounted to the body and configured for rotation about a second axis. The lever assembly is operably engageable with the hood unit whereby rotation of the lever assembly effects rotation of the hood unit to its retracted condition and vice versa. The lever assembly includes a first, deflectable, portion (70) and a separate second, depressible, portion (80). These first and second portions are respectively selectively deflectable and depressible against respective first and second restoring bias forces to disengage the lever assembly from a lock formation (128) configured to lock the lever assembly against rotation and thereby the hood unit against rotation to its retracted condition.Also disclosed is a blocking element (160) moveable from a position in which it impedes or obstructs the lever assembly. In another aspect, a portion (150) of the lever assembly is releasable restrained between a portion (128) of the hood unit and a portion (110) of the body. |
| US11098976B2 |
Airgun projectile carrier
Projectile carriers are provided. In one aspect, a projectile carrier has a storage area with a breech opening and a bolt opening aligned with the breech opening along a first axis, a plurality of projectile drivers positioned in the storage area are biased to move in a first direction within the storage area along a path that passes between the breech opening and the bore opening. A stop is positioned to stop movement of the projectile drivers in the first direction when one of the projectile drivers is positioned substantially aligned at the first axis. The projectile drivers have a block that prevents a projectile from exiting the bolt opening. The projectile drivers are sized and can be moved in a second direction to allow a bolt to drive a projectile along the first axis through the breech opening. |
| US11098971B2 |
Muzzle brake
A muzzle brake for a firearm provided herein generally includes a housing having a chamber and an insert removably couplable to the housing such that the insert is interchangeable depending on the caliber of projectile. The insert includes a body with a central bore defining a projectile axis, the central bore at least partially extending toward an end of the housing within the chamber. The muzzle brake may further include a first lateral port extending from the chamber through the housing and be configured to expel combustion gases away from the housing and a first baffle projecting radially from the body and disposed at a location along the body configured to direct a portion of the combustion gases toward the first lateral port. The muzzle brake may further include an upward port configured to expel combustion gases in direction to counteract muzzle lift of the firearm. |
| US11098968B1 |
Slide lock-back follower assembly
This disclosure describes systems, methods, and apparatus for a follower assembly comprising one or more dummy cartridges, the first thereof comprising an angled follower platform that when pressed between the follower spring and a final live cartridge in the magazine, rotates to a first side of the magazine and enhances follower interaction with a slide lock mechanism. The follower platform may also be angled back to front to further enhance this interaction. The follower platform may include a protruding heel extending laterally from a front portion of the first side of the follower platform configured to interface with the slide lock mechanism. A rear stop may extend from a rear portion of the first side and interface with a downward-facing surface of the magazine near the feed end, wherein contact between these two surfaces causes a front end of the first dummy cartridge to rotate upward. |
| US11098961B2 |
Dual loop cooling system energy storage and reuse
Methods and systems are provided for a dual loop coolant system used to control an engine temperature. In one example, cooling capacity is transferred from a low temperature loop to a heat exchanger, and cooling capacity stored in the heat exchanger is transferred to a high temperature loop (e.g., an engine coolant loop). The flow of coolant from the dual loop coolant system to the heat exchanger may be regulated responsive to a temperature of the coolant in each of the low temperature loop and the high temperature loop. |
| US11098957B2 |
Loop-type heat pipe
A loop-type heat pipe includes an evaporator configured to vaporize an operating fluid, a condenser configured to liquefy the operating fluid, a liquid pipe configured to interconnect the evaporator and the condenser, a steam pipe configured to interconnect the evaporator and the condenser and to form a loop together with the liquid pipe, a porous body provided in the liquid pipe and configured to retain therein the liquid operating fluid, and a solid columnar support provided in the liquid pipe and configured to guide the operating fluid liquefied by the condenser to the porous body. At least one first groove is formed at a side surface of the columnar support. |
| US11098949B2 |
Refrigerator appliance having USB features
A refrigerator appliance having Universal Serial Bus (USB) features is provided. In one aspect, a refrigerator appliance has a cabinet defining a chamber. At least two shelf mounting tracks are disposed within chamber. A shelf having a USB port is mountable to the shelf tracks. The shelf tracks each include at least two bus bars. One bus bar is charged with a power charge, one is charged with a ground charge, one is charged with a positive data charge, and one is charged with a negative data charge. When the shelf is mounted to the tracks, the bus bars are in electrical communication with the USB port of the shelf such that data transmissions can be routed between the USB port and a controller or some other processing device. In another aspect, a refrigerator appliance includes features for enabling USB data transmissions to a bin mounted in a door thereof. |
| US11098948B2 |
Water dispensing system
A refrigerator water dispenser includes a shelf having a lower surface. A water dispenser tube is disposed adjacent to the shelf for dispensing water into a container. An actuator support is operably coupled to the lower surface of the shelf. A load cell is disposed on the actuator support, wherein the load cell sends a signal in response to movement by the actuator support. A controller is operably coupled to the load cell, wherein the controller activates a water dispensing sequence to dispense water via the water dispenser tube in response to the signal from the load cell. |
| US11098947B2 |
Refrigerator and manufacturing method therefor
Disclosed is a refrigerator including an ultrathin wall-type insulating wall of which the thickness is made to be thin so as to increase the capacity of a storage chamber, while maintaining heat-insulating performance. A vacuum insulating material, provided inside the insulating wall, is provided so as to come into contact with an outer chamber such that the length between the outer chamber and an inner chamber is reduced. In addition, a foam material, which is formed by being foamed between the inner chamber and the outer chamber and is provided between the vacuum insulating material and the inner chamber, is formed to have a thin thickness so as to reduce the total thickness of the insulating wall, thereby increasing the capacity of the storage chamber and enabling the refrigerator to have a slim design so as to improve the aesthetics of the refrigerator. |
| US11098945B2 |
Refrigerator door and manufacturing method of the same
A refrigerator door and a manufacturing method of the same are disclosed. The refrigerator door includes a front panel that includes a first through hole and an input unit, a door liner, an upper cap decoration unit configured to seal an upper side of a first space defined between the front panel and the door liner, a frame attached to an inside of the front panel and defining a second space, a display assembly provided between the frame and the front panel and configured to emit light through the first through hole, and a touch sensor assembly provided between the frame and the front panel, the touch sensor assembly being fixed to a rear of the front panel at a position that corresponds to a location of the input unit. The upper cap decoration unit includes a communication hole for communicating with the second space and includes a cap cover. |
| US11098940B2 |
Flexible container with ice tray
An ice-making container having a base and a freestanding side extending from the base to define a mouth opposite the base, and having a divider extending from the base and/or freestanding side so as to divide the container into at least two ice-making compartments. The container is a closable container via zipper members extending from the interior sides of the mouth, wherein the mouth is deformable between open and closed configurations and the first and second zipper members are disengagable when the mouth is open and engagable when the mouth is closed. The container may be molded from platinum silicone as a unitary whole without assembled parts. The molding process may comprise liquid injection molding, compression molding, or transfer molding. |
| US11098939B2 |
Ice maker for a domestic refrigeration appliance with an ejection unit and a twisting apparatus, domestic refrigeration appliance and method
An ice maker for a domestic refrigeration appliance has an ice tray with at least one cavity for holding and freezing liquids to form a shaped ice element. An ejection unit ejects the shaped ice element from the cavity. A drive apparatus performs a relative rotational movement between the ice tray and the ejection unit to eject the shaped ice element from the cavity. The ice maker has a twisting apparatus that is coupled to the ice tray and that can be used to twist the ice tray around to release a frozen shaped ice element in the cavity. There is also described a domestic refrigeration appliance with the ice maker and a method for ejecting shaped ice elements from the ice tray. |
| US11098937B2 |
Refrigerator
To facilitate replacement or repair of a sensor for refrigerant leakage detection used for a refrigerator for a storage box such as a container in case of breakdown, a sensor for refrigerant leakage detection is disposed outside of an internal space of a storage box, and an internal air guide passage is provided which guides internal air from a discharge side of a fan provided in the internal space of the storage box to the sensor for refrigerant leakage detection. |
| US11098935B2 |
Method for operating an air-conditioning system of a motor vehicle
A method for operating an air-conditioning system of a motor vehicle, wherein the air-conditioning system comprises a refrigerant circulation and a water circulation which are thermally coupled with one another across a condenser/gas cooler. Water circulation flows through the condenser/gas cooler at a low volumetric rate of flow and a high temperature difference so the water circulation transfers heat in the heating heat exchanger to the air in a similar temperature range. Refrigerant circulation cools from 65° C. to 70° C. to −10° C. to +30° C. and water circulation raises to a temperature of 55° C. to 65° C. and that an adaptation of the temperature profile of the water circulation to the temperature profile of the refrigerant circulation takes place in the condenser/gas cooler utilizing a temperature glide of the refrigerant. The refrigerant is significantly cooled. |
| US11098933B2 |
Direct heat exchange system
A direct heat exchange system uniformly transfers heat through a multiphase substance, such as a refrigerant, to a barrier that emits heat radiantly and convectively. The system solely uses the multiphase substance to exchange heat between the multiphase substance and the barrier. No intermediary fluids are used. A heat exchange portion, such as a heat pump, absorbs and emits heat and transfers it to the multiphase substance. A tube portion carries the multiphase substance to the barrier. The heat is directly exchanged between the tube and the barrier. The barrier emits radiant heat or absorbs heat. A tube fastener fastens the tube to the barrier. A thermal mass portion stores heat behind the barrier. A dehumidification coil helps prevent indoor condensation and tempers the temperature of the air proximal to the barrier by drying the air. A decorative panel covers the tube portion and the thermal mass portion. |
| US11098927B2 |
Distributor, heat exchanger and refrigeration cycle apparatus
A distributor includes: a fluid inlet; a plurality of fluid outlets; a distribution flow passage which causes the fluid inlet to communicate with the fluid outlets, and distributes fluid which flows into the distribution flow passage through the fluid inlet, among the fluid outlets; and a plurality of heat-transfer-tube insertion portions each formed to face an associated one of the fluid outlets, the heat-transfer-tube insertion portions allowing heat transfer tubes to be inserted therein. The heat transfer tubes are inserted in the heat-transfer-tube insertion portions such that an end portion of each of the heat transfer tuber is connected to the associated fluid outlet. |
| US11098926B2 |
Self-contained in-ground geothermal generator and heat exchanger with in-line pump used in several alternative applications including the restoration of the salton sea
Provided here is a system and method for harnessing geothermal energy for generation of electricity by using complete closed loop heat exchange systems combined with onboard drilling apparatus. The system includes several devices operating separately in many different applications in energy sectors, including Self Contained In-Ground Geothermal Generator; the Self Contained Heat Exchanger; the In-Line-Pump/Generator; and preeminent drilling system for drilling wider and deeper wellbores. The system can be used for harnessing heat from accessible lava flows; harnessing the waste heat from the flame on top of flares stacks and similar cases. Also, included is an architectural solution for the restoration of the terminal lake, the Salton Sea, an area of prevalent geothermal sources, including dividing lake in three sections and importing seawater in central section with pipeline system; providing condition for tourism; treating farmland runoff waters; generating electricity including solar energy; and producing potable water and lithium as byproducts. |
| US11098925B1 |
End seals for parabolic trough solar collectors and a parabolic trough solar collector
An end seal arrangement for a Parabolic Trough solar Collector, PTC, comprises an elongated parabolic reflector trough and a receiver pipe arranged at a focus-line of the reflector trough. The end seal arrangement comprises a housing configured to be fixated to one short-end of the reflector trough, and an inlay configured to be inserted in the housing to slidably abut a circumference of the receiver pipe, such that the reflector trough is sealed to the receiver pipe by the inlay when the housing is fixated to the short-end of the reflector trough and the reflector trough pivots about its focus-line. The end seal arrangement further comprises a fixation means configured to fixate the housing to the reflector trough. By reducing heat leakage and prevent ice, snow, sand, etc. from deteriorating the reflector, improved operational performance will be achieved. |
| US11098923B2 |
Electric radiator
An electric radiator is provided. The electric radiator includes: a housing provided with an air channel cover therein; a heating assembly disposed in the housing and defining a natural convection air channel with the air channel cover, an air supply inlet being formed at a first end of the natural convection air channel and an air supply outlet being formed at a second end of the natural convection air channel above the air supply inlet, air in the natural convection air channel being heated by the heating assembly to form a natural convection in the natural convection air channel; a mesh hood mounted onto a front surface of the housing and covering the heating assembly and the air supply outlet; a first temperature limiter mounted onto the heating assembly and adjacent to the air supply outlet in an up-down direction. |
| US11098914B2 |
System and method for operating a HVAC system by determining occupied state of a structure via IP address
A system and method for operating an HVAC system based on the occupancy of a structure, wherein occupancy of the structure is determined by a remote occupancy identifier, the occupancy identifier configured to determine the occupancy of the structure by detecting if a user device is connected to a network within the structure, the occupancy identifier further configured to change at least one operational parameter setting of the HVAC controller depending on whether the structure is currently occupied or not. |
| US11098912B1 |
System and method for energy use control in an environmental control system
Provided is a method in a control system that is configured to provide command information to environmental adjustment equipment. The control system includes a plurality of user interface devices wherein each user interface device is configured to select an operating mode for a plurality of monitored areas in a building and wherein each user interface device is located in a different one of the monitored areas. The method comprises detecting a mode change request at a first user interface device for a first monitored area and executing the mode change request for the first monitored area while retaining a prior selected mode for another monitored area that was selected using a different user interface device when for each monitored area the environmental adjustment equipment includes a throttling device for controlling the flow of conditioned medium provided to the monitored area. |
| US11098908B2 |
Construction method and design method of air-conditioning system
In a construction method of an air conditioning system, the respective rooms are provided with air intake sections 9a to 9d, 18a to 18d which spout air sent from blowers 40a to 40d, 41a to 41d, an exhaust section 52 which forms discharged air current directed from the respective rooms toward the return compartment is provided between the respective rooms and the return compartment, and the plurality of blowers 40a to 40d, 41a to 41d and at least one air conditioner are disposed in the return compartment. Air discharged from the plurality of rooms in the building 1 by the air conditioner 30b operated by the return compartment is adjusted in temperature and moisture in the return compartment, and wind is sent into the plurality of rooms in the building 1 by the blowers 40a to 40d, 41a to 41d, and air conditioning in the building 1 can be performed. |
| US11098907B1 |
Apparatus and method for containing and recovering residue from a kitchen ventilation system
A containment apparatus, kit and method for containing liquid waste when cleaning a kitchen ventilation system wherein the containment apparatus includes a funnel that is removably attachable to an attachment device on a kitchen ventilation hood. |
| US11098905B2 |
Hob with overheat control device
If hobs are integrated into built-in furniture, care must be taken to ensure that during operation the temperature in or on the built-in furniture does not exceed permissible limit values. It is proposed to fasten a temperature sensor in the hob housing by means of a heat-conducting retaining element. The retaining element is arranged on the hob housing such that essentially the heat output into the worktop is transmitted via the retaining element to the temperature sensor. |
| US11098904B2 |
Dual coil electric heating element
An embodiment of an electric heating element is disclosed, including an electrically resistive inner heating element, an electrically resistive outer heating element, and a thermostat positioned along a cold leg of the inner heating element. The thermostat is configured to selectively allow electrical current to be delivered to the inner heating element while maximum electrical current, for example, continues to be provided to the outer heating element. The thermostat cycles the electrical current on and off when detecting maximum and minimum desired temperatures radiated from the electric heating element. The inner heating element has a pair of cold legs that extend parallel to a pair of cold legs of the outer heating element, some or all of which may be supported by a terminal bracket. |
| US11098903B2 |
Bezel coupling system with better alignment to knobs applied for cooking products
Aspects of the present disclosure relate to the technological field of cooking devices, and more particularly to a cooking device that includes a surface having an opening and a gas flow control valve including a rod that extends through the opening of the surface. A knob may be arrayed on the surface to cooperate with the rod. A frame-plate may be arrayed between the knob and the surface. The frame-plate includes a central orifice that allows passage of the rod there through and is rotatable around the rod to align the frame-plate relative to the surface. |
| US11098899B2 |
Panel burn through tolerant shell design
A dual wall liner for a gas turbine engine may comprise a shell having a first side and a second side, a panel contacting the shell, the panel at least partially defining a hot gas path through which a hot gas flows, wherein the first side of the shell faces the panel, wherein the shell includes a thermal barrier coating (TBC) disposed on the first side of the shell. The TBC may thermally protect the shell from heat from a hot gas path. |
| US11098896B2 |
Burner with fuel and air supply incorporated in a wall of the burner
A burner of a turbomachine has an upstream burner section providing a first fuel and an oxygen containing fluid to an upstream end of a burner interior, a downstream burner section for providing a second fuel to a downstream end of the burner interior, and an intermediate burner section between the two sections. The intermediate burner section has an annular wall surrounding a mid-section of the burner interior. The annular wall has an annular cooling fluid passage, for guiding the oxygen containing fluid, and an annular fuel passage for guiding the second fuel to the downstream burner section, the annular fuel passage being more distant to the burner interior than the annular cooling fluid passage. Two annular slots are incorporated into the annular wall. The upstream burner section has at least one integrated fuel tube through a body of the upstream burner section, configured to feed the annular fuel passage. |
| US11098894B2 |
Multifunctional fluidic burner
A burner that is useful for providing a melting flame whose axis can be altered during operation, and for providing a supersonic jet of oxidant that can penetrate through the surface of the molten material, has a unique combination of features including a specially contoured flame collar at its open discharge end. |
| US11098891B2 |
Additional primary air access for surface gas burners
A gas burner unit for a cooktop includes a spreader having a first side with a plurality of gas outlets and a second side opposite the first side and defining a portion of a fluid path. The spreader further defines a venturi in fluid communication with the gas outlets and extending away from the second side. The gas burner unit further includes an orifice holder having a protrusion defining an upwardly directed primary air inlet therethrough. The upwardly directed primary air inlet is in fluid communication with the fluid path associated with the spreader on a first end thereof and with the venturi on a second end thereof opposite the first end. |
| US11098888B1 |
Charger plate with interchangeable décor ring
A charger plate apparatus comprises a charger plate, an interchangeable decorative ring, and a ridge formed on the charger plate, wherein the interchangeable decorative ring can be secured by the ridge on the charger plate. |
| US11098885B1 |
Lighting apparatus
A lighting apparatus includes a first light source, a first light housing, a second light source and a second light housing. The first light housing is for disposing the first light source to emit a first light from a first direction via a first light opening. The second light housing is for disposing the second light source to emit a second light from a surrounding lateral wall of the second light housing. An angle between the first light direction and a radial direction of the surrounding lateral wall is between 60 degrees to 150 degrees. An inner wall of the second housing is surrounding and fixed to a neck portion of the first light housing. |
| US11098883B2 |
Lamp base with adjustable illumination angle
A lamp base includes a lamp body, a ring frame and a circumferential projection component. The lamp body includes an illuminating component, a ring frame and a circumferential projection component. The ring frame surrounds the lamp body. Such that the lamp body is seated within the ring frame. The ring frame also rotates relative to the lamp body along a rotational axis of the lamp base. The circumferential projection component has an inner circular through hole to allow the lamp body to pass through. The circumferential projection component detachably and rotatably engages with the ring frame. The lamp body rotates relative to at least one of the ring frame and the circumferential projection component along the rotational axis, so as to adjust an illumination angle of the illuminating component. |
| US11098882B2 |
Lamp easy to replace and lamp string structure
This invention is easy to change lamp and a light string structure and it is easy to change lamp comprises lampshade lamp tube and lamp holder lamp holder. A light bunch structure comprises power supply line and a plurality of the lamp has a plurality of lead are connected on the power line power source line of the two ends are respectively fixedly connected with the inserting a front and tail socket a sleeve is set with a front insert tail insert a screw cap is set on the upper cover and tail socket a matched with the tail cap. |
| US11098880B2 |
Luminaire with improved assembly, installation, and wireless functionality
A luminaire assembly includes a frame and a back plate. In some examples, the frame includes a lip, and the back plate includes a tab. The back plate is positionable within a housing area of the frame such that the tab is engaged with the lip and the back plate is retained within the frame. In other examples, a luminaire assembly includes a wireless module with an antenna positioned adjacent to a module opening of the back plate. The antenna provides wireless transmissions above the top side of the back plate and below the bottom side of the back plate. A luminaire support clip for a luminaire assembly includes a base and a tab. The tab and the base define a receiving area, and the luminaire support clip receives a portion of an edge of a back plate of the luminaire assembly within the receiving area. |
| US11098876B2 |
LED decorative lamp
An LED decorative lamp includes a support frame, a light source, and a bendable reflection assembly. The support frame is a hollow annular structure. The light source is used to emit light and is arranged in the support frame. The bendable reflection assembly is used to reflect light from the light source and is arranged on the support frame and connected to the light source. |
| US11098872B2 |
Vehicle luminaire and vehicle lamp
A vehicle luminaire according to an embodiment includes: a socket; and a light-emitting module which is provided at one end side of the socket. The light-emitting module includes: at least one light-emitting element; a first transistor of which a source is electrically connected to a cathode of the light-emitting element; a negative characteristic thermistor which is electrically connected to a gate of the first transistor; a positive characteristic thermistor which is electrically connected to the gate of the first transistor or a drain of the first transistor; and a second transistor of which a collector is electrically connected to the gate of the first transistor, a base is electrically connected to the drain of the first transistor, and an emitter is electrically connected to an output terminal. |
| US11098869B2 |
Lamp device
An object is to provide a lamp device which can be used as vehicle use headlight, and can form light distribution pattern capable of suppressing generation of dark grids in the field of view. A lamp device is provided which comprises a light source in which a plurality of light emitting elements are regularly arranged in a plane, and the light emitting elements are distributed along a first direction and along a second direction crossing the first direction in the plane, a projecting optic system capable of forming images of the respective light emitting elements of the light source on an image plane located on an optic axis of light beam emitted from the light source, and an image shifter capable of forming basic image of the plurality of light emitting elements on an image plane, and simultaneously forming first moved image which is formed by moving the basic image along the first direction and along the second direction simultaneously on the image plane. |
| US11098868B2 |
Lighting device
A lighting device includes light emitting element; first lens that receives light emitted from light emitting element and emits first emission light; and second lens that receives the first emission light and emits second emission light. Second lens includes second convex incident surface receiving the first emission light, second convex emission surface that is provided on a right side of a drawing and emits the second emission light, and second top surface portion and second bottom surface portion each located between second incident surface and second emission surface. Second bottom surface portion includes first inclined surface and second inclined surface formed to be inclined with respect to an optical axis of light emitting element. |
| US11098867B2 |
Light fixture and method for operating said light fixture
A light fixture may include a light source assembly configured to generate visible light radiation of different colours, an optical device configured to process at least a portion of the light radiation emitted by the light sources so as to form a light beam extending substantially along an optical axis, and at least one beam processing element located downstream of the optical device and configured to selectively intercept the light beam. The beam processing element may include at least one portion movable between several positions. The light fixture may include a control device configured to control the light source assembly either on the basis of the position of a movable portion of the beam processing element or on the basis of a parameter correlated to the position of the movable portion of the beam processing element. |
| US11098865B2 |
Light source, solar cell complex and lighting system including the same
According to an embodiment, a light source-solar cell complex comprises a plurality of layers receiving light to generate current or receiving power to emit a preset wavelength band of light and a plurality of connectors grown between the layers and transferring the current generated from the layers to an outside or transferring power from the outside to each layer. |
| US11098856B2 |
Narrow collimating and diffusing optic system for LED lighting
Systems and methods for narrow collimating and diffused lighting, such as narrow collimating and diffused linear LED lighting. In one embodiment, a stacked arrangement including an optical sheet is arranged to receive a light pattern from a LED light to produce a narrower light pattern with diffusion. In one aspect, the optical sheet is a lenticular sheet of microscopic lines. |
| US11098853B1 |
Pipeline supplemental containment wall systems and methods
In one embodiment, a pipeline system includes a pipe fitting to be secured to a pipe segment including tubing that defines a pipe bore and a fluid conduit implemented in a tubing annulus of the tubing, in which the pipe fitting includes a fitting grab notch implemented on an outer surface of the pipe fitting, and a supplemental containment wall assembly to be deployed at the pipe fitting. The supplemental containment wall assembly includes a containment wall shell to be secured circumferentially around the pipe fitting to define a fitting annulus that is sealed at least between the outer surface of the pipe fitting and an inner surface of the containment wall shell to facilitate providing multi-wall containment in the pipeline system and a shell grab tab implemented on the inner surface of the containment wall shell, in which the shell grab tab matingly interlocks with the fitting grab notch on the outer surface of the pipe fitting to facilitate securing the containment wall shell to the pipe fitting. |
| US11098851B2 |
High-pressure tank and attachment structure thereof
A high-pressure tank includes: a liner made of resin and including a tubular body portion and a pair of dome-shaped side end portions provided in the opposite ends of the body portion; and a fiber reinforced resin layer made of a fiber reinforced resin and covering an outer peripheral surface of the liner. The fiber reinforced resin layer is formed by winding a fiber bundle impregnated with a resin, and an outer peripheral surface of the fiber reinforced resin layer is covered with a resin layer made of a resin. A part of the fiber reinforced resin layer includes a protrusion portion by continuously winding the fiber bundle in an overlapped manner along the circumferential direction of the body portion the part of the fiber reinforced resin layer covering the body portion. |
| US11098850B2 |
Storage tank containment system
A large volume natural gas storage tank comprises rigid tubular walls having closed tubular cross-sections that are interconnected at opposing ends with two other rigid tubular walls such that interiors of the rigid tubular walls define an interior fluid storage chamber. The storage tank also includes bulkheads positioned in the interior fluid storage chamber across intermediate segments of the rigid tubular walls and closure plates connected between exterior surfaces of successive interconnected rigid tubular walls to define sides of the storage tank. Interior surfaces of the closure plates and exterior surfaces of the rigid tubular walls define an auxiliary fluid storage chamber. The storage tank also includes exterior support structures extending through the closure plates and between the exterior surfaces of the rigid tubular walls on some of the sides of the storage tank to reinforce the storage tank against dynamic loading from fluid in the interior fluid storage chamber. |
| US11098849B2 |
Detection systems for power tools with active injury mitigation technology
Power tools with conductive couplings used with active injury mitigation technology are disclosed. Conductive couplings are particularly relevant to table saws, hand-held circular saws, track saws, miter saws, and band saws with active injury mitigation technology. Conductive couplings provide a mechanism through which an electrical signal can be coupled or imparted to a blade, and then monitored for changes indicative of human contact with the blade. An exemplary conductive coupling includes a brush that establishes an electrical connection with a moving part of a power tool, and the brush maintains contact with the moving part of the power tool during at least 40 hours of cumulative time when the motor is spinning the arbor and blade without an interruption in the electrical connection sufficient to trigger the reaction system. A conductive coupling may be two-sided compliant. A conductive coupling may connect to a motor shaft to minimize electrical noise. |
| US11098848B2 |
System for distributing semisolid lubricant and method of controlling such a system
A system for distributing semisolid lubricant, including a semisolid lubricant tank and a high pressure pumping system that intermittently feeds, during a lubrication cycle, at least one first duct, the at least one first duct feeding a plurality of distributors adapted to sort the semisolid lubricant to a plurality of users; a controlled suction/delivery device, fluidly associated with the first duct, for controlled suction/delivery of a part of the semisolid lubricant conveyed by the first duct. The controlled suction/delivery device configured to suck a volume of semisolid lubricant from the first duct during a step of inactivity of the pumping system on the first duct, and to introduce the previously suctioned semisolid lubricant in the first duct during a step of activity of the pumping system on the first duct. |
| US11098847B2 |
Grease gun with an adjustable operating angle
A grease gun with an adjustable operating angle includes: a grease barrel having a first annular assembling portion and a first annular pivot portion; a gun body having a second annular assembling portion facing the first annular assembling portion and a second annular pivot portion to be pivotally disposed on the first annular pivot portion; a positioning ring fixed to the second annular assembling portion and having annularly arranged positioning cavities and facing the first annular assembling portion; and a positioning unit having a positioning member movable between a locked position and a release position, and the positioning member having a positioning portion to be inserted into or disengaged from the positioning cavities. The grease barrel and the gun body can be rotated and fixed relative to each other after rotation to adjust the angle between the two, which consequently reduces the space limitation on the grease feeding operation. |
| US11098844B1 |
Wall mount assembly
A wall mount assembly includes a case body, a latch member, a fixing plate, and a fixation member. A slit is formed on a rear surface of the case body. A first fixation hole is formed on an outer peripheral surface of the case body and communicates with the slit. The latch member is disposed on the rear surface. The fixing plate includes a latch hole and a lug. The latch member passes through the latch hole and engages with the fixing plate. The lug is inserted into the slit. When the latch member is located at a closed end of a sliding slot portion of the latch hole, a projection of the first fixation hole on the lug overlaps a second fixation hole of the lug. The fixation member is inserted into the first and the second fixation holes from the outer peripheral surface. |
| US11098837B2 |
Fitting element for use in rehabilitation of pipelines and method for producing the same
A fitting element for use in rehabilitation of pipelines with a liner. The fitting element is a composite article of reinforcing fibers and a resin composition. A first part of the fitting element has reinforcing fibers and a substantially fully cured resin composition, and a second part has dry reinforcing fibers that can accept a curable resin composition that optionally originates from the liner to form a functional joint between the fitting element and the liner. An interface layer of the fitting element structurally connects the first and the second part. A method for manufacturing the fitting element, as well as a method for rehabilitation of a pipeline with a tubular liner and a joined assembly of the fitting element and a liner for use in rehabilitating a pipeline. |
| US11098833B2 |
Quick connector
A quick connector includes a tubular socket, a wire retainer attached to an outer circumferential surface of the socket, and a guide member provided inside of the socket. The wire retainer has a lock portion which engages with a flange of a first tubular body when the guide member is at a second position. An outer circumferential surface of the guide member is formed with a holding recess in which the lock portion is fitted when the guide member is at a first position, and a wall of a pair of walls forming the holding recess is formed with a tapered guide surface that extends radially outward. The tapered guide surface guides the wire retainer so that the wire retainer goes over the flange when the first tubular body is inserted. |
| US11098832B2 |
System, method and apparatus for low profile seal
A pipe seal assembly includes a stiffener having an axis, an inner diameter (ID) and an outer diameter (OD). The seal assembly also includes an elastomer that is coupled to and extending though the stiffener, such that the elastomer is located on both the ID and the OD of the stiffener. A method of manufacturing a tubular member includes forming the tubular member with a female end; locating a seal assembly having an extension inside the female end, pressing the seal assembly into the female end to form a seal groove, belling the tubular member using the seal assembly to form a belled shape, and pressing the extension into the interior of the female end to form a spline groove inside the female end adjacent the seal groove; and then sacrificially removing the extension, but leaving the seal assembly to form a final assembly. |
| US11098829B2 |
Swivel joint
Swivel joints comprise a male sub, a female sub, annular races, ball bearings, a replaceable sleeve, and first and second pressure seals. The male sub is rotationally coupled to the female sub at, respective, generally tubular joint ends thereof. A passage extends through the subs. The female joint end and male joint end are rotationally coupled by ball bearings in the annular races. The replaceable sleeve is received in enlarged inner diameter portions of the male joint end and the female joint end. The first pressure seal ring is mounted between the replaceable sleeve and the enlarged diameter portion of the male joint end. The second pressure seal ring is mounted between the replaceable sleeve and the enlarged diameter portion of the female joint end. |
| US11098828B2 |
Apparatus and methods for connecting a first electrically conductive tube and a second electrically conductive tube
An apparatus includes first and second electrically conductive tubes, first and second electrical isolators, and a nut. The first electrical isolator has a central passageway. The first electrically conductive tube has a flared end disposed around the first electrical isolator. The flared end includes external threads. The second electrically conductive tube has an outer flange. The second electrical isolator is disposed around the second electrically conductive tube and engages the outer flange. The nut is disposed around the second electrically conductive tube and engages the second electrical isolator. The nut includes internal threads corresponding to the external threads of the flared end of the first electrically conductive tube. |
| US11098822B2 |
Arrangement with on/off valve, pneumatic actuator, magnetic valve and function monitoring device
An arrangement includes a field device with an on/off valve, a pneumatic actuator that moves the on/off valve, when applied with compressed air, into one on/off position and when ventilated into the other on/off position, a magnetic valve that applies compressed air to the actuator during electric actuation and ventilates the actuator during non-actuation and a function monitoring device that detects at least one parameter that refers to the movement of the on/off valve, where the function monitoring device includes a magnetic field sensor detecting changes to a magnetic field, where the magnetic field sensor is arranged in the region of the magnetic valve and generates a signal awakening the function monitoring device to detect the at least one parameter. |
| US11098820B2 |
Three-way valve drivable by a pump
Three-way valve drivable by a pump, switchable between at least two switch positions wherein a first port is selectively in fluid communication with a second port or with a third port. The three-way valve comprises a movable support and a pair of obstructing members carried by the movable support, at least one of which is responsive to the pressure applied by the pump at the first port, at least one of the movable support and obstructing members being movable due to transitions between an off-state and an on-state of the circulation pump. The obstructing members are adapted to engage reciprocatingly the respective seats of the three-way valve. The obstructing members are capable of changing shape synchronously when the pump switches from the off-state to the on-state. |
| US11098819B2 |
Valve device, flow control method using the same, and semiconductor manufacturing method
A valve device that greatly reduces man-hours for flow adjustment includes a valve body that defines a flow path, a valve element provided so as to be capable of opening and closing the flow path of the valve body, an operation member that operates the valve element and is moveably provided between a closed position where the valve element closes the flow path and an open position where the valve element opens the flow path, set in advance, in opening and closing directions that allow the valve element to open and close the flow path, a main actuator that moves the operation member in the opening direction, and a piezoelectric actuator for adjusting a position of the operation member positioned in the open position. |
| US11098818B2 |
Magnetic index positioner
A second mandrel is mounted to a first mandrel and is moveable longitudinally relative to the first mandrel among a plurality of index positions. A first-part magnetic element is coupled to the second mandrel. A plurality of second-part magnetic elements is coupled to the first mandrel at respective positions. The first-part magnetic element is adjacent to a respective one of the plurality of second-part magnetic elements when the second mandrel is at a respective index position. A threshold force F on the second mandrel applied for a threshold time T is required to displace the first-part magnetic element from the respective second-part magnetic element sufficiently that the first-part magnetic element will not return to be adjacent to the respective second-part magnetic element when the force F is removed. |
| US11098814B2 |
Stem coupling
A fire hydrant stem coupling sleeve includes a first end, a second end, and a medial section between the first end and the second end. The first end has external threads; the second end has external threads; the first end and the second end each have fingers defining slots between the fingers; the medial section includes a breaking element to facilitate breaking a rigid connection between the first end and the second end; and the medial section has a locator element configured to locate the sleeve with respect to a fire hydrant stem. |
| US11098810B2 |
Rapid response trigger
A hammer actuates a piston in a rapid response trigger to depressurize a control chamber, opening a path from a high pressure chamber to an exit conduit. The hammer acts in line with, but in opposition to, a spring biasing the control chamber closed using a centrally disposed piston. By aligning the spring, piston, and hammer in the same line of force, the response to the hammer is both more reliable and faster that prior triggers. |
| US11098809B1 |
Mixing tap for dispensing water
A mixing tap for dispensing water includes a tap body having a fitting end for fitting the tap body in or on a fitting opening, an spout fitted in or on the tap body and provided with a dispensing end, a mixing device arranged in the tap body. The mixing device includes a first inlet for cold water, a second inlet for hot water and an outlet for mixed water, and a hose having a nozzle. The mixing tap has an accommodation duct which runs from the fitting end to the dispensing end for receiving at least a portion of the hose. The hose is displaceable with respect to the spout between a pulled-out position, in which the hose protrudes with respect to the dispensing end, and a normal position, in which the hose does not extend with respect to the dispensing end or to a lesser degree. |
| US11098788B2 |
Curvature-adjustable backboard assembly and curved display device
The present invention provides a curvature-adjustable backboard assembly and a curved display device. The curvature-adjustable backboard assembly of the present invention includes a curvable backboard, a slider-crank mechanism, and a first low-speed position-limiting electric machine. The slider-crank mechanism comprises a central pivot and a first rail that are fixed to the backboard, a first slider mounted to the first rail, a first crank that is rotatable about the central pivot as being driven by the first low-speed position-limiting electric machine, and a first connection rod having two ends respectively and pivotally coupled to the first slider and the first crank, wherein when the first crank is driven to rotate, the first connection rod drives the first slider to move along the first rail and during the movement of the first slider along the first rail, a height of an arched form of the backboard with respect to the central pivot at a location where the first slider passes may vary accordingly so as to allow for easy and efficient variation of a curvature of the backboard according to a desired curving condition. |
| US11098783B2 |
Vibration dampers, shut-off valves, and methods for filling vibration dampers
A vibration damper may be used in connection with a motor vehicle. The vibration damper may include a hydraulic device for damping vibrations. The vibration damper may also include at least one shut-off valve connected fluidically to the hydraulic device at the vibration damper. The shut-off valve may be capable of being connected fluidically to at least one of a pump or a filling apparatus for filling the vibration damper with hydraulic fluid. The shut-off valve may comprise a valve housing with a first connector for the pump, a second connector for the filling apparatus, and a third connector for the hydraulic device. |
| US11098782B2 |
Damping valve arrangement
A damping valve arrangement of a vibration damper for a motor vehicle includes a damping valve body having a longitudinal axis A and a throughflow passage is covered by at least one valve disk, a spring arrangement has at least a first substantially disk-shaped spring element; and a force transmission disk arranged between the valve disk and the first spring element so as to be axially displaceable coaxial to the damping valve body. The force transmission disk has a first surface facing the first spring element and comprising a first contact ring with a first diameter, which first contact ring is axially elevated above the first surface, and a second surface opposite the first surface, which second surface faces the valve disk and comprises a second contact ring with a second diameter, which second contact ring is axially elevated above the second surface. |
| US11098780B2 |
Suspension
A suspension includes: a cylinder; a piston rod including a piston provided at one end-side, and inserted in the cylinder together with the piston; an outer tube part opened at the one end-side, a position of which relative to the piston rod is fixed at the other end-side, and configured to receive therein at least a part of the cylinder; and a tubular rolling diaphragm having one end disposed at the cylinder and the other end fixed to the outer tube part, and configured to roll in conjunction with displacement of the piston rod with respect to the cylinder. The rolling diaphragm becomes convex toward the other end-side of the outer tube part and is accommodated in the outer tube part, upon contraction of the suspension. |
| US11098777B2 |
Oversized brake piston footing
A brake piston is described. The brake piston is configured for use in a disk brake system, the piston comprising: a body having an outside width perpendicular to a central axis; a footing disposed at a distal end of the piston; wherein the footing is configured to exert force on a brake pad during actuation of the disk brake system; the footing having a face configured to contact the brake pad, the face having a length and a width, wherein the length is longer than the outside width of the body, and the length is greater than the width. |
| US11098772B2 |
Vehicle disc brake
The present invention is a vehicle disc brake for which incorrect installation of a friction pad can be prevented with a simple structure. The disc brake is provided with incorrect installation-preventing parts with which, if a friction pad (4) is installed with an incorrect installation orientation when a pair of tabs (10, 11) provided on the disc entry-side and disc exit-side of the back plate (4d) of a friction pad (4) is installed into pad guide grooves (9) formed on a caliper body (3), the tabs bump into the caliper body (3) and prevent the incorrect installation. The incorrect installation-preventing parts are formed from caliper-side recesses (9d, 9e), which are formed in the pad guide grooves (9) towards the center of the caliper body, and tab-side protrusions (10a, 11a), which have shapes that correspond to the caliper-side recesses (9d, 9e). |
| US11098769B2 |
Clutch mechanism and piston
A clutch mechanism switches a clutch to one of an engaging state and a released state by a piston operated by an oil pressure. The piston includes a first side surface portion configured to press the clutch, and a second side surface portion on which the oil pressure acts. The second side surface portion has an uneven shape in a circumferential direction. |
| US11098768B2 |
Inner disc-carrier for wet-type friction-clutch
An inner disc carrier (LT) for a wet-type friction clutch (K0) may have a driving toothing including ridges (S, SX) and grooves (N) for the form-locking accommodation of discs (L) of the friction clutch (K0). Each of a first group of the ridges (S) has a first opening (A1) produced in a chip-less shaping process and a section (ST) extending radially inwardly at the first opening (A1) and created during production of the first opening (A1). Hydraulic fluid supplied radially from inside the inner disc carrier (LT) from a first axial position is guided through the first openings (A1) to the discs (L). Hydraulic fluid supplied radially from inside the inner disk carrier (LT) from a second axial position is guided past the discs (L). The sections (ST) of the ridges (S) act as a damming contour for hydraulic fluid supplied radially from the second axial position. |
| US11098764B2 |
Universal joint or constant velocity joint torque transmission interface
A universal or constant velocity joint includes a first rotatable shaft member that extends along a longitudinal axis, a bearing member, and a joining member. The first rotatable shaft member has a free end that defines a shaft face spline. The bearing member includes a bearing hub having a first end, a second end, and a longitudinally extending hub bore. The first end has a hub face spline. The joining member fixes the bearing member to the shaft with the hub face spline and shaft face spline engaged in interlocking engagement. |
| US11098761B2 |
Sliding member
A sliding member incudes a back-metal layer and a sliding layer made of a copper alloy. The back-metal layer is made of a hypoeutectoid steel including 0.07 to 0.35 mass % of carbon, and has a structure including a ferrite phase and pearlite. The back-metal layer includes a pore existing region including a plurality of closed pores having an average size of 1 to 10 μm. The pore existing region extends from the bonding surface toward an inner portion of the back-metal layer and having a thickness of 2 to 20 μm. At least a part of the plurality of closed pores has contour that is partially formed by the bonding surface in a cross-sectional view. A ratio V2/V1 of a total volume V2 of the closed pores to a volume V1 of the pore existing region is 0.02 to 0.08. |
| US11098759B2 |
Support table for a lithographic apparatus, method of loading a substrate, lithographic apparatus and device manufacturing method
A support table for a lithographic apparatus, a method of loading a substrate, a lithographic apparatus and a method for manufacturing a device using a lithographic apparatus. In one arrangement, a support table is configured to support a substrate. The support table has a base surface. The base surface faces a surface of the substrate when the substrate is supported by the support table. One or more gas cushion members are provided above the base surface. Each of the gas cushion members includes a recess. The recess is shaped and configured such that a lowering of the substrate into a position on the support table at which the substrate is supported by the support table causes a localised build-up of pressure within the recess. The localized build-up of pressure provides a localised gas cushioning effect during the lowering of the substrate. |
| US11098749B2 |
Vacuum suction cup and vibrator
A vacuum suction cup assembly, including a vacuum cup, a vibration assembly, and a vibration shock absorber. The vacuum cup includes a skirt and is configured to be pressurized when placed against a surface to retain the vacuum cup against the surface in any orientation. The vibration assembly includes a vibrator; a vibration transfer plate on which the vibrator is mounted; and at least one vibration transfer blocks disposed on an opposite face of the vibration transfer plate from the vibrator, wherein the at least one vibration transfer blocks is configured and arranged to transmit a majority of the vibration forces from the vibrator to the surface. The vibration shock absorber is disposed between the vibration assembly and the vacuum cup. |
| US11098747B2 |
Self-sealing fastener and method of use
A self-sealing fastener for reducing leaks between the self-sealing fastener and a substrate. The self-sealing fastener includes a shank that extends longitudinally between a first end and a second end. The shank has an outer surface. The self-sealing fastener also includes a head that extends radially outwardly from the first end of the shank. The head has an underside surface that is adjacent to the first end of the shank and a topside surface opposite the underside surface. A mastic sealant is disposed on at least one of the outer surface of the shank and the underside surface of the head to provide a water-tight seal between the self-sealing fastener and the substrate after the self-sealing fastener is installed in the substrate. |
| US11098745B2 |
Connector with simplified and reliable mounting
Connector, wherein the connector is configured for connecting a first component to a second component, wherein the components each have an opening with cross sections different from a circular cross section, wherein the connector has a cage part which has a radial flange at one end and which has a stem portion with a cross section different from a circular cross section, said stem portion being insertable into the opening of the second component such that the flange is positioned against the front side of the second component, wherein the connector has a nut part which is at least partially accommodated by the cage part and that is rotatable, has an axial opening and has opposite wing portions. |
| US11098743B2 |
Screws with socket head
Screws are provided which have a longitudinal axis and include a threaded shank and a head wherein a socket is formed to be engaged by a wrench and having a pluri-lobed outer profile comprising a series of lobes circumferentially offset and separated by a series of circumferentially offset protrusions of the head. Each protrusion is delimited by two flanks and a front length joining the radially inner ends of the flanks and is convex and symmetrical with respect to a center axis radially oriented with respect to the longitudinal axis. The front length is formed by a center face and two inclined side faces each of which joins the radially inner end of the respective flank with a respective end of the center face, which is oriented orthogonally with respect to the center axis of the protrusion. Pluri-lobed wrenches adapted for use with such screws are also provided. |
| US11098742B2 |
Tacking fastener
A blind tacking rivet includes a stem and a sleeve. The stem includes a body and a stem head. The stem head is removable from the body. The stem head deforms a portion of the sleeve during removal of the stem head. The stem head may be discarded or may be embedded within the sleeve. |
| US11098741B2 |
Double connector for butt-joining two parts
A double connector for butt-joining two components includes two connector components which can be pushed together as far as a locked assembly position and which each have an spreadable first end portion for inserting into a hole of a component, and a second end portion for spreading the first end portion of the other connector component in each case in the assembly position and at least one locking portion for interlocking the two connector components in the assembly position. |
| US11098738B2 |
Transceiver module
A transceiver module is provided. The transceiver module includes a housing, a latch and a torsion spring. The housing includes a positioning post and a block. The latch includes a wedging protrusion. The torsion spring includes a coil portion, a first extending portion and a second extending portion, wherein the first extending portion and the second extending portion are connected to the coil portion, the first extending portion includes a first free end, the second extending portion includes a second free end, and the first extending portion intersects the second extending portion at an intersection point on a projection plane. A first area, a second area, a third area and a fourth area are defined by the torsion spring clockwise around the intersection point, the coil portion surrounds the positioning post in the first area, and the first free end is adapted to connect the latch. |
| US11098733B2 |
Mounting assembly with leaded electronic power components and their assembly with a motor housing
A mounting assembly with wire-leaded electronic power components for an inverter of an electric compressor of a climate control system includes a support frame structure with a bottom forming an upper side and an underside, and a multiplicity of passages from the upper side to the underside for securement elements for securing the support frame structure on a motor housing. On the underside of the bottom a hollow receiving volume is implemented. A leaded power module or power semiconductor is embedded. In each hollow receiving volume is a contact region for localized contact in places of the hollow receiving volume with an upwardly facing surface of power semiconductor or power module. The opposite, downwardly facing surface of the semiconductor or the power module forms a portion of the lower outer surface area of the mounting assembly. An assembly of the mounting assembly with a compressor motor housing is also provided. |
| US11098732B2 |
Vane ring assembly and compressor and gas turbine including the same
A vane ring assembly, and a compressor and gas turbine including the vane ring assembly, can prevent vibration of vanes and inhibit wear of the vane due to vibration by firmly and tightly fixing the vanes in contact with a ring. The vane ring assembly includes a retaining ring having inner and outer sides extending in a circumferential direction; a plurality of vanes respectively disposed around the inner side of the retaining ring and configured to be fastened to the retaining ring; and a plurality of fixing parts configured to be fastened to a surface of each vane, by passing through the retaining ring to fix the vanes to the inner side of the retaining ring. |
| US11098731B2 |
Grooved shroud casing treatment for high pressure compressor in a turbine engine
A compressor for a turbine engine includes a shroud having a grooved section including a plurality of groove segments extending radially into a shroud surface. A rotor assembly rotatably supported in the shroud includes a rotor hub and a plurality of rotor blades. Each rotor blade extends radially from the rotor hub and terminates at a blade tip, which is spaced from the shroud surface by a tip gap and defines a non-constant clearance region between a leading edge position and a medial chord position along the blade chord at the minimum tip clearance. The rotor blades generate an aft axial fluid flow through the shroud and the grooved section is formed in the shroud surface upstream of the medial chord positon within the non-constant clearance region for resisting a reverse axial fluid flow through the tip gap when the compressor section is operated at near stall conditions. |
| US11098730B2 |
Deswirler assembly for a centrifugal compressor
A diffuser assembly is disclosed for conditioning the effluent of a centrifugal compressor. The diffuser assembly comprises an annular conduit, a first set of vanes, and a second set of vanes. The annular conduit comprises a first wall and a second wall displaced from each other and cooperating to define an inlet, an outlet, and a passage extending from the inlet to the outlet. The passage has a first linear portion, a curved portion, and a second linear portion. The first set of vanes are positioned in the first linear portion of said passage. The second set of vanes are positioned in the curved portion of the passage. Each vane of the second set of vanes curves axially and laterally from a vane leading edge to a vane trailing edge. |
| US11098727B2 |
Counter rotating back-to-back fluid movement system
A technique facilitates movement of fluids while reducing axial loading on system components such as thrust bearings. The technique utilizes a system, e.g. a compressor, for moving fluid via counter rotating rotors. By way of example, the rotors may utilize impellers for establishing opposed fluid flows along fluid movement sections. The fluid movement sections may be arranged in a back-to-back configuration such that counter rotation of the rotors causes the impellers to move fluid flows in opposed directions, thus reducing axial loading. The opposed fluid flows ultimately are redirected to an outlet. |
| US11098724B2 |
Control system and method for determining contaminant loading of turbine blades
A control system and method utilizing one or more processors that are configured to determine contaminant loading of blades of a turbomachinery compressor based on one or more environmental conditions to which the turbomachinery compressor is exposed and one or more atmospheric air inlet conditions of the turbomachinery compressor. The one or more processors then determine a corrosion contaminant concentration on the blades of the turbomachinery compressor based on the contaminant loading that is determined and determine an upper limit on or a distribution of potential corrosion of the blades of the turbomachinery based on the corrosion contaminant concentration, at least one of the environmental conditions to which the turbomachinery compressor is exposed, and the corrosion contaminant concentration that is determined. |
| US11098722B2 |
Internal combustion boundary layer turbine engine (BLTE)
This invention, the “Internal Combustion Boundary Layer Turbine Engine” (BLTE), embodies the description of a “flat-disk radial flow turbine engine”. The BLTE uses the effects of “working fluid” or “exhaust” drag to convert the pressure of fuel combustibles to kinetic output energy in the form of a driven shaft. The BLTE application of “differentially sized flat blades” solves the problem of internal combustion and multi-stage operation for this new category of engine.This engine offers the light weight and high power output capability of a continuous or pulsed burn-mode of a radial turbine engine. Relative to conventional radial flow turbine engines, this engine provides reduced exhaust flow, reduced emissions and offers simple, inexpensive construction with commonly available machine tools. |
| US11098721B2 |
Spa tub and spa chair having a sprayer with a thermal meter
The present invention is directed to a spa tub (and to a spa chair that includes a spa tub) that has a sprayer with a thermal meter so that an employee does not need to touch or feel the water and/or fluids to gauge the temperature of the water and/or fluids. The spa tub may also have a water pump and/or an air pump assembly that is designed and configured to be mounted to the wall of a basin for providing massage therapy to a user. In addition, the spa tub may additionally have a liner and/or an air dispenser. As a non-limiting embodiment, a spa chair includes a spa tub, a basin, a mounting housing member, and a sprayer with a thermal meter. The spa chair may also include a jet assembly, an air pump assembly a spa base, a gasket or seal, an air dispenser, and/or a liner. |
| US11098719B2 |
Tensioned support shaft and other molten metal devices
A vertical member, which is preferably a support post used in a molten metal pump, includes a ceramic tube and tensioning structures to add a compressive load to the tube along its longitudinal axis. This makes the tube less prone to breakage. A device, such as a pump, used in a molten metal bath includes one or more of such vertical members. |
| US11098714B2 |
Pump and system for supplying a consumer
The invention relates to a pump, having a contour ring, having a rotor, having vanes, having side plates, having a housing and a housing cover, having under-vane grooves for supplying the lower vane faces with pressure, the vanes being arranged radially displaceably in the rotor and extending under the vanes as a result of the pressure and being pressed against the contour ring. Furthermore, the invention relates to a system for supplying oil to a consumer. |
| US11098713B2 |
Pump
A pump includes a rotor and a pump housing. The rotor is rotatable about a rotation axis and comprises a rotor hub and a rotor collar. The rotor collar extends from the rotor hub in the radial direction and encircles the rotor hub in an undulating manner. The pump housing comprises a first axial housing component, a central annular housing component, and a second axial housing component. A pump duct is formed (i) in the axial direction by the first and second housing components and (ii) in the radial direction by the central annular housing component and the rotor. |
| US11098708B2 |
Hydraulic pumping system with piston displacement sensing and control
A hydraulic pumping system can include a hydraulic actuator with a magnet that displaces with a piston, and a sensor that continuously detects a position of the magnet. A ferromagnetic wall of the hydraulic actuator is positioned between the magnet and the sensor. A hydraulic pumping method can include incrementally lowering a lower stroke extent of a rod string reciprocation over multiple reciprocation cycles of the rod string, and automatically varying the lower stroke extent or an upper stroke extent of the rod string reciprocation, in response to a measured vibration. Another hydraulic pumping method can include solving a wave equation in the rod string, and automatically varying a reciprocation speed of the rod string in response to a change in work performed during reciprocation cycles of the hydraulic actuator or a change in detected force versus displacement in different reciprocation cycles of the hydraulic actuator. |
| US11098706B2 |
Hose cartridge for a peristaltic pump having elastic legs
The present invention relates to an improvement of a hose cassette for a peristaltic pump. The hose cassette has a U-shape and is made from a flexible material, so that the liquid-conveying hose segment can surround the roller wheel in a better way, whereby the pumping capacity is improved. Surprisingly, a cassette configured in such a way can in an easier and more economical manner be made than cassettes of the prior art. |
| US11098705B2 |
Piezoelectric element drive circuit
A piezoelectric element drive circuit includes a piezoelectric element driven at a predetermined frequency and having a resonant frequency of (2n+1) times the predetermined frequency (n is a predetermined natural number), and a drive voltage generator that has a first output terminal connected to a first terminal of the piezoelectric element and a second output terminal connected to a second terminal of the piezoelectric element. When the piezoelectric element is driven, a waveform of potential difference between the first output terminal and the second output terminal is a step wave which transitions while taking an intermediate potential. A time length for which the potential difference is the intermediate potential is around (t2−t1)/(2n+1) in a period of time from time t1 at which the potential difference falls to the intermediate potential to time t2 at which the potential difference falls to the intermediate potential subsequently. |
| US11098704B2 |
Structure, diaphragm-type compressor, cooler, projector, and method for manufacturing structure
A structure according to an embodiment includes a first substrate including a first valve and a second substrate joined to the first substrate. The structure includes a region where the first valve and the second substrate are not joined. A sticking suppressing section is provided in at least one of the first valve and the second substrate in the region. By configuring the structure in this way, it is possible to suppress sticking of the first valve to the second substrate in the structure including the first substrate including the first valve and the second substrate joined to the first substrate. |
| US11098701B2 |
Variable-stiffness actuator
A variable-stiffness actuator includes a shape-memory member that increases in stiffness on heating, a heating member arranged to surround the shape-memory member along a longitudinal axis of the shape-memory member, and a heat transmitting medium arranged to surround the heating member along a longitudinal axis of the heating member. The heating member generates heat in response to supply of a current, so as to heat the shape-memory member. The heat transmitting medium is deformed to decrease an inner diameter of the heat transmitting medium to come into contact with the heating member, so as to cool the heating member. The heat transmitting medium is deformed to increase the inner diameter to come out of contact with the heating member. |
| US11098695B2 |
System and method to manage torsional oscillation of a wind turbine tower
A wind turbine comprising a tower, a nacelle, a rotor including a plurality of blades, an electrical generator operatively coupled to the rotor, and a control system. The control system comprises: a sensing system operable to output a signal indicative of the torsional oscillation frequency of the nacelle; a torsional damping module configured to monitor the torsional oscillation signal and to determine one or more blade pitch command signals for damping the torsional oscillation of the tower, and a filter module configured to receive the one or more blade pitch command signals as inputs and to output a respective one or more modified blade pitch command signals, wherein the filter module is configured to filter the one or more blade pitch command input signals to exclude frequency components greater than the torsional oscillation frequency. Aspects of the invention also relate to a method, a computer program software product and a controller for implementing the method. |
| US11098691B2 |
Methods for manufacturing wind turbine rotor blades and components thereof
The present disclosure is directed to methods for manufacturing wind turbine rotor blades and components thereof. In one embodiment, the method includes forming an outer surface of a rotor blade panel from one or more fiber-reinforced outer skins. The method also includes printing and depositing at least one reinforcement structure onto an inner surface of the one or more fiber-reinforced outer skins to form the rotor blade panel, wherein the reinforcement structure bonds to the one or more fiber-reinforced outer skins as the reinforcement structure is being deposited. |
| US11098690B2 |
Breaking wave power generation
A breaking waves power generator includes a platform, a plurality of water wheels rotatably mounted within the platform, and a deck plate mounted within the platform. The water wheels include a plurality of vanes, blades, paddles, or buckets that, when impacted by breaking water waves, cause rotation of the water wheels. Breaking water waves can travel over the deck plate. The deck plate has an angular position and horizontal position relative to the platform that are adjustable to guide the breaking water waves so that the water waves break against the vanes, blades, paddles, or buckets of the water wheels, causing rotation of the water wheels from which power is generated. A ramp is connected to the platform in front of the water wheels, over which water is guided to the platform so that water waves break against the water wheels. |
| US11098688B2 |
System and methods for starting an engine
Systems and methods for operating a vehicle that includes an engine that may be automatically stopped and started are described. In one example, an amount of time to start an engine and a rate of engine acceleration are adjusted in response to what type of event triggered an automatic engine start. |
| US11098687B2 |
Engine starting device
There is provided an engine starting device, including: a motor generator coupled to a crankshaft of an engine; and a starter including a pinion provided in a detachable manner from a ring gear provided on the crankshaft, and configured to mesh with the ring gear when the engine is started, wherein the engine is cranked through simultaneous cranking by both of the motor generator and the starter when a condition set in advance is satisfied, and wherein, in the simultaneous cranking, the starter starts rotating after the motor generator starts rotating. |
| US11098686B2 |
Fuel injection valve
An object of the present invention is to provide a fuel injection valve that can be used in a gasoline engine and can take fuel into an injection hole with a small pressure loss near a seat portion on which a valve is seated. Thus, the present invention provides a fuel injection valve for a gasoline engine which includes: a plurality of injection holes; and a seat portion that opens and closes a fuel passage to the plurality of injection holes in cooperation with a valve. At least one fuel injection hole among the plurality of injection holes is configured in a shape such that an injection hole inlet has a long axis and a short axis, and the long axis is directed in a direction in which an extension line intersects with the seat portion. |
| US11098684B2 |
Fuel supply device
A fuel supply device includes a fuel pump, a pump case, a cap, an O-ring, and a connection assembly. The pump case includes a case main body configured to receive the fuel pump and a discharge port connector. The cap includes a suction port connector. The O-ring is interposed between a fuel discharge port of the fuel pump and discharge port connector. The connection assembly includes a plurality of engagement projections and a plurality of engagement pieces configured to mate and engage with the engagement projections. The fuel discharge port of the fuel pump is configured to reach the O-ring coupled to the discharge port connector of the pump case simultaneous with the engagement between the engagement projections and the engagement pieces when the fuel suction port of the fuel pump and the suction port connector of the cap are connected together. |
| US11098678B2 |
Aft counter-rotating boundary layer ingestion engine
A boundary layer ingestion engine includes a fan section configured to extend into a boundary layer of a full annulus of an aft end of a fuselage of an aircraft. The fan section includes a first fan stage and a second fan stage. The boundary layer ingestion engine also includes a differential planetary gear system is operable to transform rotation of an input shaft into counter rotation of a first shaft coupled to the first fan stage and a second shaft coupled to the second fan stage. The boundary layer ingestion engine further includes a motor operable to drive rotation of the input shaft. |
| US11098676B1 |
Radial lip piston profile for easy forgeability
A piston for an internal combustion engine includes a piston body having a generally planar crown and a sidewall extending from the crown. A stepped combustion bowl is recessed in the crown and includes an outer bowl recessed relative to the crown and defining a generally planar annular floor surface. The stepped combustion bowl further includes an inner bowl recessed relative to the outer bowl. The inner bowl includes a sidewall that slopes continually inwardly from the outer bowl to a floor surface of the inner bowl. A plurality of protruding lips extend from the sidewall toward a central axis of the piston body. |
| US11098675B2 |
Piston
A piston for an internal combustion engine may include a cooling duct having at least one feed opening. The piston may also include a feed funnel arranged within the at least one feed opening. The feed funnel may be fixed in the at least one feed opening via a blind rivet connection. |
| US11098674B2 |
Piston for a heat engine, heat engine comprising such a piston, and methods
Various implementations include a combustion engine piston, including a skirt in a counter-part and including a first contact area of the piston in the counter-part, a head which extends transverse to a central axis, and a ring carrier which comprises at least two lands and at least two grooves for receiving the rings, including a first land adjoining the head and a second land situated between the first land and the skirt, wherein the lands include at least one contact land having a diameter greater than a minimum diameter of the skirt to form a second contact area of the piston in the counter-part, and wherein at least one contact land comprises a friction-reducing surface coating, formed at least on a radial sector covering an angle of at least 30 degrees, and up to on a single sector covering an angle of 360 degrees. |
| US11098672B2 |
Coated cylinder liner
A method of forming an engine component includes providing a cylinder liner main body having a curved interior wall forming a cylinder bore extending along a bore axis and a curved exterior wall formed circumferentially about the curved interior wall. The method includes disposing a coating layer onto the interior wall and the exterior wall. A cylinder liner is provided that includes a main body and a coating layer disposed on an exterior wall and on an interior wall of the main body. |
| US11098671B2 |
Combustion control device
A timing computation unit determines whether to execute compression latter-half injection to inject fuel in a latter half of a compression stroke of an internal combustion engine based on an operation state of the engine and computes an injection timing and an ignition timing of fuel. A timing correction unit corrects the computed injection timing to an advance side and corrects the computed ignition timing to a retard side, in a case where a detected fuel pressure is lower than a target fuel pressure. The timing correction unit corrects the computed injection timing to the retard side and corrects the computed ignition timing to the advance side, in a case where the detected fuel pressure is higher than the target fuel pressure. A combustion control unit controls a fuel injection device and an ignition device based on the injection timing and the ignition timing. |
| US11098660B2 |
Drive system and method for operating a drive system
Various implementations include drive systems and related methods of operation. In one implementation, a drive system includes: a combustion engine, where the combustion engine includes a combustion chamber with injectors for injecting a fossil fuel into the combustion chamber, a supply line for delivering a gas mixture to the combustion chamber, an electrolysis chamber for producing hydrogen gas and oxygen gas, and a vacuum pump for sucking the hydrogen gas and the oxygen gas from the electrolysis chamber, a gasification tank with volatile organic compounds received therein, and an air compressor for pumping air into the gasification tank, wherein the gas mixture comprises gasified organic compounds from the gasification tank and at least a part of the hydrogen gas and the oxygen gas. |
| US11098654B2 |
Hydraulic unit gear shrouds
A gear shroud arrangement includes a plate defining an aperture therethrough. A riser tube has a first end and an opposed second end. The first end of the riser tube is connected to the plate and is aligned with the aperture. A mounting flange extends from the second end of the riser tube. A shroud member extends from the plate in a direction opposite the riser tube. |
| US11098653B2 |
Apparatus and method for mitigating particulate accumulation on a component of a gas turbine
A gas turbine engine component assembly is provided. The gas turbine engine component assembly comprising: a first component having a first surface and a second surface opposite the first surface wherein the first component includes a cooling hole extending from the second surface to the first surface through the first component; a second component having a first surface and a second surface, the first surface of the first component and the second surface of the second component defining a cooling channel therebetween in fluid communication with the cooling hole for cooling the second surface of the second component; and a deflector forming a passageway with the second surface of the first component, the passageway configured to direct airflow into the cooling channel in a lateral direction parallel to the second surface of the second component such that a cross flow is generated in the cooling channel. |
| US11098652B2 |
Isolation seals for gas turbine engines
Isolation seals for gas turbine engines are described. The isolation seals include a first interface member configured to be fixedly attached to a first case structure, the first interface member being a full-hoop structure, a housing configured to be mounted to a second case structure, a connector pin arranged within the housing and moveable relative to the housing, and a second interface member located on an end of the connector pin, the second interface member being a full-hoop structure. The first interface member and the second interface member are engageable to form a seal therebetween. |
| US11098647B2 |
Thermal management system
A system for managing thermal transfer in at least one of an aircraft or a gas turbine engine includes a first engine system utilizing an oil for heat transfer. The oil of the first system has a temperature limit of at least about 500° F. The system additionally includes a fuel system having a deoxygenation unit for deoxygenating fuel in the fuel system, as well as a fuel-oil heat exchanger located downstream of the deoxygenation unit. The fuel-oil heat exchanger is in thermal communication with the oil in the first engine system and the fuel in the fuel system for transferring heat from the oil in the first engine system to the fuel in the fuel system. |
| US11098646B2 |
Gas turbine impeller nose cone
A gas turbine engine is provided, with a compressor section including a fan driven by an engine shaft about a rotation axis, the engine shaft defining a bore extending axially therethrough from a hot gas inlet to a hot gas outlet, the hot gas inlet located downstream of the compressor section, a nose cone mounted to the fan and defining a cavity therewithin, a first impeller and a second impeller mounted within the cavity, the first impeller having an inlet facing a forward direction of the gas turbine engine, the inlet of the first impeller in fluid flow communication with an air inlet defined in an outer surface of the nose cone, the second impeller having an inlet facing a rearward direction of the gas turbine engine, the inlet of the second impeller being in fluid flow communication with the hot gas outlet of the engine shaft. |
| US11098645B2 |
Wind funnel and gas combustion turbine systems with controlled air feed
Wind funnel and gas combustion turbine systems are disclosed. Air travels through a wind funnel where it is compressed, and then flows into a compression section of a gas turbine that is fueled by a hydrocarbon fuel source such as natural gas. Compressed air from the wind funnel enters the compression section of the gas turbine through one or more air inlets toward multiple rotating turbine blades in an air feed direction having a component normal to air impact surfaces of the turbine blades. In addition to the compressed air from the wind funnel, ambient air may be introduced into the compression section of the gas combustion turbine. |
| US11098644B2 |
Gas turbine engine buffer system
A gas turbine engine includes a fan, a compressor section, and a turbine section configured to drive the compressor section and the fan. A buffer system is configured to communicate a buffer supply air to a portion of the gas turbine engine. The buffer system includes a first bleed air supply having a first pressure, a second bleed air supply having a second pressure that is greater than the first pressure, and an ejector that selectively augments the first bleed air supply to prepare the buffer supply air for communication to the portion of the gas turbine engine. A method and a buffer system are also disclosed. |
| US11098637B2 |
Thermostat and coolant passage structure
A thermostat includes a valve member. The valve member has an insertion hole. The insertion hole is constituted by a first protective member and a second protective member. A shaft of a jiggle valve extends through the insertion hole. The jiggle valve has a substantially spherical head connected to an end of the shaft. The head closes the insertion hole by contacting the peripheral edge of the opening of the insertion hole. The materials of the first protective member and the second protective member each have a Vickers hardness higher than that of the valve member, which is part of the valve member other than the protective members. |
| US11098635B2 |
Muffler brace assembly
A muffler brace assembly for a vehicle includes a muffler and a pipe connected to an inlet of the muffler. A brace member has a first end and a second end. The first end of is connected to the pipe and the second end is connected to the muffler. A lowermost portion of the brace member is disposed lower than lowermost portions of the pipe and the muffler. |
| US11098629B2 |
Sensor shields for exhaust treatment systems of work vehicles
A sensor assembly for use within a flow conduit, the flow conduit configured to receive a treated exhaust of an exhaust treatment system of a work vehicle, includes an exhaust sensor positioned within the flow conduit between the upstream and downstream ends. Moreover, the exhaust sensor is configured to detect an amount of an emission gas present in the treated exhaust. The sensor assembly further includes a sensor shield positioned within the flow conduit upstream of the exhaust sensor. The sensor shield includes a hub and a plurality of flow divider beams extending from the hub. Additionally, the sensor shield creates a wake area downstream of the hub within which a turbulent exhaust flow is generated as the treated exhaust is directed past the sensor shield. Furthermore, the exhaust sensor is configured to receive the turbulent exhaust flow from the wake area. |
| US11098619B2 |
Method for producing a copper-infiltrated valve seat ring
A method for producing a copper-infiltrated valve seat ring and a valve seat ring are disclosed. The method includes introducing a copper powder and a functional material powder mixture into a joint cavity, simultaneously forming the copper powder and the functional material powder mixture into a green body comprising a functional section and a copper section in the joint cavity by the mold element, and sintering the green body formed in step b) to produce the valve seat ring where the copper section liquefies during the sintering and infiltrates pores present in the functional section. |
| US11098617B2 |
Hydraulic camshaft adjuster
A hydraulic camshaft adjuster for adjusting the control times of gas exchange valves of an engine is provided. A stator is rotatable synchronously with a crankshaft of the engine. A rotor is arranged so as to be rotatable relative to the stator, and is rotatable synchronously with a camshaft. A plurality of ribs are provided on the stator, dividing an annular chamber between the stator and the rotor into a plurality of pressure chambers. A rotor hub and a plurality of blades extend radially outward from the rotor hub, dividing the pressure chambers into two working chambers having different effective directions. An additional connectable pressure booster is provided at least in an effective direction of the hydraulic camshaft adjuster. The pressure booster can boost the rotor when active. |
| US11098615B2 |
Power cycle systems and methods
Methods and systems of power generation that integrate SCO2 Brayton and Rankin steam power cycles with fossil fuel combustion, One such method involves combusting a fuel material with an oxidizer material in a combustor to produce heat and a combustion exhaust. At least a portion of the combustion exhaust and a first portion of heat produced by the combustion processing are fed to a SCO2 Brayton power cycle to produce power and a second exhaust. At least a portion of the second exhaust and a second portion of heat produced by the combustion processing are feed to a steam Rankine power cycle to produce additional power and a third exhaust. |
| US11098613B2 |
Retention device for a cooling tube for a turbomachine casing
A retention device for at least one cooling tube of a cooling system of a turbomachine casing, the casing extending around an axial direction of the turbomachine, the retention device includes a fixing plate suited to being made integral with the casing and a retention element for the cooling tube. The retention device includes an adjustment system configured to adjust the relative position of the retention element with respect to the fixing plate and to absorb a relative movement between the retention element and the fixing plate. |
| US11098610B2 |
Steam turbine seal packing performance monitoring system using magnetic field communication
In a steam turbine seal packing performance monitoring system, steam pressure is measured by installing a pressure sensor inside a seal packing for preventing steam from leaking, so that pressure information can be transmitted using magnetic field communication in order to externally monitor seal packing performance. The system includes a seal packing unit that is installed on a rotor shaft and has a plurality of seal packs disposed along an axial direction of the rotor shaft; a pressure sensor installed inside the seal packing unit to detect a pressure of steam leaked from inside the seal packing unit and to transmit a magnetic field signal by converting a detection signal indicative of the detected pressure into the magnetic field signal; and an adapter for receiving the magnetic field signal, converting the received magnetic field signal into pressure data, and calculating a leakage amount of steam based on the pressure data. |
| US11098605B2 |
Rim seal arrangement
A seal arrangement for a turbine stage includes a vane assembly including radially inner and outer vane platforms and an airfoil. The seal arrangement further includes a rim seal feature including forward and aft rim seal legs extending radially inward from a radially inward surface of the radially inner vane platform. An impingement plate covers the radially inward facing surface of the radially inner vane platform and extends axially aft up to the aft rim seal leg. A rim seal containment structure is located radially inward of the impingement plate and extends axially over the aft portion of the radially inner vane platform up to the aft rim seal leg. A cooling cavity is defined between the rim seal containment structure and the impingement plate and extends axially aft up to the aft rim seal leg to provide cooling to an aft portion of the radially inner vane platform. |
| US11098602B2 |
Turbine vane equipped with insert support
Disclosed is a turbine vane having a turbine vane airfoil extending from a platform to an end wall and having an airfoil-shaped cross section having a leading edge, a trailing edge, and a pressure side and a suction side that extend from the leading edge to the trailing edge, wherein a plurality of cavities defined by a plurality of ribs extending from the pressure side to the suction side is formed in the turbine vane airfoil, at least one of the cavities is provided with a plurality of insert supports protruding inward from an inner surface of the turbine vane airfoil, and the insert supports are arranged in a circumferential direction of the cavity and arranged in a plurality of rows arranged in a radial direction. |
| US11098601B2 |
Diffuser-deswirler for a gas turbine engine
A diffuser-deswirler for a gas turbine engine is provided. The diffuser-deswirler includes an inner shell and an outer shell spaced apart and configured for receiving a flow of compressed air from a compressor of a gas turbine engine. A plurality of vanes extend between the inner shell and the outer shell to define a plurality of fluid passageways and a splitter extends along the circumferential direction between adjacent vanes to split the flow of compressed air passing through the each fluid passageway. All of these components are manufactured as a single monolithic piece and are configured for diffusing and deswirling compressor air before passing it to a combustor for an improved combustion process. |
| US11098597B2 |
Internally-cooled turbomachine component
An internally-cooled turbomachine component, having: a main body with a first end wall, a second end wall spaced apart from the first end wall, and a sidewall which extends between the first end wall and the second end wall such that the first end wall, the second end wall and the sidewall define a cooling passage extending between a fluid inlet and a fluid outlet, a pedestal bank with a plurality of pedestals which span the cooling passage between the first end wall and the second end wall, wherein the pedestal bank is spaced from the sidewall to define a flow channel therebetween; and a flow guide for directing cooling flow away from the flow channel, the flow guide extending from the flow channel into the pedestal bank. |
| US11098595B2 |
Airfoil for gas turbine engine
An airfoil includes a leading edge and a trailing edge. A first exterior wall extends between the leading edge and the trailing edge. A second exterior wall opposite the first exterior wall extends between the leading edge and the trailing edge. A first cavity is adjacent the first exterior wall and includes a central portion and at least one forward extending slot passage and at least one aft extending slot passage. |
| US11098591B1 |
Turbine blade with contoured fillet
A turbine blade for a gas turbine engine having an airfoil to platform fillet, wherein the fillet is contoured in accordance with the coordinates of Table 1. |
| US11098588B2 |
Circulating piston engine having a rotary valve assembly
An engine includes a housing defining an annular bore and a piston assembly disposed within the annular bore. The engine also includes a rotary valve comprising a circular faceplate and a wall structure disposed at an outer periphery of the faceplate, a portion of the at least one rotary valve disposed within the annular bore, and a rotary drive mechanism connected to the rotary valve and configured to rotate the rotary valve between a first position to align an opening of the wall structure with the annular bore to allow the piston of the piston assembly to travel within the annular bore from a first location relative to the rotary valve to a second location relative to the rotary valve and a second position to define a chamber relative to the piston of the piston assembly at the second location. |
| US11098585B2 |
Hydraulic end die of tunnel secondary lining trolley and construction method therefor
A hydraulic end die of a tunnel secondary lining trolley, comprises a trolley side die-end die assembly (6) and a trolley top die-end die assembly (10). The trolley side die-end die assembly is fixed at an outer ring of a trolley side die assembly (2) by means of a trolley side die-end die fixing device (3); the trolley top die-end die assembly is fixed at an outer ring of a trolley top die assembly (11) by means of a trolley top die-end die fixing device (8); and the trolley side die-end die assembly and the trolley top die-end die assembly are connected to a hydraulic control system by means of a trolley side die-end die hydraulic telescopic device (4) and a trolley top die-end die hydraulic telescopic device (9) respectively. Further disclosed is a construction method for a hydraulic end die of a tunnel secondary lining trolley. The hydraulic end die of the tunnel secondary lining trolley and the construction method therefor can conveniently and quickly mount and dismount the trolley end dies while accelerating the construction progress of tunnel secondary lining construction, thus reducing construction costs and improving labor productivity. |
| US11098580B2 |
Mud pulse valve
A mud pulse telemetry valve assembly and method including a mud valve sub and a mud pulse telemetry valve. The mud pulse telemetry valve having a flow tube positioned within the mud valve sub in a way that at least a portion of an outer surface of the flow tube is spaced a distance from at least a portion of an inner surface of the mud valve sub to form a hydraulic passageway having an upstream end and a downstream end. The mud pulse telemetry valve further having a control valve assembly and a pilot valve assembly. |
| US11098579B1 |
Electrode type near bit wireless short distance transmission modulation method and apparatus
An electrode-type near-bit wireless short-distance transmission modulation method includes the steps of by a near-bit measuring tool, measuring parameters, and acquiring parameter information, and packing the parameter information into a data packet, and transmitting the data packet to a transmission processor part; by the transmission processor part, performing binary frequency shift keying modulation on the data packet, and according to a set transmission power and driving source power, passing the modulated data packet through an amplifying circuit and a driving circuit, and then loading the modulated data packet to positive and negative electrodes of a transmitter; and by the positive and negative electrodes of the transmitter, transmitting the modulated data packet passed through the amplifying circuit and the driving circuit to a receiver, so as to realize electrode-type wireless short-distance transmission modulation. |
| US11098577B2 |
Method and apparatus to detect gas influx using mud pulse acoustic signals in a wellbore
A method and apparatus for determining a gas influx into a wellbore. A work string defining an inner bore area and an annulus area, with a pair of inner bore sensors in the inner bore and a pair of annulus sensors in the annulus. A processor sets a gas influx alarm limit based on a steady-state value of an acoustic parameter measured by the pair of inner bore sensors in an absence of a gas influx and a steady-state value of the acoustic parameter measured by the annulus sensors in the absence of the gas influx. The processor determines a gas influx in the wellbore when a subsequent value of the acoustic parameter is outside of the alarm limit and performs an action at the work string to counteract the gas influx in the wellbore. |
| US11098575B2 |
Method for flow profiling using active-source heating or cooling and temperature profiling
A method and apparatus are provided for determining movement of a fluid into or out of a subsurface wellbore, to thereby enable accurate allocation of fluids being produced by or injected into each of several zones of the wellbore. A temperature change is effected in the fluid at a first location in the wellbore. A temperature of the fluid is measured at one or more sensing locations downstream of the location of the temperature change. A simulated heat flow profile is generated from a wellbore model. The simulated heat flow profile is compared to the measured temperature of the fluid at the one or more sensing locations. An inversion model is used to determine, for a plurality of points of interest, a fluid flow direction and/or a cumulative flow rate contribution. |
| US11098570B2 |
System and method for a centrifugal downhole oil-water separator
A centrifugal separator includes an outer tube, an inner tube, an outlet pipe, and a control mechanism. The outer tube defines at least one outer tube inlet and at least one outer tube outlet. The inner tube is disposed within the outer tube. The inner tube is configured to separate the flow of a first fluid into the flow of a second fluid and a flow of a third fluid by rotation thereof. The outlet pipe is partially disposed within the inner tube and the outer tube. The outlet pipe includes a cross-sectional area. The outlet pipe is configured to channel the flow of the third fluid out of the inner tube and the outer tube. The control mechanism is coupled to the outlet pipe. The control mechanism is configured to regulate the flow of the third fluid by changing the cross-sectional area of the outlet pipe. |
| US11098561B2 |
Evaluating hydraulic fracturing breakdown effectiveness
The disclosure improves the analysis of the hydraulic fracturing (HF) break down process of a well system. The analysis can use as inputs collected HF data such as the HF fluid pressure, HF fluid flow rate, and HF fluid composition over one or more time intervals. In some aspects, the perforation parameters and stratigraphic well placement can also be used as inputs. The analysis can also use as inputs the HF model inputs that were used in collecting the HF data. The analysis can determine an effectiveness parameter of the received inputs. HF model inputs can be selected that would best fit a HF job plan goal for the current well system. In some aspects, the HF model inputs can be communicated to a well system controller of the current well system to further direct HF job plan operations. |
| US11098559B2 |
Casing reamer shoe
The device is designed for borehole reaming during casing—casing reamer shoes mounted in the conductor guide hole of a string or liner. The casing reamer shoe has a sub connected via a sleeve with a spiral mandrel having at least one screw groove, and a mandrel with a drill shoe located at one end thereof, and a pipe with at least one pin at the other end. The mandrel is mounted movably on the spiral mandrel inside a case being rigidly connected to the sub. The pin is arranged in the groove. The cross section of the screw groove has a shape of a trapezoid expanding in the direction of the longitudinal axis of the shoe. The pin has a stepped cylindrical shape with a conical transition. The device increases reliability and lifetime of the casing reamer shoe due to the shape of the grooves and pins. |
| US11098557B2 |
Liner wiper plug with rupture disk for wet shoe
A plug for delivering to a bottom end of a tubular in a wellbore and method of use. The plug includes a body having a first end and a second end opposite the first end, the first end engageable to a landing member in an interior of the tubular uphole of the bottom end. A bore extends through the body from the first end to the second end. A rupture disk that breaks above a rupture threshold pressure is on an outer diameter of the body. The plug is run into the tubular and engaged to the landing member. A hydraulic pressure is applied in the tubular to rupture the rupture disk to form an inlet to the plug. Fluid is delivered to the bottom end of the tubular via the inlet of the plug. |
| US11098549B2 |
Mechanically locking hydraulic jar and method
A mechanically locking hydraulic jar device includes an outer sleeve, an inner sleeve partially disposed in an inner bore of the outer sleeve, and a mechanical lock engaging the outer sleeve and the inner sleeve in a default position to axially secure the inner sleeve to the outer sleeve. Activation of the hydraulic jar disables the mechanical lock to allow axial movement of the inner sleeve relative to the outer sleeve, which generates an impact force when the inner sleeve reaches an activated position. The hydraulic jar device also includes an upward block and a downward block configured to limit the upward and downward axial movement, respectively, of the inner sleeve relative to the outer sleeve when the mechanical lock is disabled. |
| US11098547B2 |
Freeing stuck tubulars in wellbores
An apparatus includes a tubular, pressure sensors, expandable pads, a hydraulic chamber, and a computer system. The apparatus can be run in a wellbore. The apparatus is configured to detect whether the tubular is stuck within the wellbore. In response to determining that the tubular is stuck within the wellbore, the apparatus can determine a local of sticking of the tubular in the wellbore and can transmit a signal to the hydraulic chamber to pressurize one or more of the expandable pads, thereby causing the one or more expandable pads to expand and exert a force necessary to free the tubular. |
| US11098543B2 |
Hydraulic pressure converter with modular force multiplier for downhole tools
A hydraulic pressure converter with a force multiplier converts fluid pressure pumped down a work string from the surface into a multiplied linear force. The multiplied linear force can be used to operate downhole tools to perform tasks requiring the application of linear force. |
| US11098541B2 |
Polycrystalline-diamond compact air bit
A PDC drill bit for use in downhole air drilling includes a body with a face for engaging a bottom of a hole being drilled and a gauge for engaging a side of the hole being drilled. The face includes a cone, a nose outward of the cone, a shoulder outward of the nose. The bit further includes channels formed in the face of the bit that extend from within the cone to the gauge. The channels define a plurality of blades separated by the channels. Each of the plurality of blades has a leading edge with PDC cutters mounted thereon. One or more of the channels are defined by two side walls and a bottom wall and has a length, width and depth. The width or depth remains substantially constant from a first point on its length within the cone to a second point within the shoulder. |
| US11098540B2 |
Horizontal pipe connection and length detection system
A tubular handling apparatus for a drilling system, a method for handling tubulars, and a drilling system. The apparatus includes a first trough configured to receive at least a first tubular and a second tubular, a first skate movable along the first trough and configured to engage a first end of the first tubular, and a second skate movable along the first trough and configured to engage a second end of the second tubular. The first and second skates are configured to push a third end of the first tubular into engagement with a fourth end of the second tubular in the first trough. The apparatus also includes a tongs configured to engage the first and second tubulars in the first trough and apply torque thereto. |
| US11098536B2 |
Methods and apparatus for operatively mounting actuators to pipe
An apparatus for mounting one or more transducers to a drill pipe. The apparatus comprises a sub-pipe having a bore and a transducer-holding assembly, wherein the transducer-holding assembly is insertable into the bore of the sub-pipe from an axial end of the sub-pipe. The apparatus further comprising a tension collar connected to the bore-defining surface of the sub-pipe and bearing upon the transducer-holder. |
| US11098535B2 |
Systems and methods for tubular element handling
A system and method for transferring tubular elements may include a first structure having a first horizontal platform attached to the first structure on a bottom side and a monorail attached to the first structure on a top side, a second structure having a second horizontal platform attached to the second structure. The first structure and the second structure may be located proximate to each other, while the monorail can extend from the first structure to the second structure. The monorail can have a motion controlled assembly to move a tubular element or assembly of tubular elements. |
| US11098527B2 |
Concealed door assembly having hingedly-affixed exterior shelving and components
A concealed door hingedly-affixed to a concealed door frame adapted to resemble shelving and cabinets, the concealed door assembly simulated permanently-affixed shelving and cabinets, and comprising a playless hinge and various overlapping, double-stacked and interconnected components. |
| US11098525B2 |
Profiled arrangement, particularly for a refrigerator and/or freezer device
The invention relates to a profiled arrangement (1) particularly for a refrigerator and/or freezer device (10), comprising at least one base (8), at least one securing arrangement (2), at least one sealing arrangement (3) and at least one profiled element (5), characterised in that at least one free end (51) of the profiled element (5) is arranged on the sealing arrangement (3), and that at least one additional free end (52) of the profiled element (5) is connected to the base (8) by means of at least one movement arrangement (4) that at least partially projects into the sealing arrangement (3), said movement arrangement comprising two movement sections (40, 41) arranged approximately opposite one another. The invention also relates to a closing element (20) for a refrigerator and/or freezer device (10) having such a profiled arrangement (1), and to a refrigerator and/or freezer device (10) comprising such a profiled arrangement (1). |
| US11098523B2 |
Acoustical seal system for doors
An acoustical seal system that utilizes a sound absorbing material-based sound seal for the gap or flanking path between a closed door and the nearby surfaces (e.g., the door jam or frame and the floor). When the door is in a closed position, the acoustical seal system may leave a small gap around the door so that the door does not have to make contact with the surrounding structural components. The small gap is an air passage between the two adjacent rooms. The acoustical seal system includes a housing with one or more cavities. The housing is mounted on the sides of the door core or body or on the surrounding components such that the cavities face the small air gap when the door is in the closed position. The cavities are filled with sound-absorbing material, such as an acoustical foam, that is exposed to the air gap. |
| US11098520B2 |
Door opening/ closing device for vehicle
A door opening/closing device drives a slide door to a locked state under authentication communication between an authentication ECU of a vehicle side and a mobile device, when the slide door is in a closed and unlocked state and the presence of a user is detected by a detection unit. |
| US11098518B2 |
Power tailgate motor mount cartridge assembly
A power tailgate assembly for a vehicle includes a tailgate configured to rotatably couple to the vehicle, the tailgate having an inner panel, an outer panel, a bottom panel, and first and second side panels defining an inner cavity. An opening is defined in at least one of the first side panel and the bottom panel, and a motor mount cartridge assembly is disposed in the inner cavity at least partially within the opening to at least partially conceal the motor mount cartridge assembly within the tailgate. When installed, the motor mount cartridge assembly covers the opening without need for a discrete cover for the opening. |
| US11098516B2 |
Damper assembly and flap fitting
A damping assembly for a flap fitting includes first and second spring holders, between which at least two coil springs are arranged. In each of the at least two coils springs, a linear damper having a damper housing and having a piston rod slidable relative to the damper housing is arranged between the first and second spring holders. |
| US11098515B2 |
Automatic opening mechanism for flap doors
Mechanism for opening of a flap door of an item of furniture, including a part extensible telescopically under the action of a spring, hinged to a lateral side of an item of furniture and acting on a door by way of a thrust fulcrum, wherein a unit is provided, apt to move continuously the thrust fulcrum during the phases of opening and closure of the door. |
| US11098513B2 |
Door and window system
A door-and-window system having a handle component (121), a transmission component (123) and a force receiving portion (12231). When the handle component (121) is operated, the force receiving portion (12231) moves along a first guide groove (12211) via the transmission component (123), and at the same time a driving portion (12232) moves along a second guide groove (12221). Due to a relationship between a guide member (1224) and a third guide groove (12212), a first base seat (1221) translates relative to a second base seat (1222) along a direction of the third guide groove (12212), such that a movable door-and-window (11) can abut tightly against or move away from a sealing member (24) on a door-and-window mounting profile (2). |
| US11098510B2 |
Hinge for orthopedic device
A hinge has a hinge body forming an articulating section extending between a first end and a second end of the hinge. The articulating section is adapted to bend from a neutral axis when the first and second ends are parallel to an angular range in which the first end is arranged among a plurality of angles within the angular range relative to the second end. The hinge body may define a receptacle along the articulating section, and an insert may be provided for insertion into the receptacle. The insert can modify the stiffness of the hinge in the angular range and is arranged parallel to the neutral axis. |
| US11098508B2 |
Motor vehicle lock
The invention relates to a motor vehicle lock (1) comprising a locking mechanism that includes a rotary latch (2), at least one pawl (3), a triggering lever (4) that allows the pawl (3) to disengage from the rotary latch (2), and a latching lever function that allows the triggering lever (4) which is actuated for disengaging the rotary latch (2) to be secured in an actuated position; the triggering lever can be guided by the rotary latch (2) only in some sections. |
| US11098506B2 |
Actuating apparatus
An actuating apparatus for opening and closing a cover in or on a vehicle, having push-push kinematics which interact with the cover. |
| US11098501B2 |
Hasp with cylindrical lock
Improvements in a hasp are disclosed. The hasp allows for locking the hasp with a cylindrical lock to operate on a door such as, but not limited to, a garage door, a roll-up door or a shed door. This configuration allows for upgrade or replacement of these types of door locks without requiring re-design or replacement of the door. The cylindrical locks offer a greater protection because they can't be “picked” using traditional lock picking tools. This makes the lock safer from people that may try to break into the door. The cylindrical lock fits primarily within the hasp. This prevents a person from grinding through the lock or shackle. The shackle can be configured with just the circular opening for the key visible. It can be further enclosed to prevent infestation from bugs such as hornets that can fill the inside of the hasp with dirt. |
| US11098492B2 |
Rebar tying tool
A rebar tying tool configured to tie plural rebars using a wire is disclosed herein. The rebar tying tool may include a reel supporting mechanism configured to switch between a first state of detachably supporting a reel on which the wire is wound and a second state of undetachably supporting the reel; a wire feeding mechanism configured to feed the wire from the reel; and an openable cover that at least partially covers at least one of the reel supporting mechanism and the wire feeding mechanism. The reel supporting mechanism may switch from the first state to the second state by a user operation of closing the cover, and/or may switch from the second state to the first state by a user operation of opening the cover. |
| US11098491B2 |
Large manipulator having an articulated mast that can be quickly folded and unfolded
A large manipulator includes a chassis, a turntable arranged on the chassis and rotatable around a vertical axis via a rotary drive, and an articulated mast including two or more mast segments pivotably-movably connected, via articulated joints, with the respectively adjacent turntable or mast segment via a respective drive. The large manipulator further includes a mast sensor system configured to detect position of at least one point of the articulated mast or a pivot angle of at least one articulated joint and configured to generate sensor output signals. The large manipulator further includes a control device configured to actuate the drive in a normal operation for mast movement and to limit speed of movement of the articulated mast depending upon the sensor output signals. The drive is manually controllable in an emergency operation. The large manipulator further includes at least one limiting means, which, in the emergency operation, limit speed of the drive to a pre-specified maximum value. |
| US11098488B2 |
Rebar spacer
A rebar spacer installed in a rebar crossing portion includes a spacer body and a pair of installation metal fittings. The spacer body includes a main portion and a pair of leg portions integrally formed with the main portion. The pair of leg portions is protrudingly provided with an interval on a rebar-side surface of the main portion. The interval between the pair of leg portions is equal to or larger than a diameter of the rebar and a depth of the pair of leg portions in an installation direction is equal to or less than the diameter of the rebar. Each one of the pair of installation metal fittings has a structure such that one end portion is locked into one of the pair of leg portions and the other end portion is hooked on a back-side rebar. |
| US11098487B1 |
Self-concealing rebar chair
A rebar chair with a gravel particle affixed to each distal tip of the chair for providing a concealing offset between each distal tip and a support surface. |
| US11098479B2 |
Exterior wall finishing arrangement
A finishing arrangement for an exterior wall of a building includes: a plurality of exterior finishing panels; and at least one support member configured to support at least a portion of the weight of the exterior finishing panels. Each exterior finishing panel includes: a foam body having an interior-facing surface and an exterior-facing surface, the interior-facing surface having a plurality of pedestals formed therein, the pedestals defining a plurality of drainage channels therebetween, the exterior-facing surface being opposite the interior-facing surface and having a plurality of slots formed therein; and a plurality of structural elements, each structural element being accommodated in a respective slot, each structural element having a fastening surface for fastening a finishing material. |
| US11098478B2 |
Fastening and alignment member
A connection between a connector, a fastener and one or more structural members is disclosed. The connector can be formed with a fastening and alignment member. The fastening and alignment member includes a projecting member and a protruding member in close proximity to a predetermined location for the fastener. |
| US11098472B2 |
Erosion and sediment control above grate based inlet filter system including high traffic embodiments
An above grate based inlet filter system for erosion and sediment control comprises a filter mat configured to extend beyond the perimeter of the grate and a securing mechanism, such as magnets, configured to securing the filter mat around the perimeter of the grate. The system may include a filter berm secured in vicinity to the mat, and a rectangular array of magnets coupling the filter mat to the grate. The natural fiber filter mat may effectively be formed of vertically aligned coir fibers or alternatively of reticulated foam. Multiple side edges of the mat are undulating having a pattern of repeating recesses. The mat includes a plurality of high flow holes extending into the mat and which are closed at a bottom surface thereof. The mat includes at least one removable dewatering plug configured to allow for selective mat bypass. |
| US11098467B2 |
Automatic toilet plunger device
An automatic toilet plunger for clearing a blockage in a toilet includes a pipe having a plunger head engaged to a bottom end thereof so that the plunger head is in fluidic communication with the pipe. A pair of arms is hingedly engaged to the pipe. The arms are selectively positionable in an extended configuration and a stowed configuration. In the extended configuration, the arms engage a seat of a toilet. The arms fold downwardly, toward the bottom end of the pipe, into the stowed configuration. A handle, which is engaged to a top end of the pipe and which extends bilaterally therefrom, is hollow and in fluidic communication with the pipe. An actuator is engaged to at least one of the handle and the pipe and positioned therein. The actuator is manipulated to cause the plunger head to clear a blockage in the toilet. |
| US11098465B2 |
Faucet assembly with friction ring
Disclosed is a friction ring including a body and a contact member. The body is configured to couple the friction ring to at least one of a faucet assembly or a faucet valve assembly. The contact member is disposed on the body. The contact member is configured to slidably engage with a valve stem of the faucet valve assembly. The contact member is further configured to press against the valve stem to increase a frictional force between the contact member and the valve stem over a full range of movement of the valve stem. |
| US11098462B2 |
Construction machine
A construction machine is provided. If the rotational speed of a prime mover is set lower than a rated rotational speed and the delivery rate of a hydraulic pump is lowered, the construction machine can prevent deterioration of the operability in slow speed operation works by keeping wide a lever operation range in which the rate of flow supplied to a hydraulic actuator is variable. A center bypass control valve (2) is arranged downstream of a plurality of directional flow control valves (1, 20, 21) in a center bypass line (12), and if an engine rotational speed (N) detected by a rotational speed sensor (19) is lower than a rated rotational speed (Nmax), a controller (10) calculates a combined opening area obtained by combining opening areas of the plurality of directional flow control valves in the center bypass line based on operation pilot pressures (Pp1, Pp3 to Pp6) detected by pressure sensors (7, 25, 26, 28, 29) and controls the center bypass control valve such that an opening area of the center bypass control valve becomes smaller than the combined opening area. |
| US11098460B2 |
Dry-bulk tanker, conveying system for a dry-bulk tanker, as well as work train
A dry-bulk tanker for the provision of binding agents for soil stabilization for a spreading device comprises a storage container (10) for binding agent. A mechanical conveying device (18) for conveying binding agents from the storage container (10) into an intermediate chamber (20) is connected to the storage container (10). A pneumatic conveying device (36) for conveying the binding agent to the spreading device is connected to the intermediate chamber (20). A pressure relief device (40, 41) is connected to the mechanical conveying device in order to avoid the entry of compressed air into the storage container (10). The invention furthermore relates to a conveying system for a dry-bulk tanker and to a work train for working soils with a self-propelled ground working machine and a dry-bulk tanker. |
| US11098458B2 |
Flap gate
A flap gate includes a door body and a flap ancillary part. When the door body is in its down position, a movable end portion of the door body is located forward of a supported end portion. The door body changes its position between the down position and a maximum up position. The flap ancillary part applies tilt-up moment to the door body only when the door body is located in a position between the down position and a first position. The flap ancillary part also applies tilt-down moment to the door body only when the door body is located in a position between the maximum up position and a second position. |
| US11098455B2 |
Systems and methods for data acquisition and asset inspection in presence of magnetic interference
This disclosure relates generally to systems and methods for data acquisition and asset inspection in presence of magnetic interference. Data acquisition and assets inspection systems in many infrastructures such as railway, power line, and bridges provide inaccurate results in presence of magnetic interference. The proposed system and method proposes UAV based navigation through a dynamic correction path to inspect one or more assets in one or more infrastructures. A plurality of sensors are integrated with the UAV to acquire images of the one or more assets in presence of magnetic field. The acquired images are further processed to segment and detect anomalies in one or more parts of the one or more assets. The detected anomalies are further classified as potential anomalies and non-potential anomalies. The proposed method provides accurate results with reduced processing time. |
| US11098453B2 |
Absorbent structures with high absorbency and low basis weight
Absorbent product including a laminate of at least two plies, wherein the absorbent product has a measured Valley Volume parameter greater than 11 microns and a Pit Density of greater than 25 pockets per sq. cm. |
| US11098449B2 |
Pre-drier apparatus and method
A pre-dryer for continuous feed or cut sheet systems is described. Such a module can be used in various applications, for example, prior to printing where the time constant for fusing and glossing is long enough that the substrate temperature essentially equilibrates with that of the marking material on the surface of the sheet. The pre-dryer may be part of an image forming device. Substrates, including paper, typically have high moisture content in normal atmospheric conditions. Such substrates may have a moisture content of about 10% water by weight, which is considered high for printing. Such high moisture content in image receiving substrates leads to various artifacts and extends heating times to take the substrate to its glossing temperature that are about four times longer than for dry media. This longer heating time translates to undesirably longer paper paths or nip lengths. |
| US11098441B2 |
Cool-feeling fiber fabric and method for producing same
A method is provided for producing a fiber fabric by preparing a finishing agent treatment liquid having a mixture of first and second particles of titanium oxide having a particle diameter of 150 to 200 nm and 1 to 5 μm respectively, a silver zeolite and a binder resin, immersing a fiber fabric in the finishing agent, thermal drying the fiber fabric and subjecting the fiber fabric to heat treatment to allow the finishing agent to adhere to the fiber fabric. |
| US11098439B2 |
Laundry treatment apparatus
A laundry treatment apparatus is disclosed. The laundry treatment apparatus includes a cabinet having an accommodation space formed therein to accommodate laundry, a laundry support member provided in the accommodation space, and a presser mounted to the laundry support member and configured to apply pressure to laundry to remove wrinkles from laundry. The presser includes a support part for supporting one surface of laundry, a hanger hook configured to be hung on the laundry support member, and a press part hingedly connected to the support part to apply pressure to the opposite surface of laundry. |
| US11098438B2 |
Method for controlling dryer
A method for controlling a dryer according to an embodiment of the present invention includes: an operation of, when a dusting mode is selected and a start command is input, rotating a drying drum at a first rotational speed V1 in a first direction for a first set time; an operation of, after the first set time elapses, rotating the drying drum at a second rotational speed V2 in a second direction opposite to the first direction for a first set time; and an operation of rotating a drying fan along with the drying drum, when the drying drum rotates in the second direction, dust staining on an object introduced into the drying drum is separated from the object, and when the drying drum rotates in the first direction, the separated dust is discharged to the outside of the drying drum by a forced air flow generated by the drying fan. |
| US11098437B1 |
Lint exhaust duct cleaning tool and method for cleaning a clothes dryer ventilation system
A method for cleaning a ventilation system of a clothes dryer includes operatively connecting an open proximal end of a hollow duct cleaning tool to a portable airstream appliance adapted for generating a pressurized airflow. A lint screen is first removed from a screen housing opening at the lint exhaust of the clothes dryer. An open distal end of the hollow duct cleaning tool is then placed over the screen housing opening of the clothes dryer, such that the distal end closely engages the clothes dryer to operatively air-seal the screen housing opening. The portable airstream appliance is then activated to direct the pressurized airflow through the duct cleaning tool, lint exhaust and ventilation system of the clothes dryer, thereby evacuating lint and debris collected inside the ductwork of the ventilation system. |
| US11098431B2 |
Method for controlling spin-drying operation of washing apparatus
A method for controlling a spin-drying operation of a washing apparatus includes a laundry dispersing step of dispersing the laundry inside a drum by accelerating the drum, a spin-drying step including detecting the eccentricity of the drum, and performing spin-drying by rotating the drum to a spin-drying RPM. The laundry dispersing step is re-executed when the eccentricity exceeds a reference eccentricity, and in the spin-drying step, a rotation time during which the drum rotates at the spin-drying RPM is adjusted according to a spin-drying degree. The spin-drying degree is measured after a point in time at which the eccentricity exceeds the reference eccentricity. |
| US11098428B2 |
Washer and washer control with cycles for laundry additives and color safe bleaches/in-wash stain removers
A washer and a control for an automatic washer to operate the washer through a wash cycle selected based upon a range of conditions of a fabric load to be washed. The control has a plurality of selectable stain type entrees, each with a particular dedicated wash cycle. The control also has dispensing control over at least two wash liquor additives, one being a detergent and the other being an oxidizing agent. The control operates the dedicated wash cycles, as selected, using both the detergent and the oxidizing agent; however, the detergent and the oxidizing agent may be dispensed differently, depending on the stain type selected. |
| US11098424B2 |
Sewing machine
A sewing machine includes: a presser spring depressing a presser bar; a presser main body fixed thereto, including a presser; a lower feed dog protruding further upward than a needle plate, to feed a sewing target rearward; an upper feed mechanism above the lower feed dog, that includes an upper feed dog behind a needle location and feeds the sewing target rearward via the upper and lower feed dogs; and a spring presser release mechanism relatively movably mounted on the presser bar, including a transmission member transmitting presser spring force to the presser bar, and operating when the lower contacts the upper feed dog, lifting the transmission member relative to the presser bar, to release the force applied thereto. The movement of the transmission member with respect to the presser bar during spring presser release mechanism operation matches a movement of the lower feed dog protruding from the needle plate. |
| US11098421B2 |
Knitted fabric panel
A knitted fabric panel, composed of a knitted base fabric embroidered as a circular knitted fabric from at least one knitted base fabric thread, wherein at least one zone having a reduced thread volume is provided, the zone being knitted by further threads which by way of the two ends thereof are fixed in the knitted base fabric, at least part of the further threads being thinner than the knitted base fabric thread. The threads instead of the knitted base fabric thread are knitted in a plurality of separate loop forming courses that in the circumferential direction extend by less than 360°. |
| US11098407B2 |
Method for no-silane electroless metal deposition using high adhesive catalyst and product therefrom
A method for electroless metal deposition and an electroless metal layer included substrate are provided. The method for electroless metal deposition includes steps as follows. a) cleaning a substrate, applying a hydrofluoric acid onto the substrate; and then applying a modifying agent onto the substrate to form a chemical oxide layer on the substrate; b) a catalyst layer is formed on the chemical oxide layer, wherein, the catalyst layer includes a plurality of colloidal nanoparticles, and each of the plurality of colloidal nanoparticles includes a palladium nanoparticle and a polymer which encapsulates the palladium nanoparticle, and c) depositing a metal on the catalyst layer through an electroless metal deposition to form an electroless metal layer. |
| US11098405B2 |
Film forming apparatus and film forming method
A shower head includes a face plate having an outer peripheral portion and a plurality of gas injection holes disposed inside the outer peripheral portion, a movable portion facing the face plate and having a gas introduction passage, and a seal interposed between the outer peripheral portion of the face plate and the movable portion. The movable portion is arranged to move, in the first direction, between a first position in which the movable portion is coupled to the face plate by interposing the seal between the movable portion and the face plate, and the gas introduction passage communicates with the inside of the chamber via the gas injection holes, and a second position in which the movable portion is separated from the face plate, and the gas introduction passage communicates with the inside of the chamber via a gap between the movable portion and the face plate. |
| US11098403B2 |
High entropy alloy thin film coating and method for preparing the same
A method for preparing a high entropy alloy thin film coating includes preparing a melt alloy by arc melting raw materials including five or more elements, casting the melt alloy into a mold to form a target, placing the target inside a vacuum chamber of a magnetron sputtering system, and rotatably fixing a substrate inside the vacuum chamber, spaced apart from the target. A high entropy alloy thin film is deposited on the substrate by high vacuum radio frequency sputtering inside the vacuum chamber. |
| US11098402B2 |
Storage and delivery of antimony-containing materials to an ion implanter
A novel method, composition and storage and delivery container for using antimony-containing dopant materials are provided. The composition is selected with sufficient vapor pressure to flow at a steady, sufficient and sustained flow rate into an arc chamber as part of an ion implant process. The antimony-containing material is represented by a non-carbon containing chemical formula, thereby reducing or eliminating the introduction of carbon-based deposits into the ion chamber. The composition is stored in a storage and delivery vessel under stable conditions, which includes a moisture-free environment that does not contain trace amounts of moisture. The storage and delivery container is specifically designed to allow delivery of high purity, vapor phase antimony-containing dopant material at a steady, sufficient and sustained flow rate. |
| US11098401B2 |
Method of forming wiring on side portion of substrate
Disclosed is a method of forming wiring of a substrate includes masking a substrate side portion, on which the wiring will be formed, by attaching a deposition mask to the substrate; and forming the wiring on the substrate side portion based on sputtering after introducing the masked substrate into a chamber. |
| US11098396B2 |
Process for manufacturing a coated metal strip of improved appearance
An installation for continuous hot-dip coating of a metal strip is provided. The installation includes a tank containing a bath of molten metal, a metal strip running through the bath and a confined wiping device. The confined wiping device includes at least two wiping nozzles placed on each side of a path of the strip after the strip has left the bath of molten metal. Each nozzle has at least one gas outlet orifice and an upper face. The confined wiping device also includes a confinement box adjacent each upper face. The confinement boxes are open on a face which faces the strip. Each box includes at least one upper part and two lateral parts. |
| US11098395B2 |
Nickel-based superalloy with microstructure including rafting-resistant gamma prime phase and article prepared therefrom
In a non-limiting example, an article having a body including a nickel-based superalloy is provided. The nickel-based superalloy has a microstructure that includes a gamma phase matrix and a gamma prime phase including a plurality of rafting-resistant gamma prime particles dispersed in the gamma phase matrix. The plurality of the rafting-resistant gamma prime particles has an average particle perimeter of about 3 microns to about 15 microns, an average aspect ratio of about 1.2 to about 3, and where the microstructure of the nickel-based superalloy is substantially uniform throughout the body. |
| US11098394B2 |
Rolled wire rod
A rolled wire rod wherein the contents of Ti, N, and S (mass %) are respectively [Ti], [N], and [S], and, if [S]≤0.0010, [Ti] is (4.5×[S]+3.4×[N]) or more and (0.008+3.4×[N]) or less, while if [S]≥0.0010, [Ti] is (4.5×[S]+3.4×[N]) or more and (8.0×[S]+3.4×[N]) or less, the internal structure is a mixed structure of ferrite and pearlite with an area ratio of a ferrite fraction of 40% or more, and a mean area of sulfides present in a range from a surface of the wire rod to a depth position D/8 from the surface of the wire rod is 6 μm2 or less, wherein D represents a diameter, in mm, in a cross-section of the wire rod at a plane including the axis of the wire rod, and a mean aspect ratio of the sulfides is 5 or less. |
| US11098391B2 |
Aluminum alloy with additions of magnesium, calcium and at least one of chromium, manganese and zirconium, and method of manufacturing the same
An aluminum alloy including aluminum, about 2.5 to about 17.4 weight percent by weight magnesium, about 50 to about 3000 ppm calcium, and at least one of chromium up to about 0.2 percent by weight, zirconium up to about 0.2 percent by weight and manganese up to about 0.3 percent by weight. |
| US11098386B2 |
Steel sheet and method of manufacturing same
Steel sheet for cans high in strength and excellent in formability and appearance comprising C: 0.0010 to 0.0035%, Si: 0.050% or less, Mn: 0.10 to 0.50%, P: 0.040% or less, S: 0.040% or less, Al: less than 0.005%, N: 0.0050% or less and a balance of Fe and unavoidable impurities, wherein an average value of a ratio of length of crystal grains in a sheet thickness direction to length in a sheet width direction is 0.70 or more, a yield strength is 500 MPa or more, and, in a range of 0 to 90° of the rolling direction, a minimum value of an r-value is 1.50 or more, an average value of the r-value is 1.70 or more, and a difference of the maximum value and minimum value of the r-value is 0.50 or less. |
| US11098381B2 |
Materials and methods for controlling regulation in biosynthesis in species of the genera Ralstonia or Cupriavidus and organisms related thereto
Methods for increasing carbon-based chemical product yield in an organism by genetically modifying one or more genes involved in a stringent response and/or in a regulatory network, nonnaturally occurring organisms having increased carbon-based chemical product yield, and methods for use in production of carbon-based chemical products are provided. |
| US11098380B2 |
Reagent and method for rapid detection of porcine adenovirus
The invention provides are agent and a method using this reagent for the detection of porcine adenovirus in a sample. The reagent comprises the following primer pair: the upstream primer: (5′-3′) ATCTTGAAATCACAATTCTTCTG (SEQ ID NO: 1); the downstream primer: (5′-3′) CAAGGAGCAGYTGGTGGAG (SEQ ID NO: 2), among the downstream primer Y can be T or C. This reagent and method are of strong specificity and high sensitivity, which can rapidly detect pig porcine adenovirus in samples. |
| US11098379B2 |
Composition for detecting potato virus Y including M13KO7 bacteriophage and kit including the same
The present disclosure relates to a composition for detecting a potato virus Y including an M13KO7 bacteriophage and a kit including the same. Since the M13KO7 bacteriophage of the present disclosure may be easily produced using E. coli and is a large aggregate of proteins, the M13KO7 bacteriophage is more stable than antibodies even when exposed to external physical or chemical factors. Therefore, the composition of the present disclosure has an effect of diagnosing only the PVY specifically and accurately and may be usefully used in related industries. |
| US11098378B2 |
Compositions and methods for detection of candida species
The invention features compositions and methods for the detection of Candida species in biological samples, such as human tissue samples. The invention features species specific nucleic acid probes that can hybridize to target nucleic acid molecules in Candida species and can be used in a variety of detection assays, such as fluorescence based assays or NMR based assays. The compositions and methods of the invention can be used to rapidly and accurately detect one or more Candida species in patients and can be used to assist in point-of care-decisions for treating Candida infections. |
| US11098376B2 |
Multiplex detection of vulvovaginal candidiasis, trichomoniasis and bacterial vaginosis
Methods and compositions for detection of vulvovaginal candidiasis (VVC), trichomoniasis and bacterial vaginosis (BV) are disclosed herein. In some embodiments, the presence or absence of VVC-associated Candida, Trichomonas valginalis, and a plurality of BV-related bacteria in a sample is determined using multiplex nucleic acid-based testing methods. |
| US11098374B2 |
Genetic profiling method for animals
Genetic characterisation of closely related inbreds is at present only possible by means of whole genome sequencing. This is however a time-consuming process.The invention addresses the need for a method to differentiate between closely related substrains of inbreds. The method involves analysis of at least two tandem repeat loci per chromosome. Said tandem repeat loci are characterised by high mutation rates. The amplified fragments are subsequently used to determine the alleles that are present at each amplified locus within the DNA sample. |
| US11098365B2 |
Methods for simultaneous amplification of target loci
The invention provides methods for simultaneously amplifying multiple nucleic acid regions of interest in one reaction volume as well as methods for selecting a library of primers for use in such amplification methods. The invention also provides library of primers with desirable characteristics, such as minimal formation of amplified primer dimers or other non-target amplicons. |
| US11098361B2 |
Use of SHROOM3 in chronic kidney disease and chronic allograft nephropathy
A method for identifying the risk of developing Chronic Allograft Nephropathy (CAN) in a patient that received a kidney transplant from a donor which comprises identifying the race of the donor; determining the levels of SHROOM 3 expression in a kidney biopsy specimen obtained from the patient at a predetermined time after transplant; comparing the level of SHROOM 3 expression in the biopsy specimen with the levels of SHROOM 3 expression in a control; determining if the level of SHROOM 3 expression in the allograft is significantly higher than in the control, and diagnosing the patient as being at risk for CAN if the level of SHROOM 3 expression in the specimen is significantly higher than in the control. |
| US11098357B2 |
Compositions and methods for identification of a duplicate sequencing read
The present invention provides methods, compositions and kits for detecting duplicate sequencing reads. In some embodiments, the duplicate sequencing reads are removed. |
| US11098354B2 |
Use of titanium nitride as an electrode in non-faradaic electrochemical cell
A nanopore cell includes a conductive layer. The nanopore cell further includes a titanium nitride (TiN) working electrode disposed above the conductive layer. The nanopore cell further includes insulating walls disposed above the TiN working electrode, wherein the insulating walls and the TiN working electrode form a well into which an electrolyte may be contained. In some embodiments, the TiN working electrode comprises a spongy and porous TiN working electrode that is deposited by a deposition technique with conditions tuned to deposit sparsely-spaced TiN columnar structures or columns of TiN crystals above the conductive layer. |
| US11098351B2 |
Apparatus and methods for multi-step channel emulsification
Methods and devices for forming droplets are provided. In certain embodiments, the methods and devices form droplets having different diameters. In particular embodiments, the device includes a fluid supply channel, a collection chamber, and one or more nozzles disposed between the fluid supply channel and the collection chamber. Each nozzle may include an inlet portion with a channel height, a first step with a first step height and a first tread length, and a second step with a second step height and a second tread length. In certain embodiments, the first step height is greater than the channel height, and the second step height is greater than the first step height. |
| US11098350B2 |
Non-invasive diagnosis of graft rejection in organ transplant patients
The invention provides methods, devices, compositions and kits for diagnosing or predicting transplant status or outcome in a subject who has received a transplant. |
| US11098347B2 |
Nucleic acid amplification device, nucleic acid amplification method, and chip for nucleic acid amplification
The present invention provides a reciprocal-flow-type nucleic acid amplification device comprising:heaters capable of forming a denaturation temperature zone and an extension/annealing temperature zone;a fluorescence detector capable of detecting movement of a sample solution between the two temperature zones;a pair of liquid delivery mechanisms that allow the sample solution to move between the two temperature zones and that are configured to be open to atmospheric pressure when liquid delivery stops; a substrate on which the chip for nucleic acid amplification according to claim 2 can be placed; and a control mechanism that controls driving of each liquid delivery mechanism by receiving an electrical signal from the fluorescence detector relating to movement of the sample solution from the control mechanism; the device being capable of performing real-time PCR by measuring fluorescence intensity for each thermal cycle. |
| US11098346B2 |
Sequential delivery of fluid volumes and associated devices, systems and methods
The present technology is directed to capillarity-based devices for performing chemical processes and associated system and methods. In one embodiment, for example, a device can include a porous receiving element having an input region and a receiving region, a first fluid source and a second fluid source positioned within the input region of the receiving element; wherein the first fluid source is positioned between the second fluid source and the receiving region, and wherein, when both the first and second fluid sources are in fluid connection with the input region, the device is configured to sequentially deliver the first fluid and the second fluid to the receiving region without leakage. |
| US11098344B2 |
Methods for generating stabilized lyophilized materials
Lyophilized biological reagents, such as enzymes (e.g., PCR reagents) and antibodies, are provided that include a wax component. Thus, in some aspects, a method is provided for storing a biological reagent comprising formulating the reagent into a lyophilized composition including a wax component. Methods for using such lyophilized reagents are likewise provided. |
| US11098342B2 |
Time lapse sequencing: a convertible-nucleoside approach to enrichment-free analysis of RNA dynamics
The invention provides methods and compositions for generating mutations in new nucleic acid molecules through incorporation of a transformable nucleoside into the nucleic acid and subsequent transformation of the nucleoside through oxidative-nucleophilic-aromatic-substitution chemistry, referred to as TimeLapse chemistry. The invention further provides methods for detecting the mutations, referred to as TimeLapse-seq. |
| US11098338B2 |
Recombinant polypeptide production methods
Herein is reported a method for producing a fusion-polypeptide comprising the seeps of a) cultivating a mammalian cell comprising a nucleic acid encoding a variant fusion-polypeptide wherein the amino acid sequence of the fusion-polypeptide has been modified by replacing in a pro-fusion-polypeptide the endogenous protease cleavage site between the pro-peptide and the fusion-polypeptide with an exogenous (with respect to the origins of the parts of the fusion-polypeptide) or artificial protease cleavage site, and b) recovering the fusion-polypeptide or fusion-pro-polypeptide from the cell or the cultivation median and thereby producing the (recombinant) fusion-polypeptide. |
| US11098337B2 |
Cells producing glycoproteins having altered glycosylation patterns and method and use thereof
The disclosure relates to the field of glyco-engineering, more specifically, to eukaryotic cells wherein both an endoglucosaminidase and a glycoprotein are present. These cells can be used to deglycosylate or partly deglycosylate the (exogenous) glycoprotein, in particular, without the need for adding an extra enzyme. Methods are also provided for the application of these cells in protein production. According to one specific aspect, the eukaryotic cells are glyco-engineered yeast cells in which, additionally, at least one exogenous enzyme needed for complex glycosylation is present, e.g., allowing easier separation of differentially glycosylated glycoproteins. |
| US11098333B2 |
ATP phosphoribosyltransferase variant and method for producing L-histidine using the same
The present disclosure relates to an ATP phosphoribosyltransferase (HisG) protein and a method for producing histidine using the same. |
| US11098330B2 |
Method for producing ergothioneine
A method for producing ergothioneine at a low cost in large quantities and a bacterium for use in said method are provided. A method for producing ergothioneine or a related substance thereof, or a mixture thereof, comprising culturing a bacterium belonging to the family Enterobacteriaceae having the ergothioneine-producing ability in a culture medium, and collecting ergothioneine or a related substance thereof, or a mixture thereof, from the culture medium or from the cells obtained by culture, wherein said bacterium is the one which is modified so as to have a reduced activity of a protein comprising a core sequence region comprising 5 amino acid residues: Ser-Arg-Gly-Arg-Thr (SEQ ID NO:7) as a part thereof; and a bacterium belonging to the family Enterobacteriaceae having the ergothioneine-producing ability modified so as to have a reduced activity of a protein comprising a core sequence region comprising 5 amino acid residues: Ser-Arg-Gly-Arg-Thr (SEQ ID NO:7) as a part thereof. |
| US11098327B2 |
Methods and systems for starch based propagation of a microorganism
Systems and methods that include starch derived from grain as a carbon source for propagation of microorganisms. |
| US11098324B2 |
Non human great apes adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof
The present invention relates to novel adenovirus strains with a high immunogenicity and no pre-existing immunity in the general human population. The lack of pre-existing immunity is due to novel hypervariable regions in the adenoviral capsid protein hexon. The novel adenovirus strains also have an improved capacity for reproduction. The present invention provides nucleotide and amino acid sequences of these novel adenovirus strains, as well as recombinant viruses, virus-like particles and vectors based on these strains. Further provided are pharmaceutical compositions and medical uses in the therapy or prophylaxis of a disease, and methods for producing an adenovirus or virus-like particles utilizing the novel sequences, recombinant viruses, virus-like particles and vectors. |
| US11098316B2 |
Optimal soybean loci
As disclosed herein, optimal native genomic loci of soybean plants have been identified that represent best sites for targeted insertion of exogenous sequences. |
| US11098311B2 |
Anti-VEGF protein compositions and methods for producing the same
The present disclosure pertains to compositions comprising aflibercept and methods for producing such compositions in chemically defined media and using chromatography to reduce amounts of certain aflibercept variants. |
| US11098308B2 |
Treatment of CNS injury with RNAi therapeutics
Self-delivering PTEN RNA and methods of reducing PTEN expression are provided herein. Also provided are methods of treating spinal cord injury (SCI) and other neurotrauma with PTEN sdRNA. |
| US11098303B2 |
Systems and methods for determining nucleic acids
The present invention generally relates to systems and methods for imaging or determining nucleic acids, for instance, within cells. In some embodiments, the transcriptome of a cell may be determined. Certain embodiments are directed to determining nucleic acids, such as mRNA, within cells at relatively high resolutions. In some embodiments, a plurality of nucleic acid probes may be applied to a sample, and their binding within the sample determined, e.g., using fluorescence, to determine locations of the nucleic acid probes within the sample. In some embodiments, codewords may be based on the binding of the plurality of nucleic acid probes, and in some cases, the codewords may define an error-correcting code to reduce or prevent misidentification of the nucleic acids. In certain cases, a relatively large number of different targets may be identified using a relatively small number of labels, e.g., by using various combinatorial approaches. |
| US11098292B2 |
Engineered transaminase polypeptides for industrial biocatalysis
The present disclosure provides engineered transaminase polypeptides useful for the synthesis of chiral amine compounds under industrially relevant conditions. The disclosure also provides polynucleotides encoding the engineered transaminase polypeptides, host cells capable of expressing the engineered transaminases, and methods of using the engineered transaminases for the production of chiral amine compounds. |
| US11098291B2 |
Biocatalysts and methods for synthesizing derivatives of tryptamine and tryptamine analogs
The present disclosure provides engineered transaminase polypeptides for the production of amines, polynucleotides encoding the engineered transaminases, host cells capable of expressing the engineered transaminases, and methods of using the engineered transaminases to prepare compounds useful in the production of active pharmaceutical agents. |
| US11098285B2 |
Virulent Pseudomonas fluorescens phage ΦPf1901, and phage ΦPf901 preparation and application thereof
The present invention provides a virulent Pseudomonas fluorescens (P. fluorescens) phage ΦPf1901, and a phage ΦPf1901 preparation and an application thereof, and relates to the technical field of phage. The virulent P. fluorescens phage ΦPf1901 has an accession number of CCTCC M2019447. The virulent phage ΦPf1901 has a titer of (1.4-3)×1010 PFU/mL. The virulent phage ΦPf1901 has an optimal multiplicity of infection (MOI) value of 0.0001. The virulent P. fluorescens phage ΦPf1901 provided by the present invention exhibits very high specificity and lytic ability to P. fluorescens, which can be used to control P. fluorescens, with strong lytic and scavenging effects on a host. |
| US11098284B2 |
Enhanced generation of cytotoxic T-lymphocytes by IL-21 mediated FOXP3 suppression
A method of carrying out adoptive immunotherapy by administering a subject an antigen-specific cytotoxic T lymphocytes (CTL) preparation in a treatment-effective amount is described. In the method, the CTL preparation is preferably administered as a preparation of an in vitro antigen-stimulated and expanded primate CTL population, the CTL population: (i) depleted of FoxP3+ T lymphocytes prior to antigen stimulation, (ii) antigen-stimulated in vitro in the presence of interleukin-21; or (iii) both depleted of FoxP3+ T lymphocytes prior to antigen stimulation and then antigen-stimulated in vitro in the presence of interleukin-21. Methods of preparing such compositions, and compositions useful for carrying out the adoptive immunotherapy, are also described. |
| US11098283B2 |
T cells modified to overexpress c-Myb
Provided is an isolated or purified T cell comprising an antigen-specific receptor, wherein the antigen-specific receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR), wherein the T cell has been modified to express a transcription factor at a level that is higher than the level of the transcription factor expressed by a T cell that has not been modified to express the transcription factor, wherein the transcription factor is V-Myb Avian Myeloblastosis Viral Oncogene Homolog (c-Myb), a functional variant of c-Myb, or a functional fragment of c-Myb. Related populations of cells, pharmaceutical compositions, methods of treating a disease, and methods of inhibiting the differentiation of T cells are also provided. |
| US11098277B2 |
Culture apparatus and method of controlling culture apparatus
A culture apparatus including: a heat-insulated casing including an inner case surrounding a culture space, and an outer case, the heat-insulated casing having an opening; a box-shaped heat-insulated door to open and close the opening; and, one or more heaters provided to one or more inner surfaces of the inner case and an inner surface of an inner wall surface of the heat-insulated door, the inner wall surface facing the culture space when the door is closed; the heaters including one or more first heaters turned on when the interior of the culture space is at a first temperature to incubate a culture in the culture space and when the interior of the culture space is controlled at a second temperature to make the interior of the culture space, and second heaters to be energized when the interior of the culture space is controlled at the second temperature to sterilize the interior of the culture space. |
| US11098275B2 |
Analysis device
An analysis device includes an analysis unit configured to receive scattered light, transmitted light, fluorescence, or electromagnetic waves from an observed object located in a light irradiation region light-irradiated from a light source and analyze the observed object on the basis of a signal extracted on the basis of a time axis of an electrical signal output from a light-receiving unit configured to convert the received light or electromagnetic waves into the electrical signal. |
| US11098272B2 |
Washing product
A washing product is provided, including a first powder comprising a camellia-seed powder, and a soybean powder with 55% to 95% by weight of a total weight of the washing product, a second powder such as sodium hydrogen carbonate with 5% to 25% by weight of a total weight of the washing product, and a third powder such as citric acid with 1% to 20% by weight of a total weight of the washing product. The washing product further includes a fourth powder comprising starch, protein, cellulose, and/or sodium carboxymethyl cellulose with 1% to 20% by weight of a total weight of the washing product. The washing product is made from plant-based materials with biodegradability, nontoxicity and low-carbon property. |
| US11098271B2 |
Salt-free structured unit dose systems
A unit dose detergent pack includes a pouch and a structured detergent composition encapsulated within the pouch. The structured detergent composition includes a surfactant component including an alcohol ethoxy sulfate having a C8-C20 backbone that is ethoxylated with from about 1 to about 10 moles of ethylene oxide, a linear alkyl benzene sulfonate, a C8-C20 alcohol alkoxylated with about 2 to about 12 moles of an alkylene oxide, water and a non-aqueous solvent component. The structured detergent composition is free of an added rheology modifier. A combination of the surfactant component and the non-aqueous solvent component is present in a weight ratio of actives with a total amount of water of from about 1:0.4 to about 1:0.75 such that the structured detergent composition has a viscosity of at least about 100 Pa.s. |
| US11098270B2 |
Fabric treatment compositions and methods for providing a benefit
A fabric treatment composition having from about 2.5% to about 20% of a cationic polymer, from about 0.1% to about 20% of a perfume, and a surfactant system, the surfactant system having alkyl polyglucoside, and the composition having less than 5% by weight of an anionic surfactant. |
| US11098269B2 |
Composition suitable as surfactant
The present invention refers to a composition comprising two or more compounds of the general formula (I), a dry or liquid formulation comprising said composition as well as the use of said composition as surfactant or as anti-greying agent in a laundry process. |
| US11098268B2 |
Device for manufacturing scented candle
Provided is a device for manufacturing a scented candle, the device including: a main body; a wax and oil supply portion provided at an upper portion of the main body and including a wax supplier melting and supplying wax and an oil supplier supplying fragrance oil; a base provided at a lower portion of the main body; and a container provided on the base and receiving the liquid wax and the fragrance oil. |
| US11098257B2 |
Bioderived fuels and methods of making the same
The present disclosure relates to a composition that includes a first oxide having a phosphate, a ratio of Brønsted acid sites to Lewis acid sites between 0.05 and 1.00, and a total acidity between 50 μmol/g and 300 μmol/g, where the phosphate is at least one of a functional group covalently bonded to the first oxide and/or an anion ionically bonded to the first oxide. |
| US11098255B2 |
FCC yield selectivity improvements in high containment riser termination systems
The invention provides an improved system for separation technology intended to reduce unwanted catalyst/thermal reactions by minimizing contact of the hydrocarbons and the catalyst within the reactor. |
| US11098251B2 |
Reactor for the advanced thermal chemical conversion processing of municipal solid waste
A reactor system made up of a single canister or a plurality of separate canister sections for the advanced thermal chemical conversion processing of municipal solid waste (“MSW”), either sorted or unsorted, and autoclaves specially designed to process the waste at suitable temperature and pressure combinations is disclosed. The canister sections can be individually and separately filled with compressed bales of MSW or with selected loose MSW. The reactor system can produce syngas that has an enhanced BTU value, typically between about 300 to 700 BTU/ft3. The remainder solid waste material generally amounts to approximately 5% of the original MSW volume. This material can then be sorted for metals with the balance being sent to a landfill or other recycling processes depending on its composition. |
| US11098250B2 |
Liquid crystal composition, liquid crystal display element and liquid crystal display
Disclosed are a liquid crystal composition, a liquid crystal display element, and a liquid crystal display, said liquid crystal composition comprising one or more compounds represented by formula I, one or more compounds represented by formula II, one or more compounds represented by formula III and one or more compounds represented by formula IV, The liquid crystal composition of the present invention has a good stability to light and heat and a lower viscosity, and can attain a wider refractive index and a high clearing point (a wide service temperature range), and in particular, the liquid crystal composition has a high light transmittance, thus allowing a display device to have a high brightness or an energy saving effect. |