| Document | Document Title |
|---|---|
| US11300231B2 |
Flexible pipe and coupling therefor
Construction of a sealed connection between an elastomeric or synthetic polymer flexible pipe or hose and a metallic coupling member. The coupling member surrounds an armor layer at a free end of the flexible pipe or hose. A sealing area is defined by a recessed portion of the pipe coupling into which a sealing material is introduced. An inner liner layer of the flexible pipe or hose may extend into the sealing area where it is bonded to the sealing material. The sealing material and the inner liner layer may each be comprised of a semi-crystalline thermoplastic material. Furthermore, a reinforcement material may be provided in the inner liner layer. |
| US11300227B2 |
Tamper-resistant operating nut for hydrants
Example aspects of a hydrant and a method of preventing tampering with a hydrant are disclosed. The hydrant can comprise an operating stem extending from the hydrant, the operating stem defining an elongate stem passage; an operating nut comprising a first end, an opposed second end and a central bore defined in the operating nut and extending from the first end to the second end, the operating nut further defining a dowel bore, the operating stem extending through the central bore, the operating nut positioned such that the dowel bore and the stem passage are substantially co-axially aligned; and a dowel pin inserted through the dowel bore of the operating nut and the stem passage of the operating stem. |
| US11300226B2 |
Faucet with safety interlock for near-boiling and chilled water
A two-way or four-way water faucet dispenses near-boiling water on demand but has a safety interlock. A control valve assembly is attached to the faucet. The interlock uses two disks pressed into contact, each having a single projecting sector. One disk is fixed to the valve body. The other disk, fixed to the handle, slides against the first. The disks must be pulled apart by sliding the handle while it is being turned to superimpose the sectors and turn the control valve, connecting the faucet to the vented near-boiling water supply. A reed switch inside the fixed sector is activated by a magnet inside the rotatable sector and activates a near-boiling water pump. |
| US11300218B2 |
Three-way flow dividing valve structure
A three-way flow dividing valve structure is provided, including a valve body, a water divider, a spring, and a switch handle. A water intake communicating with the water inlet is formed on the side wall of the flow dividing chamber. A first and second outlet holes respectively communicating with the water outlets are formed at the bottom of the flow dividing chamber. The water divider includes a water dividing shaft and a water dividing dish; the bottom of the water dividing shaft is connected to the water dividing dish in the flow dividing chamber. The water dividing dish has a water dividing hole movably communicating with the outlet holes. The top of the water dividing shaft protrudes from the valve body and is connected to the switch handle. Two ends of the spring abut against the water dividing dish and the bonnet respectively. The present disclosure can be operated effortlessly. |
| US11300214B2 |
Top entry ball valve
A top entry ball valve includes a housing with a central cavity communicating with two bores co-axial along a first axis. A ball valve element is rotatably mounted within the cavity for rotation about a second axis. The valve element includes a through bore; first and second seat assemblies, mounted within the co-axial bores, respectively; first and second gear assemblies engaged with the seat assemblies, respectively; and first and second rotatable drives engaged with the gear assemblies respectively. The gear assemblies are configured to move the seat assemblies along the first axis in a first direction away from the valve element when the drives are rotated in a first direction, and to move the seat assemblies along the first axis in a second direction, opposite to the first direction, when the drives are rotated in the opposite direction, to bring the seat assemblies into sealing contact with the valve element. |
| US11300212B2 |
Device for regulating the pressure of fluids
A device (1) is represented and described for regulating the pressure of fluids, comprising: a valve housing (6) with an inlet (16) and with an outlet (15), a closure element (2), which is arranged inside the valve housing (6), and a valve seat (3), which is arranged inside the valve housing (6), wherein the closure element (2) is mounted so as to be movable and wherein the closure element (2) and the valve seat (3) are arranged such that the connection between the inlet (16) and the outlet (15) can be opened and partially or fully closed. In order to prevent the closure element (2) and the valve seat (3) becoming stuck in the case of an abrupt fall in pressure, it is proposed that the valve seat (3) is mounted so as to be movable. |
| US11300201B2 |
Method and control unit for operating a vehicle drive train
A method for operating a vehicle drive train (1) includes, during a downshift, disengaging at least one shift element (A through F) from a power flow of the transmission (5), guiding a power transmission capacity of a torque converter lockup clutch (4) to a level at which the torque converter lockup clutch (4) is in a non-slip operating condition during a positive engine override when a rotational speed of a prime mover (2) is guided towards a synchronous speed of a demanded desired ratio, and guiding the power transmission capacity of the torque converter lockup clutch (4)—no later than a point in time of the downshift at which the rotational speed of the prime mover (2) is equal to the synchronous speed of the desired ratio—to a level at which the torque converter lockup clutch (4) is transferred into a continuous slip operation due to torque. |
| US11300196B2 |
Oil cooling apparatus for hydrostatic transmissions
The present invention relates to an oil cooling apparatus for hydrostatic transmissions that includes a cooling main body coupled to a transmission case in which a hydrostatic transmission is installed; an accommodating groove formed in the cooling main body to accommodate oil; a cover unit coupled to the cooling main body to cover the accommodating groove; a supply port configured to supply the oil to the accommodating groove; a discharge port configured to discharge the oil from the accommodating groove; a plurality of guide ribs installed at positions spaced apart from each other to guide a flow direction of oil flowing along a flow path formed in the accommodating groove; a first hurdle unit coupled to at least one of the guide ribs to form a first flow region through which the oil passes; and a second hurdle unit coupled to at least one of the guide ribs to form a second flow region through which the oil passes. |
| US11300194B2 |
In-situ tuning system for speed increasing gearbox and pinion resonance
The present disclosure relates to a tuning system for modulating stiffness of a gearbox 102 and a pinion 502. The tuning system comprises one or more incremental masses 606 adapted to be attached to a non-drive end (NDE) side 504 of the pinion 502 of the gearbox 102 to allow modulation of resonant frequency of the pinion 502, and a plurality of tie rods 104 coupled between a base plate 106 of the gearbox 102 and split axial line 108 casing of the gearbox 102, wherein the plurality of tie rods 104 are adapted to modulate effective stiffness of the gearbox casing in a specific direction. |
| US11300192B2 |
Chainring for a bicycle
A bicycle chainring may have a plurality of first teeth that fit within the narrow link spaces in a drive chain, and a plurality of second teeth that fit within the wide link spaces in a drive chain. Each second tooth may have a first width that is greater than the its tip width at a location that is between about 40% and about 60% of the tooth height and a second width that is greater than the first width and is between the first plane and the root. A first transition portion may be on a first side of the second tooth and may extends between a first edge that is at the tip and extends in an edge direction that is substantially parallel to the central plane and a second edge that is disposed at the second plane and extends in the edge direction. |
| US11300190B1 |
Gear assembly with optimized configuration for mesh stiffness
A gear assembly includes a first gear having a first hub surrounded by a first plurality of teeth. The first plurality of teeth each define a respective first contact region. The gear assembly includes a second gear having a second hub surrounded by a second plurality of teeth. The second plurality of teeth are adapted to mesh with the first plurality of teeth at the respective first contact region in order to drive a respective load in a first direction. The first hub and the first plurality of teeth include respective zones defining a respective elastic modulus. A three-dimensional distribution of the respective physical size and the respective elastic modulus of the respective zones is optimized such that a fluctuation of mesh stiffness along the respective first contact region is at or below a first predefined threshold. |
| US11300184B1 |
Variable output transmission
A transmission is described. The transmission employs a main input sprocket configured to be driven by a drive system of the apparatus implementing the transmission. The main input sprocket is disposed on and coupled to a main axle of the transmission. The transmission further includes an output gear that is configured to float on the main axle and is connected to a driven output component of the apparatus implementing the transmission. By floating on the main axle, the output gear can rotate at a rate that differs from a rotational rate of the main input sprocket. To control a rate at which the output gear rotates relative to the main input sprocket, the transmission employs a reference carrier floating on the main axle. A rotational rate of the reference carrier dictates an amount of torsional relief from the main input sprocket to the output gear. A rate at which the reference carrier rotates about the main axle is controlled by a control system of the transmission, which may be implemented as a computer-based control system, a mechanical feedback-based control system, and combinations thereof. |
| US11300182B2 |
Side portion, chain link and energy guiding chain
A side portion for a chain link of an energy guiding chain. The side portion has at its ends a respective overlap region which, for limiting pivotal movement, are provided with corresponding abutment surfaces and with a pivot axis, that is to say a first overlap region having first abutment surfaces and a second overlap region having second abutment surfaces. For damping of the pivotal movement, disposed in front of at least each first abutment surface is a spring lip which is resiliently deformable about a bending axis parallel to the pivot axis. The spring lip has an end region which is axial with respect to its bending axis, for coupling in the kinetic energy which is transmitted to said spring lip in the position of installation by the second abutment surface, that corresponds to the first abutment surface, of the second overlap region of the adjacent chain link. |
| US11300179B2 |
Metal belt for belt-driven continuously variable transmission
Provided is a metal belt for a belt-driven continuously variable transmission in which metal elements are capable of keeping the compliance value small even when defamed. Each metal element of the metal belt includes a body portion located radially inward of metal rings, an ear portion located radially outward of the metal rings, and a neck portion sandwiched by the pair of metal rings and connecting the body portion and the ear portion. At least one of a front surface and a rear surface of the metal element has a recess at a center region in a right-left direction of the ear portion, and the depth of the recess is larger than the amount of curving in a front-rear direction of the ear portion. |
| US11300173B2 |
Cylinder device and method for manufacturing cylinder device
A bracket of a cylinder device includes: a tubular portion having a C-shaped cross section, holding an outer periphery of the outer shell, and having a slit in a front portion; and a pair of mounting portions and protruding outward in the radial direction from both ends of the tubular portion in the circumferential direction. The tubular portion includes a hole formed to permit insertion of the protrusion, from at least one side portion to the back portion of the tubular portion. |
| US11300171B2 |
Spring apparatus
A spring apparatus (10), including: a spring (12); an elongated object (18A) disposed within and along the spring (12); and a mode-changing assembly (16), for providing a first mode in which a portion (38) of the spring (12) being along the elongated object (18A) is not springy, and a second mode in which an entire of the spring (12) is springy. |
| US11300169B2 |
Brake disc
A brake disc according to one embodiment includes a first disc, a second disc apart from the first disc in an axial direction, and a plurality of pins disposed at intersections of three types of virtual lines and whose one ends are connected to a side of the first disc facing the second disc. The three types of virtual lines are a plurality of virtual circles concentric with the first disc, a plurality of first virtual spiral patterns passing through the center of the first disc and curved rightward when viewed from the axial direction, and a plurality of second virtual spiral patterns passing through the center of the first disc and curved leftward when viewed from the axial direction. In one embodiment, the intersections are arranged symmetrically with respect to an imaginary line connecting any one of the intersections and the center when viewed from the axial direction. |
| US11300164B2 |
Control device for engagement mechanism
A control device includes: an engagement mechanism having a first engagement element and a second engagement element; and an actuator that generates a thrust that brings the first engagement element and the second engagement element close to each other when the engagement mechanism is engaged. The control device performs engagement with the thrust of the actuator when a differential rotation speed of the engagement mechanism is less than a predetermined value. In the control device, a parameter indicating an operating state of the actuator is detected, a target differential rotation speed is calculated in accordance with a value of the detected parameter, and the differential rotation speed is controlled to the calculated target differential rotation speed. |
| US11300162B2 |
Axle and propeller shaft quick-connect joint attachment assembly
A joint assembly (10) including a female member (12), a male member (40) and a retaining member (60). The female member has a first axial end (18), a second axial end (20) and a cylindrical body portion (14) extending between the first axial end and the second axial end having a splined radially inner surface. The male member has a first axial end portion (42), a second axial end portion (46), and a splined tubular portion (44) extending between the first axial end portion and the second axial end portion. The retaining member (60) includes an annular portion and a plurality of attachment features defining an aperture. The second axial end portion of the male member has a circumferential groove (48) on the outer surface thereof. The second axial end portion of the male member extends through the aperture of the retaining member and the attachment features extend into the groove of the male member. |
| US11300160B2 |
Bearing with gliding target and associated sensor
A bearing providing a first ring and a second ring capable of rotating concentrically relative to one another, at least one annular groove being formed on the second ring and oriented towards the first ring. The bearing further providing at least one target element engaged inside the groove of the second ring while being freely gliding inside the groove in the circumferential direction, the target element protruding into a hole formed on the first ring so that the target element is blocked in rotation by the first ring when the second ring rotates and the first ring is fixed, and at least one sensor mounted on the first ring and facing the target element to detect axial positions of the target element. |
| US11300154B2 |
Method for producing a ball stud
Method for producing a ball stud with a joint ball and a shank, wherein the shank includes at least a neck region adjoining the joint ball and a fastening section opposite the joint ball, characterized by the steps: a) plastically shaping a semi-finished ball stud product; b) mechanically machining the semi-finished ball stud product; c) rolling the surface of the joint ball; d) thermochemically hardening the surface of the semi-finished ball stud product; e) removing the surface-hardened layer at least in the neck region and/or the fastening section; f) oxidizing the semi-finished ball stud product; g) polishing the joint ball. |
| US11300151B2 |
Segmented nut
A segmented nut is formed by three segments held together with a sleeve for transport and fastening use. Rotation of the sleeve, such as in the order of 60°, frees the segments, allowing for quick release of the nut. |
| US11300150B2 |
Barrel nut
A barrel nut for a fastener is disclosed. The barrel nut is configured to prevent axial movement of the fastener relative to a structure on which the fastener is installed. The barrel nut comprises a first part and a second part pivotable relative to the first part. |
| US11300145B1 |
Periodic unsteadiness generator
The systems and methods provided herein are directed to a stationary device for simulating the periodic unsteadiness typically produced by turbines in an air stream. A streamlined body includes a line of jets along its leading edge that pulses air at an angle against the air stream, and a separate line of jets along its trailing edge to expel a sustained air flow in the same direction as the air stream. |
| US11300142B2 |
Fan and motor thereof
A fan includes a base, a motor and an impeller, and the motor includes a sleeve, a rotor, a position limiting element and a composite elastic element. The sleeve is disposed on the base, and the sleeve has a bottom portion and a side wall, which constitute an accommodation space. The rotor has a rotating shaft disposed within the accommodation space, and the rotating shaft has an outer wall. An annular groove is formed on the outer wall and has a surface. The position limiting element is disposed on the sleeve and extended from the side wall toward the rotating shaft, and the position limiting element has a bottom surface. The bottom surface faces toward the bottom portion, and the bottom surface is interfered with the surface, thereby eliminating the gap between the bottom surface and the surface. Therefore, noise of the up and down vibration is avoided from generating. |
| US11300137B2 |
Centrifugal fan
A centrifugal fan includes an impeller including blades, a motor, a housing, and a resin section. The blades are arranged in the circumferential direction about a central axis extending in the vertical direction. The rotor of the motor is rotatable with the blades about the central axis. The housing includes a plate-shaped bottom plate that extends in the radial direction from the central axis, and a housing protrusion that protrudes upward from the upper surface of the bottom plate and extends in the circumferential direction. A housing recess, which is recessed downward, is located in the upper surface of the bottom plate. The resin section includes a resin filled portion filled in the housing recess, and a resin protrusion that is disposed below the blades, protrudes upward from the resin filled portion, and extends in the circumferential direction. |
| US11300131B2 |
Electric motor system and turbo compressor provided therewith
A radial load of a drive shaft is supported by only a plurality of bearingless motors. Maximum values of the radial load acting on the plurality of bearingless motors are not uniform. The bearingless motor, the maximum value of the radial load acting on which is the largest, has a greater maximum value of supporting magnetic flux generated to generate an electromagnetic force for supporting the radial load, compared with the bearingless motor, the maximum value of the radial load acting on which is the smallest. This configuration allows a reduction in size of a rotary system including a load and a drive shaft in an electric motor system. |
| US11300128B2 |
Bladeless ceiling fan
A bladeless ceiling fan is provided. The bladeless ceiling fan includes a housing configured to accommodate an electric motor. The housing can define one or more vents through which air enters an interior of the housing. The bladeless ceiling fan can further include an airfoil defining an interior passage. In addition, the bladeless ceiling fan includes one or more conduits. The one or more conduits extend from the housing to the airfoil such that air within the interior of the housing flows through the one or more conduits and into the interior passage defined by the airfoil. |
| US11300126B2 |
Compressor having controllable oil supply and vehicle
A compressor (100) and a vehicle are disclosed. The compressor (100) includes: a housing (1); a separating component (2) dividing an interior of the housing (1) into a low-pressure chamber (13) and a high-pressure chamber (14); a cylinder component (3); a crankshaft (4); a plurality of oil transmission grooves (5); and at least one oil transition groove (6). During the rotation of the crankshaft (4), each oil transition groove (6) is intermittently in communication with oil transmission grooves (5) adjacent thereto. The oil transition groove (6) is alternately in communication with two oil transmission grooves (5) located at two circumferential sides of the oil transition groove (6). An oil-way passage (31) of the cylinder component (3) is in communication with one of oil transmission grooves (5), and another one of oil transmission grooves (5) or the oil transition groove (6) is in communication with the low-pressure chamber (13). |
| US11300124B2 |
Single-screw compressor with a gap adjuster mechanism
A single-screw compressor includes a screw rotor with a helical groove, a cylindrical wall rotatably housing the screw rotor, a gap adjuster mechanism, and a gear-shaped gate rotor having a plurality of flat gates. The gate rotor is arranged outside the wall. Some of the gates enter a space inside the wall via an opening formed in the cylindrical wall and mesh with the screw rotor. A fluid is compressed in a compression chamber defined in the helical move by the screw rotor, the gates meshing with the screw rotor, and the wall. The gap adjuster mechanism avoids contact between a front surface of the gate rotor toward the compression chamber and a sealing surface of the wall facing the front surface, by displacing at least one of the gate rotor and the sealing surface of the wall in an axial direction of the gate rotor. |
| US11300121B2 |
Downhole pump sand filtering snares
Disclosed is a plunger for use in a sucker-rod pumping system. The plunger reciprocates within a barrel. The plunger comprises first, second, and third sections, in which the first and third sections are sealed against the barrel and in which a second section is between the first and third sections and in some embodiments may be a pull tube. A through passage for production fluid is provided, along with a pressure balancing chamber that is connected to the through passage via a sand snare, where the pressure balancing chamber is operable to equalize pressure on longitudinal sides of the seals, whereas the sand snare operates to restrain solids from reaching the pressure balancing chamber from the through passage (which is carrying the production fluid) and thereby create a slippage flow in the pressure balancing chamber, which equalizes pressure between the balancing chamber and the plunger's through passage. Further disclosed in embodiments a port between the second section and the first or third sections, where the port allows in one passage production fluid to pass through it between sections and in another passage or chamber allows slippage fluid to pass through it between sections. |
| US11300117B2 |
Air supply system with electronic converter
An air supply system having a compressor driven by a motor for producing compressed air, an air drier system for extracting moisture from the compressed air produced, an electronic converter for demand-dependent control of the compressor and analog and/or digital sensors for producing electrical signals, the electrical signals being useful for controlling the electronic converter and for monitoring and controlling the compressor. The electrical signals produced by the sensors are converted in the electronic converter to bus signals that can be provided for evaluation at a bus interface. |
| US11300113B2 |
System for retaining a valve assembly in a cavity formed in a cylinder body of a compressor and method of use thereof
A system for retaining a valve assembly in a cavity formed in a cylinder body of a compressor includes a ring having a through-hole positioned adjacent to the cavity and a cover partially inserted inside a through-hole of the ring. The cover and the ring can slide relative to each other. The position of the cover relative to the cylinder body can be adjusted by tightening a cover retainer. The cover applies a downward force on the valve assembly via a cage. The downward force is used to compress a seal located between the valve assembly and the cylinder body. A seal is positioned between the ring and the cover. The seal remains squeezed when the cover and the ring slide relative to each other. The system can be used to convert a jackbolt cage-cover assembly and may not require significant machining of the cavity to provide a surface-finish with a suitable roughness for a sealing surface. |
| US11300110B2 |
Double acting two stage integrated pump
A piston type pump includes a pump housing having at least one pump inlet, at least one pump outlet, and a piston arrangement connected to a drive shaft configured to, when driven, set the piston arrangement into movement. The piston arrangement includes a first primary stage piston, the first primary stage piston being slidably seated in a first primary stage cylinder formed in the pump housing, and a first secondary stage piston. The first secondary stage piston is slidably seated in a first secondary stage cylinder formed in the first primary stage piston. |
| US11300108B2 |
Wind turbine
A wind turbine for generating electric energy including a tower equipped with rotatable nacelle with rotor which is rotatable about a horizontal rotational axis and which comprises an electric generator. The wind turbine additionally comprises a device for determining flow direction and speed of the wind and a device for or regulating the alignment of the rotor against the wind. The device for determining speed and flow direction comprises pair of receiving antennas, for obtaining electric signals using electrically influenced particles, molecules carried by the wind and are supplied to a correlation measurement device. Here, the time needed by the electrically influenced particles/molecules to traverse the distance between the receiving antennas of a pair of receiving antennas is determined. Subsequently, speed and flow direction of the wind are calculated in a computing device and are supplied to the device for controlling or regulating the alignment of the rotor. |
| US11300107B2 |
Detection of oscillating movement of a wind turbine
Provided is a system for determining an amount of oscillating movement of a wind turbine, the wind turbine including a tower, a non-rotating upper part supported by the tower, a rotor having a rotor axis, and a generator for generating electric power. The system includes (a) a sensor unit adapted to provide a rotor speed signal indicative of a rotational speed of the rotor relative to the non-rotating upper part, (b) a filtering unit adapted to, based on the rotor speed signal provided by the sensor unit, provide a filtered signal including information associated with an oscillating movement of the wind turbine, and (c) a processing unit adapted to determine the amount of oscillating movement based on the filtered signal provided by the filtering unit. Furthermore, a wind turbine and a method are described. |
| US11300106B2 |
System and method for utilizing wear debris sensor to reduce damage and extend remaining useful life of gearboxes
A system and method employing wear debris sensors to monitor the operation of a lubricated mechanical system such as a gearbox (e.g., in a wind turbine), a transmission or an engine in order to control operation of the gearbox in order to reduce damage and/or extend the useful life of the gearbox. |
| US11300105B2 |
Wind turbine with a movable container housing a hoisting mechanism
A wind turbine (1) comprising a tower (2) and a nacelle (3) mounted on the tower (2) is disclosed. A movable container (39) is mounted on a lower part of the nacelle (3) or suspended below the nacelle (3), the movable container (39) housing a hoisting mechanism for hoisting and/or lowering the movable container (39) and for hoisting and/or lowering wind turbine components (9, 10, 11). |
| US11300104B2 |
Wind turbine blade removal and installation system and method
An apparatus for removing and installing a blade for a wind turbine is provided, comprising a first set of cable guides mounted within the nacelle, and a second set of cable guides positioned on an exterior surface of the rotor hub. An upper pulley block is suspended from a first hub flange and a second hub flange, wherein the upper pulley block is positioned above a third hub flange in a position for accepting the blade. A winch is positioned at a ground level, and the winch contains a lifting cable guided by the cable guides, and then reeved through the upper pulley block and a lower pulley block on a blade holding bracket, allowing the lower pulley block to be raised and lowered relative to the upper pulley block. The blade holding bracket attaches to the root end of the blade, and the lower pulley block is allowed to pivot and swivel relative to the blade holding bracket. |
| US11300101B2 |
Control system for wind turbines for reducing disturbances in an electrical grid
The present invention relates to a method for controlling a power plant for reducing spectral disturbances in an electrical grid being operative connected to the power plant, the power plant comprising a plant controller, at least one wind turbine and at least one auxiliary energy source, wherein the at least one wind turbine comprises a rotor adapted to drive a power generator via a shaft, wherein the generator is connectable with the electrical grid, and at least one damping controller configured to compensate structural oscillations of the wind turbine by controlling a torque on the shaft, wherein the at least one damping controller is capable of setting a limit of a control action on the shaft, the method comprising the steps of determining disturbance information for the power plant in the form of an electrical disturbance at a point of measurement electrically connected to the power plant, determining set-points for the at least one auxiliary energy source based on the determined disturbance information, and assigning the set-points to the at least one auxiliary energy source in order to counteract at least part of the electrical disturbance at the point of measurement using at least part of an available amount of energy from the at least one auxiliary energy source. |
| US11300099B2 |
Air density dependent turbine operation
A wind turbine controller includes a thrust limiter for controlling the thrust of the blades of wind turbine using an estimate of the air density at the wind turbine. In one embodiment, the controller receives the blade flap load indicating the current load on one of the blades which varies linearly to the air density experienced by the wind turbine. In one embodiment, the controller determines the mean of a plurality of the blade flap load values measured during a predefined time period. Using a transfer function, the controller converts the mean of the blade flap loads to an estimate of the air density at the turbine. Generally, higher air density results in greater loads on the blades while lower air density results in lower loads on the blades. |
| US11300096B2 |
Method for determining arrangement position of vortex generator on wind turbine blade, method for producing wind turbine blade assembly, and wind turbine blade assembly
A method for determining an arrangement position of a vortex generator on a wind turbine blade includes: determining, for a first region of a mounting range of the vortex generator in a blade spanwise direction, an arrangement position of the vortex generator to be an angular position offset by a predetermined angle toward a trailing edge of the wind turbine blade with reference to an inflow angle of wind to the wind turbine blade; and determining, for a second region closer to a blade tip, the arrangement position of the vortex generator to be a position between a separation position of a flow on a surface of the wind turbine blade under a rated wind speed condition and a transition position of the flow on the surface of the wind turbine blade under a variable speed operation condition of a wind turbine including the wind turbine blade. |
| US11300095B2 |
Wind turbine suitable for mounting without a wind turbine tower
This invention discloses an improved wind turbine suitable for mounting without a wind turbine tower. The wind turbine is based on a rotor with appropriately selected blades. A nozzle and diffuser in the wind flow increase the amount of wind energy available to the rotor. The rotor is interruptibly connected with one or more of a plurality of generators which allows generation at a wide range of wind speeds. The rotor is also interruptibly connected with a co-axial flywheel which allows for storage or use of rotational energy as needed by the availability of wind energy. One or more wind turbines can be grouped together in a common housing. Electricity can also be generated by means of stored energy. The lack of a wind turbine tower and the general compact design allows the wind turbine to be used in close proximity to or on buildings. |
| US11300094B1 |
High efficiency compressed-air power generation system
A high efficiency compressed-air power generation system has a main casing forming a main passage, a main rotor, an air distributor, and a main generator. The main passage has an intake section and a turbine section. The suction opening is connected to the intake section of the main passage, and the main outlet opening is connected to a turbine section of the main passage. The main rotor is rotatably mounted in the turbine section. The air distributor is configured to supply compressed air into the intake section via multiple nozzles directed toward the main turbine wheels. When compressed air is released from the air distributor, ambient air is sucked into the intake section by compressed air released by the air distributor utilizing Bernoulli's principle. The main rotor is rotated by a mixture of compressed air and ambient air to drive the main generator. |
| US11300087B2 |
Valve, in particular a suction valve, in a high-pressure pump of a fuel injection system
A valve including a magnet actuator (22) which has a magnet coil (6), a magnet armature (10) that moves in a stroke-like manner, and a pole core (20), wherein the magnet armature (10) and the pole core (20) together limit a working air gap (28), and the magnet armature (10) can at least indirectly contact the pole core (20), wherein the valve also has a valve element (14) which can be moved between an open position and a closed position, and which is at least indirectly in mechanical contact with the magnet armature (10). A separate magnet armature insert (8) arranged in the magnet armature (10) and/or a separate pole core insert (24) arranged in the pole core (20) is provided in the contact area of the magnet armature (10) on the pole core (20), in order to achieve a separation of the mechanical and magnetic forces. |
| US11300086B2 |
Fuel and oil system
A fuel and oil system includes a fuel pump, an oil pump, and a fixed electrical drive. A first electric motor controller of the fuel and oil system supplies a variable electrical drive, and a second electric motor controller supplies a variable electrical drive. The fuel pump is selectively connected to and driven by the first electric motor controller or the second electric motor controller. The oil pump is selectively connected to and driven by the second electric motor controller or the fixed electrical drive. |
| US11300084B2 |
Method and apparatus for heating a fuel
A fuel heating apparatus and method are disclosed where a conductive coil is wrapped around an outer surface of at least a portion of a nozzle of a fuel injector. The coil and the nozzle are inductively cooperative with each other such that the coil, in response to a variable current through the coil, induces a heating of the nozzle. The inductively heated nozzle can heat fuel passing into an engine so as to cause the fuel to combust as it exits the heated nozzle. This arrangement allows for sparkless combustion of fuel in an internal combustion engine. |
| US11300083B1 |
Methods and systems for operating a vehicle with two fuel tanks
Systems and methods for operating a fuel system that includes two separate fuel tanks are disclosed. In one example, fuel may be purged from a fuel rail in response to Reid vapor pressure of a fuel so that engine starting may be improved. A fuel with a higher Reid vapor pressure may be pumped into the fuel rail when the engine is expected to be cold started. |
| US11300080B2 |
Fuel tank protector valve and engine systems having same
A dual chamber fuel tank protector valve has a transversely oriented divider defining a plurality of apertures for fluid flow between a first port and a second port. Each chamber has a seal disk therein. The first seal disk is normally biased to an open position by a first biasing member. The second seal disk is normally biased to a closed position by a second biasing member having a preselected biasing force set to a preselected pressure differential that allows movement to its open position before the first seal disk moves to its closed position. When the first seal disk and the second seal disk move to their respective closed positions, the direction of movement is toward one another. |
| US11300077B2 |
Deployable fairing for door reversers systems and methods
A thrust reverser may include a frame, an actuation arrangement, a reverser door pivotally coupled to the frame, and a deployable fairing pivotally coupled to the frame, wherein the deployable fairing is configured to move away from a central axis of the thrust reverser to provide clearance for one of more thrust reverser pivot doors to rotate into a deployed position. |
| US11300071B2 |
Cylinder for opposed-piston engines
A cylinder for opposed-piston engines includes a liner with a bore and longitudinally displaced intake and exhaust ports near respective ends thereof. An intermediate portion of the liner between the exhaust and intake ports contains a combustion chamber formed when the end surfaces of a pair of pistons disposed in opposition in the bore are in close mutual proximity. A compression sleeve encircles and reinforces the intermediate portion of the liner. An annular grid of pegs disposed between the intermediate portion and the compression sleeve supports the compression sleeve against the liner and defines a turbulent liquid flow path extending across the intermediate portion in a direction that parallels the longitudinal axis of the liner. |
| US11300064B2 |
Methods and systems for an aftertreatment system
Methods and systems are provided for an aftertreatment system. In one example, a system comprising a spark-ignited engine comprising a selective catalytic reduction device (SCR) arranged in an exhaust passage downstream of a catalyst, and an injector positioned to inject a reductant directly into the exhaust passage downstream of the catalyst subsequent an engine shut-off event. |
| US11300060B1 |
Methods and system for engine braking via electric boosting device
Methods and systems are provided for engine braking in a vehicle. In one example, a method may include deactivating fueling to at least one cylinder of an engine, increasing an air mass provided to the engine via an electric boosting device, and adjusting an exhaust valve opening timing of the at least one cylinder in response to a request for engine braking. In this way, an amount of engine braking torque may be increased with reduced wear to engine system components. |
| US11300047B2 |
Combustion device and gas turbine
A combustion device includes an ammonia supply unit supplying primary reduction ammonia as a nitrogen oxide reducing agent into a combustor and mixing secondary reduction ammonia with combustion exhaust gas discharged from the combustor to reduce nitrogen oxide contained in the combustion exhaust gas and a controller configured to control at least one of the amount of supply of the primary reduction ammonia and the amount of mixing of the secondary reduction ammonia with the combustion exhaust gas in accordance with concentrations of residual nitrogen oxide and residual ammonia contained in the combustion exhaust gas after being discharged from the combustor. |
| US11300046B2 |
Compression-ignition internal combustion engine
A compression-ignition internal combustion engine includes a fuel injection nozzle including a tip end portion exposed in a combustion chamber and a nozzle hole formed at the tip end portion; and a passage forming member forming a flow guide passage through which fuel injected from the nozzle hole passes. The passage forming member includes a passage wall portion located radially outward of the flow guide passage. The passage wall portion includes a first layer that is a base portion connected to a cylinder head, and a second layer located radially outward or radially inward of the first layer. The toughness of the first layer is higher than the toughness of the second layer. The thermal conductivity of the second layer is lower than the thermal conductivity of the first layer. |
| US11300045B2 |
Systems and methods for an electrically driven direct injection fuel pump
Methods and systems are provided for operating an electric motor to drive either a transmission fluid pump or a direct injection fuel pump. In one example, a method may include operating an electric motor to drive a direct injection fuel pump to supply fuel to a direct injection fuel rail while an engine of a start/stop vehicle is on, and operating the electric motor to drive an auxiliary transmission fluid pump to circulate transmission fluid to a transmission rotationally coupled to the engine while the engine is off during an auto-stop. In this way, the direct injection fuel pump may be electrically driven without increasing vehicle costs through adding an additional electric motor. |
| US11300041B2 |
Turbocharger
A turbocharger includes a first scroll member made of sheet metal, extending in a circumferential direction of an impeller shaft, having an opening that is opened to the bearing housing, and forming a part of a wall surface of the first turbine scroll passage, a second scroll member made of sheet metal, extending in the circumferential direction of the impeller shaft, having an opening that is opened to the bearing housing, and forming a part of a wall surface of the second turbine scroll passage, and a closing member closing the opening of the first scroll member and forming the wall surface of the first turbine scroll passage on the side thereof adjacent to the bearing housing, and closing the opening of the second scroll member and forming the wall surface of the second turbine scroll passage on the side thereof adjacent to the bearing housing. |
| US11300038B2 |
Engine having prechamber ignition and method of controlling such an engine
The invention relates to an engine having prechamber ignition, in particular a gas engine, that comprises a main combustion space in a cylinder of the engine for combusting an air-fuel mixture and a prechamber having an ignition device arranged therein and a fuel injector arranged therein, wherein the prechamber has at least one transfer port that fluidically connects the prechamber to the main combustion space. The engine is characterized in that the fuel injector arranged in the prechamber is the only fuel injector via which fuel can be introduced into the associated main combustion space. |
| US11300036B2 |
Vehicle drive-force transmitting apparatus
A vehicle drive-force transmitting apparatus including: a casing; a drive-force transmitting mechanism disposed in the casing; and first and second oil pumps configured to suck, through respective inlet ports thereof, oil stored in a bottom portion of a casing, such that the drive-force transmitting mechanism is lubricated by the oil pumped up by the first and second oil pumps. The casing is provided with a drain hole through which the oil stored in the bottom portion of the casing is to be discharged to an exterior of the casing. A position of opening of the inlet port of the first oil pump is lower than a position of a lower end of the drain hole, and a position of opening of the inlet port of the second oil pump is higher than the position of the lower end of the drain hole. |
| US11300034B2 |
Standby generator air flow management system
A standby generator includes a standby generator enclosure having one or more airflow openings, a first air duct and a second air duct each coupled to at least one of the one or more airflow openings, and an engine and an alternator driven by the engine mounted in the enclosure. An engine cooling fan is driven by the engine to force a first stream of cooling air from the first air duct through the engine in a direction opposite the alternator, and an alternator cooling fan is coupled to the alternator and driven by the engine to force a second stream of cooling air from the second air duct through the alternator in a direction opposite the engine. |
| US11300032B2 |
Abnormality detection apparatus for electrically heated catalyst
An abnormality detection apparatus calculates an actually supplied electrical energy defined as the integrated value of electrical power actually supplied to the electrically heated catalyst over a specific period from the time when the supply of electrical power to the electrically heated catalyst is started and a target electrical energy in the specific period, and further calculates, from these integrated values, an accomplishment parameter relating to the ratio of the actually supplied electrical energy to the target electrical energy. The abnormality detection apparatus detects an abnormality of the electrically heated catalyst by comparing the accomplishment parameter with a specific threshold. The abnormality detection apparatus is configured to set the specific threshold according to the temperature of the electrically heated catalyst at the time when the supply of electrical power is started. |
| US11300030B2 |
Decomposition chamber for aftertreatment systems
A decomposition chamber for an aftertreatment system includes: a body including: an inlet configured to receive exhaust gas; an outlet configured to expel the exhaust gas, a thermal management chamber in fluid communication with the inlet, the thermal management chamber configured to receive a first portion of the exhaust gas from the inlet, and a main flow chamber in fluid communication with the inlet, the main flow chamber configured to receive a second portion of the exhaust gas from the inlet and to receive the first portion of the exhaust gas from the thermal management chamber; and a diffuser positioned within the main flow chamber, the diffuser including: a diffuser inlet portion including a plurality of diffuser perforations, the diffuser inlet portion configured to receive the exhaust gas from the main flow chamber, and a diffuser flange portion configured to receive the exhaust gas from the diffuser inlet portion and provide the exhaust gas to the outlet. |
| US11300027B2 |
Mixer device, a use thereof and a method for mixing
The invention relates to mixer device (52) for mixing and an additive to the exhaust gas flow from a combustion engine. The mixer device has an additive injection means (1) and a conduit (2) with an inlet opening and an outlet opening. The conduit (2) has a widened portion (5) between the inlet opening and the outlet opening. The additive injection means (1) is located in the widened portion (5) for injecting the additive into the widened portion. The widened portion (5) at the location of the additive injection means (1) defines an injection width (W) being the distance from the additive injection means (1) to the opposite part (6) of the conduit (2). The injection width (W) is larger than the maximum width (W1) of the conduit (2) adjacent the inlet opening. According to the invention, the cross sectional area of the conduit (2) at the location of the additive injection means (1) is smaller than 1.2 times the cross sectional area of the conduit (2) adjacent the inlet opening. The invention also relates to a use of the mixer device and to a method for mixing an additive to an exhaust gas from a combustion engine. |
| US11300025B2 |
Systems and methods for reducing reductant deposit formation in a decomposition reactor of an exhaust gas aftertreatment system for an internal combustion engine
An exhaust gas aftertreatment system includes a decomposition reactor, an injector, and a processor. The decomposition reactor includes a body, an impingement structure, and a heater. Exhaust gas is flowable through the body. The body includes an inlet and an outlet. The inlet is configured to receive the exhaust gas at a first temperature. The outlet is configured to selectively expel the exhaust gas at a second temperature greater than the first temperature. The impingement structure is disposed within the body between the inlet and the outlet. The impingement structure extends into the body and is located such that the exhaust gas flowing through the body impinges on the impingement structure. The heater is coupled to the impingement structure and configured to selectively heat the impingement structure. The injector is configured to inject reductant into the body. The processor is programmed to control the heater. |
| US11300024B2 |
Heat exchanger
In a heat exchanger installed on an intake path or exhaust path of an internal combustion engine and configured to cool gas by transferring heat between the gas containing exhaust and refrigerant, a water-repellent portion is formed at part of a portion that contacts the gas in a gas path through which the gas flows, and a hydrophilic portion is formed at another part of the portion. The water-repellent portion is a portion provided with water-repellent treatment. The hydrophilic portion is a portion provided with hydrophilic treatment. The hydrophilic portion is formed at a part having a temperature lower than the temperature of the part at which the water-repellent portion is formed while the heat exchanger is actuated. |
| US11300016B2 |
Valve opening and closing timing control device
A valve opening and closing timing control device includes a drive-side rotating body that rotates synchronously with a crankshaft of an internal combustion engine, a driven-side rotating body that rotates with a camshaft of the internal combustion engine, an electric motor that controls a relative rotation phase of the drive-side rotating body and the driven-side rotating body, a motor control unit that controls a current supplied to the electric motor, a current sensor that detects the current flowing into the electric motor, a regulation unit that determines a regulation phase in which the relative rotation phase is mechanically limited in an advanced angle direction and in a delayed angle direction, and a regulation phase detection unit that detects the regulation phase based on when the relative rotation phase in which a change is stopped by the regulation unit is reached and a current value detected by the current sensor increases. |
| US11300014B2 |
Valve actuation system comprising finger follower for lobe switching and single source lost motion
A switching finger follower for an engine valve train utilizes an adjustable support assembly that eliminates potential for partial engagement during operation. A lever engagement member or latch is disposed for movement on the follower body and interacts with a lever to provide a constant contact geometry. The finger follower may be configured as a lost motion device and may include a biasing assembly and a travel limiter. The latch may support the lever in at least one precise position and may support the lever in a second position for partial lost motion, or permit the lever to pivot free of the latch for complete lost motion, as in cylinder deactivation applications. |
| US11300013B2 |
Sliding member
According to one aspect of the present invention, a sliding member includes: a sliding surface against which an outer surface of a cam abuts; and a groove having a spiral shape or a plurality of grooves having an annular shape, which are provided on the sliding surface. The sliding surface includes a central region having a circular shape and including a center of the sliding surface, and a first annular region located outside the central region. A ratio RC of a width L2 of the groove to a pitch L1 of the groove in the central region is larger than a ratio RO1 of the width L2 of the groove to the pitch L1 of the groove in the first annular region. |
| US11300008B2 |
Lubrication scavenge system for a turbine engine with counter-rotating shafts
A lubricant scavenging system for a turbine engine having a pair of concentric, counter-rotating shafts. The system comprises a lubricant sump housing having a radially inner surface, a pair of pedestal mounts each adapted to receive a bearing assembly from a respective shaft, a lubricant collection point axially disposed between the pedestal mounts, and a pair of axial channels adapted to guide lubricant toward the lubricant collection point. |
| US11300005B2 |
Masking systems for a turbine
A masking system for a turbine including a first quantity of blades attached to a rotor and arranged adjacent one another to define a blade row with each blade including a blade root, includes a second quantity of center plates. Each center plate is disposed between two adjacent blades and includes a resilient member in contact with each of the two adjacent blades, and a first attachment member operable to attach the center plate to the rotor. The system includes a third quantity of side covers, each side cover positioned adjacent the blade root of one of the blades and connected to one of the center plates, each side cover including a resilient member positioned to surround a portion of the adjacent blade root, and a second attachment member operable to attach the side cover to the rotor. |
| US11300002B2 |
Static take-off port
A duct for a gas turbine engine, the duct has a wall defining a flow passage for an airflow, the wall defining a baseline surface, the duct comprising an off-take port for drawing a portion of the airflow out of the duct, the off-take port including a projected portion projecting away from the baseline surface into the flow passage, a conduit opening defined within the projected portion for receiving the portion of the airflow, and an off-take conduit communicating with the conduit opening for directing the portion of the airflow away from the duct, the projected portion having a hump upstream of the conduit opening relative to a direction of the airflow and a scoop downstream of the opening relative to the direction of the airflow. |
| US11299995B1 |
Vane arc segment having spar with pin fairing
A vane arc segment includes an airfoil fairing that has first and second fairing platforms and a hollow airfoil section. A spar has a spar platform adjacent the first fairing platform and a hollow spar leg that extends from the spar platform and through the hollow airfoil section. The hollow spar leg has an internal passage for receiving cool air there through, a clevis mount, and a pin fairing. The clevis mount is distal from the spar platform and protrudes from the second fairing platform. The clevis mount includes first and second prongs with aligned holes. A pin extends through the aligned holes. The pin fairing extends over the pin between the first and second prongs for guiding the cooling air around the pin. There is a support platform adjacent the second fairing platform. The pin locks the support platform to the spar leg. |
| US11299994B2 |
First-stage stator vane for gas turbine, gas turbine, stator vane unit for gas turbine, and combustor assembly
A first-stage stator vane for a gas turbine includes: a first portion partially defining an airfoil which includes a pressure surface, a suction surface, and a trailing edge; and a second portion positioned at a leading-edge side of the airfoil with respect to the first portion, the second portion having a recess portion or a protruding portion. The recess portion or the protruding portion has a pair of side wall surfaces, and an angle formed between the pair of side wall surfaces is less than 90 angular degrees. |
| US11299986B2 |
Method for acid fracturing and acid stimulation based on NMR diffusion measurements
A method for assessing an optimal acid injection rate in the process of hydrocarbon formation stimulation. The method comprises evaluating an anisotropic diffusion coefficient by pulsed gradient NMR, introduction of a semi-empirical correction based on comparison of the downhole conditions with the library of laboratory experiments where such corrections were measured, extrapolation of the library data to the real downhole conditions. The improved values of the diffusion coefficients are applied in determining wormhole regime conditions that are optimal in terms of acid consumption per a unit of stimulated yield of the hydrocarbon. |
| US11299985B2 |
Acoustic telemetry system
An acoustic receiver is provided. The acoustic receiver includes an optical vibrometer having an optical emitter and an optical receiver. The optical receiver is operable to emit an optical beam to a single point of reference on a conduit, and the optical receiver is operable to receive one or more reflections of the optical beam off of the single point of reference on the conduit, thereby detecting waves propagating through the conduit created by an acoustic transmitter. A processor is coupled with the optical emitter and the optical receiver. The processor is operable to: determine components of the waves created by the acoustic transmitter based on the one or more reflections of the optical beam; and determine a signal transmitted from the acoustic transmitter based on the components of the waves. |
| US11299982B2 |
Tracers for petroleum reservoirs
Analyzing a fluid extracted from a reservoir includes introducing a first composition featuring a first complexing agent into a reservoir at a first location, extracting a fluid from the reservoir at a second location different from the first location, combining the fluid with a second composition featuring a concentration of a lanthanide ion to form a third composition featuring a concentration of a complex formed by the first complexing agent and the lanthanide ion, exposing a quantity of the complex to electromagnetic radiation for a first time period ending at a time t0, detecting fluorescence emission from the quantity of the complex for a second time period starting at a time t1>t0, where t1-t0 is greater than 2 microseconds, and determining information about a fluid flow path between the first location and the second location. |
| US11299979B2 |
Magnetic distance and direction measurements from a first borehole to a second borehole
Determining distance and direction from a first borehole to a second borehole including generating a time-varying magnetic field by axially reciprocating magnets of opposed polarity, at a first location in a second borehole, and detectable in the region of the first borehole. First and second sensors positioned at an observation point in the first borehole measure the amplitude and relative phase of components of the magnetic field. From these measurements, the direction, relative to the sensors, from an observation point to the first location is determined. The distance between these points is determined by measuring amplitude variations with depth of the magnetic field at observation points in the first borehole and computing theoretical variations in the amplitude for different assumed distances between the observation points and the location of the magnetic field source which are compared with theoretical variations to determine the distance between the first and second boreholes. |
| US11299978B2 |
Multi-layer distance to bed boundary (DTBB) inversion with multiple initial guesses
System and methods for geosteering inversion are provided. A downhole tool's response along a path of a wellbore to be drilled through a formation is predicted over different stages of a downhole operation, based on each of a plurality of initial models of the formation. Each initial model represents a different number of formation layers over a specified range. The tool's actual response with respect to one or more formation parameters is determined, based on measurements obtained during a current stage of the operation. The actual response is compared with that predicted from each of the initial models. At least one of the models is selected as an inversion model, based on the comparison and a selection criterion. Inversion is performed for subsequent stages of the operation along the wellbore path, based on the selected model. The wellbore path is adjusted for the subsequent stages, based on the inversion results. |
| US11299972B2 |
Method for remediation of subterranean-formed metal-polymer complexes using peracetic acid
This disclosure describes methods for remediating subterranean-formed metal-polymer complexes in wells in subterranean formations. In particular, these methods utilize a peracetic acid remediation mixture. The peracetic acid remediation mixture is injected into a subterranean formation adjacent to a well at a pressure below the fracture pressure of the formation. A sufficient contact time is allowed and then the peracetic acid remediation mixture is pumped from the subsurface. This has been shown to degrade, and thus remediate, polymer-containing, subterranean-formed metal-polymer complexes in shale formations. |
| US11299964B2 |
Drilling productive wells
Reservoir properties can be received. A plurality of potential well trajectories can be determined. Each trajectory can characterize an extension of the well from a well origin position. Each trajectory can include a plurality of well segments. Production contribution of each potential well trajectory can be evaluated using the reservoir properties. A final well trajectory can be provided based on the evaluated production contribution of the potential well trajectories. Related apparatus, systems, techniques and articles are also described. |
| US11299963B2 |
Mobile well servicing system and method of using the same
A mobile well servicing system and method are provided for performing well services. The mobile well servicing system can include a work surface on a platform supporting an equipment such a jack, a blowout preventer (BOP), a coiled tubing (CT) injector and a mast. The mast is pivotable between a first position, with a lifting point positioned over the work surface, and a second position, with the lifting point positioned behind the platform. A hoist winch assembly mounted at the platform raises the equipment from the platform when the mast is at the first position. The equipment then pass through a space between two parallel legs of the mast, and lowered to a wellhead when the mast is at the second position. Multiple tasks such as well completion, change of dynamic temperature sensor (DTS) and electric submersible pump (ESP) can be achieved using this system. |
| US11299962B1 |
Interventionless methods and systems for testing a liner top
Interventionless testing casing within a wellbore to determine a location where the casing is leaking. Testing systems include a casing disconnect tool to receive an object, such as a ball, allowing for pressurizing to test a backside between new casing associated with the disconnect tool and older casing associated with a cased hole or open hole. |
| US11299958B2 |
Compositions and methods for well completions
Expansive cements for use in cementing subterranean wells comprise water, an inorganic cement and one or more particulate materials that swell upon contact with a water-immiscible fluid. The cements may further comprise a water-immiscible fluid. Such cements are designed to seal microannuli arising from the presence of water-immiscible fluids on casing surfaces, borehole wall surfaces or both. |
| US11299954B2 |
Fracturing relief method for stress concentration of remaining ore pillars in overlying goaf
Provided is a fracturing relief method for stress concentration of remaining ore pillars in an overlying goaf, including first, performing directional fracturing on a roof to optimize the stress of the roof and reduce the source of force; secondly, performing pulse fracturing on a coal pillar to produce a crack network, weaken the stiffness of the coal pillar and reduce the bearing capacity of the coal pillar; and finally, performing pulse fracturing on a floor strata of the coal pillar to reduce the ability of transferring stress concentration thereof. A drilling machine is used for separately constructing fracturing drill holes in a roadway to a set depth at an interval in a direction oblique to the coal pillar in an upper goaf. The roof, the coal pillar and the floor can be fractured by an oblique fracturing hole in a sublevel retreating manner. The position of the directional fracturing of the roof is approximately 1 m above the middle of a main roof above the coal pillar. The method reduces the width of the lower coal pillar, improves the coal mining rate, reduces the deformation of the lower coal roadway, effectively solves the problems of mine pressure passing through the coal pillar on the working face of the lower coal seam, rock burst, and coal and gas outburst in the mining of the lower coal seam, and simultaneously has the advantages of high safety factor, simple method, convenient construction and low cost. |
| US11299952B2 |
Rotating and reciprocating swivel apparatus and method
What is provided is a method and apparatus wherein a swivel can be detachably connected to an annular blowout preventer thereby separating the drilling fluid or mud into upper and lower sections and allowing the fluid to be displaced in two stages, such as while the drill string is being rotated and/or reciprocated. In one embodiment the sleeve or housing can be rotatably and sealably connected to a mandrel. The swivel can be incorporated into a drill or well string and enabling string sections both above and below the sleeve to be rotated in relation to the sleeve. In one embodiment the drill or well string does not move in a longitudinal direction relative to the swivel. In one embodiment, the drill or well string does move longitudinally relative to the sleeve or housing of the swivel. |
| US11299950B2 |
Expended laser tool
A laser tool apparatus includes a tool body; a fiber optic cable disposed in the tool body, the fiber optic cable including a laser head that emits a laser beam; a reshape optic disposed coaxially downstream of the fiber optic, the reshape optic reshaping the laser beam emitted from the laser head; and a flexible cable attached to the reshape optic. The flexible cable flexibly orients the laser beam at a desired angle within a borehole. |
| US11299948B2 |
Downhole method for removal of tubular metal structure
A method for removal of at least part of a first well tubular metal structure in a borehole of an existing well having a top, the first well tubular metal structure having a longitudinal extension and a first end closest to the top. The method includes inserting a downhole wireline tool having an anchor section and a machining device in the first well tubular metal structure, positioning the downhole wireline tool opposite the first section of the first well tubular metal structure so that the machining device is positioned 8-12 metres from the first end of the first well tubular metal structure and the anchor section is arranged above the machining device, and anchoring the downhole wireline tool opposite the first section by activating the anchor section to abut an inner surface of the first well tubular metal structure. |
| US11299935B2 |
Electric drilling tool suitable for ocean underwater drilling rig
An electric drilling tool suitable for ocean under rater drilling rig is provided, which belongs to the technical field of ocean drilling equipment and includes a power supply assembly, a motor assembly and a bit assembly. The power supply assembly includes a power distribution cabinet, a power supply cable and a cable plug. The motor assembly includes a connecting joint, an upper machine head, a motor housing, a stator assembly, a rotor assembly, a centering bearing, stabilizing bearings, a rotating shaft, a lower machine head and a protector. The bit assembly includes a transition joint and a bit. |
| US11299931B2 |
Wand assembly for use with a vertical architectural-structure covering
A wand assembly for use with an architectural-structure covering is disclosed. The wand assembly may include a first operating element (e.g., an operating cord) for moving the covering between extended and retracted positions and a second operating element (e.g., a tilt wand) for adjusting rotation of the covering between open and closed configurations. The first and second operating elements are coupled to a handle assembly via separate and distinct coupling mechanisms so that manipulation of the second operating element does not affect the first operating element thereby preventing twisting of the first operating element about the second operating element. The wand assembly may include a first, inner rotatable wand and a second, stationary outer wand. The inner wand is rotatable relative to the outer wand so that rotation of the inner wand does not rotate the outer wand, and hence the first operating element coupled to the outer wand. |
| US11299930B2 |
Slatted roller blind
A roller blind is disclosed which provides horizontal slats for directional shading, enabling the application of a screen fabric which allows a greater portion of visible light to pass therethrough. The disclosed slatted roller blind is free from the usage of ladder cords and is simplistic in design. The disclosed slatted roller blind maintains a compact formation of a roller shade when retracted and has greater resistance to skewing along the longitudinal axis of the roller while being retracted. Furthermore, the disclosed slatted roller blind design is capable of being utilized as an outdoor or indoor blind. |
| US11299926B2 |
Drive mechanism for imparting movements to a door
A drive mechanism for imparting movements to a door which pivots about a generally vertical axis between open and closed positions. The drive mechanism includes a frame, a power source mounted on the frame or positively driving an output shaft of the drive mechanism and thus, moving the door from a closed position toward an open position. The drive mechanism also includes an output shaft mounted for rotation about a fixed axis disposed generally parallel to a fixed axis of a power source drive shaft. A drive train including a plurality of intermeshing gear sets is arranged between the power source drive shaft and the output shaft. At least one gear set in the drive train includes a clutch mechanism selectively operable in either an engaged condition or a disengaged condition. When in a disengaged condition, the clutch mechanism operably transfers rotational movements of the power source to the output shaft so as to forcibly open the door. When operated in an engaged condition, the clutch mechanism operationally disconnect the power source and at least one gear set from the drive train thereby minimizing the manual effort required to open the door. |
| US11299924B1 |
Power-actuated jeep wrangler fabric top and associated methods
A power-actuated fabric top for a vehicle includes a fabric top section configured to be adapted between a folded position and an unfolded position, guide rails statically affixed to an existing frame of the vehicle, and a power-actuated displacement mechanism for retracting and advancing the fabric top section between the folded position and the unfolded position. Such a power-actuated displacement mechanism is operably coupled to the guide rails. The fabric top section is configured to have a substantially horizontal travel path along an anterior portion of the guide rails and thereby does not pivot up and away from the guide rails. The fabric top section is operably coupled to the guide rails and responsive to an operating mode of the power-actuated displacement mechanism. The folded position of the fabric top section is piled up inside the existing tailgate portion of the existing vehicle. |
| US11299922B2 |
Modular door operating linkage system and related method for connecting a door to a driver
A modular door operating linkage system connectable to an extendable from a door pivotable between closed and open positions about a generally vertical axis disposed such that the door can be either pushed or pulled between positions. The modular linkage system includes a rigid generally L-shaped crank arm component connected to a powered driver which drives the crank arm component in opposite arcuate directions. The modular linkage system also includes a rigid elongated track component defining a generally C-shaped linear channel. The modular linkage system also includes a rigid but adjustable multipiece link component. The linkage system further includes a rigid block component which is configured and designed to act in concert with the other components of the linkage system. The various components of the linkage system are designed and configured relative to each other such that they can be selectively interchanged with and connected to each other and to the door in a multitude of different arrangements and scenarios to easily and readily accommodate different environments wherein the door is utilized. A method for connecting a door to a powered driver is also disclosed. |
| US11299909B2 |
Post repair kit and method of reparation
A post repair kit and method of reparation juxtaposition a lateral brace to a broken section and a new section of a fence post. The kit provides a stake with a proximal end that couples to a hammer mechanism having a reciprocating ram, and a tapered anchor end that drives into the ground. Interchangeable end adapter tools detachably attach to distal end of reciprocating ram. The end adapter tools may include a slotted bit that fits onto a flat stake, where the slot is open sided to allow the tool to fit over stakes that are bent at an edge. Other adapters may engage the stake at alternative points. The hammer mechanism drives the stake into the ground parallel to the post. Fasteners are driven into the stake to secure the stake against the post sections to provide lateral support to the mended junction. |
| US11299904B2 |
Shading system and method of use
A system for providing shade onto a surface is described herein. The system includes a canopy configured for engagement with, and aerial suspension by, a frame. The frame includes a plurality of sections configured for end-to-end alignment from a left end to a right end of the frame. Each section is configured to engage with any adjacent sections to form the frame. The ends of the frame are secured to the surface, thereby aerially suspending the canopy and providing shade to the surface. |
| US11299902B2 |
Damping system utilizing space between stair chamber and inner building
The present invention relates to a damping system that utilizes a space between an inner building and a stair chamber installed outside the inner building to control vibration of an earthquake applied to a building or a building structure, and more particularly, to a damping system utilizing a space between a stair chamber and an inner building, which is installed in a building structure including the inner building and the stair chamber to damp a transverse force due to seismic waves. |
| US11299901B2 |
Control structure
A control structure device for racks or buildings. The device is able to limit forces developed within itself or a structure (e.g. building or storage rack) it connects with and is seismically supportive of as it endures ground or base motion input from a seismic event. The control structure may comprise a relatively inflexible rocker frame which is pivotably connected to a foundation. Rotation of the rocker frame causes a flexural member to flexurally displace to limit force and energy in the system. |
| US11299900B2 |
Parking lot systems
In one instance, a parking lot system is presented with a first driveway in a first direction and a second driveway in a second direction opposite the first direction. The first driveway includes a first plurality of parking spaces, wherein each parking space comprises a first rectangular space to accommodate an automobile. A second rectangle is adjacent to the first rectangular space. The second driveway includes a second plurality of parking spaces, wherein each parking space comprises a third rectangular space sized to accommodate an automobile. The second rectangle is adjacent to the third rectangle. The second rectangle forms a buffer zone into which automobile doors in the second and third rectangle may open. The first and second plurality of parking spaces at least partially abut one another directly. Other systems are also presented. |
| US11299898B2 |
Device for securing poles at the edge of a vessel or a swimming pool
A pole for a swimming pool comprises a tool for swimming pool maintenance located at one end of the pole and a device for preventing the pole from sliding into the swimming pool. The device comprises a face that surrounds the pole generally perpendicular to the pole and a baffle that extends from the outside edge of the face generally parallel to the pole. The device prevents the pole from sliding into the swimming pole by a user placing the baffle on a surface at the edge of the swimming pool. |
| US11299897B1 |
Apparatus, system, and method for assembling, aligning, leveling, and squaring in-ground pool walls
An apparatus and system for assisting in assembling, aligning, and leveling the wall panels of an inground swimming pool, the apparatus comprising an adjustment member having an externally threaded shaft section, an internally threaded fastener which is rigidly attached in a hole in a bottom flange of a wall panel, and a cleat member which is adjustably connected under the bottom flange such that the wall panel can be supported on the cleat member, whereby the wall panel can be raised or lowered as needed during assembly, alignment, and leveling of the pool wall by rotatably adjusting the position of the adjustment member, whereby the tensile strength of the threaded shaft is less than that of the threaded aperture in the cleat member such that an area of the threads on the threaded shaft section spaced from the end of the shaft section are intentionally fractured or damaged, preventing prevent the cleat member becoming disengaged from the panel. |
| US11299892B2 |
Head for a support of raised floors
A head for supports of raised floors includes a support body having an upper surface shaped as a cavity partially counter-shaped to receive a spherical cap; a protrusion emerging from the upper surface of the support body and having a threaded side wall; a tilting element having in its upper part a flat surface for supporting building elements and in its lower part a portion partially shaped like a spherical cap configured to be laid on the support body, the tilting element having a through hole configured to receive the protrusion; and a ring nut having an inner surface and an outer lateral surface, the inner surface being threaded to mesh with the threaded portion of the side walls of the protrusion, the outer lateral surface being shaped to abut against the inner surface of the through hole in the tilting element. |
| US11299889B2 |
Deck panel and fastening system
A roof deck (20) has plurality of insulated panels (22) secured together by a first plurality of fasteners (54) along their longitudinal edges (28, 29). Additionally, the panels (22) are secured by a second plurality of fasteners (56), transverse to the longitudinal axis (26), to a framework (18). A plurality of washers (60) disperse the force of the second plurality of fasteners (56). The plurality of washers (60) are secured to each of the second plurality of fasteners (56). A membrane (24) covers the roof deck (20). |
| US11299882B2 |
Foam insulation with improved low temperature properties using polyol additives
A polyisocyanurate foam insulation product is produced from an isocyanate component and a polyol-containing component including a blowing agent. The polyol-containing component comprises one or more polyols, a fire retardant, and a hydroxyl-containing low-molecular-weight additive effective to increase the R-value per inch of the insulation product as measured at 40° F., as compared with an otherwise-identical formulation lacking the hydroxyl-containing low-molecular-weight additive. The polyisocyanurate foam insulation product may have an R-value per inch of at least 6.0 when measured at 40° F. and may have an R-value per inch of at least 5.5 when measured at 25° F. Suitable hydroxyl-containing low-molecular-weight additives may include triethanolamine, trimethylolpropane, N-methyldiethanolamine, 1,4 butanediol, or another suitable multi-functional alcohol or combination of multi-functional alcohols. |
| US11299878B2 |
Vacuum sewage system with sump breather apparatus
A vacuum sewage system includes a sump pit for receiving sewage, a valve pit, a valve, a sensor-controller, a first sensor pipe, a sump breather and a second sensor pipe. The sensor-controller activates the valve so as to discharge sewage from the sump pit. The first sensor pipe communicates pressure to the sensor-controller as the level of sewage rises within the sump pit. The second sensor pipe communicates pressure to the sump breather to move the sump breather from a first state to a second state to prevent sewage from entering the sensor-controller and valve. Alternatively, the system may be provided with a single sensor pipe that communicates pressure to both the sensor-controller and to the sump breather. |
| US11299876B2 |
Electronic plumbing fixture fitting including measurement system
The present invention provides an electronic plumbing fixture fitting including a measurement system. The electronic plumbing fixture fitting includes a user input module. The user input module includes a mechanism to receive from the user numerical value(s) of parameter(s) for water to be delivered through a discharge outlet of the electronic plumbing fixture fitting (e.g., volume or volume and temperature) and a mechanism to deliver to the user the numerical value(s) of the parameter(s) via the water delivered through the discharge outlet of the electronic plumbing fixture fitting. |
| US11299875B2 |
Faucet actuator torque increasing system and method
A faucet actuator torque increasing system and method for increasing torque applied to an actuator includes a grip. The grip has a perimeter wall with a continuous convexly arcuate shape. A coupler is removably mounted on the perimeter wall of the grip. The coupler includes a first segment and a second segment which are pivotably coupled to each other via a connector. The first and second segments move between a closed condition engaging the grip and an open condition for disengaging the grip. Each of the first and second segments has an interior surface. The interior surfaces abut the grip in the closed condition. A locking member releasably locks the coupler in the closed condition. A handle is integrally attached to and extends away from the coupler. A stop is attached to the coupler to abut against the grip when in the closed condition. |
| US11299873B1 |
Sewage backflow preventing valve
A sewage backflow prevention device is installed in a gravity flow waste pipe, particularly for a residence or residences. The device includes a cylindrical body with a closed top, outflow holes in the sides, and an open bottom to be secured to the upper end of a Tee in the gravity flow sewage pipe, between the residence and the sewer. Within the cylindrical body is a hollow, floatable disk or float ball that normally closes the bottom of the backflow device preventing escape of gases. When a downstream blockage occurs, liquid rises into the device, floats the closure disk or ball upward and flows outwardly through the openings. At valve closure position the valve closure disc or ball is mostly below the outflow holes such that rats or other rodents cannot push under and lift the ball or disc. |
| US11299867B2 |
Shovel
A shovel includes a lower traveling body, an upper turning body turnably mounted on the lower traveling body, a cab mounted on the upper turning body, an operating apparatus installed in the cab, an actuator driven with the operating apparatus, and a processor configured to restrict the movement of the actuator. The processor is configured to determine the necessity of a restriction related to the movement of the actuator in accordance with whether the operating apparatus is operated with an operator's hand. |
| US11299863B2 |
Support assembly for a building structure
A support assembly for supporting a building structure, the support assembly comprising: a pile adapted to be buried into a ground surface, the pile having a longitudinal axis; a pile head adapted to be secured to a top end of a pile, the pile head including a mounting member engaging the pile and an extendable member movably mounted to the mounting member, the extendable member being movable relative to the mounting member, along the longitudinal axis, the extendable member including: a support platform adapted to receive the support beam of the manufactured home's support frame thereon; and at least one holding member adapted to engage the building structure and to prevent movement of the support beam relative to the support platform. |
| US11299858B2 |
Method for unloading, transporting and installing a railway track
The invention relates to a method for unloading, transporting and installing a railway track, which does not require the rail-carrying train to be brought closer after each cycle of unloading continuous welded rail (CWR), the train remaining parked at the end of the track already laid until all the CWR has been completely unloaded. According to the invention, the method consists of: fastening two rails to a crane of an unloading wagon and moving same through windows along the wagon, facilitating the descent thereof to the track; transferring the rails to a machine for pulling and positioning which moves along, leaving the rails supported on transport elements that move along the track already laid; transferring the rails from the track already laid to a section of sleepers; and moving the rails to their final position, using sliding elements placed on the sleepers. |
| US11299857B2 |
Method for sizing a multi-ply fiber web and a forming section for a multi-ply fiber web
A method for forming a multi-ply fiber web in which least part of the sizing of the multi-ply fiber web is provided by applying sizing agent in the form of foam by a curtain type application device (C10, C20) in between at least two layers of the multi-ply fiber web in the forming section. The invention also relates to a forming section for a multi-ply fiber web having at least one twin-wire forming part formed between a wire (10) for the bottom layer and a wire (20) for the top layer of the multi-ply fiber web, where the layers are joined, and the treated layers combined. The forming section has a curtain type application device (C10, C20) for applying sizing agent in the form of foam in between two layers of the multi-ply fiber web in the forming section of a multi-ply fiber web production line. |
| US11299856B2 |
Single ply tissue having improved cross-machine direction properties
Provided are tissue webs, and products produced therefrom, that are generally durable, flexible and have improved cross-machine direction (CD) properties, such as CD tensile energy absorption (CD TEA), CD stretch and CD modulus. The inventive tissue products generally comprise a single tissue ply that has been prepared by through-air drying and more preferably by through-air drying without creping. Moreover, the products may be produced using a transfer fabric positioned between the forming fabric and the through-air drying fabric where the transfer fabric imparts the nascent web with a high degree of CD strain. |
| US11299855B2 |
Paperboard structure with at least one barrier coating layer
A paperboard structure that includes a paperboard substrate which includes a first major side and a second major side along with at least one barrier coating layer on the first major side. The barrier coating layer(s) may include a binder and a pigment, wherein the binder has a glass transition temperature of at least 20° C., wherein a ratio of the binder to the pigment is at least about 1:2 by weight. |
| US11299853B2 |
Paper or paperboard product comprising at least one ply containing high yield pulp and its production method
A method of producing a paper or paperboard product having at least one ply comprising high yield pulp (HYP), comprising the steps of: —providing a furnish comprising at least 50% of high yield pulp (HYP) of a total pulp content in said furnish, said high yield pulp being produced with a wood yield above 85%; —dewatering the furnish to form a moist web and pressing said moist web to a dry solids content of at least 40-70%; and —densifying the moist web to a density above 600 kg/m3 in a press nip of a paper machine at a temperature above a softening temperature of water-saturated lignin comprised in said high yield pulp to provide a paper or paperboard product, containing at least 30% high yield pulp (HYP) of a total pulp content of said product. |
| US11299848B2 |
Hot iron covering assembly
A hot iron covering assembly includes a panel that has a top side, a bottom side and a perimeter edge. The top side has a size and shape of a base of an iron. The panel comprises a flexible and heat resistant material. A securing member is configured to releasably secure the panel to the base of the iron. |
| US11299842B2 |
Drum washing machine
A drum washing machine comprising: a casing (1), an outer cylinder (2) disposed in the casing (1), an inner cylinder (3) disposed in the casing (1), a door (4) provided on the casing (1), and a window gasket (5) for sealing provided between the casing (1) and the outer cylinder (2); wherein comprises: an inner cylinder front flange (32); a flow guiding structure (323) extending forward, which is provided on the inner cylinder front flange (32) and configured to introduce air into the inner cylinder (3) when entering into a spin phase; and a plurality of vents (541) opened at the window gasket (5) which are communicated with a space between the inner cylinder front flange (32) and the outer cylinder (2). When the drum washing machine enters into a spin phase to dewater, with the configuration of disposing the flow guiding structure (323) on the inner cylinder front flange (32), air in front of the inner cylinder front flange (32) could be introduced to the back side of it, and a negative pressure space could be created between the inner cylinder front flange (32) and the outer cylinder (2), and additionally, air around the window gasket (5) could enter into the space between the inner cylinder front flange (32) and the outer cylinder (2) by the vent (541) to create a high volume airflow circulating around the inner surface of the window gasket 5 to dry it quickly, which could speed up drying time, prevent the breeding of bacteria and eliminate the odor. |
| US11299841B2 |
Washing machine
A washing machine includes a casing, a tub, a drum, a pump for circulating water from the tub, a gasket connecting an entry hole of the casing to an entrance hole of the tub and including nozzles for spraying water to the drum, and distribution pipes for supplying water to the nozzles. The nozzles are arranged at both lateral sides of the gasket in a vertical direction. The distribution pipes are arranged at an outer circumferential surface the gasket and coupled to receiving pipes that protrude from the gasket. The distribution pipes include an inlet port and outlet ports disposed in the vertical direction corresponding to the nozzles. |
| US11299837B2 |
Washing machine and method for controlling washing machine
Disclosed herein are a washing machine and a method for controlling a washing machine. The washing machine may include: a body; a tub provided inside of the body to store water; a detergent supply unit disposed adjacent to the tub to supply detergent to the tub during an operating mode for washing laundry and to receive water during a cleaning mode; and a controller configured to allow a cleaning of the detergent supply unit to be performed by controlling a flow of water of the detergent supply unit and the tub during the cleaning mode of the detergent supply unit.The present disclosure may be possible to keep the washing machine clean by automatically cleaning a detergent supply unit. In addition, it may be possible to improve the quality and the reliability of the product by automatically cleaning a detergent supply unit by using an input. |
| US11299834B2 |
Combination washing/drying laundry appliance having a heat pump system with reversible condensing and evaporating heat exchangers
An appliance air/water handling system includes a rotating drum, airflow and fluid paths for directing process air and fluid, respectively, therethrough. First and second heat exchangers are in direct engagement with the airflow and fluid paths, respectively. A reversible refrigerant circuit delivers refrigerant through the first and second heat exchangers to alternatively define washing and drying conditions. In the washing condition the first heat exchanger cools the process air into cooled process air, and the second heat exchanger heats the fluid to define a heated fluid that is directed into the drum. In the drying condition the first heat exchanger heats the process air to define heated process air that is directed through the drum and through a third heat exchanger, and the second heat exchanger cools the fluid to define a cooled fluid that is directed to the third heat exchanger intersect with the heated process air. |
| US11299831B2 |
Sewing system
A sewing system which includes a detector for detecting an edge of a cloth installed on an installation table, a cloth conveyor for conveying the cloth from the installation table to a sewing machine, and a controller, wherein the cloth conveyor includes a holding member that holds the cloth, and the controller includes a holding position decision portion that determines a holding position of the cloth based on detection data of the detector, and a conveyance control portion that controls the cloth conveyor such that the holding member holds the holding position. In the sewing system according to the above, it is possible to prevent deterioration in productivity of sewn products. |
| US11299827B2 |
Nanoconductor smart wearable technology and electronics
A wearable, nanoconductor technology for smart electronic applications. A novel nano-scale geometry is achieved for nanoconductor circuits on the order of the size of a single thread or smaller, which are easily integrated with clothing and provide smart applications for wearable electronics. The nano-scale fibers provide improved material characteristics and the fixed geometry and orientation of the nanoconductor structures allow easier interface of nanoconductor electronics integrated with the clothing or with electronics external to the weave of the clothing. Novel electronic circuits based on the size and fixed geometries of the nanoconductor fibers which allow configurable functions that can be employed for different uses through logic circuit configuration or serial programming during wear are disclosed. |
| US11299826B2 |
Tubular fabric and base material for medical use using same
Provided is a tubular fabric that has a homogeneous structure along its outer circumference and excellent shape-stability and that is useful as hoses for transferring a fluid or powder or for protecting linear materials such as a wire, a cable, and a conduit, tubular filters, and medical base materials such as an artificial blood vessel. The tubular fabric includes a wall part that is woven by interlacing a warp yarn and a weft yarn and that has a double weave structure, a weft yarn in an outer layer and a weft yarn in an inner layer being not intersected with each other. The tubular fabric preferably has a circularity c of 0.8 or more and 1.2 or less, the circularity c being represented by the following equation of an outer diameter b perpendicular to an outer diameter a with respect to the outer diameter a, the outer diameter a being obtained by measuring a location corresponding to a fabric width A in weaving of the tubular fabric. Circularity c=a/b. |
| US11299825B2 |
Manufacturing of artificial muscle actuators
Methods and a device for the continuous manufacturing of artificial muscle actuator device fibers are disclosed. The method includes: threading an untwisted fiber along the axis of a tube and inside the tube that includes a heating means to raise the localized temperature of a cross-section of the tube to a predetermined temperature; providing a tension on the untwisted fiber; and twisting the untwisted fiber while the fiber is within the tube. |
| US11299823B2 |
Spinning apparatus and spinning method
A spinning apparatus includes a spinning cabinet extending in a vertical direction, a spinneret that includes a plurality of spinneret holes, is disposed on an upper end side of the spinning cabinet, and is configured to extrude a spinning dope from the plurality of spinneret holes into an interior space of the spinning cabinet, a first gas supply path connected to the spinning cabinet is configured to supply a first gas from above the spinneret to the interior space, allowing the first gas to come into contact with the spinning dope extruded from the plurality of spinneret holes, and a second gas supply path connected to the spinning cabinet is configured to supply a second gas having a higher temperature than that of the first gas from below the spinneret to the interior space, allowing the second gas to come into contact with the spinning dope extruded from the plurality of spinneret holes. |
| US11299822B2 |
Method of producing a microtube
A method of producing a microtube is provided. The method comprising co-electrospinning two polymeric solutions through co-axial capillaries to thereby produce the microtube, wherein a first polymeric solution of the two polymeric solutions is for forming a shell of the microtube and a second polymeric solution of the two polymeric solutions is for forming a coat over an internal surface of the shell, the first polymeric solution is selected solidifying faster than the second polymeric solution and a solvent of the second polymeric solution is selected incapable of dissolving the first polymeric solution. Also provided are electrospun microtubes. |
| US11299820B2 |
Electron beam heating and atomic surface restructuring of sapphire surface
Systems, methods, and devices of the various embodiments may provide a mechanism to enable the growth of a rhombohedral epitaxy at a lower substrate temperature by energizing the atoms in flux, thereby reducing the substrate temperature to a moderate level. In various embodiments, sufficiently energized atoms provide the essential energy needed for the rhombohedral epitaxy process which deforms the original cubic crystalline structure approximately into a rhombohedron by physically aligning the crystal structure of both materials at a lower substrate temperature. |
| US11299818B2 |
Method for producing PbTiO3-containing single crystal
Provided is a method for producing a single crystal, wherein compositional variations and defects in the single crystal can be prevented and a single crystal having uniform characteristics in the growth direction can be produced at high yield. In this method for producing a single crystal, a PbTiO3-containing single crystal is produced by the vertical Bridgman technique, wherein the thickness of a melt layer containing the melt in a crucible is at least 30 mm. |
| US11299815B2 |
Hierarchically structured duplex anodized aluminum alloy
A method of growing a hierarchically structured anodized film to an aluminum substrate including growing a Phosphoric Acid Anodizing (PAA) film layer to an aluminum substrate and growing a multiple of Tartaric-Sulfuric Acid Anodizing (TSA) film layers under the Phosphoric Acid Anodizing (PAA) film layer. |
| US11299813B2 |
Method for manufacturing hologram pattern and specimen including metal plating layer having hologram pattern on surface thereof
According to a method for manufacturing a hologram pattern of the present invention, the hologram pattern is applied to a metal plating layer (not a metal specimen). Accordingly, materials which can be plated are widely applicable. The hologram pattern, which becomes appeared in various colors depending on light and user's vision, can be formed with a simple process. |
| US11299812B2 |
Electrolytic solution generator
An electrolytic solution generator includes an electrolyzing unit having a stacked structure in which a conductive film is interpose between a cathode and an anode, the electrolyzing unit electrolyzing a liquid, and a housing in which the electrolyzing unit is placed. A channel is disposed in the housing, and a groove is disposed in the electrolyzing unit, as a groove which is open to the channel and to which at least a part of an interface between the conductive film and the cathode and an interface between the conductive film and the anode is exposed. A space is disposed between at least either an outer periphery of the cathode or an outer periphery of the anode and an inner surface of the housing. |
| US11299811B2 |
Continuous flow reactor and hybrid electro-catalyst for high selectivity production of C2H4 from CO2 and water via electrolysis
An electrochemical reactor for use with a liquid electrolyte is capable of generating gaseous products. An electrically conducting porous layer that is hydrophilic on the catalyst side and hydrophobic on the gas side are utilized. These different surface properties promote the transport of product gases formed at the catalyst through the porous layer to the gas side. The catalyst is formed from a hybrid Cu2O—CuBr film that has a high selectivity for ethylene gas from reacting CO2 and water in an electrochemical cell. |
| US11299810B2 |
Barrier layer for corrosion protection in electrochemical devices
The invention is directed to a barrier layer for corrosion protection in electrochemical devices, e.g. carbon based gas diffusion layers (GDLs) in electrochemical devices, comprising electrically conductive ceramic material and a non-ionomeric polymer binder. The electrically conductive ceramic material has an electrical conductivity of >0.1 S/cm, preferably >1 S/cm in air atmosphere (as detected by the powder method) and is selected from the group of precious metal and/or base metal containing oxides, carbides, nitrides, borides and mixtures and combinations thereof. Membrane-electrode assemblies (MEAs), catalyst-coated membranes (CCMs), gas diffusion electrodes (GDEs) and gas diffusion layers (GDLs) comprising the barrier layer of the invention show improved corrosion resistance, preferably against carbon corrosion; particularly in start-up/shut-down cycles and fuel starvation situations of PEM fuel cells. |
| US11299805B2 |
Plasma corrision resistive heater for high temperature processing
Implementations described herein protect a substrate support from corrosive cleaning gases used at high temperatures. In one embodiment, a substrate support has a shaft having an outer wall. The substrate support has a heater. The heater has a body having a top surface, a side surface and a bottom surface extending from the outer wall of the shaft. The top surface is configured to support a substrate during plasma processing of the substrate. A covering is provided for at least two of the top surface, side surface and bottom surface. The covering is selected to resist corrosion of the body at temperatures in excess of about 400 degrees Celsius. A sleeve circumscribing the shaft, the sleeve and the outer wall of the shaft forming a space therebetween, the space adapted to flow a purge gas therethrough in a direction toward the body. |
| US11299804B2 |
Method of manufacturing semiconductor device, non-transitory computer-readable recording medium and substrate processing apparatus
Described herein is a technique capable of suppressing deposits. According to one aspect of the technique, there is provided a method including: (a) supplying a source gas into a process chamber through a source gas nozzle while heating the process chamber; and (b) supplying a reactive gas into the process chamber, wherein (a) and (b) are alternately performed one by one to form a film on the plurality of the substrates while satisfying conditions including: (i) a supply time of the source gas in (a) in each cycle is 20 seconds or less; (ii) a pressure of the source gas in the source gas nozzle in (a) is 50 Pa or less; (iii) an inner temperature of the process chamber in (a) is 500° C. or less; and (iv) number of cycles performed continuously to form the film on the plurality of the substrates is 100 cycles or less. |
| US11299803B2 |
Metallic coating process for combustor panels using a barrel configuration
A method of coating a component includes attaching the component to a support that is configured to hold a plurality of components and placing a base of the support in a holder that is attached to rotatable member of a fixture, wherein an axis of the holder is parallel to an axis of rotation of the rotatable member. The method also includes transporting the fixture into a coating chamber wherein a direction of an exit stream of a coater in oriented perpendicularly to the axis of rotation, exposing the fixture and the component to a reverse transfer arc cleaning/pre-heating procedure, and exposing the fixture and the component to a coating procedure during which a coating is directed at the component in a direction perpendicular to the axis of rotation while the rotatable member is rotating. The method further includes transporting the fixture and removing the component from the support fixture. |
| US11299802B2 |
Germanium tetraflouride and hydrogen mixtures for an ion implantation system
The current disclosure is directed to methods and assemblies configured to deliver a mixture of germanium tetrafluoride (GeF4) and hydrogen (H2) gases to an ion implantation apparatus, so H2 is present in an amount in the range of 25%-67% (volume) of the gas mixture, or the GeF4 and H2 are present in a volume ratio (GeF4:H2) in the range of 3:1 to 33:67. The use of the H2 gas in an amount in mixture or relative to the GeF4 gas prevents the volatilization of cathode material, thereby improving performance and lifetime of the ion implantation apparatus. Gas mixtures according to the disclosure also result in a significant Ge+ current gain and W+ peak reduction during an ion implantation procedure. |
| US11299799B2 |
Austenitic stainless steel product having excellent surface properties and manufacturing method of the same
An austenitic stainless steel product having excellent surface characteristics and a manufacturing method therefor are disclosed. The disclosed austenitic stainless steel product comprises an austenitic stainless steel comprising, by weight percent, 0.005 to 0.15% of C, 0.1 to 1.0% of Si, 0.1 to 2.0% of Mn, 6.0 to 8.0% of Ni, 16 to 18% of Cr, 0.1 to 4.0% of Cu, 0.005 to 0.2% of N, 0.01 to 0.2% of Mo, and the remainder comprising iron (Fe) and other unavoidable impurities, and a Ni surface negative segregation thereof defined by the following formula (1) is 0.6 to 0.9 and the martensite fraction thereof is 10 to 30%. (CNi-Min)/(CNi-Ave) formula (1) Here, CNi-min is the minimum concentration of Ni on the surface and CNi-Ave is the average concentration of Ni on the surface. |
| US11299797B2 |
Copper-containing, high-toughness and rapidly degradable magnesium alloy, preparation method therefor and use thereof
Provided are a copper-containing, high-toughness and rapidly degradable magnesium alloy, a preparation method therefor and the use thereof, wherein same relate to the field of materials for oil and gas exploitation. When the magnesium alloy is in an as-cast state, an extrusion state or an aging state, a strengthening phase thereof mainly includes an Mg12CuRE-type long-period phase and an Mg5RE phase and an Mg2Cu phase, the Mg12CuRE-type long-period phase has a volume fraction of 3-60%, the Mg5RE phase has a volume fraction of 0.5-20%, and the Mg2Cu phase has a volume fraction of 0.5-15%, wherein RE is a rare-earth metal element. |
| US11299795B2 |
Lead-free patenting process and equipment
The controlled cooling of previously heated and substantially straight steel wires of diameter more than 3.5 mm to a predetermined temperature including the steps: guiding the wires along individual paths through first coolant bath having bath liquid of water and a stabilizing additive, the bath liquid and the wires create a steam film around each wire along individual paths; directing an impinging liquid immersed inside first coolant bath towards the wires over a length along individual paths to cool down the wires, the impinging liquid decreases the thickness of the steam film or destabilizes the steam film, increasing speed of cooling over the length along individual paths; guiding the wires along individual paths out of the first coolant bath to be cooled down in air; after the further cooling, guiding the wires along individual paths through second coolant bath. |
| US11299790B2 |
Compositions and methods for identifying secretory antibody-bound microbes
The invention relates to the identification of secretory antibody-bound bacteria in the microbiota in a subject that influence the development and progression of inflammatory diseases and disorders. Thus, the invention relates to compositions and methods for detecting and identifying the constituents of a subject's microbiota, methods of modifying the constituents of the microbiota, and methods for treating inflammatory diseases and disorders in a subject in need thereof. |
| US11299788B2 |
Method for the quantification of Faecalibacterium prausnitzii phylogroup I and/or phylogroup II members and the use thereof as biomarkers
The present invention relates to a novel method for an accurate quantification in intestinal samples of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII). It further relates to a method for detecting intestinal diseases, including the screening, diagnosis, differential diagnosis, and/or monitoring of disease activity or progression in a human subject comprising determining the abundance of PHGI and/or PHGII in an intestinal sample from said subject. Moreover, it relates to a method for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject comprising determining the abundance of PHGI and/or PHGII in an intestinal sample from said subject. |
| US11299786B2 |
Gene panel to predict response to androgen deprivation in prostate cancer
Methods for predicting the response of prostate cancer to androgen deprivation therapy (ADT) using a gene signature of five genes (CSPG5, FKBP6, FOSB, STMN1, and TTC27) is provided. Also provided are sets containing specific binding molecules for each of CSPG5, FKBP6, FOSB, STMN1, and TTC27 and kits containing such sets. |
| US11299784B2 |
Biomarkers for predicting degree of weight loss
The present invention relates to a method for predicting the degree of weight loss attainable by applying one or more dietary interventions to a subject and/or the degree of maintenance of weight loss following one or more dietary interventions; which method comprises determining the level of microRNA-486 (miR-486) in one or more samples obtained from the subject; and/or determining the nucleotide of the subject at one or more polymorphic positions genetically linked to miR-486. |
| US11299780B2 |
Methods of producing nucleic acid libraries
Provided are methods of producing nucleic acid libraries. In certain aspects, the methods include combining target nucleic acids (e.g., 5′ phosphorylated nucleic acids) and an oligonucleotide pool. Oligonucleotides of the oligonucleotide pool may include complementarity regions of varying length and nucleotide sequence, and a complementarity region identification sequence. In such aspects, the combining is under conditions in which oligonucleotides of the oligonucleotide pool hybridize to nucleic acids of the target nucleic acids (e.g., 5′ phosphorylated nucleic acids) having overhang regions that are complementary in sequence and have corresponding lengths with respect to the complementarity regions of the oligonucleotides. Compositions and kits that find use, e.g., in practicing the methods of the present disclosure are also provided. |
| US11299779B2 |
Nucleic acid modification and identification method
A method of identifying a polynucleic acid (PNA) is presented, including the steps of providing a PNA; modifying one or more nucleobases of the PNA by addition or removal of a hydrogen bonding partner, thereby altering the base pairing capacity of the one or more nucleobases; base pairing a complementary nucleic acid to the PNA, including base pairing to at least one modified nucleobase; identifying the sequence of the complementary nucleic acid at least at the position that is complementary to at least one modified nucleobase. |
| US11299777B2 |
Isothermal amplification components and processes
The technology relates in part to methods and compositions for isothermal amplification of nucleic acids. |
| US11299775B2 |
Method for designing primer, primer, primer set, DNA amplification method, and analysis method
A method for designing a primer supplied to a PCR reaction includes a primer designing step of defining a 5′-end-side base sequence of the primer so as to include a base sequence or its complementary base sequence, the base sequence enabling identification of, among thermal cycles in the PCR reaction, a synthesis cycle of a DNA molecule in an amplification product obtained by the PCR reaction performed with the primer, the identification being based on base-sequence data obtained by sequencing the amplification product. |
| US11299774B2 |
Spatially distinguished, multiplex nucleic acid analysis of biological specimens
A method for spatially tagging nucleic acids of a biological specimen, including steps of (a) providing a solid support comprising different nucleic acid probes that are randomly located on the solid support, wherein the different nucleic acid probes each includes a barcode sequence that differs from the barcode sequence of other randomly located probes on the solid support; (b) performing a nucleic acid detection reaction on the solid support to locate the barcode sequences on the solid support; (c) contacting a biological specimen with the solid support that has the randomly located probes; (d) hybridizing the randomly located probes to target nucleic acids from portions of the biological specimen; and (e) modifying the randomly located probes that are hybridized to the target nucleic acids, thereby producing modified probes that include the barcode sequences and a target specific modification, thereby spatially tagging the nucleic acids of the biological specimen. |
| US11299769B2 |
Target reporter constructs and uses thereof
Provided herein are methods and compositions for the detection of target nucleic acids using target reporter constructs (TRCs) which comprise target sequences complementary to the target nucleic acid. Further provided are methods of replicating the TRCs using rolling circle replication and/or rolling circle amplification to produce replicated TRCs which can be detected using probe sequences within the replicated TRCs. |
| US11299767B2 |
Method for generating a three-dimensional nucleic acid containing matrix
Methods of making a three-dimensional matrix of nucleic acids within a cell is provided. |
| US11299765B2 |
Methods and compositions for preparing sequencing libraries
Embodiments provided herein relate to methods and compositions for next generation sequencing. Some embodiments include the preparation of a template library from a target nucleic acid in contact with a surface, and sequencing the library on the surface. |
| US11299760B2 |
Use of monensin to regulate glycosylation of recombinant proteins
Methods of modulating the properties of a cell culture expressing a protein of interest are provided. In various embodiments the methods relate to the addition of cell-cycle inhibitors to growing cell cultures. |
| US11299752B2 |
Bio-production of lentiviral vectors
The present disclosure provides a method of generating a stable producer cell line. The generation of stable producer cell lines, such as those provided in accordance with the present invention, increases the reproducibility and ease of creating high titer lentiviral stocks while easing biosafety concerns and the variation in expressed envelope proteins defines the tropism of the generated virus. The present disclosure also provides for a novel lentiviral transfer vector plasmid. |
| US11299750B2 |
Cultured transgenic cell allowing growth of norovirus, and use thereof
An object of the present invention is to solve problems in terms of stagnation of research on norovirus by providing a cultured transgenic cell or a transgenic animal in which murine norovirus (MNV) can be grown across the barrier of host specificity in mammalian cells, and providing a screening method that uses the cultured transgenic cell or the transgenic animal. The present inventors have found that MNV infection is determined in a cultured transgenic mammalian cell or a mammal possessing the cultured transgenic mammalian cell as its own cell, the cultured transgenic mammalian cell containing one or more species selected from the entirety or a portion of the murine CD300F gene and/or a CD300 family gene having an extracellular domain nucleotide sequence similar to that of the murine CD300F gene. The present inventors have solved the aforementioned problems by providing, for example, a norovirus-related drug screening method on the basis of this finding. |
| US11299738B2 |
Further novel oligonucleotide-ligand conjugates
The present invention relates to a compound comprising a modified saccharide moiety conjugated to a nucleic acid. The compound is useful in medicine for RNA interference therapy or for research and diagnostic purposes. In particular, the compound is useful in treating liver disease. |
| US11299736B1 |
Conjugated antisense compounds and their use
Provided herein are oligomeric compounds with conjugate groups. In certain embodiments, the oligomeric compounds are conjugated to N-Acetylgalactosamine. |
| US11299735B2 |
Compositions and methods for detecting and treating insulin resistance
A miR-1983 inhibitor comprising an anti-miR-1983 oligonucleotide that is complementary to at least part of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1), the part comprising at least nucleotides 2 to 8 of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1). |
| US11299731B1 |
CRISPR editing to embed nucleic acid landing pads into genomes of live cells
The present disclosure relates to compositions, methods, modules and automated integrated instrumentation for multiplex delivery of “landing pad” edits into the genomes of a population of live cells. The landing pads then may be leveraged to insert very large DNA sequences into the genomes of the population of live cells. |
| US11299728B2 |
Sample extraction and preparation device
A fluid sample extraction device is disclosed comprising a housing defining an internal fluid passage having a distal open end and a proximal open end and a porous medium within the fluid passage, between the distal open end and proximal open end. The porous medium, which may be glass, is configured to allow fluid flow in the fluid passage to flow around the porous medium, toward the proximal open end of the housing, when fluid is drawn from the distal open end toward the proximal open end, and to allow fluid in the fluid passage to flow toward the distal open end of the housing, through the porous medium when the fluid is forced toward the distal open end. The porous medium is also configured to capture nucleic acids in the porous medium from the fluid when fluid is forced through the porous medium. Devices and kits are also disclosed. |
| US11299726B2 |
Methods for DNA and RNA extraction from fixed paraffin-embedded tissue samples
Methods and reagents are provided for the rapid extraction of nucleic acids from a fixed paraffin embedded sample (e.g., a FFPET sample). In some embodiments, the methods comprise incubating one or more sections of said tissue sample in a lysis solution comprising a buffer sufficient to maintain the pH of said solution at a pH ranging from about pH 4 to about pH 9; a chaotropic agent; a chelating agent; and a detergent; where the incubating is at a temperature ranging from about 50° C. to about 100° C.; and recovering the nucleic acid from said lysis solution. |
| US11299722B2 |
Modified lipase and use thereof
The present invention has an object of providing a modified lipase having excellent stability and reactivity at a high temperature. Provided is a modified lipase with improved reactivity and/or stability at a high temperature, the modified lipase having an amino acid sequence including one or more amino acid substitutions which are selected from the group consisting of T130C-S153C, A249P, F259Y, S282P, S283Y and S300P in the amino acid sequence represented by SEQ ID NO: 1, or an amino acid sequence having 90% or more sequence identity therewith. |
| US11299716B2 |
Aldehyde dehydrogenase variants and methods of use
The invention provides polypeptides and encoding nucleic acids of aldehyde dehydrogenase variants. The invention also provides cells expressing aldehyde dehydrogenase variants. The invention further provides methods for producing 3-hydroxybutyraldehyde (3-HBal) and/or 1,3-butanediol (1,3-BDO), or an ester or amide thereof, comprising culturing cells expressing an aldehyde dehydrogenase variant or using lysates of such cells. The invention additional provides methods for producing 4-hydroxybutyraldehyde (4-HBal) and/or 1,4-butanediol (1,4-BDO), or an ester or amide thereof, comprising culturing cells expressing an aldehyde dehydrogenase variant or using lysates of such cells. |
| US11299714B2 |
Engineered adult-like human heart tissue
A cardiac organoid containing 3-D matter of adult human heart tissue. |
| US11299709B2 |
Pluripotent stem cell and T cell differentiated therefrom and application thereof
The present invention provides a pluripotent stem cell comprising a co-expression vector in which Runx1 and Hoxa9 are of in tandem, and a T cell differentiated therefrom and application thereof. In the present invention, Pluripotent stem cells inducibly co-expressing exogenous Runx1 and Hoxa9 are successfully established by introducing an exogenous vector co-expressing Runx1 and Hoxa9 into pluripotent stem cells. The pluripotent stem cells are directionally differentiated into T-lineage progenitor cells and will be developed into T cells. The pluripotent stem cell-derived T cells obtained by the method of the present invention are not only functionally normal but also have no tumorigenic risk. |
| US11299702B2 |
Portable disposable re-usable culture device for rapid diagnosis of infectious agents
The present invention is directed to compositions, tools, methods and devices to culture microorganisms and, in particular, to compositions, tools, methods and devices for the detection of microorganisms in biological samples. |
| US11299695B2 |
Beer making machine with direct steam injection
A beer making system may use direct steam injection during wort manufacturing. Steam may be added directly to the wort, and may be part of a recirculating mash system. The steam may be the primary mechanism for adding heat to the system, and may eliminate many problems that often occur when using conventional heating systems. A water reservoir may feed a stream generator, which may inject steam into wort during mashing or boiling steps. A controller may monitor temperature and other parameters, and may calculate the dilution of wort based on the water added through the steam injection and allow a brewing system to compensate for said dilution and still produce desired results. |
| US11299687B2 |
Guiding member in the form of a metal ring for assembly with friction and with the articulating and/or sliding capability of a shaft
The bore of the ring has workings (1a) suitable to act as a grease reserve at the friction area. A self-lubricating coating (3) with low wettability is applied to the entire surface of the said bore, including in the workings (1a) suitable to act as a grease reserve, such that after wearing of the layer of self-lubricating coating at the friction surface of the bore, the difference in wettability between the said friction surface and the workings still having the coating, enables the grease to be drawn out of the said workings in order to lubricate the said friction surface. |
| US11299685B2 |
Fuel and engine oil composition and its use
A composition is provided that contains a major amount of a base oil and a minor amount of at least one butylene oxide-modified alkyl-bis-ethoxylated monoamine, wherein the alkyl group have carbon atoms in the range of 8 to 22 and ethylene oxide to butylenes oxide is in a ratio in the range of about 3:1 to about 2:1. The composition provides improved friction modification in fuel and in lubricating oils. |
| US11299684B2 |
High naphthenic content marine fuel compositions
Marine diesel fuel/fuel blending component compositions and fuel oil/fuel blending component compositions are provided that are derived from crude oils having high naphthenes to aromatics volume and/or weight ratios and a low sulfur content. In addition to having a high naphthenes to aromatics ratio, a low sulfur content, and a low but substantial content of aromatics, such fuels and/or fuel blending components can have a reduced or minimized carbon intensity relative to fuels derived from conventional sources. The unexpected ratio of naphthenes to aromatics contributes to the fuels and/or fuel blending components further having additional unexpected properties, including low density, low kinematic viscosity, and/or high energy density. |
| US11299682B2 |
Systems and methods for crude oil desalting and dehydration in a single vessel
A system for crude oil desalting and dehydration in a single vessel is disclosed. The system comprises a pressure vessel defining a cavity and comprising a sealed bulkhead separating the cavity into a first compartment and a second compartment. Disposed within the first compartment is a first distributor disposed within the first compartment, a first electrical grid assembly, and a transfer conduit that passes through the bulkhead from the first compartment to the second compartment, the second compartment being in fluid communication with the first compartment via the transfer conduit. The pressure vessel may further comprise an overflow weir in the first compartment and a second electrical grid assembly disposed within the second compartment and aligned substantially transverse to a flow path extending from the transfer conduit to the crude collection header. |
| US11299681B2 |
Process for reducing the amount of carbon disulphide (CS2) in a hydrocarbon feed
The present disclosure relates to a process for reducing the amount of carbon disulphide (CS2) in a hydrocarbon feed containing C5-C8 fractions. The hydrocarbon feed is treated with an amine functionalized anion exchange resin (basic anion exchange resin) to obtain a mixture comprising a liquid fraction containing treated hydrocarbon and a solid mass containing an adduct of CS2 and the amine functionalized anion exchange resin. The so obtained liquid fraction containing the treated hydrocarbon is separated from the solid mass to obtain the hydrocarbon having CS2 content less than 2 ppm. The amine functionalized anion exchange resin can be regenerated from the solid mass. |
| US11299675B2 |
Polymerizable polar compound, liquid crystal composition and liquid crystal display device
A polar compound having high chemical stability, high capability of aligning liquid crystal molecules, high solubility in a liquid crystal composition, and a large voltage holding ratio when the compound is used in a liquid crystal display device; and a composition containing the compound. The compound is represented by formula (1). In formula (1), for example, P1 is a group represented by any one of formulas (1b) to (1i), P2 is a group represented by formula (1d), Sp1 and Sp2 are a single bond, Z1, Z2, Z3, Z4 and Z5 are —COO—, and ring A1, ring A2, ring A3 and ring A4 are 1,4-phenylene: |
| US11299674B2 |
Liquid crystal composition and display device thereof
The present invention provides a liquid crystal composition comprising: at least one compound of general Formula I; at least one compound of general Formula II; at least one compound of general Formula M and at least one compound of general Formula N. The present invention also provides a liquid crystal display device comprising the liquid crystal composition. The liquid crystal composition provided in the present invention has a higher optical anisotropy, a higher clearing point, a higher dielectric anisotropy, a high transmittance and a larger average elastic constant. When the liquid crystal composition is used in the IPS liquid crystal display device, the transmittance of the display device can be effectively improved, so that the display device has a good display performance while also having good energy-saving and environment-friendly characteristics. |
| US11299668B2 |
Methods and compositions for acidizing and stabilizing formation of fracture faces in the same treatment
An acidizing and formation stabilizing treatment fluid for stabilizing a fracture in a subterranean formation. An acid generating agent generates an acid in situ to acidize the formation thereby enhancing the fractures within and to cure an acid-catalyzed, curable resin to stabilize the formation. |
| US11299666B2 |
Surfactant composition for the reinjection of produced water
The invention relates to the use of a non-ionic surfactant and an anionic surfactant for enhancing the injectivity of an injection well, wherein the non-ionic surfactant and the anionic surfactant are added to produced water, to form a reinjection stream which is injected into a subterranean formation by the injection well. |
| US11299661B2 |
Water-based drilling fluids that include lubricants
One or more embodiments presently described are directed to drilling fluid compositions that include lubricants, methods for making drilling fluids, and methods for drilling subterranean wells utilizing the drilling fluids. According to one embodiment, a drilling fluid composition may include a base fluid including water, a weighting agent in an amount of from 0.1 weight percent (wt. %) to 75 wt. % relative to the total weight of the water-based drilling fluid, and a lubricant in an amount of from 1 wt. % to 10 wt. % relative to the total weight of the water-based drilling fluid. The lubricant may include one or more alkyl esters and a fatty acid blend including at least palmitic acid and stearic acid. The sum of the weight percent of the palmitic acid and stearic acid may be at least 50 wt. % of the fatty acid blend. |
| US11299658B2 |
Condensation-curable polyethersilicone tile adhesives
Tiles are adhesively bonded to substrates such as kitchen or bathroom walls by a process in which a tile adhesive is used, the tile adhesive being a one component RTV-1 moisture-curable tile adhesives having properties superior to conventional cementitious and RTU tile adhesives, which contain at least one low viscosity alkoxysilyl-functional polymer, a silicone resin, an aminoalkyl-functional alkoxysilane or partial hydrolysate thereof, and in excess of 60 weight percent mineral filler, of which at least 50 weight percent is a non-reinforcing filler. |
| US11299653B2 |
Composition, adhesive film, laminate, method for producing cured product pattern, and method for manufacturing circuit substrate
There are provided a composition having excellent adhesiveness and wettability, an adhesive film, a laminate, a method for producing a cured product pattern, and a method for manufacturing a circuit substrate. A composition for forming an adhesive film for imprinting, includes a compound 1 or a compound group 2; and a solvent, in which the compound 1 and the like is a compound decomposable into two or more compounds in a case where a polarity conversion group is treated, and at least one compound has a molecular weight of 30 to 400, and at least one compound has a molecular weight of 1,000 or more, the compound 1: a compound is a resin having a polymerizable group and a polarity conversion group, in which the resin has the polarity conversion group in at least a main chain or a side chain, the polarity conversion group is bonded to the main chain of the resin via a linking group in a case where the polarity conversion group is provided in the side chain, and the number of atoms constituting a chain of the linking group is 8 or more; and the compound group 2: a compound that has a polymerizable group and does not have a polarity conversion group, and a compound that does not have a polymerizable group and has a polarity conversion group. |
| US11299650B2 |
Silicone based self-adhering article and a method for making same
An article includes a non-tacky cured silicone first layer, an optional foamed material and a tacky cured silicone second layer wherein the first layer is directly bound to the second layer and the article is conformable to a body part. The article removably adheres to a body part. Also described is a method of making the article. |
| US11299648B2 |
Polymer, coating composition comprising same, and organic light emitting diode using same
The present specification relates to a polymer comprising: a first unit represented by Formula 1; and a second unit represented by Formula 2, a coating composition comprising the same, and an organic light emitting device formed by using the same. |
| US11299642B2 |
Systems and methods of additive printing of functional electronic circuits
A composition, method, and system for directly printing and creating complete functional 3D electronic circuits and devices without any thermal or laser post-processing treatment, by using at least Triphenylamine (TPA) as a powder binding agent. The composition can have mechanical characteristics that allow it to be melted and extruded on a structure, and electrical properties that allow it to function as at least one of a conductor, insulator, resistor, p-type semiconductor, n-type semiconductor, or capacitor. |
| US11299641B2 |
Curable liquid composition, composition-accommodating container, liquid composition discharging device, cured material, and method of manufacturing cured material
A curable liquid composition includes a monomer having an SI value of less than 3.0 and a photopolymerization initiator having a weight average molecular weight of 500 or greater, wherein the curable liquid composition is negative in skin sensitization. |
| US11299635B2 |
Bis-Azo colorants for use as bluing agents
This invention relates to bis-azo colorants for use as bluing agents, laundry care compositions comprising bis-azo colorants that may serve as bluing agents, processes for making such bluing agents and laundry care compositions and methods of using the same. The bluing agents are generally comprised of at least two components: at least one chromophore component and at least one polymeric component. These bluing agents are advantageous in providing a whitening effect to fabrics, while not building up over time and causing undesirable blue discoloration to the treated fabrics. |
| US11299633B2 |
Leucoindigo salt solution with very low content of aniline and method of making same
Stable aqueous leucoindigo solution comprising an aromatic amine in the form of aniline or aniline and N-methylaniline, wherein said leucoindigo is in the form of an alkali metal salt;wherein the concentration of the aromatic amine is below 40 ppm determined according to ISO 14362-1:2017(E); andwherein the concentration of the leucoindigo salt is in a concentration range of from 10 to 45% by weight based on the total weight of the solution, and wherein the stability of the solution is measured at a temperature of 23° C.; orwherein the concentration of the leucoindigo salt is in a concentration range of from 45 to 65% by weight based on the total weight of the solution, and wherein the stability of the solution is measured at a temperature of 60° C. |
| US11299631B2 |
Asphalt composition for road paving
The present invention relates to an asphalt composition for road pavement, which is excellent in drying strength, strength after immersion in water, and strength after immersion in petroleum, a method for producing the same, and a road paving method.[1] An asphalt composition for road pavement, containing asphalt, a polyester resin, and an aggregate, wherein the polyester resin is one subjected to melt-kneading and a ratio of the polyester resin is 5 parts by mass or more and 50 parts by mass or less based on 100 parts by mass of the asphalt; [2] a method for producing an asphalt composition for road pavement, including a step of mixing asphalt, a polyester resin, and an aggregate at 130° C. or higher and 200° C. or lower, wherein the polyester resin used in the mixing step is one subjected to melt-kneading, and a ratio of the polyester resin is 5 parts by mass or more and 50 parts by mass or less based on 100 parts by mass of the asphalt; and [3] a road paving method including a step of laying an asphalt composition obtained by the method of [2], thereby forming an asphalt paving material layer. |
| US11299630B2 |
Templated assembly of collagen fibers and uses thereof
The present invention relates to a biomaterial fabrication process for the manufacture of a collagen based fabric for an aligned collagen fiber network. |
| US11299628B2 |
Organopolysiloxane composition
Provided is an organopolysiloxane composition, comprising: (A) an organopolysiloxane having at least two silicon atom-bonded alkenyl groups in each molecule, (B) an organohydrogenpolysiloxane having at least two silicon atom-bonded hydrogen atoms in each molecule, (C) a platinum catalyst, and (D) a specific isocyanide compound. |
| US11299619B2 |
Composite structure having an inorganic coating adhered thereto and method of making same
The present disclosure provides a composite structure and associated method for preparing a composite substrate comprising an inorganic coating that is adhered to an organic-based substrate via an adhesion promoting agent comprising a molecule having a urea moiety at one end of the molecule and an alkoxysilane moiety at the other end of the molecule. The use of adhesion promoting agent having at least one of an amine or imine moiety and an alkoxysilane moiety promotes tight adhesion of the inorganic coating to the substrate. |
| US11299618B2 |
Polyacetal resin composition and article molded therefrom
The present invention provides a polyacetal resin composition comprising (A) a polyacetal resin and (B) zinc oxide, wherein the content of oxyalkylene constituent units other than an oxymethylene group in the polyacetal resin (A) is 0.1% by mass or more, and wherein the total surface area of the zinc oxide (B) in the polyacetal resin composition is 0.1 to 40 m2 per 100 g of the polyacetal resin (A); as well as an article molded therefrom. |
| US11299613B2 |
Ethylene-alpha-olefin copolymer-triallyl phosphate composition
A peroxide-curable ethylene copolymer composition comprising (A) a crosslinkable ethylene/alpha-olefin copolymer, (B) an effective amount of triallyl phosphate (TAP), (C) an organic peroxide; and, optionally, (D) a supplemental polymer; wherein the (A) crosslinkable ethylene/alpha-olefin copolymer is made by copolymerizing ethylene and an olefin-functional comonomer in the presence of a molecular catalyst useful therefor. Also provided are a cured product made from the composition, methods of making and using same, and articles containing same. |
| US11299608B2 |
Thermoplastic resin composition, method for producing same and molded body
Disclosed is a thermoplastic resin composition designed to, even when containing a filler, reduce a trade-off between stiffness and impact resistance to achieve a balance between impact resistance and stiffness, a method for producing the same, and a molded body. The thermoplastic resin composition is obtained by blending a polyolefin resin, a polyamide resin containing an inorganic filler, and a modified elastomer having a reactive group that reacts with the polyamide resin, wherein the polyolefin resin has a number-average molecular weight of 350,000 or more, and the polyamide resin has a structure in which a hydrocarbon group interposed between adjacent amide bonds in a main chain has 5 or less straight chain carbon atoms. The molded body is composed of the thermoplastic resin composition. The method for producing the thermoplastic resin composition includes melt-kneading a polyolefin resin and a melt-kneaded product of a polyamide resin and a modified elastomer. |
| US11299604B2 |
Rubber mixture and tire made by the same
The present disclosure provides a rubber mixture and a tire made the same. The rubber mixture consists essentially of: at least one kind of polar or non-polar rubber, at least one kind of filler, at least one kind of vulcanizing agent, at least one kind of accelerant, an optional anti-scorching agent, and an optional aromatic material. The accelerant is a compound containing two or more X-Y single bonds, wherein X is selected from element O and S, and Y is selected from element N and P. The rubber mixture and the tires of the present disclosure adopt improved accelerants and anti-scorching agents to reduce the generation of pungent volatile organic compound such as aniline, cyclohexylamine, tert-butylamine, and imine, thereby improving the odor problem of the tire. Meanwhile, the present disclosure omits carbon black, zinc oxide and other substances with fine powders, thereby reducing dust hazards to the operators. |
| US11299601B2 |
UV-photocured resin layer and image display device using the same
A UV-photocured resin layer (and an image display device including the UV-photocured resin layer), the UV-photocured resin layer including the following cured components: an acrylate-based oligomer component selected from the group consisting of a polyisoprene-based (meth)acrylate oligomer, a polybutadiene-based (meth)acrylate oligomer, and a polyurethane-based (meth)acrylate oligomer; an acrylic-based monomer component; a plasticizer component; and a photoradical polymerization initiator component. |
| US11299595B2 |
Heat-shrinkable polyester film and package
Provided is a heat-shrinkable polyester film which has heat shrinkage properties in a main shrinkage direction in the longitudinal direction, a small variation in shrinkage in the width direction, and less likely generated wrinkles and strains at the time of shrinkage finishing. The polyester film is prepared from a polyester raw material resin comprising 50 mol % or more of an ethylene terephthalate unit in 100 mol % of constituent units of a polyester, diol components selected from aliphatic, alicyclic, and aromatic diols, and an amorphous monomer component that is 2% or more in 100 mol % of either a polyhydric alcohol component or a polybasic carboxylic acid component in the whole polyester resin, wherein the polyester does not contain polybasic carboxylic acids of tribasic or more, and the polyester film is obtained by uniaxial drawing in the longitudinal direction. |
| US11299594B2 |
Carbinol-functional silicone resin, and method for producing silicone-modified polyester
Provided herein is a carbinol-functional silicone resin. The carbinol-functional silicone resin is prepared by reacting a raw silicone resin having at least 1 mass % of silicon atom-bonded hydroxyl groups, silicon atom-bonded alkoxy groups, or a combination thereof, and a dihydroxy-functional compound, in the presence of a condensation catalyst and a solvent. The carbinol-functional silicone resin can produce a solid silicone-modified polyester without gelation of the silicone resin. |
| US11299591B2 |
Polyethyleneimine compounds containing N-halamine and derivatives thereof
This invention relates to odor control molecules comprised of polyethyleneimine compounds containing N-halamine and derivatives thereof. |
| US11299587B2 |
Starting material, for bulk drug or additives for drug, and bulk drug or drug using same
The present invention provides a raw material for bulk drugs and a pharmaceutical additive which provide excellent formulation stability and excellent over-time stability of drug efficacy when used to modify a bulk drug, a polypeptide, a bioactive protein, an enzyme, and the like. The present invention relates to a raw material for bulk drugs or a pharmaceutical additive, containing: a polyether composition (A) represented by formula (1), wherein the polyether composition (A) has a unimodal molecular weight distribution, the polyether composition (A) has a ratio (Mw/Mn) of the weight average molecular weight (Mw) to the number average molecular weight (Mn) of 1.20 or less, and the polyether composition (A) contains a compound in which m is 1 in formula (1) in an amount of 90 wt % or more based on the weight of the polyether composition (A), in formula (1), OR1, R2O, R3O, and R4O are each independently a C2-C8 oxyalkylene group; when each of these moieties exists in the plural number, each OR1, each R2O, each R3O, and each R4O may be the same as or different from each other; these moieties may be bonded randomly or in block; a, b, c, and d are each independently an integer of 50 to 1200; X1 to X4 are each independently a hydrogen atom, a substituent represented by formula (2), or a substituent represented by formula (3); and m is an integer of 1 to 10. |
| US11299586B2 |
Fluorinated ether polymer, the preparation method therefore and use thereof
The embodiments herein relate to a fluorinated ether polymer which is capable of forming coatings with stain resistance, anti-fingerprint and anti-scratching properties. The polymer may be cured with multiple measures, therefore it has a variety of applications in coating and ink industry. The fluorinated ether polymers of the embodiments herein may be added into coating formulations to decrease the surface energy of resulting coatings. It is also feasible that the fluorinated ether polymers of the embodiments herein are used as the main resin component in coating formulations. The embodiments herein also relates to a method for manufacturing the polyester resin, and the use of the polyester resin in industries. |
| US11299585B2 |
Oligocarbonate polyols obtained from dianhydrohexitol dialkylcarbonate or a dimer of dianhydrohexitol carbonate, method for the production thereof and uses thereof
Provided is a method for producing an oligocarbonate polyol devoid of aromatic groups and phenolic functions, comprising a step of polycondensation by transesterification of monomers (A1) and/or dimers (A2) and of diol monomers (B1) and/or of triol monomers (B2), in a particular molar ratio, in order to obtain an oligocarbonate polyol having a molar mass of less than 5000 g/mol and at least two hydroxyl-type chain ends, the monomer (A1) corresponding to the following formula: (A1) and the dimer (A2) corresponding to the following formula: (A2) as well as the oligocarbonate polyol that can be obtained by this method and the polycarbonate that can be obtained by reacting this oligocarbonate with a polyisocyanate. |
| US11299582B2 |
Breathable elastomeric composites with tether-containing conducting polymers for nanoscale diffusion control and protection
An interpenetrating network (IPN) polymer membrane material includes a soft polyurethane interspersed with a crosslinked conducting polymer. The material can be reversibly “switched” between its oxidized and reduced states by the application of a small voltage, ˜1 to 4 volts, thus modulating its diffusivity. |
| US11299578B2 |
Self-restoring polyurethane-based polymer and preparation method therefor
A self-restoring polyurethane-based polymer obtained by polymerization of a composition containing an aromatic disulfide diol represented by Chemical Formula, HO—Ar1—S—S—Ar2—OH, an alicyclic polyisocyanate, and a polyol. Ar1 and Ar2 each are independently a substituted or unsubstituted C6-C30 arylene group. The composition satisfies Equation, 0.1≤M[disulfide]/M[OH]. M[disulfide] is a total mole number of the aromatic disulfide diol in the composition, and M[OH] is a total mole number of the aromatic disulfide diol and the polyol in the composition. |
| US11299574B2 |
Latex polymer for improved paint washability
The present invention is directed to a coating composition or paint comprising a polymer system including one or more latex polymers, wherein the acid content and molecular weight of the latex polymers are balanced to provide a coating composition that demonstrates optimal performance characteristics of washability or stain resistance, especially when used in a flat finish paint. |
| US11299573B2 |
Stable mass polymerizable polycycloolefin compositions as 3D printing materials and a method of fabrication thereof
Embodiments in accordance with the present invention encompass compositions encompassing a latent organo-ruthenium compound, a pyridine compound, a photosensitizer and an ultra violet light blocking compound along with one or more monomers which undergo ring open metathesis polymerization (ROMP) when said composition is exposed to suitable actinic radiation to form a substantially transparent film or a three dimensional object. Surprisingly, the compositions are very stable at ambient conditions to temperatures up to 80° C. for several days and undergo mass polymerization only when subjected to actinic radiation under inert atmosphere such as for example a blanket of nitrogen. Accordingly, compositions of this invention are useful in various opto-electronic applications, including as 3D printing materials, coatings, encapsulants, fillers, leveling agents, among others. |
| US11299572B2 |
Block copolymer
The present application can provide a block copolymer and a use thereof. The block copolymer of the present application can have excellent self-assembly properties or phase separation characteristics and excellent etching selectivity, and various other functions as required can be freely imparted thereto. |
| US11299570B2 |
Low-viscosity photocurable adhesive compositions
Photocurable (meth)acrylate compositions with low viscosity when uncured, and high flexibility and shear/tensile strength when cured, further possessing rapid tack-free fixture times, comprising mixtures of urethane acrylate resin, isobornyl acrylate, N,N-dimethylacrylamide, a photoinitiator component, and a low percentage of tetrahydrofurfuryl acrylate, for example from about 9% to about 15% by weight based on the weight of the composition. Applications can include adhesive bonding of medical tubing, UV/Visible transparent plastics material medical devices or equipment, or other flexible UV/Visible transparent material substrates. |
| US11299562B2 |
Methods for terminating olefin polymerizations
Catalyst deactivating agents and compositions containing catalyst deactivating agents are disclosed. These catalyst deactivating agents can be used in methods of controlling polymerization reactions, methods of terminating polymerization reactions, methods of operating polymerization reactors, and methods of transitioning between catalyst systems. |
| US11299551B2 |
Composite binding molecules targeting immunosuppressive B cells
Provided are anti-CD19 and anti-CD38 common light chain bispecific antibodies. The anti-CD19 and anti-CD38 bispecific antibodies described herein are useful in methods for treating a cancer or a tumor. |
| US11299550B2 |
Anti-CD73 antibodies and uses thereof
Anti-CD73 antibodies and antigen-binding fragments thereof are described. Also described are nucleic acids encoding the antibodies, compositions comprising the antibodies, and methods of producing the antibodies and using the antibodies for treating or preventing diseases such as cancer. |
| US11299547B2 |
CMET monoclonal binding agents, drug conjugates thereof and uses thereof
Presented herein, in certain embodiments, are compositions comprising monoclonal binding agents that specifically bind to the extracellular domain of cMET and uses thereof. |
| US11299546B2 |
FLT3-specific chimeric antigen receptors and methods using same
An embodiment of the invention provides a chimeric antigen receptor (C AR) comprising an antigen binding domain specific for FLT3, a transmembrane domain, and an intracellular T cell signaling domain. Nucleic acids, recombinant expression vectors, host cells, populations of cells, antibodies, or antigen binding portions thereof, and pharmaceutical compositions relating to the CARs are disclosed. Methods of detecting the presence of a proliferative disorder, e.g., cancer, in a mammal and methods of treating or preventing a proliferative disorder, e.g., cancer, in a mammal are also disclosed. |
| US11299545B2 |
Anti-HLA-C antibodies and uses thereof
Anti-HLA-C6 antibodies and antigen-binding fragments thereof are described. Also described are nucleic acids encoding the antibodies, compositions comprising the antibodies, methods of producing the antibodies, and methods of using the antibodies for treating or preventing diseases, such as autoimmune diseases. |
| US11299544B2 |
Biomarkers and methods of treating PD-1 and PD-L1 related conditions
Provided herein are biomarkers for the treatment of pathological conditions, such as cancer, and method of using PD-1/PD-L1 pathway antagonists. In particular, provided are biomarkers for patient selection and prognosis in cancer, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, methods of detection and methods of advertising related thereto. |
| US11299541B2 |
Biopharmaceutical compositions
The present disclosure relates to compositions, for treating interleukin 5 (IL-5) mediated diseases, and related methods. |
| US11299539B2 |
Methods of producing two chain proteins in bacteria
Provided herein are methods of producing a polypeptide containing two chains, such as an antibody including a light chain and a heavy chain. In particular, methods are provided for producing heterologous secretory proteins in bacteria through utilization of optimized expression vectors and culture processes. |
| US11299537B2 |
Methods for treatment of motor neuron diseases
The invention relates to methods and agents useful for treating motor neuron diseases (MNDs), in particular, amyotrophic lateral sclerosis (ALS). Methods and agents for treating various physiological and pathological conditions associated with motor neuron diseases are also provided. |
| US11299530B2 |
SIRP alpha-CD70 fusion protein and methods of use thereof
SIRPalpha-CD70 fusion proteins are provided. Accordingly, there is provided a SIRPalpha-CD70 fusion protein comprising a single amino acid linker between the SIRPalpha and the CD70. Also there is provided a SIRPalpha-CD70 fusion protein in a form of at least a homo-trimer. Also provided are polynucleotides and nucleic acid constructs encoding the SIRPalpha-CD70 fusion protein, host-cells expressing the SIRPalpha-CD70 fusion protein and methods of use thereof. |
| US11299529B2 |
Chimeric antigen receptors
A chimeric antigen receptor (CAR) comprising an extracellular spacer which comprises at least part of the extracellular domain of human low affinity nerve growth factor (LNGFR) or a derivative thereof. |
| US11299524B2 |
KIF13B-derived peptide and method of inhibiting angiogenesis
A construct composed of a Kinesin-derived Angiogenesis Inhibitor peptide and one or more carrier moieties and/or stabilizing moieties is provided as are methods for inhibiting angiogenesis and treating a disease or condition characterized by excessive vascularity. |
| US11299522B2 |
Method of producing proteins in filamentous fungi with decreased CLR2 activity
The present invention relates to a method of producing a recombinant polypeptide a filamentous fungus which is genetically modified to decrease or eliminate the activity of cellulase regulator 2 (CLR2) and to express said recombinant polypeptide. The method further relates to a filamentous fungus Myceliophthora thermophila, which is genetically modified to decrease or eliminate the activity of CLR2 and the use of this filamentous fungus in the production of a recombinant polypeptide. |
| US11299520B2 |
Compositions comprising a chimeric bacterial surface layer protein and methods of use thereof
The invention features engineered probiotic lacto acid bacteria (LAB) expressing a chimeric Clostridium difficile/Lactobacillus acidophilus SlpA, or fragment thereof, and its use for the treatment or prevention of Clostridium difficile infection and gut colonization. |
| US11299519B2 |
Host cells and methods using a repressor polypeptide and an inducible promoter for gene expression
The present invention provides for a system comprising (a) a first nucleic acid comprising a nucleotide sequence encoding a nucleotide sequence of interest operatively linked to a promoter comprising a repressor polypeptide binding site, and (b) a second nucleic acid comprising a nucleotide sequence encoding a repressor polypeptide having at least 70% amino acid identity with EilR, SmvR, KmrR, RcdA, or QacR; wherein expression of the nucleotide sequence of interest from the promoter is induced by the presence of a hydrophobic inducer, such as a hydrophobic cation inducer, such as a triarylmethane, acridine, phenazine, phenothiazine, or xanthene. |
| US11299512B2 |
Cyclic di-nucleotide compounds and methods of use
Disclosed are cyclic-di-nucleotide cGAMP analogs, methods of synthesizing the compounds, pharmaceutical compositions comprising the compounds thereof, and use of compounds and compositions in medical therapy. |
| US11299510B2 |
Substituted pyridopyrrolopyrimidine ribonucleosides for therapeutic uses
Substituted pyridopyrrolopyrimidine ribonucleosides of general formula I, wherein R is as described in the independent claim, preferably R is selected from the group comprising thiophen-3-yl, furan-2-yl, furan-3-yl, benzofuran-2-yl, methylsulfanyl, methoxy, amino, dimethylamino, methyl; and pharmaceutically acceptable salt thereof, their optical isomers and mixtures of such optical isomers. Compounds according to the invention show strong cytostatic and cytotoxic effects on cell lines of tumor origin in a wide variety of diseases including tumors of different histogenetic origin. |
| US11299505B2 |
Bis-imine titanium complex, catalytic system comprising said bis-imine titanium complex and process for the (co)polymertzation of conjugated dienes
Bis-imine titanium complex having general formula (I): wherein: R1 and R2, mutually identical or different, represent a hydrogen atom; or are selected from linear or branched, optionally halogenated, C1-C20 alkyl groups, preferably C1-C15, optionally substituted cycloalkyl groups; R3 and R4, mutually identical or different, represent a hydrogen atom; or are selected from linear or branched, optionally halogenated, C1-C20 alkyl groups, preferably C1-C15, optionally substituted cycloalkyl groups, optionally substituted aryl groups; X1, X2, X3 and X4, mutually identical or different, represent a halogen atom such as chlorine, bromine, iodine; or are selected from linear or branched C1-C20 alkyl groups, preferably C1-C15, —OCOR5 groups or —OR5 groups wherein R5 is selected from linear or branched C1-C20 alkyl groups, preferably C1-C15; or represent an acetylacetonate group (acac); provided that when R1 and R2 represent a methyl group and X1, X2, X3 and X4 represent a chlorine atom, R3 and R4 are different from 2,6-di-isopropylphenyl. |
| US11299504B2 |
Process for preparing a triazine-based precursor, the precursor prepared thereby, a method for producing a micro-particulate complex using the precursor, and the micro-particulate complex produced thereby
A process for preparing a triazine-based precursor for producing a micro-particulate complex containing a far infrared-emissive silica particle comprises steps of: a) subjecting 2-4-6-trichloro-1,3,5-triazine and a first nucleophilic compound to a displacement reaction in the presence of a first solvent at a first temperature range to form an intermediate; and b) subjecting the intermediate and a second nucleophilic compound to a further displacement reaction in the presence of a second solvent at a second temperature range higher than the first temperature range. |
| US11299503B2 |
Compound, coating composition comprising the same, organic light emitting device using the same and method for manufacturing the same
The present specification relates to a compound represented by Chemical Formula 1, a coating composition comprising the compound, an organic light emitting device formed using the coating composition, and a method for manufacturing the same. |
| US11299502B2 |
Condensed cyclic compound and organic light-emitting device including condensed cyclic compound
A condensed cyclic compound and an organic light-emitting device including the same are provided. When the condensed cyclic compound is used as an emission layer material in a device, the device may have excellent driving voltage, efficiency, and colorimetric purity. An organic light-emitting device including the condensed cyclic compound may have a low driving voltage, excellent efficiency, and a long lifespan. |
| US11299499B2 |
Preparation method and application of isoxazinone compounds
Disclosed herein are a preparation method and an application of an isoxazinone compound (I), where the preparation method includes: reacting compound (II) with a carboxylic acid (III) in the presence of a dehydrating agent and a base to produce the isoxazinone compound (I); and subjecting the isoxazinone compound (I) and a protonic acid salt of an amino compound (IV) or R3OH (VII) to ring-opening reaction in the presence of a base to produce a bisamide compound (V) or an N-acyl benzoate compound (VI). |
| US11299495B2 |
Spiro-lactam NMDA receptor modulators and uses thereof
Disclosed are compounds having potency in the modulation of NMDA receptor activity. Such compounds can be used in the treatment of conditions such as depression and related disorders. Orally delivered formulations and other pharmaceutically acceptable delivery forms of the compounds, including intravenous formulations, are also disclosed. |
| US11299492B2 |
JAK kinase inhibitor compounds for treatment of respiratory disease
The invention provides compounds of formula (I): wherein X is and the variables are defined in the specification, or a pharmaceutically-acceptable salt thereof, that are useful as JAK kinase inhibitors. The invention also provides pharmaceutical compositions comprising such compounds, methods of using such compounds to treat respiratory diseases, and processes and intermediates useful for preparing such compounds. |
| US11299490B2 |
Benzenesulfonamide compounds and their use as therapeutic agents
This invention is directed to benzenesulfonamide compounds, as stereoisomers, enantiomers, tautomers thereof or mixtures thereof; or pharmaceutically acceptable salts, solvates or prodrugs thereof, for the treatment of diseases or conditions associated with voltage-gated sodium channels, such as epilepsy. |
| US11299489B1 |
Thiazole compounds as protein kinase inhibitors
Thiazole compounds of Formula (I) shown below and pharmaceutical compositions containing one of such compounds: wherein R1 and R2 are defined in the specification. Also disclosed are methods of inhibiting a tyrosine kinase and treating cancer associated with a tyrosine kinase with one of the thiazole compounds. |
| US11299486B2 |
Benzazole compounds and methods for making and using the compounds
Disclosed are novel benzazole compounds and compositions comprising the compounds. The compounds are useful as kinase inhibitors including interleukin receptor associated kinases (IRAK) inhibitors. Also disclosed are methods of making and using the compounds and compositions. The disclosed compounds and/or compositions may be used to treat or prevent an IRAK-associated disease or condition. |
| US11299478B2 |
2-cyanopyrimidin-4-yl carbamate or urea derivative or salt thereof, and pharmaceutical composition including same
Provided is a 2-cyanopyrimidin-4-yl carbamate or urea derivative or pharmaceutically acceptable salt thereof, a process for the preparation thereof, and a pharmaceutical composition comprising the same. The 2-cyanopyrimidin-4-yl carbamate or urea derivative or pharmaceutically acceptable salt thereof selectively inhibits cathepsin K and therefore can be usefully applied for preventing or treating osteoporosis. |
| US11299476B2 |
Dopamine D3 receptor selective antagonists/partial agonists; method of making; and use thereof
Disclosed herein novel dopamine D3 receptor selective antagonists/partial agonists compounds with high affinity and metabolic stability useful for the treatment of psychiatric and neurological disorders and as research and diagnostic tools. Also disclosed are methods of making the compounds. |
| US11299468B2 |
Methods for producing 5-(halomethyl)furfural
The present disclosure provides methods to produce 5-(halomethyl)furfural, including 5-(chloromethyl)furfural, by acid-catalyzed conversion of C6 saccharides, including isomers thereof, polymers thereof, and certain derivatives thereof. The methods make use of acids with lower concentrations, and allows for conversion of sugars into 5-(halomethyl)furfural at higher temperatures and faster reaction or residence times. |
| US11299466B2 |
Compound, and organic electronic element comprising same
The present specification relates to a compound of Chemical Formula 1 and an organic electronic device comprising the same. |
| US11299463B2 |
Process for the manufacture of pyrazoles or pyrimidones
In one aspect the invention relates to the use of an amine compound in a process for the manufacture of a fluorinated or non-fluorinated 5- or 6-membered heterocyclic compound containing two nitrogen atoms in the ring system of the said compound, preferably of pyrazoles or pyrimidones. The invention also relates to a process for the manufacture of pyrazoles or pyrimidones, which may be fluorinated or may not be fluorinated (non-fluorinated). Especially, the invention relates to process for the manufacture of fluorinated pyrazoles or pyrimidones, and in particular the invention relates to process for the manufacture of such fluorinated pyrazoles or pyrimidones, which each are very important building blocks for pharmaceutical and agro-applications. For example, the fungicides are Bixafen, Fluxapyroxad, Fluindapyr, Sedaxane, Isopyrazam and Benzovindifupyr strongly depend on such fluorinated pyrazoles as key building blocks, or for Florasulam and Clorasulam-methyl (Diclosulam), respectively. |
| US11299462B2 |
Crystal form of oxopicolinamide derivative and preparation method therefor
Provided are a crystal form of an oxopicolinamide derivative and a preparation method therefor. In particular, provided are crystal forms A, B, C, D, E, and F of a compound as shown in formula (I) and a preparation method therefor. Crystal forms A, B, C, D, E, and F of the compound of formula (I) obtained in the present disclosure have good crystal stability and chemical stability, and can be better used in clinical treatment. |
| US11299460B2 |
MDM2 inhibitor, preparation method therefor, pharmaceutical composition thereof and use thereof
The present invention relates to an MDM2 inhabitor, a preparation method therefor, a pharmaceutical composition thereof, and the use thereof specifically, the present invention relates to a compound represented by formula I. The compound has excellent MDM2 inhibitory activities, and can be used for preparing a pharmaceutical composition for treating cancers and other diseases related to MDM2 activities, particularly p53 wild-type cancer. |
| US11299453B2 |
Compounds for use in the elimination of pluripotent stem cells
The present invention relates to a method of reducing the number or percentage of pluripotent stem cells or of enriching differentiating or differentiated cells in a cell population comprising pluripotent stem cells and differentiating cells or differentiated cells derived from the pluripotent stem cells, the method comprising the step of contacting the cell population with a compound according to the general formula (1). |
| US11299451B2 |
Method for synthesizing 2-(1-cyclohexenyl)ethylamine
A method for synthesizing 2-(1-cyclohexenyl)ethylamine. Cyclohexanone (II) is reacted with a Grignard reagent in a first organic solvent to produce 1-vinylcyclohexanol (III), which is then subjected to chlorination and rearrangement reaction with a chlorinating reagent in a second organic solvent in the presence of an organic base to synthesize (2-chloroethylmethylene)cyclolxane (IV). Then (2-chloroethylmethylene)cyclohexane (IV) and urotropine are subjected to quaternization in a third organic solvent to synthesize N-cyclohexylidene ethyl urotropine hydrochloride (V). Finally, the N-cyclohexylidene ethyl urotropine hydrochloride (V) undergoes hydrolysis and rearrangement reaction in a solvent in the presence of an inorganic mineral acid to synthesize 2-(1-cyclohexenyl)ethylamine (I). |
| US11299450B2 |
System and process for co-producing dimethyl carbonate and ethylene glycol
A system and a process for co-producing dimethyl carbonate and ethylene glycol. The system comprises an interconnected ethylene carbonate preparation unit and an ethylene carbonate alcoholysis unit. The ethylene carbonate preparation unit comprises a fixed bed reactor and a light-component stripping column connected to each other. The fixed bed reactor is filled with a supported ionic liquid catalyst. The process comprises the steps of: reacting carbon dioxide and ethylene oxide as raw materials in the fixed bed reactor to produce ethylene carbonate, purifying the ethylene carbonate and then mixing it with an alcoholysis reaction catalyst, and reacting the mixture with methanol in a reactive distillation tower, producing dimethyl carbonate and ethylene glycol. The process increases the conversion rate of ethylene oxide and avoids the need for a process of separating conventional homogeneous catalysts from ethylene carbonate, thereby reducing process energy consumption and simplifying process procedures. |
| US11299445B2 |
Process for preparing fluorobenzene derivatives and benzoic acid hypofluorite derivatives
The invention relates to a use of a fluorination gas, and the elemental fluorine (F2) is preferably present in a high concentration, for example, in a concentration of elemental fluorine (F2), especially of equal to much higher than 15% or even 20% by volume, and to a process for the manufacture of a fluorinated benzene derivative starting from benzoic acid derivative by direct fluorination employing a fluorination gas, wherein the elemental fluorine (F2) is preferably present in a high concentration, and subsequent decarboxylation of the benzoic acid hypofluorite derivative obtained by direct fluorination. The process of the invention is also directed to the manufacture of a benzoic acid hypofluorite derivative by direct fluorination of benzoic acid derivative. Especially the invention is of interest in the preparation of fluorinated benzene derivative, final products and as well intermediates, for usage in agro-, pharma-, electronics-, catalyst, solvent and other functional chemical applications. |
| US11299444B2 |
Selective hydrogen removal
Processes are provided for the removal of hydrogen from a mixture. The process can be performed by contacting a mixture comprising hydrogen, oxygen, and one or more organic compounds with a synthetic zeolite to produce water or steam. The synthetic zeolite can include Si and Al and has a SiO2:Al2O3 molar ratio of greater than 4:1, an 8-membered ring zeolite having a framework type of AEI, AFT, AFX, CHA, CDO, DDR, EDI, ERI, IHW, ITE, ITW, KFI, MER, MTF, MWF, LEV, LTA, PAU, PWN, RHO, SFW or UFI, a degree of crystallinity of at least 80% as measured by ASTM D535-197, and at least 0.01 wt % of at least one catalytic metal, based on a weight of the synthetic zeolite, where the at least one catalytic metal can include Ru, Rh, Pd, Ag, Os, Ir, Pt, Au, Mo, W, Re, Co, Ni, Zn, Cr, Mn, Ce, Ga, alloys thereof, or mixtures thereof. At least 95% of the catalytic metal can be disposed within a plurality of pores of the synthetic zeolite. |
| US11299443B2 |
Distillate production from olefins in moving bed reactors
Systems and methods are provided for oligomerization of olefins to distillate boiling range products while also recycling naphtha boiling range olefins as part of the feed. By performing the olefin oligomerization while also recycling naphtha boiling range olefins, it has been discovered that the resulting distillate boiling range products can have an unexpected improvement in diesel combustion quality, such as an unexpected improvement in cetane rating. In order to manage coke formation and maintain consistent activity profile for the oligomerization catalyst, the reaction can be performed in a moving bed reactor. Additional temperature control can be maintained by the recycling of the naphtha boiling range portions of the oligomerization product back to the reactor. |
| US11299441B2 |
Calcium sulfate urea granules and methods for producing and using the same
A calcium sulfate urea (UCS) fertilizer granule and methods for making and using the same are disclosed. The granule can include urea, calcium sulfate, and a calcium sulfate urea adduct, wherein a portion of the surface of the calcium sulfate urea adduct includes a layer comprising urea, calcium sulfate, or calcium sulfate urea adduct, or any combination or all thereof. |
| US11299440B2 |
Bodily remains decomposition
An organic composition for decomposing bodily remains including a composite mixture of compost, peat, sulfur, and gypsum. The composite mixture is configured to combine with the bodily remains to decompose the bodily remains. The combined mixture has a reduced pH for reducing the detrimental effects of the bodily remains on the environment. |
| US11299439B2 |
Mycorrhizae and/or Bacillus amyloliquefaciens liquid fertilizer compatible formulations
The present invention is directed to agricultural formulations containing mycorrhizae and/or Bacillus amyloliquefaciens that are compatible with liquid fertilizers. The present invention further relates to methods of improving plant growth by applying mycorrhizae and/or Bacillus amyloliquefaciens containing formulations to an area where a plant will grow. |
| US11299438B2 |
Method of obtaining a liquid organic biofertilizer for soil and/or plants, the biofertilizer and methods of using the same
The invention relates to the production and use of environmentally friendly liquid organic biofertilizer for soils and/or plants which is colonized by natural soil microorganisms. It is proposed the method in which, due to the optimal processing of a starting humus-containing soil or soil mixture colonized by natural soil microorganisms with applying the proposed “soft” controlled turbulence action without cavitation effects, the conditions for preserving and reproducing the natural soil microorganisms in their natural medium are provided, as a result it is obtained the final product in the form of a homogenous fine-dispersed suspension, which contains the solids of 10-50 microns size. This product is mainly composed of water-soluble nitrogen (preferably 40 mg/100 g fertilizer) and water-soluble carbon (preferably 470 mg/100 g fertilizer) and is suitable for packaging and long-term storage. The claimed biofertilizer is uniformly colonized by the hardened natural soil microorganisms which are in the state of anabiosis and spore forms, their concentration being at its maximum. The proposed treating soil, seeds or plants with using this biofertilizer results in higher crop yields, improved fertility of depleted soils and restored fertility of sandy and sandy-loam soils. |
| US11299432B2 |
Method of making a refractory article
A method of making a refractory article is provided. The method includes: a) mixing a binder system, a refractory charge, and a second colloidal binder to form an aqueous slurry; b) casting the aqueous slurry into a mold; c) subjecting the mold containing the aqueous slurry to a temperature that is lower than a slurry casting temperature for a time sufficient to form a green strength article; and d) firing the green strength article at a temperature of at least 450° C. for a time sufficient to achieve thermal homogeneity, thereby forming a refractory article. Refractory articles made in accordance with the method have a unique combination of pore structure and mechanical properties. |
| US11299431B2 |
Ceramic sintered body, insert, cutting tool, and friction stir welding tool
Provided is a ceramic sintered body having high wear resistance and chipping resistance. Also provided are an insert, a cutting tool and a friction stir welding tool, each of which uses such a high-performance ceramic sintered body. The ceramic sintered body includes Al2O3 (alumina), WC (tungsten carbide) and ZrO2 (zirconia), wherein Zr (zirconium) element is present at either one or both of: (1) a grain boundary between crystal grains of the Al2O3; and (2) a grain boundary of crystal grains of the Al2O and crystal grains of the WC, wherein the ceramic sintered body contains 55.0 to 97.5 vol % of the WC, 0.1 to 18.0 vol % of the ZrO2, and the balance being the Al2O3, and wherein the ZrO2 is in a phase of tetragonal structure (T) or a mixed phase of tetragonal structure (T) and monoclinic structure (M). |
| US11299428B2 |
High strength ceramics with novel fracture mode
The present invention provides a method for making a high strength, small grain size ceramic having a trans-granular fracture mode by rapid densification of a green body and subsequent cooling of the densified ceramic. The ceramic may include dislocations, defects, dopants, and/or secondary phases that are formed as a result of the process and resulting in stress fields capable of redirecting or arresting cracks within the material. This ceramic can maintain transparency from ultraviolet to mid-wave infrared. |
| US11299425B2 |
Composite material comprising a fibrous reinforcement and a poly(phospho-sialate) geopolymer matrix and associated manufacturing method
A composite material containing a matrix and a fibrous reinforcement, in particular a textile embedded in the matrix. The matrix includes a geopolymer of the poly(phospho-sialate) type having the following formula I: (1) (—P—O—Si—O—Al—O—)n in which n is greater than 2. The matrix further includes zirconium covalently bonded to the matrix, especially in the —ZrO form and/or in the —O—Zr—O form. The matrix has a melting temperature greater than 700° C., especially equal to or greater than 1200° C. |
| US11299424B2 |
Pozzolanic compositions containing fly ash and remediation agents for use in cementitious materials
It has been unexpectedly discovered that the addition of a natural or other pozzolan to non-spec fly ash significantly improves the properties of the non-spec fly ash to the extent it can be certified under ASTM C618 and AASHTO 295, as either a Class F or Class C fly ash. The natural pozzolan may be a volcanic ejecta, such as pumice or perlite. Other pozzolans may also be used for this beneficiation process. Many pozzolans are experimentally tested and may be used to beneficiate non-spec fly ash into certifiable Class F fly ash. Additionally, this disclosure provides a method of converting a Class C fly ash to a more valuable Class F fly ash. This discovery will extend diminishing Class F fly ash supplies and turn non-spec fly ash waste streams into valuable, certified fly ash pozzolan which will protect and enhance concrete, mortars and grouts. |
| US11299422B2 |
Method for producing insulating glass unit and method for producing glass window
A gas adsorbent is placed on at least a surface of a first plate on one side in a thickness direction thereof or a surface of a second plate on one side in a thickness direction thereof. The gas adsorbent has a shape with relatively raised and lowered parts arranged alternately. The gas adsorbent is placed along a sealant that joins the first and second plates. |
| US11299418B2 |
Unfired heat and/or sound insulation product and insulation blanket obtained therefrom
The invention relates to an uncured thermal and/or sound insulation product, based on mineral wool, advantageously on glass wool, that is in the form of a ply comprising a mineral wool layer sized by at least one binder, said sized layer having: a surface density, or basis weight, of less than or equal to 350 g/m2, preferably less than or equal to 300 g/m2, or less than or equal to 250 g/m2, and, optionally, greater than or equal to 200 g/m2, a micronaire of at most 3 under 5 grams, preferably of at most 15 l/min, better still of at most 12 l/min, and of at least 9 l/min, and the ply having a thickness of greater than 10 mm, or greater than or equal to 15 mm, or even greater than or equal to 25 mm. The invention makes it possible to propose a thermal and/or sound insulation product that is lighter while retaining satisfactory thermal and/or sound insulation properties and a good mechanical strength. |
| US11299415B2 |
Dissolved air flotation system and methods for biological nutrient removal
A wastewater treatment system including a contact tank, a dissolved air flotation unit, a fermentation unit, and a biological treatment unit is disclosed. A method of retrofitting a wastewater treatment system by arranging the wastewater treatment system such that floated biosolids are fermented in an anerobic environment and fluidly connecting the biological treatment unit to receive at least a portion of the fermented solids is also disclosed. The method optionally includes providing a fermentation unit and fluidly connecting the fermentation unit to a biological treatment unit. A method of treating wastewater including combining the wastewater with activated sludge, floating biosolids from the activated wastewater, fermenting the floated biosolids, and biologically treating the effluent with the fermented solids is also disclosed. A method of facilitating delivery of soluble organic carbon to a biological treatment unit is also disclosed. |
| US11299414B2 |
Multiple attached growth reactor system
Described herein are attached growth reactor systems which increase nitrifying bacteria biomass through a variety of means during warm weather. As a consequence, the attached growth reactor system contains sufficient nitrifying bacteria biomass to remove ammonia from wastewater in cold to moderate climates. In one example, there are two attached growth reactors into which wastewater is distributed discontinuously. Specifically, wastewater is transferred to the first attached growth reactor for a first period of time and then is transferred to the second attached growth reactor for a second period of time during warm weather which effectively doubles the nitrifying bacteria biomass in the system. During cold weather, approximately half of the wastewater is applied to each reactor simultaneously. |
| US11299410B2 |
Water filter with water enrichment
The present invention describes a water filter apparatus (100, 100a) with integrated nutrient enrichment and/or enhancement. Desired nutrients, ions, hydrogen ions, ceramic, stones, metal etc. packed in granules or balls are selectively disposed inside a stick capsule (160), shell capsule (180) or hydrogen capsule (190). One or two stick capsules (160) are located inside a filter element (150). The stick capsule has a tapered end (162) and in association with T-shaped posts (157) formed on an inside of a cap (151) of the filter element, dynamic flow of water along the tapered end (162) induces nutrient-rich water to flow through perforations (165) at the end of the stick capsule (160), mixes/blends the two streams of water before water is discharged through a faucet (144). The filtered water is also enhanced by treating the water through flavor treatment, anti-bacterial, anti-chlorine, activated carbon and so on. |
| US11299404B2 |
Condensation catalyst systems and methods
A reactor system may comprise a housing; and a condensation catalyst layer within the housing comprising a condensation catalyst comprised of at least one of a base-substituted zeolite, a stannous salt, or a phosphonitrile chloride. The condensation catalyst layer may be configured to catalyze a condensation reaction of a plurality of silane diols in water flowing through the housing into a plurality of siloxanes. |
| US11299402B2 |
Precursor materials for li-ion battery cathode synthesis
Provided are particles for use as a precursor material for synthesis of Li-ion cathode active material of a lithium-ion cell comprising: a non-lithiated nickel oxide particle of the formula MOx wherein M comprises 80 at % Ni or greater and wherein x is 0.7 to 1.2, M optionally excluding boron in the MOx crystal structure; and a modifier oxide intermixed with, coated on, present within, or combinations thereof the non-lithiated nickel oxide particle, wherein the modifier oxide is associated with the non-lithiated nickel oxide such that a calcination at 500 degrees Celsius for 2 hours results in crystallite growth measured by XRD of 2 nanometers or less. Also provided are processes of forming electrochemically active particles using the precursors nickel oxides. |
| US11299401B2 |
Positive electrode active material for secondary battery, manufacturing method thereof, and secondary battery including same
The present invention provides a positive electrode active material for a secondary battery, which includes a lithium transition metal oxide including nickel (Ni) and cobalt (Co), and at least one selected from the group consisting of aluminum (Al), manganese (Mn), and a combination thereof. The lithium transition metal oxide is characterized in that the content of nickel (Ni) in the total transition metal elements is 80 mol % or more, and the cation mixing ratio of Ni cations in a lithium layer in the lithium transition metal oxide structure is 1.1% or less. |
| US11299400B2 |
Hierarchical porous ZrO2 material, method of preparing the same, and application thereof
A method for preparing a hierarchical porous ZrO2 includes the following steps: S1, dissolving a triblock copolymer in an organic solvent to obtain a solution A, dissolving a tannin extract in distilled water to obtain a solution B, mixing the solution A and the solution B and stirring to obtain a mixed solution; S2, adding a zirconium salt to the mixed solution obtained in step S1 and stirring; S3, heating the mixed solution obtained in step S2 in an oven to obtain ZrO2, promoting the conversion of the crystal form of ZrO2; S4, calcining ZrO2 at a high temperature to obtain the hierarchical porous ZrO2. |
| US11299398B2 |
Modified calcium aluminate compound and production method therefor
The present invention provides a novel method for producing a calcium aluminate compound having a modified surface. The present invention provides: a method for producing a modified calcium aluminate compound characterized by irradiating a calcium aluminate compound dispersed in an organic dispersion medium with a femtosecond laser, thereby modifying the surface of the calcium aluminate compound; and a modified calcium aluminate compound characterized by being obtained by this method and having at least one of an OH group, a CO group, a CH group, and an NH group. |
| US11299396B2 |
System for the production of carbon nanotubes from carbon matter, preferably, plastic waste and solar energy; method of production
The present invention relates to a system for the production of carbon nanotubes from carbonaceous matter, preferably, plastic waste and solar energy; Method of production. |
| US11299395B2 |
Porous one-dimensional polymeric graphitic carbon nitride-based nanosystems for catalytic conversion of carbon monoxide and carbon dioxide under ambient conditions
In some aspects and embodiments, the present application provides a wide range of porous 1-D polymeric graphitic carbon-nitride materials that are atomically doped with binary metals in different morphologies. In some embodiments, the graphitic carbon-nitride materials can be prepared with high mass production from inexpensive and natural abundant precursors. In some embodiments, the materials were used successfully for the oxidation of CO to CO2 under ambient reaction temperature in addition to the reduction of CO2 into hydrocarbons. In some embodiments, the materials can be used for practical and large-scale gas conversion for household or industrial applications. |
| US11299393B2 |
On-chip signal path with electrical and physical connection
An exemplary microelectromechanical system (MEMS) device comprises a plurality of stacked layers, including at least one layer that includes micromechanical components that respond to a force to be measured. Two of the layers may include respective first and second external electrical connection points. A plurality of conductive paths may be disposed in a continuous manner over an external surface of each of the plurality of layers between the first and second external electrical connection points. |
| US11299392B2 |
Packaging for MEMS transducers
The Application describes a substrate design for a MEMS transducer package. The substrate is defined by a conductive layer which forms the upper and lower surfaces of the substrate. The substrate is also provided with a conductive portion which is electrically isolated from the rest of the conductive layer. The conductive portion is supported between a first plane defined by the upper surface of the substrate and a second plane defined by the lower surface of the substrate by an electrically insulating moulding substance. |
| US11299389B2 |
Saddle with interface having passively morphing elements and method of use
Saddle with passively morphing interface panels and method of use, wherein passively morphing interface panels morphs in surface profile to be reshaped upon contact with a supporting surface of a horse's dynamic back and of horses of varying sizes and shapes, so that a direct load path is created from the riders concentrated downward weight on a chassis through a pair of symmetrically opposed line of contact edges, aligned with tilted sagittal plane sections through the horse's back surface, and making contact with the midline area of opposed pair of elements made of rigid materials that are caused to tip out of plane until moment forces are balanced, which occurs when the element's entire length makes contact with the supporting horse's back causing the elements interface's surface profile to be reshaped, without directed input, to momentarily match the varying supporting surface profiles of a horse's dynamic back. |
| US11299385B2 |
Multiple-piece vacuum-insulated heating tank of water dispenser
A multiple-piece vacuum-insulated heating tank for use in a water dispenser includes a threaded cover, a thermal insulation cover, and a heating tank body. The threaded cover is mounted on an upper opening of the heating tank body and includes a plastic cover and a protective cover mounted on and around the plastic cover. The thermal insulation cover is fitted in the upper opening and includes an upper cover and a lower cover. The lower cover is cup-shaped; is mounted with a heating tube, a water inlet pipe, a water outlet pipe, a thermowell, a temperature-sensing heat pipe, a heat collector block, and two snap-action thermostats at the bottom side; and has a sidewall formed with a step adjacent to the bottom side. The heating tank not only has a multiple-piece structure that facilitates mass production and maintenance, but also dispenses with electronic temperature control as is conventionally required. |
| US11299381B2 |
Winch handle operated bottle closures and methods for using
Novel closures for bottles comprising a bottle closure having a socket shaped and sized to receive the drive head of a convention winch handle and a closure means for securing the closure to the neck of the bottle to seal the bottle. Two such closures are described, one of for use with beer style bottle and another for rum or whiskey style bottles. The closures are particularly useful for bottled beverages brought aboard sailboats that use manual winches. The closures can be removed from the bottles using winch handles that are already aboard the sailboat, allowing the beverages to be consumed. |
| US11299376B2 |
Method for the positionally accurate receiving and depositing of a container using a gantry stacker and gantry stacker for this purpose
A gantry stacker having a spreader for containers and including a locating system arranged on the gantry stacker that determines a position of the gantry stacker. To permit a more precise receiving or depositing of containers in a predefined position in a container terminal, sensors are arranged on the gantry stacker, with the sensors and the locating system being connected to a control unit, and the control unit determines a position of the spreader, of a container to be received or of a deposit site from the position of the gantry stacker using the signals from the sensors. |
| US11299374B2 |
Method and kit for retrofitting elevator machines with thrust bearing, and retrofitted elevator machine
Disclosed is a method for retrofitting an elevator machine with a thrust bearing, including removing, from a bearing stand, a first cover plate, providing access to an end portion of a motor shaft, securing an extension shaft against the end portion of the motor shaft, securing a thrust bearing housing against or axially offset from the bearing stand, positioning a thrust bearing in the bearing housing, wherein an inner race of the thrust bearing is securely positioned against, and axially fixed to, the extension shaft, and an outer race of the thrust bearing is securely positioned against the bearing housing, and securing a second cover plate to the bearing housing. |
| US11299360B2 |
Image forming apparatus for forming image on sheet
In an image forming apparatus that can form images on both surfaces of a sheet, a first roller conveys a sheet conveyed from a reversal roller and a first motor drives the reversal and first rollers. A one-way clutch restricts transfer of a driving force from the first motor to the first roller while the reversal roller is conveying a sheet in a first direction, and permits transfer of a driving force from the first motor to the first roller while the reversal roller is conveying a sheet in a second direction. Second and third rollers are provided on a downstream side of the first roller. A second motor drives the second and third rollers. A controller drives both of the first and second motors when resuming conveyance of a sheet conveyed on a duplex conveyance path after causing the sheet to await abutment with the second roller. |
| US11299359B2 |
Lapper assembly
The present disclosure provides embodiments of a lapper assembly for use to overlap successive sheets of wood veneer or other materials along a conveyor. The lapper assembly may include a stop member configured to be rotatably mounted to a roller such that the stop member is pivotable around the rotational axis of the roller independently of the rotational angle of the roller. The lapper assembly may further include a lever arm coupled to one end of the stop member. An actuator may be pivotably coupled to the lever arm and the conveyor frame, and operated to pivot the stop member between a workpiece engaging position, in which the stop member extends into the path of workpiece flow, and a workpiece disengaging position below the path. Optionally, the lapper assembly roller and other rollers upstream/downstream may be operatively connected to a drive. Corresponding systems and methods are also disclosed herein. |
| US11299358B1 |
Storage bin sweep system with enhanced peripheral sweep capability
A system for moving particles across a floor surface of a storage bin having a peripheral wall extending upwardly from the floor surface. The system may comprise a bin sweep apparatus having an inboard end for locating toward to a central area of the bin and an outboard end for locating toward a peripheral area of the bin. The system may also comprise a peripheral sweeping apparatus configured to mount on the bin sweep apparatus to sweep particles on the floor surface adjacent to the peripheral wall toward the bin sweep apparatus. The peripheral sweeping apparatus may be mounted on the bin sweep apparatus toward the outboard end thereof. |
| US11299357B1 |
Vacuum conveyor system for removing articles, such as containers, from trays
A transfer system for removing articles from trays includes a supply conveyor and a discharge conveyor A separation and transfer arrangement, including an article transport member, is interposed between a downstream end of the supply conveyor and an upstream end of the article discharge conveyor. The article transport member. Which may be a vacuum conveyor, acts on an upper end defined by each article to suspend the articles therebelow, and advances the articles from the downstream end of the supply conveyor to the upstream end of the discharge conveyor, which are at generally the same elevation. A tray transport member extends from the downstream end of the supply conveyor, and advances the trays downwardly in an upstream-to-downstream direction so that the trays are positioned below the upstream end of the discharge conveyor as the articles are deposited on the upstream end of the discharge conveyor by the article transport member. |
| US11299356B1 |
Product purchase system including product retrieval robot of add-on product based upon mobile device and related methods
A product purchase system may include a product retrieval robot for a physical store and a mobile wireless communications device associated with a given user and configured to obtain product identifying data for a given product for purchase in the physical store. The given product for purchase may be placed by the given user into a physical shopping cart. The system may also include a server configured to identify the given product for purchase based upon the product identifying data, and determine an add-on product associated with the given product for purchase and located in the physical store. The product retrieval robot may be configured to cooperate with the server to retrieve the add-on product from the physical store and deliver the add-on product to the physical shopping cart. |
| US11299352B2 |
Automatic cart transport system
An automatic cart transport system. A track located in a factory working floor provides a trackway for an endless flexible conveyor chain. A plurality of chain units including a first chain portion having vertical rollers and a second chain portion having horizontal rollers are flexibly coupled, and the chain is advanced along the trackway by a drive motor. The chain units support thereabove, but within the track, a coupling plate having therein an aperture for accepting and capturing a chain connection shaft which is detachably connected to a cart. The cart is automatically towed along a defined pathway on the working floor of a factory by the chain, when connected to the coupling plate on the endless flexible conveyor chain. |
| US11299346B1 |
Pharmacy order filling system and related methods
Drug packets may be dispensed as a belt of drug packets. Machine-readable identifiers in the belt may be automatically read to identify drug packets and associate the drug packets with the received orders. The drug packets may be automatically inspected to confirm contents of the drug packets against the received orders. The belt may be automatically separated into segments of drug packets. Each of the segments may correspond to a supply period and each of the drug packets within each of the segments may correspond to a drug dose event for the multi-drug regimen within the supply period. The segments of the belt may be automatically accumulated into belt rolls such that, for each of the belt rolls, a first segment end is on an interior of the belt roll and a second segment end is on an exterior of the belt roll. |
| US11299344B2 |
Storage systems and methods
A storage system is described where goods are stored in containers (10) and the containers (10) are stored in stacks. Above the stacks runs a grid network of tracks on which load handling devices run. The containers (10) may be provided with one or more of the following services: power, power control, heating, lighting, cooling, sensing means, and data logging means. The provision of these services within individual containers rather than across the system as a whole, allows for flexibility in storage whilst reducing cost and inefficiency. |
| US11299343B1 |
Refuse hopper
A refuse hopper is disclosed which may be mounted in the bed of a pick-up truck, a flat-bed truck or on a trailer. The refuse hopper includes a horizontally disposed support frame having a rear end, a front end, a first side and a second side. A hopper is pivotally mounted on the support frame and has a front end, a rear end, a front side and a second side. The refuse hopper is selectively movable between a horizontally disposed loading position and a dumping position. A compactor plate is pivotally mounted to the hopper and is movable between an upwardly extending loading position to a refuse packing position within the hopper. The hopper has a volume of about 2-4.5 cubic yards. |
| US11299337B2 |
Flexible packages with flat panels
Flexible packages with reinforcing areas and flat panels. |
| US11299335B1 |
Flexible packaging rib stiffeners
A padded mailer includes ribs that provide stiffness, especially in the transverse direction. The increased stiffness helps prevent the mailer from flipping over during conveying, which would put a label on the underside of the mailer. |
| US11299334B2 |
Membrane lid with integrated two-stage tab system
The present invention relates to a resealable membrane lid for a container comprising a peelable portion and a removable portion. When the resealable peelable portion is peeled back, the seal onto the container is not disturbed. When the removable portion is removed from the container, the container contents may be accessed. The peelable portion may be resealed onto the container at any point in the process. |
| US11299331B2 |
Container
A container of a plastic material has a container body (1) for receiving a fluid and a neck part (7) adjoining the container body (1). The neck part (7) has at its free end a discharge opening for the fluid closed by a head part (11) and covered by a cap (19). The cap (19) interacts with individual blocking elements via a retaining ring (21), starting from an attachment position of the cap (19). Rotary motions in both directions of rotation are permitted along a predetermined path of travel. During a further screw-on motion beyond the predetermined path of travel, a part of second blocking elements completely passes over assigned first blocking elements, and in so doing the head part (11) is penetrated by the opening part of the cap (19). During a subsequent unscrewing motion of the cap (19) for the purpose of releasing the discharge opening, the retaining ring (21) is disengaged from the cap (19) and, in the process, is secured on the neck part (7) at least temporarily against rotation in the unscrewing direction by at least one blocking element. |
| US11299328B2 |
Bottle and cap arrangement
A bottle assembly that includes a bottle with a finish having a mouth for containing an E-liquid. The mouth of the bottle is sealed with a plug having an anti-drip well. The anti-drip well sized to prevent inadvertent spillage of the E-liquid contained within the bottle. An annular cap protrusion of the plug can engage with a channel on an upper portion of the bottle to attach the plug with the upper portioned with the mouth of the bottle. A lower channel edge can include a notch that can be used as a wedge to incrementally remove the plug from the mouth of the bottle without damage thereto. |
| US11299326B2 |
Reclosable pouch with an elongate closure mechanism
A reclosable pouch in combination with an elongate closure mechanism. The pouch has a mouth defining an opening into an interior space. The elongate closure mechanism includes a first base member disposed along a first sidewall. A pair of interlocking members extends from a first surface of the first base member. The interlocking members are parallel to each other with a space therebetween. A plurality of partial indentations is disposed along a second surface of the first base member, extending longitudinally between the opposite ends of the elongate closure mechanism, and being visible between the opposite ends of the elongate closure mechanism. The interlocking members extending from the first base member occlude and deocclude with a pair of interlocking members extending from the second base member, in order to resealably close the mouth. The plurality of partial indentations remains visible during the occluding and deoccluding. |
| US11299325B2 |
Packages with raised portions
Packages having raised portions that provide improvements in displaying graphics, such as images and branding. |
| US11299324B2 |
Produce container
An embodiment includes a bag comprising mesh and film side walls and a reinforcing strip of film; wherein (a) the mesh side wall is sealed to opposing side edges of the film side wall; (b) the reinforcing strip of film is sealed to an upper portion of the mesh side wall and to the opposing side edges of the film side wall; (c) the film side wall has a bottom extension, which is monolithic with the film side wall, extending upwardly and sealed along a lateral extent of a bottom portion of the mesh side wall; (d) the film side wall is non-coplanar with a portion of the bottom extension; (e) another portion of the bottom extension is non-coplanar with the mesh side wall; and (f) a horizontal axis intersects the bottom portion of the film side wall and three portions of the bottom extension. |
| US11299318B2 |
Portable container and container assembly
An accessory for use with a portable container includes a jacket having a storage member and configured to extend around at least a portion of the sidewall of the container and a connection member connected to the jacket and configured to support the jacket in connection with the container. The connection member includes a connector configured to be connected to a port on the container such that a portion of the connector is received through the port. |
| US11299317B2 |
Carton with tab
A foldable food carton including a lid portion; a bottom portion; and a viewable tab attached to the lid portion, wherein the tab comprises one or more of alphabetic text, numeric text, QR code, bar code, graphic, design, or combination thereof printed on the tab. A method of assembling a carton with a viewable tab, including providing a carton in an unfolded configuration, and folding the carton into an assembled configuration, wherein upon folding the carton into the assembled configuration the tab moves from a first position to a second position. |
| US11299315B2 |
Foldable box connection structure, foldable box and method of using the same
The invention provides a foldable box connection structure, a foldable box and a method of using the same. The foldable box connection structure comprises a first side plate, a second side plate, a first hinge, a first top plate, a seam cover plate and a positioning plate. The first hinge is used to connect the first top plate and the second side plate. The seam cover plate can be folded to cover the first hinge, and the seam cover plate and the positioning plate are configured to secure the first hinge. The foldable box includes the above-mentioned connection structure. In the present invention, the first top plate is hooked by the first hinge and the seam cover plate, and a second top plate is hooked by a third hinge, so that the foldable box has a fixed structure. |
| US11299312B2 |
Method for producing a leak-tight vessel, and a leak-tight vessel
The present invention describes a method for producing a leak-tight vessel for holding a gas and/or liquid, comprising the steps of winding a heat-sealable thermoplastic barrier strip around a removable mandrel in such a way that each strip fragment overlaps with a substantially parallel strip fragment over at least a lateral overlapping distance, consolidating the overlapping strip fragments so as to form a gas and/or liquid tight layer, winding a fibrous material around the gas and/or liquid tight layer, thereby leaving an opening large enough for removing the mandrel. The invention also describes a leak-tight vessel produced in this way. |
| US11299308B2 |
Electronic product packaging system
An electronic product packaging system includes a robot on which a vacuum suction device adapted to pick up a packaging box and a gripper adapted to grab an electronic product are disposed, a packaging box loading platform adapted to load a pile of a plurality of the packaging boxes stacked together, a product loading device having a loading groove adapted to load a row of a plurality of the electronic products, and a packaging platform carrying the electronic products and the packaging boxes. The robot is configured to pick up the packaging box from the packaging box loading platform and place the packaging box on the packaging platform with the vacuum suction device. The robot is configured to grab the electronic product from the product loading device and place and pack the electronic product into the packaging box on the packaging platform with the gripper. |
| US11299305B2 |
Sewn stack of absorbent sheets
The invention provides a stack comprising a plurality of absorbent sheets stacked in facing arrangement. The stack is bound along its top edge by at least one line of stitches comprising a plurality of spaced apart stitch holes and a thread disposed therein. Individual sheets further comprise a line of perforations comprising a plurality of spaced apart perforation holes. The line of stitches and the line of perforations are such that there is generally a one-to-one numerical correspondence amongst at least a majority of the plurality of stitch holes and perforation holes. |
| US11299304B2 |
Device and method for transporting ready-cut and filled hose pieces
The present invention relates to a simplified device and a process-technically simplified and also more rapidly applicable method for transporting readily cut and filled hose pieces within a machine for producing pouches filled with brewable material. The device according to the invention has a transport wheel which has several supports distributed over its circumference, each holding a pouch which are pivotally mounted on the transport wheel. In the method according to the invention, a hose piece for forming a pouch with at least one chamber between a head and a bottom is inserted in the radial direction into a support of the transport wheel. In a removal station the pouch is removed radially from the transport wheel with the bottom leading. |
| US11299303B2 |
Food article loading system and method
A food article loading system including a shuttle conveyor mounted for reciprocal movement having a first paddle belt for receiving food articles, and upper and lower drives engaging the upper and lower passes of the first paddle belt; a loading head having a second paddle belt for receiving the food articles from the first paddle belt lower pass; a slide gate for receiving groupings of food articles from the loading head; and a control for independently actuating the upper and lower drives to operate at selected speeds, to cause rotation of the first belt and the shuttle conveyor to reciprocate longitudinally to receive and retain a first predetermined number of the food articles, deposit a second predetermined number of the elongate food articles onto the second belt at a selected frequency, and selectively open the slide gate to allow groupings of food articles to fall into receptacles. |
| US11299302B2 |
Integrated semiconductor die parceling platforms
In certain embodiments, a system includes: an inspection station configured to receive a die vessel, wherein the inspection station is configured to inspect the die vessel for defects; a desiccant station configured to receive the die vessel from the inspection station, wherein the desiccant station is configured to add a desiccant to the die vessel; a bundle station configured to receive the die vessel from the desiccant station, wherein the bundle station is configured to combine the die vessel with another die vessel as a die bundle; and a bagging station configured to receive the die bundle from the bundle station, wherein the bagging station is configured to dispose the die bundle in a die bag and to heat seal the die bag with the die bundle inside. |
| US11299300B2 |
Pouch filling station
A table top appliance rapidly fills a pouch through some mechanical actuation or automation by inserting the pouch into the appliance and the machine fills the pouch. One embodiment of the food pouch filling station may be a mechanical version that includes a method to pump or push the contents of the container into the pouch. A second embodiment of the food pouch filling station may be an electric pump version that fills pouches and may have the option of controlling the amount of food dispensed. The food pouch filling station may also include a valve that connects to the pouch to control the flow to the pouch. |
| US11299298B2 |
Connection device with separation controlled by non-pyrotechnic thermal effect with reduced reaction time
In order to provide a temporary connection between two structure elements, such as two parts of a space launcher or of another type of spacecraft or aircraft, a connection device with controlled separation comprises a thermally breakable layer, two thermal containment layers, between which the thermally breakable layer is arranged, and an electrically conductive element arranged between the two thermal containment layers in such a way as to heat the thermally breakable layer using the Joule effect when an electric current passes through the electrically conductive element. |
| US11299297B1 |
Magnetic shield system for spacecraft
A system to create a magnetic field or fields around the outside of a spacecraft to provide protection from cosmic and solar radiation. Electromagnets are placed within one or more layers of the outer shell or surface of a spacecraft and are used to generate magnetic fields. Side electromagnets are placed within one or more of the side layers of the outer shell or surface of the spacecraft and separate configurations of electromagnets are positioned within one or more layers of the outer shell or surface of the spacecraft, in a cross shaped configuration, either Quadrupole electromagnet configuration or two right-angled electromagnet configuration, at the front and rear of the spacecraft in geometric alignment with the opposite poled side positioned electromagnets. Magnetic field lines are channeled around the outside of the spacecraft by use of the right-angled electromagnet configuration or centered on the center of the quadrupole electromagnet configuration. |
| US11299296B2 |
Spacecraft
Disclosed is a spacecraft including: a housing defining an exterior space, the housing having a first face and a second face; and first and second radiators carried by the first and second faces, the first and second radiators each having an inner main face, an outer main face, and side faces. The spacecraft includes a first auxiliary radiator and a first auxiliary heat transfer device thermally connecting the first auxiliary radiator to the inner main face of the second radiator, the first auxiliary radiator being arranged in a first portion of the exterior space defined by the outer main face of the first radiator and by first planes containing the side faces of the first radiator. The first auxiliary heat transfer device includes a heat conducting device. The first auxiliary radiator is composed solely of one or two radiating panels supporting the heat conducting device. |
| US11299288B2 |
Method of presenting flight data of an aircraft and a graphical user interface for use with the same
A method of presenting flight data of one or more aircrafts, including the steps of: receiving dataset associated with the aircraft from a data management system; applying an analysis process to compare at least two portions of the received dataset; and presenting the analysed data portions to a user in a visualized manner. A graphical user interface is also included for use with the method. |
| US11299287B1 |
Methods and systems for orienting a thrust propulsor in response to a failure event of a vertical take-off and landing aircraft
Aspects relate to systems and methods for orienting a thrust propulsor in response to a failure event of a vertical take-off and landing (VTOL) aircraft. An exemplary system includes a plurality of lift propulsors mechanically connected to a VTOL aircraft, wherein each of the plurality of lift propulsors are configured to produce lift, a plurality of sensors, wherein at least a sensor is configured to detect a failure of at least a lift propulsor, and transmit a failure datum, a thrust propulsor mechanically attached to the VTOL aircraft with an orientable joint, wherein the thrust propulsor is configured to produce thrust and orient the thrust propulsor as a function of a thrust orientation datum, and a flight controller configured to receive the failure datum, generate a thrust orientation datum as a function of the failure datum, and transmit the thrust orientation datum to the orientable joint. |
| US11299286B2 |
System and method for operating a multi-engine aircraft
The present disclosure provides methods and systems for operating a rotorcraft comprising a plurality of engines configured to provide motive power to the rotorcraft and at least one rotor coupled to the plurality of engines. Failure of an active engine of the rotorcraft is detected when the rotorcraft is operated in an asymmetric operating regime (AOR), in which at least one first engine of the plurality of engines is the active engine and is operated in an active mode to provide motive power to the rotorcraft and at least one second engine of the plurality of engines is a standby engine and is operated in a standby mode to provide substantially no motive power to the rotorcraft. At least one flight control input is adjusted to compensate for a reduction in rotational speed of the at least one rotor resulting from the failure of the active engine. An increase in a power output of the standby engine of the rotorcraft is commanded. |
| US11299285B2 |
Systems and methods for providing throttle guidance as a function of flight path acceleration
Technologically improved vehicle control systems and methods are described. The provided vehicle control systems and methods embody an inner loop auto-throttle control for causing delta-throttle changes, i.e., servo changes, to achieve desired acceleration targets. The system generates an error on a potential flight path angle using a received thrust acceleration command. The error on the potential flight path angle is converted into an equivalent acceleration. A throttle rate command TLA_ratecmd is generated by converting the equivalent acceleration into the throttle rate command TLA_ratecmd. |
| US11299280B2 |
Leading-edge thermal anti-ice systems and methods
An anti-ice system is disclosed, including an airfoil structure having a leading-edge portion facing a wind direction. The airfoil structure includes an outer skin and an inner skin which form a plurality of channels, each channel having an air inlet and an air outlet. An air delivery duct inside the airfoil structure extends transverse to the wind direction and has a plurality of openings directed toward the air inlets of the channels. A heat exchanger is configured to provide hot air to the air delivery duct. |
| US11299273B2 |
Contoured passenger seat privacy shell shape of aircraft passenger compartment suites
An aircraft passenger compartment suite may include a privacy shell element proximate to an aircraft seat installed within the aircraft passenger compartment suite. The privacy shell element may include a first section configured to conform to a primary section of the aircraft seat, and a second section configured to conform to an auxiliary section of the aircraft seat. The privacy shell element may include a first profile configured to conform with the aircraft seat when the aircraft seat is in a first position, and a second profile configured to conform with the aircraft seat when the aircraft seat is in a second position. The second profile of the privacy shell element may be configured to occupy a greater amount of passenger aircraft living space surrounding the aircraft passenger compartment suite than an amount of passenger aircraft living space occupied by the first profile of the privacy shell element. |
| US11299271B2 |
Automatic announcement in a passenger aircraft
An announcement device or a passenger aircraft contains a memory or announcements with assigned potential flight phases and a control and evaluation unit with inputs for input signals with information relating to flight phases of the passenger aircraft, an output for the announcements, wherein the control and evaluation unit is configured to determine a current flight phase on the basis of the input signals, to check whether an announcement for the current flight phase is present in the memory, and to output this announcement as the current announcement at the output.A passenger aircraft contains the announcement device.In a method for outputting an announcement, announcements and input signals are provided, a current flight phase is automatically determined from the said input signals and a possibly present associated current announcement is output.A cabin management system of a passenger aircraft is used as an announcement device and/or to carry out the method. |
| US11299263B2 |
Automatic, active blade tracking and balance system
The present invention includes an apparatus and method for automatically adjusting the tracking of one or more blades comprising: a blade tracking adjustment mechanism connected to one or more blades of an aircraft; a blade tracking measurement system that measures the tracking of the one or more blades; and a computer that receives an output from the blade tracking measurement system with tracking information for each of the one or more blades; wherein the computer outputs instructions for the blade tracking adjustment mechanism to change a pitch of one or more of the blades to correct blade tracking. |
| US11299262B2 |
Composite skid member with varying cross-sections
Various implementations directed to composite skid member with varying cross-sections are provided. In one implementation, an aircraft landing gear assembly may include two composite skid members configured to contact the ground, where each composite skid member includes a first cross-section and a second cross-section, and where the first cross-section is different than the second cross-section. The aircraft landing gear assembly may also include two cross members configured to couple to a fuselage of an aircraft and configured to interconnect the two composite skid members. |
| US11299257B2 |
Aircraft, systems, and methods for trim control in fly-by-wire aircraft systems
Aircraft, fly-by-wire systems, and controllers are provided. An aircraft includes a trim control system and a fly-by-wire system. The trim control system is configured for controlling surfaces of the aircraft. The fly-by-wire system is communicatively coupled with the trim control system and includes an input device and a controller. The input device is configured to receive a re-trim input from a user. The controller is communicatively coupled with the input device and is configured to control the trim control system, to obtain the re-trim input from the user, and to set a pitch trim of the aircraft based on a stable flight condition at a present airspeed of the aircraft in response to the re-trim input from the input device. |
| US11299247B1 |
Watercraft paddle with drip diverting edge
A single or double bladed watercraft paddle having an improved blade with a bottom edge configured to divert water flow off of a raised paddle blade to reduce the likelihood of it flowing or dripping into the watercraft, onto the paddler, or onto the paddler hands. In one embodiment, the bottom edge of the paddle blade is provided with a notch or plurality of adjacent notches, in another embodiment, the bottom edge of the paddle blade is provided with a protrusion or plurality of adjacent protrusions, and in another embodiment the bottom edge of the paddle blade is provided with a combination of adjacent notches and protrusions. The notches and protrusions may be of various shapes and sizes. |
| US11299246B1 |
Propeller assembly with noise reducing hub arrangement
A propeller assembly is provided for mounting on a rotatable propeller shaft having a terminal end. The propeller assembly includes a housing structure extending along a longitudinal axis and having first and second ends. The housing structure includes an inner surface defining a cavity and an opening in the second end in communication with the cavity. A bushing assembly has first and second ends and includes an outer surface engageablc with the inner surface of the housing structure. An adaptor has first and second sides and is adapted for receipt on the propeller shaft. The adaptor has an enlarged portion having a diameter greater than a diameter of the opening in the second end of the housing structure. A nut is receivable on the terminal end of the propeller shaft. The nut is threadable on the propeller shaft to a tightened configuration wherein the nut engages the adaptor and maintains the propeller assembly on the propeller shaft. The nut, in the tightened configuration, the first side of the adaptor engages the second end of the bushing assembly and the enlarged portion of the adaptor is spaced from the second end of the housing structure. |
| US11299244B2 |
UV LED waveguide system with scattering for anti-fouling
The invention provides a waveguide element (1000) comprising a first face (1001) and a second face (1002) with radiation transmissive material (1005) configured between the first face (1001) and the second face (1002), wherein the radiation transmissive material (1005) is transmissive for UV radiation, wherein the radiation transmissive material (1005) is a matrix material for a phase (1010) of another composition than the radiation transmissive material (1005), wherein the phase (1010) is available in the matrix as regions (1110) with the regions (1110) having mean particle radii (r1) selected from the range of 50-1500 nm and having an average region concentration selected from the range of 1*104-1.5*108/mm3 of the radiation transmissive material (1005). |
| US11299242B2 |
U-tank active roll dampening system for and method for active roll dampening of a vessel
U-tank active roll dampening system and method for active roll dampening of a vessel provided with a U-tank enabling controlling of fluid level in side tanks in anti-phase in front of vessel roll motion period. |
| US11299237B2 |
Electronic device and method for controlling electronic device
An electronic device comprises a wireless transmitter and an operation device. The operation device comprises a base, a brake lever, operation portions and an electronic controller. The base is to be removably attached to a handlebar. The operation portions includes first, second and third operation portions. The first operation portion is arranged on the base. The second and third operation portions are arranged adjacent to the brake lever and are disposed between the brake lever and the handlebar. At least one of the operation portions includes a lever. At least one of the operation portions includes a button. The electronic controller is configured to transmit an operation signal to the wireless transmitter upon operation of any of the operation portions to control at least one bicycle component that is any one of a shifting device, a brake device, an adjustable seatpost, a suspension and a drive unit. |
| US11299233B2 |
Method and apparatus for an adjustable damper
A vehicle suspension damper is described. The vehicle suspension damper includes: a pilot valve assembly; a primary valve; and an adjuster, wherein the pilot valve assembly meters fluid to the primary valve, and the adjuster moves the primary valve. |
| US11299224B2 |
Three-row wheel vehicle
A three-row wheel vehicle having front, center and rear wheels has laterally spaced leading arms each pivotably connected to a vehicle body, laterally spaced swing arms each connected to the front end of the leading arm swingably in the front and rear direction and rotatably supporting the front wheel at the lower end, and laterally spaced connecting links each attached at one end to the swing arm pivotably around an axis and attached at the other end to the vehicle body pivotably around another axis; heights of the axes are different when the vehicle is on a horizontal flat traveling road; and each connecting link is arranged to apply a reaction force including an upward component to the swing arm when a rearward force acts from the front wheel to the one end via the swing arm. |
| US11299220B2 |
Track assembly for a towed vehicle
A track system for use with a towed vehicle has an attachment assembly and a multi-member frame assembly. The multi-member frame assembly includes a primary frame member connected to the attachment assembly, at least one wheel-bearing frame member pivotably connected to the primary frame member about a pivot located within a recess, and at least one resilient bushing assembly located within the recess and engaging the pivot. The at least one bushing assembly is resiliently deformable in a circumferential direction to permit pivoting of the pivot with respect to the recess, and is fixedly connected within the recess to resiliently bias the pivot towards a rest position with respect to the recess. The track system further includes leading and trailing idler wheel assemblies rotatably connected to the at least one wheel-bearing frame member, and an endless track. |
| US11299214B2 |
Closed structural component and process for preparing the same
The present invention is directed to a closed structural component and process for preparing the same. |
| US11299211B2 |
Lower vehicle-body structure of electric vehicle
A lower vehicle-body structure of an electric vehicle to increase resistance to lateral collision and also improve front-end collision load transfer performance of a tunnel. The lower vehicle-body structure of an electric vehicle includes a floor having a tunnel formed in a front part at a middle in a vehicle-width direction; and a floor cross member spanning, above the floor, between side sills disposed on opposite sides of the floor. Also, a rear end of the tunnel is located directly in front of the floor cross member, and reinforcing brackets are provided extending from the tunnel toward an upper end of the floor cross member and connected to the upper end of the floor cross member. |
| US11299210B2 |
Structural integration brace for front vehicle compartment
In accordance with an exemplary embodiment, a vehicle is provided that includes: a body; a drive system configured to propel the body; and a front motor compartment formed within the body, the front motor compartment including: a first shock tower; a second shock tower; and a structural integration brace for a vehicle, including: a first end attached to a first shock tower of the vehicle; and a second end attached to a second shock tower of the vehicle; wherein the structural integration brace extends between the first end and the second end, generating a load path therebetween within the front motor compartment of the vehicle. |
| US11299209B1 |
Vehicle pillar pass through for sealing baffle
The present disclosure describes a vehicle including an inner wheelbase panel, a first panel, a second panel and a pillar that is coupled to the wheelbase panel. The pillar includes a wall, a first flange, a second flange, and a tunnel. The wall defines an inner cavity and an outer cavity. The first flange extends outwardly from the wall and the second flange extends inwardly from the wall. The vehicle includes baffle which extends through the tunnel and is sized and shaped to seal both the inner cavity and the outer cavity. |
| US11299206B2 |
Vehicle structure for a cross-vehicle load path
A load impact management system for an automotive vehicle includes a load member extending from a first vehicle frame rail to a second vehicle frame rail and perpendicular to each of the first and second vehicle frame rails and to a vehicle body axis. The load member is coupled to the first vehicle frame rail at two attachment points and coupled to the second vehicle frame rail at two attachment points. The load member defines a load path between a first side of the automotive vehicle to a second side of the automotive vehicle opposite the first side and the load member is forward of a passenger compartment of the vehicle. |
| US11299200B1 |
Steering systems for vehicles
A steering system for a wheel of a vehicle includes a pivot member having multiple pivot-node locations. The pivot member is connectable at a first pivot-node location to a sub-frame of the wheel. A steering rod is actuatable to rotate the wheel about a steering axis and is mechanically coupled with the pivot member to be co-pivotable with the pivot member. A suspension-connector rod has a first end that is connected to the pivot member at a second pivot-node location, and has a second end that is connectable to a suspension arm linking the wheel of the vehicle to the sub-frame. When the steering system is installed in a vehicle, a lateral force acting upon the wheel is transmitted via the steering rod to the pivot member so as to rotate the pivot member, and the rotation is effective to transmit a substantially-vertical force vector to the sub-frame. |
| US11299195B2 |
Vehicle steering system
A vehicle steering system, including: a steering actuator including an electric motor, a steering rod configured to steer a wheel by a steering amount, and a motion converting mechanism configured to convert a rotating motion of a motor rotation shaft into a motion of the steering rod; first and second motor rotation angle sensors configured to detect a motor rotation angle; a steering amount sensor configured to detect a motion amount of the steering rod as the steering amount; and a controller configured to execute a steering amount control and to perform detection-value inappropriateness determination in which it is determined that any one or two of a detection value of the first motor rotation angle sensor, a detection value of the second motor rotation angle sensor, and a detection value of the steering amount sensor are inappropriate based on comparison among the detection values. |
| US11299190B2 |
Infant car seat challenge testing station
A station for conducting an infant car seat challenge test includes a first portion, a second portion, and a resilient cushion. The first portion has a top configured as an open-top receptacle. The resilient cushion is disposed in and is coupled to the open-top receptacle. The resilient cushion has a sloped top surface where the sloped top surface is sloped towards a first side of the open-top receptacle. The resilient cushion is adapted to support an infant car seat thereon. The second portion is coupled to the first portion at a second side of the open-top receptacle. The second portion includes a platform positioned above the open-top receptacle wherein the platform is adapted to support an electronic display thereon. |
| US11299189B2 |
Motorized cart retriever for monitoring cart status
A motorized cart retriever, which may be a cart pusher or a cart puller, can apply a force to a nest of human-propelled, wheeled carts to facilitate retrieval of the carts. The cart retriever can include a transceiver configured to wirelessly receive cart status information from cart transmitters of the wheeled carts and wirelessly report event data to a control unit. The cart status information may include an identification of the cart transmitter, a location of the cart, a lock or unlock status of a cart wheel, a misuse condition, etc. The event data can include the cart status information, a number of wheeled carts being retrieved, etc. The cart wheel may include a brake. The transceiver may communicate a message to the cart wheel to keep the brake unactuated during retrieval. The control unit may analyze the event data to detect traffic patterns of the carts. |
| US11299188B2 |
Moving body
According to one embodiment, a moving body includes an electrical component, a base frame that includes caster portions provided to be runnable on a floor surface, and is formed such that a front side is narrower than a rear side along a front-rear direction, the rear side is opened, and thus another moving body is insertable from the rear side, and a battery case that accommodates a battery supplying power to the electrical component and has an opening and closing lid opening rearward. A restricting member is provided inside the base frame and restricts a position of the other moving body inserted from the rear side to a position where the opening and closing lid opens at least to an angle at which the battery in the battery case is replaceable. |
| US11299186B2 |
Knock-down hamper
A hamper has a base having a base frame with a base shelf provided inside the base frame, and a plurality of caster assemblies secured to the base frame. A supporting frame assembly has two U-shaped frames, with each U-shaped frame having a horizontal base bar and two vertical bars extending from opposite ends of the base bar, with the two U-shaped frames coupled to each other at the center of each base bar, and with the base bars secured to the base. A fabric body has a plurality of side walls, and four vertical corner sleeve pockets, with each vertical corner sleeve pocket defining a channel that receives a separate vertical bar. A top frame secured to the upper ends of the vertical bars. |
| US11299184B2 |
Railcar bogie including protective film and protective film-equipped plate spring
A railcar bogie includes: a protection target member of the railcar bogie; and a protective film including an adhesive surface stuck to the protection target member. The protective film is configured such that an impact absorbing layer and a flame-retardant layer are laminated in this order from the protection target member side. The impact absorbing layer is thicker than the flame-retardant layer. |
| US11299182B2 |
Suspended public transit system
Provided herein are transit systems for travel overhead of streets, having: at least a first vehicle and a second vehicle; a main track on which the vehicles travel, the main track having a suspended overhead rail over the streets by a support structure, such that the vehicles travel at an elevated level overhead of street level; docking stations for the vehicles to lower to the street level for loading and/or unloading passengers and/or cargo; a two-position switch at each docking station, having cables enabling vertical movement of the vehicle, and a replacement track; wherein the two-position switch allows for docking of the first vehicle while the second vehicle passes the docked first vehicle, by enabling lowering of the first vehicle from the elevated level to the street level, and the replacement track providing a track portion for the second vehicle on which to pass the first vehicle. |
| US11299180B2 |
Vehicle control device, vehicle control method, and storage medium
A vehicle control device includes: a recognizer configured to recognize a surrounding situation of a vehicle based on an output of an on-board sensor; an interruption vehicle specifier configured to specify an interruption vehicle attempting to interrupt a travel lane from a lateral side of the travel lane in which there is the vehicle based on a recognition result of the recognizer; and a driving controller configured to control at least one of an acceleration or deceleration speed or steering of the vehicle based on a position of the specified interruption vehicle. |
| US11299179B2 |
Quality index and real-time forward propagation of virtual controls for smart enablement of automated driving
A system to enable an automobile vehicle automated driving control includes a quality index of an automated driving control system prior to enablement of an automated driving control function of an automobile vehicle. An adaptive forward propagation horizon and a prediction horizon for assessment of the quality index are computed. Vehicle states and road geometry are propagated over the adaptive forward propagation horizon, and the quality index is assessed based on forward propagated states over the prediction horizon. A first signal permits actuation of the automated driving control function of the automobile vehicle and a second signal precludes actuation of the automated driving control function. One of the first signal or the second signal is elected based on the results of assessing a quality control index trajectory over the adaptive forward propagation horizon. |
| US11299178B1 |
Vehicle travel control method and vehicle travel control device
A travel control method for a vehicle having an autonomous travel control function includes: detecting an oncoming vehicle travelling in the opposite lane of the travel lane in which the subject vehicle travels; predicting whether or not the oncoming vehicle enters into the travel lane in which the subject vehicle travels; when it is predicted that the oncoming vehicle enters into the travel lane in which the subject vehicle travels, setting initial deceleration of the subject vehicle in a case of time until the subject vehicle and the oncoming vehicle pass each other being relatively long to a smaller value than the initial deceleration in a case of the time being relatively short; and executing deceleration travel control of the subject vehicle. |
| US11299177B2 |
Information processing method, electronic device, and storage medium
An information processing method, an electronic device, and a storage medium are provided, which are related to the fields of big data, cloud computing, automatic driving, and the like. The specific implementation includes: receiving a data acquisition task and an acquisition strategy issued by a cloud; analyzing the acquisition strategy to obtain priority information of the acquired data for the data acquisition task; and taking the priority information as an importance degree identifier corresponding to the acquired data, and performing preferential transmission after data acquisition and data screening according to the importance degree identifier. |
| US11299172B2 |
Automotive autonomous driving to perform complex recurrent low speed manoeuvres
An automotive autonomous driving system comprising automotive on-board systems comprising a propulsion system, a braking system, a steering system, and a sensory system, an automotive user interface, and an automotive electronic control unit connected to, via an automotive on-board communications network, and configured to cooperate with, the automotive on-board systems and the automotive user interface to provide an automotive autonomous driving system. The automotive electronic control unit is further configured to store and populate a database of recurrent low speed manoeuvres and cause recurrent low speed manoeuvres stored in the database of recurrent low speed manoeuvres to be repeated in autonomous driving mode. |
| US11299171B2 |
Driving support control device of vehicle, driving support system of vehicle, and driving support control method of vehicle
A driving support control device of a vehicle is provided including an acquiring unit configured to acquire a traveling state of the vehicle which is detected and a traveling environment of the vehicle, and a control unit, configured to, in a case where zero-point learning of a yaw rate sensor has not been completed, cause a driving support unit to execute collision avoidance support using a reduced operational area reduced from a reference operational area which becomes a reference in view of an error of the yaw rate sensor as an operational area of collision avoidance support, and the traveling state of the vehicle and the traveling environment of the vehicle. |
| US11299168B2 |
Time synchronization scheme between different computation nodes in autonomous driving system
A method, apparatus, and system for timing synchronization between multiple computing nodes in an autonomous vehicle host system is disclosed. Timing of a first computing node of an autonomous vehicle host system is calibrated based on an external time source. A first timing message is transmitted from the first computing node to a second computing node of the autonomous vehicle host system via a first communication channel between the first computing node and the second computing node. Timing of the second computing node is calibrated based on the first timing message, wherein immediately subsequent to the calibration of timing of the second computing node, timing of the first computing node and of the second computing node is synchronized. |
| US11299167B2 |
System and method for improving real-time estimates of visitor volume to places
The present invention is a system and method for improving the accuracy with which human behavioral insights regarding visitor volume to places can be predicted. The process aligns at least two different data sets and normalizes the information by removing statistical bias. In a particular implementation motor vehicle data is collected from a known subset of road-borne vehicles and compared to data collected from unknown vehicles. The data is then increased or discounted to remove biases present in the known subset. The system analyzes the normalized data and returns a report including predictions to a human user. |
| US11299165B2 |
Evaluation device and evaluation method
To enhance safety in vehicle operation. An evaluation device according to the present technology includes a communication unit capable of communicating with a vehicle, and a control unit that performs an evaluation of a state related to sensing of danger by a user on the basis of an electroencephalogram of the user detected by an electroencephalogram sensor, and causes the communication unit to transmit evaluation result information to the vehicle. That is, for example, on the basis of an electroencephalogram of a user such as a driver of a vehicle, evaluation of a state related to sensing of danger such as whether or not the user has sensed a danger is performed, and evaluation result information is transmitted to the vehicle side. |
| US11299161B2 |
Vehicle control system, vehicle control method, and storage medium
A vehicle control system includes: an information acquiring unit that acquires an index value relating to easiness of merging which is evaluated on the basis of at least one of vehicle information relating to an operation of another vehicle that has advanced from a merging lane to a main lane before a subject vehicle and external system information acquired near a merging point using the other vehicle in a case in which the subject vehicle is running in the merging lane merging into the main lane; and an automated driving control unit that executes automated driving of the subject vehicle on the basis of the index value acquired by the information acquiring unit. |
| US11299160B2 |
Vehicle control device, vehicle control method, and storage medium
A vehicle control device (100, 1) including: a detector (110, 16) detecting other vehicles; a lane change executer (154) executing a lane change of a subject vehicle on the basis of states of the other vehicles detected by the detector without depending on a steering operation of a vehicle occupant of the subject vehicle; a determiner (152) determining whether or not the lane change is to be continued on the basis of the states of the other vehicles executing a lane change from a third lane adjacent to a second lane to the second lane, which are being detected or have been detected by the detector, after control of executing a lane change of the subject vehicle from a first lane to the second lane adjacent to the first lane is started by the lane change executer; and a return controller (156) returning the subject vehicle from the second lane to the first lane in a case in which it is determined that the lane change is not to be continued by the determiner. |
| US11299159B2 |
Apparatus for and method of controlling vehicle creep torque
A method of and an apparatus of controlling a creep torque to be exerted on a vehicle, may include facilitating a control unit to determine from a vehicle speed signal whether or not a vehicle comes to a stop, facilitating the control unit to determine from a slope angle signal a state of a road in accordance with a slope angle of the road; facilitating the control unit to determine a gear-shift step state, facilitating the control unit to decide a creep torque command on the basis of a result of the determination, the gear-shift step state, and information on the state of the road in accordance with the slope angle, and facilitating the control unit to output the decided creep torque command to perform creep torque control that generates a creep torque corresponding to the creep torque command from a motor. |
| US11299155B2 |
Driving control apparatus for vehicle
An ACC function for performing constant speed cruise according to a target speed when there is no preceding other vehicle in a vehicle's driving lane and performing following cruise by maintaining a predetermined inter-vehicle distance when there is a preceding other vehicle, an LKA function for maintaining cruise, an override function for stopping the ACC function and the LKA function by a driver's operation intervention, and a fallback function for performing fallback control of the ACC function and/or the LKA function, with notifying the driver of stopping the ACC function and/or the LKA function and operation takeover, at a time of system operational design domain deviation of the ACC function and/or the LKA function, override threshold values of the functions serving as a determination criterion of the operation intervention for stopping the ACC function and/or the LKA function at the time of system operational design domain deviation are configured to be altered to a value greater than during normal operation when the functions are within a system operational design domain. |
| US11299153B2 |
Vehicle traveling control apparatus
A vehicle traveling control apparatus comprises a driving support ECU. The driving support ECU determines whether or not a driver of a vehicle is under an abnormal state where the driver losses an ability to drive the vehicle. The driving support ECU executes a deceleration control to decelerate the vehicle after an abnormal determination time point at which it is determined that the driver is under the abnormal state. The driving support ECU decelerates a vehicle speed of the vehicle to within a predetermined low vehicle speed range and thereafter, causes the vehicle to travel at a speed within the low vehicle speed range. |
| US11299151B2 |
Enhanced vehicle tracking
The present invention relates to a method and system for accurately predicting future trajectories of observed objects in dense and ever-changing city environments. More particularly, the present invention relates to substantially continuously tracking and estimating the future movements of an observed object. As an example, an observed object may be a moving vehicle, for example along a path or road. Aspects and/or embodiments seek to provide an end to end method and system for substantially continuously tracking and predicting future movements of a newly observed object, such as a vehicle, using motion prior data extracted from map data. |
| US11299149B2 |
Considerate driving system
Driving control systems and methods include a first vehicle having one or more processors programmed to receive an individual driving behavior model specific to a driver of a second vehicle proximate the first vehicle. The individual driving behavior model is based on historical driving behavior of the driver of the second vehicle. The one or more processors are programmed to identify a motion plan for the first vehicle based on the individual driving behavior model specific to the driver of the second vehicle, and to control movement of the first vehicle according to the identified motion plan. |
| US11299148B2 |
Travel control apparatus and vehicle
The present invention provides a travel control apparatus for controlling traveling of a self-vehicle to avoid another vehicle on a front side, the apparatus comprising: a calculation unit for calculating a relative speed between the self-vehicle and the other vehicle; a state detection unit for detecting an operation state of the other vehicle; and a control unit for controlling avoidance processing of avoiding the other vehicle and causing the self-vehicle to pass a lateral side of the other vehicle, wherein the control unit changes a separation distance to separate the self-vehicle and the other vehicle in the avoidance processing in accordance with the relative speed calculated by the calculation unit and the operation state detected by the state detection unit. |
| US11299144B2 |
Method for providing vehicle-trajectory information and method for locating a pothole
A method for providing vehicle-trajectory information. The method includes a read-in task, in which at least one item of inertial information is read in that indicates at least one parameter of a movement of a vehicle during travel. In addition, the method includes an acquisition task, in which location information is acquired that indicates the position of the vehicle during the movement. In a last determination task, the vehicle-trajectory information is determined using the inertial information and the location information, the vehicle-trajectory information representing the movement of the vehicle at the position. |
| US11299142B2 |
Hybrid electric powertrain architectures and control logic for vehicle response management
Presented are hybrid electric vehicle (HEV) powertrains and control logic for vehicle response management, methods for making/operating HEV powertrains, and motor vehicles equipped with HEV powertrains. A method of controlling a hybrid powertrain includes receiving data indicative of a motor speed of a traction motor and torque commands for the motor, an engine, and an engine disconnect clutch (EDC). A vehicle controller uses a state observer module to estimate a jerk response based on the motor speed, and determines if the EDC is in a torque-transmitting active state. Responsive to the EDC being in the active state, the controller calculates an incremental feedback control signal that is predicted to reduce the estimated jerk based on the engine, motor, and clutch torque commands. One or more torque command signals are transmitted to the engine, motor and/or EDC to modulate a torque output thereof based on the incremental feedback control signal. |
| US11299139B2 |
Drive train for a vehicle
A drive train for a vehicle includes a first electromagnetic device, a second electromagnetic device electrically coupled to the first electromagnetic device by an electrical power transmission system, and an engine coupled to the first electromagnetic device and configured to drive the first electromagnetic device to provide electrical energy. In all modes of operation where the engine drives the first electromagnetic device to provide the electrical energy, the first electromagnetic device operates without providing the electrical energy to an energy storage device. |
| US11299137B2 |
Lateral control for vehicle wireless charging guidance
A method for providing low speed lateral steering control for an autonomously driven or semi-autonomously driven vehicle includes obtaining a desired final vehicle position relative to a current vehicle position, and calculating, by one or more data processors, a target vehicle position based on the current vehicle position and the desired final vehicle position. The method further includes calculating, by the one or more data processors, a road wheel angle command value based on the target vehicle position; determining, by the one or more data processors, a control signal based on the calculated road wheel command value; and providing the control signal to a steering controller. |
| US11299135B2 |
Vehicle brake control device
A brake control device including a pressure adjusting unit including an electric pump and an electromagnetic valve, and that adjusts, using the electromagnetic valve, a brake liquid discharged by the electric pump to an adjusted liquid pressure and introduces the adjusted liquid pressure to the wheel cylinders of the rear wheels; and a master unit that includes a master cylinder and a master piston, and that includes a master chamber connected to the wheel cylinders of the front wheels and a servo chamber to which the adjusted liquid pressure is introduced and which provides, to the master piston, an advancing force that opposes a retreating force applied to the master piston by the master chamber. |
| US11299132B2 |
Driving support apparatus
A driving support apparatus is provided with: a determinator configured to determine a collision probability; and a braking controller programmed to perform a braking control, and a preliminary braking control. The braking controller includes: a braking force increaser configured to increase the braking force applied in the preliminary braking control; and a braking force adjuster configured to perform adjustment, if the braking force applied at an end time point of the preliminary braking control is greater than the braking force applied at a start time point of the braking control in such a manner that a braking force applied in transferring from the preliminary braking control to the braking control has a small change amount, or in such a manner that it is greater than the braking force applied at the end time point of the preliminary braking control. |
| US11299127B2 |
Authorized operation of vehicles
A system for starting a vehicle has a first apparatus having a microprocessor, a first data repository, a normally open electrical imposed between positive vehicle battery voltage and a keyed ignition switch, and a second electronic apparatus comprising a second microprocessor executing second coded instructions from a non-transitory medium, the second microprocessor coupled with the first microprocessor, a second data repository coupled to the second microprocessor and storing a list of identities of drivers authorized to operate the vehicle, and an input mechanism enabling a candidate driver to identify to the second microprocessor. The candidate driver identifies to the second microprocessor by the input mechanism, the second microprocessor, executing the second coded instructions, determines if the driver identity matches an identity on the list drivers authorized to operate the vehicle, and if so, causes the first microprocessor to close the normally open contact. |
| US11299120B1 |
Side airbag assemblies and methods of assembly
A side airbag assembly is attachable to a frame of a seat of a vehicle. The side airbag assembly may include an inflatable airbag cushion in a packaged configuration. The inflatable airbag cushion may be inflated by an inflator in fluid communication with the inflatable airbag cushion to supply inflation gas to inflate the inflatable airbag cushion. The inflator may include an attachment stud to mount the airbag assembly to the side of a seat. The side airbag assembly may further include a wrapper configured to wrap around the inflator and the inflatable airbag cushion in the packaged configuration and a cap that is coupled to the wrapper. The cap is configured to enclose a first end of the inflatable airbag cushion in the packaged configuration. |
| US11299117B2 |
Energy absorbing device
An energy absorbing device includes a deformable elongate member that is arranged in a manner such that the device, in use, deforms in a controlled manner upon the absorption of impact energy. The invention also provides a method for manufacturing the energy absorbing device. |
| US11299115B2 |
Power storage unit control device
A power storage unit control device includes a discharging circuit that discharges from a power storage unit to a load, a control circuit that controls the discharging circuit, and a switching unit that executes a discharge prohibition mode in which discharge control of the discharging circuit by the control circuit is prohibited, if a stop signal based on an operation stopped state of a vehicle is received and a power source unit is greater than or equal to a predetermined voltage, and executes a discharge permission mode in which discharge control of the discharging circuit by the control circuit is permitted, if an operation signal based on the operating state of the vehicle is received and the power source unit is greater than or equal to the predetermined voltage. |
| US11299110B2 |
Acoustic insulation structure for power train
An acoustic insulation structure for a power train according to the present disclosure is provided with a cover member that covers at least an internal combustion engine of the power train including the internal combustion engine, and that includes a pool portion in which water that has entered into the inside of the cover member pools; and a water-absorption member arranged at the inside of the cover member. The cover member includes a moisture outlet that releases, into the atmospheric air, moisture present inside the cover member. The water-absorption member extends to the moisture outlet from the pool portion. |
| US11299108B2 |
Vehicular camera with pliable connection of PCBS
A vehicular camera configured to be disposed at a vehicle so as to have a field of view exterior of the vehicle includes a lens holder, an imager printed circuit board, a connector printed circuit board and a rear housing. The circuitry of the imager printed circuit board is electrically connected to the circuitry of the connector printed circuit board via a flexible electrical connector. The imager printed circuit board has an imager disposed at a side thereof and is attached to the lens holder with the imager side facing the lens. The imager printed circuit board and the connector printed circuit board are joined together via a pliable material. The rear housing is mated with the lens holder to encase the imager printed circuit board and the connector printed board. |
| US11299107B2 |
Camera signal monitoring apparatus and method
The present invention provides a camera signal monitoring apparatus and method, the camera signal monitoring apparatus including a vehicle information input unit receiving a vehicle speed and a yaw rate signal of a vehicle; a navigation information input unit receiving a road curvature signal provided in a high precision map; a camera information input unit receiving a camera signal including a vehicle speed and a yaw rate signal from a vehicle front camera; and a monitoring unit calculating a reference curvature value based on at least one of the vehicle speed and the yaw rate signal of the vehicle, which are input from the vehicle information input unit, or the road curvature signal from the navigation information input unit, and determining a reliability by comparing the calculated reference curvature value with a curvature value calculated using the camera signal input from the camera information input unit. |
| US11299106B2 |
Mounting system for a mobile microphone
A mounting assembly for a radio handset microphone including an adapter configured to couple to a mechanical hang-up clip. The adapter includes a housing configured to receive a magnet. |
| US11299104B1 |
Universal crossmember assembly for a roof rack of a motor vehicle
A universal crossmember assembly is provided for a motor vehicle having a roof and first and second rails attached to the roof. The assembly includes a crossbar having first and second ends along an axis. The assembly further includes a first clamp mechanism engaged with the first end for securing the crossbar to the first rail. The assembly further includes a second clamp mechanism engaged with the second end for securing the crossbar to the second rail. Each clamp mechanism includes at least first and second jaws having an associated one of first and second rail gripping surfaces for gripping one of the rails when an actuator is moved to an actuated position. Each clamp mechanism further includes a biasing mechanism capable of urging the first jaw away from the second jaw when the actuator is moved to a non-actuated position. |
| US11299096B2 |
Rear-view mirror device mounted in a vehicle, vehicle-mounted display device, vehicle-mounted display system
A glass plate includes a first arcuate surface at an outer circumferential edge part, the first arcuate surface facing a front surface side. A frame supports the glass plate from a rear surface side and includes a second arcuate surface in a portion toward the glass plate. A display unit is stored in a housing and outputs a display light toward the glass plate. A center C and a radius R of the second arcuate surface are made to be identical to a center C and a radius R of the first arcuate surface, respectively. |
| US11299092B2 |
Indoor illumination lamp
An indoor illumination lamp includes a housing to be attached to an interior ceiling of a vehicle and provided with an opening, an interior light lens arranged at the opening of the housing, a chamber provided in the housing and surrounding the opening where the interior light lens is arranged, a light emitting diode arranged at a corner of the chamber and capable of emitting light toward the interior light lens, and a reflector arranged on an inner face in the chamber. |
| US11299091B2 |
Vehicle headlight and method for assisting a parking maneuver
The invention relates to a vehicle headlamp (1) comprising; a high-resolution lighting apparatus (2) for projecting various light distributions onto a roadway area (4) positioned in front of a vehicle (3); an environmental detection device (5) for detecting at least one parking space (6) located in the environment surrounding the vehicle (3); and a control device (7) for dynamically controlling the lighting apparatus (2); wherein the environmental detection device (5) is designed to issue information corresponding to a detected parking space (6) to the control device (7), wherein the control device (7) is designed, in case the environmental detection device (5) detects a parking space (6), to control the lighting apparatus (2), under consideration of at least the information issued by the environmental detection device (5) related to the parking space (6), in such a manner that the lighting apparatus (2) at least projects a definable ground projection (8), which at least represents the vehicle length, onto the roadway area (4) in front of the vehicle (3). |
| US11299087B2 |
Light assembly for attachment to a surface of a vehicle
A light assembly for attachment to a surface of a vehicle includes a vehicle base configured to be coupled to the surface of the vehicle, and a light head coupled to the vehicle base and including a plurality of light emitting diodes and a lens. The lens has a plurality of total internal reflection lenses. Each total internal reflection lens has a truncated frustoconical cross-sectional shape. |
| US11299085B2 |
Low beam and work light control for a work vehicle
Systems, methods, and apparatuses for roadway illumination by an industrial vehicle are disclosed. A work light of the industrial vehicle is operated to provide illumination to an area located between a forward end of the industrial vehicle and an area illuminated by a low beam light. The work light and the low beam light are operated together to provide improved illumination during travel of the industrial vehicle along the roadway while promoting visibility of operators of oncoming vehicles. |
| US11299083B2 |
Stowable ramp system for livestock transport, and related methods of use
An apparatus has: a livestock transport having a floor, walls, ground engaging members, and an access door opening; a ramp; and side panels that are pivotally connected to the walls of the livestock transport, in which the ramp and the side panels are configured to move between: a deployed position where the ramp extends from the access door opening and the side panels cooperate with the ramp to form a livestock loading chute; and a transport position where the ramp is stowed and the side panels are swung about to lie against the walls of the livestock transport. A kit has the ramp and side panels of the apparatus. A method of using the apparatus involves moving the ramp and side panels between the deployed position and the transport position to load, unload, and transport, respectively, livestock. |
| US11299081B2 |
Multifunction footrest apparatus for vehicle
A multifunction footrest apparatus for a vehicle is provided in a space in which a passenger seat is positioned so as to be movable in a front-rear direction. The multifunction footrest apparatus may be inserted into and housed in a lower space under a dashboard including a glove box, and it may perform a massage and an acupressure for calves and soles of a back seat passenger by using a lower door including a first massage device and an upper door including a second massage device and an acupressure plate. |
| US11299079B1 |
Armrest with cushioned component having an integrated air channeling system
An armrest assembly includes a body portion having a cushioned component, wherein the cushioned component includes first and second portions spaced-apart from one another. The cushioned component includes a porous lattice matrix. A duct assembly includes a main inlet and first and second outlets that are operably coupled to the first and second portions of the cushioned component, respectively. The duct assembly further includes first and second channels fluidically coupled to the first and second outlets, respectively. An air diverter member is pivotally supported between first and second positions and includes a channel disposed therethrough. The channel of the air diverter member opens into the first channel when the air diverter member is in the first position, and opens into the second channel when the air diverter member is in the second position for directing airflow to the first and second outlets, respectively. |
| US11299078B2 |
Armrest
An armrest includes a first branch cable and a second branch cable, a frame, a skin covering the frame, and a foamed resin material. The frame includes a first routing section and a second routing section in which the first branch cable and the second branch cable are arranged, respectively. The foamed resin material is disposed on an inner side of the skin. The first branch cable and the second branch cable are disposed within the foamed resin material in the first routing section and the second routing section. |
| US11299077B2 |
Sensor disposition structure in seat
A sensor disposition structure in a seat includes a cushion pad and a board-like member which is disposed under the cushion pad. A concave is formed in an upper surface of the board-like member, and a sensor is disposed in the concave. |
| US11299076B2 |
Seat
A seat has a seat cushion unit including: a seat cushion frame; a seat pad which lies over the seat cushion frame; and a trim which covers the seat pad. The trim includes: a trim main body which mainly covers a top surface of the seat pad; a first trim joiner which extends from the trim main body to a backside of the seat cushion frame at the rear of the seat pad, and is fastened to the seat cushion frame; and a second trim joiner which is connected to a back surface of the trim main body in at least one of left and right end regions of the rear of the seat cushion unit, extends to the backside of the seat cushion frame at the rear of the seat pad, and is fastened to the seat cushion frame. |
| US11299073B2 |
Deployable driver station for an autonomous driving vehicle
A deployable driver station including a seat utilizing both a front-facing driver seat bottom and a coupled rear-facing passenger seat bottom. In a driver configuration, the driver seat bottom is used in a conventional manner, being disposed behind the steering wheel or other steering control and the interior panel, while the passenger seat bottom is disposed more centrally within the passenger compartment. In a passenger configuration, the passenger seat bottom is used like the adjacent rear-facing passenger seat bottom(s), when used, while the driver seat bottom is disposed under the interior panel such that it does not take up space in the passenger compartment. Likewise, the steering wheel or other steering control is disposed under the interior panel. A common two-sided pivoting seat back is alternately used for the driver seat or the passenger seat by pivoting to an appropriate angle for the configuration. |
| US11299070B2 |
Electric seat slide device
A screw shaft attached to the upper rail is screwed into a nut member attached to the lower rail. When the screw shaft is rotated with respect to the nut member by a drive unit, the screw shaft is moved rearward and forward with respect to the nut member, and the upper rail is also moved rearward and forward with respect to the lower rail. A fixing nut is fixed to an inner surface of the lower rail behind the nut member, and a stopper bolt is fastened to the fixing nut from below the lower rail. When the upper rail moves forward, a stopper portion provided at a tip of the stopper bolt contacts the stopper plate to restrict an excessive forward movement of the upper rail. |
| US11299052B2 |
Industrial truck comprising an electrical plug connector
An industrial truck comprises a drive part comprising a battery compartment and a battery having a cladded exterior surface and is positioned within a housing. The housing is configured to be positioned within the battery compartment. An electrical plug connector is configured to be electrically connected to the battery such that the electrical plug connector is configured to supply power to the battery during a charging process. The electrical plug connector has a plug-in direction for an external electrical plug connector and the plug-in direction has an angle of 20° to 70° relative to a horizontal axis. |
| US11299045B2 |
Method for operating a display arrangement of a motor vehicle, operator control device and motor vehicle
A method for operating a display arrangement of a motor vehicle, which includes at least two display devices each with a display surface. A visible display content can be shifted here three-dimensionally between two display planes. A detection and evaluation device of an operator control device carries out: acquisition of an operator control action by a touch-sensitive operator control surface, preferably a pulling and/or shifting gesture, and of its extension direction, and, on the basis of the determined extension direction, determination of a data set which describes the display content, as well as determination of a predetermined shift of a virtual image of the display content from one of the display planes to the other of the display planes. |
| US11299038B2 |
Fuel filler structure
A fuel filler structure includes a vehicle body panel, a filler housing, a filler tube cap and a tether. The vehicle body panel defines a fuel filler opening. The filler housing has an outboard side and an inboard side. The outboard side is installed to the vehicle body panel at least partially surrounding the fuel filler opening and is dimensioned to receive and surround a portion of a fuel filler tube. The filler tube cap is configured to removably attach to the fuel filler tube at least partially within the filler housing. The tether is attached at a first end to the filler tube cap and is attached at a second end to the filler housing for pivoting movement about a vertical axis. |
| US11299032B2 |
Cooling apparatus and a cooling system provided with the same for autonomous driving controller
A cooling apparatus for an autonomous driving controller may include, a chiller fluidically connected to an air-conditioning system through a refrigerant connection line so that a refrigerant circulating in the air-conditioning system provided in the vehicle is introduced into the chiller; a reservoir tank storing a coolant, and fluidically connected to the chiller; and a water pump mounted between the reservoir tank and the autonomous driving controller; wherein coolant pipes connected to the water pump and the chiller may be connected to the autonomous driving controller respectively. |
| US11299030B2 |
Smart mobile vehicle
The present invention provides a smart mobile vehicle comprising a vehicle body, a chassis, driving wheels, a battery module, a plurality of motors and a vehicle control unit. The chassis has a suspension system, a brake system and a steering system. The two driving wheels are composed of a plurality of circular units, and the driving wheels are embedded in two-wheel frames on two sides of the vehicle body. The battery module provides the smart mobile vehicle with driving power. The plurality of motors disposed between the two circular units or on a surface of any one of the circular units; wherein the motors are electrically connected to the battery module, and the torque and directional outputs of the motors is used to drive the rotation of the two driving wheels. The vehicle control unit is electrically connected to the motors and the battery module to transmit a monitoring signal. |
| US11299029B2 |
Power transmission apparatus
A power transmission apparatus is used in a vehicle and mounted on a vehicle member via a mount. The power transmission apparatus includes a case. The case includes a motor provided inside the case. The case includes a mount fastening portion for fastening the mount with a plurality of bolts. The mount fastening portion has a plurality of bolt tightening holes. The plurality of bolt tightening holes are provided so that the plurality of bolts are tightened into the plurality of bolt tightening holes. The bolt tightening holes have axial directions parallel to each other. A space isolated from an inside of the case is formed by a wall of the case in a region connecting two adjacent bolt tightening holes when the mount fastening portion is viewed in the axial directions of the plurality of bolt tightening holes. |
| US11299027B2 |
Power system for hybrid vehicles
The present invention provides a power system for a hybrid vehicle, relating to the field of hybrid vehicles. The power system for a hybrid vehicle adopts a first planetary gear mechanism with two sun gears, the first sun gear rotates with an input shaft, the second sun gear and the input shaft are independent of each other, and the second sun gear achieves different motion states through a second brake or/and a second clutch, and cooperates with a first brake to provide different transmission ratios of four to six gears when an engine and motors are in driving, so that the power system is simple in structure and low in cost, and the fuel economy and acceleration dynamic performance of the power system are improved. |
| US11299026B2 |
Hybrid powertrain with two electric machines and an internal combustion engine
A drive train for a hybrid motor vehicle comprises a gearbox input shaft, which is operably linked to a first electric machine and an internal combustion engine by a first partial drive train for torque transmission and is operably linked to a second electric machine by a second partial drive train for torque transmission. The second electric machine is permanently connected to the gearbox input shaft for torque transmission. The first electric machine and the internal combustion engine can be connected in a couplable manner to the gearbox input shaft for torque transmission. |
| US11299020B2 |
Vehicle-body structure of vehicle
There are provided a vehicle-body frame member forming an opening portion for entrance at a vehicle side part and a front side door provided so as to open and close the opening portion. The vehicle-body frame member comprises a side sill, the front side door comprises a door panel portion provided with an inner lower portion which overlaps with the side sill in a vehicle wide view and reinforcement portions provided at three side-portions of a peripheral part of the door panel portion which are continuous and include the inner lower portion such that the reinforcement portions overlap with the vehicle-body frame member in a vehicle side view. |
| US11299014B2 |
Refrigeration cycle device
A refrigeration cycle device includes a high-temperature side heat exchanger, an expansion valve for decompressing the refrigerant flowing out of the high-temperature side heat exchanger, a low-temperature side heat exchanger that exchanges heat between the refrigerant decompressed by the expansion valve and coolant, a high-temperature coolant circuit in which the coolant circulates to the high-temperature side heat exchanger, a low-temperature coolant circuit in which the coolant circulates to the low-temperature side heat exchanger, a battery and a low-temperature side radiator configured to exchange heat with the coolant in the low-temperature coolant circuit; and a heat transfer portion configured to transfer heat from the high-temperature coolant circuit to the low-temperature coolant circuit such that the coolant dissipates heat in the battery and the low-temperature side radiator. |
| US11299010B2 |
Alertness maintenance apparatus
An alertness maintenance apparatus includes a stimulation controller that is configured to cause a stimulation device to generate multiple types of temperature stimuli maintaining an alert state of a subject person, the temperature stimuli including a temperature stimulus to a hand of the subject person and also including a temperature stimulus to a face of the subject person or a temperature stimulus to a torso of the subject person via a seat on which the subject person sits. |
| US11299009B2 |
Vehicle HVAC system with modular door design
A modular door for a vehicle HVAC system includes a door plate, a first shaft, and a second shaft. The door plate has a front surface extending between an upper edge surface and a lower edge surface. The upper edge surface defines a first array of keyed orifices. The lower edge surface defines a second array of keyed orifices. The first shaft has a first keyed protrusion that is disposed within a first keyed orifice of the first array of keyed orifices. The second shaft has a second keyed protrusion that is disposed within a first keyed orifice of the second array of keyed orifices. The first keyed orifice of the first array of keyed orifices and the first keyed orifice of the second array of keyed orifices form a pair of axially aligned keyed orifices. |
| US11299007B2 |
Support device and air conditioning system for vehicle
A support device secures first tubes and second tubes to a vehicle body. The first tubes and the second tubes extend outward from an air conditioning case of a vehicle air conditioning system. The support device is outside the air conditioning case. The support device includes a first bracket in contact with the first tubes, and a second bracket in contact with the second tubes. The support device includes a common bracket coupled to both of the first bracket and the second bracket. The common bracket and the first bracket are in contact with the first tubes from opposite sides, holding the first tubes therebetween. The common bracket and the second bracket are in contact with the refrigerant tubes from opposite sides, holding the refrigerant tubes therebetween. |
| US11299006B2 |
Thermoregulation system for an electrically driven vehicle, and vehicle comprising such a system
This thermoregulation system (1) for an electrically driven vehicle (V), the vehicle comprising at least one electric machine (E), at least one battery (30), and at least one power electronics component (37), comprises a coolant circuit (5), a pump (7), coolant heat exchangers, connected to the coolant circuit (5) so that the coolant may circulate through them and comprising a main exchanger (9), configured for exchanging heat between the coolant and air coming from the outside of the vehicle (V), at least one battery exchanger (11), configured for exchanging heat between the coolant and said at least one battery (30), and at least one secondary exchanger (13, 36), configured for exchanging heat between the coolant and said at least one electric machine (E) and/or said at least one power electronics component (37). The coolant circuit (5) is divided in a first branch (B1), which comprises the main exchanger (9) and the at least one battery exchanger (11), a second branch (B2) which comprises the at least one secondary exchanger (13, 36), the coolant being circulated in parallel in the first and second branches (B1, B2), and a pump branch (PB) to which the pump (7) is connected, the pump branch (PB) being connected to the first and second branches (B1, B2) by an upstream and a downstream connection points (P1, P2) so that the coolant circulating in the pump branch (PB) is formed by a mix of the coolant circulating in the first branch (B1) and of the coolant circulating in the second branch (B2), and is directed towards the first and second branches (B1, B2) downstream the pump (7). |
| US11299004B2 |
Sway bar linkage assembly
A sway bar linkage assembly includes a socket joint, a shank extending from the socket joint, a bolt, and a bushing. The shank has a first bore with a first bore diameter and a second bore extending between the first bore and the socket joint. The second bore has a second bore diameter less than the first bore diameter such that a flange extends between the first bore and the second bore. The bolt has a head, a shaft extending from the head and a stud extending between the shaft is included. The shaft has a first diameter and the stud has second diameter less than the first diameter such that a ledge extends between the shaft and the stud. The bushing is compressed a predefined by the bolt when the bolt extends through the bushing and the ledge of the bolt abuts against the flange of the shank. |
| US11299001B2 |
Electrically powered suspension system
An electrically powered suspension system includes: an electromagnetic actuator configured to generate a driving force related to vibration damping of the vehicle; an information acquisition unit configured to acquire information on a stroke velocity of the electromagnetic actuator; a target damping force calculation unit configured to calculate a target damping force based on the stroke velocity; a drive control unit configured to control driving of the electromagnetic actuator based on the target damping force; and a filter processing unit configured to perform a filtering process by applying a predetermined filtering characteristic to the stroke velocity. The filter processing unit has a plurality of filtering characteristics set in a second frequency region, which has a frequency higher than that of a first frequency region. The filter processing unit selectively applies, among the plurality of filtering characteristics, one filtering characteristic that is based on the stroke velocity to the stroke velocity. |
| US11299000B2 |
Electrically powered suspension system
An electrically powered suspension system 11 achieves vibration control of a vehicle without disturbing a vehicle behavior and impairing riding comfort even if an electric motor 31 of an electromagnetic actuator 13 generates excessive heat, wherein the electromagnetic actuator 13 includes the electric motor 31 generating a driving force for vibration damping and extension/contraction; a target damping force setting part 51 setting a target damping force; a target extension/contraction setting part 53 setting a target extension/contraction force; and a drive controller 49 performing the drive control of the electric motor 31 using a drive force based on the target damping force and target extension/contraction force by limiting the motor current not to exceed a current threshold that is an addition of a damping current threshold and extension/contraction current threshold, which thresholds are separately configured considering a priority of riding comfort and steering stability. |
| US11298996B2 |
Articulation system for commercial road vehicles
An articulation system (1) for interconnecting first and second vehicle units of an articulated road vehicle comprises a central element (2) including a vertical cylinder with left and right arcuate walls (4) extending between two facing openings. First and second interconnecting structures (5) are joined to the central element (2) and are adapted to be respectively attached to the first and second vehicle units on opposed sides of the central element (2). Each interconnecting structure has a pitch joint member (5a) and a yaw joint member (5b). The pitch joint member (5a) has a frame (7) perpendicular to a longitudinal axis of a corresponding one of the first and second vehicle units and a pitch hinge mechanism (6) at a floor level to interconnect with the corresponding one of the first and second vehicle units. The yaw joint member (5b) has a frame (8) perpendicular to the longitudinal axis of the corresponding one of the first and second vehicle units and left and right arcuate walls juxtaposed to the left and right arcuate walls (4) of the vertical cylinder and rotatable therearound. The frame (7) of the pitch joint member (5a) and the frame (8) of the yaw joint member (5b) are juxtaposed and mechanically linked to jointly form a planar roll joint mechanism. |
| US11298993B2 |
Detection of trailer detachment from a vehicle
A system for monitoring a trailer includes a detection device configured to monitor a connection between a coupler attached to the trailer and a trailer hitch attached to a vehicle and generate data related to the connection, and a processing device configured to receive the data from the detection device, and analyze the data to detect whether a partial detachment condition is present. Based on detecting the partial detachment condition, the processing device is configured to generate a notification to a driver to alert the driver of the partial detachment condition and/or control operation of the vehicle. |
| US11298988B2 |
Rotary joint assembly for a tire inflation system
A rotary joint assembly for a tire inflation system for a vehicle includes a stationary portion defining a first fluid passage. The stationary portion includes a support portion and having a first annular sealing face. The first fluid passage ending in the first annular sealing face. The assembly also includes at least one bearing and a rotatable portion rotatably mounted on the support portion by way of the at least one bearing. The rotatable portion defines a second fluid passage and has a second annular sealing face, the second fluid passage ending in the second annular sealing face. The rotatable portion defines an axis of rotation of the rotatable portion and a radial direction oriented perpendicular to the axis of rotation. The at least one bearing supporting an inner face of the rotatable portion, wherein the inner face of the rotatable portion faces toward the axis of rotation. An annular seal chamber is radially disposed between the first annular sealing face and the second annular sealing face and provides fluid communication between the first fluid passage and the second fluid passage. The at least one bearing and the annular seal chamber at least partially overlap along an axial direction oriented in parallel to the axis of rotation. |
| US11298982B2 |
Tread for a pneumatic tire
A tread for a tire includes: a first tread zone extending circumferentially, continuously, and entirely around the tire, the first tread zone being formed of a first compound; a second tread zone extending circumferentially, continuously, and entirely around the tire, the second tread zone being formed of a second compound different from the first compound; and a boundary groove axially separating the first tread zone from the second tread zone, the first tread zone, the second tread zone, and the boundary groove entirely forming the tread, the boundary groove having an axial centerline disposed an axial distance from an equatorial plane of the tire. The first tread zone has a first circumferential groove and a sidewall portion defining an intermediate circumferential rib of the first tread zone and a shoulder circumferential rib of the first tread zone. |
| US11298979B2 |
Non-pneumatic tire
The disclosed technology generally relates to a tire, and more particularly to a non-pneumatic tire that has handling performance similar to a pneumatic tire, supports the load of a vehicle and improves riding comfort by employing a parametric structure. In one aspect, a non-pneumatic tire includes a tread that comes in contact with the ground, a rim that is connected with an axle, and a spoke unit that functions as a structural support between the rim and the tread, in which the spoke unit is formed by circularly arranging spokes. The spokes have a single closed-loop longitudinal cross-section circumscribed to the rim and around the center of the tire. |
| US11298976B2 |
Bearing device for vehicle wheel
In a bearing device for a vehicle wheel (1), a large-diameter section (2i) is formed on an outer side of a fitting cylinder section (2h), and a small-diameter section (2j) is formed on an inner side of the fitting cylinder section (2h). A cap member (8) is formed by bending a metal steel plate, and has a cover plate section (81) which closes the inner open end of an outer member (2) and a fitting section (82) which is fitted over the small-diameter section (2j). A tapered portion (83) based on the spring back angle θ of the fitting section (82) is provided at the outer peripheral edge of the outer end section of the fitting section (82). |
| US11298975B2 |
Vehicle wheel
A vehicle wheel includes: a rim including a well portion and a guide member; and a sub-air chamber member serving as a Helmholtz resonator. The well portion has an outer circumferential surface extending in a wheel circumferential direction of the vehicle wheel. The guide member engages with the sub-air chamber member to guide the sub-air chamber member on the outer circumferential surface in the wheel circumferential direction, thereby to attach the sub-air chamber member to the rim. |
| US11298969B1 |
Marking device holder
The marking device holder may comprise a body, an instrument holder, and a plurality of touch points. The marking device holder may be operable to move a writing instrument over a writing surface in a straight line. The writing instrument may detachably couple to the instrument holder such that the writing instrument contacts the writing surface. The plurality of touch points may form a stable base for the body that may resist tipping and may reduce friction during forward motion of the body. As non-limiting examples, the writing instrument may be a pen, a pencil, a mechanical pencil, a marker, or a stylus. As non-limiting examples, the writing surface may be paper or a device screen. |
| US11298968B2 |
Method for labeling products with a transparent photoluminescent label, and transparent photoluminescent label
A method for marking a product (1) with a photoluminescent mark, said mark comprising a photoluminescent portion (10) which is transparent under normal light conditions and revealed by photoluminescence under UV illumination, said mark further comprising a non photoluminescent portion (9) which is transparent under normal light conditions as well s under UV illumination, said method comprising: deposing on said product a stack, said stack comprising alternatively layers (2,4) such as AlN, with a thickness of less than 1 micron and layers (3) of a second material, such as GaN with a thickness of less than 10 nm; raising the transparency of said non photoluminescent portion (10) with a deposition of transparent material (6) or incorporation of ions into said non photoluminescent portions. |
| US11298960B2 |
Printer device and control method of printer device
A printer device includes a transport mechanism that transports a continuous sheet in which a plurality of printing media are spaced apart from each other by a gap width and attached on a mount, a transmission sensor that detects transmittance of the continuous sheet, and a control unit that adjusts the transmission sensor. The control unit transports the continuous sheet in the +Y direction by using the transport mechanism, performs reverse transport control to transport the continuous sheet in the −Y direction by a reverse-feed distance that is greater than the gap by using the transport mechanism when the head position of a printing medium is detected by the transmission sensor, and adjusts the transmission sensor after the reverse transport control. |
| US11298959B2 |
Active energy radiation unit and active energy radiation device
An active energy radiation unit includes a light source which radiates ultraviolet rays onto a target object, and a main gas supply mechanism which is disposed to be adjacent to the light source and ejects an inert gas. The main gas supply mechanism includes a receiving part which receives the inert gas, and a main ejection port which is provided at a position between the receiving part and the light source and closer to the target object than the receiving part. A flow path area from the receiving part to the main ejection port is constant. |
| US11298949B2 |
Printing agent containers
It is disclosed a printing agent container having ink an authenticity detection mechanisms comprising: a receptacle having a top wall a bottom wall opposing such top wall and a sidewall between such top wall and such bottom wall; an internal volume defined by such receptacle that contains a printing agent, and a vibration transducer on one of the side walls, wherein the container is to be mechanically coupled to a carriage so that the printing fluid is disposed on the bottom surface, being the vibration transducer to detect a vibration signal induced by the carriage and wherein the container comprises a communication channel to a controller being the controller to receive through the communication channel a container signature from the vibration transducer and to identify a container identification signal associated to the container signature. |
| US11298948B2 |
Liquid consuming apparatus
There is provided a liquid consuming apparatus including: a liquid consuming section; a tank having a liquid storage chamber and an inlet port; a cap; and a casing having a cover movable with respect to the tank between a closed position and an open positon. The cover has an inner surface and a projection projected from the inner surface toward the tank. The projection of the cover is provided with a pressing portion facing the outer surface of the cap at a predetermined spacing distance, under a condition that the liquid consuming apparatus is in a normal state in which the cover is in the closed position and that the cap is installed in the inlet port, and the pressing portion abuts firstly against the outer surface, under a condition that the cap is moved in the insertion direction for allowing the cap to be removed from the inlet port. |
| US11298946B2 |
Liquid supply apparatus and image recording apparatus
A liquid supply apparatus a tank and a cartridge attachable to the tank along an attachment direction crossing a vertical direction. The ink cartridge includes a first storing chamber configured to store liquid therein. The tank includes a second storing chamber configured to store liquid therein, a liquid channel and an air channel, which both communicate with the second storing chamber. When the cartridge is attached to the tank with the first storing chamber of the cartridge communicating with the liquid channel and the air channel, the first storing chamber has a portion located above the liquid channel and the air channel. The second storing portion has a first area located above a lower end of the first storing chamber of the cartridge in the vertical direction and a second area continuous with the first area and located below the first storing chamber of the cartridge in the vertical direction. |
| US11298945B2 |
Liquid replenishing system
A liquid replenishing system includes a liquid tank and a liquid storage bottle for storing liquid to be replenished to the liquid tank. The liquid tank includes a tank body, a cylindrical adapter, and a needle penetrating into the tank body inside the cylindrical adapter. One end of the needle is located outside the tank body and another end of the needle is located inside the tank body. The liquid storage bottle includes a bottle body, a nozzle having an ejection port for ejecting a liquid stored in the bottle body, and includes a slit valve provided at the ejection port. In a case where the nozzle of the liquid storage bottle and the cylindrical adapter of the liquid tank are fitted to each other, one end of the needle is inserted into the slit valve so that the liquid storage bottle is secured to the liquid tank. |
| US11298942B2 |
Liquid jetting apparatus
A liquid jetting apparatus includes: individual channels; and a manifold commonly provided for the individual channels. Each of the individual channels has: a nozzle; a pressure chamber arranged away from the nozzle in a predetermined direction to extend along a plane orthogonal to the predetermined direction and connected to the manifold, a connecting channel connected to the pressure chamber to form at least a part of a channel communicating the pressure chamber and the nozzle, and a circulation channel connected to the connecting channel to form a part of a channel communicating the connecting channel and the pressure chamber. The connecting channel has a throttle, and the throttle has a smaller diameter along the plane orthogonal to the predetermined direction than a diameter, of a part of the connecting channel except the throttle, along the plane orthogonal to the predetermined direction. |
| US11298937B2 |
Printing apparatus and control method therefor
A method for inspecting an ink discharge status based on a temperature change of an energy generating element includes calculating a difference value between a value obtained by statistics of information indicating ink discharge statuses obtained for a plurality of nozzles close to a target nozzle and the information obtained for the target nozzle; comparing the calculated difference value with a predetermined threshold; and judging the ink discharge status for the target nozzle based on a result of the comparison. This enables to appropriately detect a nozzle which is in a discharge failure status due to an ink droplet adhered to a discharge surface of a printhead or the like. |
| US11298935B2 |
Wash-up blade
Provided is an apparatus suitable for use as a printer wash-up blade. Also provided is a method of cleaning a roller on a rotary printing press using the above apparatus. |
| US11298924B2 |
Component with bonded thermoplastic and thermoset layers
A component is provided that includes a multi-layer body configured with a thermoplastic layer, a thermoset layer and a scrim at an interface between the thermoplastic layer and the thermoset layer. The thermoplastic layer includes a plurality of reinforcement particles within a thermoplastic matrix. The thermoset layer is configured from or otherwise includes a thermoset matrix. |
| US11298923B2 |
Edifice sealing web, and process for manufacturing same
An edifice sealing web that includes a sealing web facing away from the edifice, an adjoining barrier layer which extends on the side facing the edifice and is based on mixtures of homopolyamides and/or copolyamides, and a self-adhesive layer. |
| US11298920B2 |
Silicone rubber and fiber-resin composite-based laminated product
A laminated product (10) comprises at least: a layer (1) of silicone rubber, in particular of the high temperature crosslinking type, such as, for example, a silicone rubber of VMQ or PVMQ grade the said layer (1) of silicone rubber being sandwiched between two layers (2) of fibre-resin composite comprising filaments (3) of an inorganic substance (4), in particular glass, embedded in a thermoset resin (5), such as, for example, a vinyl ester resin. The silicone layer has a thickness, denoted T1, of between 1.5 and 3 times the thickness T2 of each layer of fibre-resin composite, which is between 0.25 and 2 mm. Such a laminate may be used in the manufacture of a finished article, in particular of a non-pneumatic wheel or tire. |
| US11298919B2 |
Interlayer for laminated glass, and laminated glass
Provided is an interlayer film for laminated glass with which both the reflected double images and the transmitted double images can be suppressed in the laminated glass. An interlayer film for laminated glass according to the present invention is an interlayer film for laminated glass used for laminated glass that is a head-up display, in which the interlayer film includes a region for display corresponding to a display region of the head-up display, the interlayer film has one end and the other end on the opposite side of the one end, the other end has a thickness larger than a thickness of the one end, an absolute value of difference between a maximum value of measured values of variation in thickness and a minimum value of measured values of variation in thickness is 32 μm or less when the variation in thickness is measured in a distance of 80 mm centered at points of every 2 mm intervals in a direction connecting the one end and the other end in the region for display from the one end to the other end, and a region of the other end side from the region for display has a wedge angle that is smaller than a wedge angle of the region for display. |
| US11298918B2 |
Visibly transparent broadband infrared mirror films having fluoropolymers and 7:1:1:7:1:1 layer thickness ratio
Multilayer infrared (IR) reflecting films are provided. An optical repeating unit of the film include a plurality of optical polymeric layers arranged to reflect light by constructive and destructive interference. Optical layer A is a high refractive index polymeric layer, and optical layer B is a low refractive index isotropic polymeric layer containing fluoropolymers. The film has an average reflectance of about 50% to about 100% in a near infrared wavelength range of about 850 nm to about 1850 nm, and an average transmission of about 70% to about 90% in a visible light range. |
| US11298910B2 |
Sheet folding apparatus
A sheet folding apparatus includes a sheet folding unit disposed to fold a sheet and a conveyance unit disposed to feed the sheet to the sheet folding unit in a feed direction orthogonal to a fold direction of the sheet folding unit while correcting a skew of the sheet. The conveyance unit includes an elongated reference guide, a conveyance mechanism disposed to convey the sheet in the feed direction while exerting a force on the sheet toward the reference guide, an adjustment mechanism disposed to adjust an inclination of the reference guide with respect to the feed direction. The apparatus further includes an input unit through which a user inputs a folding misalignment amount of the sheet folded by the sheet folding unit. The inclination of the reference guide is corrected by the adjustment mechanism based on at least the folding misalignment amount inputted through the input unit. |
| US11298906B2 |
Groove plate platform for vertical press machines
A press plate block is provided and has capacity to conduct and transfer heat, a mounting interface for mounting the block onto a press machine, a press surface defining a press footprint the press surface elevated above the rest of the top surface area and having a peripheral edge, a first and second interface for accepting heating and temperature sensing components, a first radiused groove disposed adjacently to the peripheral edge of the press surface and a second radiused groove disposed orthogonally to the first groove, the second groove intersecting the first groove at a lower elevation, the second groove breaking out of the block at one end of the block. |
| US11298901B2 |
Article of footwear with fluid-filled element
Articles of footwear include an upper and a sole structure having a fluid-filled element in the heel region. The fluid-filled element includes: (a) an upper surface, (b) a lower surface, and (c) an outer peripheral surface extending between the upper surface and lower surface. The fluid-filled element also includes a pair of spaced apart, substantially U-shaped voids that extend through a central region of the fluid-filled element. A first void of the pair of voids is located closer to a forward end of the fluid-filled element than a second void of the pair. Both the first void and the second void have an open portion of its U-shape oriented toward the forward end of the fluid-filled element. |
| US11298894B2 |
Method and device for producing a fiber-reinforced plastic component
A method for producing a fiber-reinforced plastic component includes inserting a fiber preform, which is arranged on a fluid-filled hollow core, in a mold that has at least two mold parts, closing the mold, the fiber preform and the hollow core being received in a mold cavity defined by the at least two mold parts, filling the cavity with a plastic material and curing the plastic material in the closed, heated mold. The internal pressure in the mold is measured during the curing of the plastic material and the distance between the at least two mold parts is increased when the pressure exceeds an upper threshold value. |
| US11298893B2 |
Method for manufacturing structure using composite material
Manufacturing structure using a composite material includes: a tapering step for forming a first tapered surface on a first stiffener in an uncured state; a bending step for bending the stiffener such that a second surface is on the inner side; an arranging step for arranging the first stiffener and a skin at prescribed positions; a vacuum suctioning step for vacuum suctioning the first stiffener and the skin; and a bonding step for curing the first stiffener to bond the first stiffener and the skin. In the tapering step, the angle formed between the first tapered surface and the second surface is an acute angle. In the vacuum suctioning step, the first tapered surface is brought into contact with the skin while maintaining contact between the first surface and the skin, and the first stiffener is deformed so that a second tapered surface is formed on the second surface. |
| US11298889B2 |
Laminated sealing member for prosthetic heart valve
An implantable prosthetic valve that is radially collapsible to a collapsed configuration and radially expandable to an expanded configuration comprises an annular frame having an inflow end and an outflow end, a leaflet structure positioned within the frame and secured thereto, and a laminate sealing member comprising an encapsulating material. The laminate sealing member has a main portion that encapsulates at least a portion of the frame and an end portion extending from the inflow end of the frame, and the end portion of the laminate sealing member is folded to form a cuff adjacent the inflow end of the frame and secured to the main portion of the laminate sealing member. |
| US11298887B2 |
Packages configured for improved sealing
A package is provided that is formed from a packaging material, such as film, having increased adhesive in critical locations, such as adjacent folds in the end seal and other areas so that that the increased adhesive can at least partially fill voids adjacent such folds. The additional, localized sealant material is applied in a plurality of discrete locations in the end seal or other region adjacent where folds are formed and overlap with a sealant layer so as to provide additional sealant material for at least partially filling the voids without being present throughout the entirety, majority or large portions of the packaging material. |
| US11298886B2 |
Method and device for connecting fibre-reinforced webs
A process for joining two sheeting articles reinforced with unidirectionally aligned endless-fibres by ultrasonic welding, wherein the fibres are embedded in a matrix of polycarbonate and the sheeting articles have abutting ends that are substantially rectangular and substantially even. The process comprises (1) arranging the sheeting articles next to one another end-to-end in the region of the abutting ends in a welding apparatus between a sonotrode and an anvil, (2) welding the sheeting articles by means of ultrasound, wherein the sonotrode and the anvil exert pressure on the to-be-welded sheeting articles in the melting region between the sheeting articles and perpendicularly to the abutting ends of the sheeting articles, and (3) removing the sheeting articles that are welded to one another from the welding apparatus. Also provided is a second process for joining two sheeting articles, a sheeting article, an apparatus, and a multilayer composite. |
| US11298885B2 |
Three-dimensionally article with knock out support defined with build material
A method of manufacturing a three-dimensional article includes (1) receiving a data file, (2) analyzing the data file, and (3) defining a support structure. The data file defines a hollow three-dimensional article to be formed from a build material. Analyzing the data file includes identifying an opening that converges to an apex along the sequence of layers. The opening is at least partly defined by an inside edge of the three-dimensional article. The support structure is attached to the edge and closes the opening. The support structure includes a structural sheet portion and an interface web portion. The structure sheet portion defines a majority of an area of the support structure except for a boundary contour between the structural sheet portion and the inside edge. The interface web portion closes the boundary contour and defines a weakness contour for removing the structural portion from the three-dimensional article. |
| US11298883B2 |
Determining property mapping resources with property constraints in an additive manufacturing
In an example, a method includes receiving, at a processor, a plurality of property parameter sets representing attainable property combinations in additive manufacturing and being associated with print material description. A constraint of a first property of the property parameter sets may also be received and a hull of a property mapping resource for use in determining additive manufacturing instructions for generating an object in which the first property meets the received constraint may be determined. |
| US11298882B2 |
Carriage synchronization of a multi-carriage three-dimensional printer
An example three-dimensional printing system includes a first carriage, a second carriage, and a synchronization controller. The synchronization controller is coupled to the first carriage and the second carriage to synchronize movements of the first carriage and the second carriage. The synchronization controller is to avoid interference between the first carriage and the second carriage. |
| US11298880B2 |
Freezing method for cleaning an additive manufacturing part
The present invention relates to a method for removing powder from a component or part produced by a powder bed additive manufacturing system. The method comprises the steps; providing a part, the part having at least one internal cavity with at least one external opening, the at least one cavity being at least partly filled with powder grains, the powder grains being connected to each other and to the walls of the cavity by mechanical, frictional, electrical, physical or chemical forces; adding medium in liquid phase to the at least one cavity of the part, the liquid having the property that it expands in phase transition from liquid to solid phase; transforming added medium to solid phase to loosen and break up at least a fraction of the powder grains connections from each other; and removing powder from the at least one internal cavity. |
| US11298876B2 |
Three-dimensional printing
An example of a three-dimensional (3D) printing kit includes a build material composition and a fusing agent to be applied to at least a portion of the build material composition during 3D printing. The build material composition includes a polyamide having: an avalanche angle ranging from about 35 degrees to about 55 degrees; a break energy ranging from about 25 kJ/kg to about 57 kJ/kg; and an avalanche energy ranging from about 7 kJ/kg to about 22 kJ/kg. The fusing agent includes an energy absorber to absorb electromagnetic radiation to coalesce the polyamide in the at least the portion. |
| US11298874B2 |
3D printing of an intraocular lens having smooth, curved surfaces
A continuous additive fabrication system comprises a bath of photopolymer resin and a light source assembly having a light source and a motorized variable aperture. The light source assembly is operable to generate a focus point in the bath of photopolymer resin, the shape of the focus point at a curing plane within the bath of photopolymer resin corresponding to the shape of the motorized variable aperture. The continuous additive fabrication system further comprises a platform configured to support a build object and a drive mechanism (coupled to at least one of the platform and the light source assembly) configured to continuously move the curing plane through the bath of photopolymer resin. A size and/or shape of the motorized variable aperture is changed while the curing plane in continuously moved through the bath of photopolymer resin. |
| US11298872B2 |
Removable build plate for three-dimensional printers
A removable and replaceable build plate for a three-dimensional printer supports magnetic coupling to a printer and advantageous adhesion for an initial layer of build material. |
| US11298869B2 |
Method and apparatus for producing a high aspect ratio nanostructured foil by extrusion coating or extrusion casting
A solid nano- or micro-structured thermoplastic foil including a nano- or micro-structured surface area is produced by providing an extrusion casting roller for an industrial polymer extrusion casting process using a thermoplastic material, applying a nano- or micro-structured surface on the extrusion casting roller, maintaining a temperature of the casting roller below a solidification temperature of the thermoplastic material while the casting roller and the counter roller are rotating, and continuously applying a melt of the thermoplastic material between a counter roller and the casting roller while the casting roller and the counter roller are rotating. A rotational velocity of the casting roller may be 10 meters/minute. The melt of the thermoplastic material is moved between the casting roller and the counter roller while the rollers are rolling, and the melt of the thermoplastic material is solidified upon contact with the casting roller to form the thermoplastic foil. |
| US11298868B2 |
Manufacturing method of reinforced layer
A manufacturing method for manufacturing a reinforced layer constituting a high-pressure tank includes: a first forming step of forming a cylindrical pipe portion and extending in an axial direction of the high-pressure tank, the pipe portion including a first end portion including a first end and a second end portion including a second end, the pipe portion being formed to have a first stepped portion such that the first stepped portion projects outwardly at a position distanced from the first end in the axial direction by a first distance; a first placing step of placing the first end inside a first dome portion by moving at least either of the first dome portion and the pipe portion until a first bottom end portion of the first dome portion abuts with the first stepped portion; and a first joining step of joining the pipe portion to the first dome portion. |
| US11298860B2 |
Golf ball and method of manufacture
A method for manufacturing a golf ball having a core, an intermediate layer and a cover that is formed of a resin material composed primarily of a polyurethane resin and has a thickness of 0.1 mm to 0.7 mm by injection molding the cover using a vertically separating two-part injection mold having specific gate and support pin configurations. This method enables a relatively soft urethane resin cover that is thin and of high quality to be formed, and has a good golf ball productivity. |
| US11298854B2 |
3-D printed master model
This disclosure concerns a master model for the production of a mold, comprising: (a) a first part, a second part comprising a textured surface; wherein the first part and the second part are connected. |
| US11298852B2 |
Device and method for producing reaction plastics
A device and a method for producing reaction plastics, including a first metering device with a first metering unit and a second metering unit, each of which is suitable for receiving and dispensing a first mixing component in a metered manner, a second metering device which is suitable for receiving and dispensing a second mixing component in a metered manner, and a mixing device which is suitable for receiving and mixing the first mixing component dispensed by the first metering unit and/or the second metering unit of the first metering device and the second mixing component dispensed by the second metering device. For this purpose the first metering unit and the second metering unit are connected to the mixing device such that prior to beginning the mixing process, the first mixing component can be brought to an operating state required for the mixing process, in particular an operating pressure, by guiding the first mixing component from the first metering unit to the second metering unit via the mixing device. |
| US11298847B2 |
Device and method for cutting an extruded pipe to length
A method cuts an extruded pipe to length using a separating device. The separating device includes a separator rotating about an extrusion axis of the extruded pipe, the separator being rotatably mounted in the separating device, and cutting tools being arranged on the separator. The cutting tools are configured to carry out the separation. The method includes transferring energy to move the cutting tools. The energy is transferred from a stationary outer region of the separating device to a movable inner region of the separating device. The energy is transferred continuously or cyclically and the transferred energy is buffered in an energy storage device. The energy is transferred inductively or capacitively. A discharge time of the energy storage device is between 2% and 25% of a total separation cycle. |
| US11298845B2 |
Razor docking
A shaving razor system includes a razor handle that docks with a razor cartridge. The handle is configured to dock with the razor cartridge using a single hook configured to mate with a cartridge tab. A central pushrod is mounted with a spring into the handle and is configured to exert a pushing force on the mounted cartridge. To eject the cartridge, the single hook may be pushed to pivot to the side of the cartridge tab, and thereby release the razor cartridge by ejecting it with the spring loaded pushrod. |
| US11298843B2 |
Shaving cartridges pivotable about two axes
A connector for attaching a cartridge to a handle. The connector is adapted to rotate around a rocking axis with respect to the handle. The connector includes a pair of arms adapted to attach the connector to the cartridge, a holder adapted to attach the connector to the handle, and at least a pair of resilient lateral tongues protruding from the connector and positioned symmetrically with regard to a connector axis. One of the lateral tongues is adapted to flex when the connector is rotated in a first direction around the rocking axis, and the other lateral tongue is adapted to flex when the connector is rotated in a second direction around the rocking axis. |
| US11298841B2 |
Hair cutting system and attachment
There is disclosed an attachment (22) for a cutting head (100) of a hair cutting device (1). The attachment (22) comprises first and second side portions (24, 26) configured to cover, respectively, first and second sides (112, 114) of a stationary cutting member (115) of the cutting head (100), and an intermediate portion (28) interconnecting the first and second side portions (24, 26) and configured to cover an outer surface (120b) of a first wall portion (120) of the stationary cutting member (115). The first and second side portions (24, 26) are configured to protrude relative to the plurality of primary cutter teeth (118) of the stationary cutting member (115), which define a cutting zone of the cutting head. The first and second side portions (24, 26) and the intermediate portion (28) define a recess exposing the primary cutter teeth (118) of the stationary cutting member (115). The recess is non-interrupted over a distance of at least 50% of the length of the cutting zone. |
| US11298840B2 |
Rotary electric shaver
A rotary electric shaver includes a main body in which a first transmission mechanism, and a connecting portion is disposed; a head unit in which a plurality of blade units each having an outer blade, an inner blade being in sliding contact with an inner surface of the outer blade, and a driven shaft rotating the inner blade are disposed, and a second transmission mechanism that transmits a driving power of the first transmission mechanism to rotate the driven shaft is built, and which is connected to the connecting portion; and a drive shaft for transmitting the driving power of the first transmission mechanism to the second transmission mechanism, wherein a first endless belt is disposed in the first transmission mechanism and a second endless belt is disposed in the second transmission mechanism. |
| US11298836B2 |
Folding machete
A knife includes a blade defining an aperture and a handle. The handle includes a body pivotably coupled to the blade, a catch movably coupled to the body, and a biasing member coupled to the body. The catch includes a protrusion. The biasing member is configured to apply a biasing force on the catch. The handle is selectively repositionable between a first position and a second position relative to the blade. The biasing force biases the protrusion of the catch toward the blade when the handle is in the first position. The protrusion is received by the aperture to prevent rotation of the handle relative to the blade when the handle is in the first position. |
| US11298822B2 |
Robot, method of controlling robot, and robot control device
A method of controlling a robot having a plurality of joints includes measuring load torque applied to a driving-force transmission system of each of the plurality of joints while moving a hand of the robot along a predetermined path, comparing a measurement value of the load torque and an allowable range of each of the joints, and controlling a rate of change in acceleration of the driving-force transmission system of each of the joints, depending on a comparison result, in a next operation in which the hand of the robot is moved along the predetermined path. |
| US11298819B2 |
Robot control method
A robot control method of controlling motion of a robot arm by using a servo motor includes adding d-axis electric current to a motor electric current command (steps 15-6, 15-8) if external temperature is less than or equal to a predetermined value (step 15-3), and if an absolute value of the motor electric current command is less than or equal to a predetermined value (step 15-4), and if a value of detected overload is less than or equal to a predetermined value (step 15-5). |
| US11298817B2 |
Planetary gearing for a robot gearing arrangement
A planetary gearing for a robot gearing arrangement includes a sun gear, a ring gear, and a planet carrier with at least three planetary gears rotatably mounted thereon. The planetary gears are arranged on planet pins arranged perpendicular to the planet carrier and are in meshing engagement with the sun gear and the ring gear. At least one first planetary gear is biased in a first circumferential direction and/or at least one second planetary gear is biased in a second circumferential direction. A first planet pin of the first planetary gear is at least partially elastically deformable in the second circumferential direction and/or the second planet pin of the second planetary gear is at least partially elastically deformable in the first circumferential direction. |
| US11298814B2 |
Link actuating device having a proximal-end-side link hub, a distal-end-side link hub, and three or more link mechanisms
A link actuation device includes a proximal-end-side link hub, a distal-end-side link hub, three or more link mechanisms each coupling the link hubs such that a posture of the distal-end-side link hub can be changed relative to the proximal-end-side link hub. Each link mechanism includes a proximal-side end link member, a proximal-side intermediate link member, a distal-side intermediate link member, and a distal-side end link member. Actuators for arbitrarily changing the posture and a distance from the distal-end-side link hub to the proximal-end-side link hub are provided to three or more link mechanisms of the three or more link mechanisms. A control unit calculates a rotation angle of the proximal-side end link member according to a targeted posture of the distal-end-side link hub and a targeted distance between the centers of the spherical links, and controls the respective actuators so as to attain the calculated rotation angle. |
| US11298813B1 |
Lug bolt and nut holder device
A lug bolt and nut holder device is provided. The holder device includes a main body portion having at least one receiving aperture defined therein, wherein the at least one receiving aperture is configured for receiving at least a portion of a lug bolt. The holder device further includes a flange that extends outwardly from the main body portion, wherein the flange includes an upper surface. Further, at least one post extends from the upper surface, wherein the at least one post is configured for being inserted into an opening defined in a nut. |
| US11298811B2 |
Apparatus for installing fasteners and explosive loads for use therewith
A bracket for attachment to an overhead substrate to carry a suspending wire or rod is formed from metal plate or strap stock having a bend connecting a first generally rectangular section of the stock with a second generally rectangular section of the stock. The first generally rectangular section of stock has a dimple formed on one side of the stock with a corresponding bulge protruding from the other side. The bulge protrudes alongside the second generally rectangular section of stock. The bulge has a base and an apex, a generally conical outside surface adjacent to the first u) generally rectangular section of stock and a through aperture at the apex. The bracket is applied with a tool that can be provided with a washer system to accommodate different fastener lengths and a safety to deactivate the triggering mechanism. |
| US11298808B1 |
Torque structure
A torque structure includes a first body provided with a first receiving chamber, a first indicator, and a second receiving chamber, a second body provided with a drive portion, a first elastic member biased against the drive portion, a first locking set received in the first receiving chamber, an adjusting set driven by the first body, an indication unit movable to indicate the torque of the torque structure, a third body assembly covering the indication unit, a second locking set rotatable relative to the first locking set, and a third locking set operable between a locking position where the first body cannot be rotated relative to the second body and an unlocking position where the first body is rotated relative to the second body to adjust the torque. |
| US11298806B2 |
Hand tool having a head which is position-adjustable and lockable relative to a handle
A hand tool includes a head and a handle. The head is pivotally mounted to the handle, permitting the position of the head to be changed relative to the handle. In addition, the tool includes a primary locking mechanism and a secondary locking mechanism. The primarily locking mechanism primarily fixes the head relative to the handle in a particular position. The secondary locking mechanism can be used to further lock the head and handle. The locking mechanisms are actuated by movement of a sleeve which is located on the handle. |
| US11298798B2 |
Polishing delivery apparatus
A polishing delivery apparatus, configured to provide slurry and rinse agent to a polishing pad, includes a delivery arm, at least one first nozzle, and at least one second nozzle. The delivery arm is rotatably connected to the polishing pad and has an arc-shaped top surface facing away from the polishing pad, a bottom surface facing away from the arc-shaped top surface, and a recess indenting from the bottom surface. The first nozzle is mounted on the bottom surface of the delivery arm and has a first nozzle head facing toward the polishing pad. The second nozzle is mounted in the recess of the delivery arm and has three second nozzle heads, in which one of the three second nozzle heads faces toward the polishing pad, and the other two of the three second nozzle heads face toward sidewalls of the recess. |
| US11298794B2 |
Chemical mechanical polishing using time share control
A method of chemical mechanical polishing includes rotating a polishing pad about an axis of rotation, positioning a substrate against the polishing pad, the polishing pad having a groove that is concentric with the axis of rotation, oscillating the substrate laterally across the polishing pad such that a central portion of the substrate and an edge portion of the substrate are positioned over a polishing surface of the polishing pad for a first duration, and holding the substrate substantially laterally fixed in a position such that the central portion of the substrate is positioned over the polishing surface of the polishing pad and the edge portion of the substrate is positioned over the groove for a second duration. |
| US11298793B2 |
Compact multi-material cut-off tool
A compact multi-material cut-off tool includes a housing, and an arbor rotatably supported by the housing upon which a cutting disk is attachable for co-rotation therewith. A motor is coupled to the arbor to provide torque thereto. A controller is operable to selectively drive the motor in a first rotational direction and an opposite, second rotational direction. A first lighting element is coupled to a first portion of the housing, and a second lighting element is coupled to a second portion of the housing. One of the first lighting element and the second lighting element is configured to be activated by the controller in response to the motor being driven in the first rotational direction. The other of the first lighting element and the second lighting element is configured to be activated by the controller in response to the motor being driven in the second rotational direction. |
| US11298792B2 |
Combined additive manufacturing method applicable to parts and molds
A combined additive manufacturing method applicable to parts and molds relates to moldless-growth manufacturing of parts and molds, which includes steps of: S1: layering and slicing a three-dimensional CAD (computer-aided design) model of a workpiece to be formed according to shape, thickness and dimensional accuracy requirements of the workpiece, so as to obtain a plurality of layered slice data; S2: planning a forming path according to the layered slice data, and generating layered slice numerical control codes for forming; and S3: deposition-forming a powder material on a substrate layer-by-layer and performing pressure forming or milling forming according to the layered slice numerical control codes in the step S2, which uses a numerically controlled high-speed cold spray gun to spray the powder material to a determined position for deposition-forming. The method of the present invention overcomes thermally induced adverse effects of hot processing and drawbacks of cold spray deposition. |
| US11298789B2 |
Method and device for determining and/or monitoring the state of a protective cover
A method for determining and/or monitoring the state of a protective cover, includes the steps of a) obtaining a first state value of at least one characteristic physical, mechanical and/or chemical property of the protective cover at a first point in time; and b) obtaining a second state value of the at least one characteristic property of the protective cover at a second point in time, which is to subsequent to the first point in time; and c) comparing the obtained state values; and d) determining the state of the protective cover based on the comparison performed in step c). |
| US11298788B2 |
Electric power tool dust collection system
An electric power tool dust collection system includes: a hammer drill, to which a dust suction bit is mounted; a dust collection device mounted to the hammer drill and including a suction portion (introduction port), a dust collection motor, a dust collection fan rotated by drive of the dust collection motor to generate a sucking force in the introduction port, and a dust collection portion (dust box) that stores powder dust suctioned from the introduction port; and exhaust flow paths (exhaust flow path and tubular flow path) respectively formed in the hammer drill and the dust collection device to lead exhaust that has passed through the dust box to a high-temperature portion (output portion) of the hammer drill. |
| US11298787B2 |
Adjustable workpiece support system and method
An adjustable workpiece support system includes an adjustable support apparatus, an analysis support point module, a coordinate post-processing module and a control module. The adjustable support apparatus has a group of support devices for supporting a supported workpiece, the each support device being adjustable in height and angle. The analysis support point module is used to import a computer-aided design file of the supported workpiece, and analyze the computer-aided design file to obtain a group of support points of the supported workpiece. The coordinate post-processing module is configured to calculate the support coordinates of the each support device corresponding to the group of support points. The control module is configured to receive the support coordinates of the each support device, and adjust the height and angle of the each support device to support the supported workpiece, so that the amount of deformation of the supported workpiece is the minimum. |
| US11298783B1 |
Method of manufacturing improved crossbar connection for implements
A method of constructing an improved attachment or implement for use with equipment connected to a coupler is provided. The implement has a crossbar which is one of machined, cast or extruded to provide a cross section within at least the connection zone which lacks welds while still providing parallel flats for connecting to a channel in the coupler. The cross section in the connection zone is void-free and seam free. |
| US11298781B2 |
Workpiece rotating appartus and robot system
A workpiece rotating apparatus including a first rotary positioner and a second rotary positioner which are arranged to face each other in a direction along a substantially horizontal rotation axis, which hold, respectively, one end portion and the other end portion of a long workpiece, and which can rotate the workpiece around the rotation axis, a linear motor which linearly moves the second rotary positioner in a direction along the rotation axis, and a motor controller which controls the linear motor to adjust a position of the second rotary positioner in a direction along the rotation axis, and the motor controller controls the linear motor so that magnitude of force acting on the linear motor from the other end portion of the workpiece via the second rotary positioner becomes equal to or smaller than a predetermined threshold. |
| US11298774B2 |
Method to eliminate dissimilar metal welds
A method of eliminating dissimilar metal welds has been disclosed. The method includes the steps of providing a first part having a first alloy composition; providing a second part having a second alloy composition different from the first part; connecting a containment structure to the first part; pouring a powder into the containment structure such that the powder is in contact with the first part; positioning a portion of the second part in the containment structure such that the second part compresses the powder between the first and second parts; and performing hot isostatic pressing (HIP) to consolidate the powder and join the first and second parts together. |
| US11298771B2 |
DSC-based all-digital SiC inversion type multi-function argon arc welding power supply
The invention provides a DSC-based full-digital SiC inversion type multi-function argon arc welding power supply, which includes a main circuit and a DSC control circuit; the main circuit includes a common mode noise suppression module, a power frequency rectification and filter module, a SiC inversion and commutation module, power transformer, a SiC rectification and smoothing module and a non-contact arc ignition module connected in sequence and are respectively connected to external arc load; the DSC control circuit includes a DSC minimum system, a human-machine interaction module, a fault diagnosis and protection module, a SiC high-frequency drive module connected to SiC inversion and commutation module, and an electrical load signal detection module connected to the arc load. The argon arc welding power supply has a simple structure, high control accuracy, fast response, small size, high efficiency, low energy consumption and excellent process adaptability, which can improve the quality of welding process. |
| US11298770B2 |
Arc welding method and arc welding device
An arc welding method alternately generates a short-circuit state and an arc state. In the method, short circuits are generated also in the arc period. This more than doubles the total number of short circuits, which is the sum of the short circuits generated in the short circuit period and those generated in the arc period. This enables a thin plate to be arc welded at a higher speed, while reducing its burn-through. |
| US11298768B2 |
Method of preparing a surface for diffusion bonding and method of diffusion bonding
A method of preparing a surface for diffusion bonding comprises contacting a binder material with a discontinuous surface comprising surface regions separated by gaps. The binder material is selectively deposited onto the surface regions and has a sufficient viscosity to form a self-supporting layer without flowing into the gaps. The self-supporting layer of binder material comprises a mass density in a range from about 0.001 g/in2 to about 0.050 g/in2. A braze powder is distributed over the self-supporting layer of binder material, and a predetermined amount of the braze powder is attached to the binder material. The discontinuous surface is then heated to remove the binder material and adhere the braze powder to the discontinuous surface. Thus, a prewet surface with a braze deposit thereon is formed. |
| US11298767B2 |
Resistive soldering method, assembly of antenna and glass, and resistive soldering system
A resistive soldering system, includes a first electrode; a second electrode; a support cylinder; a resistive soldering joint which is adapted to raise or lower the first electrode, the second electrode and the support cylinder; and a power supply unit which is connected with the first and second electrodes and adapted to supply power and a heating current to the first and second electrodes. |
| US11298765B2 |
Toothed rack and method for producing a toothed rack for a steering gear of a motor vehicle
A rack for a steering gear of a motor vehicle may include a toothed portion having a toothing, and a shaft portion. Separate segments comprising at least one in each case bar-shaped toothed segment and one shaft segment are provided, are aligned on a common longitudinal axis, and are connected to one another at a joint. The method may involve providing a raw material piece having a piece length that is a multiple of a segment length, thermally continuously hardening the raw material piece across a multiple of a segment length to produce a hardened semi-finished segment product, cutting to length a hardened segment from the hardened semi-finished segment product, providing a further segment, and joining the hardened segment to a further segment. |
| US11298759B2 |
Rotary tool for lower receiver manufacturing
A rotary tool can be adapted for removing material from a workpiece such as a lower receiver. A rotary tool can have an adapter with a major diameter, and a cutter head with a minor diameter. The major diameter of the adapter can reduce deflection and chatter, while the minor diameter of the cutter head can be used to manufacture lower receivers with accuracy. The rotary tool can be adapted to be engaged with a rotary power tool. |
| US11298749B2 |
Cutting insert, holder, and cutting tool that includes cutting insert
There is provided a cutting insert used for both drilling and turning. The cutting insert includes an insert main body having a front surface and a rear surface, the outline shapes of which are parallelogram shapes, peripheral side surfaces disposed on four sides of the insert main body, cutting edges provided on respective intersecting ridge lines between the front surface and the peripheral side surface and between the rear surface and the peripheral side surface of the insert main body, and a hole provided in the insert main body to incline with respect to the front surface and the rear surface, the hole being usable for attachment. |
| US11298748B2 |
Surface coated cutting tool and method for manufacturing the same
A surface coated cutting tool comprises a base material and a coating layer that coats the base material, the coating layer including an alternate layer composed of a first unit layer and a second unit layer alternately stacked, the first unit layer being composed of a nitride containing aluminum and zirconium, in the first unit layer, when the total number of metal atoms constituting the first unit layer is represented as 1, a ratio thereto of the number of atoms of the zirconium being not less than 0.65 and not more than 0.95, the second unit layer being composed of a nitride containing titanium and aluminum, in the second unit layer, when the total number of metal atoms constituting the second unit layer is represented as 1, a ratio thereto of the number of atoms of the aluminum being larger than 0.40 and not more than 0.70. |
| US11298747B2 |
High fatigue strength porous structure
A porous apparatus includes a first layer and a second layer. The second layer has a plurality of struts. At least some of the struts define a porous geometry defining a plurality of faces, at least one of the plurality of the faces at least partially confronting the first layer. Each face is bounded by intersecting struts at vertices. Less than all of the vertices of each face of the porous geometry at least partially confronting the first layer are connected by a strut to the first layer. A process of producing the at least partially porous structure includes depositing and scanning metal powder layers. At least some of the scanned metal powder layers form either one or both of a portion of a first section of the structure and a portion of a second section of the structure formed by at least the struts defining the porous geometry. |
| US11298745B2 |
Method for manufacturing metal foam
The present application provides a method for manufacturing a metal foam. The present application can provide a method for manufacturing a metal foam, which is capable of forming a metal foam comprising uniformly formed pores and having excellent mechanical properties as well as the desired porosity, and a metal foam having the above characteristics. In addition, the present application can provide a method capable of forming a metal foam in which the above-mentioned physical properties are ensured, while being in the form of a thin film or sheet, within a fast process time, and such a metal foam. |
| US11298742B2 |
Hybrid component with cooling channels and corresponding process
A component is provided and includes a core including a ceramic matrix composite material, one or more cooling channels formed about the core, an outer metal shell disposed about the core and the one or more cooling channels and a protective material between the core and the outer metal shell. The one or more cooling channels are formed about the core as an array of cooling channels in the protective material. |
| US11298737B2 |
Device and method for the autofrettage of a workpiece
A method for the autofrettage of a workpiece may involve arranging the workpiece between a first securing means and a second securing means, and applying high-pressure fluid to an internal volume of the workpiece that is formed between the first and second securing means. A die or ram may be driven into the internal volume through an inlet in the first securing means. Consequently, as a result of the ram being advanced, not only is a fluid pressure generated in the internal volume, but also the workpiece is mechanically autofrettaged by way of the ram. A device may be employed to perform such hydromechanical autofrettage of the workpiece. |
| US11298733B2 |
Method for calculating plate thickness schedule for tandem rolling machine and rolling plant
A plate thickness schedule calculation method includes a plurality of steps. One step acquires a rolling model expression including a roll force model or a motor power model. Another step determines whether or not a parameter restriction has occurred that restricts at least one parameter of roll force, motor power and a reduction rate in each rolling stand. Further another step is to select a first derived function when no parameter restriction occurs and to select a second derived function when the parameter restriction has occurred in accordance with a result of the determination for each rolling stand. Still another step modifies each delivery side plate thickness in each rolling stand using a matrix including the one derived function selected from the first derived function and the second derived function in accordance with the result of the determination. |
| US11298726B2 |
Cleaner and cleaning device
A cleaner and a cleaning device are disclosed. The cleaner includes: a guide rail; a lifting lever, one end of which is disposed on the guide rail and capable of moving along the guide rail; a feed pipe, disposed inside the lifting lever; and a nozzle, disposed on an end portion of one end of the lifting lever away from the guide rail and communicated with the feed pipe. The lifting lever is configured to allow the nozzle to be away from or close to the guide rail. |
| US11298718B1 |
Fog nozzle adapter
A nozzle adapter for connecting corrugated tubing to a fog nozzle housing. The nozzle adapter comprises a channel body and a clamp, the channel body having a connector section and defining a flow channel extending through the channel body. The connector section comprises an outlet opening of the flow channel and is adapted and configured to removably connect to a piece of corrugated tubing. The clamp is operatively connected to the channel body and operable to clamp a fog nozzle housing so that an outlet end of the fog nozzle housing faces downstream toward the flow channel. |
| US11298713B2 |
Device for dispensing essential oil or tincture
A portable liquid dispensing device which includes a liquid cartridge containing a prefilled desired liquid supported within the dispensing device. A dispensing mechanism is positioned within the device for engagement with the liquid cartridge for dispensing a desired amount of liquid from the liquid cartridge to an outlet exiting the device. An actuator button is also provided for actuating the dispensing mechanism and dispensing the desired amount of liquid through the outlet of the dispensing device. The dispensing mechanism includes a central shaft with a first end engaged with the actuator button, a second end is positioned adjacent the outlet, and a plunger assembly is supported on the central shaft intermediate the first and second ends for substantially sealed engagement with an internal surface of the liquid cartridge and central shaft to move the plunger assembly and liquid toward the outlet upon actuation of the actuator button. Upon deactivation of the actuator button, the central shaft slidably moves or retracts through the plunger assembly, without moving the plunger assembly. |
| US11298710B2 |
Dual media nozzle
A dual media spray nozzle assembly for cleaning an optical viewer or sensor lens is disclosed. The assembly includes two media pathways that terminate in two arrays at the target cleaning area. The nozzle arrays are coplanar. The two media may be activated sequentially or simultaneously. The assembly includes a cover, a spray element, and a media inlet body. The nozzles are formed in a curved, semi-annular opening of the spray element. The spray element includes front and back sides. Formed on the front side is a first media flow path associated with a first media inlet formed on the media inlet body. The first media flow path is associated with the first array of nozzles. Formed on the back side is a second media flow path associated with second media inlets formed on the media inlet body. The second media path is associated with the second array of nozzles. |
| US11298709B2 |
Low-pressure spray nozzle assembly
A low-pressure spraying equipment for atomizing a working fluid at a low-pressure, includes a spray tip body having a top and a lower end, a handle arranged on the top of the spray tip body, and a chamfer defined at the lower end of the spray tip body. The spray tip body further includes a retaining shoulder and a ring collar, a mounting hole having a channel axis, a pre-atomizing component, and a tip atomizing component. The pre-atomizing component further includes a feeding channel, a pre-atomization channel, and a pre-atomization regulating channel. The feeding channel, the pre-atomization channel, and the pre-atomization regulating channel are three coaxial hollow channels sequentially defined and connected along the channel axis inside the pre-atomizing component. |
| US11298708B2 |
Meshes capable of droplet fragmentation, and related systems and uses thereof
Meshes capable of droplet fragmentation are generally described. Inventive articles, systems, and uses thereof are also described. |
| US11298704B2 |
Stationary waste comminuting device having an energy accumulator
The waste shredding device includes at least one shredding shaft, an electric motor for driving the at least one shredding shaft, a mains connection for supplying the electric motor with electrical energy and an energy store for storing energy and for at least partially supplying the electric motor with electrical energy, in particular for covering power peaks. Furthermore, a corresponding method for operating the waste shredding device. |
| US11298700B2 |
Feedback system for parallel droplet control in a digital microfluidic device
Digital microfluidics apparatuses (e.g., devices and systems) configured to determine provide feedback on the location, rate of movement, rate of evaporation and/or size (or other physical characteristic) of one or more, and preferably more than one, droplet in the gap region of a digital microfluidics (DMF) apparatus. |
| US11298699B2 |
Separation and analysis of samples bymicrofluidic free-flow electrophoresis
A microfluidic device (11) is provided for separation and analysis of microfluidic samples. The device comprises: a separation channel (10); a first electrolyte channel (12) configured to provide a flow of high conductivity electrolyte solution, in use; and provided with a positive electrode (13) at a downstream outlet of the channel; a second electrolyte channel (14) configured to provide a flow of high conductivity electrolyte solution, in use, and provided with a negative electrode (15) at a downstream outlet of the channel; and wherein the flow of electrolyte through the first and second electrolyte channels removes electrophoresis products and gas bubbles from the device; and wherein the presence of the electrolyte provides a substantially homogenous electric field across the separation channel. |
| US11298697B2 |
Method to produce chemical pattern in micro-fluidic structure
A flow cell includes: a first substrate; a second substrate; a first resin layer disposed over an inner surface of the first substrate; a second resin layer disposed over an inner surface of the second substrate; a first plurality of biological capture sites located at the first resin layer; a second plurality of biological capture sites located at the second resin layer; and a polymer layer interposed between the first resin layer and the second resin layer, such that the first substrate is attached to the second substrate via at least the first resin layer, the polymer layer, and the second resin layer, wherein the polymer layer defines a plurality of microfluidic channels that extend through polymer layer. |
| US11298695B2 |
Pipette tip for an automated pipetting device and production method thereof
The present invention relates to pipette tips for connecting to a pipette tube of a pipetting device that is used for taking up and dispensing fluids. A pipette tip is shaped as a long tube that forms a pipette body with an opening on one of its ends and the other end is designed to connect to the pipette tube. The pipette tip is characterised in that it has an electrode as a volume measuring electrode of a measuring capacitor. The present invention further relates to pipetting devices with a pipette tip, methods for determining the volume of a fluid sample in such a pipette tip, methods for recognising such a pipette tip on a pipetting device, methods for producing such a pipette tip, uses for such a pipette tip and a set of pipette tips. |
| US11298691B2 |
Prussian blue derived catalysts
Prussian blue analog derived catalysts having a composition of highly porous transition metal (“TM”) oxides with nano particle size. Such OER catalysts are synthesized from the PBA, containing cobalt, iron, nickel, copper, manganese, zinc, magnesium etc., as secondary building units (“SBUs”) coordinated by hexacyano-based ligands. Furthermore, the PBA-derived catalysts may also integrated into a highly graphitized carbon network to further improve the conductivity, mass transport and durability against oxidative corrosion. |
| US11298686B2 |
Honeycomb catalytic converter
The present invention relates to a honeycomb catalytic converter including: a honeycomb structured body in which multiple through-holes are arranged longitudinally in parallel with one another with a partition wall therebetween; and a noble metal supported on the honeycomb structured body, wherein the honeycomb structured body contains a ceria-zirconia complex oxide and alumina, each partition wall includes a first carrier layer defining a surface layer of the partition wall and carrying Pd, and a second carrier layer located more inwardly of the partition wall than the first carrier layer and carrying Rh. |
| US11298677B2 |
Lithiated cyclodextrin metal organic frameworks and methods of making and using the same
Disclosed herein are lithiated cyclodextrin metal organic frameworks and method of making and using the same. A metal organic framework comprising a coordinated network of repeating units extending in three dimensions, wherein the repeating unit comprises a cyclodextrin, a first coordinating metal cation, and a second coordinating metal cation. |
| US11298676B2 |
Porous material for storing of molecules and its use
The invention concerns new types of porous coordination polymers (MOF) and a method for their preparation. MOFs have been prepared through synthesis of salts of trivalent cations M3+, the source of which are aluminium, chromium, iron or yttrium salts, it is advantageous if of chlorides, nitrates or sulphates, with linkers carrying two or more phosphinic groups under presence of solvent. Linkers are phenylene-1,4-bis(R phosphinic acid) (PBPA) and biphenylene-4,4′-bis(R phosphinic acid) (BBPA). For the prepared MOFs, the structure has been tested using x-ray powder diffraction, specific surface and porousness which have been characterised through adsorption isotherm of nitrogen and further the stability of prepared MOFs has been determined using thermogravimetric analysis.All the prepared MOFs have been stable around 400° C. and have contained mesopores or micropores where hydrogen or CO2, for example, can be stored. |
| US11298671B2 |
Bulk catalyst withdrawal system and methods for the use thereof
A method for processing a chemical stream includes contacting a feed stream with a catalyst in a reactor portion of a reactor system causing a reaction which forms a product stream. The method includes separating the product stream from the catalyst, passing the catalyst to a catalyst processing portion of the reactor system, processing the catalyst in the catalyst processing portion, and passing a portion of the catalyst from the catalyst processing portion of the reactor system into a catalyst withdrawal system that includes a catalyst withdrawal vessel and a transfer line coupling the catalyst withdrawal vessel to the catalyst processing portion. Each of the catalyst withdrawal vessel and the transfer line include an outer metallic shell and an inner refractory lining. The method further includes cooling the catalyst in the catalyst withdrawal vessel from greater than or equal to 680° C. to less than or equal to 350° C. |
| US11298670B2 |
Compact quench zone reactor internals
Hydroprocessing reactor internals height reduction is achieved by placing a mixing chamber above the collection tray. The mixing chamber has spillways on the top (top spillways) and the side of the mixing chamber (side spillways) for fluid entry. The design of the spillways has a significant impact on pressure drop. The pressure drop is reduced by having wide shallow spillways rather than narrow and deep spillways without impacting mixing performance. With both side and top spillways, the height of the mixing chamber can be reduced significantly with minimal impact on fluid mixing and pressure drop. |
| US11298667B2 |
Preparation vessel with a cooling device
A preparation vessel, in particular for a food processor, has a vessel wall and a preparation area surrounded by the vessel wall. The vessel wall has a cooling device that contacts the vessel wall in a heat-conducting manner for cooling a preparation item present in the preparation area. The vessel wall in at least a partial area has a double-walled design, with an inner wall bordering the preparation area and an outer wall that is formed separately from the inner wall and spaced apart from the inner wall by a gap, wherein the gap has the cooling device and a phase change material located between the cooling device and the outer wall as viewed in a direction from the preparation area to the outer wall. |
| US11298666B2 |
Slurry mixer for a battery electrode
A slurry mixer for a battery electrode capable of maximally simplifying a configuration of a high-speed stirring body to minimize a rotational load, such that a stirring time of the slurry may be greatly reduced and productivity may be increased, preventing a powdery material from being accumulated on an upper side face and an upper surface of a low-speed stirring body, preventing a deterioration in a performance, failure and a reduction in a life span of a high-speed stirring shaft and bearing, and uniformly stirring mixed materials located at inner corners and a bottom of a container, thereby further increasing stirring efficiency. |
| US11298665B2 |
Apparatus and method for mixing paste material with gas
An apparatus (1) for mixing a paste material with gas includes: a mixing part (2) that mixes the paste material with the gas using a piston pump (10); and a static mixer (3) that is connected to the mixing part to stir a mixture obtained by mixing the paste material with the gas in the mixing part. The static mixer includes one or a plurality of stirring sections through which the mixture passes, the stirring section has a shape that allows a flow of the mixture passing through the stirring section to be stirred. A ratio of a volume of the piston pump to a volume of at least one of the stirring sections of the static mixer is within a range from 1:0.2 to 1:5. |
| US11298663B2 |
Thin metal/ceramic hybrid membrane sheet and filter
A thin micro-porous membrane sheet and filtering device using it is presented. The membrane sheet includes a thin porous metal sheet of thickness between 20 and 200 μm with a porous ceramic coating of thickness less than 25 μm on at least one of its surfaces. The porous metal sheet has mean pore sizes at micro and sub-micrometer level and has a surface substantially free of pores greater than 10 micrometers. The ceramic coating layer may be made of particles with a mean particle size in a range of 10 to 300 nm and contains certain sintering promoters. The ceramic coating is sintered with the metal sheet in non-oxidizing environment at lower temperatures than typical ceramic membranes. The thin membrane sheet is used to filter fine particulates from micrometers to nanometers from a liquid or gas stream. The thin membrane sheet may be assembled into a filter device having high surface area packing density and straight mini-flow channels. |
| US11298655B2 |
Wall-mounted plant-based air purification system
The present disclosure generally relates to plant-based air purification systems and more particularly to wall mounted systems for removing impurities from indoor air using plants. |
| US11298652B2 |
Hybrid low dew point compressed air dryer
The present disclosure is directed to a dryer system for drying compressed gas discharged from a compressor. The dryer system includes a refrigeration drying system operable for removing moisture from the compressed gas and a desiccant drying system with a desiccant wheel located in series downstream of the refrigeration drying system operable for removing additional moisture from the compressed gas. |