最新美国发明专利第2024-04-02期 - 专利汇|PatentHub专利检索|专利查询网|发明专利查询分析

Document	Document Title
US11944947B2	Mixer and method for mixing two components The disclosure relates to a specifically static mixer for mixing two components, with a housing, in which a mixing element is accommodated, and an input part with a first intake and a diametrically opposite second intake, wherein, within the input part, a first channel is formed between the first intake and the mixing chamber and a second channel is formed between the second intake and the mixing chamber. The first channel extends radially inward from the first intake and opens into a central opening in the cover. The second channel has two partial channels as storage chambers not leading into the mixing chamber, and two intake sections located radially within the storage chambers and leading into the mixing chamber. The intake sections branch off the respective storage chambers, extend inward in the opposite direction to the first channel and open into the central opening in the cover.
US11944946B2	Mixing assemblies including magnetic impellers The present disclosure relates to improved magnetic mixing assemblies and mixing system. The magnetic mixing assemblies can provide improved mixing action, ease of use, and low friction. The mixing assemblies can be adapted for use with a wide variety of containers including narrower neck containers and flexible containers.
US11944945B2	Fluid mixing systems and methods of use A fluid mixing system includes a flexible bag having a first end, an opposing second end, and an interior surface bounding a compartment; a retainer coupled to the second end of the flexible bag, the retainer having a retention cavity formed thereon that communicates with the compartment of the flexible bag; and an elongated member having a first end rotatably coupled to the first end of the flexible bag and an opposing second end freely disposed within the retention cavity of the retainer so that the second end of the elongated member can rotate within the retention cavity relative to the retainer.
US11944944B2	Mixing apparatus A mixing apparatus includes a mixer configured to mix a material including a rubber or a resin in the presence of a working fluid that is in a supercritical state or a subcritical state. The mixer includes a chamber that forms a flow passage for the working fluid and the material, and a mixing blade disposed in the chamber and fixed to the chamber.
US11944942B1	Polyether block polyamide/polydimethylsiloxane composite membrane for gas separation, and preparation method and use thereof The present disclosure relates to a polyether block polyamide/polydimethylsiloxane (PDMS) composite membrane for gas separation, and a preparation method and use thereof, and belongs to the technical field of membrane separation. In the present disclosure, an amphoteric copolymer PDMS-polyethylene oxide (PEO) (PDMS-b-PEO) is introduced into an intermediate layer to adjust the interfacial binding performance, thereby promoting preparation of an ultra-thin polyether block polyamide composite membrane. Studies have shown that the surface enrichment of PEO segments not only inhibits a dense SiOx layer formed due to a plasma treatment of a PDMS intermediate layer, but also provides additional hydrophilic sites and interfacial compatibility for the subsequent selective layer. The use of PDMS-b-PEO in an intermediate layer allows the successful preparation of a selective layer with a thickness of about 50 nm.
US11944939B2	Hollow fiber membrane element, hollow fiber membrane module, and method of forward osmosis water treatment A hollow fiber membrane element, comprising: a core tube comprising a side face having a plurality of pores; and a hollow fiber membrane group consisting of a plurality of hollow fiber membranes disposed around the core tube, the hollow fiber membrane element being a both open-ended type hollow fiber membrane element in which both ends of the core tube and the plurality of hollow fiber membranes are open. The hollow fiber membrane group includes a first hollow fiber membrane layer composed of a plurality of first hollow fiber membranes disposed so as to surround the core tube and a second hollow fiber membrane layer composed of a plurality of second hollow fiber membranes disposed so as to surround the first hollow fiber membrane layer, and a permeability coefficient of the plurality of first hollow fiber membranes is smaller than a permeability coefficient of the plurality of second hollow fiber membranes.
US11944938B2	Ion permeable membrane An ion permeable membrane includes ion conductor particles and a fiber base material, in which each of the ion conductor particles has a first portion embedded inside the fiber base material, and a second portion exposed on outside surfaces of the fiber base material, and the second portions are continuous between an upper surface and a lower surface in a thickness direction of the ion permeable membrane.
US11944933B2	Tunable, rapid uptake, aminopolymer aerogel sorbent for direct air capture of CO2 A primary amine polymer aerogel comprising greater than 5 wt. % of primary amine monomers covalently bound to cross-linking monomers, wherein the primary amine monomers are selected from vinyl amine. A secondary amine polymer aerogel comprising secondary amine monomers covalently bound to cross-linking monomers, the secondary amine monomers being a result of substituting a hydrogen atom from a primary amine polymer aerogel, the primary amine polymer aerogel comprising vinyl amine monomers covalently bound to the cross-linking monomers. A tertiary amine polymer aerogel comprising tertiary amine monomers covalently bound to cross-linking monomers, the tertiary amine monomers being a result of substituting hydrogen atoms from a primary amine polymer aerogel, the primary amine polymer aerogel comprising vinyl amine monomers covalently bound to the cross-linking monomers.
US11944929B2	Filter assembly for gas turbine engine A filter housing for containing a cartridge assembly having a filter cartridge secured to a filter cover, the filter housing has a peripheral wall extending around a longitudinal axis, and end wall secured to the peripheral wall, the filter housing defining a cavity partially enclosed by the peripheral wall and the end wall, the peripheral wall defining a cartridge-receiving section extending from the end wall along the longitudinal axis and sized for receiving the filter cartridge and a cover-receiving section extending along the longitudinal axis from the cartridge-receiving section to an open end of the filter housing opposed to the end wall and sized for receiving the filter cover, a portion of the cover-receiving section recessed radially outwardly from the cartridge-receiving section relative to the longitudinal axis, a lubricant outlet of the filter housing extending through the portion of the cover-receiving section of the peripheral wall.
US11944927B2	Filter media packs, methods of making and filter media presses The disclosure is directed toward presses which may comprise planar or curved press plates that can be driven toward and away from each other such as via linear reciprocating movement to press filter media sheets as opposed to using rolls. The press plates can create such features as embossments that may have the ridges and grooves, brands, creases or other such features. The press can create pleated packs or individual panels for non-pleated packs. Additionally, a variety of embossed pleat packs, unique shapes, structural components and other pleat packs that may be formed by presses or other methodology are disclosed as well as filter cartridges using such pleat packs.
US11944925B2	Liquid filter arrangement; components; and, methods Liquid filter arrangements are described and shown. The arrangements generally include a filter member comprising a shell enclosing a filter cartridge. Unique features for interface between the enclosed filter cartridge and the shell are provided. Also provided are unique features for interaction between the cartridge and a filter head, in use.
US11944924B2	Filter interconnect using a magnetic shear force An interconnection scheme between a filter cartridge and its corresponding manifold whereby a magnetic shear force is introduced to remove a blocking mechanism that would otherwise prohibit attachment. The magnetic shear force may also be employed to activate or deactivate a switch or valve, or engage or disengage an engagement mechanism relative to other components upon interconnection. The magnetic shear force is generated by complementary correlated magnet structures moved into close proximity to one another. The interconnection scheme may be a linear or rotational attachment of the filter cartridge with respect to the manifold. A valve assembly utilizing magnetic shear force may be employed to activate a bypass action between a manifold ingress port and egress port, thereby allowing water to flow when a filter cartridge is removed from the manifold and directing water to the filter cartridge when the valve assembly is activated.
US11944922B1	Water treatment system The disclosure includes a water system that includes a feed water heat exchanger including a feed water heat exchanger above a water collection tank and a feed water heat exchanger/steam generator connected to the feed water heat exchanger. The feed water heat exchanger/steam generator includes a heat exchanger, coils, boiler burners, and emissions control. The water system includes a brine/waste water feed water heat exchanger positioned within brine/waste water tank enclosure, which includes a brine/waste water tank that is in fluidic connection with the feed water heat exchanger/steam generator. The water system includes a preheater in fluidic connection with the brine/waste water feed water heat exchanger, and a post-preheater heat exchanger enclosure including a post-preheater heat exchanger, post-preheater coils, post-preheater burner and post-preheater emissions control, the post-preheater heat exchanger in fluidic connection with the pre-heater. The water system includes a vapor removal device in fluidic connection with the post-preheater heat exchanger.
US11944918B1	Assembly robot toy An assembly robot toy includes a gear box, a head part and an assembly component. The head part and the assembly component are detachably arranged on the gear box, the gear box internally is provided with a gear set, and a motor and a plurality of transmission rods which are respectively connected with the gear set. The assembly component is connected with the gear set and/or the transmission rod, and the bottom of the gear box is provided with a second avoidance hole corresponding to the position of the gear group for the assembly connection. The head part is provided with a power supply module which is electrically connected with the motor and used for supplying power to the motor; and the transmission rod is configured to rotate by transmission of the gear set when the motor is driven.
US11944917B2	Media synchronized control of peripherals A computer system and method for synchronizing actions associated with media between a media/network device and peripherals. In an example implementation, a system includes a one or more processors configured to receive, by a communication module from a media/network device based on peripheral addressing information, a peripheral payload including a first set of actions and timing information related to media. The one or more processors perform the first set of actions based on the peripheral payload, generate response data for the first set of actions, and transmit the response data to the media/network device via a wireless network.
US11944913B2	Printed documents readily identifying indicia printing defects A printed security-enhanced document, printing method, and system for ensuring that any printing defects present in the variable indicia also occur in the background on the document protected. By ensuring that random printing defects in the variable indicia also appear in the same document's background, detection of the printing defects becomes more readily apparent.
US11944906B2	Video modification and transmission using tokens Modified video is distributed to a viewer of a computer-implemented game by causing a processor to distribute, toward a terminal device of a viewer, a first video including an animation of a first avatar of a distributor generated based on motion data; distribute, toward the terminal device, a second video related to a computer-implemented game generated with operation data using a received web page; receive, from the terminal device, token data indicative of a token sent to the distributor from the viewer during execution of one unit section of the game; and distribute, toward the terminal device, the second video including, during one time section occurring after the one unit section of the game ends and before a next unit section of the game begins, a rendering of a token object selected based on the token data.
US11944902B2	Systems and methods for portable exergaming In a first aspect, a system for playing a video game is provided that includes (1) one or more sensors adapted to monitor one or more biometric parameters of a user and communicate the one or more monitored biometric parameters (MBPs); (2) a computing device adapted to communicate with the one or more sensors and to receive the one or more communicated MBPs; and (3) a video game having an avatar adapted to move an object on an incline, the video game adapted to execute on the computing device. The video game is adapted to control the avatar to perform an action in the video game based in part on the received one or more communicated MBPs. Numerous other aspects are provided.
US11944899B2	Wireless device with enhanced awareness Methods and systems are provided for gaming headset with enhanced off-screen awareness. An audio system that is used for outputting audio signals to a user may be configured for identifying in audio signals, based on parameters or criteria associated with a user of the system, one or more components in the audio signals; determining characteristics of the one or more components based on perception of the audio signals by the user; and adjusting based on the characteristics of the one or more components, the one or more components and/or one or more other components in the audio signals. The audio system may include circuits for handling the required functions. The circuits may include a detection circuit configured for identify the one or more components, one or more adjustment circuits for applying the adjustments, and a controller circuit for controlling applying the adjustments.
US11944898B2	Computing device with enhanced awareness Methods and systems are provided for gaming headset with enhanced off-screen awareness. An audio system that is used for outputting audio signals to a user may be configured for identifying in audio signals, based on parameters or criteria associated with a user of the system, one or more components in the audio signals; determining characteristics of the one or more components based on perception of the audio signals by the user; and adjusting based on the characteristics of the one or more components, the one or more components and/or one or more other components in the audio signals. The audio system may include circuits for handling the required functions. The circuits may include a detection circuit configured for identify the one or more components, one or more adjustment circuits for applying the adjustments, and a controller circuit for controlling applying the adjustments.
US11944892B2	User interface with interactive mapping and segmented timeline Systems and methods for generating user interface elements associated with a guided workout are disclosed herein. For example, by analyzing location data associated with a user device, along with digital content corresponding to the guided workout, the system may generate user interface elements including graphical representations, segmented timelines, and performance metrics associated with a user's progress and performance while consuming the guided workout content. These interface elements may be displayed to the user during and/or after the workout and may allow for user interaction to view varying levels of detail associated with the interface elements.
US11944891B2	Selection of a sports club, racket or bat using ground pressure forces applied by the player in a stroke A method for selecting a most suitable golf club from a set, where the shafts of the set are of different levels of flexibility along the shaft, includes using a pressure sensing mat upon which the player places both feet while carrying out a sample swing to measure forces applied by feet of the player during the stroke. The pressure sensing mat provides output signals indicative of vertical forces, lateral forces, both heel to toe and side to side, lateral speed, both heel to toe and side to side applied by the feet of the player during the swing and a processor operating on the signals selects certain ones of the output signals to calculate a load factor from the selected signals which is used to select one of the set most suitable for use by the player using a color coding system applied to the load factor.
US11944889B2	Abdominal weight lifter belt assembly with variable fasteners A quick hook-up and release anchor belt assembly for adjustably interconnecting two detachably coupled belts that are especially suited in combination for constraining the abdominal portion of a weight lifter's torso, and the like, the belt being of substantial thickness. Each belt includes a flexible elongate length and optionally a rigid end portion. The belts are positionable and detachably attachable along their elongate length by means of hook and loop fasteners. A releasable toggle or connector is operable to instantly draw up or alternatively allow interconnected separation and attachment of the two end portions of the coupled belts.
US11944885B2	Shuttlecock and method of manufacturing a shuttlecock The present invention relates to a shuttlecock generally including a striking part and an aerodynamic part. The shuttlecock includes: a base to serve as striking element for the striking part of shuttlecock, a stems part formed by a plurality of stems to provide support to the aerodynamic part, the stems being connected or connectable with the base, and a sheeting part formed by a sheeting for forming of an aerodynamic member of the aerodynamic part attached or attachable to the stems. The stems part substantially has a shape of a pyramidal stems frustum, the base of the frustum preferably conforming to the open end of the aerodynamic part. The sheeting part, while attached to the stems, substantially has a shape of a pyramidal sheeting frustum. The edges of the pyramidal sheeting frustum are defined by the edges of the pyramidal stems frustum at an overlapping part of the sheeting part with the stems part. The aerodynamic part substantially has the shape of a pyramidal frustum defined by the pyramidal stems frustum and the pyramidal sheeting frustum.
US11944880B2	Golf club heads and methods to manufacture golf club heads Embodiments of golf club heads, golf clubs, and methods to manufacture golf club heads and golf clubs are generally described herein. In one example, a golf club heady may include a body portion having an interior cavity with a front opening, a face portion coupled to the front opening to close the interior cavity, a plurality of back groove portions on a back surface of the face portion, a mass portion coupled to the body portion, a polymer filler material in the interior cavity, and a face support portion coupled to the back surface of the face portion. Each groove portion of the plurality of back groove portions is located between the face support portion and a perimeter edge of the face portion. Other examples and embodiments may be described and claimed.
US11944876B2	Autonomous tennis assistant systems Systems, methods, and computer-readable media are disclosed for autonomous tennis assistant systems. Example methods include determining, by a device, an outer boundary line of a tennis court, generating a digital representation of the tennis court using the outer boundary line, where the digital representation includes at least a portion of an out-of-bounds area adjacent to the outer boundary line, determining a first location of a first tennis ball, and causing a tennis ball retrieval robot to move to the first location to retrieve the first tennis ball, where the tennis ball retrieval robot is wirelessly connected to the device.
US11944873B2	Hydrofoils and method A method for providing a swim fin includes providing a foot attachment member and a blade member having a predetermined blade length. The blade member has a soft portion made with a relatively soft thermoplastic material. The method includes providing a relatively harder portion and the relatively soft thermoplastic portion that is molded to the relatively harder thermoplastic portion. The method includes providing an orthogonally spaced portion of the relatively harder portion that is arranged a predetermined orthogonal direction while said swim fin is in state of rest. The method includes providing the blade member with a predetermined biasing force portion that is arranged to urge the orthogonally spaced portion while the swim fin is in a state of rest. The method includes arranging a significant portion of the blade length to experience pivotal motion a lengthwise angle of attack during use.
US11944865B2	Constant tension mechanism of training machine A constant tension mechanism of a training machine is provided, including: a base, configured to be connected to a body of the training machine; an elastic member, abutted against the base; and a tension mechanism, including a movable member movably connected with the base and abutted against the elastic member, and at least one tension pulley rotatably disposed on the movable member and configured to urge a belt connected to the body; wherein relative to the base a direction in which the elastic member forces the movable member and a direction in which the at least one tension pulley moves point toward the same direction.
US11944856B1	Exterior fire suppression system An exterior fire suppression system that includes: a conduit line providing pressurized flow of a fire-suppressing material; a plurality of variable flow spray nozzles coupled to the conduit line and operable to disperse a variable spray of the fire-suppressing material onto the exterior of the building; a pump; a reservoir tank in fluid communication with the pump and the conduit line, the reservoir tank configured to store the fire-suppressing material; a control system operable to control a flow of the fire-suppressing material from the reservoir tank, the pressurized flow of the fire-suppressing material through the conduit line via the pump, and the dispersion of the fire-suppressing material through the plurality of variable flow spray nozzles; and a power supply operably connected to provide electric power to the pump and the control system.
US11944853B2	Rope anchor A rope anchor with a J-shaped a body having a hook and spine. The end of the spine has an attachment hole for a rope and an elongated, teardrop-shaped rope slot that is either enclosed or gated. The gate is biased closed to span the open side of the rope slot and pushed opened to allow access for a rope. A tip, composed of a flat chip of metallic material, fits into a slot at the end of the hook. The tip is generally triangular with two or three sharp corners, or square or rectangular with four sharp corners. The slot orients the tip so that only one of the sharp corners is exposed, or so that two adjacent sharp corners are exposed. When an exposed sharp corner is not suitable for use, the tip can be reoriented to expose a different sharp corner.
US11944850B2	Ultrasound therapy catheter with multi-chambered balloons for transluminal longitudinal positioning A multi-angular ultrasound device. Multi-angular ablation patterns are achieved by a catheter-based ultrasound transducer having a plurality of transducer zones. A multi-chambered balloon is positioned on the catheter.
US11944848B2	Compositions, methods and systems for gas vesicle based cavitation The system and process of therapeutic and effective cavitation by using ultrasound to collapse gas vesicles as well as cavitate the bubbles produced from the collapsed gas vesicles. Therapeutic effect includes, but is not limited to lysing cells by cavitation. The cells expressing the gas vesicles can optionally be used as delivery cells to preform tasks such as transporting the gas vesicles into deep tissue areas, releasing compounds at the cavitation site, and more. The gas vesicles can optionally be modified to facilitate getting the bubbles near the cavitation targets by functionalizing the gas vesicles.
US11944845B2	Asymmetric dual-mode ionization systems and methods An asymmetric dual-mode ionization chamber measurement system can include a first high-voltage plate, a second high-voltage plate and a readout plate. The first high-voltage plate can be disposed from the readout plate by a first active volume. The second high-voltage plate can be disposed from the readout plate by a second active volume. A high-voltage potential can be coupled to the first high-voltage plate during a first mode, and to the second high-voltage plate during a second mode. Ion pairs generated by a radiation stream passing through the first active volume during the first mode and the second active volume during the second mode can be measured at the readout plate to determine a radiation rate of the ionizing radiation. The asymmetric dual-mode ionization chamber measurement system can advantageously measure different radiation streams that have significantly different ranges of radiation rates flux.
US11944844B2	Internal body cavity therapeutic applicators and methods for using them An apparatus for providing treatment to at least one tissue includes a distal balloon, a proximal balloon, and an intermediate balloon positioned between the distal balloon and the proximal balloon and inflatable independently from the distal and proximal balloons. A source lumen is positioned within at least the intermediate balloon receives a radiation source to treat target tissue adjacent the intermediate balloon.
US11944840B2	Photobiomodulation therapy garment, methods and uses The present specification discloses a photobiomodulation therapy garment having a garment structure configured to be worn by a user atop a skin surface with one or more near-infrared light sources integrated with the garment structure. The near-infrared light source is configured to emit near-infrared light directed to one or more regions of interest of the skin at a wavelength between 600 nm to 1600 nm and at a predetermined dosimetry and duration. A controller with a processor and memory is in communication with the near-infrared light source to control the operational parameters of the near-infrared light source.
US11944839B2	Acquisition of interferometric recordings of brain and neuron activity by coherent microwave probe with therapeutic activation, inactivation, or ablation of molecular, neuronal or brain targets Low power MASER (Microwave Amplification by Stimulated Emission of Radiation) radiation is used to non-invasively record molecular activity in a biological object such as a brain. Low power MASER radiation is also used to neuromodulate molecular targets via Rabi coupling, resulting for example in conformational and function change in specific molecular targets such as ligand-gated ion channels, voltage-gated ion channels, G-proteins, or dopamine receptors. The method can be used to change the energy state of targeted molecules via energization or enervation, or to ablate targeted molecules.
US11944837B2	System and methods for treating cancer cells with alternating polarity magnetic fields Systems and method for destroying or inhibiting cancer cells and other rapidly-dividing cells include applying AP magnetic fields having a defined frequency of 5 Hz-500 kHz and a field strength of 0.1-5000 μT to a target body area that includes the cancer or other rapidly-dividing cells, and modifying the cancer or tumor microenvironment to increase the presence of cancer-suppressive cells or decrease the presence of cancer-promoting cells. In various embodiments, the systems and methods may include adjusting the therapy based on the dosage of an immunotherapy drug administered to the patient before, during, or after the application of the AP magnetic fields.
US11944836B2	Method and wearable device to stimulate positive DNA gene expression and other positive biological processes and mitigate negative DNA gene expression and other negative biological processes in order to improve health and wellness This present invention is a novel method and wearable device for stimulating positive DNA gene expression and mitigating negative DNA gene expression in order to improve health and wellness. The invention's unique characteristics include the application of multiple modalities, their unique configuration for safe, low-power application, the wearable device's unique arrangement in a flat, flexible configuration for elastic contouring with comfort required for an extended period of wearing, and the ability to optimize and personalize the parameters and mixing among such modalities. The invention further combines biometric feedback data with Artificial Intelligence analytic capabilities, to facilitate the identification and characterization of DNA resonant frequencies, and associated “stimulus-response” modeling associated with such biological interactions. The present invention will provide unique guidance to discover the optimal input-output parameters to actively control DNA and gene expression with a prescriptive approach to selectively activate certain positive expressions and to selectively suppress certain negative expressions.
US11944831B2	Systems and methods for treating cardiac arrhythmias A leadless pacing device may include a housing having a proximal end and a distal end, and a set of one or more electrodes supported by the housing. The housing may include a first portion and a second portion, with a guide wire port extending through the second portion. A guide wire lumen may extend through the second portion of the housing and the guide wire port may be located at a proximal end of the guide wire lumen. An exposed electrode may be located on a side of the housing that is opposite a side on which the guide wire port is located. The leadless pacing device may include a fixing member on the housing and extending radially from the housing. The leadless pacing device may further include a proximal member extending proximally from a proximal end of the housing. The proximal member may be elongated.
US11944830B2	Feedthrough system One aspect is a feedthrough system including a) a feedthrough including i) an insulating body, ii) an electrically conductive pathway, wherein an end of the electrically conductive pathway is level with a surface of the insulating body, iii) an electrically conductive pad, wherein the electrically conductive pad is attached to the level end of the electrically conductive pathway, b) an electrical contact element including a metal, wherein the electrical contact element is attached to the level end of the electrically conductive pathway by a joint microstructure, or wherein, when the feedthrough includes an electrically conductive pad, the electrical contact element is attached to the electrically conductive pad by a joint microstructure. Furthermore, the present embodiment refers to a process for preparing the inventive feedthrough system, and to a device including the inventive feedthrough system.
US11944829B1	Self-sealing strain relief mechanism for implantable pulse generators A medical implant is in the form of an implantable pulse generator. The implantable pulse generator includes a housing and a socket arranged on the housing for receiving an end portion of a lead. The socket provides a strain relief for the lead. The strain relief forms a sleeve which surrounds a through-opening for receiving the lead. A seal protrudes from an inner side of the sleeve facing the through-opening and is designed to sealably close the through-opening when no lead is inserted into the through-opening.
US11944827B2	Lead body with flexible circuits and method One aspect is a method of forming a lead for implantation. The method includes forming a distal end assembly, forming a proximal end assembly, and forming a flexible circuit coupling the distal end assembly to the proximal end assembly. The distal end assembly, the proximal end assembly and the flexible circuit are formed over an inner member. An outer member is placed over the combination of the distal end assembly, the proximal end assembly and the flexible circuit. The outer member and circuit are fused adjacent the distal end assembly to the proximal end assembly.
US11944824B2	Control of a medical device Methods of controlling at least one medical device wherein at least one adapter allows communication among the medical device and other devices. The methods include analysis of a representation of a unique biologic identifier of a person or device that is providing or receiving medical information.
US11944823B2	Multi-mode electrical stimulation systems and methods of making and using Methods and systems can facilitate identifying effective electrodes and other stimulation parameters, as well as determining whether to use cathodic and anodic stimulation. Alternately, the methods and systems may identify effective electrodes and other stimulation parameters based on preferential stimulation of different types of neural elements. These methods and systems can further facilitate programming an electrical stimulation system for stimulating patient tissue.
US11944820B2	Neurostimulation of mixed nerves Neurostimulation of a mixed nerve comprising a plurality of nerve fibre types. An implantable electrode array comprising a plurality of electrodes is positioned proximal to the mixed nerve. An electrical stimulus is delivered from at least one nominal stimulus electrode of the implantable electrode array, in accordance with a set of stimulus parameters. A recording of the electrophysiological response evoked by the electrical stimulus is obtained from at least one nominal recording electrode of the implantable electrode array. The recording is analysed by assessing one or more selected characteristics of the recording, and from the observed selected characteristics a level of recruitment of one or more fibre types recruited by the electrical stimulus is identified. The stimulus parameters are refined in a manner to effect selective recruitment of one or more fibre types relative to other fibre types of the mixed nerve.
US11944817B2	Variable amplitude signals for neurological therapy, and associated systems and methods Variable amplitude signals for neurological therapy, and associated systems and methods are disclosed. A representative method includes activating automatic delivery of an electrical therapy signal to a patient's spinal cord region at a frequency in a frequency range between 1.5 kHz and 100 kHz, via at least one signal delivery contact carried by an implanted signal delivery device. The delivery can include repeatedly and automatically delivering the electrical therapy signal at each of multiple therapy signal amplitudes to the at least one signal delivery contact, without the therapy signal generating paresthesia in the patient. The foregoing process can be used as a screening tool to screen responders from non-responders in the context of a non-paresthesia-generating therapy, and/or can be used during long-term treatment, for example, for chronic pain.
US11944808B1	External defibrillator apparatus with self-contained piezoelectric power source An external defibrillator apparatus (10, 74) operates to deliver electrical shocks to the heart muscles of a patient using a self-contained piezoelectric power source. The apparatus has a body (12) which includes a handle portion (26) in fixed operative connection with disposed paddle portions (14, 16). Each paddle portion includes a respective electrode (22, 24). Manual movement of a trigger (28, 78) is operative to cause circuitry (32, 82) which includes a piezoelectric crystal (34) to develop sufficient electrical potential between the electrodes to deliver the electrical shocks to the heart muscles through external contact with the patient's chest.
US11944807B2	Vagal nerve stimulation for treating central nervous system disorders Devices, systems and methods are disclosed for treating one or more symptoms of central nervous system disorders in a patient, such as anxiety disorders, fibromyalgia, traumatic brain injury, PTSD, and others. A method includes positioning a contact surface of a device in contact with an outer skin surface of patient and applying an electrical impulse transcutaneously from the device through the outer skin surface of the patient to a vagus nerve in the patient for about 90 seconds to about 3 minutes. The electrical impulse is sufficient to modify the vagus nerve such that the symptoms of the central nervous system disorder are reduced. For chronic treatment of such disorders, a stimulation protocol is provided that includes two or more doses administered per day for a period of time sufficient to relieve the symptoms.
US11944803B2	Cooled mechanical circulatory support system and method of operation A mechanical circulatory support system for a heart having a cooling element and a method for using the system to treat the effects of a cardiac episode. The support system has a pump comprising a rotor, the rotor having at least one blade. The system also has a catheter having an inner surface and an outer surface, the catheter extending proximally relative to the pump housing. The outer surface of the catheter is configured to contact blood when disposed within patient vasculature. The outer surface of the catheter comprises a heat transfer surface configured for cooling blood that comes in contact with the outer surface. The support system is operated to provide a temperature selected to cool the circulating blood in contact with the outer surface of the catheter to a temperature selected to reduce or prevent an effect of a cardiac episode.
US11944802B2	Motor assembly for catheter pump A catheter pump is disclosed herein. The catheter pump can include a catheter assembly that comprises a drive shaft and an impeller coupled to a distal end of the drive shaft. A driven assembly can be coupled to a proximal end of the drive shaft within a driven assembly housing. The catheter pump can also include a drive system that comprises a motor and a drive magnet coupled to an output shaft of the motor. The drive system can include a drive assembly housing having at least one magnet therein. Further, a securement device can be configured to prevent disengagement of the driven assembly housing from the drive assembly housing during operation of the pump.
US11944797B2	Device for adjusting tightening angle of needle safety protector A device for adjusting the tightening angle of a needle safety protector is proposed. The device is configured to provide an injection needle in an integrated state with a needle hub for preventing reuse of the injection needle and to fasten the needle hub to a needle safety protector that is disposed of in a folded state after use, a fastening structure is improved such that rotation is possible by a predetermined angle when the needle safety protector is rotated. Accordingly, an injection is safely performed by correcting the injection needle to the reference direction. In addition, even when a syringe is assembled by deviating from a reference angle during the mass production with the automatic line, the wrong angle is corrected in use.
US11944796B2	Data collection apparatus for attachment to an injection device A data collection device comprises: a first portion having one or more features configured for attaching of the first portion to a dosage knob of an injection device; a second portion rotatably coupled with the first portion, wherein at least part of the second portion is movable axially relative to the first portion; a sensor arrangement configured to detect rotation of the first portion relative to the second portion; and a processor arrangement configured to, based on said detected movement, determine a medicament amount expelled by the injection device, wherein the coupling arrangement is configured to provide a non-permanent coupling between the first portion and the dosage knob of the injection device.
US11944789B2	Autoinjector with a signaling device An autoinjector for dispensing a liquid product includes a housing; a product container arranged in the housing, particularly, a syringe comprising a displaceable piston; a drive member; a first spring which acts on the drive member and the piston to dispense the product from the container; signal element releasably axially coupled with the drive member so that the signal element is transported in the dispensing direction as the drive member is displaced; and a second spring, which exerts a spring force on the signal element against the dispensing direction and is tensioned as the signal element is transported in the dispensing direction. When the signal element is released or detached from the axial coupling, the second spring causes the signal element to accelerate opposite the dispensing direction and strike against a signal stop and generate an acoustic and/or tactile signal.
US11944787B2	Injector device An injector device includes an elongate housing configured to receive container of medicament. The injector device also includes a needle sleeve mounted within the housing and moveable between an extended position in which the needle sleeve at least partially extends from the distal end of the housing, and a retracted position in which the needle sleeve is received further within the housing than in the extended position. The injector device also includes a release mechanism configured to control actuation of a piston rod. The release mechanism includes a rotatable member disposed within the housing and in cooperating engagement with the needle sleeve such that movement of the needle sleeve from the extended position to the retracted position causes the rotatable member to rotate within the housing from a first position to a second position.
US11944784B2	Combined analyte sensor and infusion set Disclosed herein are combined devices and methods of manufacturing such combined devices. The combined devices disclosed herein include an analyte sensor including a sensor probe; an infusion set hub including a cannula; and a flexible base. The analyte sensor and infusion set hub are attached to the flexible base such that movement of one of the analyte sensor and the infusion set hub is substantially not transferred to the other one of the analyte sensor and the infusion set hub.
US11944783B2	Electronic modules for a syringe An injection monitoring device includes a syringe having a barrel configured to contain a medicament and a plunger configured to be displaced linearly into the interior of the barrel to dispense the medicament, a flange positioned between a proximal end and a distal end of the injection monitoring device and configured to be gripped during performance of the injection, and one or more force sensors positioned to detect data associated with an amount of force applied to the injection monitoring device during performance of an injection.
US11944777B2	Packaging assembly A packaging assembly comprises a case configured to at least partially contain a plurality of injection devices for delivering a medicament; a light sensor configured to detect light incident on the packaging assembly; and a wireless communication module configured to establish a wireless connection with at least one external device conditional on an intensity of light detected by the light sensor exceeding a threshold light intensity.
US11944774B2	Vascular access channel and methods An embodiment includes a vascular port comprising: first and second portions that are not monolithic with each other; wherein: (a)(i) the first portion includes a first arcuate surface to contour to a first portion of a vessel and the second portion includes a second arcuate surface to contour to a second portion of the vessel; (a)(ii) the first and second portions couple to one another around the vessel when implanted to form a central chamber that houses the vessel; (a)(iii) the first portion includes a port that includes a funnel with a funnel surface that narrows as the funnel surface approaches the central chamber; (a)(iv) the central chamber includes a central longitudinal axis and the funnel includes a central vertical axis that is orthogonal to the longitudinal axis; (a)(v) the second portion includes a hardened, non-compliant surface that intersects the vertical axis.
US11944773B2	Tattoo machine rechargeable battery unit with voltage controller A compact battery and voltage supply controller apparatus for a tattoo machine is disclosed. The battery and controller are configured to connect the battery to the tattoo machine through replaceable internally received magnetic connection adapters. The toggle switch operated display screen provides easy-to-view status and health of the battery and incremental voltage adjustment using a voltage boost circuit and adjustment knob. The internal battery can be replaced and/or removed and recharged.
US11944771B1	Personal medical device for administering treatment via mucous membrane The invention claims a new type of handheld medical device is meant to help the medical community by enabling them to treat patients remotely. This solves the problem of patient suffering or death due to lack of access to a medical professional or long wait times by enabling a patient-centred response to diseases, such as COVID-19. The device is hand-held, with incorporated germicidal UVC lights, an internal application tip and the delivery mechanism focuses on the mucous membrane. The top chamber connects to a removable container which can be used with the prescribed treatment/therapy, vaccine, or viral testing fluid/reagent, as needed. The versatility, non-invasive nature and germicidal properties constitute distinct improvements over other similar medical devices. This device also promotes the development of non-invasive inoculation and drug delivery systems via the mucous membrane.
US11944770B2	Expandable sheath with interlock dilator An expandable introducer sheath with an interlock dilator. The present technology provides an expandable sheath with a step feature inside its distal opening, and a dilator with an interlock that includes a catch surface configured to engage with the step feature and resist further relative movement so that the body of the dilator is prevented from exiting the distal end of the expandable sheath. This interlocking engagement may allow the dilator to be used to extend and maintain tension on the expandable sheath during insertion into a patient, and then to be retracted from the expandable sheath by pulling the dilator in the opposite direction. The present technology also provides a dilator hub with a spring mechanism configured to achieve and maintain a desired tension on the expandable sheath and to prevent overextension of the expandable sheath when the dilator is being inserted into the expandable sheath.
US11944767B2	Wire lock assembly A wire lock assembly for an access port of an elongate medical tube includes a body having an exterior surface, an interior surface, and a central opening disposed therethrough, an attachment mechanism disposed through the exterior surface of the body, the attachment mechanism having an open end and a closed end, at least one notch arranged on the body and positioned proximate to the central opening and at least one seal supported within the interior surface of the body in communication with the central opening, the seal comprising a passageway therethrough, where the interior surface of the body defines a non-linear pathway for securing one or more medical devices.
US11944761B2	System and method for medical device position guidance A medical device position guidance system includes a plurality of noninvasive external detector devices communicable with an invasive medical device. A magnetic field is used to gather information about the anatomical size and shape of a subject, such as a human. The medical device position guidance system further uses the magnetic field to obtain information about the positioning of the invasive medical device relative to the subject's anatomy. A method of using the medical device position guidance system is also provided.
US11944756B2	Oxygen source attachment for a tracheal device A tracheal tube attachment for a tracheal device is disclosed. The tracheal tube attachment fits over an end of a tracheal device to directly connect the tracheal device to an oxygen source. The tracheal tube attachment may include a central chamber having radial openings which may be partially or fully covered by a collar rotatably fitted around the central chamber. The collar and radial openings may be used to control the amount of oxygen received through the oxygen tube, as well as exhaling carbon dioxide to ambient.
US11944753B2	Variable skin breathability adhesive arrangements for patient interfaces Securement arrangements for use in securing a patient interface to the skin of a patient include a substrate material having a first surface and an adhesive material disposed on the first surface. The locations of the adhesive material are varied so as to minimize repetitious adherence of the adhesive material to the patient during repeated applications.
US11944748B2	Acoustic dose meter An acoustic dose meter is provided comprising a housing, and a cylindrical seat for staging a pressurized medicine canister. The housing includes at least one compartment for housing electronics and passageways for connecting electronics for power and data communication. A microprocessor including a transient memory containing machine instruction is also included. Additionally, a power source connected to the microprocessor, a power switch connected to the microprocessor and the power source for booting the microprocessor are added. At least one visual display device connected to the microprocessor for displaying available doses is provided. A first set of acoustic sensors connected to the microprocessor and adapted as acoustic sound generators and a second set of acoustic sensors connected to the microprocessor and adapted as acoustic soundwave recorders are implemented to detect and analyze frequencies enabling determining of dosing count availability.
US11944744B2	Cartridges with uninterrupted airflow and vapor paths for vaporizer devices Cartridges for vaporizer devices are provided. In one exemplary embodiment, the cartridge can include an atomizer and a channel extending through the cartridge from an inlet to an outlet. The atomizer includes a wicking element that is configured to substantially draw a vaporizable material from a reservoir and into the atomizer, and a heating element that is configured to substantially vaporize the vaporizable material into a vaporized material. The channel has an airflow path and a vapor path that intersect at a first junction between the inlet and the outlet. The airflow path is configured to receive and substantially allow air to pass therethrough, and the vapor path is configured to direct the vaporized material into the first junction so that the vaporized material mixes with the air to substantially form an aerosol downstream of the atomizer. Vaporizer devices are also provided.
US11944743B2	Vapor provision systems A vapor provision system includes an inhalation sensor; an input button; control circuitry and a vaporizer for generating vapor from a vapor precursor material when provided with power from the control circuitry, wherein the control circuitry is configured to provide power for the vaporizer to generate vapor both in response to determining from signaling received from the inhalation sensor that a user is inhaling on the vapor provision system and in response to determining from signaling received from the input button that a user has activated the input button for at least a threshold amount of time.
US11944742B1	Apparatus, methods, and systems for administering a medication to an animal A method for veterinary administration of medication to an animal, particularly a horse, is disclosed. The method involves inserting a capsule containing the medication, which is a liquid formulation, into a device connected to a tubular chamber. An atomizer is activated to atomize the medication, producing atomized medication. Before administration, a force is applied to a mask placed over the animal's muzzle, connected to the chamber. The atomized medication is then delivered to the animal. The liquid formulation, in some instances, comprises cells, cellular byproducts, or cell-derived products such as stem cells or products from human mesenchymal stem cells. This formulation may lack preservatives and may encompass peptides, proteins, growth factors, cytokines, exosomes, and extracellular vesicles. The delivery mechanism may involve deflating an air bladder to convey the atomized medication. The capsule allows for controlled transfer of the medication between chambers within it, facilitated by removing barriers and applying force.
US11944741B2	Medical treatment systems and related methods thereof A medical system including a compressible device, and a covering over the compressible device, wherein the covering includes a delivery configuration and a deployed configuration, wherein, in the delivery configuration, the covering at least partially covers the compressible device to maintain the compressible device in a compressed state, and wherein, in the deployed configuration, the covering is releasable from the device to transition the compressible device from the compressed state to an expanded state.
US11944734B2	Blood purification apparatus A blood purification apparatus that includes a blood circuit including an arterial blood circuit and a venous blood circuit and through which blood of a patient is allowed to extracorporeally circulate; a blood purification unit connected to and provided between the arterial blood circuit and the venous blood circuit and that purifies the blood flowing through the blood circuit; a blood pump provided to the arterial blood circuit and that delivers the blood of the patient from a distal end of the arterial blood circuit to a distal end of the venous blood circuit; a substitution line through which a substitution fluid is allowed to be introduced into the blood circuit; and an infusion portion attached to the substitution line and from which a predetermined liquid drug to be administered to the patient is allowed to be infused into the substitution line. The blood purification apparatus includes a control unit that executes a drug introduction mode in which the substitution fluid in the substitution line is introduced into the blood circuit, the control unit causing the liquid drug infused from the infusion portion in the drug introduction mode to be introduced into the blood circuit together with the substitution fluid; and a calculation unit that calculates a volume of the substitution fluid introduced from the substitution line into the blood circuit with the execution of the drug introduction mode.
US11944732B2	Dialysis system having localized disinfection An extracorporeal therapy system includes: (i) a dialysis fluid circuit including dialysis fluid preparation structure to prepare a dialysis fluid for treatment, the dialysis fluid circuit including a fresh dialysis fluid pump, a used dialysis fluid pump, and at least one filter for purifying the dialysis fluid; (ii) a blood circuit including a blood filter for use during the treatment; (iii) a blood pump operable to pump blood through the blood circuit and blood filter; (iv) a source of disinfecting fluid; and (v) a control unit operable with the dialysis fluid preparation structure and the blood pump, the control unit programmed to cause the disinfecting fluid to be delivered to and located for a duration at an area of the dialysis fluid circuit having the at least one purifying filter, and wherein during the duration the disinfecting fluid is precluded from contacting at least the fresh dialysis fluid pump.
US11944731B2	Dialyzer control apparatus and driving method thereof A dialyzer control apparatus includes a magnetic field generator which is disposed on an outer surface of a dialyzer which removes wastes from a blood flowing therein and generates a magnetic field; and a controller which controls the magnetic field generator to perform a magnetic field stimulation on the blood flowing into the dialyzer. The magnetic field stimulation may be a stimulation related to the improvement of the Rouleaux formation for the red blood cells in the blood.
US11944730B2	Breast status determination The present invention relates to a breast status determination device (10′). The breast status determination device (10′) comprises a breast shield (16′), a nipple elongation measurement unit (17′), and a breast status determination unit (20′). The breast shield (16′) can receive abreast (12) of a user (14) therein. The nipple elongation measurement unit (17′) can measure an elongation of a nipple of the breast (12) received in the breast shield (16′) for a specific pressure in the breast shield (16′) during a milk extraction session. The breast status determination unit (20′) can determine a status of the breast (12) based on the elongation of the nipple (26). The breast status determination device (10′) can allow estimating of milk left in the breast during the milk extraction session, when the breast (12) is empty, and whether a milk ejection reflex is present or absent in the breast (12).
US11944729B1	Liftable aroma diffuser A liftable aroma diffuser includes a shell assembly having a storage space and a first opening communicated with the storage space; a lifting mechanism slidably connected to the shell assembly and including a lifting main body and a fragrance storage element arranged on the lifting main body and configured to bear a fragrance element; and a drive assembly arranged on the shell assembly and connected to the lifting main body and configured to drive the lifting mechanism to slide relative to the shell assembly. The lifting mechanism is able to change between a first received state of being received in the storage space and a first extended state of at least partially extending out of the storage space from the first opening.
US11944728B2	Air treatment device with scented pad mechanism An air treatment device includes a housing and a pad holder mounted within the housing. The pad holder has an opening providing access to a support surface for a scented pad. When positioned on the support surface the scented pad has a first end portion remote from the opening and a second end portion adjacent the opening. A mechanism associated with the pad holder is configured to at least partially remove the scented pad from the pad holder. The mechanism includes a lever arm and a pad pusher connected to the lever arm. The lever arm is configured such that movement of the lever arm pushes the pad pusher along the support surface toward the opening, the pad pusher engaging the first end portion of the scented pad and moving the second end portion of the scented pad at least partially out of the pad holder opening.
US11944726B2	Method for fabrication of additively manufactured, self-gelling structures and their use Disclosed are Self-Gelling materials and structures or materials or structures having one or more self-gelling components that overcome existing gel limitations due to hydrogel localization for medical applications by providing, for example, 1) microstructurally, or physically, anchored characteristics to help localize the gel, and the overall printed, or otherwise formed structure, giving structural form to the gel that allows the gel to be localized within the body, and even sutured in place, and mitigates gel migration and extends its residence time; 2) to provide an underlying 3D printed structure to help contain and support the gel after implantation; and more. Self-Gelling 3D printed structures may be further processed via milling to yield deconstructed scaffold micro-granules, with the composition and nano-/micro-structure of the original larger structure. Deconstructed scaffold micro-granules may be hydrated to form a micro-granule embedded gel network that can be injected, giving form to injectable gels.
US11944724B2	In situ forming hemostatic foam implants Systems and methods related to polymer foams are generally described. Some embodiments relate to compositions and methods for the preparation of polymer foams, and methods for using the polymer foams. The polymer foams can be applied to a body cavity and placed in contact with, for example, tissue, injured tissue, internal organs, etc. In some embodiments, the polymer foams can be formed within a body cavity (i.e., in situ foam formation). In addition, the foamed polymers may be capable of exerting a pressure on an internal surface of a body cavity and preventing or limiting movement of a bodily fluid (e.g., blood, etc.).
US11944720B2	Method and device for preparing an implant obtained from a culture of stem cells Disclosed is a method for preparing an implant including a culture of cells on a membrane, the method including steps that consist of: securing the membrane to a mounting; placing the membrane in a recess of a housing providing two spaces having adjusted heights, above and below the membrane; injecting, into the spaces, a liquid capable of transforming into gel at a transport temperature lower than an injection temperature of the liquid; and bringing the housing to the transport temperature, so as to form an implant including the membrane and two layers of gel having adjusted thicknesses, on two opposite faces of the membrane, respectively.
US11944719B2	Thin film interposition of basement membrane scaffolds Disclosed are compositions and methods of making basement membrane constructs having interior or luminal volumes. The interior or luminal volumes may be in the form of vascular networks for liquid (e.g., blood) or gas perfusion. The interior spaces may also contain cells, such as epithelial cells. Also disclosed are tissues and organs, and methods of making thereof, comprising basement membrane constructs.
US11944717B2	Devices for in situ formed nerve caps and/or nerve wraps Disclosed are methods, devices and materials for the in situ formation of a nerve cap and/or a nerve wrap to inhibit neuroma formation following planned or traumatic nerve injury. The method includes the steps of identifying a severed end of a nerve, and positioning the severed end into a cavity defined by a form. A transformable media is introduced into the form cavity to surround the severed end. The media is permitted to undergo a transformation from a first, relatively flowable state to a second, relatively non flowable state to form a protective barrier surrounding the severed end. The media may be a hydrogel, and the transformation may produce a synthetic crosslinked hydrogel protective barrier. The media may include at least one anti-regeneration agent to inhibit nerve regrowth.
US11944710B2	Device for disinfecting equipment and method of using the same This disclosure relates to a device for disinfecting equipment, such as CPAP components, and a method of using the same. A device for disinfecting equipment according to an exemplary aspect of the present disclosure includes, among other things, a chamber, an ultraviolet (UV) light configured to emit UV light within the chamber, an ozone generator configured to generate ozone within the chamber. The device further includes a control unit configured to activate the UV light and the ozone generator during different periods of time.
US11944708B2	Methods of treating central nervous system disorders via administration of nanoparticles of an mTOR inhibitor and an albumin The present application provides methods of treating a CNS disorder (such as glioblastoma and epilepsy) in an individual, comprising systemically (e.g., intravenously or subcutaneously) administering to the individual an effective amount of a composition comprising nanoparticles comprising an mTOR inhibitor (such as a limus drug, such as sirolimus or a derivative thereof) and an albumin, optionally further comprising administering a second agent (such as an anti-VEGF antibody, a proteasome inhibitor, or an alkylating agent).
US11944706B2	Hybridosomes, compositions comprising the same, processes for their production and uses thereof The present invention provides a hybrid biocompatible carrier (hybridosome) which comprises structural and bioactive elements originating from at least one biocompatible delivery module (BDM) and at least one engineered drug encapsulation module (EDEM) comprising at least one tunable fusogenic moiety. The invention further provides pharmaceutical compositions comprising said hybridosomes, processes for their manufacture, as well as pharmaceutical uses and pharmaceutical methods based thereon.
US11944704B2	Coenzyme Q10 aerosol The present invention provides a formulation of Coenzyme Q10 that can be re-dispersed from a stable dry powder to formulation to yield a nanodispersion that can be readily aerosolized for inhalation.
US11944703B2	Ocular injector and methods for accessing suprachoroidal space of the eye An ocular medical injector is provided for drug delivery. A method includes inserting a puncture member of the medical injector into the eye until the puncture member reaches the suprachoroidal space (SCS). The puncture member defines a lumen therethrough. With the puncture member disposed within the SCS, a flexible cannula is advanced distally through the lumen of the puncture member, beyond the distal end portion of the puncture member and along the SCS towards a posterior region of the eye. The flexible cannula has an atraumatic distal tip and defines a lumen therethrough. With the distal tip of the flexible cannula disposed within the SCS beyond a distal end portion of the puncture member, a therapeutic substance is administered to the SCS.
US11944700B2	Body ink compositions and applicators A temporary tattooing ink is produced from concentrated genipin. In one embodiment, the concentrated genipin forms part of a solution. In another embodiment, the genipin is provided in a gel form which also includes a solvent and a thickening agent. Finally, an applicator is described into which genipin may be embedded for applying to a user's skin.
US11944697B2	Manufacturing process for 2-phase spray conditioner A process is described for the preparation of a hair treatment composition, which comprises the following process steps: a) Providing a water phase (Ia) comprising water and optionally other components and heating the water phase to a temperature of from about 70 to about 95° C., b) Providing an oil phase (Ib) comprising at least one oil and at least one emulsifier, and adding the oil phase to the heated water phase from step a), c) Homogenize the mixture from step b), d) Cooling the emulsion resulting from step c) to a temperature of from about 35 to about 45° C. and optionally adding further active ingredients, e) Filling of the emulsion resulting from step d) into preferably transparent containers, whereby in the resting state after from about 10 to about 90 minutes a separation into a water phase (II) and an emulsion phase (IIb) occurs.
US11944692B2	Thermoactive dental composite composition The present invention relates to dental, light-curable, one-component composite compositions comprising (A) monomers, (B) fillers, and (C) initiators, the viscosity η20 of which at 20° C. is greater than 400 Pas, preferably greater than 800 Pas and more preferably greater than 1200 Pas, and the viscosity η50 of which at 50° C. is less than 150 Pas, preferably less than 120 Pas and more preferably less than 90 Pas, and wherein the quotient η50/η20 of the viscosity of the composite composition at 50° C. and the viscosity of the composite composition at 20° C. is less than 0.125, preferably less than 0.1. The invention is preferably directed to dental composite compositions selected from the group consisting of dental filling materials, lining materials, luting materials and fissure sealants.
US11944689B2	Drug conjugates with self-stabilizing linkers having improved physiochemical properties Compounds and compositions are disclosed in which a Drug Unit is linked to a targeting Ligand Unit through a self-stabilizing Linker Unit from which a drug compound or active drug moiety is released at the targeted site of action. Methods for treating diseases characterized by the targeted abnormal cells, such as cancer or an autoimmune disease using the compounds and compositions of the invention are also disclosed.
US11944680B2	Engineered chimeric fusion protein compositions and methods of use thereof Compositions and methods for making and using engineered cells, such as, engineered myeloid cells that express a chimeric fusion protein that has a binding domain capable to binding surface molecules on target cells such as diseased cells.
US11944665B2	Methods and compositions for modulating lymphatic vessels in the central nervous system In some embodiments herein, methods, compositions, and uses for modulating lymphatic vessels of the central nervous system are described. In some embodiments, methods, compositions, or uses for treating, preventing, or ameliorating symptoms of a neurodegenerative disease comprise by increasing flow via meningeal lymphatic vessels are described. In some embodiments, methods, compositions, or uses for treating, preventing, or ameliorating symptoms of inflammatory neurological disease be inhibiting or preventing immune cell migration through meningeal lymphatic vessels are described.
US11944657B2	Agent for inducing interferon production containing lactic acid bacteria This invention provides an IFN inducer comprising, as an active ingredient, lactic acid bacteria and capable of inducing IFN production, an immunopotentiating agent or prophylactic agent against virus infection comprising such inducer, and a food or drink product comprising such IFN inducer and having IFN-inducing activity, immunopotentiating activity, or prophylactic activity against virus infection. The agent for inducing IFN production comprises, as active ingredients, lactic acid bacteria that can activate plasmacytoid dendritic cells (pDCs) and promote IFN production, such as Lactococcus garvieae NBRC100934, Lactococcus lactis subsp. cremoris JCM16167, Lactococcus lactis subsp. cremoris NBRC100676, Lactococcus lactis subsp. hordniae JCM1180, Lactococcus lactis subsp. hordniae JCM11040, Lactococcus lactis subsp. lactis NBRC12007, Lactococcus lactis subsp. lactis NRIC1150, Lactococcus lactis subsp. lactis JCM5805, Lactococcus lactis subsp. lactis JCM20101, Leuconostoc lactis NBRC12455, Leuconostoc lactis NRIC1540, Pediococcus damnosus JCM5886, or Streptococcus thermophilus TA-45.
US11944655B2	Probiotic microcapsule The invention is directed to a microcapsule and the method to obtain it. The microcapsule comprises a core in the form of a lipid sphere coated by a protein film, wherein the lipid sphere comprises sporulated microorganisms and at least one lipid wall material, and the protein film is a mix of carbohydrate, protein material and water. The method to obtain this microcapsule includes the stages of mixing sphere components, mixing protein film components, homogenizing the protein film and the subsequent coating of the lipid sphere by means of fluidization with the protein film.
US11944652B2	Nano-vesicles derived from genus Sphingomonas bacteria and use thereof The present invention relates to vesicles derived from bacteria of the genus Sphingomonas and a use thereof. These vesicles were significantly decreased in clinical samples of patients with hepatic cirrhosis, liver cancer, myocardial infarction, renal insufficiency, diabetes, brain tumors, mild cognitive impairment, dementia, depression, autism, and atopic dermatitis as compared to normal individuals. Administration of isolated vesicles suppressed secretion of inflammatory mediators by pathogenic vesicles such as E. coli-derived vesicles. Upon oral administration, the vesicles were distributed in the brain tissue. Vesicles derived from bacteria of the genus Sphingomonas are envisioned for use in methods of diagnosis, as well as compositions and methods for treating, hepatic cirrhosis, liver cancer, myocardial infarction, renal insufficiency, diabetes, brain tumors, mild cognitive impairment, dementia, depression, autism, and atopic dermatitis. These vesicles are also useful as drug carriers for drug delivery to the brain.
US11944648B2	Bispecific OR-gate chimeric antigen receptor responsive to CD19 and CD20 A CD19-OR-CD20 chimeric antigen receptor (CAR) protein construct is provided. Also provided are nucleic acids encoding the CD19-OR-CD20 CAR; and methods of use, e.g. in the treatment of B cell malignancies. The CD19-OR-CD20 CAR of the invention is a bispecific CAR that can trigger T-cell activation upon detection of either CD19 or CD20 (or both). It is a single molecule that confers two-input recognition capability upon human T cells engineered to stably express this CAR.
US11944647B2	Articles of manufacture and methods for treatment using adoptive cell therapy Provided are adoptive cell therapy methods involving the administration of doses of cells for treating disease and conditions, including certain B cell malignancies. The cells generally express recombinant receptors such as chimeric antigen receptors (CARs). In some embodiments, the methods are for treating subjects with non-Hodgkin lymphoma (NHL). In some embodiments, the methods are for treating subjects with relapsed or refractory NHL. Also provided are articles of manufacture and prophylactic treatments in connection with adoptive therapy methods.
US11944646B2	Method for treating type I diabetes with peptide-loaded dendritic cells The present invention provides a composition comprising dendritic cells loaded with hHsp60sp, which dendritic cells are from a subject and have been fixed with paraformaldehyde (PFA). The subject may suffer from an autoimmune disease. Also provided are a method for preparing the composition; recombinant human cells comprising a heterologous gene encoding a fusion protein of HLA-E and hHsp60sp or B7sp, and expressing the fusion protein on the surface of the cells; a method for determining a percentage of maximum inhibition of testing the function of the HLA-E restricted CD8+ Treg cells from a subject, determining whether HLA-E restricted CD8+ Treg cells freshly isolated from a subject are defective, or determining whether defective HLA-E restricted CD8+ Treg cells from a subject are correctable; and a method for correcting defective HLA-E restricted CD8+ Treg cells, treating type 1 diabetes (T1D), or treating multiple sclerosis (MS).
US11944645B2	Modified cell and use thereof in gene and cell therapy The present disclosure describes compositions and methods for treating cancer. Embodiments relate to a cell modified to express one or more molecules at a level that is higher or lower than the level of the one or more molecules expressed by a cell that has not been modified to express the one or more molecules, wherein the one or more molecules comprise Cavin3, ZBED2, and MYC.
US11944639B2	Preventive and curative peroxometallate based composition, notably pharmaceutical composition The invention concerns a mixture or a composition, that is preferably therapeutically active by topical administration, comprising: —at least one metal salt, the metal being chosen from molybdenum (Mo), tungsten (V), vanadium (V), gold (Au), a lanthanide, in particular lanthanum; —at least one chelating agent; —at least one source of peroxidative radicals; —at least one buffer agent; and pharmaceutical compositions constituted by or comprising said mixture, the methods for producing same and applications thereof, in particular in a method for the therapeutic treatment of a viral infection, and in particular involving a virus of the Herpesviridae family; or as an anti-inflammatory.
US11944637B2	Biomaterials comprising hyaluronic acid binding peptides and extracellular matrix binding peptides for hyaluronic acid retention and tissue engineering applications The present invention provides novel biomaterial compositions and methods having a technology to improve retention of hyaluronic acid (HA). The biomaterial compositions utilize small HA binding peptides and extracellular matrix binding (ECM) peptides that are tethered to synthetic biocompatible polymers. When tethered to the polymers, the peptide region allows the polymers to bind to HA and to tissues such as cartilage. The novel biomaterial compositions can be used to coat or chemically modify cartilage or tissues with a biologically compatible polymer having HA binding peptides, which allow HA to bind to the surface of the cartilage or tissues. Methods of using same are also provided.
US11944636B2	Medicinal composition comprising a non-coding RNA molecule and an antibody targeting a tumor antigen This invention discloses a medicinal composition includes a non-coding RNA molecule and an antibody targeting a tumor antigen for preventing and/or treating cancer. This invention uses the synergistic combination of a non-coding RNA molecule or its functional variant or homologue, and an antibody targeting a tumor antigen to prevent and/or treat cancer, thereby providing a novel and effective method in preventing and/or treating various cancers.
US11944635B1	Compositions and methods for treating epilepsy Disclosed herein are compositions and methods for delivering compositions to a subject in need of treatment for epilepsy. The disclosed compositions are orally delivered. Further disclosed are kits comprising the disclosed compositions as part of a method of delivering cannabidiol and CBD-containing compositions to subjects in need of treatment for epilepsy.
US11944633B2	Oral formulations of fasudil with ion exchange resin An oral pharmaceutical composition is provided that can comprise a rho kinase inhibitor, for example, fasudil, a pharmaceutically acceptable salt thereof, a hydrate thereof, a prodrug thereof, a substituted derivative thereof, or a metabolite thereof, or any combination thereof, the rho kinase inhibitor having a bitter taste; and an ion exchange resin. The ion exchange resin can partially or fully mask the bitter taste of the rho kinase inhibitor, making the composition more palatable. The composition can comprise a solid dosage form, and/or a liquid dosage form. The solid dosage form can comprise a powder, granules, a tablet, or a capsule, or any combination thereof. The composition can be present, for example, in a unit dose, in an amount sufficient to treat a neurodegenerative disease. A method of treating the neurodegenerative disease with the oral pharmaceutical composition is provided. The method can ameliorate a symptom of a neurodegenerative disease.
US11944629B2	Concentrated methotrexate solutions Concentrated methotrexate solutions are described which are suitable for the use of an active substance in the production of a parenterally administered medicament for the treatment of inflammatory autoimmune diseases. The methotrexate is added to a pharmaceutically acceptable solvent at a concentration of more than 25 mg/ml.
US11944623B2	Modulators of Kv3 channels to treat pain The present invention provides a modulator of Kv3.1 and/or Kv3.2 and/or Kv3.3 channels for use in the prophylaxis or treatment of pain. Modulators for use in the prophylaxis or treatment of pain include compounds of formula (I) or a pharmaceutically acceptable salt and/or solvate thereof and/or derivative thereof:
US11944606B2	Azaindoles as inhibitors of HPK1 Azaindole compounds and their use as inhibitors of HPK1 are described. The compounds are useful in treating HPK1-dependent disorders and enhancing an immune response. Also described are methods of inhibiting HPK1, methods of treating HPK1-dependent disorders, methods for enhancing an immune response, and methods for preparing the azaindole compounds.
US11944604B1	Nanoformulation of spriooxindole and methods for treating hepatocellular carcinoma A spirooxindole nanoformulation includes a proniosome loaded with a spirooxindole derivative. In an embodiment, the spirooxindole derivative comprises (Compound 4d)
US11944602B2	Treatment of autoimmune disease in a patient receiving additionally a beta-blocker The present invention relates to methods of treating autoimmune diseases with siponimod in patients receiving additionally a beta-blocker.
US11944600B2	Use of cannabinoids in the treatment of a neurodegenerative disease or disorder The present invention relates to the use of cannabinoids in the treatment of a neurodegenerative disease or disorder. In particular the cannabinoids cannabidiolic acid (CBDA) and cannabidivarin (CBDV) were able to produce neuroprotective effects in a mouse model of neurodegenerative disease. In particular these effects were associated with the symptoms associated with amyotrophic lateral sclerosis (ALS). Furthermore, the combination of the cannabinoid tetrahydrocannabinol (THC) with the drug olexisome provided a synergistic disease modifying effect in a mouse model of neurodegenerative disease. In particular these effects were associated with the symptoms associated with ALS.
US11944599B2	Method of extracting myricetin from Xanthoceras sorbifolia Bunge A method of extracting myricetin from Xanthoceras sorbifolia Bunge is provided. The method includes: step 1, baking obtaining Xanthoceras sorbifolia Bunge crude powder; step 2, mixing the crude powder with a counter-current extraction solution to perform a counter-current extraction to obtain a filtrate and a filter residue; step 3, mixing the filter residue with a solvent to obtain a first mixture, and heating the first mixture to reflux for extraction to obtain an extraction liquid; step 4, mixing the extraction liquid and the filtrate, and concentrating under reduced pressure to obtain a concentrated solution; and step 5, separating and eluting the concentrated solution to obtain an eluent, then drying the eluent to obtain the myricetin.
US11944595B2	Treatment or prevention of cardiovascular events via the administration of a colchicine derivative A method for reducing a composite endpoint risk of myocardial infarction (MI), stroke, coronary revascularization, unstable angina requiring hospitalization, cardiac arrest, and cardiovascular death in a subject including administering, orally once per day to the subject, a composition comprising about 0.5 total mg of (i) colchicine, (ii) a pharmaceutically acceptable salt of (i), or any combination of (i) and (ii), wherein the patient has at least one history of diabetes, a past myocardial infarction, an unstable angina, a coronary bypass surgery, and a coronary angioplasty; wherein the patient is also administered a daily dose of statin therapy; and wherein the composite endpoint risk in the subject is reduced relative to a dosing regimen where the patient receives standard secondary prevention therapy of a statin.
US11944594B2	Treatment or prevention of cardiovascular events via the administration of a colchicine derivative A method for reducing a risk of at least one cardiovascular event in a subject in need thereof, which includes administering, orally once per day to the subject, a composition comprising about 0.5 total mg of (i) colchicine, (ii) a pharmaceutically acceptable salt of (i), or any combination of (i) and (ii), wherein the at least one cardiovascular event is chosen from myocardial infarction (MI), stroke, coronary revascularization, unstable angina requiring hospitalization, cardiac arrest, and cardiovascular death; wherein the subject has no contra-indications to colchicine therapy, and has at least one risk factor; and vii. therapy with at least one drug chosen from aspirin, clopidogrel, statins, beta blockers, calcium blockers, and ACE inhibitors; and wherein the composition reduces the risk of the subject experiencing the at least one cardiovascular event by a greater percentage than a composition that does not include colchicine or the pharmaceutically acceptable salt thereof.
US11944589B1	Nasogastric tube securing device A nasogastric tube securing device is an apparatus designed to hold various medical tubes that enter through a person's nose without the use of adhesive tape. A first configuration of the device will attach to an upper lip area of a patient allowing the tube to enter upward into the nasal cavity. A second configuration will attach to the distal end of a nose with a downward facing clip that also holds the tube as it enters the nasal cavity. In both configurations, the clip system used utilizes a plastic sliding track that holds the tube and allows it to slide back and forth, either across the upper lip or side to side along the user patient's nose. The tube clip on the track permits one tube to be exchanged for another one without removing the adhesive, thus eliminating repeating trauma to the skin area. Both clip systems are held in place with Allevyn® Adhesive, Mepilex® silicone foam dressing, or similar product to further reduce skin irritation.
US11944588B2	Devices and systems for delivery of combination therapies In one aspect, the subject invention is directed to a method of preparing a combinatorial drug delivery device based on a predetermined selection of drug components. The method includes: preparing a plurality of containers, each accommodating one of the selected drug components; coupling the containers to a common outlet so that the drug components may be extracted from the containers and dispensed through the common outlet; and, applying negative pressure to extract the drug components from the containers and urge the drug components towards the common outlet.
US11944583B2	Rotatable and retractable beauty instrument based on signal synchronization A rotatable and retractable beauty instrument based on signal synchronization includes a main body. A back cover and a positioning head cover are respectively provided at rear and front sides of the main body. A synchronous rotating disk, a rise-fall retractable body and an active rubber body are sequentially arranged between the main body and the positioning head cover. A control main board is arranged between the main body and the back cover, and a direct-current speed-reducing motor is arranged on the control main board. A synchronous transmission circuit board is arranged on one surface of the synchronous rotating disk, and the rise-fall retractable body and multiple springs are arranged at a top of the other surface of the synchronous rotating disk. Based on the combination of the rise-fall retractable body and the synchronous rotating disk, the automatic extension and retraction is achieved.
US11944581B2	Systems and methods for bilateral wireless communication Systems and methods for communicating between multiple lower limb exoskeletons are provided. A first exoskeleton boot can receive, responsive to transmitting a first packet, a second packet from a second exoskeleton boot through a wireless connection between the first exoskeleton boot and the second exoskeleton boot. The first exoskeleton boot can determine a latency for communication between the first exoskeleton boot and the second exoskeleton boot based on a time difference between transmission of the first packet and receipt of the second packet and update, responsive to the comparison, a model indicating data weighted based on the latency for controlling the first exoskeleton boot and the second exoskeleton boot. The first exoskeleton boot can generate, using data from the model, a command to cause an electric motor of the first exoskeleton boot to generate torque to aid a limb of a user in performing a movement.
US11944580B2	Wearable walking assist robot and method for controlling the same A wearable walking assist robot is provided that ensures high walking assistance performance without a complex calculation process by detecting a gait phase based on pressure distribution on feet and performing a corresponding control mode that is set in advance. The wearable walking assist robot includes a sensor unit that senses pressure on the soles of the feet of a wearer and a controller that determines gait phases of both a first leg to be operated and a second leg based on the sensed pressure. Additionally, the controller selects one of a plurality of control modes set in advance based on the determined gait phases and operates a joint-driving unit for the first leg to be operated.
US11944572B2	Phacoemulsification tip A phacoemulsification tip, including an aspiration tube presenting a cutting tip at a distal end. The aspiration tube has a tube wall presenting an internal face and an external face. The internal face supports at least one internally extending internal ridge. The at least one internal ridge presents an internal distal face, an internal proximal face and an internal apex. The internal distal face meets the internal face at an acute angle measured internally. The at least one internal ridge is structured to engage lens fragments separated from a crystalline lens to enhance proximal movement of the lens fragments and to inhibit distal movement of the lens fragments through the aspiration tube.
US11944571B2	Treatment apparatus with an optical coherence tomography device, and method for correcting an OCT cross-sectional image The invention relates to a treatment apparatus having a modular intraocular lens, which comprises a first part having a haptic and a marking, visible in optical coherence tomography, with known dimensions of said marking and a second part having an optics body and which has a convergence state, in which the second part is in contact with the first part, and a spaced-apart state, in which the second part is spaced apart from the first part, having an optical coherence tomography device, which is configured to record, by means of optical coherence tomography, an OCT cross-sectional image which shows the first part arranged in a capsular bag of an eye and which shows dimensions of the marking in the OCT cross-sectional image, and having an evaluation unit which is configured to create a corrected OCT cross-sectional image by transforming coordinates of the OCT cross-sectional image in such a way that dimensions of the marking in the corrected OCT cross-sectional image are closer to the known dimensions of the marking than the dimensions of the marking in the OCT cross-sectional image.
US11944565B2	Finger splint for PIP immobilization A splint immobilizes a proximal interphalangeal (PIP) joint of a finger while allowing a distal interphalangeal (DIP) joint to be flexed. The splint may include a splint body and straps configured to secure the splint body to the finger. The splint body may have a size to fit the finger, a shape to generally conform to and partially surround the finger from the palmar side, and a length to extend from a proximal phalanx of the finger across the PIP joint to a middle phalanx of the finger without extending across the DIP joint. The splint body may have an integrally-formed periphery defining a central opening. The periphery may include a first base at the proximal phalanx, a second base at the middle phalanx, and opposing sides extending between the first and second bases.
US11944561B2	Toe walking prevention article A toe walking prevention article includes a first component being a soft material or a flexible material having a length in a length direction at least extending from a middle of a foot of a wearer to toes of the foot. The first component has at least one securing feature configured to be secured to the foot. A rigid component being a stiff material is securely attached to the first component configured for placement underneath the ball. When the wearer toe walks so that the heel is off a ground, the rigid component pushes on a sensory nerve located at the ball of the foot which causes an uncomfortable sensation to the wearer. Responsive to the uncomfortable sensation, the wearer moves the heel of the foot onto the ground.
US11944556B2	Stent graft device with anchoring members having adjustable geometries A stent graft device that includes a frame, a cover material covering the frame, and an anchoring member having an adjustable geometry is provided. The anchoring member may be incorporated as part of the frame or coupled thereto. The anchoring member may be formed of a material having a tensile strength such that it can be bent, straightened, or otherwise changed in shape. Tissue growth over and/or around the anchoring member anchors the stent graft device within a lumen. During removal of the stent graft device, the geometry of the anchoring member changes to allow the anchoring member to be removed from the tissue growth along a removal path with minimal trauma. The design and/or shape of the anchoring member is not particularly limited so long as the anchoring member has an adjustable geometry that permits tissue overgrowth and subsequent removal from the tissue overgrowth with minimal trauma.
US11944553B2	Expanding spinal fusion cage Disclosed herein are expanding spinal fusion cage embodiments including an expandable cage assembly configured to expand from a collapsed state to an expanded state in an intervertebral space when inflated with a material. The assembly can include an inflatable section defining an interior volume configured to receive the material and expand the interior volume in response to a pressure from the received material to cause the expandable cage assembly to transition from the collapsed state to the expanded state, and a stabilization section configured to restrain the inflatable section during inflation.
US11944552B2	Stand-alone interbody fusion Improved fixation or stabilization of implants is achieved via one or more deployable spikes or anchors. The deployable spikes or anchors may be present in the implant in a nested, collapsed, or retracted position while the implant is inserted into the human body, and may then be deployed (e.g., into adjacent bone) after the implant is in place, thereby fixing the implant's location against unwanted movement. Such fixation or stabilization of the implant may reduce patients' pain, may improve overall short-term and long-term stability of the implant, and may improve osteo-integration into the implant.
US11944548B2	Minimally invasive surgical systems for fusion of the sacroiliac joint A sacroiliac fusion stabilizer (SIFS) for fusing a first bone fracture fragment to a second bone fracture fragment is provided. In one embodiment, the SIFS has a lazy-S shape with a series of protrusions at the ends of the SIFS. In another embodiment, the SIFS has two overlapping lazy-S shapes.
US11944545B2	Implant introducer A tool configured to deliver a radially compressible hydrogel implant at a surgical site includes an introducer tube, a plunger provided inside the introducer tube and configured to travel from the proximal end of the introducer tube toward the distal end of the introducer tube urging the hydrogel implant through a sloped portion of the introducer tube radially compressing the implant before exiting through the distal end of the introducer tube, a handle connected to the introducer tube, and a clamp hingeably connected to the handle.
US11944544B2	Expandable augment system for acetabular cup An expandable augment system is provided for use with an acetabular cup. The expandable augment system can include an expandable augment module that is adjustable in size and that can be adjusted incrementally between a fully collapsed state and an expanded state. A first portion of the expandable augment module is attachable to an outer surface of an acetabular cup and a second portion of the expandable augment module is attachable to bone or to a fixed augment module (e.g., a fixed angle augment module) that is attached to bone and interposed between the adjustable augment module and bone.
US11944543B2	Magnetic joint implant The application is directed to devices and methods where one or more magnetic or magnetizable implants provides therapeutic benefits to a patient. The implant may be useful for expanding the range of motion of joints or dynamically providing different responses to changing conditions in the body where the implant is placed. An electromagnet is placed on or in a bone on one side of a joint, and another electromagnet or magnetically active material is placed on or in a bone on the opposing side of the joint. The electromagnet may be continuously energized to relieve pressure in the joint space, or may be energized in response to forces applied to the joint.
US11944542B2	Inflatable penile prosthesis cylinders An implantable inflatable penile prosthesis cylinder includes an outer tube member having a longitudinal axis, an inner tube member contained within the outer tube member, and one or more tensile support members within the inner tube member. The inner tube member includes at least one inflatable chamber section, at least a portion of which is defined by a wall of the inner tube member. The one or more tensile support members extend between interior surfaces of the wall and are placed in tension when the at least one chamber section is in an inflated state.
US11944535B2	Intraocular lenses having zone-by-zone step height control A method and system provide an ophthalmic device. The ophthalmic device includes an ophthalmic lens having anterior surface, a posterior surface and at least one diffractive structure including a plurality of zones. The at least one diffractive structure is for at least one of the anterior surface and the posterior surface. Each zone includes at least one echelette having a least one step height. The step height(s) are individually optimized for each zone. To compensate chromatic aberration of eye from distance to a range of vision, a greater than 2π phase step height may be employed and the step height(s) folded by a phase, which is an integer multiple of two multiplied by π. Hence chromatic aberration of eye may be compensated to improve vision from distance to near.
US11944533B2	Implantable prostheses for tissue expansion A method of manufacturing a tissue expander for implanting into a body of a living subject can include mixing granules of a solute with an elastomer. The method can further include forming a matrix with the elastomer. The granules can be embedded within the elastomer. The elastomer can define boundaries of a plurality of chambers within the matrix. The method can further include curing the elastomer, such that the boundaries of the matrix are permeable to water at a temperature between a desired temperature range.
US11944532B2	Engineered tendon graft for rotator cuff repair The present disclosure relates to tissue engineering, and more particularly to a method for treating or repairing rotator cuff or other tendon tears or damage using scaffold-free, 3-dimensional engineered tendon constructs.
US11944531B2	Devices, systems, and methods for repairing soft tissue and attaching soft tissue to bone Devices, systems and/or methods for repairing soft tissue adjacent a soft tissue repair site. In one embodiment, a repair device configured to couple to soft tissue is provided. The repair device includes a capture portion and an anchor portion. The capture portion configured to extend with radial portions. The anchor portion includes a base with multiple legs extending therefrom. The multiple legs are configured to move from a linear position to a formed position such that, in the formed position, the multiple legs couple to structure of the capture portion.
US11944529B2	Corneal graft assembly transport devices for improved surgical operations Assemblies for storing, handling, transporting, viewing, evaluating, and/or shipping corneal tissue are provided. The completed fitted assembly supports and allows for transporting a graft or implant with an assembly that comprises; a vial that is either cylindrical or rectangular cuboid and lid that includes a poly-cone insert, a support base so that the vial is able to stand upright and remain motionless, support columns integrated seamlessly within the vial with apertures that provide for full fluid communication and notches for positioning and support of an assembled corneal tissue carrier that is suited to accommodate compressive force generated between said lid and said notches, in addition to being able to accommodate a tissue carrier assembly via compression forces between said lid and a bottom surface of said vial, and a rectangular cuboid shape that also includes a flat transparent surface that provides inspection of corneal tissue visually or via instrumentation.
US11944527B2	Readjustable midurethral sling An adjustable midurethral sling is provided. The adjustable midurethral sling includes a midurethral sling, a frame, an adjustment suture, a housing, two end parts, tunnel opening hooks, outlets, and tunnel opening hook insertion holes. The adjustable midurethral sling is used in a surgical treatment of an involuntary leakage, wherein the involuntary leakage is defined as a urinary incontinence in cases of an abdominal pressure increase as a result of coughing, sneezing etc.
US11944522B2	Absorbent article with ear portion An absorbent article includes a first waist region, a second waist region and a crotch region disposed between the first and second waist regions. The absorbent article further includes a topsheet, a backsheet, an absorbent core disposed between the topsheet and the backsheet, and a laminate. The laminate has an elasticized region. The laminate includes a first nonwoven, a second nonwoven and an elastomeric material sandwiched between said first and second nonwovens in the elasticized region. The laminate includes a bonding region with a bond density of at least 4% and at least partially overlapping the elastomeric material. The laminate exhibits an Unload Force at 50% of at least 0.90 N.
US11944517B2	Hearing protection device having dosimeter with alerting function A system including an acoustic barrier suitable for wearing in or on an ear of an individual mammalian subject, and a processor. The acoustic barrier defines at least one sound path therethrough and includes a microphone for measuring sound pressure inside the acoustic barrier. The processor is arranged to receive measurements from the microphone and determine a risk that a sound dose limit will be reached before a predetermined time associated with the dose limit. The system is arranged to provide an indication of the determined risk.
US11944516B2	Three-dimensional stabilization thread form for dental implants An implant for insertion within a maxillofacial bone of a patient including a tapered body and one or more threads formed along the body. The one or more threads on one or more lead threads include multiple thread forms including both three-dimensional stabilization thread and standard thread (e.g. v-thread, buttress thread, etc.) forms. The one or more threads including the multiple thread forms provides for maximizing the restriction of lateral movement of the implant within a full or partial osteotomy.
US11944515B2	Orthodontic devices In some embodiments, apparatuses and methods are provided herein useful to orthodontic appliances. In some embodiments, an orthodontic appliance comprises a main body portion including a first end and a second end, wherein the first end is opposite the second end, the main body portion comprising a first orthodontic device, wherein the first orthodontic device is configured to be bonded to a first tooth of a patient's mouth, and wherein the first orthodontic device is located to proximal the first end, and an eyelet, wherein the eyelet is located proximal to the second end, and a second orthodontic device, wherein the second orthodontic device is configured to be bonded to a second tooth of the patient's mouth, wherein the second orthodontic device includes a protrusion, and wherein the protrusion is located within the eyelet during use in the patient's mouth.
US11944514B2	Methods for fabricating dental appliances with integrally formed components Systems, methods, and devices for improved orthodontic treatment of a patient's teeth are provided herein. In some embodiments, a method includes determining an appliance geometry for a dental appliance. The appliance geometry can include a first region representing a shell comprising a plurality of teeth receiving cavities, and a second region representing at least one integrally formed component to be integrally joined to the shell. The method can also include generating instructions including a first digital representation of the shell based on the first region, and a second digital representation of the at least one integrally formed component based on the second region. The method can further include transmitting the instructions to a fabrication system configured to additively manufacture the dental appliance by fabricating the shell based on the first digital representation, concurrently with fabricating the at least one integrally formed component based on the second digital representation.
US11944512B2	Dental isolation system A dental isolation system includes a dental tool that has a handle portion at a proximal end, a tip portion at an opposite, distal end, and a body portion extending between the handle portion and the tip portion. The handle portion has handles and finger apertures so that a dentist can manipulate the distal end. The tip portion is inserted into an O-ring of a dental dam and, when actuated by a dentist, the tip portion forms a quadrant, allowing the stretched O-ring to easily fit over a tooth.
US11944510B2	Robotic surgical systems and robotic arm carts thereof A surgical cart for supporting a robotic arm includes a vertically-extending support column, a carriage movably coupled to the support column and configured to carry a robotic arm, and a braking mechanism.
US11944509B2	Surgical implant for marking soft tissue An implantable tissue marker device is provided to be placed in a soft tissue site through a surgical incision. The device can include a bioabsorbable body in the form of a spiral and defining a spheroid shape for the device, the spiral having a longitudinal axis, and turns of the spiral being spaced apart from each other in a direction along the longitudinal axis. A plurality of markers can be disposed on the body, the markers being visualizable by a radiographic imaging device. The turns of the spiral are sufficiently spaced apart to form gaps that allow soft tissue to infiltrate between the turns and to allow flexibility in the device along the longitudinal axis in the manner of a spring.
US11944505B2	Medical devices with sensing characteristics for intravascular treatment sites and methods thereof The present disclosure relates to medical devices including occlusion devices, clot retrieval systems, and stents. More particularly, the medical devices described herein measure characteristics for intravascular treatment sites. The medical devices may include pressure sensors and/or length sensors that may be used to determine the effectiveness of the medical devices during or after treatment. These sensors may be particularly helpful when used on an occlusion device or a clot removal device.
US11944503B2	Systems and methods for preventing tissue migration in surgical staplers A surgical instrument including a system for stopping a beam of the surgical instrument from impacting a distal pin when reversing a knife is disclosed. A knife assembly of the surgical instrument comprises the knife, the beam, and a firing nut. A firing lead screw can drive the firing nut distally and proximally. A firing screw compression spring extends along the firing lead screw and applies a load proximally on the firing nut when the firing nut is driven toward a distal end of the firing lead screw.
US11944497B2	Ultrasonic blood flow imaging display method and ultrasonic imaging system An ultrasonic blood flow imaging display method and an ultrasonic imaging system. The system comprises: a probe (1); a transmitting circuit (2), configured to excite the probe (1) to transmit an ultrasonic beam to a scanning target; a receiving circuit (4) and a beam forming module (5), configured to receive an echo of the ultrasonic beam to obtain an ultrasonic echo signal; a data processing module (9), configured to obtain, according to the ultrasonic echo signal, blood flow velocity vector information and Doppler blood flow velocity information about a target point in the scanning target and at least part of ultrasonic images of the scanning target, and superposing the ultrasonic images and the Doppler blood flow velocity information to form a Doppler color blood flow graph; and a display (8), configured to contrastively display the blood flow velocity vector information and the Doppler color blood flow graph. By means of a mode of contrastively displaying a common blood flow display image and a vector blood flow, a better viewing angle is provided for a user.
US11944494B2	Ultrasonic probe According to the present invention, a transducer part is mechanically scanned in a chamber for a medium. A pair of diaphragms are provided to the two sides of the transducer part (one side and the other side in the mechanical scanning direction). Each of the diaphragms has a hollow membrane and a base. The hollow membrane has a pair of longitudinal lateral surfaces extending in a longitudinal direction parallel to the center axis of rotation. An attachment hole is formed in a partition wall, and a projecting part provided on the base is inserted into the attachment hole.
US11944492B2	Ultrasonic sensor array, guide wire, guide wire system, and catheter A medical ultrasonic sensor array includes a plurality of ultrasonic sensors having a plurality of first electrode plates, a plurality of piezoelectric elements, and a second electrode plate. Each of the ultrasonic sensors has a first electrode plate and a piezoelectric element sandwiched between the second electrode plate and the first electrode plate. Each first electrode plate of each ultrasonic sensor is separated from each other first electrode plate of each other ultrasonic sensor. The second electrode plate is a single body electrode plate shared by the plurality of the ultrasonic sensors. The second electrode plate includes a plurality of cavities, each cavity being formed in a surface of the second electrode plate at which the piezoelectric elements connect to the second electrode plate at a position between connection regions connecting a respective pair of the piezoelectric elements to the second electrode plate.
US11944490B2	Neuromodulation energy application techniques Techniques for accurate positioning of an energy application device for neuromodulation treatment protocols are provided. A neuromodulation positioning patch is applied to a patient's skin. The energy application device is coupled to a frame of the neuromodulation positioning patch to position a transducer of the energy application device within an opening at a treatment position within the opening. The frame is also coupled to a removable dock for an imaging probe. When the frame is coupled to the removable dock the frame of the neuromodulation positioning patch, acquires image data through the opening to identify or verify the treatment position.
US11944487B2	Simultaneous sensor tracking in medical interventions A controller (120) for simultaneously tracking multiple sensors in a medical intervention includes a circuit (121-181) that causes the controller (120) to execute a process. The process executed by the circuit (121-181) includes receiving first and second signals respectively from a first and a second passive ultrasound sensor (S2) used in the medical intervention. The first and second signals respectively include first and second sensor information indicative of respective locations of the first and the second passive ultrasound sensor (S2). The process executed by the circuit (121-181) also includes combining (120) the first signal and the second signal for transmission over only one channel, and providing the first signal and the second signal over the only one channel to a system (190) that determines the location of the first passive ultrasound sensor (S1) and the location of the second passive ultrasound sensor (S2) and that has only the one channel to receive the first signal and the second signal.
US11944484B2	Material decomposition calibration method and apparatus for a full size photon counting CT system A method and a system for providing calibration for a photon counting CT detector forward model for material decomposition. Various slabs of predetermined material and path lengths are placed in the photon counting CT detector and scanned using one or more stationary X-rays to obtain calibration data and parametrize the forward model.
US11944483B2	Radiation detector with automatic exposure control and a method of automatic exposure control Disclosed herein is a method comprising: determining doses of radiation received by a first set of pixels of a radiation detector; determining that the doses satisfy a criterion; adjusting exposure of the radiation detector to the radiation in response to the doses satisfying the criterion; and forming an image based on radiation received by a second set of pixels of the radiation detector.
US11944481B1	Method and apparatus for predicting an image analysis tool based on user behavior This patent provides a method and apparatus to improve image analysis for a user viewing an image comprising multiple structures on a display. An eye tracking system is set up for a user viewing the image on a display, such as using an eye facing camera. An analysis of the eye tracking data and a structure that is being viewed is performed. An image analysis tool, such as an image manipulation tool, an image measurement tool or an image annotation tool, is predicted from a group of image analysis tools and is presented to the user. The user can then use the predicted tool as the user sees fit, such as executing the capabilities of the tool via a mouse.
US11944477B2	Diagnostic device for companion animal An apparatus for diagnosing a companion animal with radiation is provided. The apparatus includes a radiation irradiation unit configured to generate the radiation and irradiate the radiation toward a diagnosis object; a detector disposed to face the radiation irradiation unit and configured to detect the radiation irradiated from the radiation irradiation unit; a driving unit configured to adjust positions of the radiation irradiation unit and the detector; and a communication unit configured to communicate with an external device in a wireless manner. The driving unit adjusts the positions of the radiation irradiation unit and the detector such that the diagnosis object is located between the radiation irradiation unit and the detector, and the radiation irradiation unit irradiates the radiation toward the diagnosis object when the diagnosis object is located between the radiation irradiation unit and the detector.
US11944475B2	System and method for mobile radiography deployment A mobile radiography system includes sensors to detect a tilt angle and or pitch angle of the system to prevent deployment of the extendable boom and/or column and/or prevent activation of a motor drive if the tilt angle or pitch angle exceeds a pre-set boundary.
US11944467B2	Distributed healthcare communication system A graphical audio station of a nurse call system is operable to permit a user to perform one or more of the following functions: establish a two-way voice communication link with another computer device in another patient and/or with a another computer device located in another staff work area and/or with a wireless communication device carried by caregiver and/or with a telephone of the healthcare facility; broadcast a voice page to a group of other selected computer devices; compose and send a text message to a portable device that is carried by a caregiver and that has wireless communication capability; browse web pages and/or view multimedia content, such as videos, hosted on servers of the healthcare facility and/or that are accessible via the Internet; view and/or acknowledge and/or answer and/or cancel alerts or nurse calls originating in a plurality of patient rooms.
US11944463B2	Pseudo-CT generation from MR data using a feature regression model Systems and methods are provided for generating a pseudo-CT prediction model that can be used to generate pseudo-CT images. An exemplary system may include a processor configured to retrieve training data including at least one MR image and at least one CT image for each of a plurality of training subjects. For each training subject, the processor may extract a plurality of features from each image point of the at least one MR image, create a feature vector for each image point based on the extracted features, and extract a CT value from each image point of the at least one CT image. The processor may also generate the pseudo-CT prediction model based on the feature vectors and the CT values of the plurality of training subjects.
US11944460B2	Method and apparatus for determining sharpness of pulse wave signal A method for determining a sharpness index of a pulse wave signal includes receiving a pulse wave signal; determining a first reference line starting point and a second reference line starting point on the basis of a curvature of the pulse wave signal; determining a first reference line connecting the first reference line starting point and a first reference line ending point by determining the first reference line ending point by applying an intersecting tangent method to the first reference line starting point, and determining a second reference line connecting the second reference line starting point and a second reference line ending point by determining the second reference line ending point by applying the intersecting tangent method to the second reference line starting point; and determining a sharpness index by using a peak point of the pulse wave signal, the first reference line, and the second reference line.
US11944458B2	Breast securement devices Breast securement devices for imaging systems are provided. The securement device can include a breast tray configured to support a patient's breast. In one example, one or more walls extend from the breast tray to receive the patient's breast. In another example, a pair of arms pivotably extend at least partially over the breast tray to receive the patient's breast therebetween. In still another example, a membrane covers the breast tray and the patient's breast and selectively couples to the breast tray via a suction force. In yet another example, a paddle includes a plurality of flexible fingers that contour to the patient's breast, or includes an array of pins that independently slide within of the paddle and contour to the patient's breast, or includes a bladder having non-Newtonian fluid. Additionally or alternatively, a sling may receive the patient's breast and support the breast from below.
US11944455B2	Systems and methods for performing an electrocardiogram A system and method for performing an electrocardiogram is described herein. The system may include one or more of an electrode strip, a data recorder, a connector, one or more computing platforms, and/or other components. The electrode strip may include multiple electrodes configured to provide signals conveying information associated with electrocardiograms. The multiple electrodes may be integrated into the electrode strip. The data recorder may be configured to receive and record information associated with electrocardiograms. Information associated with electrocardiograms may be communicated from the electrode strip to the data recorder via a connector. The connector may include a cableless connector. In some implementations, the information associated with electrocardiograms may be transmitted to one or more computing platforms.
US11944449B2	Methods and kits for assessing neurological function and localizing neurological lesions A method for assessing neurological function in a subject includes a) prompting a user to follow a moving saccade-evoking stimulus on a display, b) tracking eye movement of the subject while the user follows the moving stimulus, c) collecting a first eye conjugacy data of the subject relating to the saccade-evoking stimulus, and d) comparing the first eye conjugacy data with a second eye conjugacy data, the second eye conjugacy data relating to an anti-saccade stimulus.
US11944447B2	Neurovascular coupling analytical method based on electroencephalogram and functional near-infrared spectroscopy A neurovascular coupling analytical method based on an electroencephalogram and functional near-infrared spectroscopy includes: S100: acquiring an electroencephalogram signal and a brain hemodynamic signal; S110: extracting an event-related potential signal from the electroencephalogram signal; S120: extracting a time characteristic from the event-related potential signal; S130: extracting a hemodynamic response function from the brain hemodynamic signal; S140: extracting an amplitude characteristic and time characteristics from the hemodynamic response function; and S150: analyzing influence of the time characteristic of the event-related potential signal on the amplitude characteristic and the time characteristics of the hemodynamic response function to obtain a coupling result. The time characteristic of the event-related potential signal is a delay. The amplitude characteristic of the hemodynamic response function is a peak amplitude, and the time characteristics of the hemodynamic response function comprises a rising delay, a peak time, and a full width at half maximum.
US11944446B2	Apparatus, method, and system for pre-action therapy Embodiments of the present disclosure provide an apparatus, method and system for physical, pre-action, extremity and related spinal cord, brain stem and neural therapies. An apparatus according to the present disclosure can include: a computing device configured to convert an input control action into a simulation instruction, wherein the input control action is provided by an input device; at least one simulated extremity operatively connected to the computing device and configured to simulate at least one modeled human anatomical movement based on the simulation instruction, wherein the at least one modeled human anatomical movement is distinct from the input control action; and a feedback device operatively connected to the computing device and configured to transmit a sensory response, wherein the sensory response is based on the modeled human anatomical movement.
US11944445B2	Method for detecting elements of interest in electrophysiological signals and detector A method for automatically detecting elements of interest in electrophysiological signals includes: delivering electrophysiological signals; producing a whitened time-frequency representation of the electrophysiological signals; setting a threshold; applying this threshold to the whitened time-frequency representation; and, in the whitened time-frequency representation, detecting local maxima that are higher than or equal to the applied threshold.
US11944443B2	Fast recovery of ECG signal method and apparatus Fast recovery electrocardiogram (ECG) signal method and apparatus are provided. In one embodiment, an ECG apparatus includes an input for receiving a biometric cardiogram signal, such as a Wilson Central Terminal (WCT) signal, and a combiner, such as an adder, for producing a compensated signal. Processing circuitry produces an ECG reflective of the compensated signal and also outputs a signal corresponding to high frequency response of the compensated signal to compensate for low response of the biometric cardiogram signal to high frequency spikes. A resultant ECG is produced by the processing circuitry having pacing signal contribution within the biometric cardiogram signal cancelled.
US11944438B2	System for detecting female urination by using wearable device, and diagnosis method using the same The present disclosure provides a method for detecting female urination by using a wearable device. A female urination detection method according to an embodiment of the present disclosure is a method for detecting urination of a subject to be measured, who is a female, by using a measurement device mounted on the subject to be measured, the method comprising: (a) acquiring sensor data (S) generated according to movement of a sensor of the measurement device; and (b) extracting effective data (SEff) related to urination by filtering the sensor data (S) acquired in (a) by an effective data extracting module of an analysis device through a preset method.
US11944435B2	System and procedure for stabilizing, storing and recovering blood samples Blood samples are maintained in a modified atmosphere sealed environment, where moisture is reduced using a desiccant and oxygen is removed using a deoxygenation compound, thus resulting in the preservation of numerous blood analytes, for delayed (e.g., 14 days from collection) blood testing, such as for enzymatic activity, concentration of protein and measurement of other blood components in human and veterinary blood test applications.
US11944430B2	Multi-sensor diabetes management system Systems, devices, and methods for monitoring and assessing blood glucose level in a patient are discussed. An exemplary system receives physiologic information from a patient using an ambulatory medical device. The physiologic information is correlated to, and different from, a direct glucose level measurement. The system determines a glucose index indicative of an abnormal blood glucose level using the received physiologic information by the two or more physiologic sensors. The system may use the glucose index to initiate or adjust a therapy, or to trigger a glucose sensor, separate from the two or more physiologic sensors, to directly measure blood glucose concentration.
US11944424B2	Dynamic 129Xe gas exchange spectroscopy Methods and systems with 129Xe dynamic spectroscopy with a fitting function that includes one or more non-Lorentzians, optionally with a barrier Voigt, and signal processing for identifying cardiogenic oscillations for evaluating disease states, use in drug discovery or monitoring disease status.
US11944423B2	In-vivo monitoring of an internal volume of a mammal using magnetic field gradients A method for in-vivo monitoring of a target internal volume of a mammal that includes: (a) placing the target internal volume proximal to a three-dimensional magnetic field generator; (b) generating first, second, and third magnetic field gradients along respective first, second, and third axes that are mutually orthogonal; (c) measuring first, second, and third magnetic fields with a three-dimensional magnetic sensor disposed in an ingestible capsule, the ingestible capsule disposed in the target internal volume; (d) with a controller in electrical communication with the three-dimensional magnetic sensor, generating a magnetic sensor output signal that encodes a measurement of the first, second, and third magnetic fields; (e) broadcasting the magnetic sensor output signal from an antenna disposed in the ingestible capsule, and (f) receiving the magnetic sensor output signal with a receiver. The received magnetic field data can be used to determine the three-dimensional position of the ingestible capsule.
US11944418B2	Device, apparatus and method of determining skin perfusion pressure Disclosed embodiments relate to apparatuses and methods for a skin perfusion pressure determination device. In some embodiments, a skin perfusion pressure determination device can include a sensor module including a first sensor for sensing a first parameter associated with a pressure exerted on a target area by the sensor module and a second sensor for sensing a second parameter associated with an amount of blood perfusion at the target area, wherein the first sensor and the second sensor are arranged such that, when the sensor module is pressed against the target area the first sensor produces an output corresponding to the sensed first parameter and the second sensor produces an output corresponding to the sensed second parameter, a proximal end assembly configured to contact the target area, a display to provide feedback of the pressure exerted on a target area and/or the amount of blood perfusion at the target area, and a communication device for providing data transfer from the skin perfusion pressure determination device to a control unit.
US11944412B2	Blood pressure detection device A blood pressure detection device manufactured by a semiconductor process includes a substrate, a microelectromechanical element, a gas-pressure-sensing element, a driving-chip element, an encapsulation layer and a valve layer. The substrate includes inlet apertures. The microelectromechanical element and the gas-pressure-sensing element are stacked and integrally formed on the substrate. The encapsulation layer is encapsulated and positioned on the substrate. A flowing-channel space is formed above the microelectromechanical element and the gas-pressure-sensing element. The encapsulation layer includes an outlet aperture in communication with an airbag. The driving-chip element controls the microelectromechanical element, the gas-pressure-sensing element and valve units to transport gas. The gas is introduced into the flowing-channel space through the inlet apertures and transported into the airbag through the outlet aperture, to inflate the airbag for blood pressure measurement, and a detection datum of blood pressure outputted by the gas-pressure-sensing element is transmitted to the microprocessor to calculate.
US11944410B2	Diagnosis and monitoring of cardio-respiratory disorders Methods and systems estimate cardio-respiratory parameter(s), such as from in-phase and quadrature channels. The channels may represent patient chest movement and may be generated with a sensor, such as a contactless sensor that may sense movement with radio-frequency signals. In the methods/systems, the in-phase and quadrature channels may be processed, such as in a processor(s), using relative demodulation to generate cardio-respiratory parameter estimate(s). Optionally, the processing produces a jerk signal that may be filtered for producing a heart rate estimate, such as from zero-crossings of the filtered signal. Optionally, the processing produces a chest velocity signal that may be filtered for producing a respiratory rate estimate, such as from zero-crossings of the filtered signal. Optionally, a respiratory volume, such as tidal volume, may be estimated from an intrapulmonary pressure signal generated by applying a function to a chest displacement signal where the function relates intrapulmonary pressure and chest displacement.
US11944407B2	Hybrid optical system An optical system comprises a first optical path configured to supply a first light with a first range of wavelengths; a second optical path configured to supply a second light with a second range of wavelengths shorter than the first range of wavelengths; a third optical path configured to supply a third light with a third range of wavelengths shorter than the second range of wavelengths; an optical I/O unit configured to emit the first light, the second light and the third light to a target and acquire a light from the target; a reference unit configured to split off a reference light from the third light; and a detector that includes a range of detection wavelengths shared with a CARS light and an interference light.
US11944400B2	Robotic system for angioplasty and endoluminar surgery Robotic Angioplasty and Endoluminar Surgery System to separate patient and operator by remotely moving guides and catheters during operations, composed of three or more elements, of which at least one disposable (nose), available in different versions, like for independent advancements and retractions of a balloon catheter (or stent) and relative guide and to their common axial rotation, or for moving a guide with a moving core or a catheter. The nose should be inserted into a non-sterile Slave placed near the patient, covered with sterile drapes, and with a combination of toothed wheels it translates all into three rotations controlled by three independent motors, possibly measuring the torque applied by the motors. By replacing the three angular gauges to the motors, a Master is obtained, controlled by a doctor by moving non-sterile tubes.
US11944395B2	3D visualization enhancement for depth perception and collision avoidance A series of images is obtained from an endoscope. Three-dimensional reconstruction is performed on the series of images to reconstruct anatomy shown in the series of images. A graphic, such as a grid, is rendered based on the three-dimensional reconstruction, over the series of images resulting in an enhanced endoscopic video feed to be shown on a display.
US11944389B2	Impedance shift and drift detection and correction An impedance location of an electrode in an impedance based coordinate system and a magnetic location of a magnetic position sensor in a magnetic based coordinate system can be received. A transformed impedance location of the magnetic position sensor can be computed. A difference between the transformed impedance location of the magnetic position sensor and the magnetic location of the magnetic position sensor can be determined. A magnitude of the difference between the impedance location of the magnetic position sensor and the magnetic location of the magnetic position sensor can be computed. A statistical significance of the difference between the transformed impedance location of the magnetic position sensor and the magnetic location of the magnetic position sensor can be computed. A determination can be made that an impedance shift exists if the magnitude of the difference exceeds a threshold and a statistical significance of the difference exceeds a threshold.
US11944385B2	Systems and methods for medical image analysis A surgical planning and assessment system is disclosed. The system may include a computing system having a processor, a data store, a patient specific planning and analysis module, and a display. The system may be configured to access a database storing a plurality of possible surgical plans. The computing system may store a target surgical plan including a plurality of patient specific inputs including at least one preoperative medical image of a spine of a target patient and analyze the target surgical plan to determine a predicted alignment of the spine of the target patient. The computing system may develop a plurality of predictive models including a predicted alignment of the spine of the target patient based on the target surgical plan and suggest at least one alternative surgical plan with respect to the target surgical plan.
US11944384B2	Preoperative planning method for multimodal ablation treatment and apparatus thereof The present application relates to computer-based preoperative planning technology, and discloses a preoperative planning method for multimodal ablation treatment and apparatus thereof, which can automatically provide objective, scientific, and quantitative multimodal ablation planning information. In this method, acquiring parameters of an volume to be ablated; calculating property changes of the tissue caused by performing freezing on the volume according to the parameters of the volume to be ablated, and acquiring a first planning data required for the property changes of the tissue to satisfy a first predetermined condition; further calculating property changes of the tissue caused by performing heating on the volume to acquire a second planning data required for the property changes of the tissue to satisfy a second predetermined condition based on the properties satisfying the first predetermined condition; outputting the first planning data and the second planning data.
US11944382B2	Systems and methods for bulk motion compensation in phase-based functional optical coherence tomograpgy Disclosed are methods and systems correcting bulk-motion artifacts in phase-based functional OCT images. The disclosed methods and systems are based on the use of the standard deviation of the phase shift signal present in phase-based OCT imaging. When applied with functional OCT techniques such as OCT angiography, Doppler OCT, and OCT elastography, the disclosed methods provide improved image quality and decreased computational cost compared to other methods of bulk motion compensation.
US11944380B1	Systems and methods to facilitate vision screening and reporting Various implementations disclosed herein relate to systems, methods, and devices to facilitate mass vision screening of individuals. An example method includes capturing a first image of an individual and confirming an identity of the individual based on the first image. In response to confirming the identity of the individual, the method may further include capturing one or more second images of an eye of the individual; determining one or more health metrics of the individual based on the one or more second images, and transmitting, to a remote device, the identity of the individual and the one or more health metrics of the individual. The one or more health metrics may include at least one of a pupillary distance of the individual, a pupil size of the eye of the individual, a complete refraction of the eye of the individual, or an alignment indicator of the eye of the individual.
US11944379B2	Systems and methods for using machine learning to predict contact lens compatibility Systems and methods for determining a compatibility between a multi-focal contact lens and a patient seeking presbyopia vision correction include receiving, from a first device associated with a first eye-care professional (ECP), a request for selecting a contact lens for a consumer, wherein the request comprises biometric information associated with the consumer; obtaining a performance metric associated with the first ECP; determining, using the machine learning model and based on the performance metric, a customized compatibility index indicating a compatibility between a particular contact lens and the consumer for the first ECP; and presenting a report indicating the compatibility index on the first device. Additional systems, methods, and non-transitory machine-readable mediums are also provided.
US11944376B2	Transmission line with heat transfer ability The present invention relates to systems and devices for delivering energy to tissue for a wide variety of applications, including medical procedures (e.g., tissue ablation, resection, cautery, vascular thrombosis, treatment of cardiac arrhythmias and dysrhythmias, electrosurgery, tissue harvest, etc.). In particular, the present invention relates to systems and devices for the delivery of energy with heat transfer ability. In some embodiments, the systems and devices also have variable characteristic impedance as a result of the use of heat transfer materials. In certain embodiments, methods are provided for treating a tissue region (e.g., a tumor) through application of energy with the systems and devices of the present invention.
US11944373B2	Peri-vascular tissue ablation catheters An intravascular catheter for peri-vascular and/or peri-urethral tissue ablation includes multiple needles advanced through supported guide tubes which expand around a central axis to engage the interior surface of the wall of the renal artery or other vessel of a human body allowing the injection an ablative fluid for ablating tissue, and/or nerve fibers in the outer layer or deep to the outer layer of the vessel, or in prostatic tissue. The system may also include a means to limit and/or adjust the depth of penetration of the ablative fluid into and beyond the tissue of the vessel wall. The catheter may also include structures which provide radial and/or lateral support to the guide tubes so that the guide tubes expand uniformly and maintain their position against the interior surface of the vessel wall as the sharpened injection needles are advanced to penetrate into the vessel wall. A method can involve injection/infusion of the ablative fluid over an extended time period of at least 10 seconds or with two injections at two different penetration depths to reduce or eliminate patient pain during ablation.
US11944372B2	Ablation probe system with center working channel One general aspect includes a system for ablation including a catheter including a sheath defining a sheath lumen and a distal end, and an elongate electrode assembly axially moveable within the sheath lumen. The electrode assembly includes a shaft defining a central channel and a distal central channel opening. The electrode assembly also includes an expandable electrode array including two or more electrode elements positioned at the distal portion of the electrode assembly, where the electrode array is moveable between a retracted position contained within the sheath lumen and an expanded position protruding from the sheath.
US11944369B2	Forceps with linear trigger kickout mechanism A forceps includes shaft members each having a jaw member disposed at a distal end thereof and configured move the jaw members between open and closed position. A knife deployment mechanism includes a trigger moveable along a longitudinal axis to deploy a knife between retracted and extended positions between the jaw members, the knife deployment mechanism including links that cooperate to actuate the knife. A knife kickout mechanism is pivotably coupled to one link and is configured to engage a ramp disposed in a shaft member upon approximation of the shaft members, the knife kickout is configured to cooperate with the links to urge the knife back to an at rest position upon the opening of the shaft members.
US11944367B2	Electrosurgical device for cutting tissue A tool assembly for use with an electrosurgical device for cutting tissue includes a base portion, an electrical insulator extending distally from the base portion, a return lead adapted to be electrically coupled to a return terminal, and an active lead adapted to be electrically coupled to an active terminal. The return lead is movably supported on the electrical insulator. The active lead is fixed to the electrical insulator. The return lead is rotatable about a pivot and translatable along a longitudinal axis relative to the electrical insulator and the active lead. Upon activation, electrosurgical energy is transmitted from the active lead through tissue to the return lead to cut tissue in contact with the active lead.
US11944363B2	Surgical rod bending method A method for bending a surgical rod using an automated bending system includes receiving an indication of a plurality of line segments defined on the rod and an indication of an angle measurement to be formed between at least two adjacent ones of the plurality of line segments. Bending parameters to perform on the rod to form the angle measurement between the at least two adjacent ones of the plurality of line segments are determined and operation of the automated bending system is controlled using the bending parameters to create an angle having the angle measurement between the at least two adjacent ones of the plurality of line segments.
US11944357B2	Minimally invasive surgery add on screw system A system, medical devices, and methods for use in surgical procedures, such as spinal surgeries. The system, medical devices, and methods are designed to provide a surgeon the ability to add a screw connector, or screw head such as a tulip, to pre-existing implanted bone, such as pedicle, facet, lateral mass, etc., screw system without having to remove the previously implanted screws and/or rods already existing in a patient.
US11944354B2	Spinal implant system and method A spinal construct includes a coupling member including a first mating surface engageable with an existing fastener implant. The existing fastener implant defines a cavity configured for disposal of an existing spinal rod implant. A connector is engageable with the existing fastener implant and has a rod extending therefrom. A locking member is engageable with a second mating surface of the coupling member. Systems, surgical instruments, implants and methods are disclosed.
US11944353B2	Implants and instruments for enhancing vertebral alignment and sagittal balance Spinal stabilization implant assemblies, as well as systems, instruments and methods are provided for implanting and stabilizing adjacent vertebra in connection with a surgical procedure, particularly a spinal surgery. The implant assemblies and instruments enable controlled spinal rod insertion and reduction, and controlled rotation or de-rotation of adjacent spinal bones for optimized compression to achieve enhanced sagittal balance in a treated spine.
US11944349B2	Adjustable vascular closure device assembly A vascular closure device assembly, comprises a sheath comprising: a sheath main body defining a channel therethrough, a sheath engagement portion, and a sheath mounting portion located at a proximal end of the sheath main body. The assembly comprises a housing within which the sheath mounting portion is secured such that the sheath is rotatable relative to the housing, and such that the housing inhibits axial displacement of the sheath relative to the housing. The assembly also includes a dilator comprising a dilator main body, and a dilator engagement portion extending from the dilator main body towards the sheath. The dilator engagement portion is configured to engage the sheath engagement portion such that axial displacement of the dilator relative to the sheath causes the sheath to rotate relative to the housing, and wherein the housing is configured to inhibit axial displacement of the sheath during rotation.
US11944348B2	Surgical access device including an anchor having a suture retention mechanism A surgical access device includes a cannula body, an anchor, and a first suture retention mechanism. The cannula body includes a housing and an elongated portion extending distally from the housing. The elongated portion defines a longitudinal axis and a channel extending therethrough. The anchor is disposed in mechanical cooperation with the elongated portion of the cannula body and is longitudinally translatable relative to the elongated portion. The first suture retention mechanism extends laterally from the anchor. A suture-receiving channel is defined between a portion of the suture retention mechanism and a portion of the anchor.
US11944346B2	Optical trocar assembly A cannula assembly configured to receive a surgical instrument therethrough includes an elongated body portion, a housing coupled to a proximal end portion of the elongated body portion, and an annular-shaped light member. The housing defines a longitudinally-extending channel therethrough dimensioned for passage of the surgical instrument. The light member is disposed within the housing and about the channel.
US11944344B2	Guidance system, method and devices thereof A guidance system, a method and a device for dynamically guiding a surgical needle catheter onto an organ to be surgically operated of a patient. In particular, the disclosure relates to a guidance system, a method and a device to aid in the percutaneous kidney puncture.
US11944343B2	Aspiration catheter including mechanical cutter In some examples, a catheter includes an elongated body defining an inner lumen and comprising an expandable member disposed at a distal portion of the elongated body, and a rotatable cutting tool located within an inner lumen of the elongated body, the rotatable cutting tool configured to segment a thrombus into smaller pieces while an aspiration force pulls the thrombus proximally into the inner lumen. In some examples, the catheter further comprises an intermediate structure oriented radially between the rotatable cutting tool and an interior surface of the elongated body, the intermediate structure configured to prevent the cutting tool from contacting the interior surface of the elongated body. In some examples, a stopper is configured to limit movement of the cutting tool distally past a distal end of the expandable member.
US11944342B2	Identification of elastic lamina to guide interventional therapy Described herein is a system and method for identifying elastic lamina during interventional procedures, such as atherectomy. Such identification can be used to avoid trauma to the external elastic lamina during the procedure.
US11944341B2	Ultrasonic surgical instrument with a mid-shaft closure system and related methods An ultrasonic surgical instrument comprises a shaft assembly including a waveguide, and an end effector arranged at a distal end of the shaft assembly and including an ultrasonic blade and a clamp arm. The instrument also comprises a base translatably coupled to shaft assembly. The base includes a first mechanical input and a second mechanical input. The instrument further comprises a closure actuation mechanism operatively connected between the first mechanical input and the clamp arm and configured to actuate the clamp arm from an open position toward a closed position upon selective drive of the first mechanical input. The instrument also includes an insertion actuation mechanism operatively connected between the second mechanical input and the shaft assembly and configured to actuate the shaft assembly from a proximal position toward a distal position upon selective drive of the second mechanical input for insertion of the end effector.
US11944337B2	Surgical instrument with increased actuation force A surgical instrument with improved end-effector gripping force. The instrument comprises a shaft, which may be inserted into a body of a patient. The articulated end-effector is mounted on the distal extremity of the instrument shaft and comprises a plurality of links interconnected by a plurality of joints, whose movements are remotely actuated by the surgeon's hands. This remote actuation is accomplished through mechanical transmission, mainly along flexible elements, which are able to deliver motion from a set of actuation elements, placed at a proximal extremity of the shaft, to the instrument's articulated end-effector. The articulated end-effector further comprises one or more cam-and-follower mechanisms that are able to amplify the force transmitted by the flexible elements so that the actuation force at the instrument jaws is maximized and the tension on the transmission elements minimized, thus increasing the fatigue resistance and life of the instrument.
US11944336B2	Joint arrangements for multi-planar alignment and support of operational drive shafts in articulatable surgical instruments Various shaft guide embodiments are disclosed and may comprise a shaft guide body that comprises a proximal end that may have an oval shape aligned on a proximal long axis and a distal end that may have a distal oval shape aligned on a distal long axis that is transverse to the proximal long axis. The shaft guide body may further comprise a first passage that defines a first passage proximal opening oriented in a first orientation and a second passage that defines a second passage distal opening that is oriented in a second orientation that differs from the first orientation.
US11944329B2	Suction evacuation device A method for removing a stone from a patient comprising the steps of: providing a suction evacuation assembly which includes a sheath and one or more side arms; inserting and positioning a distal end of the sheath into a lumen or cavity of a patient's body containing a stones; connecting a tube to one of the side arms and to a collection bottle; connecting another tube to the collection bottle and a negative pressure system; visualizing the stone or foreign body using a scope inserted through the assembly; activating the negative pressure system in order to remove the stone from the cavity if the diameter of the stone is narrower than an inside diameter of the sheath and the side arm, or performing a lithotripsy on the stone to create fragments with a decreased diameter which allow the passage through the assembly; and collecting the stone in the collection bottle.
US11944328B2	Apparatus and methods for controlled clot aspiration A vacuum aspiration control system for use with a vacuum source and an aspiration catheter includes a connecting tube configured to connect the vacuum source with a lumen of an aspiration catheter. An on-off valve is operatively coupled to the connecting tube, and a sensing unit is configured to detect flow within the connecting tube and provide a signal representative of flow. A controller receives the signal to decide whether to open or close the valve. The controller may automatically close the valve to stop flow when flow through the connecting tube is unrestricted, or according to a predetermined timing sequence. The controller can further periodically open a closed valve to determine whether flow has entered an acceptable range. The controller can still further engage pulsed aspiration with a pressure manipulation assembly when flow is restricted or occluded.
US11944323B2	Surgical tool A surgical tool for use in gaining access to the spine and including a part which is arranged to avoid other anatomical structures when the tool is in use; the tool comprising: a distal working end formation, a proximal end and intermediate said ends a formation displaced from a longitudinal axis and extending between said distal and proximal ends wherein the displaced formation is arranged to avoid said other anatomical structures anatomy during use of the working end of the tool.
US11944318B2	Surgical clamp A surgical clamp is disclosed. The surgical clamp comprises a two-piece body comprising atop jaw housing that inter-fits with a bottom jaw housing; the top jaw housing comprising a top jaw; the bottom jaw housing comprising a bottom jaw; the inter-fitting top jaw housing and bottom jaw housing disposed for movement relative to one another; a bias to the top jaw housing and bottom jaw housing apart; and a lever moveable between a lock position and an open position and the lever disposed to prevent opening movement of the top jaw housing relative to the bottom jaw housing and to allow graduated relative closing movement of the top jaw housing relative to the bottom jaw housing in the lock position and to allow opening and closing movement of the top jaw housing relative to the bottom jaw housing in the open position. The structure of the clamp is such that compressive force applied to one or more of the top jaw housing and the bottom jaw housing causes graduated closing movement of the top jaw housing and the bottom jaw housing to close the top jaw and the bottom jaw. The lever may comprise an axial arm and a lateral arm wherein the axial arm comprises one or more tooth or pawl disposed at a distal end of the axial arm and the lateral arm comprises a button disposed on a distal end of the lateral arm wherein pressing the button or the distal end pivots or moves the axial arm. The pivoting or movement may be oblique pivoting or movement and may disengage the one or more tooth from the rack.
US11944315B2	Left atrial appendage occlusion devices An occlusion device (210) is provided for occluding a left atrial appendage (LAA), including a compliant balloon (230) defining a fluid-tight balloon chamber (232), and an actuating shaft (234), which is disposed at least partially within the balloon chamber (232) for setting a distance between distal and proximal end portions (236, 238) of the balloon (230). A proximal LAA-orifice cover (70) includes a frame (72) and a covering (74) fixed to the frame (72). An orifice-support stent (290) is fixed to and extends distally from the proximal LAA-orifice cover (70), and is generally cylindrical when in a radially-expanded state. Other embodiments are also described.
US11944312B2	Percutaneous catheter directed intravascular occlusion devices Embodiments of the present invention provide an improved vascular occlusion device for occlusion of a passageway, cavity, or the like. According to one embodiment, a medical device for occluding a left atrial appendage is provided. The medical device includes a first portion having at least one plane of occlusion that is configured to be positioned outside of the left atrial appendage, and a second portion having at least one plane of occlusion that is configured to be at least partially positioned within a cavity defined by the left atrial appendage.
US11944309B2	Powered circular stapler with reciprocating drive member to provide independent stapling and cutting of tissue An apparatus includes a shaft assembly and an end effector. The shaft assembly includes an outer sheath and a staple driving mechanism. The end effector includes a staple deck, an anvil, a first staple driver, and a second staple driver. The staple deck defines a plurality of staple openings in at least one annular array. Each staple opening in the plurality of staple openings houses a staple. The anvil is configured to actuate relative to the staple deck to compress tissue between the staple deck and the anvil. The staple driving mechanism is configured to actuate the first staple driver to fire a first staple of the plurality of staples against the anvil. The staple driving mechanism is further configured to actuate the second staple driver independently of the first staple driver to fire a second staple of the plurality of staples against the anvil.
US11944307B2	Surgical stapling system including jaw windows A fastener cartridge can include, one, a cartridge body comprising a deck and a plurality of fastener cavities and, two, a plurality of fasteners positioned in the fastener cavities. The cartridge body can further comprise extensions extending from the deck having different sizes and/or configurations. The extensions can control the flow of tissue relative to the deck and/or support the fasteners as they are ejected from the fastener cavities.
US11944303B2	Staple cartridge A staple cartridge can comprise a plurality of staples positioned within a cartridge body, wherein the cartridge body can comprise a tissue-contacting deck and a plurality of ridges extending from the tissue-contacting deck. The ridges can be configured to prevent, or reduce the possibility of, tissue from moving relative to the staple cartridge during use. The staple cartridge can further comprise a plurality of staple cavities, wherein each staple cavity can comprise an opening in the deck which is at least partially surrounded by a ridge. The ridges can comprise a uniform height or a height which varies along the length thereof. The height can vary relative to a proximal end and a distal end of the cartridge body and/or between the center of the cartridge body and the side.
US11944301B2	Surgical instruments having a reinforced staple cartridge The present disclosure provides a surgical instrument, such as a tissue sealing instrument, with an elongate shaft and first and second jaws movably coupled to the shaft. The second jaw comprises a cavity for receiving a staple cartridge and a substantially longitudinal reinforcing wall extending through the cavity. The instrument further includes a drive member configured to translate through the end effector to close the jaws and to engage a plurality of staples within the staple cartridge to drive the staples into tissue. The reinforcing wall provides additional support for the staple cartridge to inhibit deformation of the staple cartridge during actuation, thereby improving the staple formation in the tissue. This improves the tissue seal provided by the staples without increasing the overall size of the end effector.
US11944296B2	Powered surgical instruments with external connectors A modular surgical instrument system, comprising a handle assembly, comprising a disposable outer housing configured to define a sterile barrier. The disposable outer housing comprises a first housing-portion and a second housing-portion movable relative to the first housing-portion between an open configuration and a closed configuration. The handle assembly further comprises a control inner core receivable inside the disposable outer housing in the open configuration. The disposable outer housing is configured to isolate the control inner core in the closed configuration. The modular surgical instrument system further comprises a primary wired interface configured to transmit data and power between the control inner core and at least one of modular components of the modular surgical instrument system, a secondary interface comprising a sensor located within the outer housing, and a control circuit configured to confirm a primary connection through the primary wired interface based on at least one sensor reading.
US11944295B2	Surgical instrument comprising end effector with longitudinal sealing step Disclosed is an electrosurgical instrument including an end effector with a cartridge having an asymmetric cartridge body.
US11944292B2	Anvil layer attached to a proximal end of an end effector An anvil-attachable layer for use with a surgical stapler, or fastening instrument, wherein a proximal end portion of the layer is attached to a staple cartridge assembly, for example. The layer may be attached to the staple cartridge assembly by an adhesive, weld, or a staple-cartridge-based clamp, wherein the attachment is weak enough to allow the layer to pull away from the staple cartridge assembly with stapled tissue. Alternatively, the layer can include two or more lateral slits that define a connector region that can be cut by a knife of a surgical stapler to release the layer.
US11944291B2	Wound closure system A wound closure system and a method of reducing the size of an open wound are disclosed. A suture line is sutured through body tissue adjacent an open wound, the suture line sutured so as to pass into the body tissue at an entry point and exit at an exit point, the suture line including a plurality of barbs extending outwardly at an acute angle with respect to a surface of the suture line. A biasing member applies a continuous pulling force on the suture line for stretching the body tissue toward the open wound, wherein the biasing member is configured to take up any slack of the suture line during stretching of the body tissue and keep the suture line taut.
US11944289B2	Articulating surgical instruments Articulating surgical instruments are disclosed. In one embodiment, a surgical instrument may include an elongated shaft assembly including an articulable portion moveable between a non-articulated configuration and an articulated configuration. First and second articulating shafts of the elongated shaft assembly may be coaxially arranged and axially fixed at an attachment point located distally from the articulable portion. Proximal portions of the first and second articulating shafts may be displaceable in opposing directions to articulate the articulable portion from the non-articulated configuration to the articulated configuration. In another embodiment, an articulation control may be movable from a first position to a second position to move an articulation lock from a locked configuration to an unlocked configuration to selectively permit articulation of a surgical instrument. The articulation lock also may be movable from the second position to a third position to articulate the surgical instrument.
US11944287B2	System and method for retracting body tissue A method for retracting body tissue providing a retractor system that includes a rail having two opposed widened rail portions separated by a narrowed portion, each widened portion engageable by a separate clamp. The clamps are configured to support the rail to a fixed surface, or to support a surgical device. Each clamp may independently be positioned or slid along the rail to a desired location without interference with a clamp on an opposing widened rail portion. A device clamp is formed of spherical mating portions which enable alignment of a surgical device along six degrees of freedom, and tightenable by securing a single fastener. A retractor blade mount enables an angular and tilting disposition of a retractor blade, as well as remote manipulation of the retractor blade.
US11944283B2	Medical apparatus and adhesion promoting device using same To reduce the risk of a ruptured suture after a surgery or the like, a medical apparatus includes a biodegradable sheet in which a plurality of through-holes are formed, a value of a ratio (D/P) of a hole diameter D to a pitch P of the through-hole is in a range of 0.25 or more and less than 40. Such a medical apparatus is useful as an adhesion promoting device for promoting adhesion of biological tissue.
US11944282B2	Articulation mechanisms and methods of use An accessory device for use with a medical device includes a first cuff secured to a distal end of the medical device, a second cuff secured to the medical device proximal of the first cuff, an actuator, and at least one actuation wire extending from the first cuff, through the second cuff, to the actuator.
US11944280B2	Adapter, surgical instrument set, and method for connecting surgical instrument An adapter for detachably connecting a surgical instrument to a robot arm of a robotic surgical system according to an embodiment may include: a base including a first surface to be attached to an attachment portion of the robot arm, a second surface, and a plurality of recesses formed in the first surface; an engagement member disposed in the base and movable between an advanced position where the engagement member is advanced into the plurality of recesses and a retracted position where the engagement member is retracted from inside the plurality of recesses; a biasing member which biases the engagement member in a direction from the retracted position to the advanced position; and an operating member to be operated to move the engagement member to the retracted position against a biasing force of the biasing member.
US11944271B2	Endoscope tip part with improved optical properties An endoscope tip part including a tip housing at least partially enclosing an interior cavity and including a window, and a vision assembly accommodated in the interior cavity and including an imaging subassembly including an image sensor viewing in an optical direction through the window of the tip housing, a light source comprising an illumination surface for emitting light, a separate frame component including a light shielding wall made of an opaque material and extending between the image sensor and the light source so as to at least partially shield the image sensor from light emitted from the light source.
US11944270B1	Systems and methods of rotation compensation for brain optical imaging and stimulation Embodiments of the present disclosure are directed to microendoscope instruments and methods that allows the imaging fiber to freely rotate with the animal while capturing images and projecting stimulation patterns with correct orientations. The microendoscope includes a first spatial light modulator for sourcing a first light source and generating a stimulated pattern to a fiber coupled to an imaging implant for attaching to the brain of the subject. A rotary joint is disposed between the microendoscope and the imaging implant to facilitate the movements and rotations of the imaging implant that is attached to the subject, thereby provides an essentially frictionless contact to brain of the subject so that the subject can freely moves and rotates without feeling the cumbersome imaging implant and fiber that are attached to the subject. A camera captures images obtained from the imaging implant with the specimen taken from the subject.
US11944269B2	Endoscope connector and endoscope An endoscope connector includes: a plug including an electric contact configured to be electrically connected to an external medical apparatus, the plug being provided with a first substrate; a first frame electrically connected to the plug; a second frame electrically connected to the first frame, the second frame being made of metal; a first electric connection member electrically connected to the first substrate; a second electric connection member connected to the first electric connection member; a substrate unit including a second substrate and an electromagnetic shield member covering the second substrate, the electromagnetic shield member being made of metal; and an urging member configured to urge the substrate unit in a direction of the second frame, and to put the electromagnetic shield member into an electric conduction state by causing the electromagnetic shield member to abut on the second frame.
US11944265B2	Medical imaging systems and methods An exemplary medical imaging system includes an imaging device that includes a visible light camera configured to obtain image data representative of a two-dimensional visible light image of a scene and a depth sensor separate from the visible light camera and configured to obtain depth data representative of a depth map of the scene. The medical imaging system further includes a image processing system communicatively coupled to the imaging device and configured to generate, based on the image data and the depth data, a right-side perspective image of the scene and a left-side perspective image of the scene that together form a stereoscopic image of the scene.
US11944264B2	Confocal endoscope with fixing device The present invention relates to the technical field of endoscopes, and discloses a confocal endoscope with a fixing device. The confocal endoscope includes an insertion tube, a flexible tube, a plurality of airbag assemblies, and a pressure supply assembly, where the flexible tube is slidably sleeved on the insertion tube, a plurality of containing units are formed in an outer wall of the flexible tube in an axial direction and are distributed in the axial direction of the flexible tube at intervals, each containing unit includes a plurality of containing grooves evenly distributed in a circumferential direction of the flexible tube, and the outer wall of the flexible tube is concaved inwards to form the containing grooves; the airbag assemblies and the containing units are arranged in a one-to-one correspondence mode, each airbag assembly includes a plurality of elastic airbags, the elastic airbags and the containing grooves are arranged in a one-to-one correspondence mode, and the elastic airbags are connected to inner walls of the containing grooves; the pressure supply assembly is selectively communicated with the elastic airbags of one or more airbag assemblies and configured to inject fluid media with certain pressure into the elastic airbags. According to the present invention, the insertion tube can be prevented from jittering.
US11944261B2	Electronic endoscope system and data processing device An electronic endoscope system includes an electronic endoscope, a processor that includes an evaluation unit, and a monitor. The evaluation unit includes an image evaluation value calculation unit that calculates an image evaluation value indicating an intensity of lesion in the living tissue for each of a plurality of images of the living tissue, and a lesion evaluation unit that calculates a representative evaluation value of the image evaluation value from the image evaluation values of the plurality of images corresponding to a plurality of sections for each of the plurality of sections in which a region of the organ is divided using information of an imaging position in the organ whose image is captured and evaluates an extent of the lesion in a depth direction inside the organ using the representative evaluation value.
US11944260B2	Vacuum cleaner A vacuum cleaner including a vacuum motor configured to draw an air flow through an air flow path of the vacuum cleaner; a dirt separator having dirt, receptacle; a display screen; and a controller configured to control images displayed on the screen. The dirt receptacle has a closed configuration in which it can receive dirt separated from the air flow, and an open configuration in which dirt contained in the dirt receptacle can be emptied therefrom. The controller is configured to display video instructions on the screen.
US11944259B2	Vacuum cleaner A vacuum cleaner comprises a nozzle (N) for cleaning a surface, a suction tube (T) for receiving input air from the nozzle (N), a cyclone device having a cyclone (C) and a dirt container (DC) both oriented substantially perpendicular to the suction tube (T), a cyclone device input coupled to the suction tube (T) from which the input air is transported, following a spiral around a center, in a first direction substantially perpendicular to the suction tube (T) to reach a stage (V) at which dirt is separated from the input air to obtain cyclone output air, from which stage the cyclone output air is conveyed through a conduit in a second direction substantially perpendicular to the suction tube (T) and opposite to the first direction to arrive at a cyclone device output, a filter (F) for filtering the cyclone output air, and an airflow generator (A) for generating an airflow through the suction tube (T), the cyclone (C) and the filter (F), wherein when the nozzle (N) is touching the surface, the suction tube (T) is put in a substantially horizontal position, the first and second directions are substantially perpendicular to the surface, with the notion substantially perpendicular allowing for a deviation of not more than 35 degrees.
US11944256B2	Easy loading silverware basket A dishwasher system for cleaning dishes may include at least one rack configured to receive a silverware basket, the basket including at least one silverware compartment, a pair of camshafts including a first camshaft and a second camshaft, each fixed to the rack and operable by a gearbox configured to rotate the camshafts with respect to the rack, the camshafts arranged below the silverware basket, and a cam arranged at each end of each of the camshafts, wherein upon rotation of the camshaft by the gearbox, the cams affect the height of a respective corner of the basket to allow the silverware therein to be lifted or lowered and exposed to spray at various heights or angles from sprayers within the dishwasher.
US11944255B2	Wall mounted dishwasher A wall mounted dishwasher incorporates storage into an exterior door of the dishwasher to facilitate user access to utensils stored in the dishwasher. The exterior door may be hinged and configured to rotate about a substantially vertical axis, and one or more spray devices and/or one or more fluid collection pans may be integrated into the exterior door.
US11944252B2	Cleaning system and method for cleaning items to be cleaned A cleaning system (110) and a method for cleaning items to be cleaned (112) are proposed. The cleaning system (110) comprises: a) at least one cleaning apparatus (114), having at least one at least partially closed cleaning chamber (116) with at least one loading apparatus (118) for loading the items to be cleaned (112) with at least one cleaning liquid; and b) at least one transport system (144) for the automatic transport of the items to be cleaned (112), the transport system (144) comprising: a. at least one first conveying apparatus (146) for the delivery of dirty items to be cleaned (112); b. at least one second conveying apparatus (148) for the transport of the dirty items to be cleaned (112) to the cleaning apparatus (114); c. at least one transfer apparatus (150) for the transfer of at least one part of the dirty items to be cleaned (112) from the first conveying apparatus (146) onto the second conveying apparatus (148); and d. at least one buffer store (152) for the buffer storage of at least one part of the dirty items to be cleaned (112), the transfer apparatus (150) being set up to selectively transfer the dirty items to be cleaned (112) from the first conveying apparatus (146) directly onto the second conveying apparatus (148), or to buffer store them in the buffer store (152) and to subsequently transfer them onto the second conveying apparatus (148).
US11944251B2	Domestic dishwasher A household dishwasher includes a washing container having a floor, and a spray arm supported for rotation about an axis of rotation and including spray nozzles for applying washing liquor and/or fresh water to a dishwasher load received in the washing container. The spray arm is designed so as to be capable of being disassembled and re-assembled along the axis of rotation, in order to transfer the spray arm from a first mode, in which the spray nozzles point away from the floor, into a second mode, in which the spray nozzles point toward the floor, and vice versa.
US11944250B2	Cleaning system incorporating stitch bonded cleaning pad with multi-filament stitches A cleaning pad structure of stitch bonded construction incorporating one or more substrate layers of an absorbent nonwoven material with an optional additional fluid blocking substrate layer of polymer film or other suitable material in juxtaposed relation to the absorbent nonwoven layers. Stitching yarns are introduced in stitching relation through the substrate layers. One face of the pad defines a cleaning surface of raised yarn loops formed by the stitched yarns. The pad further includes an attachment surface facing away from the cleaning surface. The stitches of yarns across the attachment surface define an engagement surface for attachment to cooperating hooking elements across a surface of a mop head to define a hook and loop attachment system.
US11944249B2	Nozzle for cleaner A nozzle for a cleaner includes a nozzle housing having a suction flow path through which air containing dust flows, a first rotation cleaning unit and a second rotation cleaning unit located on a bottom side of the nozzle housing, the first rotation cleaning unit and the second rotation cleaning unit being spaced apart from each other in a left-right direction of the nozzle housing, each of the first rotation cleaning unit and the second rotation cleaning unit having a rotation plate, a driving device located in the nozzle housing, and a water tank located on the nozzle housing, the water tank being configured to store water to be supplied to the first rotation cleaning unit and the second rotation cleaning unit. The water tank includes a first chamber, and a second chamber spaced apart from the first chamber in the left-right direction of the nozzle housing.
US11944248B2	Surface cleaning device with automated control A surface cleaner is provided. The surface cleaner comprises: an operating component configured to perform a function of the surface cleaner; a base moveable along a surface; an accelerometer configured to generate a signal; and a controller in communication with the accelerometer and the operating component, wherein the controller is operable to control the operating component based on the signal, and wherein the operating component is selected from a group consisting of a suction motor operable to generate an airflow, a brushroll motor operable to drive a brushroll, an actuator operable to adjust a height of a brushroll from the surface, a pump operable to deliver a cleaning fluid, an actuator operable to control an airflow or fluid valve, and an indicator operable to indicate a parameter of the surface cleaner.
US11944247B2	Mopping member, mopping apparatus, cleaning robot, and control method for cleaning robot Disclosed relates to a mopping member, a mopping apparatus, a cleaning robot, and a control method for the cleaning robot. The mopping member includes a first mop and a second mop; the first mop is provided with a first rotating center, the second mop is provided with a second rotating center, and the distance between the first rotating center and the second rotating center is a rotating center distance. When the first mop and the second mop rotate, a short-diameter edge of one mop corresponds to a long-diameter edge of the other mop; at a connection line position of the first rotating center and the second rotating center, a gap between the first mop and the second mop is formed between the short-diameter edge of one mop and the corresponding long-diameter edge of the other mop.
US11944242B2	Scrubbing tool having a dissolvable cleaning head A scrubbing tool for cleaning a surface that has a handle for holding by a user in a cleaning operation. The handle has a first connector. The scrubbing tool also has a cleaning head having a second connector configured to mate with the first connector in order to attach the cleaning head to the handle in an engaged position. The cleaning head is comprised entirely of a material configured to dissolve in water and has a cleaning agent.
US11944241B1	Hands-free toilet paper dispenser The hands-free toilet paper dispenser comprises a toilet paper holder, a sheet feeder mechanism, a motion sensor, and a fragrance dispenser. The hands-free toilet paper dispenser may mount on a wall of a bathroom adjacent to a toilet. The hands-free toilet paper dispenser may hold a roll of toilet paper on the toilet paper holder. The sheet feeder mechanism may be adapted to dispense one or more sheets of toilet paper when a user's hand passes in front of the motion sensor without having to touch the hands-free toilet paper dispenser. The fragrance dispenser may be operable to dispense a fragrance into the bathroom to mask odors resulting from use of the toilet.
US11944240B2	Fabric warming rack An unenclosed fabric warming rack includes at least one rod extending along a horizontal plane, a first light source positioned on a first end of the at least one rod, and a second light source positioned on a second end of the at least one rod.
US11944232B2	Apparatus for making a beverage, comprising an image acquisition device An apparatus for making a beverage including an infusion chamber for a capsule containing a food substance, an insertion opening for inserting the capsule into the apparatus, a transfer channel for transferring the capsule from the insertion opening to the infusion chamber, an image acquisition device to acquire at least one image of a portion of the capsule. The image acquisition device includes an optical sensor facing an image capture zone in which, in use, said capsule is located or passes. A viewing window, made of transparent material, is interposed between the optical sensor and the image capture zone. A heating element for heating the viewing window is applied to, or incorporated in, the viewing window.
US11944229B2	Electric kettle An electric kettle may include a body configured to form a space in which liquid, such as water may be contained, a handle that protrudes from an outer surface of the body, a heating module provided inside of the body to heat liquid inside of the body, an operation portion provided in the handle to operate so as to control an operation of the heating module, and a main printed circuit board (PCB) provided inside of the handle to control the operation of the heating module according to an operation of the operation portion. The body may have a double wall structure including two walls spaced apart from each other, and an electric wire that connects the main PCB and the heating module may be guided from the handle to the heating module through a space between the two walls.
US11944220B2	Bedding system and method The present disclosure relates to a bedding system that can minimize the time, labor and/or frustration associated with making a bed. It comprises a fitted sheet to fit over the mattress top surface and side surfaces and a flat sheet to fit over the fitted sheet outer surface. The flat sheet lower section is being secured/coupled to the fitted sheet lower section. The bedding system further comprises a bedspread to fit over the flat sheet outer surface. The bedspread lower longitudinal edge, the bedspread first side longitudinal edge, the bedspread second side longitudinal edge and the bedspread upper section are being releasably secured to the flat sheet lower longitudinal edge, the flat sheet first side longitudinal edge, the flat sheet second side longitudinal edge and the flat sheet upper section along their respective lengths.
US11944218B2	System and method of providing packing inventory sensing and management of a supply compartment for a storage receptacle A package deposit enclosure designed for public use is powered by an efficient storage battery and photovoltaic cell array. These unique features allow the package deposit enclosure to be placed in locations where no power is available, but where there is frequent human traffic. Sensing and wireless data communication features allow the unit to be emptied less often than typical package delivery enclosures. Wireless communication also allows users' access to real-time information. On board power enables other functions, such as lighting and audio, to enhance device functionality.
US11944217B1	Anti-theft package delivery apparatus and system A package delivery apparatus for securing delivered packages includes a flexible bag, a security strap, and a locking mechanism. The flexible bag is configured to accommodate one or more packages and includes an opening adjustable between an open position and a closed position. The security strap is integrated with the bag and cinches around the opening. The locking mechanism selectively allows the security strap to move in one direction to secure the closed position. The locking mechanism includes a housing, a lock element, a ratcheting mechanism, and a handle mechanism. The security strap extends through the housing and the ratcheting mechanism and is coupled to the handle mechanism. Moving the handle mechanism to an extended position cinches and locks the bag closed. The lock element is selectively actuated to disengage the security strap from the ratcheting mechanism and allow the bag to be re-opened.
US11944206B1	Detachable rocking chair structure A detachable rocking chair structure is provided. The detachable rocking chair structure includes a main backrest rod, a main backrest reinforcement rod, a cushion side rod, a connecting crossbar, an elastic band, and a rocking chair cover, where the main backrest reinforcement rod includes a first end connected to the main backrest rod and a second end connected to the cushion side rod; the connecting crossbar and the elastic band are connected to the cushion side rod; and the rocking chair cover is sleeved on an upper surface of each of the main backrest rod, the cushion side rod, the connecting crossbar, and the elastic band.
US11944202B2	Folding headrest stand A compact headrest stand that selectively unfolds to support a user's head over a support surface. The stand includes a lower member pivotally attached to an upper member. A downward-extending lip configured to capture the edge of a support surface is formed on the opposite edge of the lower member. The upper member includes a center void and two support arms, each with a saddle clip. Attached to the saddle clips is a headrest assembly configured to support the user's forehead and facial bones. During use, the lower member is placed on a support surface, and the upper member is rotated upward and diagonally aligned over the lower member. The headrest is placed on the saddle clips and can swivel between the two support arms. Attached to the lower member is a stop leaf that, when diagonally aligned, holds the upper member diagonally over the lower member.
US11944199B2	Mechanical stretching device for movable seat unit and seat unit The present disclosure relates to a mechanical stretching device for a movable seat unit, and a movable seat unit thereof. The mechanical stretching device includes: a linkage support that comprises a support structure configured to support the mechanical stretching device on ground and a linkage structure attachable to a seating portion of the seat unit; a back mechanism that is pivotally connected to the linkage support and is configured to attach to a backrest of the seat unit; and a leg stretching structure including a footrest element, and the leg stretching structure is pivotally connected to the linkage support, and the footrest element is attached to a footrest of the seat unit. The mechanical stretching device is configured to implement a sequential conversion or a reverse sequential conversion of the seat unit from a sitting state to a relaxing state and to a lying state.
US11944191B2	Foldable buffet station This invention is a foldable buffet station comprising supporting legs and a countertop frame mounted on upper ends of the supporting legs. The supporting legs comprise two sets of supporting panels on left and right sides. Each set of the supporting panels comprises a front supporting panel and a rear supporting panel which are rotationally connected. The countertop frame comprises a front beam, a rear beam, and two left and right side beams which form a rectangular frame. The two left and right side beams are respectively fixed at upper ends of the two rear supporting panels on left and right sides. The rear beam is detachably fixed at upper ends of the two back side supporting panels. The front beam is fixed at upper ends of the two front side supporting panels. When it is necessary to fold the buffet cart, the cooking module on the countertop frame is removed first, and then the rear beam is removed; since the front supporting panels and the rear supporting panels are rotationally connected, pushing the two rear supporting panels at this time results in rotation and folding, and the side beams follow the corresponding supporting panels to rotate. As a result, the occupying space of the entire buffet cart can be greatly reduced, which is convenient for transportation and storage.
US11944190B2	Post engageable table A post engageable table system is provided where one or two half sections of a table are removably engageable to one or both sides of an upright support post. Compressive fasteners adjacent recesses on a contact edge of each table half section are positionable to a compressive engagement with a second side of the post wherein they can be engaged, removed, or adjusted for height in such an engagement.
US11944185B2	Modular accessory system for storage containers with MOLLE webbing A modular system for a container with MOLLE webbing is described, comprising a two component coupling system including: 1), a clip component which couples to the MOLLE on the container; and 2), a bracket component that couples to the clip and support various modular subcomponents. The same modular accessory system works with hard coolers while allowing the lid to close flat against the lip of the bucket while the modular accessories are in use.
US11944173B2	Takeout food container The present invention discloses a disposable takeout food container, comprising a first sleeve cover, and a second sleeve cover. The first sleeve cover and the second sleeve cover when oriented perpendicular to a tray and engaged with the tray, support the tray at an elevated position, functioning as serving tray stands to form a stable table-tray.
US11944172B2	Portable listening device with sensors An earbud includes a housing that includes a driver assembly positioned within the housing forming a front volume in front of the driver and a back volume behind the driver. An acoustic insert is positioned behind the driver assembly and attached to an interior surface of the housing such that it forms a bass channel that is routed from the back volume to a vent in the housing.
US11944167B2	Wristbands with magnetic coupling A wristband can comfortably secure an electronic device, such as a wristwatch or fitness/health tracking device, to a wrist of a user. The wristband can include a number of magnets that allow the wristband to be magnetically coupled to itself when folded over or when separate band portions are overlapping. The magnets can include a polymer mixed with a magnetic material to provide magnetic properties and flexibility. The magnets can be joined together by a continuous support structure that extends through opposing pairs of the magnets. The support structure can provide substantial and ability as well as tensile strength. The magnets and the support structure can be surrounded by a flexible cover to protect the components within.
US11944164B2	Device clamping, multi-purpose, with removable, interchangeable and customizable plate A mechanical closure and fastening device, having a first part (1), made of a plate with a pin (1A) extending therefrom, the pin having first and second shaped sections in registry alignment and a narrower engaging section therebetween; and a second part (2), made of three plates (2A), (2B) and (2C), joined together, each having an opening in registry alignment and shaped to receive the first and second shaped sections when the pin is inserted thereinto; wherein plate (2B) has a rotatable plate within a fixed housing and having a lever (3) with which the rotatable plate may be rotated between an open position and a tightened, locked position within the housing, wherein in the tightened, locked position the opening in the rotatable plate is rotated out of registry alignment with the openings in plates (2A) and (2C); and wherein when the rotatable plate is in the open position, and the pin (1A) is inserted into the openings, the first and second shaped sections of pin (1A) are fixedly engaged by the openings in plates (2A) and (2C), and the engaging section therebetween is aligned with the opening in plate (2B), the rotatable plate may be rotated with the lever (3) about the engaging section to the tightened, locked position to thereby capture the first shaped section and lock the first and second parts (1) and (2) together.
US11944161B2	Process for thermoregulating a flexible cellular material by compression and expansion of the gas trapped in its cells and associated device A flexible cellular material is thermoregulated by compressing and expanding gas trapped in its cells A flexible elastomer material of a device that provide thermoregulation includes two layers of different shore hardness and conductivity and is has gas-filled cells. Each cell has a zone to store the gas when compressing the material in the layer C with higher hardness and thermal conductivity and another zone to expand the gas when decompressing the material in the layer D with lower hardness and thermal conductivity. The flexible material can be used as a sole in shoes to maintain a cool temperature. With each step, the cell zones located in the layer C act as adiabatic chambers whose gasses heat with compression. When the foot leaves the ground the zones of cells located in the layer D then act as a reactor nozzle that will expand the air and therefore cool it.
US11944155B2	Article of footwear having an elevated plate sole structure An article of footwear is provided having an elevated plate structure incorporated in the sole structure and optionally including a fluid-filled chamber. The elevated plate structure can include an upper plate and a plurality of legs extending downward toward the outsole. End portions of the legs can engage an upper region of the outsole. The elevated plate structure can form a cage region that can optionally include a fluid-filled chamber substantially disposed therein. The elevated plate structure can further include a lower plate disposed at an upper region of the outsole, which can form a lower portion of the cage region. Portions of the legs can be integrated with impact-attenuating members in the heel region in various configurations and can provide features for the impact-attenuating members, such as support, impact-attenuation and adjustable impact-attenuation features.
US11944153B2	Articles of footwear with engineered wood An article of footwear includes an upper and a sole structure that defines a forefoot region, a midfoot region, and a heel region. The sole structure comprises densified wood and includes an upper midsole cushioning member, a lower midsole cushioning member, an outsole coupled with a bottom surface of the lower midsole cushioning member, and a plate positioned between the upper midsole cushioning member and the lower midsole cushioning member.
US11944140B2	Glove A glove that is detectable by a metal detector. The glove is prepared from latex formulation including a metallic additive. The metallic additive includes a pigment, a surfactant and a solvent. The metallic additive is used in an amount of at least 10 phr based on an amount of a latex formulation.
US11944138B2	Face mask and method for manufacturing thereof A face mask and a method for manufacturing the face mask are disclosed. The face mask comprises a sheet, a first lateral flap, a second lateral flap, a first loop, a second loop and an elastic film. The sheet comprises a central portion, a first lateral portion, a second lateral portion and an opening. The first lateral flap is coupled to the first lateral portion to form a first chamber. The second lateral flap is coupled to the second lateral portion to form a second chamber. The first loop connects to a first strap and is coupled to the first lateral flap. The second loop connects to a second strap and is coupled to the second lateral flap. The elastic film is coupled to the sheet and covers the opening.
US11944137B2	Face shield, monitoring system and barrier formation in the same A face shield and a face shield monitoring and tracking system, which enables the monitoring of the use of the face shield in real time and the transmission and storage of data and information regarding its use for further management and analysis. The face shield is also equipped with an electrostatic field provided on the surface of a front panel, to attract and retain contaminated droplet particles or aerosols present in the environment.
US11944134B2	Article of warmth with integrated and concealed battery retention pocket An electrically heated article of warmth adapted to generate heat to a user person's body. The article of warmth has at least one integrally formed pocket to support and conceal one or more batteries at desired locations and orientations therein for the comfort of the user person. The pocket is formed between opposed fabric materials to define a hollow concealed pocket space. An opening is formed in one of the opposed fabric materials for access to the hollow concealed pocket space. The opposed fabric materials have an inner surface facing one another in the hollow concealed pocket space. The inner surfaces have sticky materials which when the inner surfaces are placed against one another they exhibit a binding retention force. The one or more batteries are retained at the desired locations and orientations by the retention force of the of the inner surface of the opposed fabric materials being placed in contact with one another. In one embodiment, only one of the inners surfaces has a sticky material and the batteries are provided with a further sticky material to bind to the inner surface.
US11944130B2	Vaporizer device A vaporizer device includes various modular components. The vaporizer device includes a first subassembly. The first subassembly includes a cartridge connector that secures a vaporizer cartridge to the vaporizer device and includes at least two receptacle contacts that electrically communicate with the vaporizer cartridge. The vaporizer device includes a second subassembly. The second subassembly includes a skeleton defining a rigid tray that retains at least a power source. The vaporizer device also includes a third subassembly. The third subassembly includes a plurality of charging contacts that supply power to the power source, and an end cap that encloses an end of the vaporizer device.
US11944126B2	Inhalation component generation device, method of controlling inhalation component generation device, and program An inhalation component generation device includes a load configured to vaporize or atomize an inhalation component source with electric power from a power supply, and a control unit configured to be capable of acquiring a voltage value of the power supply. The control unit is configured to be capable of estimating or detecting at least one of degradation and failure of the power supply based on a time period required for the voltage value of the power supply to reach an upper limit from a lower limit of a predetermined voltage range during charging of the power supply.
US11944122B2	Vapor provision device with liquid capture An assembly for a vapor provision device includes a reservoir for storing source liquid; a liquid conduit for delivering the source liquid from the reservoir to a vapor generator for vaporizing the source liquid; and a liquid capture element in liquid transfer contact with at least a portion of the liquid conduit between the vapor generator and a part of the liquid conduit that receives liquid from the reservoir, and including an absorbent structure providing a higher capillary force than a capillary force of the reservoir.
US11944117B2	Method for manufacturing heated cigarette product A method of manufacturing a smoking article that contains, as members, at least a tobacco rod, a cooling segment, and a filter segment and in which a low-stiffness member L and a high-stiffness member H are adjacent to each other, the method includes (A) placing an adhesive on either surface of a tipping paper to form each portion of a high adhesive weight and a low adhesive weight per unit area after solidification, where the portion of a high adhesive weight is provided in a region for wrapping the member L; and (B) preparing a composite segment that contains at least the tobacco rod, the cooling segment, and the filter segment and wrapping the composite segment in the tipping paper.
US11944116B1	Device and method for removing unwanted objects from cut tobacco in a cut tobacco production line A device for removing unwanted objects from cut tobacco in a cut tobacco production line is disclosed, which includes: a raw cut tobacco feeding and conveying unit (N1), a heavy unwanted object removal unit (N2), a cut tobacco dispersion and recovery unit (N3), a moderate unwanted object removal unit (N4), a cut tobacco humidification unit (N5) and a light unwanted object removal unit (N6). An unwanted object removal method using the cut tobacco unwanted object removal device is also disclosed. The device and method of the disclosure can effectively remove unwanted objects from cut tobacco.
US11944115B2	Methods and systems for incorporating nicotine into oral products This document provides methods and systems for stabilizing nicotine and incorporating nicotine into one or more oral products. This document also provides oral products. Nicotine can be stabilized by mixing liquid nicotine with cellulosic fiber such that the liquid nicotine absorbs into pores of the cellulosic fiber to form a cellulosic fiber-nicotine mixture. In some cases, a cellulosic fiber-nicotine mixture can be combined with one or more binders and molded into an oral product.
US11944114B2	Smokeless tobacco lipid granules A smokeless tobacco product includes a plurality of orally disintegrable granules. Each granule has a lipid core and at least one layer surrounding the core. The core can also include binders, powdered tobacco carbohydrates, water soluble polymers, flavorants, salts, sweeteners, and combinations thereof. The orally disintegrable granules can provide a pleasing texture and/or flavor experience.
US11944113B2	Nutritionally enhanced isolate from stabilized rice bran and method of production Provided is a nutritionally enhanced derivative (isolate) from Stabilized Rice Bran (SRB) with improved antioxidant, fat and protein levels enhancing both the nutritional and yield values over existing techniques. Also provided is an improved method that utilizes certain enzyme combinations under various time and temperature conditions for extracting these nutritionally enhanced isolates from SRB.
US11944111B2	Stabilizing sorbic acid in beverage syrup A method for preparing a sorbate powder comprising dissolving sorbate salt in water, adding a stabilizing carrier to the sorbate solution, and spray drying the sorbate solution to form the sorbate powder. The sorbate powder is stable in beverage syrup.
US11944110B2	Meat treatment composition and use thereof This invention concerns reduction of moisture loss during the processing of meat. The present invention resides in the finding that pre-treatment of fresh meat with compositions comprising acetic acid salts and certain polysaccharide materials can reduce moisture loss with as much as 15%, as compared to non-treated meat. In some embodiments, the compositions are based on ingredients that can be labeled as ‘natural ingredients’. The invention provides compositions comprising such combinations of one or more acetic acid salts with one or more polysaccharide materials; methods and uses involving the treatment of meat with said compositions; as well as the meat products that are accordingly obtained.
US11944105B1	Method and apparatus for conveying a meat product and using a knife for automated cutting of meat The technology as disclosed herein includes a method and apparatus for deboning a meat item, and more particular for deboning a poultry item including performing an initial shoulder cut for removing boneless breast meat from the poultry carcass or frame. The technology as disclosed and claimed further includes a method and apparatus for removing a tender meat portion from a poultry item. The method and apparatus disclosed and claimed herein is a combination of a robotic arm including an ultrasonic knife implement and/or an annular blade knife implement and a vision system for varying the cut path based on the shape and size of the poultry item. The combination as claimed including the ultrasonic knife can perform a meat cut while penetrating the meat with less force than the typical penetration that occurs when using a traditional knife. The combination as claimed including the annular blade knife implement can remove the tender meat portion for the keel bone and posterior sheath.
US11944103B2	Device for cooking and topping of food A device, comprising a cooker and a topper for auto cooking and or topping of food.
US11944102B2	Method for controlling pest infestations The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5′ UAAACAAUCGCAAGAAGCUGA 3′ (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5′ AGCUUCUUGCGAUUGUUUAAG 3′ (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.
US11944095B2	Substrate for efficient use in sanitizing and disinfecting The current invention relates to modifying the surface of a cellulose-containing nonwoven substrate carrying a quaternary ammonium compound. A material for a nonwoven disinfecting wipe is provided which material includes a nonwoven substrate comprising cellulose and synthetic fibers and a combination of poly(vinylamine) and poly(amideamine-epichlorohydrin). Further, a method is provided for preparing a material for a nonwoven disinfecting wipe, the method comprising treating a nonwoven substrate comprising cellulose with poly(vinylamine) and poly(amideamine-epichlorohydrin).
US11944094B1	Seed germination activator for control of broomrape A seed germination activator for control of broomrape includes butylisobutylphthalate (hereinafter “BIP”). A biocontrol composition includes BIP and at least two nonionic surfactants for administration in irrigation water. Methods of controlling broomrape may include administering the biocontrol composition comprising BIP in the irrigation water prior to planting crops.
US11944092B2	Compositions for controlling phytoplankton contamination A composition for mitigating, inhibiting, ameliorating and/or eliminating phytoplankton growth in a waterbody, the composition comprising an active ingredient at concentration of 80.0-99.5% (w/w) of the composition and a coating material at concentration of 0.5-20% (w/w) of the composition; wherein the critical surface tension of the composition is between 15-60 dyn/cm and wherein the relative density of the composition, prior to being submerged in water, is above 1 g/cm3.
US11944089B2	Monitoring apparatus for temperature-controlled sample collection and transport A portable temperature-controlled container for receiving and housing one or more handheld carriers, each handheld carrier configured to transfer samples to and from a temperature-controlled storage environment, the handheld carrier including a handle and a tray portion, the tray portion configured to be slid into a port of a rack or tower provided in the temperature-controlled storage environment in order to withdraw a sample located in the port, the portable temperature-controlled container including a housing having an opening forming an internal cavity configured to receive one or more handheld carriers, and a lid configured to substantially close the opening, where the housing includes a recess configured to receive the handle of the handheld carrier such that closing of the lid substantially seals the internal cavity when the one or more handheld carriers are placed in the housing.
US11944088B2	Ex vivo organ care system The invention generally relates to systems, methods, and devices for ex vivo organ care. More particularly, in various embodiments, the invention relates to caring for a liver ex vivo at physiologic or near-physiologic conditions.
US11944087B2	Agricultural sprayer with real-time, on-machine target sensor An agricultural applicator, that applies material to an agricultural field, includes an on-board, real-time image sensor that senses targets for the material to be applied. A controller controls applicators, such as nozzles or other applicators, to apply the material to the sensed targets.
US11944083B2	Rotating rod holder An apparatus for stowing and/or transporting rod-shaped structures such that the rods are easily insertable into, and removable from, the rod holder when it is located underneath an overhead obstruction that would otherwise prevent insertion or removal of rods into the rod holder. The rod holder rotates away from the receiving structure to which it is attached by operation of a rotatable attachment between the rod holder and a base. The base comprises a latching mechanism to prevent the rod holder from rotating unless it is released using a latch release lever. The rod holder allows insertion of longer rods into the rod holder than would otherwise be possible using rod holders of the prior art. The rod holder increases ease of access to rods stored in the rod holder. An exemplary use case is the storage of fishing rods under a T-top on a fishing boat.
US11944078B1	Metering and dispensing container A metering dispenser for pet products and other products has a container and a tunnel within the container. The tunnel has a product receiving opening near an internal wall of the container and a dispensing opening extending through an opposite wall. When the container is moved, products fall into the receiving opening, through the tunnel and out through the dispensing opening. Pet product ingestion is extended and pets learn to manipulate the container to obtain food and treats.
US11944077B2	System and method for an animal puzzle bowl for mental stimulation of senior animals An animal puzzle bowl is disclosed having a plurality of sockets and a lid with a coupling joint configured to couple with those sockets in a plurality of orientations. The lid may include elements such as a lip or grip for an animal to interact with to allow for opening of the lid so the animal may reach the contents of the bowl. The lids may also include holes so the animal may be encouraged to interact with the bowl by the sight or smell of food or other items of interest. The bowl base can include more than one bowl to allow for a combination of lids to be used. By varying the combination and orientation of the lids an animal must problem solve to reach a desired item in the bowl each time, thus mentally stimulating the animal.
US11944075B2	Top-fill hummingbird feeder with float valve base closure mechanism having a foam/frame float A top-fill hummingbird feeder is provided having a nectar container with a liquid flow opening at a lower end and a removable cap at an upper end, a feeding basin positioned below the nectar container, and a sealing mechanism associated with the liquid flow opening and the feeding basin. The sealing mechanism includes a bottle seal assembly configured for removable coupling with a base of the feeding basin, and a float valve captured by said bottle seal assembly to prevent rotation thereof while allowing the float valve to move upwardly and downwardly with changing nectar levels in the feeding basin. The float valve includes a float having a frame with a buoyant member mounted thereon, the buoyant member being made of a closed-cell foam.
US11944072B1	Intelligent bird feeding observation device An intelligent bird feeding observation device, including: a storage bin, wherein a top of the storage bin is provided with a feed inlet, and two opposite sides of the storage bin are provided with a sliding groove of which one end penetrates through the storage bin; a cover body, wherein the cover body is movably covered on the feed inlet of the storage bin through a rotating shaft, and the rotating shaft is positioned in the sliding groove; a tray, wherein the tray is arranged at a bottom of the storage bin, the tray is provided with a feeding cavity with an opening at the top, and the storage bin covers part of the feeding cavity and is communicated with the feeding cavity; and a camera module, wherein the camera module is arranged on the storage bin and photographs towards the feeding cavity of the tray.
US11944071B2	Portable protective shield device for protecting pet animals against attack Described herein is a portable protective shield device for providing an instant protection to a pet animal against a sudden attack by an aggressive animal without causing any harm to the attacking animal. The device includes a pet protective shield capable of being actuated from a ready position to a protective position, the pet protective shield comprising at least one shielding member that, upon actuation, expands to form a shield around the pet. The present subject matter focuses on protecting the pet/animal under attack rather than tackling the attacker.
US11944068B2	Adjustable dog toy A dog toy comprises a first component having a body that defines a cavity, the body having an opening into the cavity. The dog toy also comprises a second component having a body comprising a first protrusion and a second protrusion. Each of the first protrusion and the second protrusion is selectively insertable into the first component opening in a manner where it remains within the opening to close the opening and is removable from the first component opening when a separation force is applied. The separation force for the first protrusion is different than the separation force for the second protrusion. A treat can be inserted into the first component cavity, the first component cavity can be closed by insertion of the first protrusion or second protrusion into the first component opening, and a dog can gain access to the treat by separating the first component and the second component.
US11944067B2	Cage assembly for animal test subjects A cage assembly can have at least one enclosure. Each enclosure can have a floor defining a floor area having a major dimension and a cover having a bottom surface. A spacing between the bottom surface of the cover and the floor can define a cage height. At least one sidewall can extend between the floor and the cover. A ratio of the cage height to the major dimension of the floor area of each enclosure of the at least one enclosure can be at least 0.70.
US11944056B1	Maize hybrid X13R182 A novel maize variety designated X13R182 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X13R182 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X13R182 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X13R182, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X13R182 are provided. Methods for producing maize varieties derived from maize variety X13R182 and methods of using maize variety X13R182 are disclosed.
US11944053B2	Integrated ceiling device with mechanical arrangement for a light source An integrated ceiling device includes integrated ceiling device including an electronic device housing, a heat dissipating structure, a light source, and a reflection/refraction assembly. An air gap is defined between the electronics housing and other components allowing ambient air to flow therethrough for cooling.
US11944051B2	Planter with elevated internal portion and water preservation features A planter includes an interior surface and a riser extending from a bottom of the interior surface and including a space between the riser and lateral walls of the planter. The riser includes an open-top recess formed in a top portion of the riser. A plate including a protrusion extending from a bottom side of the plate and forming an open-top reservoir on a top side of the protrusion. The protrusion is configured to be coupled with the recess to secure the plate to the riser.
US11944050B2	Fixtureless lamp The present disclosure provides advantageous lighting systems that can be installed on parallel rows of horizontal supports. The lighting systems can be configured to have a single electrical feedthrough on one end of the lamp that can also act as a mating feature between the lamp and supports. More particularly, the present disclosure provides improved lighting systems that are fixtureless, waterproof, customizable, and easy to install/remove.
US11944049B2	Vertical grow tower conveyance system for controlled environment agriculture including tower shuttle A vertical farming structure having vertical grow towers and associated conveyance mechanisms for moving the vertical grow towers through a controlled environment, while being exposed to controlled conditions, such as lighting, airflow, humidity and nutritional support. The present disclosure describes a reciprocating cam mechanism that provides a cost-efficient mechanism for conveying vertical grow towers in the controlled environment. The reciprocating cam mechanism can be arranged to increase the spacing of the grow towers as they are conveyed through the controlled environment to index the crops growing on the towers. The present disclosure also describes a tower shuttle mechanism that provides operational flexibility by decoupling the loading and unloading operations of the grow towers from the vertical farming structure and, therefore, allowing multiple grow towers to be extracted for harvesting in a batch process before loading new grow towers into the vertical farming structure in a separate process.
US11944047B2	Automated data-based irrigation system and method A system and method for obtaining real-time data regarding the condition of a crop and planning and executing an irrigation cycle in response to the data. The invention uses an unmanned aerial vehicle to survey the conditions within an irrigated area. The unmanned aerial vehicle is operated from a base station mounted on the boom assembly of a pivot irrigation system. The inventive system determines a position for the base station and uses that position to land the UAV.
US11944045B2	Liquid containment and focus for subterranean capillary irrigation This invention is related to a gravity flow, multipurpose bidirectional nonpressurized climate smart subirrigation conduit apparatus for managing soil moisture and growing plants. The subirrigation conduit apparatus creates a suspended virtual water table at the desired buried depth, thus creating a anaerobic saturated zone and a capillary fringe. The capillary fringe is describe in the art as a moisture zone that has perfect air and moisture mixture for plant growth, can also be used to irrigate with high turbidity obstruction liquids such as precipitation runoff and alternative waters such as untreated greywater. When too much water is present within the landscape, the Multipurpose bidirectional nonpressurized climate smart subirrigation conduit apparatus can be used in reverse flow to drain the landscape. Bidirectional nonpressurized flow is achieved by gravity water equalization thus cutting any need for energy consumption.
US11944037B2	Hemp harvester A hemp harvester which strips the leaves and flowers from the stalks and branches of a hemp plant and separates them for subsequent processing includes a branch lifter for lifting and bunching the branches of the hemp plants as the harvester advances towards them; a stripper with counter rotating stripper rollers having radially extending resiliently flexible paddles which converge as said rolls turn to trap said flowers and leaves between them and strip the flowers and leaves from said stalks and branches; a capture system for capturing the separated flowers and leaves as they are stripped from the stalk and branches of the plants, a transfer and mulcher system for mulching and transferring said flowers and leaves from said capture system to a collection chamber; and an uprooting system for uprooting and collecting the stripped plants as said hemp harvester passes.
US11944036B2	Forage harvester A forage harvester with at least one work assembly is disclosed. The forage harvester has a corn cracker to process grain components and a driver assistance system. The driver assistance system controls the corn cracker by adjusting the machine parameters of the corn cracker. In particular, the driver assistance system has an optimization model which includes a multidimensional characteristic map that represents a relationship between a processing quality of the grain components and at least three parameters that comprise an input parameter representing a current harvesting process state and at least one machine parameter of the corn cracker as an output parameter. Thus, the driver assistance system determines the output parameter in the control routine during the harvesting process based on the varying input parameter from the optimization model and adjusts it in the corn cracker to achieve a uniform given processing quality of the grain components during the harvesting process.
US11944032B2	Autonomous vehicle systems and methods An autonomous mowing system comprising: a memory configured to hold a set of path data defining a set of paths, the set of paths comprising a transit path to a maintenance area and a set of mow paths to cover the maintenance area; a processor coupled to the memory; a computer-readable medium coupled to the processor, the computer-readable medium storing a set of instructions executable by the processor, the set of instructions comprising instructions for: using the set of path data, determining a plurality of candidate routes that traverse the transit path and fully cover the maintenance area and a total cost for each of the plurality of candidate routes; determining a least cost route from the plurality of candidate routes; and configuring an autonomous mower to follow the least cost route to mow the maintenance area.
US11944031B2	Produce harvesting apparatus and precision farming system This invention relates to a precision agriculture produce harvesting system and produce harvesting apparatus configured for integration with the system, an essential feature of which is a harvesting device subsystem (100) that includes a harvesting device, for instance pruning shears (102) and a harvesting separation stroke detector (108) housed within a control module housing (110) mounted to the shears (102). A person operating the pruning shears (102) produces discernible separation strokes when the handles (104) of the shears (102) are squeezed together to produce a shearing action. The stroke detector (108) detects the separation strokes of the shears (102). By the addition of the control module (108) to the pruning shears (102), the shears are essentially converted into a data logging device by means of which important aspects of a produce harvesting process can be digitised and supplied to a harvest data digital data processing system.
US11944027B2	Combine header equipped with an automated header transport system and drawbar A header that includes at least one support and transport wheel assembly having an axle and two wheels. The wheel assembly is coupled to the main body of the header by an actuating system that includes an actuator mechanism configured to actuate a swivel movement of the axle and the wheels, the swivel movement being configured to bring the wheel assembly to or from a position wherein the axle is transversal to the longitudinal direction of the header. The wheel assembly is equipped with a drawbar that is deployable from a storage position to a deployed position, wherein the movement of the drawbar between the positions is synchronized with the swivel movement of the wheel assembly.
US11944026B1	Agricultural implements with real time adjustments based on measured soil properties An agricultural implement has implement settings for soil engaging tools that are controlled based on measured temporal and long-term soil properties in a field. A controller receives data from various soil and optical sensors and provides decision support for adjusting the implement settings. The soil sensors include a square or modified square electrical array that includes two independent, isolated disk coulters running side-by-side followed by two independent, isolated soil engaging runners. One runner has an optical sensor for organic matter, and the other runner has a temperature and moisture sensor. Above-ground optical sensors can be used to measure soil and plant material ahead of and behind the soil engaging tool. The controller can provide real time alerts to an operator that adjustments to the implement settings are needed, or the adjustments can be made automatically based on operator set thresholds, factory settings, or historical individual or global grower adjustments.
US11944025B2	Agricultural drill/planter/coulter/disc blade with step plane notch edge A ground engaging agricultural blade, coulter, or disc having a central opening adapted to be attached to an implement for rotation about a substantially horizontal axis of rotation; the coulter or disc have an outer periphery; and plurality of step plane notches disposed in the outer periphery. The blade can be used with a hub disposed around the central opening or a spacer spool on a shaft extending through the central openings of adjacent blades, the spacer spools extending radially outwardly by a distance.
US11950521B2	Resistive random-access memory (RRAM) device and forming method thereof A resistive random-access memory (RRAM) device includes a bottom electrode, a high work function layer, a resistive material layer, a top electrode and high work function spacers. The bottom electrode, the high work function layer, the resistive material layer and the top electrode are sequentially stacked on a substrate, wherein the resistive material layer includes a bottom part and a top part. The high work function spacers cover sidewalls of the bottom part, thereby constituting a RRAM cell. The present invention also provides a method of forming a RRAM device.
US11950520B2	Optically switchable memory A method of manufacturing a storage device for storing information, apparatus for storing information, an optical memristor device and a memory cell are disclosed. A method comprises providing at least one first electrode and at least one further electrode and providing each of at least one region of a first material between, and in electrical connection with, a respective first electrode and a further electrode whereby said step of providing at least one region comprises providing in the first material, a plurality of changeable particles that have charge storage capacity and at least one electrical property that is reversibly changeable responsive to absorption of incident electromagnetic radiation.
US11950508B2	Light emitting device A light emitting device includes a first electrode, a second electrode, and at least one emission layer between the first electrode and the second electrode and includes at least one polycyclic compound represented by Formula 1 below, thereby exhibiting long service life characteristics. In Formula 1, the substituents are the same as defined in the detailed description.
US11950507B2	Organic electroluminescence device Disclosed is an organic electroluminescence device. The organic electroluminescence device has an organic layer having a specific combination in which a hole transporting material is doped with a p-type conductive doped material. The organic electroluminescence device can provide better device performance, such as lifetime improvement and voltage reduction.
US11950505B2	Carbazole-based compound and organic light emitting diode comprising same Provided is a compound of Chemical Formula 1: wherein: X1 is N or CR, X2 is N or CR′, and X3 is N or CR″; two or more of X1 to X3 are N; R, R′, R″ and R1 each independently is hydrogen or deuterium, a is an integer of 0 to 9, and when a is 2 or greater, the R1s are the same as or different from each other; Ar1 and Ar2 each independently is a substituted or unsubstituted aryl group; L is a direct bond or a substituted or unsubstituted arylene group, n is an integer of 1 to 3, and when n is 2 or 3, the Ls are the same as or different from each other; and R11 to R18 each independently is hydrogen, deuterium, a nitrile group, or a substituted or unsubstituted: alkyl group, cycloalkyl group, alkoxy group, aryloxy group, aryl group, or heteroaryl group, or bond to adjacent groups to form a substituted or unsubstituted ring, and an organic light emitting device comprising same.
US11950503B2	Organic material and photoelectric conversion element An organic material represented by General Formula (1): where, in General Formula (1), R1 is an alkyl group having 6 carbon atoms or more but 20 carbon atoms or less; n is an integer of from 1 through 3; X1 to X4 are each a hydrogen atom or a fluorine atom; and Z is a compound represented by General Formula (2), (3), or (4) below: where, in General Formulae (2) to (4), R2, R3, and R4 are each an alkyl group having 6 carbon atoms or more but 20 carbon atoms or less; and Y is an oxygen atom or a sulfur atom.
US11950500B2	Organic light emitting diode and organic light emitting device having thereof The present disclosure relates to an organic light emitting diode that includes at least one emitting material layer including an anthracene-based host and a boron-based dopant, at least one electron blocking layer including an amine-based compound substituted with at least one polycyclic aryl group, and optionally at least one hole blocking layer including an azine-based compound or a benzimidazole-based compound. The organic light emitting diode has enhanced luminous efficiency as well as excellent luminous lifetime.
US11950498B2	Compound, material for organic electroluminescence element using same, organic electroluminescence element, and electronic device This compound is represented by formula (1)
US11950495B2	Organic light-emitting device and organometallic compound Provided are an organometallic compound represented by Formula 1 and an organic light-emitting device including a first compound represented by Formula 1. The organic light-emitting device includes: a first electrode; a second electrode facing the first electrode; and an organic layer between the first electrode and the second electrode and including an emission layer, wherein the organic layer includes the first compound represented by Formula 1:
US11950492B2	Organic electroluminescence device and polycyclic compound for organic electroluminescence device An organic electroluminescence device includes a first electrode, a hole transport region on the first electrode, an emission layer on the hole transport region, an electron transport region on the emission layer, and a second electrode on the electron transport region, wherein the emission layer includes a polycyclic compound containing one electron donor and one electron acceptor, and the electron donor includes an azaborine group and the electron acceptor includes any one of a cyano group, a carbonyl group, a boron group, a sulfonyl group, a sulfinyl group, a phosphine oxide group, a nitrogen-containing five-membered ring, or a nitrogen-containing six-membered monocyclic ring.
US11950491B2	Semiconductor mixed material and application thereof A semiconductor mixed material comprises an electron donor, a first electron acceptor and a second electron acceptor. The first electron donor is a conjugated polymer. The energy gap of the first electron acceptor is less than 1.4 eV. At least one of the molecular stackability, π-π*stackability, and crystallinity of the second electron acceptor is smaller than the first electron acceptor. The electron donor system is configured to be a matrix to blend the first electron acceptor and the second electron acceptor. The present invention also provides an organic electronic device including the semiconductor mixed material.
US11950490B2	Display device having conductive spacers connecting anode and cathode on opposing substrates The disclosure provides a display panel and a display device. The display panel includes a first substrate and a second substrate, the second substrate has an organic electroluminescent device, an anode layer of the organic electroluminescent device is away from the first substrate and a cathode layer thereof is closer to the first substrate than the anode layer; the cathode layer is electrically connected to an auxiliary electrode on a light entering surface of the first substrate through multiple conductive spacers, the cathode layer is a transparent electrode layer; the auxiliary electrode has a resistance smaller than that of the cathode layer of the organic electroluminescent device; the auxiliary electrode is a grid-shaped auxiliary electrode and in a non-display region, the auxiliary electrode is opaque; the multiple conductive spacers includes first conductive spacers on the auxiliary electrode and second conductive spacers on the cathode layer of the second substrate.
US11950486B2	Display device and manufacturing method thereof, electronic apparatus A display device, an electronic apparatus and a method for manufacturing the display device are disclosed. The display device includes an array substrate and a first thin film encapsulation layer disposed on the array substrate. The array substrate is a silicon based organic light-emitting diode array substrate, and the array substrate includes a silicon substrate and a light-emitting device disposed on the silicon substrate; a second thin film encapsulation layer disposed between the light-emitting device and the first thin film encapsulation layer; and a color filter layer disposed between the first thin film encapsulation layer and the second thin film encapsulation layer, at each edge of the first thin film encapsulation layer, an orthographic projection of the array substrate on a plane parallel to the array substrate extends beyond an orthographic projection of the first thin film encapsulation layer on the plane.
US11950485B2	Display apparatus Provided is a display apparatus including a substrate having a display area including a main pixel, and a sensor area including a sub-pixel and a transmission portion, a plurality of first lines arranged in the sensor area, extending in a first direction, and bypassing the transmission portion, and a first electrode layer under the plurality of first lines, between the sub-pixel and the transmission portion, and at least partially overlapping a spacing region between the plurality of first lines.
US11950478B2	Display apparatus A display apparatus is disclosed that includes a first display area and a second display area adjacent to the first display area. The first and second display areas include first and second light emitting areas having first and second pixel densities, respectively. The first and second light emitting areas at an interface between the first and second display areas are arranged such that in operation light emitted by the first and second light emitting areas produces a gradual decrease in light intensity from the first display area to the second display area near the interface.
US11950477B2	OLED display panel and OLED display device The present application discloses an OLED display panel, including a plurality of first color sub-pixels, a plurality of second color sub-pixels, and a plurality of third color sub-pixels, wherein the first-color subpixels, the second-color subpixels, and the third-color subpixels constitute a plurality of repeating units, the repeating units include a first repeating unit and a second repeating unit, and the first repeating unit and the second repeating unit are arranged at intervals in any row or any column.
US11950476B2	Display device having an opening between pixels A display device includes a substrate; a transistor disposed on the substrate; a first insulating layer disposed on the transistor; and a first pixel electrode and a second pixel electrode disposed on the first insulating layer to be adjacent to each other. The first insulating layer includes a first opening between the first pixel electrode and the second pixel electrode.
US11950475B2	Display device including light-emitting layers with opposing-direction portions A display device includes a display panel having first and second regions with the second region having a higher resolution than the first region and an electronic module under the first region. The display panel includes first and second emission layers in a first sub-region of the first region with the second emission layer being spaced apart from the first emission layer. The first emission layer has a first light-emitting portion and a second light-emitting portion adjacent to the first light-emitting portion in a first direction, and the second emission layer has a third light-emitting portion and a fourth light-emitting portion adjacent to the third light-emitting portion in the first direction. The first light-emitting portion is inclined from the second light-emitting portion toward a lower surface of the display panel, and the fourth light-emitting portion is inclined from the third light-emitting portion toward an upper surface of the display panel.
US11950472B2	Flexible display apparatus including dummy pattern between wirings A flexible display apparatus includes a flexible substrate having an active area and an inactive area, the inactive area including a first area adjacent to the active area, a second area in which a pad is disposed, and a bending area disposed between the first area and the second area, wherein a plurality of wirings extending from the second area to the first area are disposed in the bending area, and at least one dummy pattern is in between the plurality of wirings.
US11950470B2	Display device with hole surrounded by data lines in different layers A display device comprising: first and second pixels; a first data line connected to the first pixel and configured to have data voltages applied thereto; and a second data line connected to the second pixel, the second data line being adjacent to the first data line, and configured to have the data voltages applied thereto, wherein the first data line includes a 1A-th data line which is in a first data layer, and the second data line includes a 2B-th data line which is in a second data layer different from the first data layer.
US11950467B2	Display device and method of providing the same A display device includes a driving member which provides an electrical signal and includes a connection terminal which transmits the electrical signal, a pad electrode which receives the electrical signal from the driving member and is electrically connected to the connection terminal of the driving member, an organic layer on the pad electrode, the organic layer including a side surface defining an opening of the organic layer which exposes the pad electrode to outside the organic layer and within the opening, a protrusion protruding from the side surface, and a connection conductive layer which electrically connects the pad electrode to the connection terminal, within the opening of the organic layer, where the connection conductive layer covers each of the pad electrode which is exposed by the opening of the organic layer, the side surface of the organic layer, and the protrusion of the organic layer.
US11950466B2	Display substrate, method of manufacturing the same, and display apparatus A display substrate, a method of manufacturing the same, and a display apparatus are provided. Multiple subpixels in the display substrate include first and second subpixels. Each subpixel includes a power signal line pattern and a light-emitting element. The power signal line pattern includes first and second power line portions. At least a part of the first power line portion extends in a second direction. The light-emitting element includes an anode pattern. In the display substrate, an overlap between the anode pattern of the first subpixel and the power signal line pattern is larger in area than an overlap between the anode pattern of the second subpixel and the power signal line pattern, an overlap between the anode pattern of the first subpixel and the first power line portion is larger in area than an overlap between the anode pattern of the first subpixel and the second power line portion.
US11950462B2	Display device A first conductive layer in the same layer as that of a first electrode is coupled to a third conductive layer and a second electrode in the same layer as that of a third metal layer through a slit formed in a flattening film of a non-display area. Second conductive layers in the same layer as that of a second metal layer are provided to overlap with the slit.
US11950458B2	Display apparatus having self-aligned structures A display apparatus includes a base substrate, a thin film transistor layer on the base substrate, an insulation layer on the thin film transistor layer, a first electrode on the insulation layer and in a light emitting area, a pixel defining layer having an opening that has a size and a shape substantially same as that of the first electrode, and on the insulation layer, a light emitting layer on the first electrode, and a second electrode on the light emitting layer.
US11950454B2	Display panel and display device A display panel and a display device are disclosed, the display panel comprises: a base substrate; and pixel circuits in an array, the display panel comprises a light transmittance region and a display region around the light transmittance region, the pixel circuits are disposed in the display region, a gate line of each row of m rows of pixel circuits is divided into a first gate line portion and a second gate line portion which are connected through an auxiliary gate line, a data line of each column of n columns of pixel circuits is divided into a first data line portion and a second data line portion which are connected through an auxiliary data line.
US11950453B2	Display device and method of manufacturing the same A display device includes a ferromagnetic layer including a ferromagnetic material, a cover window disposed above the ferromagnetic layer, and a display panel disposed between the ferromagnetic layer and the cover window, where the display panel includes a curved area which is bent.
US11950445B2	Foldable display screen including multi-cover protection layers A foldable display screen includes a display panel, a first optical adhesive layer, a first cover protection layer, a second optical adhesive layer, and a second cover protection layer; the first optical adhesive layer is located on the display panel; the first cover protection layer is located on a side of the first optical adhesive layer away from the display panel; the second optical adhesive layer is located on a side of the first cover protection layer away from the first optical adhesive layer; the second cover protection layer is located on a side of the second optical adhesive layer away from the first cover protection layer. At an operating temperature, an elastic modulus of the second optical adhesive layer is smaller than an elastic modulus of the first optical adhesive layer.
US11950443B2	OLED display device An OLED display device includes a display panel, a metal sheet, and a middle frame. The display panel is closely attached to one side of the metal sheet, and is defined with a foldable area and a non-foldable area. The metal sheet is disposed between the middle frame and the display panel. The middle frame is disposed on one side of the metal sheet facing away from the display panel. The foldable area of the middle frame is disposed with a hub piece, and the foldable area of the metal sheet is disposed with a magnet sheet, and the magnet sheet is disposed opposite to the hub piece.
US11950441B2	Organic electron-conducting layer having N-dopant Various embodiments may include an organic electron-conducting layer comprising an n-dopant having the structure: wherein Ln denotes a number n of independently selected ligands L; M is a metal; R and R′ comprise compounds independently selected; n is from 0 to 5; m is from 1 to 6; n+m is from 2 to 6; and x has a value of 0, 1 or 2.
US11950438B2	Inorganic light emitting diode and inorganic light emitting device including the same The present disclosure relates to an inorganic light emitting diode (LED) in which an emitting material layer (EML) includes inorganic luminescent particles dispersed in a siloxane matrix, wherein the siloxane matrix has a thickness equal to or less than a thickness of a layer of the inorganic luminescent particles, and an inorganic light emitting device including the inorganic LED. The siloxane matrix allows surface defects of the inorganic luminescent particles to be minimized and to prevent injections of holes and electrons from being delayed. The inorganic LED and the inorganic light emitting device lower their driving voltages and improve their luminous efficiency.
US11950429B2	Ferroelectric capacitors, transistors, memory devices, and methods of manufacturing ferroelectric devices The present invention relates to ferroelectric capacitors, transistors, memory device, and method of manufacturing ferroelectric devices. The ferroelectric capacitor includes a first electrode, a second electrode facing the first electrode, a ferroelectric layer between the first electrode and the second electrode, and an interfacial layer between the ferroelectric layer and the first electrode or between the ferroelectric layer and the second electrode. The ferroelectric layer includes hafnium-based oxide. The interfacial layer includes HfO2.
US11950428B2	Three-dimensional memory device and manufacturing method thereof A memory device includes a first stacking structure, a second stacking structure, a plurality of first isolation structures, gate dielectric layers, channel layers and conductive pillars. The first stacking structure includes a plurality of first gate layers, and a second stacking structure includes a plurality of second gate layers, where the first stacking structure and the second stacking structure are located on a substrate and separated from each other through a trench. The first isolation structures are located in the trench, where a plurality of cell regions are respectively confined between two adjacent first isolation structures of the first isolation structures in the trench, where the first isolation structures each includes a first main layer and a first liner surrounding the first main layer, where the first liner separates the first main layer from the first stacking structure and the second stacking structure. The gate dielectric layers are respectively located in one of the cell regions, and cover opposing sidewalls of the first stacking structure and the second stacking structure as well as opposing sidewalls of the first isolation structures. The channel layers respectively cover an inner surface of one of the gate dielectric layers. The conductive pillars stand on the substrate within the cell regions, and are laterally surrounded by the channel layers, where at least two of the conductive pillars are located in each of the cell regions, and the at least two conductive pillars in each of the cell regions are laterally separated from one another.
US11950425B2	Semiconductor memory device with mold structure A mold structure includes gate electrodes stacked on a first substrate, a channel structure penetrating a first region of the mold structure to cross the gate electrodes, a first through structure penetrating a second region of the mold structure, and a second through structure penetrating a third region of the mold structure. The mold structure includes memory cell blocks extending in a first direction and spaced apart in a second direction, and a dummy block extending in the first direction and disposed between the memory cell blocks. Each of the memory cell and dummy blocks includes a cell region and an extension region arranged in the first direction. The first region is the cell region of one of the memory cell blocks, the second region is the extension region of the one of the memory cell blocks, and the third region is the extension region of the dummy block.
US11950423B2	Semiconductor device and electronic system including the same A semiconductor device includes: a cell area including a cell substrate, a memory cell array, and a first bonding metal pad on the memory cell array, the memory cell array including a plurality of word lines stacked on the cell substrate and a plurality of bit lines on the plurality of word lines; and a peripheral circuit area having the cell area stacked thereon and including a peripheral circuit substrate, a plurality of circuits on the peripheral circuit substrate, and a second bonding metal pad bonded to the first bonding metal pad, wherein the plurality of circuits include: a plurality of planar channel transistors respectively including a channel along a top surface of the peripheral circuit substrate; and at least one recess channel transistor including a channel along a surface of a recess trench arranged in the peripheral circuit.
US11950420B2	Memory device A memory device includes gate electrode layers stacked on an upper surface of a substrate and each including a plurality of unit electrodes extending in a first direction, and a plurality of connecting electrodes connecting the unit electrodes to each other. The memory device also includes channel structures extending through the gate electrode layers in a direction perpendicular to the upper surface of the substrate, first common source lines extending in the first direction and interposed between the unit electrodes, and second common source lines extending in the first direction between the first common source lines and each having a first line and a second line separated from each other in the first direction by the connecting electrodes.
US11950418B2	Method and structure for forming stairs in three-dimensional memory devices Embodiments of a three-dimensional (3D) memory device and fabrication methods thereof are disclosed. In an example, a method for forming a 3D memory device includes the following operations. A dielectric stack is formed to have interleaved sacrificial layers and dielectric layers. A stair is formed in the dielectric stack. The stair includes one or more sacrificial layers of the sacrificial layers and one or more dielectric layers of the dielectric layers. The stair exposes one of the sacrificial layers on a top surface and the one or more sacrificial layers on a side surface. An insulating portion is formed to cover the side surface of the stair to cover the one or more sacrificial layers. A sacrificial portion is formed to cover the top surface of the stair. The sacrificial portion is in contact with the one of sacrificial layers. The one or more sacrificial layers and the sacrificial portion are replaced with one or more conductor layers.
US11950414B2	Memory device According to one embodiment, a memory device includes a substrate; a structure including a plurality of conductive layers stacked on the substrate; and a pillar arranged inside the structure and including a semiconductor layer that extends in a direction perpendicular to a surface of the substrate. The semiconductor layer includes a first portion on a side of an upper portion of the structure, and a second portion between the first portion and the substrate. The first portion has a thickness larger than a thickness of the second portion.
US11950413B2	High voltage polysilicon gate in high-K metal gate device An integrated circuit device includes a plurality of metal gates each having a metal electrode and a high-κ dielectric and a plurality of polysilicon gates each having a polysilicon electrode and conventional (non high-κ) dielectrics. The polysilicon gates may have adaptations for operation as high voltage gates including thick dielectric layers and area greater than one μm2. Polysilicon gates with these adaptations may be operative with gate voltages of 10 V or higher and may be used in embedded memory devices.
US11950412B2	Gate fringing effect based channel formation for semiconductor device A memory device is described. Generally, the device includes a string of memory transistors, a source select transistor coupled to a first end of the string of memory transistor and a drain select transistor coupled to a second end of the string of memory transistor. Each memory transistor includes a gate electrode formed adjacent to a charge trapping layer and there is neither a source nor a drain junction between adjacent pairs of memory transistors or between the memory transistors and source select transistor or drain select transistor. In one embodiment, the memory transistors are spaced apart from adjacent memory transistors and the source select transistor and drain select transistor, such that channels are formed therebetween based on a gate fringing effect associated with the memory transistors. Other embodiments are also described.
US11950411B2	Semiconductor memory devices with dielectric fin structures A semiconductor device includes a plurality of first nanostructures extending along a first lateral direction. The semiconductor device includes a first epitaxial structure and second epitaxial structure respectively coupled to ends of each of the plurality of first nanostructures along the first lateral direction. The semiconductor device includes a dielectric fin structure disposed immediately next to a sidewall of each of the plurality of first nanostructures facing a second lateral direction perpendicular to the first lateral direction. The semiconductor device includes a first gate structure wrapping around each of the plurality of first nanostructures except for the sidewalls of the first nanostructures. The semiconductor device includes a metal structure disposed above the first gate structure and coupled to one of the first or second epitaxial structure.
US11950409B2	Semiconductor device having diode connectedto memory device and circuit including the same A semiconductor device and a circuit are provided. The semiconductor device includes a substrate, a first gate structure, a first doped region, and a capacitor structure. The substrate includes a first well region having a first conductive type. The first gate structure is disposed on the substrate. The first doped region is in the substrate and has a second conductive type different from the first conductive type. The first gate structure and the first doped region are included in a first transistor. The capacitor structure includes a first electrode electrically coupled to the first doped region. The second doped region is in the substrate and has the second conductive type. The second doped region is electrically coupled to the first electrode of the capacitor structure and the first doped region.
US11950403B2	Widened conductive line structures and staircase structures for semiconductor devices Systems, methods, and apparatuses for widened conductive line structures and staircase structures for semiconductor devices are described herein. One memory device includes an array of vertically stacked memory cells, the array including a vertical stack of horizontally oriented conductive lines. Each conductive line comprises a first portion extending in a first horizontal direction and a second portion extending in a second horizontal direction, wherein the second portion of each conductive line is of a width greater than the first portion of each conductive line.
US11950402B2	Memory device having 2-transistor vertical memory cell and shield structures Some embodiments include apparatuses and methods of forming the apparatuses. One of the apparatuses includes a conductive region, a first data line, a second data line, a first memory cell coupled to the first data line and the conductive region, a second memory cell coupled to the second data line and the conductive region, a conductive structure, and a conductive line. The first memory cell includes a first transistor coupled to a second transistor, the first transistor including a first charge storage structure. The second memory cell includes a third transistor coupled to a fourth transistor, the third transistor including a second charge storage structure. The conductive structure is located between and electrically separated from the first and second charge storage structures. The conductive line forms a gate of each of the first, second, third, and fourth transistors.
US11950390B2	Conductor assembly for a power distribution system An electrical conductor assembly for use in a power distribution assembly includes an electrical conductor and a casing covering at least a portion of the electrical conductor. A spring member is mounted to the casing and configured to apply a compressive force to the electrical conductor.
US11950389B2	Subsea variable speed drive apparatus A subsea variable speed drive apparatus comprising a pressure resistant container (90) comprising a curved wall section having a curved, internal surface (90a); and a variable speed drive comprising at least one power electronics module (50) arranged inside the container and held at a predetermined ambient pressure. The at least one power electronics module is mounted on a heatsink (40) which is mounted on the internal surface, the heatsink comprising a curved surface (40b) contacting the internal surface and having a radius of curvature corresponding to the radius of curvature of the internal surface. A subsea hydrocarbon fluid pumping system comprising such subsea variable speed drive apparatuses and a related method are also disclosed.
US11950388B2	Electronic board for voltage converter Circuit board, defining a plurality of switching arms connected in parallel so as to convert a first voltage into a second voltage, at least one of which is DC voltage. The board includes a plurality of controllable electronic switches mounted pairwise in series on either side of a midpoint, so as to produce the switching arms connected in parallel. A plurality of decoupling capacitors are connected in parallel to one another, and in parallel to the DC voltage. Two electrically conductive layers are arranged parallel to one other, one of which is at the highest potential of the DC voltage and the other of which is at the lowest potential of the DC voltage. Each of the decoupling capacitors having one terminal connected to one of these electrically conductive layers and its other terminal connected to the other of these electrically conductive layers.
US11950387B2	Methods for forming hermetically-sealed packages including feedthrough assemblies Methods of forming hermetically-sealed packages are disclosed. In one or more embodiments, the hermetically-sealed package can include a housing and a feedthrough assembly that forms a part of the housing. The feedthrough assembly can include a non-conductive substrate and a feedthrough. The feedthrough can include a via from an outer surface to an inner surface of the non-conductive substrate, a conductive material disposed in the via, and an external contact disposed over the via on the outer surface of the non-conductive substrate. The external contact can be electrically coupled to the conductive material disposed in the via. Further, the external contact can be hermetically sealed to the outer surface of the non-conductive substrate by a laser bond surrounding the via.
US11950385B2	Material removal from inner surface to preserve perception of outer surface aesthetics A veneer for a wall-mounted keypad may include indicia that are laser cut therethrough and that are representative of functions that may be performed by the keypad. The veneer may include a recess that extends into an inner surface of the veneer, proximate to the indicia. The recess may be shaped such that a perceived aesthetic of an outer surface of the veneer is preserved during formation of the indicia. The recess may for example have an organic shape defined by a curved outer perimeter that does not define any corners.
US11950384B2	Dynamic electrical and fluid delivery system with indexing motion for batch processing chambers Process assemblies and cable management assemblies for managing cables in tight envelopes. A processing assembly includes a top chamber having at least one substrate support, a support shaft, a robot spindle assembly, a stator and a cable management system. The cable management system includes an inner trough assembly and an outer trough assembly configured to move relative to one another, and a plurality of chain links configured to house at least one cable for delivering power to the process assembly.
US11950383B2	Display apparatus A display apparatus according to a concept of the disclosure includes: a display panel configured to display an image in a front direction; a top chassis positioned in a front direction of the display panel; a bottom chassis positioned in a rear direction of the display panel; a rear cover covering a rear side of the bottom chassis; and a stand member being accommodatable in the rear cover and selectively coupled with a rear surface of the rear cover, wherein the rear cover includes an accommodating portion in which the stand member is accommodated and a coupling portion coupled with the stand member, and the stand member includes an inserting protrusion which is inserted into the accommodating portion and the coupling portion.
US11950378B2	Via bond attachment A method for attaching two electronics boards, e.g., a testing PCB and a space transformer, comprises rack welding resin prepreg and a mylar film to a testing PCB; laser drilling via holes in the resin prepreg and mylar film such that the holes are aligned on one side of the resin prepreg with connection/capture pads on the testing PCB and aligned (after attachment) on the other side of the resin prepreg with connection capture pads on a space transformer, filling the via holes with sintering paste; applying a pressure treatment to remove air, bubbles, and voids from the sintering paste; removing the mylar film; and using a lamination press cycle to attach a space transformer to the resin prepreg.
US11950375B2	Printing components to substrate posts A method of printing comprises providing a component source wafer comprising components, a transfer device, and a patterned substrate. The patterned substrate comprises substrate posts that extend from a surface of the patterned substrate. Components are picked up from the component source wafer by adhering the components to the transfer device. One or more of the picked-up components are printed to the patterned substrate by disposing each of the one or more picked-up components onto one of the substrate posts, thereby providing one or more printed components in a printed structure.
US11950370B2	Information processing device, information processing method, and program An information processing device is used in a mounting system that performs processing of mounting a component on a mounting target. The information processing device includes: a memory section configured to store multiple pieces of abutting part data including a shape of an abutting part that abuts against the component, multiple pieces of attachment part data including a shape of an attachment part to be attached to an attachment section to which a collection member for collecting the component is attached, and multiple pieces of connection part data including a shape of a connection part that connects the abutting part and the attachment part, in the collection member; and a control section configured to output one or more of the abutting part data, the attachment part data, and the connection part data stored in the memory section.
US11950369B2	Work system and feeder carriage transfer method A work system includes a mounting system which mounts a component on a board and an unmanned conveyance system having an unmanned conveyance vehicle. The unmanned conveyance system includes a first notifier which notifies the mounting system of an arrival notification indicating that the unmanned conveyance vehicle arrives at a position where separating the feeder carriage from the base starts, and a first processor which causes the unmanned conveyance vehicle to travel in a direction away from the base upon receiving, from the mounting system, a release notification indicating that a connection of the feeder carriage is released. The mounting system includes a second processor which causes the connection mechanism to release the connection of the feeder carriage upon receiving the arrival notification, and a second notifier which notifies the unmanned conveyance system of the release notification upon being informed of completion of the release operation.
US11950363B2	Sensor interposer employing castellated through-vias An example sensor interposer employing castellated through-vias formed in a PCB includes a planar substrate defining a plurality of castellated through-vias; a first electrical contact formed on the planar substrate and electrically coupled to a first castellated through-via; a second electrical contact formed on the planar substrate and electrically coupled to a second castellated through-via, the second castellated through-via electrically isolated from the first castellated through-via; and a guard trace formed on the planar substrate, the guard trace having a first portion formed on a first surface of the planar substrate and electrically coupling a third castellated through-via to a fourth castellated through-via, the guard trace having a second portion formed on a second surface of the planar substrate and electrically coupling the third castellated through-via to the fourth castellated through-via, the guard trace formed between the first and second electrical contacts to provide electrical isolation between the first and second electrical contacts.
US11950361B2	Method and procedure for miniaturing a multi-layer PCB A multiple layer printed circuit board (PCB) in which the cores (or core layers) are removed and replaced with prepreg layers, which provide structure integrity for the PCB. Such a multi-layer PCB may include signal layers, ground plane layers, inner signal layers, and a single core substrate layer. Each of the layers may be separated from the other layers by at least one prepreg substrate layer.
US11950359B2	Card reader A card reader for use with a card may include a card insertion part provided with an insertion port into which the card is inserted, a protruded part which is provided on a front face of the card insertion part and is protruded to a front side with respect to the card insertion part, a breakage detection wiring which is provided in an inside of the protruded part, and a detection part which detects at least one of disconnection and a short circuit of the breakage detection wiring.
US11950357B2	Circuit board for transmitting high-frequency signal and method for manufacturing the same A method for manufacturing a circuit board circuit board for transmitting high-frequency signal, including: providing a first-line circuit board (20), a second circuit board (40), at least one third circuit board (50), a fourth circuit board (60), a fifth circuit board (61), and a sixth circuit board (62); stacking the first circuit board (20), the second circuit board (40), and third circuit board (50) in that order, and stacking the fourth circuit board (60), the sixth circuit board (62), and the fifth circuit board (61) on the third circuit board (50), and pressing them together to obtain the circuit board circuit board for transmitting high-frequency signal. The method manufacturing the circuit board circuit board for transmitting high-frequency signal can reduce a width of the transmission line. The present disclosure further provides the circuit board circuit board for transmitting high-frequency signal obtained by the above method.
US11950356B2	Mating backplane for high speed, high density electrical connector A printed circuit board includes a plurality of layers including attachment layers and routing layers; and via patterns formed in the plurality of layers, each of the via patterns including first and second signal vias forming a differential signal pair, the first and second signal vias extending through at least the attachment layers; ground vias extending through at least the attachment layers, the ground vias including ground conductors; and shadow vias located adjacent to each of the first and second signal vias, wherein the shadow vias are free of conductive material in the attachment layers. The printed circuit board may further include slot vias extending through the attachment layers and located between via patterns.
US11950352B2	Split structure particle accelerators A particle accelerator can include a first waveguide portion and a second waveguide portion. The first waveguide portion can include a first plurality of cell portions and a first iris portion that is disposed between two of the first plurality of cell portions. The first iris portion can include a first portion of an aperture such that the aperture is configured to be disposed about a beam axis. The first waveguide portion can further include a first bonding surface. The second waveguide portion can include a second plurality of cell portions and a second iris portion that is disposed between two of the second plurality of cell portions. The second iris portion can include a second portion of the aperture. The second waveguide portion can include a second bonding surface.
US11950351B2	Electromagnetic field control member Provided is an electromagnetic field control member, the member including an insulating member made of a ceramic having a tubular shape and including a plurality of through holes extending in an axial direction; a conductive member that is made of a metal, seals off each of the through holes, and leaves an opening portion in the through hole, the opening portion opening to an outer periphery of the insulating member; and a power feed terminal connected to the conductive member. The through holes each include inner wall surfaces further including inclined surfaces for which a width between inner walls facing each other increases from an inner periphery of the insulating member to an outer periphery of the insulating member: and vertical surfaces that are located on an inner peripheral side of the insulating member and for which a width between inner walls facing each other is constant.
US11950350B2	Radio wave radiating device and oven having same A radio wave radiating device includes: a radio wave supply unit extending in one direction, one end of the radio wave supply unit being connected to a power source, an earth part spaced apart from the radio wave supply unit by a predetermined distance in a direction intersecting with the one direction, extending in the one direction, one end of the earth part being connected to a ground, and a radiating element connected to another end of the radio wave supply unit and another end of the earth part, respectively, and configured to radiate a radio wave received from the radio wave supply unit. The radiating element includes a middle portion connecting the radio wave supply unit and the earth part, a first radiating portion extending in a direction away from the earth part, and a second radiating portion extending in a direction away from the radio wave supply unit.
US11950349B2	Combination microwave and hood system A combined ventilation and microwave oven system includes an external enclosure with a top portion defining recirculation vent outlets, a cooling air inlet, a cooling air outlet, and an outside vent outlet, first and second side portions, and a bottom portion defining a vent inlet. The vent inlet is connected with the recirculation vent outlets and the outside vent outlet via airflow pathways. A hood assembly is disposed within the external enclosure and includes a first hood fan disposed between the cooking cavity and the first side portion and a second hood fan disposed between the cooking cavity and the second side portion. The hood assembly is configured to direct air through the vent inlet and through an interior of the external enclosure. A cooling fan is disposed between the cooking cavity and the second side portion to direct air through the cooling air inlet and the cooling air outlet.
US11950348B2	Induction coil assembly for uterine ablation and method A vapor delivery device includes an induction coil system. The induction coil system can include a coiled fluid tube, a coiled wire, a capsule between the coiled fluid tube and the wire, and a cooling fluid supply configured to force a cooling fluid through the capsule across the coiled wire. The induction coil system can include a closed loop ferrite core, a wire coiled around a first portion of the ferrite core, and a fluid tube coiled around a second portion of the ferrite core. A wire coil can be contained in a cartridge system removably coupleable to a disposable vapor delivery device. The system can include a fluid flow controller and induction power regulation to maintain a specific operating pressure range for vapor within a uterus or other bodily cavity, tract, or duct.
US11950347B2	Induction heat cooking apparatus to implement WPT and PFC power converter An induction heat cooking apparatus that includes: a rectifier that is configured to convert alternating current (AC) voltage supplied from an external power source into direct current (DC) voltage; an inverter that is configured to generate current based on DC voltage received from the rectifier and provide the current to output nodes; heating coils that are configured to, based on the current generated by the inverter, generate magnetic fields for providing heat; a first capacitive unit that includes one or more resonance capacitors and that is coupled between the output nodes; a second capacitive unit that includes one or more wireless power transfer (WPT) capacitors and that is configured to be coupled between the output nodes; and a mode conversion switch that is configured to couple the second capacitive unit to the first capacitive unit in parallel is disclosed.
US11950346B2	Configuring a bridge with groups after addition of said bridge to a lighting system A system (1) for configuring a bridge (13) in a wireless lighting system (31), which has been commissioned, is configured to determine that a bridge has been added to the wireless lighting system. The wireless lighting system comprises a plurality of lighting devices (14-19). The system is further configured to obtain information relating to the plurality of lighting devices, analyze the information, and determine one or more groups of lighting devices based on the analysis. At least one of the one or more groups comprises multiple of the plurality of lighting devices. The system is further configured to configure the bridge with the determined one or more groups upon determining that the bridge has been added to the wireless lighting system.
US11950345B2	Method for controlling cheering sticks to emit light based on UWB location technology The invention discloses a method for controlling cheering sticks to emit light based on a UWB location technology, First, setting location base stations, and generating a wireless local area network by the location base stations to cover a target area; next, after cheering sticks are connected to the location base stations through the wireless local area network, calculating positions of the cheering sticks according to signals sent by the location base stations; and converting the position coordinates into display coordinates according to a stadium seat mapping table obtained from the base stations; and finally, acquiring, by the cheering sticks, animation data from the location base stations, calculating play sequences of the cheering sticks according to the animation data and the display coordinates, acquiring, by the cheering sticks, play times from the base stations, and synchronously playing the play sequences to realize animation play of a whole cheering stick array.
US11950343B2	Configurable lighting system Apparatus, systems, and methods for controlling light output in a lighting system based on defined light profiles are provided. In one example implementation, a light fixture can include a first light emitting diode (LED) array having one or more LED light sources and a second LED array having one or more LED light sources. The light fixture can include a power circuit configured to provide power to the first LED array and the second LED array according to a power distribution among the first LED array and the second LED array. The light fixture can include one or more control devices configured to control the power circuit to adjust the power distribution among the first LED array and the second LED array based at least in part on a signal indicative of a real time clock and a defined light profile associated with a user identified to be present in a space illuminated by the light fixture.
US11950337B2	Wiring boards for array-based electronic devices In accordance with certain embodiments, lighting systems include one or more lightsheets each including a plurality of strings of light-emitting elements, control elements, and power conductors for supplying power to the light-emitting elements and control elements.
US11950335B2	Display device A display device includes a glass substrate, light emitting diodes (LEDs) and driving circuits. The glass substrate includes first and second sides. The driving circuits are coupled to the LEDs. An anode of each of the LEDs receives a first anode signal different from a first reference anode signal by a first signal difference and a second anode signal different from a second reference anode signal by a second signal difference. A cathode of each of the LEDs receives a first cathode signal different from a first reference cathode signal by a third signal difference and a second cathode signal different from a second reference cathode signal by a fourth signal difference. The LEDs that are closer to the second side have greater first and third signal difference, and the LEDs that are closer to the first side have greater second fourth signal difference.
US11950334B2	Horticulture grow lights A grow light includes a plurality of cool white LEDs, a plurality of warm white LEDs, and a driver electrically coupled to the cool white LEDs and the warm white LEDs. An intensity level and spectral composition of the radiant energy emitted by the grow light may be tuned or configured by varying a ratio of the quantity of cool white LEDs to the quantity of warm white LEDs, by varying a spatial arrangement among the cool white LEDs and the warm white LEDs, or by varying a level of current provided to some or all of the cool white LEDs and the warm white LEDs.
US11950333B2	Light-emitting module Light (light (L1)) at peak luminous intensity in a light distribution of a first region (12a) of a light-irradiating surface (12) is sent to a first region (32a) of a target surface (32) via a first region (22a) of a reflecting surface (22). Light (light (L2)) at peak luminous intensity in a light distribution in a second region (12b) of the light-irradiating surface (12) is sent to a second region (32b) of the target surface (32) via a second region (22b) of the reflecting surface (22). An optical distance from the first region (12a) of the light-irradiating surface (12) to the first region (32a) of the target surface (32) via the first region (22a) of the reflecting surface (22) is greater than an optical distance from the second region (12b) of the light-irradiating surface (12) to the second region (32b) of the target surface (32) via the second region (22b) of the reflecting surface (22). The luminous intensity of the light (L1) is higher than the luminous intensity of the light (L2).
US11950330B2	Fluid permeable heater assembly for an aerosol-generating system and method for assembling a fluid permeable heater for an aerosol-generating system A cartridge for an aerosol-generating system is provided, including a liquid storage portion including a housing containing a liquid aerosol-forming substrate, the housing having an open end; and a heater assembly including: an electrical heating element configured to heat the substrate to form an aerosol, the heating element including a planar filament arrangement having one or more electrically conductive filaments, an electrically insulating substrate having a planar attachment face, the filament arrangement disposed on the planar attachment face, and clamping elements mechanically fixing the filament arrangement to the electrically insulating substrate and applying a pulling force onto the filament arrangement, at least a portion of the heater assembly being fluid-permeable, and the heater assembly being arranged over the open end of the housing.
US11950328B2	System and method for a closed-loop bake-out control A control system for operating a heater includes a controller configured to determine an operational power level based on a measured performance characteristic of the heater, a power set-point, and a power control algorithm, determine a bake-out power level based on a measured leakage current at the heater, a leakage current threshold, and a moisture control algorithm, and select a power level to be applied to the heater. The selected power level is the lower power level from among the operational power level and the bake-out power level.
US11950324B2	Techniques for multi-data rate communications Techniques for multi-data rate communications include receiving, by a first node device within a mesh network, an information element that specifies one or more communication modes supported by a second node device within the mesh network; selecting, by the first node device, a first communication mode from the one or more communication modes, wherein a first metric value determined for the first communication mode based on the information element is lower than a second metric value determined for a default communication mode by a threshold value; and configuring, by the first node device, a communication link between the first node device and the second node device according to the first communication mode.
US11950322B2	Storage of UE contexts in RAN for inactive UEs Systems and methods are disclosed herein that relate to configuration of a periodic updating timer for, e.g., a Radio Access Network (RAN)-controlled inactive state. In some embodiments, a method of operation of a RAN node in a cellular communications network comprises configuring a User Equipment (UE) with a timer value T for a periodic updating timer. In this manner, the RAN node is able to configure the UE with a time value T, e.g., for use by the UE for providing periodic update messages while the UE is operating in an inactive state such as, e.g., a RAN-controlled inactive state.
US11950321B2	Methods and systems of using remote subscriber identification modules at a device The present invention discloses methods and systems for communicating at a cellular router between a first wireless communication module and a first subscriber identity module (SIM). The cellular router receives a first request from a first wireless communication module and encapsulates the first request in a first modified request. The cellular router then sends the first modified request to a first SIM card in a first communication apparatus and waits for a first modified reply. While waiting for the first modified reply the cellular router sends at least one halt message to the first wireless communication module after a first time threshold. After receiving the first modified reply, the cellular router decapsulates the first modified reply to retrieve a first reply and sends the first reply to the first wireless communication module where the first modified reply is a reply to the first modified request.
US11950316B1	Vehicle-passenger assistance facilitation Vehicles may be associated with a variety of different types of events, including events associated with vehicle operations and/or events associated with vehicle passengers. The present disclosure is related to, when an event is detected, exchanging information with a vehicle passenger, such as via the passenger's mobile device and/or wearable device. In some instances, an event may be detected, and examples of the present disclosure may provide an application notification presenting various information. The notification may, in some examples, be configured to help the passenger locate the passenger device, to alert the passenger to the event, to provide instructions, and/or to provide a control interface for controlling a vehicle operation. In some examples, the notification may supersede operations of the passenger device, such as by being presented even if the device is in a locked state or has an unrelated application open and in the foreground.
US11950312B2	Terminal apparatus, base station apparatus, and method A terminal apparatus in communication with a base station apparatus includes a receiver configured to receive, from the base station apparatus, a message related to Radio Resource Control (RRC) connection reconfiguration, and a processing unit. The processing unit determines, based on information included in the message related to the RRC connection reconfiguration, a DRB to which a DAPS is to be applied and a DRB to which the DAPS is not to be applied, and associates, with a target primary cell, an RLC entity and a DTCH logical channel for the DRB to which the DAPS is not to be applied.
US11950311B2	Terminal apparatus and method for storing priority information for cell reselection A terminal apparatus includes: a transmitter configured to transmit a first message for requesting resume from an inactive state to a connected state; a receiver configured to receive a second message that includes priority information for cell selection (first information) and indicates a transition to an idle state (release of connection); and a controller configured to store the first information, in which the controller determines, based on whether or not a transition from an inactive state to an idle state is triggered by reception of the second message, in a case of storing the first information, whether to store or discard the first information.
US11950307B2	Efficient handling of a resource control state change and multi-node connectivity This document describes techniques and devices for efficient handling of a resource control state change and multi-node connectivity. Instead of performing multiple radio resource control (RRC) procedures to change a resource control state of a user equipment (UE) and establish, modify, or release a connection with multi-node connectivity, the techniques described herein combine the multiple RRC procedures into a single RRC procedure that supports both a resource control state change and multi-node connectivity. In particular, a master node sends a resource control state and multi-node connectivity message that includes both state change information and multi-node connectivity information. With this single message, timing and power resources of the UE can be conserved and failures resulting from asynchronous communication of the state change information and the multi-node connectivity information can be avoided.
US11950303B2	Communication system using wireless communication, communication apparatus, and control method A communication system includes a communication apparatus and a communication terminal configured to wirelessly communicate with each other, wherein the communication terminal includes a first wireless communication interface configured to support a Bluetooth® standard and include a single antenna, and wherein the communication apparatus includes a second wireless communication interface configured to support the Bluetooth® standard and include a plurality of antennas, and includes one or more controllers configured to function as a unit configured to obtain angle information and field intensity information based on a result of reception of radio waves, by the plurality of antennas, transmitted from the single antenna; and a unit configured to transmit an establishment request for wireless communication based on the Bluetooth® standard to the first wireless communication interface via the second wireless communication interface based on a fact that the angle information and the field intensity information satisfy a predetermined condition.
US11950300B2	Using a smartphone to control another device by voice A method and system for implementing a speech-enabled interface of a host device via an electronic mobile device in a network are provided. The method includes establishing a communication session between the host device and the mobile device via a session service provider. According to some embodiments, a barcode can be adopted to enable the pairing of the host device and mobile device. Furthermore, the present method and system employ the voice interface in conjunction with speech recognition systems and natural language processing to interpret voice input for the hosting device, which can be used to perform one or more actions related to the hosting device.
US11950296B2	Method of performing random access procedure, and transmitting device, apparatus and storage medium therefor In the present disclosure, a UE transmits a random access preamble (RAP) on a physical random access channel (PRACH) and a control channel (CCCH) service data unit (SDU) on a physical uplink shared channel (PUSCH); and receives a medium access control (MAC) protocol data unit (PDU) based on transmitting the RAP and the CCCH SDU. The MAC PDU includes a first part, and a second part after the first part. The first part includes multiple UE contention resolution identities (UE CRIDs).
US11950281B2	Method and device for transmitting data Aspects of the disclosure provide a method of transmitting data, including monitoring a data transmission of a first base station in a preset license before talk (LBT) time-frequency region in at least one fixed frame period (FFP). The preset LBT time-frequency region includes at least one time-frequency sub-region. The method can further include determining FFP transmission mode information of the first base station based on a monitoring result on each time-frequency sub-region in the preset LBT time-frequency region in each FFP, and determining an FFP transmission mode of the first base station based on the FFP transmission mode information.
US11950280B2	Channelization and BWP Methods, systems, and apparatus designed to support flexible carrier bandwidths in new radio. Multiple carrier bands may be combined into a single composite carrier depending on channel availability in the carrier bands. A composite carrier indicator (CCI) indicates to network devices, the available carrier bands within the channel occupancy time. In addition, bandwidth part inactivity time is suspended when channel access is not available.
US11950274B2	Method for scheduling logical channel, method for generating configuration information, and device The present disclosure relates to a method for scheduling a logical channel, a method for generating configuration information and a device. The method for scheduling a logical channel comprises: determining, according to logical channel configuration information, a coverage area of each logical channel, the configuration information comprising coverage area information of the logical channel; selecting, according to a transmission distance of a grant, a logical channel having a coverage area matching the transmission distance; and allocating a resource to the selected logical channel, and completing scheduling. The method for generating configuration information comprises: generating configuration information according to service quality information of a service, the configuration information comprising coverage area information of each logical channel; and sending the configuration information to user equipment. The invention achieves generation of logical channel configuration information comprising coverage area information and scheduling of a logical channel according to the configuration information. The method for scheduling a logical channel, the method for generating configuration information, and the device according to embodiments of the present disclosure ensure that a transmission distance requirement is met during a communication process, thereby enhancing communication performance.
US11950271B1	Limiting uplink noise by adjusting MIMO transmission layers Dynamically limiting MIMO transmission layers assigned to wireless devices to mitigate uplink noise levels measured at an access node (e.g. RSSI). The transmission layers can be adjusted based on a device capability or power class. For example, maximum MIMO transmission layers assigned to HPUEs can be reduced first.
US11950270B2	Method and apparatus for collecting and processing interference information A system that incorporates the subject disclosure may perform, for example, a method for receiving interference information from each of the plurality of communication devices detecting interference information in a plurality of segments of a radio frequency spectrum, correlating the interference information of the plurality of communication devices to generate correlated information, and identifying a plurality of interferers according to the correlated information. Other embodiments are disclosed.
US11950269B2	Transmission method and apparatus for reducing latency in wireless cellular communication Methods and apparatuses are provided in which information for a length of a short transmission time interval (STTI) is transmitted to a terminal. A timing advance for the terminal is transmitted to the terminal. The timing advance is included in a timing advance range among different timing advance ranges, and the timing advance range is associated with the information for the length of the STTI. A signal is transmitted to the terminal based on the information for the length of the STTI.
US11950268B2	Methods and devices for resource allocation for control resource region Embodiments of the present disclosure relate to methods, devices and apparatus for resource allocation for a control resource region in a wireless communication system. In an embodiment of the present disclosure, a method may include determining resource units each containing a predetermined number of resource blocks based on available transmission resources. Resource blocks not contained in the resource units are distributed in the available transmission resources to divide resource blocks contained in the resource units into a plurality of resource segments. The method also comprise allocating one or more of the determined resource units to the control resource region and transmitting resource allocation information indicating the allocated one or more of resource units. With embodiments of the present disclosure, there is provided an effective solution for resource allocation for control resource region.
US11950266B2	System and method for supporting GAN service request capability in a wireless user equipment (UE) device In one embodiment, a scheme is disclosed for supporting wireless access network service request capability in a user equipment (UE) device that is operable in wide area cellular network (WACN) bands as well as in wireless access network bands (e.g., GAN bands and/or UMA bands). The UE device includes capability for gaining Internet Protocol (IP) connectivity with a wireless access network node (e.g., a GAN controller (GANC) or UMA network controller (UNC)). Thereafter, the UE device is operable to initiate a registration request message towards the wireless access network node, wherein the registration request message includes at least one information element pertaining to wireless access network services required by the UE device.
US11950262B2	Sidelink beam management Methods, systems, and devices for wireless communications are described. A device may be configured to support multi-beam, or multi-panel operations, or both which may allow multiple sidelink transmissions to occur simultaneously. In some cases, flexible beam-management for the beamformed sidelink communications is implemented to manage the beams. A transmitting UE may indicate transmission beam information to the base station that the base station may use to schedule sidelink transmissions as part of a beam management procedure. The beam management procedure may allow a transmitting UE to update transmission beam information based on the mobility of the sidelink UEs and other environmental factors. In some cases, beam management includes a beam training procedure that may be implemented to refine the sidelink beams, where support for multi-panel and multi-beam operation may allow for multiple beams to be trained simultaneously.
US11950256B2	Wireless communication device, wireless communication method, and computer program A wireless communication device including an acquisition unit that acquires an information set related to a transmission parameter when transmitting a resource arbitrarily selected from a predetermined resource pool to a transmission target (for example, performing grant-free transmission), and a setting unit that sets the transmission parameter using the information set.
US11950249B2	Two-stage grant for uplink data transmission in new radio-unlicensed (NR-U) Wireless communications systems and methods related to communicating in a communication medium are provided. A first wireless communication device communicates with a second wireless communication device, a first scheduling grant. The first wireless communication device communicates, with the second wireless communication device, a second scheduling grant including at least one of a start slot index (SSI) or a slot format indicator (SFI). The first wireless communication device communicates, with the second wireless communication device, an uplink communication signal based on the first scheduling grant and the second scheduling grant.
US11950246B2	Sidelink vehicle to vulnerable road user techniques for wireless communications systems Methods, systems, and devices for wireless communications are described. A first wireless device may receive an indication of one or more parameters for communications over a sidelink channel during a first time period, where the one or more parameters may include a time threshold for a second resource pool. The wireless device may transmit data over a first resource pool of the sidelink channel during a first portion of the first time period based on the one or more parameters, the first resource pool including resources for communications between the first wireless device and a second wireless device. The wireless device may monitor the second resource pool during a second portion of the first time period for the time threshold, the second resource pool including resources for communications between the first wireless device and a third wireless device.
US11950241B2	Self-contained time division duplex (TDD) subframe structure for wireless communications Aspects of the present disclosure provide a self-contained subframe structure for time division duplex (TDD) carriers. Information transmitted on a TDD carrier may be grouped into subframes, and each subframe can provide communications in both directions (e.g., uplink and downlink) to enable such communications without needing further information in another subframe. In one aspect of the disclosure, a single subframe may include scheduling information, data transmission corresponding to the scheduling information, and acknowledgment packets corresponding to the data transmission. Furthermore, the subframe may additionally include a header and/or a trailer to provide certain bi-directional communications functions.
US11950236B2	Node and method for prescheduling ULink resources in a wireless network according to a UE's application requirements Example embodiments presented herein are directed towards a wireless device (101) and a network node (102, 103, 104, 110, 111, 115), and corresponding methods therein, for prescheduling uplink communications in a wireless network. Such prescheduling is performed prior to the time the uplink communication is needed. According to the example embodiments, the prescheduling is performed with the network node having knowledge of a communication pattern of the wireless device via at least one prescheduling parameter obtained by the network node (the base station, or a core network node), either transmitted by the wireless device or else retrieved by the network node from subscription or historical data. The prescheduling parameter may relate to the application or service that has been activated, and a prescheduling cancellation is sent when it is halted.
US11950235B2	Resource selection with sidelink receiver sensing Methods, systems, and devices for wireless communications are described. In some examples, a first UE may receive an indication of first resources from a second UE. In some examples, the second UE may be a UE configured to receive a transmission from a third UE over the first resources. In some such examples, the first UE may transmit, to a fourth UE, a sidelink transmission over available resources that exclude the first resources. Additionally, or alternatively, the second UE may be a UE that received sidelink control information from the third UE indicating the resources for transmission by the third UE to a fourth UE. In some such examples, the first UE may transmit, to the second UE, a sidelink transmission over available resources that exclude the first resources.
US11950234B2	Method for determining sidelink category, terminal device, and network device A method for determining a sidelink type, a terminal device, and a network device are provided. The method comprises: receiving downlink control information (DCI) sent by a network device; determining, on the basis of the DCI, a first type of sidelink or a second type of sidelink as a target sidelink according to a preset rule, the first type of sidelink being different from the second type of sidelink in configuration parameters; and using the target sidelink to perform data transmission of the sidelink.
US11950232B2	Multiplexing sidelink control information-only grants and data-only traffic Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a first user equipment (UE) may transmit, to a second UE, a grant-only indicator to indicate that a second stage sidelink control information (SCI-2) is decoupled from physical sidelink shared channel (PSSCH) data in a slot, and that the SCI-2 indicates an SCI-2-only grant. The first UE may transmit, to the second UE in the slot, the SCI-2-only grant multiplexed with data-only traffic in a first PSSCH transmission based at least in part on the grant-only indicator, wherein the SCI-2-only grant indicates a resource allocation for a subsequent slot. Numerous other aspects are described.
US11950227B2	Periodic radio resource A base station central unit receives, from a base station distributed unit, configuration parameters of at least one periodic radio resource for packet transmissions of a wireless device in a radio resource control (RRC) inactive state or RRC idle state. The base station central unit sends, to the base station distributed unit, a wireless device context release message comprising an RRC release message and an indication that the base station distributed unit maintains the at least one periodic radio resource after the wireless device transitions to the RRC idle state or the RRC inactive state. The base station central unit receives, via the base station distributed unit, data from the wireless device while the wireless device is in the RRC inactive state or the RRC idle state.
US11950225B2	Selective channel state measurement and report for small data transfer in power saving mode A user equipment (UE) may initiate a Type-1 or Type-2 random access procedure from a power saving mode, generate a channel state information (CSI) report and a buffer status report, and selectively multiplex the CSI report and BSR with mobile originated (MO) data in a random-access message of the random-access procedure. The UE may further transmit a request to remain in the power saving mode after finishing the transmission of the MO data. The configuration of random access and CSI reporting procedure depends on the UE type or UE capability supported by the network.
US11950223B2	Scheduling new radio (NR) shared channel transmission In a general aspect, a User Equipment (UE) in a cellular communications network receives a Radio Resource Control (RRC) signaling message from a base station communicatively coupled to the UE over a communications channel. The UE accesses a search space in the RRC signaling message. The UE identifies a fallback Downlink Control Information (DCI) Information Element (IE) included in the search space. The UE determines whether an aggregation factor is indicated in the fallback DCI IE for shared channel communications with the base station, over multiple slots in the communications channel. The UE determines an uplink/downlink (UL/DL) configuration for transmission on the communications channel. The UE schedules an aggregated transmission over multiple slots in the communications channel based on the aggregation factor and the uplink/downlink configuration.
US11950222B2	Techniques for wireless communication using sub-slot based physical sidelink shared channels Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment (UE) may receive a configuration that indicates multiple time intervals corresponding to multiple physical sidelink shared channels (PSSCHs) within a slot, wherein at least one PSSCH, of the multiple PSSCHs, starts in a symbol other than an initial data symbol of the slot. The UE may communicate in one or more PSSCHs, of the multiple PSSCHs, within the slot based at least in part on the configuration. Numerous other aspects are described.
US11950221B2	Techniques to synchronize radio access technologies for co-channel operation Methods, systems, and devices for wireless communications are described. A wireless device that uses a first radio access technology (RAT) may identify a transmission timing scheme for a shared radio frequency spectrum band, the transmission timing scheme comprising a first set of time intervals allocated for transmissions using a first RAT and a second set of time intervals allocated for transmissions using a second RAT. The wireless device may transmit, during a time interval of the first set of time intervals, a channel reservation signal indicating an end time of the time interval and indicating that the wireless device uses the first RAT. The wireless device may transmit, based at least in part on the transmitted channel reservation signal, over the shared radio frequency spectrum band during at least a portion of the time interval before the end time of the time interval.
US11950214B2	Devices, methods and computer programs for saving frequency resources in wireless communications A client device for wireless communication includes a transceiver and a processor. The transceiver is configured to receive frequency resource information to indicate a set of frequency resources for a physical random access channel (PRACH) preamble transmission. The frequency resource information includes at least one of: an interlace information indicating at least one of an interlace of a block-interlaced frequency-division multiplexing (B-IFDM) allocation, a resource element allocation information indicating a subset of resource elements within each block of the at least one B-IFDM interlace, and a resource element spacing information, such that an at least one resource element within at least one block of the at least one B-IFDM interlace is allocated for the transmission of one PRACH preamble according to a tone-interlaced frequency-division multiplexing (T-IFDM) allocation. The resource element allocation is repeated in each block of the at least one B-IFDM interlace.
US11950213B2	Controlling deployment of IoT devices over wireless networks with an adaptive gateway Systems, machine-readable media, and methods to control deployment of IoT devices over wireless networks with an adaptive gateway are provided. A gateway device may broadcast on different channels in a first time slot of a time interval. The gateway device may receive a response from a sensor device in a second time slot of the time interval. The gateway device may further communicate to the sensor device in a third time slot of the time interval. The gateway device may receive transmissions from the sensor device in one or more subsequent instances of the fourth time slot of the time interval. Based at least in part on the one or more transmissions from the sensor device, the gateway device may transmit data to one or more computer systems via one or more networks.
US11950209B2	Reuse of control resources for data transmission Example embodiments of the present disclosure relate to a device, method, apparatus and computer readable storage medium for reusing control resources for data transmission. In example embodiments, if downlink data is to be transmitted to a terminal device, a network device determines a control resource set associated with the terminal device in a control resource region. The network device selects, from the control resource set, localized control resources for control information associated with the downlink data, and selects data resources for the downlink data in the control resource region and a data resource region. The network device transmits the control information to the terminal device by using the localized control resources, and transmits the downlink data to the terminal device by using the data resources.
US11950207B2	Tracking area planning A method is disclosed for improved tracking area planning and handling, comprising: assigning a single tracking area code to a plurality of eNodeBs at a messaging concentrator gateway, the messaging concentrator gateway situated in a network between the plurality of eNodeBs and the core network; storing, at the messaging concentrator gateway, at least one indicator of a last known location of a user equipment (UE) other than the single tracking area code; receiving a paging message from the core network at the messaging concentrator gateway for a UE; and performing a paging sequence using the at least one indicator to identify a set of eNodeBs to page the UE, thereby allowing larger tracking area list sizes to be used without increasing signaling traffic between the radio access network and the core network.
US11950206B2	Paging on narrow beam and alignment with default DRX In accordance with an example embodiment of the present invention, a method comprising: receiving from a network node, by a user equipment of a plurality of user equipment associated with more than one communication beam of a communication network, information comprising locations in time of the user equipment during paging occasions with at least one cell of the communication network associated over more than one communication beam, wherein the information identifies any provided order of the more than one communication beam covering the locations in time of the user equipment during the paging occasions; and based on the information, identifying by the user equipment at least one communication beam and timing of at least one paging occasion, of the paging occasions, for the user equipment.
US11950204B2	Method and apparatus for transmitting and receiving a signal in the wireless communication system In an exemplary embodiment, a method performed by a relay user equipment (UE) in a wireless communication system is provided. The method comprising: receiving, from a base station (BS), a paging configuration including at least one of a number of total paging frame, a number of paging occasion for a paging frame, an offset for paging frame, a first DRX cycle of a remote UE, or paging search space; transmitting, to a remote UE, the paging configuration; receiving, from the remote UE, information related the remote UE including at least one of identity of the remote UE, paging identity of the remote UE or a second DRX cycle of the remote UE; identifying a paging occasion of the remote UE based on the information related the remote UE and the paging configuration; and monitoring the paging occasion of the remote UE for receiving a paging message for the remote UE.
US11950201B2	Triggering of an aperiodic or semi-periodic positioning reference signal procedure In an aspect, a UE obtains a plurality of positioning reference signal (PRS) configurations. The UE receives, from a BS, an L1 or L2 message that indicates one of the plurality of PRS configurations, which in turn triggers an aperiodic or semi-periodic PRS procedure in accordance with the indicated PRS configuration.
US11950200B2	Enabling user equipment (UE) positioning anchors for vehicle-to-everything (V2X), vehicle-to-vehicle (V2V), and vehicle-to-pedestrian (V2P) positioning A method of wireless communication by a positioning entity includes determining an accuracy of a positioning estimate of a first non-anchor sidelink user equipment (UE). The method also includes determining the accuracy satisfies an accuracy condition. The method further includes configuring the first non-anchor sidelink UE as a first anchor UE based on the positioning estimate satisfying the accuracy condition.
US11950195B2	Performing measurements in telecommunication systems including absolute time difference between measurements A method, device and computer readable medium for performing measurements in telecommunication systems are disclosed. The method comprises: includes receiving, from a first network device, a first configuration of a first measurement object for a carrier frequency; receiving, from a second network device, a second configuration of a second measurement object for the carrier frequency; determining an absolute time difference between a first measurement timing in the first configuration and a second measurement timing in the second configuration; and in response to determining that the absolute time difference is below a predetermined threshold, performing a single measurement for the carrier frequency based on the first measurement timing in the first configuration or the second measurement timing in the second configuration.
US11950193B2	Method and device for transmitting S-SSB in NR V2X An operating method of a first device (100) in a wireless communication system is presented. The method can comprise the steps of receiving an SL SSB from a second device, and acquiring bit information on the basis of the order in which a first m-sequence and a second m-sequence are mapped to a first PSS symbol and a second PSS symbol.
US11950189B2	Method and apparatus for uplink transmission and reception in wireless communication system Disclosed are a method and an apparatus for uplink transmission and reception in a wireless communication system. A method for transmitting an uplink channel according to an embodiment of the present disclosure may comprise the steps of: receiving downlink control information (DCI) from a base station; and transmitting the uplink channel to the base station on the basis of the DCI. N (N is a natural number) transmit power control (TCI) command values may be indicated by the DCI, and transmission power of the uplink channel may be determined on the basis of one of the N TPC command values.
US11950186B2	Power saving techniques Techniques are described to enable a user equipment (UE) to save power consumption and/or can enable the UE to acquire the channel state in time without reducing the UE's data transmission efficiency. An example technique includes determining, by the communication device, an operating mode based on a first signaling, and operating the communication device in the operating mode, where the operating mode includes any one of a normal mode, a first power saving mode, a second power saving mode, a third power saving mode, or a fourth power saving mode.
US11950185B2	Wake-up signal configuration Systems and methods for configuring wake-up signals are provided. A network node allocates a first wake-up signal (WUS) at a first frequency location and one or more second WUSs at second frequency location(s). Responsive to receiving a page associated with a wireless device, the network node transmits the appropriate first or second WUS on the configured frequency.
US11950182B2	Negotiation of a PC5 rat for a V2X service Embodiments of a User Equipment (UE) and methods of communication are generally described herein. The UE may be configurable to operate as an initiating UE for a vehicle-to-everything (V2X) application that includes PCS communication between the initiating UE and a receiving UE. The initiating UE may receive, from a base station, control signaling that indicates a default PCS radio access technology (RAT) for the V2X service. The default PCS RAT may be either a Long Term Evolution (LTE) PCS RAT or a New Radio (NR) PCS RAT. Based on the default PCS RAT and/or PCS RATs supported by the initiating UE, the initiating UE may select either the LTE PCS RAT or the NR PCS RAT. The selected PCS RAT may be proposed, in a negotiation with the receiving UE, for the V2X service.
US11950174B2	Detailed alarm messages and support In one embodiment, a method of alerting a user of a WCD is described. The method includes receiving an alert from the WCD on a remote device associated with the user and in communication with the WCD and transcribing the alert into a message for the user. The method also includes personalizing the message for the user and delivering the message to the user via the remote device.
US11950170B2	Passive sensor tracking using observations of Wi-Fi access points A method of passive sensor tracking includes using a Wi-Fi access point that transmits a management frame comprising sensor data of a sensor as part of Wi-Fi wireless network discovery, associating unique identifying information of the Wi-Fi access point with a sensor in a sensor tracking database, receiving observation data of the Wi-Fi access point from a Wi-Fi AP Database, the observation data including the unique identifying information of the Wi-Fi access point and the sensor data of the sensor, and storing the sensor data in the sensor tracking database. The Wi-Fi AP Database receives one or more reports comprising observation data from one or more wireless devices that encounter the Wi-Fi access point.
US11950169B2	Uplink positioning methods and apparatuses for non-terrestrial networks Apparatus, methods and computer program products for user equipment positioning solutions and related signalling. An apparatus comprising at least one processor and at least one memory including computer program code, the at least one memory and the computer program code are configured, with the at least one processor, to cause the apparatus to at least send (550), to a network node of a communication network, at least one signaling configuration with at least one set periodicity, wherein the at least one signaling configuration is for use at the network node in calculating at least position information for relaying to the communication network at least for positioning support of the apparatus, and receive (570) the positioning support from the communication network in response to the at least one signaling configuration.
US11950163B2	Crowdsourced contact tracing Systems and methods include the following. Information about a first electronic communication device is transmitted to at least one server and/or decentralized infrastructure. The information includes vicinity information. A status signal associated with a first user of the first electronic communication device is optionally transmitted. Contact proximity network information about a contact proximity network is received. The contact proximity network is based on the information from a plurality of electronic communication devices and information about the association between users and electronic communication devices. The contact proximity network information includes status signal information and interconnected nodes corresponding to different users and pairwise connections between users based upon their relative physical space and time proximity. A notification indicating a network-based proximity of a first user to a second user is provided, indicating a minimum number of connections between the first user and the second user during a specified time frame.
US11950159B2	Method and device for reselecting heterogeneous network in sidelink relaying Proposed is a method for a first device to perform wireless communication. The method may comprise the steps of: establishing a connection with a second device; and reselecting a cell on the basis that the first device is in a radio resource control (RRC) IDLE state or an RRC INACTIVE state. For example, a priority related to cell reselection can be set such that a cell related to a new radio (NR) has a high priority. For example, cell reselection can be performed first on the cell related to the NR on the basis of the priority related to cell reselection.
US11950158B2	Method and device for distributing idle user equipment in multi-carrier based mobile communication system The present invention relates to a method and device for distributing idle UE by a carrier in eNB of a multi-carrier based mobile communication system. The method of distributing idle UE in a multi-carrier based mobile communication system according to the present invention includes a process of determining a search rate by a carrier on the basis of information representing load on the carrier, a step of determining a cell reselection priority on the idle UE on the basis of the determined search rate, and a process of transmitting the determined cell reselection priority to the idle UE.
US11950157B2	Mobility and load balancing target selection for unlicensed carriers Methods, nodes and computer program products control radio channel deployment when using un-licensed carriers in a wireless communication network and control mobility and/or load balancing target selection when using un-licensed carriers. When performed in an access node, unlicensed carrier intrinsic cell channel load is determined in a cell served by the access node based on one or more predetermined channel load indicators and neighbor cell channel load information is obtained, from one or more neighboring access nodes. The neighbor cell channel load information includes unlicensed carrier channel load in respective cells based on the one or more predetermined channel load indicators. At least one channel deployment operation is initiated based on an outcome of one or more comparative operations including the determined unlicensed carrier intrinsic cell channel load and/or the obtained neighbor cell channel load information.
US11950156B2	Techniques for sharing transmission power during handover in wireless communications This disclosure provides systems, methods and apparatus, including computer programs encoded on computer storage media, for cancelling transmissions during handover operations. In one aspect, a user equipment (UE) can cancel at least a portion of a first uplink transmission where the first uplink transmission overlaps with a second uplink transmission scheduled by a target cell in a dual active protocol stack (DAPS)-based handover (HO). In another aspect, a network can receive, from the UE, a capability indicating whether cancelling uplink transmission from a source cell in DAPS-based HO is supported, and the network can schedule an uplink transmission for the UE during the DAPS-based HO to the target cell based on the capability.
US11950151B2	Self-organizing networks (SON) for mobility robustness optimization (MRO) and automatic network slice creation Some embodiments of this disclosure include apparatuses and methods for applying mobility robustness optimization (MRO) and automatic network slice creation in 5G Self-Organizing Networks (SON). A network system may identify user equipment (UE) performing a handover from a first node to a second node. The network system may apply a MRO function to identify a target parameter corresponding to the handover. The network system may monitor connection measurements and/or radio link failure reports to identify the handover as failing to meet the target parameter. The network system may then modify the target parameter to facilitate the handover to the second node. For the automatic creation of a network slice instance (NSI), a network system may receive network slice specifications and apply the specifications to an automatic NSI creation function. The network system may instantiate network functions according to the automatic NSI creation function to create an NSI.
US11950148B2	Handover management method In accordance with an aspect of the present disclosure, there is provided a handover management method performed by a session management function (SMF). The method comprises, receiving handover information related to a user equipment (UE) receiving a predetermined service by accessing a source radio access network (S-RAN), obtaining, after receiving the handover information, resource information on a resource used when the predetermined service is provided to the UE at the S-RAN, and transmitting, to a user plane function (UPF), a request that a resource corresponding to the obtained resource information is to be secured in a target radio access network (T-RAN).
US11950147B2	Smart non-stand alone (NSA) operation between mm-wave and SUB6 A method is provided. The method includes determining, while a user equipment (UE) is connected to a long term evolution (LTE) cell, that the UE supports connection with a first fifth generation (5G) frequency range (FR1) base station (gNB) and a second 5G frequency range (FR2) base station (SgNB), when the UE is camped to an FR1 cell, determining whether at least one connection condition is satisfied, and controlling to release the UE from the FR1 cell and initiating the UE to an FR2 cell when the at least one connection condition is determined to be satisfied.
US11950145B2	Beamforming in wireless communications Aspects described herein relate to wireless communications. According to some aspects, a first base station may coordinate with a second base station to select beamforming codewords. The first base station may receive an index indicating beamforming codewords used by a second base station. The first base station may select a beamforming codeword for use in transmitting signals to a wireless device based on the beamforming codeword indicated by the second base station.
US11950143B2	Method and device for supporting handover The present disclosure relates to a communication method and system for converging a 5th-Generation (5G) communication system for supporting higher data rates beyond a 4th-Generation (4G) system with a technology for Internet of Things (IoT). The present disclosure may be applied to intelligent services based on the 5G communication technology and the IoT-related technology, such as smart home, smart building, smart city, smart car, connected car, health care, digital education, smart retail, security and safety services. According to an aspect of the embodiments of the present disclosure, a method for supporting handover is provided, comprising: receiving a message from a central unit control plane entity of a target base station; receiving a data packet from a source base station; and discarding a packet data convergence protocol (PDCP) service data unit (SDU) including the PDCP sequence number (SN) in the received data packet according to the indication of the message.
US11950140B2	System and method for providing device management and network management at an edge device An edge device is disclosed and includes a processor, a memory, and a power management unit (PMU). The processor executes code instructions of an edge throughput services management system for managing a wireless network and one or more devices operatively coupled to the wireless network and the edge device. The processor detects a number of managed client information handling systems operatively coupled to the edge device; creates a persona associated with each of the managed client information handling systems; conducts an inventory of one or more applications requiring network access associated within each persona; prioritizes each persona for network access; and prioritizes each application associated with each persona for network access. The edge throughput services management system to provide a service for monitoring and recommending adjustments to the wireless network and managed client information handling systems for flexible data bandwidth access to the wireless network.
US11950136B2	Load relocation in a communications network This application discloses a load relocation method, apparatus, and a system. The method includes determining, by a communications network entity, a target access management entity for load relocation; and sending, to an access network entity, an identifier of an original access management entity and an identifier of the target access management entity or an address of the target access management entity with respect to the access network entity. The access network entity sends a message from a user equipment (UE) to the target access management entity based on the identifier of the original access management entity carried in the message from the UE. In the foregoing solution, signaling overheads in a load relocation process are reduced and load relocation efficiency is improved.
US11950135B2	Data transmission method and device A data transmission method and device includes, when the target length of a time-domain resource required by a target transmission block is greater than a first length of an available time-domain resource of a target time slot, the network access device determines a size of a first transmission sub-block transmitted on the available time-domain resource of the target time slot, divides the target transmission block into the first and second transmission sub-blocks according to the size of the first transmission sub-block, in which a second length of a time-domain resource required by the second transmission sub-block is equal to the difference between the target length and the first length, determines a first time-domain resource configured to transmit the second transmission sub-block in the next time slot after the target time slot according to the second length, and sends a first resource allocation message to a terminal.
US11950134B2	Method and device in communication nodes for wireless communication The present disclosure discloses a method and a device in communication nodes for wireless communications. In a first node, a successful transmission of a first packet is acknowledged by a first entity, the first entity being used for unicast; a second entity being used for non-unicast does not indicate that the second entity deletes a duplicated first packet; the second entity being used for unicast indicates that the second entity deletes a duplicated first packet; herein, the first entity and the second entity are associated with a same higher layer entity. The present disclosure helps avoid deleting a same packet repeatedly transmitted through multicast, thus ensuring the continuity of traffics received by multicast, which further reduces higher layer retransmissions triggered by deletion of the packet, thus decreasing traffic delay.
US11950132B2	Wireless communication system, base station, user equipment, and wireless communication method A wireless communication system includes a first wireless communication device, and a second wireless communication device. The first wireless communication device includes: a communicator that delivers, to the second wireless communication device, data addressed to a third wireless communication device and receives, from the second wireless communication device, information on communication quality according to failed data of which delivery fails among the data delivered from the second wireless communication device to the third wireless communication device; and a controller that controls delivery of the data in accordance with the information on the communication quality.
US11950126B2	Half duplex techniques for wireless communications Aspects described herein relate to receiving, over a sub-channel of multiple sub-channels, ultra-reliable quality-of-service (QoS) traffic from one or more UEs over a time duration wherein other sub-channels of the multiple sub-channels are used for initial ultra-reliable QoS transmissions from one or more other transmitting UEs over the time duration, and relaying, along with one or more other relaying UEs, the ultra-reliable QoS traffic over a subsequent time duration.
US11950125B2	Consistent Quality of Service policy in a software defined enterprise Systems and methods for providing enhanced Quality of Service (QoS) network transmissions can be based on an application sub-class or a user class. Systems and methods can include inspecting the information packet having a network level QoS field having a first network level QoS portion and a second network level QoS portion, determining an application sub-class or user class associated with the information packet, tagging the first network level QoS portion of the information packet according to a first network level QoS value, tagging the second network level QoS portion of the information packet according to a traffic priority indication and to a determined application sub-class or user class, and queuing the information packet for transmission from a network element based on the tagged first network level QoS portion and the second network level QoS portion.
US11950124B2	Methods, apparatus and systems for integrated access and backhaul bearer management A method for data radio bearer management, the method including: transmitting a data radio bearer (DRB) setup request message to a wireless communication node; receiving a DRB setup response message from the wireless communication node, determining at least one DRB and at least one Quality of Service (QoS) flow mapped to the at least one DRB supported by the wireless communication node; and configuring the wireless communication node to support the at least one DRB and the at least one QoS flow.
US11950117B2	Large scale radio frequency signal information processing and analysis system A large-scale radio frequency signal information processing and analysis system that provides advanced signal analysis for telecommunication applications, including band capacity and geographical density determinations and detection, classification, identification, and geolocation of signals across a wide range of frequencies and across broad geographical areas. The system may utilize a range of novel algorithms for bin-wise processing, Rayleigh distribution analysis, telecommunication signal classification, receiver anomaly detection, transmitter density estimation, transmitter detection and location, geolocation analysis, telecommunication activity estimation, telecommunication utilization estimation, frequency utilization estimation, and data interpolation.
US11950115B2	Wireless communication performance measurement method and wireless communication performance measurement system A measurement station collects radio base station performance information related to a radio communication performance of each radio base station, radio connection information related to a radio communication performance and a communication status of a corresponding radio terminal station, generates a measurement condition and an expected measurement result based on the radio base station performance information and the radio connection information, and notifies a measurement control signal corresponding to the measurement condition to the radio terminal station through the radio base station; the radio terminal station performs a communication setting of an own station based on the notified measurement control signal, and notifies a measurement preparation status to the measurement station; and the measurement station measures the radio communication performance by causing a flow of a measurement traffic to the radio terminal station through the radio base station, acquiring a measurement result, and determining whether the measurement result is within a range of the expected measurement result.
US11950113B2	Prioritizations during beam failure recovery Methods, systems, and devices for wireless communications are described. A user equipment (UE) may determine, during a beam failure recovery period, that a configured control resource set at least partially overlaps with a beam failure recovery control resource set. The UE may configure, based at least in part on the at least partial overlap, a receive beam to receive the beam failure recovery control resource set. The UE may receive a control signal over the beam failure recovery control resource set during the beam failure recovery period.
US11950108B2	Reusing resources in a wireless relay An operation method of a repeater relaying wireless communications between a base station and at least one terminal in a communication system may include: transmitting, to the base station, a first capability report including information on beam-related capability supported by the repeater; transmitting, to the base station, a first request signal for requesting to perform first configuration for coverage extension of the repeater; receiving, from the base station, information on the first configuration configured based on the first capability report and the first request signal; and relaying the wireless communications between the base station and the at least one terminal based on one or more beams formed based on the received first configuration.
US11950106B2	User equipment capability indication of receive beamforming for cell identification An apparatus of a New Radio (NR) User Equipment (UE), a method, and a system. The apparatus includes a Radio Frequency (RF) interface, and processing circuitry coupled to the RF interface. The processing circuitry is to: generate a signal including capability information of the UE, wherein a time period for intra-frequency cell detection and measurement for the UE is based on the capability information; and cause a transmission of the signal within a cellular network to include the UE using the RF interface.
US11950104B2	Method and device for adjusting automatic retransmission, base station, and user equipment Provided are a method and apparatus for adjusting automatic retransmission. The method includes detecting uplink retransmission service information of at least two target user equipments (UEs), where after listen before talk (LBT) detection performed on a grant-free uplink transmission resource in an unlicensed spectrum fails, the at least two target UEs are capable of sharing a same original retransmission alternative resource to perform automatic uplink retransmission; determining whether the original retransmission alternative resource is overloaded according to the uplink retransmission service information; adjusting related configuration information of retransmission alternative resource to obtain adjusted retransmission configuration information in response to determining that the original retransmission alternative resource is overloaded; and delivering the adjusted retransmission configuration information to the at least two target UEs.
US11950103B2	Communication control device, method of controlling communication, and communication system A communication control device (40) includes: an acquisition unit (441) that acquires a spectrum grant request following a certain scheme from a plurality of second radio systems that perform a wireless communication using a radio wave of a frequency band used by a first radio system; a classification unit (442) that groups the second radio systems into a plurality of groups according to a scheme of the spectrum grant request; and a calculation unit (443) that calculates a communication parameter of the second radio system for each of the groups.
US11950102B2	Method for beam management in unlicensed band, terminal device, and network device Embodiments of the present disclosure provide a method for beam management in an unlicensed band, a terminal device, and a network device. The method includes: receiving, by a terminal device, a reference signal resource from a network device; measuring, by the terminal device, the reference signal resource in the unlicensed band, to obtain a beam measurement result; and sending, by the terminal device using an uplink resource for transmitting a beam report, the beam report comprising the beam measurement result.
US11950100B2	Method for determining a jitter attack, jitter attack detecting device, and computer program A method to determine a jitter attack on authorization system granting permission using a resource comprising: receiving at least three subcarrier signals from an authentication device, determining a relative phase deviation from an expected relative phase behavior for the at least three subcarrier signals, and concluding on a jitter attack if the relative phase deviation fulfills a predetermined criterion.
US11950096B2	Using a client device for providing extra level of security for critical parameters Aspects of the present disclosure are drawn to client device for use with a network controller and an external server, the network controller being configured to manage a wireless network, to change a critical parameter of the wireless network, to transmit a request for a one time password (OTP). The external server being configured to generate the OTP in response to the request for the OTP, to provide a notification of the OTP and to transmit the OTP to the network controller. The network controller being configured to additionally receive the OTP from the external server. The client device including a memory having a data structure stored therein, the data structure including a list of configurable critical parameters of the wireless network, and including a processor configured to execute instructions stored on the memory to cause the client device to receive a request to configure a configurable parameter of the wireless network. The client device also determines whether the configurable parameter of the wireless network matches a configurable critical parameter of the wireless network within the list of configurable critical parameters of the wireless network. The client device further transmits, when the configurable parameter of the wireless network matches a configurable critical parameter of the wireless network within the list of configurable critical parameters of the wireless network, the request for the OTP. The client device may also receive the notification of the OTP from the external server and access the OTP based on the notification and may transmit the OTP to the network controller.
US11950095B2	Communication apparatus and method for controlling the same A communication apparatus automatically starts operating in a direct wireless communication mode in conjunction with a user's logging in to the communication apparatus.
US11950094B2	Customer communication system A system for automatic authentication of service requests includes authentication of a remote access device. This authentication may be accomplished automatically prior to text or audio communication between a customer and a service agent. In some embodiments, authentication is accomplished automatically by authentication of the remote access device or accomplished by asking the customer questions. A single authentication of the remote access device may be used to authenticate a service request transferred between service agents. The authentication of the remote device may include, for example, use of a personal identification number, a fingerprint, a photograph, and/or a hardware identifier.
US11950092B2	Location of a mobile device with 5G wireless access using SUPL Techniques described herein provide means by which cell information indicative of a location of a UE may be conveyed to a location server over a 5G NR data connection using a SUPL message with an LTE cell ID data field. In some embodiments, for example, the UE may include the Cell ID of a LTE neighbor cell or information regarding a 5G NR serving cell, such as a portion of the 5G NR Cell ID or a reserved value or sequence identifying the 5G NR serving cell. The techniques may be applicable to the Secure User Plane Location (SUPL) solution defined by OMA and may enable a UE and a SUPL Location Platform (SLP) to support location of the UE using a version of SUPL without explicit support of 5G NR wireless access.
US11950090B2	In-car adaptive sound quality output method, device, storage medium and car audio system The application relates to a sound quality output method. The method includes: obtaining the current volume level input by the user; determine the audio signal gain difference between the current volume level and the baseline volume level according to the current volume level and the preset baseline volume level, determining an equal loudness curve difference between the current volume level and the baseline volume level according to the audio signal gain difference, and the current volume level and the baseline volume level, determining the audio quality response curve corresponding to the current volume level according to the equal loudness curve difference and the pre-stored audio quality response curve corresponding to the baseline volume level, determining the output signal parameters of multiple audio output channels according to the audio quality response curve corresponding to the current volume level. The application optimizes the sound quality effect and enhances acoustic experience.
US11950083B2	Head tracking correlated motion detection for spatial audio applications Embodiments are disclosed for head tracking state detection based on correlated motion of a source device and a headset communicatively coupled to the source device. In an embodiment, a method comprises: obtaining, using one or more processors of a source device, source device motion data from a source device and headset motion data from a headset; determining, using the one or more processors, correlation measures using the source device motion data and the headset motion data; updating, using the one or more processors, a motion tracking state based on the determined correlation measures; and initiating head pose tracking in accordance with the updated motion tracking state.
US11950082B2	Method and apparatus for audio processing An apparatus and method of loudspeaker equalization. The method combines default tunings (generated based on a default listening environment) and room tunings (generated based on an end user listening environment) to result in combined tunings that account for differences between the end user listening environment and the default listening environment.
US11950079B2	Delay estimation method and apparatus A delay estimation method includes determining a cross-correlation coefficient of a multi-channel signal of a current frame, determining a delay track estimation value of the current frame based on buffered inter-channel time difference information of at least one past frame, determining an adaptive window function of the current frame, performing weighting on the cross-correlation coefficient based on the delay track estimation value of the current frame and the adaptive window function of the current frame, to obtain a weighted cross-correlation coefficient, and determining an inter-channel time difference of the current frame based on the weighted cross-correlation coefficient.
US11950073B2	Coaxial speaker The present invention provides a coaxial speaker, which includes a frame, a vibration system and a magnetic circuit system. The magnetic circuit system includes a magnetic conduction assembly and a magnet assembly. The magnetic conduction assembly includes a first magnetic conduction plate, an inner side wall and an outer side wall, and a second magnetic conduction plate fixed on the side of the inner side wall. The magnet assembly includes a first magnet that forms a first magnetic gap and a second magnet that forms a second magnetic gap, a first vibration assembly and a second vibration assembly. The present invention is provided with high internal space integration, high magnetic circuit utilization, and meets the requirements of the full frequency domain.
US11950071B2	Acoustic device The present invention provides an acoustic device including a frame, a vibration system and a magnetic system. The vibration system includes a diaphragm, a voice coil assembly, and a support assembly. The support assembly includes a flexible circuit board and a support membrane. The flexible circuit board includes a first fixing end secured to the frame, a second fixing end secured to the voice coil assembly, a connecting portion, and a soldering pad. The voice coil assembly includes a first voice coil and a second voice coil. The first voice coil includes a first leading wire. The first leading wire has a first extension part extending from a surface of the first voice coil, a second extension part bending and extending from the first extension part along an outer surface of the second voice coil, and a soldering part welding to the soldering pad.
US11950070B2	Sound production device A sound production device includes a substrate having a cavity and a plurality of cantilever diaphragms fixed on the substrate. Each of the plurality of the cantilever diaphragms includes a fixed end fixed on the substrate and a free end extending from the fixed end to a position suspended above the cavity. The free end includes a first surface and a second surface oppositely arranged. The free end and the substrate or other free ends are spaced to form a gap. The sound production device further includes a first dielectric elastomer actuator, a second dielectric elastomer actuator, and a flexible connector. The sound production device of the present disclosures adopts dielectric elastomer actuators on both of the upper and lower sides of the cantilever diaphragms to together act on the cantilever diaphragms, thereby improving the linearity of the sound production device.
US11950066B2	TWS earphone interaction method and system using residual slots The present disclosure provides a TWS earphone interaction method and system, and TWS earphones. When a main earphone and a secondary earphone receive a data packet sent by an audio source, within a residual slot of a data transmission slot, the main earphone and the secondary earphone can perform data interaction, wherein the residual slot is the remaining data transmission slot after the data packet is transmitted. When a data packet is received, the main earphone sends acknowledgment information to the audio source, within a residual slot of a next data transmission slot, the main earphone and the secondary earphone can perform data interaction, wherein the residual slot is the remaining of the next data transmission slot after the acknowledgment information is sent.
US11950065B2	Speaker system A full-range speaker is driven by an original sound signal output from a sound source. A vibration detection unit detects vibration of the full-range speaker and outputs a playback signal. A subtractor outputs an error signal indicating the difference between the original sound signal and the play back signal. The error signal is amplified by the amplifier to drive the woofer which increases the sound pressure level in the low frequency range by outputting a sound in the same phase as the sound of the full range speaker if the sound pressure level of the full range speaker is insufficient, or in the opposite phase as the sound of the full range speaker if the sound pressure level is excessive. If the sound pressure level is excessive, the sound pressure level is reduced by outputting a sound in phase with the sound of the full range speaker.
US11950064B2	Method for audio rendering by an apparatus A method for audio rendering by an apparatus comprising at least one audio rendering device, the method comprising: extracting (S10) a plurality of frequency band components from an input audio signal; determining (S15) from the device frequency response and the plurality of extracted frequency band components at least one indicator representative of masking frequencies energy, masking frequencies corresponding to frequency bands that are above a frequency threshold; determining at least one correction factor (S16) from the indicator representative of masking frequencies energy; e) for each frequency band, determining a second acoustic level threshold (S20) by modifying (S17) with the correction factor a predetermined first acoustic level threshold associated with said frequency band, and determining a reduction gain from a comparison (S30) between an acoustic level of the extracted frequency band and the second acoustic level threshold associated to said extracted frequency band, and applying (S40) the reduction gain.
US11950060B2	Hearing device The present disclosure concerns a hearing device (10) with improved sealing and providing easy exchange of for example covers and/or filters and/or sealings in/on the hearing device.
US11950059B2	Antenna structure for hearing devices A hearing device includes an enclosure comprising a shell and a faceplate and is configured for at least partial insertion within an ear of a user. An antenna structure of the hearing device is oriented such that a direction of an electric field (E-field) of a propagating electromagnetic signal generated by the antenna structure is directed non-tangentially with respect to the user at the location of the user's ear. The antenna structure includes an antenna disposed in or on the faceplate and a ground plane at least partially supported by the faceplate. A battery and electronic circuitry are disposed within the shell. The electronic circuitry is powered by the battery and is electrically coupled to send and/or receive signals via the antenna structure.
US11950056B2	Method, apparatus and system for neural network hearing aid The disclosure generally relates to a method, system and apparatus to improve a user's understanding of speech in real-time conversations by processing the audio through a neural network contained in a hearing device. The hearing device may be a headphone or hearing aid. In one embodiment, the disclosure relates to an apparatus to enhance incoming audio signal. The apparatus includes a controller to receive an incoming signal and provide a controller output signal; a neural network engine (NNE) circuitry in communication with the controller, the NNE circuitry activatable by the controller, the NNE circuitry configured to generate an NNE output signal from the controller output signal; and a digital signal processing (DSP) circuitry to receive one or more of controller output signal or the NNE circuitry output signal to thereby generate a processed signal; wherein the controller determines a processing path of the controller output signal through one of the DSP or the NNE circuitries as a function of one or more of predefined parameters, incoming signal characteristics and NNE circuitry feedback.
US11950053B2	MEMS chip The present invention discloses a MEMS chip including a substrate with a back cavity; a capacitance system disposed on the substrate including a back plate, a membrane opposite to the back plate forming an inner cavity; a protruding portion accommodated in the inner cavity, fixed on one of the back plate and the membrane and spaced apart from the other along a vibration direction; a support system configured to support the capacitance system, including a first fixation portion suspending the membrane on the substrate, and a second fixation portion suspending the back plate on the substrate; the protruding portion comprises an annular first protruding portion and an annular second protruding portion surrounding the first protruding portion. The MEMS chip has higher sensitivity, higher resonance frequency and higher low frequency property.
US11950052B2	Acoustic transducer with gap-controlling geometry and method of manufacturing an acoustic transducer A transducer of the preferred embodiment including a transducer and a plurality of adjacent, tapered cantilevered beams. Each of the beams define a beam base, a beam tip, and a beam body disposed between the beam base and the beam tip. The beams are arranged such that each of the beam tips extends toward a common area. Each beam is joined to the substrate along the beam base and is free from the substrate along the beam body. A preferred method of manufacturing a transducer can include: depositing alternating layers of piezoelectric and electrode onto the substrate in block, processing the deposited layers to define cantilever geometry in block, depositing metal traces in block, and releasing the cantilevered beams from the substrate in block.
US11950051B2	Piezoelectric speaker A piezoelectric speaker (10) includes: a piezoelectric film (35); a fixing face (17) for fixing the piezoelectric film (35) to a support; and an interposed layer (40) disposed between the piezoelectric film (35) and the fixing face (17). The interposed layer (40) has a holding degree of 5×108 N/m3 or less.
US11950049B2	Acoustic reflector, speaker unit, and chair An acoustic reflector includes a reflection portion on which an elliptical reflection surface is formed, in which sound output from a speaker device that has an output position of the sound at or near one focal point on the elliptical reflection surface is reflected by the elliptical reflection surface, and the reflection portion has a size that reflects sound in a range of equal to or less than a nominal directional angle of the speaker device. As a result, because an outer shape of the reflection portion is formed to have a size in the range corresponding to the nominal directional angle of the speaker device, it is possible to reduce the size of the acoustic reflector.
US11950048B2	Sound absorption material, method of making the same and speaker box filled with the same The present invention discloses a sound absorption material including an organic frame material; a binder; a thickener; and a plurality of sound absorption grains attached to the organic frame material via the binder, having a grain size in a range of 10-100 μm. The stability and the sound absorption performance of the sound absorption material have been effectively improved.
US11950047B2	Loudspeaker A loudspeaker for producing sound at bass frequencies including: a diaphragm; a frame, wherein a proximal end of the diaphragm is suspended from the frame by at least one proximal suspension element, wherein the at least one proximal suspension element is configured to substantially prevent translational movement of the proximal end of the diaphragm relative to the frame, whilst permitting translational movement of a distal end of the diaphragm which is opposite to the proximal end of the diaphragm; a drive unit configured to move the distal end of the diaphragm based on an electrical signal.
US11950039B2	Ringed-shaped biometric earpiece A wearable device includes a ring-shaped housing having a central opening and defining an annular interior volume. The housing is configured to be worn within an ear of a subject such that the subjects ear canal is exposed by the central opening. At least one optical emitter and at least one optical detector are supported within the housing. The housing includes at least one window through which light can be delivered from the at least one optical emitter to the ear, and through which light from the ear can be delivered to the at least one optical detector.
US11950037B2	External microphone combined with a heating system A surface vehicle includes a microphone detecting sounds originating outside of the surface vehicle. A heating element is mounted in association with the microphone and provides heat for preventing accumulation of ice near the microphone wherein the ice accumulation would degrade an ability of the microphone to detect sounds originating outside of the surface vehicle.
US11950036B2	Speaker assembly An electronic device can include a housing defining an aperture and a display positioned in the aperture. The display and the housing can define an internal volume in which a speaker assembly is positioned. The speaker assembly can include a speaker module and a speaker enclosure in fluid communication, with the speaker enclosure at least partially defining a speaker volume.
US11950035B2	Sound generating apparatus for vehicles and vehicle including the same A sound generating apparatus for vehicles may include a sound generating device to be covered by a vehicle interior material of a vehicle. The sound generating device may be configured to vibrate the vehicle interior material. A vehicle including the sound generating apparatus for vehicles may include a vehicle interior material, covering a vehicle structure, and at least one sound generating apparatus disposed at the vehicle interior material. The vehicle interior material may vibrate according to a vibration of the sound generating apparatus to output a sound.
US11950030B2	Electronic apparatus and method of controlling the same, and recording medium An electronic apparatus enables a user to suitably select sound to be collected in connection with moving image capturing. The electronic apparatus is communicable with a plurality of sound collection devices, and includes a display control unit that displays, for each of the plurality of sound collection devices, a display item corresponding to the each sound collection device, based on positional information for the respective each sound collection device, acquired by a position acquisition unit, and displays, with the plurality of displayed display items, an image acquired by an image acquisition unit, wherein the display control unit displays, for the each sound collection device, the corresponding display item, even if the display item corresponds to a sound collection device not located within a range of image capturing of the acquired image, and a control unit associates and records the acquired image and sound information in a recording device.
US11950027B2	Interactive projection system and operation method thereof An interactive projection system including a projector and a touch interactive light source device is provided. The projector includes a projection optical engine, a camera module, and a control module. The touch interactive light source device includes at least one infrared light source module and a wireless signal transmission module. The control module is electrically connected to the projection optical engine and the camera module, and controls the touch interactive light source device through the wireless signal transmission module, so that the touch interactive light source device is placed in a recommended installation position and the interactive projection system is in an interactive mode. An operation method of the interactive projection system is also provided.
US11950026B2	Methods and apparatus employing angular and spatial modulation of light A light projection system including a light source and a light controller to generate modulatable beams of light and an angular light modulator (ALM) positioned to selectively direct the light from each beam. The light controller can be a spatial light modulator or a processor programmed to control light output. The angular light modulator may be a digital micromirror device (DMD). The ALM may be configured to direct the images into diffraction orders or using scanning the images. A LIDAR system to detect a position of an object including a first source of a two-dimensional array of beams of light and ALM to project light into a selected one of a plurality of directions. An illumination system, comprising a first angular-spatial light modulator (ASLM) and a second ASLM system configured such a first beam and a second beam of light intersect.
US11950023B2	Intelligent automobile networking system An intelligent automobile networking system, which includes a cloud server, a dash camera installed on a vehicle communicatively coupled to the cloud server for recording the video and position information related to the driving of the vehicle, an IP camera installed on a place exclude the dash camera and the cloud server to record surveillance images of that place, and a mobile device is communicatively coupled to the cloud server, the dash cam and the IP camera, wherein, two-way information between the vehicle and the field installed with the IP camera can be received, shared and commonly managed, and the system App is cross-platform installed on the cloud server, the mobile terminal and the dash camera.
US11950010B2	Imaging apparatus and imaging system This technology relates to an imaging apparatus and an imaging system for improving the accuracy of distance measurement performed by use of SPADs.The imaging apparatus includes a pixel array section having pixel sections arrayed therein. Each pixel section includes: an SPAD (single photon avalanche photodiode); a resistance component configured to be connected serially with the SPAD; an output section configured to output a light reception signal indicating photon incidence on the SPAD; and a pulse generation section configured to output a pulse signal in synchronism with the output of the light reception signal. Each pixel sections further includes at least one of: a switch configured to be connected interposingly between the SPAD and the resistance component and turned off in synchronism with the pulse signal; or a pull-in section configured to pull in an input current flowing through the SPAD via the resistance component in synchronism with the pulse signal, thereby suppressing the input current flowing through the SPAD. This technology may be applied to cameras that capture range images, for example.
US11950009B2	Solid-state image sensor In a solid-state image sensor that compares an amount of change in light amount and a threshold, time required to adjust the threshold is shortened.The solid-state image sensor includes a voltage comparison unit and a count unit. In the solid-state image sensor, the voltage comparison unit compares an analog signal according to an amount of change in incident light with a predetermined voltage indicating a boundary of a predetermined voltage range, and outputs a comparison result as a voltage comparison result. Furthermore, in the solid-state image sensor, the count unit counts a count value every time the voltage comparison result indicating that the analog signal falls outside the voltage range is output.
US11950006B2	White balance and fixed pattern noise frame calibration using distal cap The disclosure extends to methods, systems, and computer program products for producing an image in light deficient environments and correction of white balance and/or fixed pattern noise at startup or at any other time during a procedure.
US11950005B2	Solid-state imaging device and imaging apparatus A solid-state imaging device includes: a photoelectric conversion element that is disposed on a semiconductor substrate and generates signal charges by photoelectric conversion; a first diffusion layer that holds signal charges transferred from the photoelectric conversion element; a capacitive element that holds signal charges overflowing from the photoelectric conversion element; an amplifier transistor that outputs a signal according to the signal charges in the first diffusion layer; a first contact that is connected to the first diffusion layer; a second contact that is connected to a gate of the amplifier transistor; and a first wire that connects the first contact and the second contact. A shortest distance between the semiconductor substrate and the first wire is less than a shortest distance between the semiconductor substrate and the capacitive element.
US11950002B2	Analog resolution adjustment for CMOS image sensor Analog power savings is achieved by pre-charging only those pixels of a sensor array that are needed as determined responsive to any one of a power configuration, image size, image position of interest, desired/selected frame rate, desired/selected resolution, etc. To that end, the solution presented herein selects one or more sensor segments, each comprising a subset of pixels of the sensor array, and only pre-charges the pixels in the selected segment(s). In so doing, the solution presented herein provides a power savings proportional to the number of uncharged pixel circuits.
US11949999B2	Systems and methods for gate-based vehicle image capture A gate-based vehicle image capture system for analyzing vehicle image data is presented. The system may include a portable imaging gate apparatus configured to capture vehicle image data of a vehicle. The portable imaging gate apparatus may include a plurality of imaging assemblies positioned at a plurality of viewing angles. The system may further include an external processing server configured to receive the vehicle image data from the portable imaging gate apparatus. The external processing server may also analyze the vehicle image data to identify a plurality of vehicle features, and determine a first vehicle feature from the plurality of vehicle features. The first vehicle feature may be related to a vehicle incident. The system may also include a provider server configured to receive the first vehicle feature from the external processing server, and update an aspect of a risk evaluation based on the first vehicle feature.
US11949998B2	Photographic paddle and process of use thereof A photographic paddle and process of use thereof are provided. The photographic paddle is used for photographing interior or close-up vehicle exterior region features of a subject vehicle, and to rapidly produce high-quality images that are reflection-free and glare-free. The photographic paddle has the ability to produce wide-angle high-quality images and stereoscopic three-dimensional images that are reflection-free and glare-free. The photographic paddle has additional utility to photograph interior and close-up vehicle exterior region features of a subject vehicle in-situ in a densely arranged inventory lot without having to move the vehicle to and from a staging area. The photographic paddle has further utility as a versatile process that is able to rapidly adapt to changing photographic conditions as the photographic paddle moves relative to vehicle features to be photographed, ensuring capture and production of high-quality, reflection-free, and glare-free images without having to set the camera prior to each image capture.
US11949993B2	Electric device, controlling method of controlling electric device, and computer readable storage medium An electric device according to the embodiments of the present disclosure includes a camera module that takes a photograph of a subject to acquire a first camera image, and takes a photograph of the subject to acquire a second camera image with a wider angle of view than the first camera image; an image signal processor that controls the camera module to acquire a camera image; and a display module that displays an image.
US11949992B2	UAV panoramic imaging A method includes in response to receiving an instruction for starting a panoramic mode, controlling an unmanned aerial vehicle (UAV) to hover at or near a predetermined location; while the UAV is hovering at or near the predetermined location, causing an image capturing device to capture a plurality of images by controlling a carrier that couples the image capturing device to the UAV to rotate the image capturing device about a first axis of the carrier; and stabilizing the image capturing device against motions with respect to a second axis or a third axis of the carrier while the image capturing device is rotating about the first axis of the carrier.
US11949991B2	Panoramic image capture for multispectral sensor An image capture device may include a first spectral filter and a second spectral filter arranged so that a panoramic image capture operation captures light filtered by the first spectral filter and light filtered by the second spectral filter in a same region of a combined image and one or more processors to: capture a plurality of images based on the panoramic image capture operation; extract first information and second information from the plurality of images, wherein the first information is associated with the first spectral filter and the second information is associated with the second spectral filter; identify an association between the first information and the second information based on a feature captured in the plurality of images via the first spectral filter and the second spectral filter; and store or provide information based on the association between the first information and the second information.
US11949990B2	Scale-down capture preview for a panorama capture user interface This document describes apparatuses and techniques enabling a scale down capture preview for a panorama capture user interface. This scale down preview enables users to more-easily and more-accurately capture images for a panorama.
US11949989B2	Multiple camera imager for inspection of large diameter pipes, chambers or tunnels One embodiment provides a system, including: an inspection platform configured to move through underground infrastructure; an imaging device coupled to the inspection platform; the imaging device comprising a camera housing that arranges an array of four or more cameras in a predetermined configuration; the camera housing comprising a plurality of apertures, wherein each aperture houses a respective camera therein with a viewing axis offset about 30 degrees to about 120 degrees from a viewing axis of an adjacent camera within the array; and circuitry that operates the imaging device to capture a plurality of images using the four or more cameras; where the circuitry captures the plurality of images for a composite image of an interior region of the underground infrastructure, and where the region is larger than a single viewing field of any of the four or more cameras. Other embodiments are described and claimed.
US11949988B2	Camera actuator including a dummy member and camera module including same Disclosed in an embodiment of the present invention is a camera actuator including a housing, a mover disposed in the housing and including an optical member, a tilting guide unit disposed between the housing and the mover, a driving unit which is disposed in the housing and drives the mover, and an elastic member disposed between the tilting guide unit and the housing, wherein the driving unit includes a first magnet disposed on a first side surface of the mover and a dummy member disposed on a second side surface of the mover facing the first side surface.
US11949986B2	Anti-shake method, anti-shake apparatus, and electronic device The present application discloses an anti-shake method, an anti-shake apparatus, and an electronic device. The method includes: acquiring, in a case that a camera of an electronic device captures a first picture in real time, a shaking parameter of the electronic device; and cropping a first region in the first picture according to a first cropping parameter corresponding to the shaking parameter, and displaying the cropped first picture, where the first picture includes the first region and a second region, the second region is a common region of the first picture and N frames of pictures, the N frames of pictures are pictures captured before the first picture is captured, and N is an integer greater than or equal to 1.
US11949983B2	Transmission and confirmation of camera configuration data and commands through a network Systems and methods for transferring data between a server and a system of cameras. One embodiment provides a low-power radio frequency (“RF”) network for a system of cameras. The network comprises a server configured to access information related to the system of cameras, wherein the server receives a signal indicating a user input, and a first camera of the system of camera. The first camera is configured to receive a status report from a second camera of the system of cameras, update a cache of the first camera based on the status report from the second camera of the system of cameras, and transmit the updated cache of the first camera to the server.
US11949981B2	Display device, method for controlling display device, and non-transitory computer readable medium for reducing power consumption relating to image display A display device according to one embodiment of the present disclosure acquires time series images; processes the acquired images; performs control so that a processed image is displayed on a display; detects a closed state of an eyelid of a user; and starts power saving processing to reduce power consumption of the image processing or the displaying, in response to the detection of the closed state of the eyelid, and instructs restart of processing that was being performed before the power saving processing, in the image processing or the displaying, at a timing when a specific time has elapsed from the detection of the closed state of the eyelid.
US11949977B2	Electronic equipment, method for controlling the same, and recording medium Electronic equipment includes an obtaining unit configured to obtain a third image in which a first image captured via a first optical system and a second image captured via a second optical system are arranged side by side, the second image having parallax with the first image and a setting unit configured to set, in the third image, a target area to which predetermined processing is to be applied, based on a user operation. The setting unit is configured to set the target area in such a manner that the item indicating the target area includes either one of the first image and the second image.

1 2 3 4 5 6 7 8 9 10