| Document | Document Title |
|---|---|
| US11921704B2 |
Version control interface for accessing data lakes
A version control interface for data provides a layer of abstraction that permits multiple readers and writers to access data lakes concurrently. An overlay file system, based on a data structure such as a tree, is used on top of one or more underlying storage instances to implement the interface. Each tree node tree is identified and accessed by means of any universally unique identifiers. Copy-on-write with the tree data structure implements snapshots of the overlay file system. The snapshots support a long-lived master branch, with point-in-time snapshots of its history, and one or more short-lived private branches. As data objects are written to the data lake, the private branch corresponding to a writer is updated. The private branches are merged back into the master branch using any merging logic, and conflict resolution policies are implemented. Readers read from the updated master branch or from any of the private branches. |
| US11921698B2 |
System and method for data quality assessment
Methods and systems for providing data assessment across related datasets, including identifying exceptional values in datasets and assessing upstream and or downstream datasets that utilize the exceptional values. Data assessment rules use exceptional values found in a dataset and data lineage information to identify impacted data in upstream or downstream datasets. |
| US11921693B1 |
HTTP events with custom fields
A data intake and query system receives a message including raw machine via an internet protocol (IP) such as the hypertext transfer protocol (HTTP). The message includes a distinct payload portion and a distinct custom field portion. The payload portion includes raw machine data, while the custom field portion includes values for fields. An event that includes the raw machine data and the values is generated from the payload portion and the values are extracted from the custom field portion. The event is then stored such that the values are associated with the event. |
| US11921688B2 |
Environment construction support device and environment construction support method
According to the invention, it is possible to efficiently construct an environment for implementing an IT system. Provided is an environment construction support device. The environment construction support device stores a tree structure model that is information representing an environment for implementing an IT system in a tree structure and can be updated as needed, a construction script structure that is information related to a construction script that is a series of codes for constructing the environment and can be updated as needed, and parameter correspondence information that is information indicating a correspondence between an element of the tree structure model and an element of the construction script, and updates the parameter correspondence information to correspond to latest contents of the tree structure model and the construction script structure by comparing at least one of the tree structure model and the construction script structure with the parameter correspondence information. |
| US11921685B2 |
System and method for on-demand data cleansing
A system and method for on-demand data cleansing is disclosed. The system includes a processor and a volatile memory including a data object having a plurality of data fields, each field having a tag and a value. The system also includes a cleansing module stored in the volatile memory and executed by the processor. The cleansing module includes a library having a plurality of tag-operation pairs. The cleansing module is configured to receive a pointer locating the data object within volatile memory, and further configured to, for each data field, look up the tag of the data field among the library tags, and execute the operation paired with the matching library tag on the value of the field, modifying the value of the data field while it is stored in volatile memory. The cleansing module is configured to execute the operation in near real-time, and at runtime. |
| US11921684B2 |
Systems and methods for database management using append-only storage devices
An apparatus is disclosed. The apparatus may be implemented in a database node or a storage node and includes one or more processors and memory storing instructions for causing the processor to perform a number of operations. Responsive to a page write request, the apparatus determines an identifier corresponding to the requested page, sends component blocks corresponding to the page to a storage node for appending to an append-only storage log of the storage node, receives the physical location of the stored component blocks, and associates the physical storage location of the stored component blocks with the logical identifier corresponding to the page. |
| US11921682B2 |
Extracting data from a blockchain network
According to at least one embodiment, a method, computer system, and computer program product for model-driven extraction of event data by a computational device is provided. The present invention may include transforming event data of an event occurring on a blockchain network using an event schema to comply with a data model of an external data structure; mapping, based on the event schema and the data model, the event data to a logical structure of the external data structure; and loading the transformed event data to the external data structure to modify a data content of the external data structure based on the mapping. |
| US11921681B2 |
Machine learning techniques for predictive structural analysis
Various embodiments of the present invention provide methods, apparatus, systems, computing devices, computing entities, and/or the like for performing predictive structural analysis. Certain embodiments of the present invention utilize systems, methods, and computer program products that perform predictive structural analysis using at least one of table column classification machine learning models, table column clustering machine learning models, structural variance generation machine learning models, and emergence report generation machine learning models. |
| US11921678B2 |
Using a logical operation coalescer to concurrently update file system objects
The technologies described herein are generally directed toward using logical operation coalescing to concurrently update file system objects. According to an embodiment, a system can comprise a processor and a memory that can enable performance of operations including receiving a first data update from first node equipment for a first part of an entry of a data structure comprising multiple linked entries, and a second data update from second node equipment for a second part of the entry of the data structure. The operations can further include locking, by the first computing equipment, the first part and the second part of the entry. Further, the operations can include, based on the first data update and the second data update, updating, by the first computing equipment, respectively, the first part and the second part of the entry. |
| US11921677B1 |
Sharing namespaces across file system clusters
Embodiments are directed to sharing namespaces across file system clusters. A file in a spoke file system may be determined based on a command provided to the spoke file system such that the file may be associated with an inode mask. Data blocks associated with the file may be determined based on the command and the inode mask such that the data blocks may be absent from the spoke file system. Requests for leases may be generated based on the absent data blocks such that each lease request corresponds to a portion of the absent data blocks Employing the leases provided by a hub file system to: copy the absent data blocks from the hub file system where each portion of absent data blocks may be associated with a lease; updating the inode mask to include the leases and each copied portion of absent blocks. |
| US11921672B2 |
Query execution at a remote heterogeneous data store of a data fabric service
Systems and methods are described for executing a query of raw machine data that is stored at a remote data store that may store heterogeneous data. The system can determine the directories or file types that may store event data and may instruct one or more worker nodes to access files that may store events based on the determined directories of file types. Further, the system may exclude files at the remote data store that may not be identified as potentially storing events enabling a query that implicates a heterogeneous data store to be efficiently executed. |
| US11921671B2 |
Managing volume snapshots in the cloud
Systems, methods, and machine-readable media for creating, deleting, and restoring volume snapshots in a remote data store are disclosed. A storage volume and a storage operating system are implemented in a software container. Through a user interface, a user may create a snapshot of the volume to a cloud storage. A user may also delete individual snapshots from the cloud storage. Further, deletion of a most recent snapshot may occur by awaiting deletion (though marking as deleted to the user) until a next snapshot is received. Snapshots in the cloud storage are manipulatable even after destruction of the source volume (by destruction of the container, for example). A controller outside the container is used by implementing the same API as the controller in the container had. Full restores of snapshots in the cloud are also possible even when the original container and volume have been destroyed. |
| US11921661B2 |
Stand with dual purpose RJ12 interface
Some embodiments include a stand that includes a communication interface, a universal serial bus (USB) microcontroller, and one dual purpose RJ12 interface configured to switch between a cash drawer mode and an RS232 mode. The stand can be configured to be coupled to a main display device. The main display device (e.g., an application running on the main display device) can enable selection of the cash drawer mode for communications via the dual purpose RJ12 interface, and receive an input signal after the selection. The main display device can enable selection of the RS232 mode for communications via the dual purpose RJ12 interface based on the input signal and transmit an indication to the stand, where the dual purpose RJ12 interface is configured to operate in the RS232 mode. The stand can include a hinge structure that enables the main display device to be flipped to face an opposite direction. |
| US11921660B2 |
Equalization time configuration method, chip, and communications system
An equalization time configuration method is applied to a processor system in which a Peripheral Component Interconnect Express (PCIe) bus or a Cache Coherent Interconnect for Accelerators (CCIX) bus is used. The equalization time configuration method includes determining a working physical layer (PHY) type of a master chip and a working PHY type of a slave chip, determining an equalization time of the slave chip in a fourth phase of equalization based on the working PHY type of the master chip, and determining an equalization time of the master chip in a third phase of the equalization based on the working PHY type of the slave chip. |
| US11921658B2 |
Enabling use of non-volatile media-express (NVMe) over a network
Enabling a protocol for efficiently and reliably using the NVME protocol over a network, referred to as NVME over Network, or NVMEoN, may include an NVMEoN exchange layer for handling exchanges between initiating and target nodes on a network, a burst transmission protocol that provides guaranteed delivery without duplicate retransmission, and an exchange status block approach to manage state information about exchanges. |
| US11921654B2 |
Collection of runtime information for debug and analysis, including by aggregating status information into a standardized message format and timestamping
A hardware functional module sends, to an aggregation module and in a standardized message format, first status information associated with the hardware functional module according to a first set of reporting rules via a first dedicated link. The firmware functional module sends, to the aggregation module and in the standardized message format, second status information associated with the firmware functional module according to a second set of reporting rules via a second dedicated link. The aggregation module aggregates the first status information in the standardized message format and the second status information in the standardized message format and inserts a timestamp to obtain a timestamped and aggregated message stream. The timestamped and aggregated message stream enables a visualization system to analyze the hardware functional module and the firmware functional module. |
| US11921650B2 |
Dedicated cache-related block transfer in a memory system
A memory system includes a dynamic random access memory (DRAM) device, a second memory device, and a memory controller circuit. The memory controller circuit is coupled to the DRAM device by a first data channel configured to transfer first data between the memory controller circuit and the DRAM device on behalf of a host, and is also coupled to the DRAM device by a second data channel configured to transfer second data between the memory controller circuit and the DRAM device on behalf of the second memory device while the first data is being transferred across the first data bus. |
| US11921649B1 |
Multiple parallel mode flash channels with serial link
Various implementations described herein relate to systems and methods for a solid state drive (SSD) that includes a first controller and a NAND package. The NAND package includes a plurality of dies grouped into a plurality of subsets. The NAND package includes a second controller operatively coupled to each of the plurality of subsets via a corresponding one of a plurality of parallel mode channels. The first controller is operatively coupled to the NAND package via a serial link. |
| US11921647B2 |
Sequencer chaining circuitry
A system can include a plurality of sequencers each configured to provide a number of sequenced output signals responsive to assertion of a respective sequencer enable signal provided thereto. The system can include chaining circuitry coupled to the plurality of sequencers. The chaining circuitry can comprise logic to: responsive to assertion of a primary enable signal received thereby, assert respective sequencer enable signals provided to the plurality of sequencers in accordance with a first sequence; and responsive to deassertion of the primary enable signal, assert the respective sequencer enable signals provided to the plurality of sequencers in accordance with a second sequence. |
| US11921645B2 |
Securing data direct I/O for a secure accelerator interface
The present disclosure includes systems and methods for securing data direct I/O (DDIO) for a secure accelerator interface, in accordance with various embodiments. Historically, DDIO has enabled performance advantages that have outweighed its security risks. DDIO circuitry may be configured to secure DDIO data by using encryption circuitry that is manufactured for use in communications with main memory along the direct memory access (DMA) path. DDIO circuitry may be configured to secure DDIO data by using DDIO encryption circuitry manufactured for use by or manufactured within the DDIO circuitry. Enabling encryption and decryption in the DDIO path by the DDIO circuitry has the potential to close a security gap in modern data central processor units (CPUs). |
| US11921642B2 |
Methods and apparatuses for addressing memory caches
A cache memory includes cache lines to store information. The stored information is associated with physical addresses that include first, second, and third distinct portions. The cache lines are indexed by the second portions of respective physical addresses associated with the stored information. The cache memory also includes one or more tables, each of which includes respective table entries that are indexed by the first portions of the respective physical addresses. The respective table entries in each of the one or more tables are to store indications of the second portions of respective physical addresses associated with the stored information. |
| US11921639B2 |
Method for caching data, a host device for caching data, and a storage system for caching data
A method for caching data, and a host device and a storage system that caches data. The method includes determining a first file in a storage device as a first predetermined type of file; reallocating a logical address of a predetermined logical address region to the first file; and updating a first logical address to physical address (L2P) table, corresponding to the predetermined logical address region, in a cache of the host device. The updated first L2P table includes a mapping relationship between the logical address reallocated for the first file and a physical address of the first file. |
| US11921638B2 |
Flash-integrated high bandwidth memory appliance
According to some embodiments of the present invention, there is provided a hybrid cache memory for a processing device having a host processor, the hybrid cache memory comprising: a high bandwidth memory (HBM) configured to store host data; a non-volatile memory (NVM) physically integrated with the HBM in a same package and configured to store a copy of the host data at the HBM; and a cache controller configured to be in bi-directional communication with the host processor, and to manage data transfer between the HBM and NVM and, in response to a command received from the host processor, to manage data transfer between the hybrid cache memory and the host processor. |
| US11921637B2 |
Write streaming with cache write acknowledgment in a processor
In described examples, a processor system includes a processor core that generates memory write requests, a cache memory, and a memory controller. The memory controller has a memory pipeline. The memory controller is coupled to control the cache memory and communicatively coupled to the processor core. The memory controller is configured to receive the memory write requests from the processor core; schedule the memory write requests on the memory pipeline; and contemporaneously with scheduling respective ones of the memory write requests on the memory pipeline, send to the processor core a write acknowledgment confirming that writing of a data payload of the respective memory write request to the cache memory has completed. |
| US11921635B2 |
Method and apparatus for shared virtual memory to manage data coherency in a heterogeneous processing system
Embodiments described herein provide a scalable coherency tracking implementation that utilizes shared virtual memory to manage data coherency. In one embodiment, coherency tracking granularity is reduced relative to existing coherency tracking solutions, with coherency tracking storage memory moved to memory as a page table metadata. For example and in one embodiment, storage for coherency state is moved from dedicated hardware blocks to system memory, effectively providing a directory structure that is limitless in size. |
| US11921634B2 |
Leveraging processing-in-memory (PIM) resources to expedite non-PIM instructions executed on a host
Leveraging processing-in-memory (PIM) resources to expedite non-PIM instructions executed on a host is disclosed. In an implementation, a memory controller identifies a first write instruction to write first data to a first memory location, where the first write instruction is not a processing-in-memory (PIM) instruction. The memory controller then writes the first data to a first PIM register. Opportunistically, the memory controller moves the first data from the first PIM register to the first memory location. In another implementation, a memory controller identifies a first memory location associated with a first read instruction, where the first read instruction is not a processing-in-memory (PIM) instruction. The memory controller identifies that a PIM register is associated with the first memory location. The memory controller then reads, in response to the first read instruction, first data from the PIM register. |
| US11921633B2 |
Deduplicating data based on recently reading the data
Deduplicating data based on recently reading the data, including: determining whether a calculated signature for write data matches a particular signature corresponding to data that was recently read from the storage device, wherein the signature is calculated using the write data as input; and after determining that the calculated signature for the write data matches the particular signature, obtaining the data that was recently read and comparing the data that was recently read to the write data. |
| US11921623B2 |
Device and method for testing a sequence generated by a random number generator
Embodiments provide a device for testing a bit sequence generated by a Random Number Generator, wherein the device is configured to apply one or more statistical tests to the bit sequence, in response the detection of N bits generated by the Random number generator, each statistical test providing at least one sum value derived from the bits of the sequence, the testing device comprising: a comparator for comparing at least one test parameter related to each statistical test to one or more thresholds; a validation unit configured to determine if the bit sequence is valid depending on the comparison made by the comparator for each statistical test; wherein at least one of the test parameter and the at least one threshold is determined from N and from a target error probability. |
| US11921621B2 |
System and method for improved unit test creation
System and method for creating unit tests include: constructing a CFG representation for a computer program; utilizing the CFG to identify different potential execution paths and to identify different formulas corresponding to the different potential execution paths; parsing the source code to generate an abstract syntax tree; analyzing the computer program to determine whether it provides capability to set each of the associated variables in each formula by utilizing the abstract syntax tree; translating variables, fields, and expressions of the source code represented in each formula into decision variables; computing a solution to the list of pre-conditions from each formula to one of the potential solutions that specifies values for decision variables; selecting a formula, from the plurality of formulas, with a fewest number of associated variables; and creating a unit test, based on the data and the list of pre-conditions collected and solved. |
| US11921620B2 |
Generating a visualization of blocks of code statements related to errors in a log file
Provided are a computer program product, system, and method for generating a visualization of blocks of code statements related to errors in a log file. A log file logs errors in execution of program code. Source code, from which the program code is compiled, is analyzed to determine blocks of statements in the source code whose execution resulted in the errors in the log file. Blocks of statements in the source code are annotated with the errors in the log file caused by the blocks of statements. Execution of a block of statements annotated with an error resulted in the error logged in the log file. The annotated blocks of statements are processed to generate a video providing a visualization of the blocks of statements in the source code whose execution resulted in the errors. |
| US11921618B2 |
Locating failures in microservice system
An information handling system may include at least one processor and a memory. The information handling system may be configured to: execute an application comprising a plurality of microservices on the at least one processor, wherein the application is configured to service external requests by executing a plurality of application programming interface (API) calls among the plurality of microservices; and for each API call: determine a span ID associated with such API call; determine a trace ID associated with a particular external request that is associated with such API call; and log the span ID and the trace ID. |
| US11921606B2 |
Methods and systems for determining system capacity
Methods and system are provided for determining a system capacity. The system capacity may be determined by performing one or more capacity tests. The one or more capacity tests may produce capacity test results. |
| US11921596B2 |
Virtual machine failover management for geo-redundant data centers
A data storage infrastructure may establish a partition that includes a first data center and a second data center that is geographically separated from the first data center. The data storage infrastructure may replicate a full snapshot and one or more incremental snapshots of a virtual machine from a first data management platform to a second data management platform, where the virtual machine is migrated from a first host of the first host group to a second host of the second host group upon a failover event occurring at the first data center. The data storage infrastructure may then capture an incremental snapshot of the virtual machine based on linking a first instance of the virtual machine that was replicated from the first data management platform and a second instance of the virtual machine that is managed by the second data management platform. |
| US11921595B2 |
System and method for multi-tier synchronization
The present invention provides a System and method for multi-tiered data synchronization. Data is synchronized between a master synchronization server, one or more proxy synchronization servers, and client devices. Client devices establish synchronization sessions with either a proxy synchronization server or a master synchronization server, depending on which server provides the “best” available connection to that client device. Each proxy synchronization server synchronizes data with client devices that have established a synchronization session with such proxy synchronization server. The master synchronization server synchronizes data with client devices that have established a synchronization session with the master synchronization server. Each proxy synchronization server synchronizes data with the master synchronization server. Metadata associated with synchronized files is synchronized throughout the system in real-time. Files may be synchronized in real-time or of a delayed time. |
| US11921587B2 |
Parallelization of incremental backups
A backup of a current state of a storage is determined to be initiated. A previous state of the storage storing key-object entries is analyzed to identify parallelization partition identifiers. At least a portion of the partition identifiers is used as boundaries between subgroups of the key-object entries processed in parallel to perform the backup of the current state of the storage. |
| US11921585B2 |
Run-time selection of optimal commands for accessing serial access resources
Run-time selection of optimal commands for accessing serial access resources is described. A system receives a request to access a serial access resource. The system identifies a first section to access in the serial access resource and a second section to access in the serial access resource which is separated from the first section to access by an intermediate section in the serial access resource. The system generates combinations of access commands associated with accessing the first and the second sections to access. The system estimates target values, based on locations of the first and the second sections to access in the serial access resource, corresponding to the combinations of access commands. The system selects a combination of access commands which corresponds to an optimal target value. The system enables performance of the selected combination of access commands on the first and the second sections in the serial access resource. |
| US11921580B2 |
Redundant multiport memory for vehicle applications
A redundant multiport memory for vehicle applications can have different ports coupled to different hosts that are configured to provide advanced driver assistance system (ADAS) for the vehicle. Different multiport memory devices can provide primary or secondary storage of data for the hosts. At least one of the hosts can perform a functionality check on at least one of the multiport memory devices and make use of a second multiport memory device to which it is coupled if a first multiport memory device to which it is coupled fails the check. |
| US11921576B2 |
Memory device and repair method with column-based error code tracking
A memory device is disclosed that includes a row of storage locations that form plural columns. The plural columns include data columns to store data and a tag column to store tag information associated with error locations in the data columns. Each data column is associated with an error correction location including an error code bit location. Logic retrieves and stores the tag information associated with the row in response to activation of the row. A bit error in an accessed data column is repaired by a spare bit location based on the tag information. |
| US11921575B1 |
Systems and methods for verifying vehicle identification number (VIN)
A VIN verification system allow an accurate detection of incorrectly entered VIN in an electronic file followed by correction of the incorrectly entered VIN. A server of the VIN verification system verify characters and letters of the VIN in the electronic file to detect data entry and/or transmission errors. The server upon determining that the characters and entered in the VIN are incorrect will then replace the characters and letters with alternate or substitute characters and letters and generate a new VIN in the electronic file. The server will reexamine the new VIN to validate the new VIN, and then transmit the electronic file to another web application for further processing. |
| US11921574B2 |
Apparatus and method for fault handling of an offload transaction
Apparatus and Method for Fault Handling of an Offload Transaction. For example, one embodiment of a processor comprises: a plurality of cores; an interconnect coupling the plurality of cores; and offload circuitry to transfer work from a first core of the plurality of cores to a second core of the plurality of cores without operating system (OS) intervention, the work comprising a plurality of instructions; the second core comprising first fault management logic to determine an action to take responsive to a fault condition, wherein responsive to detecting a first type of fault condition, the first fault management logic is to cause the first core to be notified of the fault condition, the first core comprising second fault management logic to attempt to resolve the fault condition. |
| US11921568B2 |
Methods and systems for determining stopping point
A computer-implemented method includes based on a calculated first estimated error rate, second estimated error rate, first uncertain rank count, second uncertain rank count, and target error rate, displaying a stopping point indication. A computing system includes a processor; and a memory storing instructions that, when executed, cause the computing system to: based on a calculated first estimated error rate, second estimated error rate, first uncertain rank count, second uncertain rank count, and target error rate, display a stopping point indication. A non-transitory computer readable medium includes program instructions that when executed, cause a computer system to: based on a calculated first estimated error rate, second estimated error rate, first uncertain rank count, second uncertain rank count, and target error rate, display a stopping point indication. |
| US11921567B2 |
Temporarily preventing access to a storage device
Temporarily limiting access to a storage device, including: determining that a storage device of a plurality of storage devices in a storage system is operating outside of a defined performance range; determining that the storage device operating outside of the defined performance range may be caused by a rehabilitative action performed on the storage device; and modifying a storage operation issuance policy for one or more storage devices of the plurality of storage devices until a determination that the storage device is operating within the defined performance range. |
| US11921564B2 |
Saving and restoring configuration and status information with reduced latency
In one embodiment, an apparatus includes: a port circuit to receive a configuration write from a source circuit; a save restore memory coupled to the port circuit to store information of a plurality of control and status registers (CSRs); and a configuration network coupled to the port circuit, the configuration network coupled to a plurality of nodes, each of the plurality of nodes comprising at least one CSR. The port circuit may be configured to send the configuration write to a first node of the plurality of nodes and to the save restore memory. Other embodiments are described and claimed. |
| US11921562B2 |
Dynamic power management
Power supply efficiency may be provided. First, a total power supply capacity may be determined comprising a sum of a plurality of supply capacities respectively corresponding to a plurality of power supplies serving a plurality of components. Next, a load value corresponding to the plurality of components may be determined. A number of the plurality of power supplies may then be powered down. The number of power supplies powered down may comprise a value that may cause a remaining number of the plurality of power supplies serving the plurality of components to operate within an efficiency range. |
| US11921560B2 |
Memory device power management
Methods, systems, and devices for memory device power management are described. An apparatus may include a memory die that includes a power management circuit. The power management circuit may provide a voltage for operating one or more memory dies of the apparatus based on a supply voltage received by the memory die. The second voltage may be distributed to the one or more other memory dies in the apparatus. |
| US11921555B2 |
Systems, methods, and devices for providing power to devices through connectors
A method may include coupling a device to a host through a connector, receiving, by a host controller, a request for boost power from the device, determining, by the host controller, an amount of surplus power available from one or more power sources arranged to provide power to the device through the connector, and allocating at least a portion of the surplus power to the device as boost power. The method may further include negotiating an amount of the boost power based on the amount of surplus power available from the one or more power sources. The method may further include monitoring a power consumption of the device, and reducing a total power allocation to the device based on the power consumption of the device. |
| US11921553B2 |
Wearable electronic device having heat dissipation structure
According to an embodiment disclosed in the present document, an electronic device may include: a lens frame at least partially including a thermally conductive material; a pair of wearable members which can be rotatably coupled to the lens frame; at least one lens disposed in the lens frame; and transparent conductive lines disposed on the lens. The transparent conductive lines may be connected to the thermally conductive material of the lens frame to receive heat transferred from the lens frame. Other various embodiments are possible. |
| US11921550B2 |
Circuit board, display panel and display apparatus
A circuit board, a display panel and a display apparatus are provided. The circuit board includes a main circuit board and an adapter circuit board stacked on the main circuit board. The adapter circuit board is provided with at least one first pad region, and the first pad region includes a hollowed region penetrating through the adapter circuit board and multiple first pads distributed around the hollowed region. The main circuit board is provided with at least one second pad region including multiple second pads, and the first pads of each of the first pad regions are respectively soldered to the multiple second pads of a corresponding second pad region. |
| US11921540B2 |
Electronic device and method for performing fast transition between screens
An electronic device and method are disclosed. The device includes a foldable housing including a hinge connecting a first and second housing, a first bendable display, a second display oriented facing the first display, at least one sensor for detecting the bending, a memory and a processor. The processor implements the method, including: detecting bending by the sensor while displaying an application, determining to pre-generate another screen of the application based on the bending angle, pre-generating the second execution screen before the change in the angle is reaches a threshold value, and active a deactivated display and display the second execution screen on the activated display when the angle surpasses the predetermined threshold value. |
| US11921539B2 |
Display apparatus comprising a camera module inserted into an opening of an array substrate that is supported by a lens hole guide
A liquid-crystal display (LCD) device includes: an array substrate on which a sub-pixel is disposed; a color filter substrate on which a color filter corresponding to the sub-pixel is disposed; and a liquid-crystal layer between the array substrate and the color filter substrate. The array substrate comprises a lens hole, the color filter substrate comprises a lens hole guide, and a diameter of the lens hole is smaller than an inner diameter of the lens hole guide. |
| US11921526B2 |
Method and system for controlling an electric heater using control on energy
A method for controlling a heated process of an electric heater includes obtaining a setpoint variable indicating a target temperature of the heater. The method includes identifying an energy profile for the heater based on the setpoint variable. The energy profile provides a defined magnitude of initial electrical energy to be applied to the heater to have a temperature of the heated process reach the target temperature. The method includes obtaining a process variable indicating a performance characteristic of the heated process. The method includes providing electrical energy to the heater based on at least one of the energy profile and the process variable. |
| US11921525B1 |
System and method for controlling fluid flow with a pressure relief valve
A fluid supply system and method is provided that includes a fluid pump, a pressure sensor, a pressure relief valve (PRV), and a fluid monitoring device. The fluid pump receives fluid from a first conduit and discharges fluid into a second conduit. The pressure sensor produces sensed fluid pressure signals. The PRV is in signal communication with the pressure sensor. The fluid monitoring device includes a control orifice in fluid communication with second and third conduits. The second conduit has a first inner diameter, the third conduit has a second inner diameter, and the control orifice has an orifice inner diameter, and the orifice inner diameter is less than the first and second inner diameters. The pressure sensor senses fluid pressure in the third conduit at a position in close proximity to the control orifice. The fluid monitoring device may be in a lead or a lag domain configuration. |
| US11921524B2 |
Autonomous concentration control systems and methods of controlling concentration of a gas or particle mixture
A method of controlling a concentration or range of concentrations of a liquid or gas in an enclosure is provided. The method includes positioning an injection station within the enclosure. the injection station includes a liquid or gas source, a sprayer assembly and a system that delivers the liquid or gas from the liquid or gas source to the sprayer assembly. A concentration level of the liquid or gas in the environment surrounding the injection station is monitored using a sensor and the sensor providing a signal indicative of the concentration level to a controller. The controller controls the flow of the liquid or gas to the sprayer assembly based on the signal. |
| US11921521B2 |
Method of controlling an aircraft, flight control device for an aircraft, and aircraft with such flight control device
A method of controlling an aircraft having multiple configurations is provided, wherein each configuration is controlled by a different control law implemented by a flight control device and transition from one configuration to another configuration is achieved by gradually blending out a control law for one configuration and by gradually increasing an impact of a control law for another configuration in the flight control device based on an estimated flight condition of the aircraft by dynamically adjusting, in the flight control device, respective maximum and minimum limit values of control volumes, which control volumes are defined by parameter ranges of control parameters in connection with a corresponding control law for the one configuration and for the other configuration, respectively. |
| US11921517B2 |
Controlling movement of a robotic cleaning device
A method of controlling movement of a robotic cleaning device over an area to be cleaned. The method includes storing at least one representation of the area over which the robotic cleaning device is to move, receiving an instruction to execute a cleaning program, localizing, in response to the instruction, the robotic cleaning device relative to the stored representation, and moving over the area to be cleaned as stipulated by the cleaning program by taking into account the stored representation. |
| US11921516B2 |
Magnetic marker and driving assistance system
Provided is a driving assistance system using a magnetic marker capable of providing more pieces of information. In the driving assistance system for assisting driving of a vehicle, a magnetic marker (1) including a magnet sheet (11) serving as a magnetism generating unit which generates a magnetic field and also an RFID tag (15) as an information providing unit which provides information to a vehicle side is laid on a travelling road of the vehicle, and the vehicle includes a magnetic sensor serving as a magnetism detecting unit which magnetically detects the magnetic marker (1) and also a tag reader as an information acquiring unit which acquires the information provided by the RFID tag (15) included in the magnetic marker (1). |
| US11921514B2 |
Mobile robot
According to an embodiment of the present disclosure, a mobile robot may include an outer cover including an insulating material and defining an appearance; an inner cover including an insulating material and configured to define a predetermined gap with respect to the outer cover; a battery disposed inside the inner cover; and at least one pressure sensing module disposed in the gap between the outer cover and the inner cover. The pressure sensing module may include an outer metal panel contacting an inner periphery of the outer cover, an inner metal panel contacting an outer periphery of the inner cover and spaced apart from the outer metal panel, and a pressure sensing sheet pressed between the outer metal panel and the inner metal panel and having a variable resistance. The battery may generate an electric potential difference between the outer metal panel and the inner metal panel. |
| US11921511B2 |
Automated inspection of autonomous vehicle equipment
An equipment inspection system receives data captured by a sensor of an autonomous vehicle (AV). The captured data describes a current state of equipment for servicing the AV. The equipment inspection system compares the captured data to a model describing an expected state of the equipment. The equipment inspection system determines, based on the comparison, that the equipment differs from the expected state. The equipment inspection system may transmit data describing the current state of the equipment to an equipment manager. The equipment manager may schedule maintenance for the equipment based on the current state of the equipment. |
| US11921510B1 |
Approach for consolidating observed vehicle trajectories into a single representative trajectory
A method and apparatus is provided for controlling the operation of an autonomous vehicle. According to one aspect, the autonomous vehicle may track the trajectories of other vehicles on a road. Based on the other vehicle's trajectories, the autonomous vehicle may generate a pool of combined trajectories. Subsequently, the autonomous vehicle may select one of the combined trajectories as a representative trajectory. The representative trajectory may be used to change at least one of the speed or direction of the autonomous vehicle. |
| US11921507B2 |
Vehicle system and method for providing services
A method for providing medical services to a patient, including: receiving a medical service request associated with a patient location; selecting an aircraft, located at an initial location, from a plurality of aircraft based on the patient location and the initial location; determining a flight plan for flying the aircraft to a region containing the patient location; at a sensor of the aircraft, sampling a first set of flight data; at a processor of the aircraft, autonomously controlling the aircraft to fly based on the flight plan and the set of flight data; selecting a landing location within the region; and landing the aircraft at the landing location, including: sampling a set of landing location data; determining a safety status of the landing location based on the set of landing location data; outputting a landing warning observable at the landing location; at the sensor, sampling a second set of flight data; and in response to determining the safety status and outputting the landing warning, autonomously controlling the aircraft to land at the landing location based on the second set of flight data. |
| US11921505B2 |
Unmanned surface vehicle control method based on switching T-S fuzzy system under DoS attack
The present invention discloses a collaborative design method using an event-triggered scheme (ETS) and a Takagi-Sugeno (T-S) fuzzy H∞ controller in a network environment. For the problem about the unmanned surface vehicle control based on a switching T-S fuzzy system under an aperiodic DoS attack, the present invention provides an H∞ controller design method based on the event-triggered scheme. The characteristics of the unmanned surface vehicle system under the DoS attack are analyzed, and external disturbance in the navigation process is added into an unmanned surface vehicle motion model to establish an unmanned surface vehicle switching system model. The stability of the system is analyzed by piecewise Lyapunov functionals, such that controller gain and event-triggered scheme weight matrix parameters are obtained, thus ensuring that a networked unmanned surface vehicle navigation system has the ability to resist the DoS attack and the external disturbance. |
| US11921504B1 |
Vehicle controller validation
Techniques for generating simulations to evaluate an update to a controller. The controller may be configured to control one or more functionalities of an autonomous and/or a semi-autonomous vehicle. A simulation computing system may receive a request to evaluate a first controller. The simulation computing system may generate a simulation based on data associated with a previous operation of the vehicle in an environment, the previous operation being controlled by a second controller (e.g., standard for evaluation, control version, etc.). The simulation computing device may cause the first controller to control a simulated vehicle in the simulation and may determine whether to validate the update to the controller based on a difference between first metrics associated with a control of the simulated vehicle by the first controller and second metrics associated with a control of the vehicle by the second controller. |
| US11921501B2 |
Automatic driving system
An automatic driving system includes a control device that controls automatic driving of a vehicle, and a storage device that contains external environment information indicating an external environment of the vehicle. A driving transition zone is a zone in which a driver of the vehicle takes over at least a part of driving of the vehicle, from the control device. A termination target velocity is a target velocity of the vehicle at an end point of the driving transition zone. The control device variably sets the termination target velocity, depending on the external environment at the end point or the external environment surrounding the end point. Then, the control device controls the velocity of the vehicle in the driving transition zone, such that the velocity of the vehicle at the end point is the termination target velocity. |
| US11921500B2 |
Graphical user interface for enhanced unmanned aerial vehicle flight along computed splines
Technology for generating and displaying a graphical user interface for operating an unmanned aerial vehicle (UAV) is disclosed herein that generates and updates a representation of a spline flight path. In various implementations, a graphical user interface detects user interactions with a remote control device directing the flight control subsystem of the UAV to record keyframes and to compute a spline based on the keyframes during flight. The graphical user interface displays a real-time perspective of the UAV with a representation of the spline and the keyframes overlaying the view. The graphical user interface continually updates the representation as the UAV flies and when the spline is updated as the keyframes are updated. |
| US11921498B2 |
Industrial internet of things (IoT) for correction and regulation of defective product, control methods and storage medium thereof
The present disclosure provides an industrial IoT for correction and regulation of a defective product, a control method, and a storage medium. The industrial IoT includes a user platform, a service platform, a management platform, and a sensing network platform that interact in sequence. The service platform, the management platform, and the sensing network platform are all arranged in a front-sub-platform layout. The control method is applied in the industrial IoT. The industrial IoT may calculate whether a defective product is correctable according to a correction cost of the defective product, and may reduce the correction cost and a time consumption of a corresponding correction device, thereby reducing correction cost of the defective product and a loss in a manufacturing process, further ensuring a normal product manufacturing efficiency of the correction device, and thus reducing a correction loss of a waste product and the defective product. |
| US11921494B2 |
Rapid automation system and method for line clearance
An automated line clearance inspection system will enable fast and accurate inspection of packaging equipment lines to reduce or prevent product intermixing. The system includes a set of image capturing devices that are controlled via a central processing unit whereby end run images are compared with control images to determine if a line is cleared. |
| US11921493B2 |
Systems and methods for real-time measurement and control of sprayed liquid coverage on plant surfaces
Presented herein are systems and methods for automatically determining liquid coverage on plant surfaces. More particularly, in certain embodiments, presented herein is a system for receiving an image depicting one or more plant surfaces, automatically identifying the plant surfaces in the image and distinguishing portions covered by liquid, and automatically determining a liquid coverage value. In some embodiments, the system determines changes to liquid spraying parameters to achieve desired liquid coverage values. In some embodiments, the system uses two cameras to cooperatively conduct background removal in images and determination of liquid coverage. |
| US11921492B2 |
Transfer between tasks in different domains
A system for trajectories imitation for robotic manipulators is provided. The system includes an interface configured to receive a plurality of task descriptions, wherein the interface is configured to communicate with a real-world robot, a memory to store computer-executable programs including a robot simulator, a training module and a transfer module, and a processor, in connection with the memory. The processor is configured to perform training using the training module, for the task descriptions on the robot simulator, to produce a plurality of source policy with subgoals for the task descriptions. The processor performs training using the training module, for the task descriptions on the real-world robot, to produce a plurality of target policy with subgoals for the task descriptions, and update the parameters of the transfer module from corresponding trajectories with the subgoals for the robot simulator and real-world robot. |
| US11921489B2 |
Numerical control device, learning apparatus, inference apparatus, and numerical control method
A numerical control device for machining a workpiece while performing vibration cutting in which a tool and the workpiece are relatively vibrated by driving a first axis that drives the tool or a second axis that drives the workpiece, includes a parameter adjustment unit that adjust a parameter related to a vibration condition for the vibration cutting, based on the amount of cutting load generated on the first axis or the second axis when the vibration cutting is performed, and a controller that controls the vibration cutting using the adjusted parameter. |
| US11921486B2 |
Automation design environment with integrated industrial power system management capabilities
Systems, methods, and devices are disclosed herein for the integrated design and deployment of process control logic and power control logic in the context of industrial automation environments. In an implementation a computer displays, in an integrated design environment, representations of process control logic for controlling manufacturing devices an industrial automation process and of power control logic for controlling electrical devices in the industrial automation process. The computer further deploys the process control logic and the power control logic to a programmable logic controller (PLC) that controls the industrial automation process. |
| US11921482B2 |
Method of controlling a microgrid, power management system, and energy management system
A method of controlling a microgrid comprises receiving, by a power management system, PMS, of the microgrid, operating point values for a plurality of controllable assets. The method comprises determining, by the PMS, an asset headroom. The method comprises determining, by the PMS, a modified operating point value that is dependent on the received operating point value of the controllable asset, the determined asset headroom of the controllable asset, and a total power offset of the microgrid. The method comprises controlling, by the PMS, the controllable assets for which the modified operating point values have been determined in accordance with the modified operating point values. |
| US11921481B2 |
Systems and methods for determining equipment energy waste
A building management system (BMS) includes one or more memory devices having instructions stored thereon that, when executed by one or more processors, cause the one or more processors to perform operations including using the operating data to evaluate one or more fault detection rules to determine whether at least one of the plurality of building devices is experiencing a fault condition, in response to determining that at least one of the plurality of building devices is experiencing the fault condition, determining an amount of carbon emissions generated due to the fault condition based on a fault emissions model associated with the fault condition and initiating an automated response based on the amount of carbon emissions associated with the fault condition. |
| US11921479B2 |
Aerial solar agricultural irrigation, energy generation, hydro conservation with beneficiary sharing for relieving poverty, protecting animals, wildlife and the environment autonomous apparatus
The presented agricultural apparatus was developed for peoples in undeveloped countries, peoples affected by the changing climates to reduce water usage and reduce electricity usage, bringing more water retention in the soils used for growing food all year round, for heating and cooling purposes of food and peoples living areas. The presented apparatus is used with a generation of electricity apparatus that utilizes a plurality of solar photo voltaic panels in a rack mounting structure utilizing various apparatus as a means for increasing water irrigation, reduce water usages, and reduce electricity usage costs and supply at a specific spatial point area. The apparatus was developed as a means to help people in rural un developed areas as well as cities and industrial growing areas. Also included in the apparatus system is a means for an autonomous Virtual Currency related split payments apparatus for a mining aspect of rewarded distributions to poverty, animal, wildlife and environment beneficiaries. |
| US11921475B2 |
Controlling tenant services based on tenant workload sequencing
A control system controls tenant services to various tenants by obtaining tenant attributes for each tenant, with respect to a particular workload. A model is generated that models tenant usage performance for a set of best performing tenants. The model is then applied to a remainder of the tenants to obtain a metric indicative of a likely tenant capacity for incremental usage of the workload. The control system controls the services provided to the tenant based upon the likelihood of adoption metric. |
| US11921474B2 |
Virtual metrology method using convolutional neural network and computer program product thereof
A virtual metrology method using a convolutional neural network (CNN) is provided. In this method, a dynamic time warping (DTW) algorithm is used to delete unsimilar sets of process data, and adjust the sets of process data to be of the same length, thereby enabling the CNN to be used for virtual metrology. A virtual metrology model of the embodiments of the present invention includes several CNN models and a conjecture model, in which plural inputs of the CNN model are sets of time sequence data of respective parameters, and plural outputs of the CNN models are inputs to the conjecture model. |
| US11921472B2 |
System and method to sense computing device parameters within an enclosed space
Apparatuses, methods, systems, and program products are disclosed to determine when a portable electronic device is moved within an enclosed space. A processor and memory may control a sensor may store code executable by the processor to measure a parameter at an inlet of the computing device. The parameter may include an airflow rate, an air temperature at the inlet, and/or a current supply to a fan of the computing device. The processor may execute code to determine when the parameter at the inlet reaches a threshold. When the processor determines that the measured parameter has reached the threshold, a signal from the sensor to the processor and/or from the processor to an operator may be sent, indicating that the threshold has been reached. |
| US11921471B2 |
Systems, articles, and methods for wearable devices having secondary power sources in links of a band for providing secondary power in addition to a primary power source
Wearable devices having a primary and secondary power source are disclosed, wherein the secondary power sources are located in links of a band portion of the wearable device and the secondary power sources provide a secondary source of power beyond that provided by the primary power source. One exemplary wrist-wearable device includes a centralized processor pod having a primary power source, a wireless communication radio, and one or more sensors. The exemplary wrist-wearable device further includes a band with a plurality of links. Each of the plurality of links can include a secondary power source. The exemplary wrist-wearable device further includes communicative pathways that can be configured to convey at least power and data between the links and centralized processor pod. The communicative pathways can be configured to convey power from the secondary sources of power to the centralized processor pod beyond the power provided by the primary power source. |
| US11921470B2 |
Device with buttons and electronic timepiece
A device with buttons includes: a display unit that is configured to perform predetermined display; and a plurality of buttons that are positioned on a lower side of the display unit. An area of a button to be most frequently used is the largest among areas of the plurality of buttons. |
| US11921461B2 |
Elastic retaining member for fixing a timepiece component on a support element
The invention relates to an elastic retaining member (1) for fixing a timepiece component (2) on a support element (3), comprising an opening (5) into which said support element (3) can be inserted, the retaining member (1) comprising rigid arms (6) and elastic arms (7) defined between connection areas (9) contributing to ensure elastic clamping of the support element (3) in the opening (5) each rigid arm (6) being provided with two flat contact areas (8) of the retaining member (1) able to cooperate with corresponding convex contact portions (10) of the support element (3). |
| US11921459B2 |
Imaging system with cleaning of fine particle collection device
An imaging system includes a housing to define a housing space, a collection device to collect fine particles in the housing space, a detection device to detect a collection performance of the collection device, and a cleaning device to clean the collection device. |
| US11921453B2 |
Image forming apparatus
An image forming apparatus includes a latent image forming device and a visualizing device. The latent image forming device forms a latent image with an adhesive on a base material. The visualizing device causes particles to adhere to the latent image to visualize the latent image as an uneven image. The particles each contains an insoluble substance. |
| US11921452B2 |
Image forming apparatus
An image forming apparatus includes an image forming unit to form an image on a sheet based on a mode selected from a plurality of modes having different image forming speeds, a memory to store first data for a first mode included in the plurality of modes, the first data indicating a correspondence for the first mode between a type of the sheet and the image forming speed, and second data for a second mode included in the plurality of modes, the second data indicating a correspondence for the second mode between a type of the sheet and the image forming speed, and a display. A controller determines a first image forming speed for the first mode from the first data based on the type of the sheet, and determines a second image forming speed for the second mode from the second data. |
| US11921448B2 |
Fixing device and image forming apparatus incorporating same
A fixing device includes a rotator, a pressure member, a conductor, and a heater. The pressing member presses the rotator to form a nip between the rotator and the pressing member. The conductor is grounded and includes a contact portion having a limiting shape to limit a contact area in which the contact portion is in contact with an inner circumferential surface of the rotator. The heater is in contact with the inner circumferential surface of the rotator to heat the rotator. |
| US11921445B2 |
Transport device, fixing device, and image forming apparatus
A transport device includes: a first transport body; a second transport body that is movable between a contact position and a separate position with respect to the first transport body and that nips a transported material with the first transport body at the contact position; and a transport section that includes a holder to hold a leading end portion of the transported material and that transports the transported material toward a nip region where the first transport body and the second transport body nip the transported material in a state in which the second transport body is located at the separate position. After holding of the leading end portion by the holder for the transported material transported by the transport section has been released, the second transport body nips the transported material with the first transport body and transports the transported material. |
| US11921442B2 |
Transport device and image forming apparatus
A transport device includes a transport path that includes an opening through which a developer flows into the transport path, an opening and closing portion that is provided to be movable along the transport path and that opens and closes the opening, and a transport body that is disposed in the transport path, that includes a blade formed in a spiral shape on an outer periphery of a shaft portion, that transports the developer flowing into the transport path through the opening and moves the opening and closing portion to an opening position with the blade by rotating forward, and that idly rotates with respect to the opening and closing portion moved to the opening position in a case of forward rotation. |
| US11921441B2 |
Developer supply container and developer supplying system
A developer supply container includes a developer discharging portion that is provided with a discharge passageway. A track is provided at a first side of the developer discharging portion. A shutter is provided with a shutter opening configured to permit discharge of the developer from the discharge passageway, with the shutter including a recessed portion on an outer side of the shutter. The recessed portion includes an inclined surface. |
| US11921440B2 |
Developer supply device, development device, and image formation apparatus
A developer supply device according to an embodiment may include: a developer container; and a developer container holder to which the developer container is to be attached in a first direction. The developer container includes: a shutter movable between a closing position to close a supply port of a housing thereof and an opening position to open the supply port; and a sealing member provided between the housing and the shutter. The shutter includes: a cover portion including a cover surface configured to close the supply port; and a protruding portion projected in the first direction from the cover portion and provided at a position spaced apart from the cover surface to a side of the developer container holder. The developer container holder includes an engagement portion to be engaged with the protruding portion in a state where the developer container is attached to the developer container holder. |
| US11921433B2 |
Optical metrology in machine learning to characterize features
A metrology system may include an optical metrology tool configured to produce an optical metrology output for one or more features on a processed substrate, and a metrology machine learning model that has been trained using a training set of (i) profiles, critical dimensions, and/or contours for a plurality of features, and (ii) optical metrology outputs for the plurality of features. The metrology machine learning model may be configured to: receive the optical metrology output from the optical metrology tool; and output the profile, critical dimension, and/or contour of the one or more features on the processed substrate. |
| US11921432B2 |
Optical system with variable focal distance and optical assembly comprising such a system
The present invention relates to an optical system with a variable focal distance in a predetermined focal distance range, comprising two mirrors and a KB mechanical assembly having two supports adapted to support the mirrors one after the other along their main axis so as to form a propagation path.The system is characterized in that each mirror has a useful portion whose width and/or thickness is/are variable and selected according to said predetermined distance range, and in that, for each mirror, it further comprises a deformation mechanism adapted to generate a curvature of the corresponding mirror along its length to adjust the focal distance within said predetermined distance range. |
| US11921431B2 |
Advanced load port for photolithography mask inspection tool
A method and a system for inspecting an extreme ultra violet mask and a mask pod for such masks is provided. An EUV mask inspection tool inspects a mask retrieved from a mask pod placed on the load port positioned exterior of the mask inspection tool. The inspection process is performed during a selected period of time. After the inspection process is initiated, a robotic handling mechanism such as a robotic arm or an AMHS picks up the mask pod and inspects the mask pod for foreign particles. A mask pod inspection tool determines whether the mask pod needs cleaning or replacing based on a selected swap criteria. The mask pod is retrieved from the mask pod inspection tool and placed on the load port before the selected period of time lapses. This method and system promotes a reduction in the overall time required for inspecting the mask and the mask pod. |
| US11921427B2 |
Methods for making hard masks useful in next-generation lithography
Imaging layers on the surface of a substrate may be patterned using next generation lithographic techniques, and the resulting patterned film may be used as a lithographic mask, for example, for production of a semiconductor device. |
| US11921426B2 |
Substrate processing method, substrate processing apparatus, and recipe selection method
A substrate processing method includes a preprocessing forming step of forming a preprocessing film on a surface of a substrate having the surface on which a first region and a second region in which different substances are exposed are present, a preprocessing film separating step of separating the preprocessing film from the surface of the substrate with a stripping liquid, a processing film forming step of forming a processing film on the surface of the substrate after the preprocessing film separating step, and a processing film separating step of separating the processing film from the surface of the substrate with the stripping liquid. A removal capacity for the processing film to remove the first removal target present in the second region is higher than a removal capacity for the preprocessing film to remove the first removal target present in the second region, and a removal capacity for the preprocessing film to remove the first removal target present in the first region is higher than a removal capacity for the processing film to remove the first removal target present in the first region. |
| US11921423B2 |
Imprint apparatus and product manufacturing method
An imprint apparatus executes imprint processing of curing imprint material in a state in which the imprint material supplied onto a substrate and a mold are in contact with each other. The imprint apparatus includes a modulator configured to modulate incident light, a first optical system configured to guide first light from a first light source to the modulator, and second light from a second light source that has a wavelength different from that of the first light to the modulator, and a second optical system configured to guide modulated light modulated by the modulator to the substrate. |
| US11921421B2 |
Overlay correcting method, and photolithography method, semiconductor device manufacturing method and scanner system based on the overlay correcting method
An overlay correcting method capable of optimizing correction of an overlay within a scanner correction limit of a scanner of a scanner system, and a photolithography method, a semiconductor device manufacturing method and the scanner system which are based on the overlay correcting method are provided. The overlay correcting method includes collecting overlay data by measuring an overlay of a pattern; calculating correction parameters of the overlay by performing regularized regression using the overlay data, the regularized regression being based on a correction limit of the scanner such that the correction parameters fall within the correction limit of the scanner; and providing the correction parameters to the scanner. |
| US11921420B2 |
Method and system for reticle enhancement technology
Methods incorporate variable side wall angle (VSA) into calculated patterns, using a mask 3D (M3D) effect. Embodiments include inputting a mask exposure information, calculating a mask 2D (M2D) effect from the mask exposure information, and determining the M3D effect from the M2D effect. Determining the M3D effect may include determining the VSA, such as by using a neural network. Embodiments may include determining a dose margin from mask exposure information; calculating a VSA using the dose margin; and calculating a pattern on a substrate using the calculated VSA, wherein calculating the pattern on the substrate includes a mask 3D effect. |
| US11921415B2 |
Optical coating for projection screen
Provided is an optical coating for a projection screen, containing the following components in parts by weight: 2-15 parts of light-absorbing material, 5-20 parts of aluminum silver powder, 20-60 parts of acrylate oligomer, 10-45 parts of diluent, 0.5-15 parts of photoinitiator, and 0.1-6 parts of auxiliary agent; the light-absorbing material is one or more of carbon black, lamp black, iron black, and aniline black, and has an average particle size of 20-2000 nm; the aluminum silver powder is flake-shaped and has an average particle size of 3-10 μm. |
| US11921412B2 |
Method for manufacturing projection screen and projection screen
A method for manufacturing a projection screen and a projection screen are provided. The method includes: preparing a substrate; under a first preparation condition, forming a reflective layer by vacuum plating above the substrate; and under a second preparation condition, forming a diffusion layer by the vacuum plating on the reflective layer. The second preparation condition is different from the first preparation condition, and a sputtering power in the second preparation condition is higher than a sputtering power in the first preparation condition. |
| US11921411B2 |
Wavelength conversion element and projection device
A wavelength conversion element includes a substrate, a wavelength conversion layer and a heat dissipation member. The substrate has a supporting surface. The wavelength conversion layer is disposed on the supporting surface. The heat dissipation member is disposed on the supporting surface and is surrounded by the wavelength conversion layer. The heat dissipation member has a heat dissipation plate and a plurality of heat dissipation tooth portions. The heat dissipation plate is fixed on the supporting surface. The heat dissipation plate has an outer side surface. The outer side surface is perpendicular to the supporting surface. The heat dissipation tooth portions are respectively connected to the outer side surface. A projection device including the wavelength conversion element is also provided. The wavelength conversion element can improve wavelength conversion efficiency and reliability, and the projection device can improve image brightness and service life. |
| US11921408B2 |
Projection device and projection system with suspending attachment
A projection device according to the present disclosure includes a light source unit, an image formation unit, a projection optical unit, and a housing which has a first surface and a second surface opposed to each other, and is configured to house the light source unit, the image formation unit, and the projection optical unit, wherein the first surface includes a first region, and a second region lower in height from the second surface than the first region, and a receiving part on which a suspending attachment is mounted is disposed in the second region. |
| US11921405B2 |
Camera
A camera can perform two different photographing operations with a lens at different positions without vignetting while preventing entry of light and dust. A camera includes a frame including a film compartment to contain a photographic film and a barrel extending from the film compartment in an optical axis direction, and a lens barrel movable in the barrel in X-direction. The lens barrel includes cylinders movable frontward relative to the barrel, and a cylinder movable frontward relative to the cylinder. The camera includes a rear bellows connecting the frame and the cylinder, and a front bellows connecting the cylinder and the cylinder. In a first photographing state in which the cylinders extend frontward relative to the barrel and the cylinder is accommodated inside the cylinder, the rear bellows is expanded and the front bellows is partially contracted. In a second photographing state, the cylinder extends frontward relative to the cylinder. |
| US11921402B2 |
Systems and method for capturing filter data on a matte box
A matte box for a camera includes a frame, a filter tray holder having at least one stage configured to receive a filter, and at least one filter tray configured to support the filter. The at least one filter tray is removably coupled to the filter tray holder at the at least one stage so that the filter is positioned in front of a lens of the camera. The matte box also includes a filter information system that has an identification tag coupled to the at least one filter tray and/or the filter. The identification tag includes informational data regarding the filter. A reader device supported on the frame and configured to receive the informational data from the identification tag. The filter information system records the informational data of the filter received in the filter tray holder. |
| US11921401B2 |
Nonlinear optical chromophores having a diamondoid group attached thereto, methods of preparing the same, and uses thereof
Nonlinear optical chromophores having one or more diamondoid groups covalently attached to the chromophore, methods of making nonlinear optical chromophores, their use in thin films and electro-optical devices containing such nonlinear optical chromophores and thin films comprising the same. |
| US11921398B2 |
Pluggable optical module, optical communication system and control method of pluggable optical module
To autonomously apply a bias voltage to an optical modulator according to phase angle information provided from outside in a pluggable optical module. A pluggable electric connector (11) can communicate a communication data signal and a control signal with an optical communication apparatus (92). An optical signal output unit (13) includes a Mach-Zehnder type optical modulator including a phase modulation area and outputs an optical modulation signal (LS) modulated according to the communication data signal. An optical power control unit (14) can control optical power of the optical modulation signal (LS). A pluggable optical receptor (15) can output the optical modulation signal (LS) to an optical fiber (91). A control unit (12) controls a modulation operation of the optical signal output unit (13) and the bias voltage applied to the phase modulation area.The control unit (12) determines the bias voltage applied to the phase modulation area according to phase angle information of the control signal (CON1). The optical signal output unit (13) applies the bias voltage determined by the control unit (12) to the phase modulation area. |
| US11921396B2 |
Viewing angle adjustment device and display device including the same
A viewing angle adjustment device and a display device including the same are discussed. The viewing angle adjustment device can include a first protective layer, a second protective layer disposed on the first protective layer, a light conversion layer disposed between the first protective layer and the second protective layer and including dispersion liquid having dispersed floating particles, and an auxiliary light conversion layer disposed on the second protective layer. The auxiliary light conversion layer can include first patterns where a light absorbing layer and a transparent layer are disposed in a center area, and second patterns where the light absorption layer, the transparent layer and a reflective layer are disposed in an edge area. |
| US11921394B2 |
Layered structure with high dielectric constant for use with active matrix backplanes
Layered dielectric materials for use in controlling dielectric strength in microelectronic devices, especially as they relate to electrophoretic and electrowetting applications. Specifically, a combination of a first atomic layer deposition (ALD) step, a sputtering step, and a second ALD step result in a layer that is chemically robust and nearly pinhole free. The dielectric layer may be disposed on the transparent common electrode of an electrophoretic display or covering the pixelated backplane electrodes, or both. |
| US11921393B2 |
Blue phases on patterned surfaces
Stable, macroscopic single-crystal chiral liquid crystal compositions are described. The compositions include a single-crystal chiral liquid crystal material on a patterned surface. The patterned surface seeds a particular crystallographic orientation at the substrate-liquid crystal interface. Also described are methods of forming the single-crystal chiral liquid crystal compositions. |
| US11921391B2 |
Display panel and display device
A display panel including a thin film transistor array substrate, a color filter substrate, a gold ball, a color resist bump, a first transparent electrode, and a second transparent electrode is provided. The first transparent electrode covers the color resist bump and is connected to the second transparent electrode at a top of the color resist bump. The display panel disclosed in the present invention improves stability of a common electrode signal by constructing a new electrode signal channel, and prevents a technical problem of horizontal crosstalk on the display panel. |
| US11921387B2 |
Display panel having first scan lines and second scan lines connected in parallel and display device
The present invention provides a display panel and a display device using the display panel. By connecting a plurality of second scan lines in parallel, resistance between output terminals of chips on film (COF) and first scan lines are reduced, and differences between output resistances of the COF corresponding to different first scan lines are reduced, so differences between signals in different first scan lines are reduced, and uneven display problems in existing display panels are solved. |
| US11921385B2 |
Display device and array substrate
An array substrate of a display device includes a pixel electrode layer on a substrate, which includes active pixel electrodes in an active display region; outermost active pixel electrodes include a first active pixel electrode including a first pixel electrode edge and a second pixel electrode edge; in a first direction, the first pixel electrode edge is between the second pixel electrode edge and a frame region. One of the array substrate and an opposite substrate of the display device includes a common electrode layer including a first extended common electrode which includes a first extended portion extending beyond the first active pixel electrode; a first extended portion edge of the first extended portion and a first substrate edge of the substrate respectively extend in a second direction; in the first direction, the first extended portion edge is located between the first substrate edge and the first pixel electrode edge. |
| US11921381B2 |
Display device
A display device includes: a plurality of pixel electrodes arranged in the display region of a first substrate; a color filter provided on a second substrate opposing the first substrate and overlapping the pixel electrode; a planarization insulating layer provided on the color filter; a common electrode provided on the planarization insulating layer and having an opening; a spacer arranged between the pixel electrode and the common electrode; and a light-shielding layer provided between the first substrate and the pixel electrode and overlapping the spacer. |
| US11921379B2 |
Process for driving a 2D/3D switchable autostereoscopic display device
The disclosure relates to a switching process for switching in an autostereoscopic display device from a first view mode to a second view mode, wherein the autostereoscopic display device comprises a display panel, a lenticular device and means for applying a voltage, the process comprising the application of a switching voltage across both switching electrodes of the lenticular device wherein a ramp voltage is applied that increases during a ramp period of at least 0.50 second from a starting voltage at which the lenticular device is in its, first view mode to a final voltage at which the lenticular device is in its second view mode, wherein during at least 0.40 second of the ramp period, the ramp voltage is at an intermediate voltage that is in the range of 5-60% of the minimal voltage; and the final voltage is equal to or higher than minimal voltage. |
| US11921376B2 |
Liquid crystal display panel and method of manufacturing the same, and display device
A liquid crystal display panel includes: a first base, a second base disposed opposite to the first base, a liquid crystal layer and a first optical compensation layer that are disposed between the first base and the second base, and a second optical compensation layer disposed on a side of the first base away from the liquid crystal layer or on a side of the second base away from the liquid crystal layer. An orthogonal projection of an optic axis of the first optical compensation layer on the first base is parallel to orthogonal projections of optic axes of liquid crystal molecules in the liquid crystal layer on the first base. An orthogonal projection of an optic axis of the second optical compensation layer on the first base is perpendicular to the orthogonal projection of the optic axis of the first optical compensation layer on the first base. |
| US11921371B2 |
Method of fabricating a liquid crystal display device and a liquid crystal display device
A method of fabricating a liquid crystal display device including a reflective or transflective liquid crystal cell whose liquid crystal molecules are aligned in a planar or vertical manner, this liquid crystal cell being formed of a transparent front substrate located on the side of an observer, and a rear substrate, also transparent, which extends beneath the front substrate, parallel to and at a distance from the latter, these two front and rear substrates being joined to each other with a sealing frame which defines a sealed enclosure in which a liquid crystal composition is confined, the front and rear substrates being coated on their opposite faces with electrically conductive transparent electrodes and counter-electrodes, the optical properties of the liquid crystal composition being modified by application of an electric field at the point of intersection between an electrode and a corresponding counter-electrode. |
| US11921368B2 |
Electronic devices having antiglare films with transparent apertures
An electronic device may be provided with a display. The display may be overlapped by an antiglare film. The antiglare film may have a rough surface to diffuse incident light, thereby reducing glare. Additionally, the antiglare film may have a smooth portion that forms a transparent window and allows light to pass through undiffused. The electronic device may include a light-based component, such as a camera, that receives undiffused light through the transparent window. By overlapping the light-based component with the transparent window, the light-based component may receive the light in an unimpeded manner, thereby making more accurate measurements of the light. The display may have one or more display layers, such as opaque masking layers or polarizers, with openings that are aligned with the transparent window. The light-based component may receive the light through these openings so that the light is not absorbed or polarized before reaching the component. |
| US11921358B2 |
Bistable spectacles knuckle
A bistable hinge element for an eyeglasses frame, which includes a temple cage having a bottom extended laterally by two longitudinal side walls which define a housing that opens onto the proximal transverse face through an opening that is U-shaped in cross-section. The hinge element further includes a front cage which has a bottom extended laterally by two longitudinal side walls which define a housing that opens onto the proximal transverse face through an opening that is U-shaped in cross-section, and a solid body that is elastically deformable along the longitudinal axis, and which has a central portion, with a cross-section corresponding to the transverse cross-section of the U-shaped openings, which is extended at each end by a bulge of a cross-section that is complementary to the transverse cross-section of the housings of the temple and front cages. |
| US11921357B2 |
Wearable electronic device with articulated joint
Apparatuses, systems for electronic wearable devices such as smart glasses are described. The wearable device can comprise a frame, an elongate temple and an articulated joint. The frame can define one or more optical element holders configured to hold respective optical elements for viewing by a user in a viewing direction. The temple can be moveably connected to the frame for holding the frame in position when the device is worn by the user. The articulated joint can connect the temple and the frame to permit movement of the temple relative to the frame between a wearable position in which the temple is generally aligned with the viewing direction, and a collapsed position in which the temple extends generally transversely to the viewing direction. The articulated joint can include abase foot fixed to the frame and oriented transversely to the viewing direction. |
| US11921356B2 |
Contact lens cleaner
A contact lens cleaner device which can be used to clean contact lenses from debris and bacteria. The contact lens cleaner device pumps contact lens solution into reservoirs where contact lenses can be placed. The contact lenses rotate within the reservoirs and debris falls into a filter, as the contact lens solution continues to be pumped through the device. UV-lighting kills bacteria and cleanses the contact lenses in the reservoirs. |
| US11921355B2 |
Head-worn personal audio apparatus supporting enhanced hearing support
Techniques for providing wearable electronic devices with electrical components are disclosed. The electrical components can provide electrical technology to eyewear to facilitate audio support including enhanced hearing. The electrical components can operate independently or together with other electrical components provided elsewhere. The wearable electronic devices with electronic components can, for example, provide audio output, audio enhancements, or event-related audio content. |
| US11921349B2 |
Lens driving device, and camera module and optical device, which include same
An embodiment comprises: a housing; a bobbin, disposed in the housing, for mounting a lens; a first coil arranged on an outer circumferential surface of the bobbin; a magnet arranged in the housing; a second coil arranged in the housing; and a magnetic member, which is attached to the second coil and increases the strength of an induction voltage induced to the second coil by means of an interaction according to a movement of the first coil. |
| US11921344B2 |
Laser module
A laser module is provided and includes a laser unit, a focusing lens, an electric device, and a temperature control device. The laser unit is configured to emit a laser light. The focusing lens corresponds in position to the laser unit, and the focusing lens is configured to converge the laser light emitted from the laser unit so as to outwardly output the laser light. The electric device includes a focusing ring, a voice coil motor, and a motor base. The voice coil motor is configured to drive and move the focusing lens in a straight line toward or away from the laser unit with the focusing ring. The temperature control device is mounted on the laser unit and includes a thermoelectric cooling module and a thermistor. The thermoelectric cooling module is configured to cooperate with the thermistor to adjust a working temperature of the laser unit. |
| US11921338B2 |
Fiber distribution hub
The present disclosure relates to a telecommunications distribution hub having a cabinet that defines a primary compartment. The cabinet also includes one or more main doors for accessing the primary compartment. Telecommunications equipment is mounted within the primary compartment. The distribution hub further includes a secondary compartment that can be accessed from an exterior of the cabinet without accessing the primary compartment. A grounding interface is accessible from within the secondary compartment. |
| US11921337B2 |
Sealing unit for optical fiber cable cabinet
A sealing unit for a cabinet containing optical components. A gasket defines a plurality of apertures configured to provide a seal around a plurality of optical fiber cables, wherein the gasket has an interior side intended to face the interior of the cabinet and an exterior side intended to face an exterior of the cabinet. A first retaining device is located on the interior side of the gasket, and a second retaining device is located on the exterior side of the gasket. The first and second retaining devices each include a plurality of channels, wherein each channel is aligned with a respective aperture of the gasket and each channel is configured to receive one of the plurality of optical fiber cables. Each channel has a profile defined by a plurality of protruding surfaces configured to restrain longitudinal movement of an optical fiber cable received therein. |
| US11921335B2 |
System for data transmission in optical systems
The invention relates to an optical light guiding system, comprising an interface for coupling in and/or an interface for decoupling data and at least one data channel for transmitting data, and a method for transmitting data in optical systems, comprising the steps of coupling data into an interface of a beam guidance element; the transmission of the data by means of a first and/or a second data channel, which are arranged within the beam guiding element (or the casing), wherein the data channels can also be used for the fractional monitoring of the beam guiding element; and decoupling the data from an interface. |
| US11921334B2 |
Alignment structure of optical element
An alignment structure of optical element is provided, including: an optical fiber, having a parallel fiber segment and a plurality of bare fiber segments; a cover plate, provided with a plurality of side-by-side guide grooves and a plurality of first coupling parts, the bare fiber segments of the optical fiber being arranged in the corresponding guide grooves, cross-sectional shapes of the guide grooves being at least one of U-shaped or V-shaped; and a silicon chip, provided with lines and a plurality of second coupling parts; when the cover plate is matched with the silicon chip, the first coupling parts and the second coupling parts being coupled and positioned with each other respectively, and the optical fiber being fixed between the silicon chip and the cover plate. As such, precise positioning and rapid assembly are achieved. |
| US11921330B2 |
Light receiving device, and light transmitting and receiving device
In order to efficiently receive spatial light without using a condensing lens, this light receiving device comprises: a first light guide body that has at least a first light receiving surface and a first light emission end and guides, in an oriented manner, signal light entering from the first light receiving surface to the first light emission end; a second light guide body that has at least a second light receiving surface and a second light emission end, the second light receiving surface being connected to the first light emission end, and that guides, in an oriented manner, signal light entering from the second light receiving surface to the second light emission end; and a light receiver that has a light receiving part connected to the second light emission end and that converts the signal light received by the light receiving part to an electrical signal. |
| US11921313B2 |
Function display for selectively displaying symbols representing switching functions and/or switching states with a reduced veiling glare
The present disclosure relates to a function display for selectively displaying symbols representing switching states for a motor vehicle including a light guide stack of at least two transparent or translucent, planar light guides arranged in an overlaid manner in a stacking direction, which are spaced apart by a transparent or translucent layer including a material that is optically thinner compared to the adjacent light guides so that the light guides have a main surface facing towards an observer and a main surface facing away from the observer that faces towards a light guide which is most closely adjacent in stacking direction; at least one light source per light guide arranged to couple light into the respective light guide via an end face; wherein one light-refractive and/or light-scattering microstructured portion per light guide, which is provided in or on the light guide, is provided for generating a symbol display. |
| US11921312B2 |
Light emitting unit, display, and lighting apparatus
There are provided a light emitting unit that enhances the uniformity of in-plane colors, as well as a display and a lighting apparatus that include such a light emitting unit thereon. The light emitting unit includes: a plurality of light emitting sections each having a light source and a wavelength conversion member, the wavelength conversion member converting a wavelength of light emitted from the light source; an optical component having a light incident surface in opposition to the plurality of light emitting sections; and a color unevenness prevention structure suppressing direct entering of light from the light source into the optical component. |
| US11921305B2 |
Retroreflective traffic sign and process and apparatus for manufacturing same
A retroreflective sign comprising a rigid substrate with a pattern of cell walls formed of a polyurethane adhesive or two-part polyurea adhesive, and a polymeric sheet having a front face and a rear face, the rear face facing the substrate, the rear face comprising microprismatic reflective elements is disclosed. The polymeric sheet is adhered directly to the cell walls formed of the polyurethane adhesive or two-part polyurea adhesive while leaving an air gap between the microprismatic retroreflective elements and the rigid substrate in the cells. A method of making the retroreflective sign includes applying a polyurethane adhesive or two-part polyurea adhesive to a front side of a rigid substrate in a pattern defining cell walls; and prior to full curing of the polyurethane adhesive, laminating the front side of the rigid substrate a rear side of a polymeric sheet via the cell walls, the polymeric sheet comprising microprismatic elements. |
| US11921304B2 |
Polygon mirror, deflection device, optical scanning apparatus and image forming apparatus
A polygon mirror includes: a base body having a plurality of side surfaces, a first surface adjacent to the plurality of side surfaces, and a second surface adjacent to the plurality of side surfaces and opposite to the first surface; and a film formed on the plurality of side surfaces and extending from the plurality of side surfaces over the first surface and the second surface, wherein the film includes: a first region formed on the first surface along the plurality of side surfaces; a second region formed on the second surface along the plurality of side surfaces, and wherein a first volume of the first region and a second volume of the second region are different from each other. |
| US11921301B2 |
Dual lens drive device, dual camera module, and optical device
The present embodiment relates to a dual lens drive device that comprises: a housing; a first bobbin which is disposed to move in a first direction inside the housing; a second bobbin which is disposed to move in the first direction inside housing and is spaced apart from the first bobbin; a first coil which is disposed on the first bobbin; a second coil which is disposed on the second bobbin; a magnet which is disposed in the housing and faces the first coil and the second coil; a base which is disposed below the housing; a substrate which comprises a circuit member having a third coil disposed to face the magnet between the housing and the base; and a support member which movably supports the housing with respect to the substrate, wherein the housing is integrally formed. |
| US11921288B2 |
Display apparatus providing expanded viewing window
A display device includes a light source array including a plurality of light sources where at least one of the plurality of light sources is selectively driven, a spatial light modulator for modulating light from the light source array to form image light, a focusing optical system for focusing the image light formed by the spatial light modulator at a position in a predetermined eye box, a micro mirror array arranged in an optical path formed in the focusing optical system and including a plurality of mirror cells. The plurality of mirror cells are controlled to be in an ON state in that light is reflected in a direction toward an inside of the eye box or to be in an OFF state in that light is reflected in a direction toward an outside of the eye box. |
| US11921277B2 |
Image acquisition device and image acquisition method
An image acquisition device includes: a stage on which a sample is placed; a drive unit; a first irradiation optical system; a second irradiation optical system; a beam splitter; a pupil dividing element; a first imaging lens; a first imaging element; an analysis unit; a control unit; a second imaging lens; and a second imaging element, a first irradiation light irradiation range captured by the first irradiation optical system includes a second imaging region captured by the second imaging element, the second imaging region is located behind a first imaging region in a scanning direction, and the control unit controls a focus position of an objective lens based on focus information before capturing the second imaging region by the second imaging element. |
| US11921276B2 |
Method and apparatus for evaluating image relative definition, device and medium
Provided are a method and apparatus for evaluating image relative definition, a device and a medium, relating to technologies such as computer vision, deep learning and intelligent medical. A specific implementation solution is: extracting a multi-scale feature of each image in an image set, where the multi-scale feature is used for representing definition features of objects having different sizes in an image; and scoring relative definition of each image in the image set according to the multi-scale feature by using a relative definition scoring model pre-trained, where the purpose for training the relative definition scoring model is to learn a feature related to image definition in the multi-scale feature. |
| US11921274B2 |
Method for detecting emission light, detection device and laser scanning microscope
Detecting emission light, in a laser scanning microscope, wherein the emission light emanating from a sample is guided onto a two-dimensional matrix sensor having a plurality of pixels and being located on an image plane, and a detection point distribution function is detected by the matrix sensor in a spatially oversam pled manner. The emission light emanating from the sample is spectrally separated in a dispersion device; the spectrally separated emission light is detected by the matrix sensor in a spectrally resolved manner; and during the analysis of the intensities measured by the pixels of a pixel region, the spectral separation is cancelled at least for some of said pixels. Additional aspects relate to a detection device for the spectrally resolved detection of emission light in a laser scanning microscope and to a laser scanning microscope. |
| US11921270B2 |
Inspection system including reference specimen and method of forming semiconductor device
An inspection system includes a main support die configured to receive a target specimen; an auxiliary support die adjacent to the main support die and configured to receive a reference specimen; a cleaning device configured to remove contaminants from the reference specimen; an objective lens unit configured to direct light to main support die from a light source adjacent to the objective lens unit; a spectroscope between the objective lens unit and the light source; a detector adjacent to the objective lens unit; an imaging device between the objective lens unit and the detector; and a computer system in communication with the detector. |
| US11921269B2 |
Optical imaging device
An optical imaging system includes a first lens, a second lens, a third lens, a fourth lens, and a fifth lens, disposed in order from an object side, and a first reflection member and a second reflection member, disposed on an object side of the first lens, each having a freeform surface. |
| US11921268B2 |
Zoom lens and image pickup apparatus
A zoom lens includes, in order from an object side to an image side, a lens unit closest to the object side and having a positive refractive power, an intermediate unit including at least three lens units and an aperture stop, and a lens unit closest to the image side and having a positive refractive power. A distance between each pair of adjacent lens units changes in zooming. The lens unit closest to the object side is configured not to move for zooming, and the at least three lens units and the aperture stop are configured to move in zooming. The lens unit closest to the image side includes a first positive lens. A predetermined condition is satisfied. |
| US11921265B2 |
Optical lens comprising two lens groups of −+ refractive powers having six lenses of −−+−++, −+++−++, −−++−+ or −−+−+− refractive powers
An optical lens comprises: a first lens (L1) having a negative focal power; a second lens (L2); a third lens (L3); a fourth lens (L4); a fifth lens (L5), wherein the fourth lens (L4) and the fifth lens (L5) forms an achromatic lens group; and a sixth lens (L6), wherein the first lens (L1), the second lens (L2), the third lens (L3), the fourth lens (L4), the fifth lens (L5), and the sixth lens (L6) are sequentially disposed along a direction from an object side to an image side, wherein the first lens (L1) has at least one object surface (S1) facing the object side, and the object surface (S1) of the first lens (L1) is convex, and wherein the second lens (L2) has at least one image surface (S4) facing the image side, and the image surface (S4) of the second lens (L2) is convex so as to facilitate forming a concentric circle structure. |
| US11921264B2 |
Photographing lens assembly, image capturing unit and electronic device
A photographing lens assembly includes seven lens elements which are, in order from an object side to an image side: a first lens element, a second lens element, a third lens element, a fourth lens element, a fifth lens element, a sixth lens element and a seventh lens element. The second lens element has positive refractive power. The seventh lens element has an image-side surface being concave in a paraxial region thereof, and the image-side surface of the seventh lens element has at least one convex shape in an off-axis region thereof. |
| US11921263B2 |
Mobile device and optical imaging lens thereof
An optical imaging lens includes first, second, third, fourth, fifth, and sixth lens elements, disposed sequentially from an object side to an image side, each of the lens elements having an object-side surface facing toward the object side and an image-side surface facing toward the image side. The image-side surface of the first lens element comprises a concave portion in a vicinity of an optical axis. The object-side surface of the third lens element comprises a concave portion in a vicinity of a periphery of the third lens element. The object-side surface of the fourth lens element comprises a concave portion in a vicinity of the optical axis. The lens elements of the optical imaging lens as a whole are only the six lens elements. |
| US11921254B2 |
Optical seismic surveying system
An optical seismic surveying system including, a multibeam laser source including a plurality of laser-sources, a Diffractive-Optical-Element (DOE), an imager and a processor. The laser-sources direct respective laser-beams toward a single common focal point. The DOE is located at a single common focal point and configured to split each laser-beam into a plurality of laser-beams, toward an instantaneous area of interest. The laser-beams impinging on the instantaneous area of interest produce a laser spot assemblage including a plurality of laser spots. The imager acquires a plurality of defocused images of speckle patterns produced by diffused reflections of the laser spots. The speckle pattern correspond to a respective laser spot and thus to a respective sensing point in the instantaneous area of interest. The processor determines a relative displacement between corresponding speckle patterns in sequential pairs of images and determines a respective time-signal for each sensing point representing vibrations thereat. |
| US11921252B2 |
Security screening device capable of detecting and locating dangerous objects by using radiation
The present invention relates a security screening device, comprising: a radiation generator for respectively generating X-rays and neutron beams and irradiating same toward an inspection object; an inspection object transfer unit for changing the position of the inspection object; a radiation detector configured to respectively detect X-rays and neutron beams transmitted through the inspection object; and a gamma ray detector installed adjacent to the inspection object and configured to detect a gamma signal generated from the inspection object, wherein the radiation detector acquires image information of the inspection object by using radiation information detected from the X-rays and neutron beams that have passed through the inspection object, and the gamma ray detector analyzes the detected gamma ray to detect the location of the inspection object from the analysis of the inspection object and the image information. |
| US11921251B2 |
Position sensing apparatus and method
Inductive position sensors for sensing relative position (e.g., relative rotary position) between members are provided. In one example implementation, the inductive position sensor includes a transmit aerial having at least one transmit winding. The inductive position sensor can include a receive aerial having one or more receive windings. The inductive position sensor can include a coupling element operable to be disposed on the second member. The inductive position sensor can include processing circuitry configured to provide one or more signals indicative of the position of the first member relative to the second member based on current induced in the one or more receive windings resulting from an oscillating signal provided to the transmit winding. The inductive position sensor includes at least one electrostatic shield. The electrostatic shield can include a plurality of conductive traces arranged so that no current loops are formed in the electrostatic shield. |
| US11921245B2 |
Photon counting device and photon counting method
A photon counting device includes a plurality of pixels each including a photoelectric conversion element configured to convert input light to charge, and an amplifier configured to amplify the charge converted by the photoelectric conversion element and convert the charge to a voltage, an A/D converter configured to convert the voltages output from the amplifiers of the plurality of pixels to digital values; and a conversion unit configured to convert the digital value output from the A/D converter to the number of photons by referring to reference data, for each of the plurality of pixels, and the reference data is created based on a gain and an offset value for each of the plurality of pixels. |
| US11921243B2 |
Scintillation crystal including a co-doped rare earth silicate, a radiation detection apparatus including the scintillation crystal, and a process of forming the same
A scintillation crystal can include a rare earth silicate, an activator, and a Group 2 co-dopant. In an embodiment, the Group 2 co-dopant concentration may not exceed 200 ppm atomic in the crystal or 0.25 at % in the melt before the crystal is formed. The ratio of the Group 2 concentration/activator atomic concentration can be in a range of 0.4 to 2.5. In another embodiment, the scintillation crystal may have a decay time no greater than 40 ns, and in another embodiment, have the same or higher light output than another crystal having the same composition except without the Group 2 co-dopant. In a further embodiment, a boule can be grown to a diameter of at least 75 mm and have no spiral or very low spiral and no cracks. The scintillation crystal can be used in a radiation detection apparatus and be coupled to a photosensor. |
| US11921241B2 |
Ultrasonic probe and ultrasonic diagnostic apparatus using thereon
An ultrasonic probe including: a plurality of transducers; a plurality of low-noise amplifier circuits individually corresponding to the plurality of transducers, the plurality of low-noise amplifier circuits having a variable resistor feedback unit making a resistance value variable by an electrical signal inputted to a control terminal; and a control circuit; wherein the control circuit has a dummy circuit generating a bias voltage of a feedback unit of the low-noise amplifier circuit, and an adding circuit outputting an added signal of a bias voltage by the dummy circuit and a control signal increasing or decreasing with a lapse of time; and the plurality of low-noise amplifier circuits input an output of the adding circuit to the control terminal of the variable resistor feedback unit to perform variable control on a gain of the low-noise amplifier circuit. |
| US11921237B2 |
Systems and methods for biasing light detectors
An example circuit includes a light detector and a biasing capacitor having (i) a first terminal that applies to the light detector an output voltage that can either bias or debias the light detector and (ii) a second terminal for controlling the output voltage. The circuit includes a first transistor connected to the second terminal of the biasing capacitor and configured to drive the output voltage to a first voltage level above a biasing threshold of the light detector and thereby biasing the light detector. The circuit includes a second transistor connected to the second terminal of the biasing capacitor and configured to drive the output voltage to a second voltage level below the biasing threshold of the light detector and thereby debiasing the light detector. The second voltage is a non-zero voltage that corresponds to a charge level of the biasing capacitor. |
| US11921236B1 |
Light detection and ranging (lidar) sensor system including seed modulation module
A light detection and ranging (lidar) system for a vehicle may include an input optical path, a first optical path, a plurality of second optical paths, a first optical amplifier, and a plurality of second optical amplifiers. The input optical path may be configured to receive a beam from a laser source. The first optical path and the plurality of second optical paths may be respectively branched from the input optical path. The first optical amplifier may be coupled to the first optical path and configured to output a local oscillator (LO) signal. The plurality of second optical amplifiers may be respectively coupled to the plurality of second optical paths, one of the plurality of second optical amplifiers being selectively turned on to modulate the beam received through a second optical path and output a modulated optical signal of the beam. |
| US11921233B2 |
Adaptive radar for near-far target identification
Examples disclosed herein relate to an adaptive radar for near-far target identification. The radar includes an antenna module configured to radiate a transmission signal with an analog beamforming antenna in a plurality of directions using one or more phase control elements in a first radar scan and to generate radar data capturing a surrounding environment. The radar also includes a data pre-preprocessing module configured to receive the radar data and determine adjustments to transceiver parameters in the antenna module for a second radar scan subsequent to the first radar scan based at least on range. The radar also includes a perception module configured to detect and identify a target in the surrounding environment from the radar data. Other examples disclosed herein relate to methods of near-far target identification in a radar. |
| US11921229B2 |
Distance measurement using millimeter wave radar
An apparatus, including processing unit (PU) cores and computer readable storage devices storing machine instructions for determining a distance between a target object and a radar sensor circuit. The PU cores receive a beat signal generated by the radar sensor circuit and compensate for a phase difference between the received beat signal and a reconstruction of the received beat signal to obtain a phase compensated beat signal. The phase compensated beat signal is then filtered to remove spurious reflections by demodulating the phase compensated beat signal using an estimated frequency of the phase compensated beat signal. The PU cores then apply a low pass filter to the demodulated phase compensated beat signal, resulting in a modified beat signal. The PU cores then determine the distance between the target object and the radar sensor circuit using the modified beat signal. |
| US11921227B2 |
Accuracy and latency improvements for Rel-17 NR positioning
A system and methods are disclosed for reducing Rx/Tx timing errors in a wireless network for latency of positioning measurements. Additionally, a system and methods are disclosed for increasing positioning accuracy by mitigating NLOS errors and/or by performing two-stage beam sweeping for DL-AoD. Further, a system and methods are disclosed for performing M-sample positioning measurements to improve latency reporting in connection with positioning reporting. |
| US11921218B2 |
Marine vessel LIDAR system
Techniques are disclosed to enable an electronic system for use in connection with navigating a marine vessel to a desired position with respect to a waterline boundary. The system has one or potentially more light detection ranging (LIDAR) sensors for detecting structures across a region by vertically scanning the region using the LIDAR sensors. The system also includes a memory element configured to store characteristics of the detected structure. Additionally, the system includes a processing element that can identify a primary reference point associated with navigation of the marine vessel to the desired position based on the characteristics of the detected structure and display information about a current position of the marine vessel in relation to the desired position. |
| US11921207B2 |
Holographic light detection and ranging
A light detection and ranging system arranged to scan a scene is provided. A light source outputs light having a first characteristic. A spatial light modulator receives output light from the light source and outputs spatially-modulated light in accordance with computer-generated holograms represented thereon. A light detector receives light having the first characteristic from the scene and outputs a light response signal. A holographic controller is arranged to output a plurality of computer-generated holograms to the spatial light modulator. Each computer-generated hologram is arranged to form structured light having a corresponding pattern within the scene. The holographic controller is further arranged to change the pattern of the structured light formed by at least one of the plurality of computer-generated holograms. |
| US11921204B2 |
LiDAR system and method
A light detection and ranging (LiDAR) system includes light sources configured to generate separate beams of light, a lens array configured to receive the separate beams of light from the light sources and to collimate the separate beams of light into collimated outgoing light that is directed toward an examined area of interest, a light sensitive detector configured to sense reflection of at least part of the collimated outgoing light, and one or more processors configured to determine a distance to one or more objects off which the at least part of the collimated outgoing light was reflected toward the light sensitive detector. The one or more processors are configured to determine the distance based on the reflection of the at least part of the collimated outgoing light. |
| US11921200B1 |
Live down sonar view
A sonar system is provided for generating live sonar images having an expanded coverage angle. The sonar system includes a first sonar transducer assembly defining a first facing direction and having array(s) of sonar transducer elements and a second sonar transducer assembly defining a second facing direction and having array(s) of sonar transducer elements. The sonar system includes processor(s) and a memory including computer program code configured to, when executed, cause the processor(s) to receive first and second sonar return data from the first and second plurality of sonar transducer assemblies, receive first and second facing direction data for the first and second sonar transducer assemblies, position first and second sonar return data based on the first and second facing direction data to form positioned first and second sonar return data, and generate a live sonar image of the underwater environment using the positioned first and second sonar return data. |
| US11921198B2 |
Apparatus for determining spatial positions of multiple audio sources
An apparatus determines a spatial position of an audio source in multi moving audio sources scenarios. The apparatus receives audio signal versions as local sound waves. The apparatus determines first and second probabilities for a direction of arrival of the audio signal version based on the audio signal versions received within a first time interval; determines third and fourth probabilities for the direction of arrival of the audio signal version based on the audio signal versions received within a second time interval; determines a first probability difference between the first and third probabilities; determines a second probability difference between the second and fourth probabilities; combines the third probability and the first probability difference to obtain an updated third probability; combines the fourth probability with the second probability difference to obtain an updated fourth probability; and determines the spatial position based on the updated third and fourth probabilities. |
| US11921195B2 |
Apparatus and method of RF built in self-test (RFBIST) in a radar system
A novel and useful safety functionality assurance mechanism incorporating an RF built in self-test (RFBIST) system in a radar system having a plurality of transmitter devices and receiver devices. The RFBIST functions to verify, inter alia, that the transmitted signal is operating correctly and that all channels transmit a proper, valid or ‘legal’ signal and that the receiver devices are also operating correctly. A higher level of safety assurance is achieved by comparing safety data between the receiver devices. In one embodiment, the signal received from the various transmitter devices is compared. The RFBIST circuit block eliminates the physical transmit antenna position properties to compare the transmitted signal properties after signal path elimination. Thus, the present invention is capable of (1) validating multiple transmitter devices with a single receiver device and (2) validating multiple receiver devices with a single transmitter device. When receiver devices detect a fault and that particular device is the master device, then a mechanism is provided to shut down the master device and making a slave device the new master device. |
| US11921194B2 |
Radar anti-spoofing systems for an autonomous vehicle that identify ghost vehicles
A radar anti-spoofing system for an autonomous vehicle includes a plurality of radar sensors that generate a plurality of input detection points representing radio frequency (RF) signals reflected from objects and a controller in electronic communication with the plurality of radar sensors. The one or more controllers execute instructions to determine a signal to noise ratio (SNR) distance ratio for the input detection points generated by the plurality of radar sensors, where a value of the SNR distance ratio is indicative of an object being a ghost vehicle. The one or more controllers also determine an effective particle number indicating a degree of particle degradation for the importance sampling for each variable that is part of the state variable. In response to determining the effective particle number is equal to or less than a predetermined threshold, the one or more controllers estimate a ghost position for the ghost vehicle. |
| US11921186B2 |
Radar device, method of detecting failure of radar device, and method of operating radar device
A radar device includes a transmission module that generates a transmission chirp signal synchronized with a timing signal, and reception modules that each receive a reflected wave and a direct wave of the transmission chirp signal emitted from the transmission module, and perform mixing on a received signal, using a reception chirp signal, the reception chirp signal being synchronized with the timing signal and having the same slope as the transmitted chirp signal. The radar device includes a signal processor that detects a target on the basis of a beat signal resulting from the mixing performed by the reception modules. The signal processor detects a level of the beat signal generated from the received direct wave from the transmission module to the reception modules. The signal processor determines a failure of the radar device by comparing the detected level with a threshold. |
| US11921182B2 |
Accelerated magnetic resonance thermometry
Systems and methods provide accelerated MR thermometry utilizing prior knowledge about the images to be reconstructed from incomplete k-space data, thereby facilitating accurate reconstruction. In various embodiments, missing data is computationally estimated using a machine learning algorithm such as a neural network, and an image is generated based on iteratively updated estimated missing information. |
| US11921178B2 |
Systems and methods for ultralow field relaxation dispersion
A system of field cycled magnetic resonance system and a method of operating a field cycled magnetic resonance system are described. In accordance with various embodiments, the disclosed system includes a static field magnet, wherein the magnet is configured to provide a low static external magnetic field to a given field of view, a radio frequency coil, and a field cycling magnet. In accordance with various embodiments, the method includes providing a static field magnet configured to image a tissue sample within a given field of view, applying a low static external magnetic field to the given field of view, providing a radio frequency coil configured to produce cycling radio frequency field, providing a field cycling magnet, altering the low static external magnetic field within the given field of view, and collecting images from the system. |
| US11921175B2 |
Arrayed structure and magnetic resonance imaging apparatus
According to one embodiment, an arrayed structure includes a cylindrical-shaped conductor layer and a cylindrical-shaped layer stack. The cylindrical-shaped layer stack is arranged on an inner periphery of the conductor layer and a plurality of frequency selective surfaces are arranged in layers and stacked. Each of the frequency selective surfaces has a plurality of elements which are periodically arranged. Each element of the plurality of elements is formed in such a manner that at least a portion of an edge of a first element that faces an adjacent element in the same layer is closer to a center of the first element than another portion of edge. |
| US11921173B2 |
Device and method for determining an orientation of a magnet, and a joystick
A method of determining an orientation α,β of a magnet which is pivotable about a reference position having a predefined position relative to a semiconductor substrate, comprising: a) determining at least two of the following magnetic field gradients: i) a first magnetic field gradient dBx/dx; ii) a second magnetic field gradient dBy/dy; iii) a third magnetic field gradient dBz/dx; iv) a fourth magnetic field gradient dBz/dy; b) determining a first angle α based on at least one of the magnetic field gradients; c) determining a second angle β based on at least one of the magnetic field gradients. A sensor device is configured for performing this method. A sensor system includes such sensor device and a magnet, optionally connected to a joystick. |
| US11921172B2 |
Magnetoresistive sensor element with synthetic antiferromagnet biasing
Apparatus and associated methods relate to a magnetoresistive sensor element with synthetic antiferromagnetic biasing structure separated, by a non-magnetic tuning spacer, from a free ferromagnetic layer of a TMR/GMR sensor. The synthetic antiferromagnetic biasing structure includes first and second ferromagnetic layers separated from one another by a synthetic antiferromagnetic spacer. The synthetic antiferromagnetic biasing structure is biased during manufacture and pinned via exchange coupling with an adjacent antiferromagnetic layer. The synthetic antiferromagnetic biasing structure biases the free ferromagnetic layer via tuned exchanged coupling via relative proximity controlled by thickness of the non-magnetic tuning spacer. |
| US11921171B2 |
Space weather monitor system
A magneto-inductive DC magnetometer is provided that is operable to output fluxgate quality measurements in a low mass, volume, power and cost package. The magnetometer enables constellation-class missions not only due to its low-resource requirements, but also due to its potential for commercial integrated circuit fabrication. In addition, the magnetometer will be part of a ground-based Space Weather Underground Citizen Science instrument package that enables dense arrays of space weather-relevant observations at mid-latitudes. The magneto-inductive operating principle is based on a simple resistance-inductor (RL) circuit and involves measurement of the time it takes to charge and discharge the inductor between an upper and lower threshold by means of a Schmitt trigger oscillator. This time is proportional to the inductance that in turn is proportional to the field strength. |
| US11921170B2 |
Protection of low-voltage distribution networks
A method for protecting a low-voltage distribution network. The low-voltage distribution network includes a low-voltage side of a three-phase distribution transformer that is configured to supply electrical power to at least one single-phase load through a respective distribution line of a plurality of three-phase distribution lines distribution lines. The method includes measuring variations of a periodic neutral-to-ground voltage between a neutral terminal of the three-phase distribution transformer and a local ground node by sampling the variations at a sampling frequency, detecting a fault in the low-voltage power distribution network based on the variations of the periodic neutral-to-ground voltage, and disconnecting the low-voltage side from the low-voltage power distribution network responsive to the fault being detected. |
| US11921168B2 |
Connector connection verification system
A connector connection verification system includes a cable connector and a networking device. The networking device includes a port system defining a port and including a networking device connector, and at least one cable connector sensor device that is located adjacent the port. The cable connector sensor device(s) detects that the cable connector is inserted in the port defined by the port system while the cable connector does not mate with the networking device connector included in the port system and, in response, transmits an incorrect connection signal that indicates that the cable connector is incorrectly connected to the port system. A management interface provided on the networking device may receive the incorrect connection signal from the cable connector sensor device(s), and provide information that describes the cable connector and that indicates that the cable connector is incorrectly connected to the port system for display on a display device. |
| US11921162B2 |
Information processing device, information processing method, non-transitory computer readable medium, and information processing system
According to one embodiment, the information processing device includes: a first state estimator configured to estimate a state of a target rechargeable battery based on: first data including a charge amount and voltage value of a rechargeable battery; information including a state of the rechargeable battery; and second data including a charge amount and voltage value of the rechargeable battery. |
| US11921156B2 |
Structure and method for testing of PIC with an upturned mirror
A structure and method for the wafer level testing of interposer-based photonic integrated circuits is described that includes the formation of an upturned mirror structure and the method of utilizing the interposer-based mirror structure for electrical and optical testing of optoelectrical circuits that include emitting components such as lasers, detecting components such as photodetectors, and both emitting and detecting components. Electrical activation of the optoelectrical emitting or sending devices and the subsequent detection and measurement of the optical signals in detecting or receiving devices provides information on the operability or functionality of the PIC on the die at the wafer level, prior to die separation or singulation, using the electrical and optical components of the PIC circuit. |
| US11921155B2 |
Dice testing method
A dice testing method is provided. The dice testing method is used to determine which test data of test items can be explained by test data of other test items based on statistical analysis. After the test items with the test data that can be explained by the test data of the other test items are found out, corresponding dices will not be tested for those test items. |
| US11921154B2 |
Test system
A test system for testing a device having a plurality of electrical contacts. The test system comprising: a device table operable to hold at least one device under test, a probe comprising at least one probe end for contacting electrical contacts of a device under test, a movement mechanism operable to move one or both of the device table and the probe so as to bring the at least one probe end into contact with at least one electrical contact of a device under test, and a profile determining system configured to determine a profile of the electrical contacts of a device under test. |
| US11921153B2 |
Monitoring circuit and semiconductor device
Embodiments of the present disclosure relate to a monitoring circuit and a semiconductor device, and particularly, to a monitoring circuit including an oscillation circuit configured to generate an oscillation signal having a rising characteristic or a falling characteristic according to a threshold voltage level and a counter configured to count the number of rises or the number of falls of the oscillation signal, and a semiconductor device including the monitoring circuit. |
| US11921147B2 |
Detection of loss of neutral or phase
A method for monitoring a polyphase network includes the steps, repeated regularly, of: acquiring voltage measurements taken by voltage sensors of an item of electrical equipment, and producing current values of electrical parameters; accessing a reference table comprising a list of connection configurations each associated with a distinct combination of reference values of said electrical parameters, the list of connection configurations comprising configurations each corresponding to a combination of connection states for each phase (P1, P2, P3) and for the neutral (N); implementing an exploratory algorithm intended to explore the reference table to identify the current connection configuration. |
| US11921138B2 |
Insulation resistance detection device
An insulation resistance detection device detects a voltage at a connection point between a coupling capacitor and a resistance in the case where a frequency signal is outputted to the resistance, and detects an insulation resistance between a ground portion and a power supply path based on a moving average value of a detection voltage. The insulation resistance detection device includes a first determination unit, a resistance detection unit, and a second determination unit. In response to a determination that the pulsation of the detection voltage is attenuated, the resistance detection unit detects the insulation resistance based on, instead of a first moving average value, a second moving average value calculated by using the detection voltage in a second range including a smaller number of detection voltages than in the first range. |
| US11921133B2 |
Testing head having improved frequency properties
A testing head apt to verify the operation of a device under test integrated on a semiconductor wafer includes a plurality of contact elements, each including a body that extends between a first end portion and a second end portion, and a guide provided with a plurality of guide holes apt to house the contact elements. The guide includes a conductive portion that includes and electrically connects the holes of a group of guide holes to each other and is apt to contact a corresponding group of contact elements apt to carry a same type of signal. |
| US11921129B2 |
Automatic specimen feeding system and control method therefor
Disclosed is an automatic specimen feeding system and a control method therefor. The automatic specimen feeding system includes a main frame installed adjacent to a carbon measuring apparatus, having a space with an open upper portion; a specimen seating unit which reciprocates horizontally in a direction perpendicular to the carbon measuring apparatus while moving up and down with respect to the main frame, and on which a plurality of specimens can be seated; a specimen lift unit which is installed under the specimen seating unit and can lift one of the plurality of specimens seated on the specimen seating unit; and a specimen input unit which is installed lengthways in the direction towards the carbon measuring apparatus to grip specimens lifted by the specimen lift unit and to input the specimens into the carbon measuring apparatus. |
| US11921128B2 |
Apparatus for inspecting pharmaceutical containers
An apparatus for inspecting a pharmaceutical cylindrical container made of glass or polymer includes a handling device that has a first holder that holds a lateral surface of the pharmaceutical cylindrical container and includes a first support wheel and a second support wheel. The handling device moves such that the pharmaceutical cylindrical container is transferred from a first transfer position to the inspection area and from the inspection area to a second transfer position. The handling device and/or a friction wheel rotate the pharmaceutical cylindrical container around a container longitudinal axis. A first plane is defined through the first rotational axis of the first support wheel and the container longitudinal axis, while a second plane is defined through the second rotational axis of the second support wheel and the container longitudinal axis. The first and second planes intersect at an angle in a range of 45° to less than 120°. |
| US11921126B2 |
Device with blockable/un-blockable fluid channels and built-in self-test equipment
A device includes a plurality of first fluid channels connected to one or more first fluid inlets, a plurality of first valves, each of the first valves having a first control port which allows for blocking or un-blocking a flow through one of the first fluid channels based on a pressure applied to the first valve via the first control port, a plurality of first control channels, each of the first control channels being connected to at least one of the first control ports, and self-test equipment. |
| US11921125B2 |
Slide inventory and reinsertion system
A slide rack inventory and reinsertion system for use with a digital slide scanning apparatus is provided that determines, prior to scanning of glass slides in a slide rack, a status of each slot in the slide rack as properly occupied, improperly occupied, or empty. The system also determines whether a slide that has been removed from the slide rack for processing has been properly reinserted into the slide rack. |
| US11921124B2 |
Control of pH in aqueous urea-containing solutions utilizing amino acid-containing compositions
Aqueous calibration or quality control reagents that include urea are disclosed; the reagents may further include at least one amino acid-containing composition to provide pH stability thereto. Methods of production and use thereof are also disclosed. |
| US11921119B2 |
Methods of prognosis and treatment
A method of determining a management course for treating a subject showing symptoms of a disease is disclosed. The method comprises measuring the TRAIL protein level in a blood sample of the subject, wherein when the TRAIL level is above a predetermined amount, the subject is treated as a low-risk patient. |
| US11921117B2 |
Characterization of subvisible particles using a particle analyzer
The present specification discloses methods of characterizing a population of particles using a particle analyzer. Particles may be characterized by size, absolute number, whether the particle is non-proteinaceous or proteinaceous, whether a proteinaceous particle has or lacks a certain physical property, or any combination thereof. |
| US11921116B2 |
Enigma and CDH18 as companion diagnostics for CDK4 inhibitors
The present disclosure relates to the use of one or more biomarkers to evaluate the likelihood that a CDK4 inhibitor would produce an anti-cancer effect in a subject. Accordingly, in certain non-limiting embodiments, the present disclosure provides for methods, compositions and kits for a companion diagnostic for CDK4 inhibitors, and in particular, for the use of the colocalization of Enigma and CDH18 biomarkers to foci within the cancer for determining whether the cancer can be successfully treated by CDK4 inhibition. |
| US11921115B2 |
Prostate antigen standards and uses thereof
Aspects of the disclosure relate to improved methods for predicting whether a prostate tissue biopsy obtained from a subject will contain detectable prostate cancer. In some embodiments, the disclosure provides improved prostate antigen standards for quantifying levels of prostate antigens. |
| US11921110B2 |
Method for producing an array of planar microparticles with surface molecular multiplexing, resulting array and use thereof
A method for controlled production of an array of planar microparticles with the multiplexing of molecules on the surface thereof, intended to function as molecular sensors and/or actuators and a matrix (array) of microparticles, the surface thereof being printed with all of the molecular components required to provide the surface with functionality. Different molecular elements are multiplexed on the surface of each particle while they are supported on a substrate by means of a structural foot engraved below the particle. These microparticles can be released mechanically from the support on which they are produced using a controlled mechanical rupture method which is not chemically aggressive and therefore does not affect the molecules previously printed on the surface. The array and the particles contained therein offer great versatility in both chemical and/or biological applications. |
| US11921109B2 |
Microfluidic system and method for real-time measurement of antibody-antigen binding and analyte detection
Microfluidic devices for use with reagents bound to microspheres for determination of the concentration of an analyte in a liquid sample are provided. The devices include two sequential mixing channels that promote rapid binding of microsphere-bound reagents with reagents in solution and a means for detecting labeled microsphere-bound reaction products. Also provided are methods for using the devices with microsphere-bound reagents to determine the concentration of an analyte in a liquid sample and to measure the binding affinity of antibody for an antigen. |
| US11921106B2 |
Sample analyzer and computer program product
A sample analyzer prepares a measurement sample from a blood sample or a body fluid sample which differs from the blood sample; measures the prepared measurement sample; obtains characteristic information representing characteristics of the components in the measurement sample; sets either a blood measurement mode for measuring the blood sample, or a body fluid measurement mode for measuring the body fluid sample as an operating mode; and measures the measurement sample prepared from the blood sample by executing operations in the blood measurement mode when the blood measurement mode has been set, and measuring the measurement sample prepared from the body fluid sample by executing operations in the body fluid measurement mode that differs from the operations in the blood measurement mode when the body fluid measurement mode has been set, is disclosed. A computer program product is also disclosed. |
| US11921105B2 |
Method for identifying positive allosteric modulators for odorant receptors
The various aspects presented herein relate to the perfumery industry. More particularly, the various aspects presented herein relate to assays and methods for screening and identifying compositions and/or ingredients that intensify a subject's perception of target odorant compounds based on the use of particular olfactory receptors activated by the target odorant compound. |
| US11921104B2 |
Control material and methods for cell analyzers
This disclosure relates to verifying the operation of cell analyzers, including microscope-based cell imaging and counting analyzers. In one general aspect, a mixture of micro-beads having known characteristics is introduced into the analyzer. One or more images of the mixture are acquired with the analyzer's microscope, the images are analyzed, and a determination is made about whether results meet one or more predetermined quality control thresholds. Also disclosed is a hematology control material that can be used to perform the verification and includes a solvent, a dye dissolved in the solvent, and micro-beads suspended in the solvent. In another general aspect, a quality control method for the analyzers includes capturing images of samples that include patient cells using at least a microscope, extracting sample-specific information about properties of the patient samples from the images, and testing information from the samples against predetermined standards to verify the operation of the analyzer. |
| US11921102B2 |
Compact optical imaging system for cell culture monitoring
An optical imaging system for cell culture monitoring is provided. The system includes an illumination segment having an illumination source and a collimating lens positioned between a first surface of a cell culture vessel and the illumination source. The illumination source and the collimating lens are arranged to transmit light through the first surface at an angle oblique to the first surface of the cell culture vessel. The system also includes a detection segment having a detector and a lens positioned between the first surface of the cell culture vessel and the detector. The lens focuses light to the detector through an aperture stop, and the detector receives light that exits the first surface of the cell culture vessel at an angle oblique to the first surface. |
| US11921101B2 |
Calibration in automated testing apparatus
Disclosed are calibration techniques that can be implemented by a device that conducts biological tests. In certain embodiments, the device for testing a biological specimen includes a receiving mechanism to receive a carrier, a camera module arranged to capture imagery of the carrier, and a processor. Some examples of the processor can detect a calibration mode trigger. In calibration mode, the processor can divide the captured imagery into segments and selectively perform one or more calibration procedures for each segment. Then, the processor records a calibration result for each segment. |
| US11921100B2 |
Methods, systems, and computer program products for locating and tracking objects
A system for locating and tracking an object is provided. The system includes a measuring device configured to determine a property of a paving-related material, a locating device configured to determine a location of the measuring device, a tracking system configured to store tracking information associated with the measuring device and one or more properties determined by the measuring device, and a communications system configured to transfer, to a remote device, the location of the measuring device and the tracking information associated with the measuring device. |
| US11921099B2 |
Method for quantitatively analyzing reservoir formation of ultra-deep evaporite-dolomite symbiotic system
A method for quantitatively analyzing the reservoir formation of an ultra-deep evaporite-dolomite paragenesis system is performed as follows. A typical drilling core containing the evaporite-dolomite paragenesis system and a field section are observed. The logging data is subjected to single-factor analysis to determine the planar distribution regularity of the ultra-deep evaporite and the dolomite, and the analysis of sedimentary combination pattern and development evolution regularity is performed. The diagenetic system is determined, and the reservoir formation of the evaporite-dolomite paragenesis system is analyzed. Based on the above technical solutions, the property, the evolution path and the reservoir formation of sedimentation-diagenesis fluids in the evaporite-dolomite paragenesis system can be clarified. |
| US11921097B2 |
Method for dynamic measurement of individual tree carbon sink
A method for dynamic measurement of individual tree carbon sink, including: 1. Individual tree survey and equipment arrangement; 2. Automatic data collection of individual tree; 3. Computation of individual tree carbon sink: computing height, volume, biomass, and carbon storage of an individual tree by using the data collected in step 2; 4. Detecting state changes of an individual tree, and performing step 6 if it changes, otherwise performing step 5; 5. Continuous monitoring of individual tree carbon sink: continuously receiving the data collected in step 2 at set monitoring frequency and performing step 3, while storing the data; 6. Verification on the monitoring state of the individual tree. The invention can reduce erroneous measurements, repeated measurements, data fabrication, missing measurements, data recording and computation errors, and the workload of quality control and continuous monitoring, realizing continuous and accurate monitoring of individual tree carbon sink, and significantly improve monitoring timeliness. |
| US11921096B2 |
Fluid analysis system
Embodiments herein relate to breath analysis system. In an embodiment, a gas measurement device is included having a housing defining an interior volume. The housing can include a fluid ingress port, a fluid egress port, a bottom wall, and a circuit board disposed within the interior volume. The circuit board can include a first side and a second side, where the first side of the circuit board faces inward toward the interior volume. The circuit board can include a plurality of gas sensors disposed on the first side of the circuit board and a plurality of conductive pads disposed on the second side of the circuit board, wherein a plurality of electrical contacts contact the conductive pads when the circuit board is seated within the housing. Other embodiments are also included herein. |
| US11921095B2 |
Data acquisition technique for rapid sampling
A method of mass spectrometry is disclosed comprising repeatedly or continuously causing first analyte sample to be released or ejected from a first sample. A determination is made as to whether or not a quality threshold such as an intensity threshold has been met or exceeded, wherein if the quality threshold has been met or exceeded then the method further comprises repeatedly or continuously causing second analyte sample to be released or ejected from a second sample. |
| US11921093B2 |
Mounting a sample separation unit by a swivel mechanism
A mounting device for mounting a sample separation unit configured for separating, preferably chromatographically separating, compounds in a fluidic sample includes a first fluid connector configured for being mechanically and fluidically coupled with a first fluid interface of the sample separation unit, a second fluid connector configured for being mechanically and fluidically coupled with a second fluid interface of the sample separation unit, and a swivel mechanism configured for swivelling the first fluid connector between a mounting orientation for mounting the first fluid interface of the sample separation unit at the first fluid connector and an alignment orientation for aligning the second fluid interface of the mounted sample separation unit with the second fluid connector for subsequently coupling the second fluid interface with the second fluid connector. |
| US11921086B2 |
Sensor mounting pad with secondary restraint feature
A device and method for mounting sensors to components comprising a mounting pad adapted for adhesive attachment to the component and further including a feature allowing for a secondary restraint. In various variations, the sensor may be an accelerometer, vibration sensor, temperature sensor or other sensor. The feature and secondary restraint may include one or more holes in the mounting pad for attachment by safety wire or other restraint to provide limited movement in the case of adhesive failure. |
| US11921083B2 |
Device for capturing macromolecules and methods for manufacturing and using same
The present disclosure provides an in-channel filtration device for capturing one or more macromolecules from an electrophoretic gel, and methods for manufacturing and using same. |
| US11921076B1 |
Methods and devices for COVID-19 testing using urine samples
The present invention generally includes methods, devices and/or kits for the detection of a COVID-19 infection in an individual by measuring the level or concentration or one or more ions present in a urine sample that is substantially free of COVID-19 RNA, antibodies, or antigen material. |
| US11921073B2 |
Fluid sensor for sensing properties of a fluid comprising a tuning fork mechanical resonator
A fluid sensor includes a tuning fork mechanical resonator including a base and a tine projecting from the base along a longitudinal direction of the tine, and a pair of electrodes disposed on the tine. The base and the tine are formed from a piezoelectric material including lithium tantalate. The electrodes are exposed to a fluid. |
| US11921072B2 |
Contact-type detection electrode and movable electric device
A contact-type detection electrode for detecting dispersible dirt and a movable electric device are provided. The contact-type detection electrode includes a support, and electrical conductors arranged on the support and being flexible. |
| US11921070B2 |
Processes, apparatuses and system for measuring a measured variable
It is an object of the invention to improve processes, apparatuses and systems for measuring a measured variable. To this end, a measured variable is measured in a measuring process on the basis of an NV center as a quantum sensor. The NV center has a plurality of quantum states and is optically excitable on the basis of an occupancy of one of the quantum states into at least one excited state of the quantum states by means of an excitation light. The at least one excited state can decay at least with emission of emission light of the NV center. In the measuring process, the NV center is irradiated by the excitation light, the excitation light having a time periodic modulation, and a respective occupancy probability and/or a respective lifetime of the quantum states depending on the measured variable and the excitation light. A phase shift is determined between the emission light of the NV center and the modulation of the excitation light and a measurement value for the measured variable is determined on the basis thereof. |
| US11921068B2 |
Molecular weight measurement method and solvent for use in measurement
In a first step, a sample liquid is fabricated by mixing a sample formed of a polyester or decomposition products of a polyester into a solvent. The solvent used here contains chloroform and 2,2,2-trifluoroethanol and has an organic base added thereto. The organic base is at least one of a primary amine, a secondary amine, a tertiary amine and a heterocyclic amine. Next, in a second step, each of the amount of the terephthalic acid terminal and the amount of the hydroxy group terminal in the sample liquid is measured through a nuclear magnetic resonance spectroscopy aiming at hydrogen atoms. Subsequently, in a third step, the number average molecular weight of the sample is calculated from the amount of the terephthalic acid terminal and the amount of the hydroxy group terminal measured in the second step. |
| US11921067B2 |
System and method for magnetic resonance mapping of physical and chemical changes in conducting structures
A method of diagnosing a conducting structure includes providing the conducting structure in a magnetic field, immersing the conducting structure in a detection medium, or placing a detection medium in the vicinity of the conducting structure, exciting nuclear or electronic spins within the detection medium using a broad-band excitation pulse, receiving an NMR or ESR spectrum from the detection medium, obtaining a frequency distribution of the detection medium, and indirectly measuring internal characteristics of the conducting structure by characterizing frequency changes in the frequency distribution. Conducting structures are analyzed on the basis of changes in magnetic susceptibilities and internal electric current distributions, which may change over the course of a charging/discharging cycle, and a result of degradation and failure of the conducting structure. The conducting structure may be, for example, a battery, a capacitor, a supercapacitor, a fuel cell, or a catalyst material. |
| US11921061B2 |
Orientation degree distribution calculation method, orientation degree distribution analyzer, and orientation degree distribution analysis program
An orientation degree distribution analysis method includes steps of: inputting, to a main storage device, crystal structure information of an object to be measured, information on an intensity ratio of each diffraction peak and a crystal plane corresponding to each diffraction peak by X-ray diffraction measurement, information on a diffraction range and a diffraction sensitivity, and information on an intensity ratio of each diffraction peak of a randomly oriented sample; calculating an angle defined by an orientation plane and a crystal plane corresponding to a diffraction peak of interest from the information stored in the main storage device; calculating an existence ratio and storing the existence ratio in the main storage device; setting an orientation degree distribution function; and calculating an orientation degree distribution from the information of the inputting step and the information of the calculating step. |
| US11921054B2 |
Cleaved semiconductor wafer camera system
A semiconductor wafer imaging system for imaging a semiconductor wafer includes shroud panels defining a black box, a camera positioned in the black box for imaging the semiconductor wafer, and an illumination panel for directing diffuse light to the semiconductor wafer. A portion of the diffuse light is reflected off the semiconductor wafer and the camera images the semiconductor wafer by detecting the reflected diffuse light. |
| US11921053B2 |
Methods and systems for inclusion analysis
Various methods and systems are provided for analyzing sample inclusions. As one example, a correction factor may be generated based on inclusion properties of a first sample determined using both an optical emission spectrometry (OES) system and a charged-particle microscopy with energy dispersive X-ray spectroscopy (CPM/EDX) system. The OES system may be calibrated with the correction factor. The inclusion properties of a second, different, sample may be determined using the calibrated OES system. |
| US11921045B2 |
Holographic three-dimensional multi-spot light stimulation device and method
A holographic three-dimensional multi-spot light stimulation device is provided with: a three-dimensional imaging holographic optical system A which employs fluorescent exciting light to acquire three-dimensional fluorescence distribution information resulting from fluorescent signal light from a plurality of stimulation target objects; and a three-dimensional light stimulation holographic optical system B which employs a light stimulation hologram generated on the basis of the acquired three-dimensional fluorescence distribution information to form a plurality of light spots in space, to impart stimulation simultaneously to the plurality of stimulation target objects. Furthermore, the three-dimensional light stimulation holographic optical system B is provided with a spatial light phase modulating element 22 and a control unit 25, wherein the control unit 25 generates the light stimulation hologram by controlling the spatial light phase modulating element 22 on the basis of the three-dimensional fluorescence distribution information. |
| US11921042B2 |
Optical measuring device and process
An achromatic 3D STED measuring optical process and optical method, based on a conical diffraction effect or an effect of propagation of light in uniaxial crystals, including a cascade of at least two uniaxial or conical diffraction crystals creating, from a laser source, all of the light propagating along substantially the same optical path, from the output of an optical bank to the objective of a microscope. A spatial position of at least one luminous nano-emitter, structured object or a continuous distribution in a sample is determined.Reconstruction of the sample and its spatial and/or temporal and/or spectral properties is treated as an inverse Bayesian problem leading to the definition of an a posteriori distribution, and a posteriori relationship combining, by virtue of the Bayes law, the probabilistic formulation of a noise model, and possible priors on a distribution of light created in the sample by projection. |
| US11921039B2 |
Method and active control system for food treatment processes
A method and a control system of a food treating process made of a plurality of sub-processes is disclosed. The system comprises a plurality of product sensors including at least a spectrograph sensor and a thermograph sensor, plant sensors, control devices, a main hardware and software architecture apt, and a database structure to provide timely and automatic regulation controls, preferably exploiting synergies between various optimised parallel processes. |
| US11921038B2 |
Optical device
An optical device comprises an optical filter having a substrate and a multilayer film having layers with different refractive indexes formed on at least one side of the substrate; and an infrared light emitting and receiving device having a first conductive-type semiconductor layer, an active layer, and a second conductive-type semiconductor layer. The multilayer film has alternatively stacked first second layers each having refractive indexes of 1.2 or more and 2.5 or less, and 3.2 or more and 4.2 or less, respectively, in a wavelength range of 2400 nm to 6000 nm. The optical filter includes a wavelength range having an average transmittance of 70% or more with a width of 50 nm or more in a wavelength range of 2400 nm to 6000 nm, and has a maximum transmittance of 5% or more in a wavelength range of 6000 nm to 8000 nm. |
| US11921036B2 |
In situ apparatus for furnace off-gas constituent and flow velocity measurement
An optically based combustion off-gas stream velocity sensor assembly is provided for detecting in real-time off-gas flow velocity and/or volume as it moves through a flue duct. The sensor assembly includes two paired coherent light emitters and optic sensors, positioned in a spaced orientation in the flow path direction. The light emitter/optic sensor pairs operate to emit and detect across the off-gas stream coherent light beam energy having a wavelength component corresponding to an absorption profile of an off-gas species component. The detection of non-absorbed portions of the emitted beam is used to identify and detect the movement of a flow species signature at different locations along the flue duct. |
| US11921033B2 |
Single-shot Mueller matrix polarimeter
A single-shot Mueller matrix polarimeter (1700), MMP, comprising: a polarization state generator (1706), PSG, arranged to receive a source optical field (1704) and provide a probe field (1708) having a plurality of spatial portions, each portion having a different polarization state; a polarization state analyser (1718), PSA, arranged to receive a modified probe field (1716) resulting from interaction of the probe field generated by the PSG with a sample under investigation, and further arranged to apply, to each of a corresponding plurality of spatial portions of the modified probe field, a plurality of retardances and a plurality of fast axis orientations; and a detector (1720) arranged to detect an output (1722) of the PSA. |
| US11921029B2 |
Product index mechanism and product inspection system
A product index mechanism for a product inspection system includes a material strip driving wheel and an index structure driving wheel. The material strip driving wheel engages with a material strip carrying a plurality of products to be inspected by an inspection device of the product inspection system. The driving wheel drives the material strip to move. The index structure driving wheel rotates synchronously with the material strip driving wheel and includes a plurality of product index structures thereon. As a product on the material strip is moved by the material strip driving wheel to an inspection position of the inspection device, one product index structure on the index structure driving wheel is rotated to a trigger position corresponding to a trigger of the inspection system. Activation of the trigger transmits a trigger signal to the inspection device to inspect the product. |
| US11921027B2 |
Method for introducing liquid samples into sample processing device
A specimen introduction method for improving a measurement accuracy and efficiency includes a preparation step, first step, second step, and third step. The preparation step uses a switching member to connect a first feeder to a first inlet-and-outlet, a second inlet-and-outlet to a discharge container, a third inlet-and-outlet to a first inflow port, and a second feeder to a second inflow port. The first step includes filling a path from the second feeder to the switching member through the second inflow port, a specimen treatment device, and the first inflow port with a second liquid. The second step includes filling a path from the first feeder to the switching member with a first liquid. The third step includes subsequently introducing the first liquid into the first inflow port from the first feeder through the switching member, and introducing the second liquid into the second inflow port from the second feeder. |
| US11921026B2 |
Method and apparatus for an anti-sorting flow cytometer
A method, system and apparatus for anti-sorting particles is disclosed. In an example embodiment, particles move in a fluid along a microfluidic channel. A measurement device determines which particles are selected or desired particles by measuring a desired characteristic of the particles and outputting an associated signal. The energy source continuously imparts a force on unselected or undesired particles in a deflection region of the microfluidic channel to remove the unselected or undesired particles from the stream of particles. Based upon the signal outputted by the measurement device, the energy source is controlled to reduce or eliminate the force on selected particles such that the selected particles flow on a natural or expected flow path to a collection area such as an output channel. By avoiding application of force to desired particles, the anti-sorting systems and methods can improve viability and other characteristics of the desired particles. |
| US11921022B2 |
Method and rheometer for determining the density of an at least flowable, in particular liquid, specimen
A method for determining the density of an at least flowable, in particular liquid, specimen with a rheometer, in particular a rotational rheometer, includes providing the rheometer with a first measurement component for receiving the at least flowable, in particular liquid, specimen, and a second measurement component with a known volume to be immersed into the specimen. The first and second measurement components are movable relative to one another. The perpendicular force between the two measurement components is measured after the immersion of the second measurement component into the specimen. The measured perpendicular force corresponds to the buoyancy force acting between the specimen and the second measurement component. The density of the specimen is calculated based on Archimedes' principle by reference to the known volume of the second measurement component and the measured perpendicular force. A rheometer for carrying out the method is also provided. |
| US11921021B2 |
Gas concentration device, gas detection system, gas concentration method, and gas detection method
A gas concentration device includes a first container, a second container, a pressure control device, and a path. The first container includes a first space surrounded by a first partition wall and stores a specimen, and a pressure inside the first space is reduced. The second container is airtightly connected to the first container by a first path and has a second space surrounded by a second partition wall and stores a gas flowing in from the first space. The pressure control device reduces a volume of the second space. A gas inside the second space is discharged through a second path. |
| US11921019B2 |
Grinding samples using rotational and linear motion
The disclosure is directed to a sample preparation apparatus for grinding or homogenizing test samples. More specifically, the disclosure relates to grinding samples using rotational and linear motion. Grinding samples can be accomplished with an apparatus with a slider-crank mechanism that is attached to an oscillating connecting linkage. The amplitude of oscillatory motion can be greater than or equal to a length of a sample processing chamber. |
| US11921010B2 |
Display assemblies with differential pressure sensors
Electronic display assemblies providing enhanced leak detection, and systems and methods related to the same, are provided. A differential pressure sensor detects a differential pressure between an ambient environment and a testing area of the electronic display assembly. A controller determines differential pressure readings based on data received from the differential pressure sensor and selectively generates electronic notifications based on said differential pressure readings. |
| US11921009B2 |
Method and apparatus for detecting leakages from sealed containers
A method for detecting leakages of fluids from sealed containers includes defining a detection zone in which a sealed container will be placed, putting the detection zone in communication with at least one gas sensor through at least one duct, introducing a flushing gas into the detection zone through the at least one duct, placing a container in the detection zone, sucking gases from the detection zone through the duct and transferring them to the sensor for ascertaining the presence of a gas leakage in the container. |
| US11921007B2 |
Fixing system for housing for measuring characteristics of a tire
A ground attachment system (1) for a tire characteristics detection unit (15) comprises an attachment plate (2) comprising a plurality of recesses (3) distributed over the surface of the attachment plate, a plurality of frustoconical clamping rings (4), and a plurality of cylindrical guide tunnels (5) arranged in the detection unit (15), the clamping rings (4) and the guide tunnels (5) each comprising a complementary conical portion (6, 7) converging towards the attachment plate (2) when the ring (4) is in the clamping position in a tunnel (5). |
| US11921004B2 |
Method for detecting decreased preload in ball screw and linear motion drive device
A linear motion drive device including a ball screw, a linear motion table driven by the ball screw to move linearly, and an abnormality detection device configured to detect a decrease in a preload applied to the ball screw. The abnormality detection device includes a vibration sensor configured to measure vibration during operation of the ball screw, a calculation processing unit configured to acquire a vibration value of a vibration signal in a specific frequency band among vibration signals measured by the vibration sensor, and an abnormality detection unit configured to determine that a decrease in the preload has occurred in the ball screw when the vibration value is less than a previously determined threshold with respect to a reference value, the reference value being a vibration value in an initial stage of the operation of the ball screw or during a normal operation of the ball screw. |
| US11921003B2 |
Testing device for precision retaining ability and fatigue life of RV reducer
The invention relates to a device for testing the precision retaining ability and fatigue life of RV reducer. The device includes a workbench, a mounting bracket base, a upper pressure plate for the mounting bracket, a servo motor, a mounting fixed sleeve, a tested RV reducer, a temperature sensor, an extension arm, a simulated swing arm, two counterweight blocks named the first and second counterweight block, the first displacement sensor, a sensor holder, a sensor protector, a detection rod, and the second displacement sensor. The device is equipped with two counterweight blocks at the end of the simulated swing arm to simultaneously provide variable loaded torque and loaded bending moment to the RV reducer. The first displacement sensor is placed under the counterweight block to measure the positioning accuracy and repeat positioning accuracy of RV reducer. The second displacement sensor is placed under the detection rod to measure the bending stiffness of RV reducer. After running for a specified time, the precision retaining ability, fatigue life and wear rule of RV reducer are tested. The invention provides an experimental basis for theoretical research on the wear rule and accelerated life of RV reducer. |
| US11921000B2 |
Visual fiber finder for sequencing optical fiber testing
There is provided optical power loss measurement method and system for that aims to provide a more productive way to perform optical power loss measurements involving test units typically at different locations. Visual fiber finder light can be used to assist the user at the other end of the optical fiber link under test in identifying where to connect the power meter unit. A visual fiber finder light and test light are combined on a same output port of a light source unit at one end of the optical fiber link under test wherein visual fiber finder light is interleaved with test light in a cyclic sequence so that both are not active at the same time. The optical power meter unit determines a time slot when to measure test light in accordance with the given cyclic sequence. |
| US11920996B2 |
Customizable pressure sensor array
A pressure sensor array can be used to record a pressure distribution in gait analysis and/or tactile sensing applications. The pressure sensor array can include a piezo-resistive material and a uniform distribution of a plurality of flexible circuits. Each of the plurality of flexible circuits comprise at least one wire connecting an internal portion of a respective flexible circuit to a common port. A device housing the pressure sensor array can be customized to a size and used for a gait analysis and/or tactile sensing application. The arrangement of the wiring permits partial sensors to be used as part of the pressure sensor array during the gait analysis and/or tactile sensing application. |
| US11920995B2 |
Drive shaft monitoring system
Drive shaft monitoring system has a first and second coded disc. The first and second coded disc are provided with multiple slots or recesses evenly distributed in circumferential direction thereof. The drive shaft monitoring system includes at least two independent light sensor assemblies arranged in connection with the slots or recesses of the first and second coded disc. |
| US11920992B2 |
Deformable sensors and methods using magnetic repulsion for modifying run-time membrane stiffness
Deformable sensors and methods for magnetically modifying membrane stiffness are provided. A deformable sensor may include a membrane coupled to a housing to form a sensor cavity. The deformable sensor may further include a first magnet located on an inner surface of the membrane in the sensor cavity. The deformable sensor may additionally include a magnetic object located at a base within the sensor cavity. The magnetic object may be configured to modifiably repel the first magnet and modify stiffness of the deformable sensor based upon the modified repulsion. |
| US11920989B2 |
Thermal sensor circuit
An electronic device includes a module that delivers a positive temperature coefficient output voltage at an output terminal. A thermistor includes a first MOS transistor operating in weak inversion mode and having a negative temperature coefficient drain-source resistance and whose source is coupled to the output terminal. A current source coupled to the output terminal operates to impose the drain-source current of the first transistor. |
| US11920988B2 |
Improving, detecting and indicating stability in an industrial temperature dry block calibrator
The present invention discloses methods for detecting and improving temperature stability in measurements performed by a dry block, i.e. a temperature calibrator. The dry block comprises a heating and cooling device. An energy metering integrated circuit measures an applied input power to the heating elements of the heating and cooling device. Additionally, a real-time compensation algorithm uses measurement results obtained by the energy metering integrated circuit, and outputs a control signal to the heating elements. The arrangement may comprise a back draft damper adjacent to a fan. The fan position may be selected. Stability criteria may be set. Leaning of the dry block can be tracked. Different sensors are used for the temperature control and for the temperature stability indication. |
| US11920985B2 |
Electronic quality indicator
A visually sensible indicator of temperature including electronic temperature sensing circuitry sensing at least when a temperature exceeds at least one predetermined temperature threshold and providing at least one corresponding threshold exceedance output which is sensible as heat and a heat-responsive visually sensible display which is responsive to the at least one threshold exceedance output for providing at least one visually sensible indication indicating that the temperature has exceeded the predetermined temperature threshold. |
| US11920978B2 |
Method and apparatus for detecting pulsed radiation
A method of detecting pulsed radiation comprising the steps of irradiating at least a portion of an array of sensor elements with pulsed radiation (71); addressing the array using a rolling shutter operation (72); reading the array to obtain a radiation image (73); and then applying a pulse detection operation (74) to the radiation image. The rolling shutter operation (72) is configured to address each element line of the array for a predetermined integration period. The predetermined integration period being calculated using an integration period function, itself a function of an anticipated pulse repetition interval of the pulsed radiation. The method and apparatus for the same enable low cost camera arrays to be used for pulse detection and for wider application in the field of low cost communications. |
| US11920975B2 |
Repeater design for distributed acoustic sensing on multispan fiber links
Aspects of the present disclosure are directed to alternative repeater design(s) that advantageously improve signal-to-noise of distributed acoustic sensing (DAS) systems using coherent detection of Rayleigh backscatter in multi-span links including inline amplification that may be employed—for example—in undersea submarine systems. The repeater designs incorporate Rayleigh combine units (RCU) and Rayleigh drop units (RDU) to reduce Rayleigh backscatter loss as Rayleigh signal(s) is/are routed to a link that propagates the backscatter signal in an opposite direction relative to interrogation pulse(s). |
| US11920973B2 |
Analysis device, analysis system, and analysis method
An analysis device includes a vibration sensor that detects vibration of a machine, a calculation unit that calculates an average value of detection data of the vibration sensor in each predetermined cycle interval, converts a plurality of data points included in each interval to one data point indicating the average value to reduce calculation points, and performs vibration analysis with the reduced calculation points, and a wireless communication device that transmits processed data output from the vibration analysis performed by the calculation unit. |
| US11920969B2 |
Systems and methods for measuring the filling level of a silo
The invention relates to a system (100) and a method (200) for measuring the filling level of a silo (110) for storing and mixing at least one bulk material, the silo being provided with a plurality of support legs (111) on the ground. The system comprises: a single deformation sensor (120) provided to be fixed to a single support leg of the silo so that the deformation sensor can detect deformations of the support leg in order to generate at least one measurement signal which comprises the deformation values, a first wireless communication means (130) provided to transmit the measurement signal, and a remote server (140) which comprises a second wireless communication means and a processor, the processor being provided to process the measurement signal so as to obtain an estimation of the filling level of the silo. |
| US11920963B2 |
Method and system for optical fiber sensing
A method of optical sensing comprises coupling an excitation optical signal into a first optical fiber to induce Rayleigh backscattering, thereby providing a backscattered signal. The backscattered signal is optically amplified in the first optical fiber, thereby providing an amplified backscattered signal. The amplified backscattered signal is coupled into a second optical fiber and is optically re-amplifying in the second optical fiber. |
| US11920956B2 |
Obstruction detector assemblies, systems, and related methods for detecting obstructions along oil and gas equipment
Aspects of the present disclosure relate to obstruction detector assemblies, systems, and related methods for detecting obstructions along oil and gas equipment. In one implementation, an obstruction detector assembly includes a driver housing having an internal chamber and a plurality of fastener openings. The obstruction detector assembly includes a driver stem disposed at least partially in the internal chamber of the driver housing. The driver stem is movable partially out of the internal chamber of the driver housing. The obstruction detector assembly includes a driver head disposed outside of the driver housing and coupled to the driver stem. In one implementation, movement of the driver stem and the driver head is used to detect obstructions (such as a wireline) in a wellhead structure. In one implementation, movement of the driver stem and the driver head is used to detect obstructions (such as sand) in a valve. |
| US11920953B2 |
Device for determining orientation of an object
The present disclosure relates to a device (100) for determining orientation of an object (3). The device (100) includes a hollow-spherical enclosure (2) supportable by the object (3) and a plurality of sensors (S1 . . . Sn) circumferentially disposed in the hollow-spherical enclosure (2). A gimbal assembly (1) is secured in the hollow-spherical enclosure (2), where at least one gimbal ring of the gimbal assembly (1) is fixed perpendicular to a gravitational weight a gravitational vector (G) of the gimbal assembly (1). Further, at least one light source (8) is secured in the gimbal assembly (1) and the gimbal assembly (1) is configured to align the at least one light source (8) relative to orientation of the object (3) such that, the light emitted by the at least one light source (8) is incident on at least one sensor of the plurality of sensors (S1 . . . Sn), to determine orientation of the object (3). |
| US11920950B2 |
System and method for generating precise road lane map data
An in-vehicle system for generating precise, lane-level road map data includes a GPS receiver operative to acquire positional information associated with a track along a road path. An inertial sensor provides time local measurement of acceleration and turn rate along the track, and a camera acquires image data of the road path along the track. A processor is operative to receive the local measurement from the inertial sensor and image data from the camera over time in conjunction with multiple tracks along the road path, and improve the accuracy of the GPS receiver through curve fitting. One or all of the GPS receiver, inertial sensor and camera are disposed in a smartphone. The road map data may be uploaded to a central data repository for post processing when the vehicle passes through a WiFi cloud to generate the precise road map data, which may include data collected from multiple drivers. |
| US11920947B2 |
Notification controller and electrically powered vehicle
A notification controller that controls a notification apparatus that gives a notification to a driver of an electrically powered vehicle includes a receiver, a first determination unit, and a first notification unit. When the receiver receives a prescribed leveling signal, the first determination unit determines whether or not the electrically powered vehicle can participate in power leveling at a prescribed participation spot, based on at least one of timing of start and timing of end of power leveling indicated by the prescribed leveling signal, a position of the electrically powered vehicle, and a remaining amount of power stored in the vehicle. When the first determination unit determines that the electrically powered vehicle can participate, the first notification unit causes the notification apparatus to perform first notification processing for inviting the electrically powered vehicle to go to the prescribed participation spot. |
| US11920946B2 |
Dynamic scaling of geospatial data on maps
Methods, systems, and non-transitory computer readable media configured to display a geographical map overlaid with a marker layer comprising at least one marker; receive input from a user to change a zoom level of the geographical map from a first map scale to a second map scale; display the geographical map at the second map scale; and overlay the marker layer at the second map scale with the at least one marker at a second marker size. The second marker size is determined based on a correlation between the second map scale and the second marker size, in which (i) the second marker size is increased or decreased in the same direction as the second map scale when the second map scale is within a range from a low threshold point to a high threshold point, and (ii) a ratio change between two adjacent marker sizes is smaller than a ratio change between two corresponding adjacent map scales when the second marker size is outside the range from the low threshold point to the high threshold point. |
| US11920944B2 |
Dynamically generating scenery for a virtual reality driving session based on route information
In some implementations, a device may identify objects associated with the route based on one or more images associated with a selected route. The device may generate a model associated with the route including the scenery, wherein the scenery includes models of the objects based on geographic locations of the objects and three-dimensional spatial information of the objects. The device may determine a visual reference point for the virtual reality driving session based on at least one of vehicle information associated with the vehicle or user information. The device may provide, to a virtual reality device, presentation information that causes the virtual reality driving session to be displayed by the virtual reality device from a perspective of the visual reference point within a vehicle model associated with a selected vehicle placed in the model of the route with the scenery. |
| US11920943B2 |
Systems and methods using artificial intelligence for routing electric vehicles
The present invention provides specific systems, methods and algorithms based on artificial intelligence expert system technology for determination of preferred routes of travel for electric vehicles (EVs). The systems, methods and algorithms provide such route guidance for battery-operated EVs in-route to a desired destination, but lacking sufficient battery energy to reach the destination from the current location of the EV. The systems and methods of the present invention disclose use of one or more specifically programmed computer machines with artificial intelligence expert system battery energy management and navigation route control. Such specifically programmed computer machines may be located in the EV and/or cloud-based or remote computer/data processing systems for the determination of preferred routes of travel, including intermediate stops at designated battery charging or replenishing stations. Expert system algorithms operating on combinations of expert defined parameter subsets for route selection are disclosed. Specific fuzzy logic methods are also disclosed based on defined potential route parameters with fuzzy logic determination of crisp numerical values for multiple potential routes and comparison of those crisp numerical values for selection of a particular route. Application of the present invention systems and methods to autonomous or driver-less EVs is also disclosed. |
| US11920942B2 |
Device, method, computer program, and computer readable-recording medium for route guidance
A method for controlling autonomous lane change of a moving body is disclosed. The method includes calculating a driving route from a current location of the moving body to a destination; determining whether an intersection or a forked road exists at a predetermined distance from the current location of the moving body on the calculated driving route; checking, when the intersection or the forked road exists, link information corresponding to a lane in which the moving body is located, and determining a moving direction toward the intersection or the forked road; determining an entry route for entering the intersection or the forked road according to the determined moving direction; and generating a control signal for controlling a moving direction of the moving body according to the determined entry route. |
| US11920938B2 |
Autonomous electric vehicle charging
Methods and systems for autonomous vehicle recharging or refueling are disclosed. Autonomous electric vehicles may be automatically recharged by routing the vehicles to available charging stations when not in operation, according to methods described herein. A charge level of the battery of an autonomous electric vehicle may be monitored until it reaches a recharging threshold, at which point an on-board computer may generate a predicted use profile for the vehicle. Based upon the predicted use profile, a time and location for the vehicle to recharge may be determined. In some embodiments, the vehicle may be controlled to automatically travel to a charging station, recharge the battery, and return to its starting location in order to recharge when not in use. |
| US11920935B2 |
Navigation device, automatic driving control device, and navigation method
A navigation device includes an own vehicle position detecting unit configured to detect position information of own vehicle; a route setting unit configured to set a guidance route that guides the own vehicle to a destination on the basis of a first map including information of a traveling route and the position information of the own vehicle; a matching unit configured to match a position of the own vehicle as a first own position with the traveling route where the own vehicle travels on the first map on the basis of the position information of the own vehicle; a driving lane detecting unit configured to match the position of the own vehicle as a second own position with a driving lane where the own vehicle travels on a second map on the basis of the second map including information of the driving lane in the traveling route and the position information of the own vehicle; and a calculating unit configured to determine whether the second own position is included in the first own position. When the guidance route is set, the matching unit matches the first own position on the guidance route, and when the second own position is no longer included in the first own position thereafter, the matching unit matches the first own position on the first map on the basis of the position information. |
| US11920932B2 |
Micro hemispherical resonator gyroscope, and an assembly method and wafer fixture
A wafer-level assembly method for a micro hemispherical resonator gyroscope includes: after independently manufactured glass substrates are softened and deformed at a high temperature, forming a micro hemispherical resonator on the glass substrate; forming glass substrate alignment holes at both ends of the glass substrate by laser ablation; aligning and fixing a plurality of identical micro hemispherical resonators on a wafer fixture by using the alignment holes as a reference, and then performing operations by using the wafer fixture as a unit to implement subsequent processes that include: releasing the micro hemispherical resonators, metallizing the surface, fixing to the planar electrode substrates, separating the wafer fixture and cleaning to obtain a micro hemispherical resonator gyroscope driven by a bottom planar electrode substrate. The wafer-level assembly method includes: fixedly mounting the plurality of independently manufactured micro hemispherical resonators on the same wafer fixture to implement a wafer-level installation operation. |
| US11920931B2 |
Gyroscope with self-test
A microelectromechanical gyroscope which comprises one or more Coriolis masses driven by a drive transducer and a force-feedback system. The force-feedback circuit comprises first and second sideband modulators and the self-test circuit comprises first and second sideband demodulators. |
| US11920929B2 |
Detecting and guiding optical connection(s) for one or more imaging modalities, such as in optical coherence tomography
One or more devices, systems, methods, and storage mediums for detecting and guiding optical connection(s) using one or more imaging modalities are provided herein. Examples of applications include imaging, evaluating and diagnosing biological objects, such as, but not limited to, for Gastro-intestinal, cardio and/or ophthalmic applications, and being obtained via one or more optical instruments, such as, but not limited to, optical probes, catheters, capsules and needles (e.g., a biopsy needle). Devices, systems, methods, and storage mediums may include or involve a method, such as, but not limited to, for guiding and/or determining status of engagement and/or disengagement of one or more optical connections. A device, system, method, or storage medium may detect, monitor, and/or guide a probe/catheter to minimize, reduce, and/or avoid engagement and disengagement failures and to have a robust means of determining status of probe/catheter engagement to an apparatus or system. |
| US11920925B2 |
Measuring tape with improved center post
A measuring tape device may include a housing having an aperture, a reel assembly enclosed within the housing, and a blade having a first end configured to extend from the housing through the aperture and a second end configured to be wound on the reel assembly. The reel assembly may be configured to alternately allow the blade to be withdrawn from the reel assembly through the aperture or received in the aperture onto the reel assembly via operation of a spring. The spring is anchored to a post disposed within the housing at a first end of the spring and operably coupled to the blade at a second end of the spring. The post includes a slot dividing the post into a first post portion and a second post portion. Each of the first and second post portions may have rounded edges at portions thereof that define lateral boundaries of the slot. |
| US11920924B2 |
Method and apparatus for relating measurements with comparable objects for the purpose of recording evidence
The invention is a method and measuring device configured for measurement by comparing the an area of interest or object with an object of comparable size and/or shape. This invention may be most useful when recording and classifying evidence. The measuring device should be portable and comprised of a flat, straight elongated member with measuring indicia along one or both the measuring edges, wherein the measuring indicia corresponds with values with labels of the standard sizes of comparable objects. The measuring indicia extends along the length of the measuring edge and the labels indicate the closest sized object. Other measuring indicia along the length of the measuring edge may also correspond to standard measurement units. The method should directly correlate a measurement with a comparable object for the purpose of recording evidence. |
| US11920922B2 |
Combiner alignment detector
A system for detecting an alignment of a relay lens assembly and a combiner of a head-up display is disclosed. The system includes an illuminated reticle spatially coupled to the relay lens assembly, an optical sensor spatially coupled to the combiner, and a control module configured to receive an input from the optical sensor, determine a position of the combiner relative to the relay lens assembly based on the received input; and generate an output based on a determined position of the combiner relative to the relay lens assembly. In another system, the illuminated reticle is spatially coupled to the combiner, and the optical sensor is spatially coupled to the relay lens assembly. The system may also participate in a feedback loop with the head-up display to reduce jitter in the head-up display. |
| US11920919B2 |
Projecting a structured light pattern from an apparatus having an OLED display screen
An apparatus includes a display screen that includes OLED pixels disposed at a particular pitch in a first plane. A light projector includes light emitting elements disposed in a second plane parallel to the first plane. The light emitting elements are disposed at the same pitch as the OLED pixels or at an integer multiple of the pitch of the plurality of OLED pixels. The light emitting elements are operable to produce light at a wavelength for transmission through the display screen, and the first and second planes are separated from one another by a distance D such that d2=2*(λ)*(D)/(N), where d is the pitch of the OLED pixels, λ is the wavelength, and N is a positive integer. |
| US11920914B2 |
Tubing dimensional measurement system
Provided herein are measurement systems including a micrometer assembly for receiving a length of tubing, the micrometer assembly including a plurality of non-contact optical micrometers disposed around the length of tubing for measuring an outer diameter (OD) at a first plurality of positions along a circumference of the length of tubing. The measurement system may further include a displacement gauge assembly for receiving the length of tubing from the optical micrometer assembly, the displacement gauge assembly including a plurality of non-contact gauges disposed around the length of tubing for measuring a wall thickness at a second plurality of positions along the circumference of the length of tubing. A controller receives the OD measurements and thickness measurements, and determines an inner diameter and a concentricity of the length of glass tubing based on an index of refraction of the length of glass tubing, the OD measurements, and the thickness measurements. |
| US11920913B2 |
Conversion parameter calculation method, displacement amount calculation method, conversion parameter calculation device, and displacement amount calculation device
A conversion parameter calculation method includes: obtaining, from an image capturing device, image data obtained by the image capturing device capturing an image of an object having attached thereto a marker with which specific coordinates are detectable; obtaining displacement direction information indicating a direction of a displacement of the object, the direction crossing an image capturing surface of the image capturing device; detecting specific coordinates, based on the marker included in the image data; estimating a position of the image capturing device, based on a result of the detection; calculating distance data indicating a distance from the image capturing device to the object, based on the position of the image capturing device; and calculating, using the distance data and the displacement direction information, a conversion parameter for converting a pixel displacement amount of the object into an actual displacement amount. |
| US11920905B2 |
Anti-ballistic laminate manufacturing method and products
Laminates and their process of manufacture, with the laminates made with anti-ballistic materials, such as woven and unwoven fabrics. The laminates are provided with different structures, materials, bondings, and other features, and example methods of manufacturing those laminates efficiently and in mass quantities. The method of production is a process of laminating individual flexible sheets including anti-ballistic material (which may be of woven or unwoven cloth or thin solid sheets or foils comprised of one or more light-weight anti-ballistic materials) into a flexible laminate for use to protect people or spaces from ballistic objects such as bullets and shrapnel from weapons and other moderate to high-kinetic energy objects. |
| US11920901B2 |
Systems and methods for cooperation between cameras and conducted electrical weapons
Police officers use conducted electrical weapons (“CEWs”) and cameras. A camera and a CEW may cooperate to improve the performance and use of the CEW and evidence collection by the camera. A camera and a CEW may also cooperate to improve the safety of the user and the target. Improvements may include improving targeting of the CEW, identifying and classifying body parts of the target as suitable or unsuitable for electrode deployment, adjusting electrode trajectory prior to launch, and automating electrode launch. Evidence collection may be improved by recording placement of electrodes on the target. Safety of the target may be improved by monitoring the movements of the target and altering characteristics of the delivered stimulus signal if potential harm to the target may occur. |
| US11920900B2 |
System for ejection of countermeasure boxes
An ejecting system for dispensing countermeasure boxes includes a container arranged to hold a multiple of stacked boxes. A pushing actuator is arranged to push at one end of the stack of boxes in a first direction. The system further includes an ejecting mechanism including a driving actuator connected to a rotating member. The rotating member is arranged to engage with a box and on the side of the box most distant from the pushing actuator such that said box is moved in a second direction perpendicular to said first direction, and ejected. |
| US11920892B2 |
Crossbow arrow rest
In some embodiments, crossbow comprises a frame, a bow portion comprising a bowstring, a latch and a trigger. An arrow rest is supported by the frame at a first location. The frame is also arranged to support the arrow rest at a second location. A distance between the latch and the first location is different from a distance between the latch and the second location. |
| US11920891B2 |
Paddle for discipline with pivoting handle and related methods
A paddle is for corporal discipline. The paddle includes a handle, and a paddle portion having a base, and an elongate flat member extending from the base. The elongate flat member is to be used for striking a subject to be disciplined in the corporal discipline. The paddle also includes a hinge device comprising a first arm coupled to the handle, a second arm coupled to the base, a pivoting hinge coupled between the first arm and the second arm and configured to switch the paddle portion between a locked state where the paddle portion and the handle are substantially parallel and a folded state where the paddle portion and the handle freely move, and a settable feature. The settable feature selectively changes a threshold pivoting force of the pivoting hinge for causing the paddle portion to switch from the locked state to the folded state. |
| US11920877B2 |
3D printed cold plates and methods for cooling power devices embedded in 3D printed circuit boards
A system and method of forming integrated power electronic packages includes 3D-printing a cold plate having a hollow interior recess and a plurality of fins. The method includes printing, using a 3D printer, an electrical insulation layer and a conductor substrate onto a top surface of the cold plate, such that the electrical insulation layer and conductor substrate are embedded within the top surface of the cold plate. The method further includes embedding power devices in the conductor substrate, printing, using a 3D printer, a circuit board on and around the power devices, and mounting electronic components on the circuit board. |
| US11920876B2 |
Distributor for plate heat exchanger and plate heat exchanger
A distributor for a plate heat exchanger includes a tube part having a tube wall and having a first end and a second end; a first flange formed at the first end; and a connecting protrusion. The connecting protrusion projects from the tube wall of the tube part in a direction away from an axis of the tube part, and projects from the first flange at the inside of the outer edge of the first flange in a direction towards the second end of the tube part; the connecting protrusion has a connecting protrusion wall, which has an axial connecting protrusion wall that faces in the axial direction of the tube part and is remote from the first flange, the axial connecting protrusion wall being between the first end and the second end of the tube part, and having at least one through-hole. |
| US11920873B2 |
Wound heat exchanger, method for producing a wound heat exchanger and method for exchanging heat between a first fluid and a second fluid
The invention relates to a wound heat exchanger having a core tube extending along a longitudinal axis in an axial direction and having a tube bundle, which has a plurality of tubes for conducting a first fluid, wherein the tubes are wound about the core tube in a plurality of windings, the tubes being arranged in a radial direction perpendicular to the axial direction in a plurality of tube layers, adjacent windings of at least one tube layer having different axial distances in the axial direction and/or tube layers adjacent in the radial direction having different radial distances from each other in a cross-sectional plane perpendicular to the longitudinal axis. The invention further relates to a method for producing a wound heat exchanger and to a method for transferring heat between a first fluid and a second fluid by means of the heat exchanger. |
| US11920870B1 |
Thermal energy storage system
A thermal energy storage system (TESS), effectively a thermal energy battery, is characterized by combination of wet and dry tanks and a circuitously routing of a liquid heat exchange medium from the wet tank through the dry tank such that electrically or fluidically sourced thermal energy can be stored in a dry heat-storage medium, and later released on demand. An optional phase change material (PCM) may be held in a third tank that is likewise circuitously served with the liquid heat exchange medium to enable more sudden and rapid release of energy when the PCM drops to its phase change temperature, for more instantaneous response to heat demand. The TESS may serve space heating and/or hot water demands of a residential home or other small building. The heat exchange medium may be warmed through operation of a heat pump acting in an air conditioning capacity to cool an indoor space. |
| US11920864B2 |
Dryer and a method for drying a liquid feed into a powder
A dryer for drying a liquid feed into a powder comprises a drying chamber defined by a chamber wall including a bottom wall portion; a feed inlet for receiving the liquid feed and dispersing particulate feed into the drying chamber; at least one air inlet for entering drying air into the drying chamber; and at least one drying chamber outlet for dried powder and/or spend drying air from the drying chamber. The feed inlet comprises a decanter centrifuge with an axis of rotation; a first axial end; a second axial end; and a solid phase outlet at the first axial end. |
| US11920860B2 |
Refrigerator, server, and method for controlling the refrigerator
A refrigerator for recognizing an object to be stored and automatically opening a door based on the recognized object, and a method therefor are provided. The refrigerator includes a main body, at least two doors provided on a front surface of the main body, two or more storage rooms provided in the main body or the at least two doors and configured to store objects, a cooler configured to cool the two or more storage rooms, a door driver configured to generate power for automatically opening and closing the at least two doors, a camera configured to photograph an image of surroundings around the at least two doors, and at least one processor configured to, in the case in which an object is recognized from the image of the surroundings, transmit a control signal for opening a door to the door driver based on the recognized object. |
| US11920852B2 |
Refrigerator and control method thereof
A refrigerator may include a storage part including a compressor and an evaporator and configured to store a food item at a low temperature using air cooled by the evaporator. The refrigerator may also include an ice making compartment configured to make or store ice using air cooled by the evaporator, and a fan for making ice allowing air cooled by the evaporator to flow to the ice making compartment. Additionally, a rotation speed of the fan for making ice changes while the fan for making ice continues to operate during operation of the compressor. |
| US11920851B2 |
Refrigerator appliance
A refrigerator includes a cabinet, a first door, a second door, a partition wall, and a pressure relief valve. The cabinet defines first and second internal storage chambers. The first and second doors are disposed over the first and second internal storage chambers, respectively. The first and second doors are configured to transition between open and closed positions to provide access to and cover the first and second internal storage chambers, respectively. The partition wall separates the first internal storage chamber from the second internal storage chamber. The partition wall defines a channel that establishes fluid communication between the first and second internal storage chambers. The pressure relief valve extends between the first internal storage chamber and an exterior of the cabinet. The pressure relief valve is configured to open to vent air from the first internal storage chamber to the exterior of the cabinet. |
| US11920849B1 |
Combined ice chest and bar top
The combined ice chest and bar top forms a temporary station from which the one or more beverages can be prepared and distributed. The combined ice chest and bar top incorporates a pedestal structure, a storage platform, a storage stanchion, and a service platform. The storage platform attaches the pedestal structure to the storage stanchion. The storage stanchion attaches the service platform to the storage platform. The pedestal structure is the inferior structure of the combined ice chest and bar top. The pedestal structure forms the cart structure that allows the combined ice chest and bar top to be rolled into position. The pedestal structure further adjusts the elevation of the storage platform, the storage stanchion, and the service platform relative to a supporting surface. |
| US11920841B2 |
Air-conditioning apparatus
An air-conditioning apparatus includes a main circuit in which a compressor, a flow switching device, an indoor heat exchanger, a pressure reducing device, and a plurality of parallel heat exchangers connected in parallel with each other are connected by pipes, a bypass pipe, a flow control device provided to the bypass pipe and configured to adjust a flow rate of refrigerant flowing through the bypass pipe, an evaporating pressure sensor configured to measure an evaporating pressure of the refrigerant, and a controller. The air-conditioning apparatus is configured to operate in a normal heating operation mode and a heating-defrosting operation mode. When an operation associated with the normal heating operation mode is switched to an operation associated with the heating-defrosting operation mode, the controller adjusts an opening degree of the flow control device using the evaporating pressure in the parallel heat exchanger and a driving frequency of the compressor. |
| US11920840B2 |
Unit cooler with staggered defrost on a plurality of evaporator coils
An HVAC system includes a unit cooler, which includes a first evaporator coil, a second evaporator coil, and a blower. The HVAC system further includes a first sensor, a second sensor, a first valve, a second valve, and a controller. The controller actuates the blower to direct air to flow over the first evaporator coil and the second evaporator coil, receives measurements from the first sensor and the second sensor, initiates a defrost cycle for the first evaporator coil by transmitting instructions to close the first valve to prevent the flow of refrigerant into the first evaporator coil, transmits instructions to open the first valve when the defrost cycle for the first evaporator coil has terminated, and initiates a defrost cycle for the second evaporator coil by transmitting instructions to close the second valve to prevent the flow of refrigerant into the second evaporator coil. |
| US11920837B2 |
Container for storing a composition comprising tetrafluoropropene and method for storing same
The invention relates to a container housing a composition comprising tetrafluoropropene. The container is made from metal and includes an inner surface, said inner surface being in contact with the composition and being at least partially covered with a coating containing zinc. Advantageously, the aforementioned composition comprises at least 15 wt.-% tetrafluoropropene relative to the total weight of the composition. |
| US11920831B2 |
Heating unit with a partition
A heating unit for a heating, ventilation and/or air conditioning (HVAC) system may have a first airflow path through the heating unit, a second airflow path through the heating unit, and a heater assembly having a first heating coil positioned within the first airflow path, a second heating coil positioned within the second airflow path, and a coil divider separating the first heating coil and the second heating coil. |
| US11920828B2 |
System and method for photoelectrochemical air purification
An air purification system including a filter assembly including a substrate including a fibrous media, and a photocatalytic material disposed on the substrate, wherein the photocatalytic material includes a first quantity of crushed nanostructures; and a photon source arranged to illuminate the photocatalytic material with optical radiation. |
| US11920824B2 |
Humidifying device for transferring water from waste air of a waste air flow to supply air of a supply air flow
A humidifying device for transferring water and/or water vapour from waste air of a waste air flow to supply air of a supply air flow is provided. In the compensating chamber of the housing of the humidifying device, at least one spreading means is arranged, which spreads apart the plate stack of the humidifying device and the housing cover closing the housing in the direction of the longitudinal axis. |
| US11920822B2 |
Air handling unit with integral inner wall features
An air handling unit has an interior wall configured to selectively retain a removable component of the air handling unit. An air handling unit has an interior wall configured as a drain pan. An air handling unit has an outer skin joined to the interior wall, an insulator disposed between the interior wall and the outer skin, and the interior wall has a mounting channel configured to selectively retain a removable component of the air handling unit. |
| US11920818B2 |
Fan unit and air treatment system including the same
A problem to be solved by the present disclosure is to realize a fan unit capable of determining occurrence or non-occurrence of a backflow during operation. In a second unit, a second controller calculates front-rear differential pressure by substituting a rotation speed and a volume of air or a wind speed that can be acquired in real time into a relational expression. The relational expression derives, from two values of the rotation speed, the volume of air or the wind speed, and the front-rear differential pressure, the remaining one value. Then, the second controller determines that a backflow occurs if the calculated front-rear differential pressure is within a range that cannot occur under a normal condition. Therefore, the occurrence of a backflow can be detected without using an expensive pressure sensor or a directional wind speed sensor. |
| US11920812B2 |
Air conditioning system
An air conditioning system for controlling air conditioning in a room in accordance with an air conditioning operation instruction received from a user includes: a ventilation device ventilating the room; an air agitation device agitating air in the room; an air conditioner controlling the air conditioning of the room and operations of the ventilation device and the air agitation device; and a detection device detecting presence of the user in the room. The air conditioner controls the operations of the ventilation device and the air agitation device before the user enters the room based on an indoor temperature inside the room, an outdoor temperature outside the room, an operation mode of air conditioning control performed by the air conditioner included in the air conditioning operation instruction, an operating status of the ventilation device, and a detection result provided by the detection device. |
| US11920810B2 |
Systems and methods for agent based building simulation for optimal control
A system for a building management system simulation includes one or more processors and memory. The memory includes instructions stored thereon, that when executed by the one or more processors, cause the one or more processors to generate a space agent representing a space in a building, the space agent to maintain an environmental condition of the space based on an optimization state of the space, generate an equipment agent representing a device that serves the space, and register the space agent and the equipment agent to a space communication channel associated with the space. The space agent communicates with the equipment agent over the space communication channel. |
| US11920809B2 |
Predictive temperature scheduling for a thermostat using machine learning
A heating, ventilation, and air conditioning (HVAC) control device configured to receive a user input for controlling an HVAC system, to determine whether the user input indicates an energy saving occupancy setting, and to identify a first plurality of time entries that are associated with a confidence level for a predicted occupancy status that is less than a predetermined threshold value in the predicted occupancy schedule. The device is further configured to modify the predicted occupancy schedule by setting the first plurality of time entries to an away status when the user input indicates an aggressive energy saving occupancy setting. The device is further configured to modify the predicted occupancy schedule by setting the second plurality of time entries to a present status when the user input indicates a conservative energy saving occupancy setting. The device is further configured to output the modified predicted occupancy schedule. |
| US11920808B2 |
Energy management system and energy management method
An energy management system is configured to calculate a percentage of satisfied based on the report data for each of the plurality of buildings; create, for each of the plurality of buildings, a plan for operating each of the air-conditioning facilities based on the percentage of satisfied and a predetermined target percentage of satisfied; calculate a first energy consumption amount based on the first piece of data; calculate a second energy consumption amount based on the second piece of data, the third piece of data, and the fourth piece of data, the second energy consumption amount being obtained when the each of the air-conditioning facilities is operated after a lapse of a predetermined time period; and control, when the first energy consumption amount is larger than the second energy consumption amount, the operation of the each of the air-conditioning facilities so as to achieve the second energy consumption amount. |
| US11920806B2 |
Ultraviolet (UV) light-based refrigerant leak detection system and method
A leak detection system of a heating, ventilating, and air conditioning (HVAC) system includes a sensor configured to detect a UV tracer in a monitored gas volume of the HVAC system. The leak detection system also includes a controller communicatively coupled to the sensor. The controller is configured to modify operation of the HVAC system in response to the sensor detecting the UV tracer in the monitored gas volume. |
| US11920802B2 |
Air conditioner units and heating elements thereof
An air conditioner unit includes an indoor heat exchanger assembly positioned in an indoor portion of the air conditioner unit. The indoor heat exchanger assembly includes an indoor heat exchanger and an indoor fan. The air conditioner unit also includes a heating unit. The heating unit may be positioned in the indoor portion of the air conditioner unit downstream of the indoor fan and/or at the exhaust side of the indoor fan. |
| US11920793B1 |
Adjustable gaseous fuel injector
A fuel injector for a gas turbine engine combustor is provided that includes a swirler, a mounting stage, and a distributor. The swirler has a shaft, a collar, a throat section, and first and second axial ends. The throat section includes an inner radial surface that defines a central passage that extends between the swirler inner bore and the collar. The collar includes a plurality of apertures extending therethrough disposed radially outside of the central passage. The mounting stage is disposed in the inner bore, and has an annular flange, a central hub, and at least one strut. The distributor has a stem attached to a head. The stem has a distal end opposite the head portion engaged with the central hub. The head portion has an end surface and a side surface. The distributor is selectively positionable relative to the throat section. |
| US11920791B1 |
Trapped vortex reverse flow combustor for a gas turbine
A trapped vortex reverse flow combustor for a gas turbine includes a first dome structure having a plurality of first-dome vortex driver airflow openings for providing a first vortex generating mid airflow therethrough to a trapped vortex cavity. A second dome structure is arranged downstream of the first dome structure and includes a plurality of second-dome vortex driver airflow openings providing a first vortex generating outer airflow therethrough to the trapped vortex cavity, and a plurality of primary driver airflow openings providing a primary driver airflow therethrough radially inward of the trapped vortex cavity. |
| US11920789B2 |
Combustor assembly for a turbine engine
A combustor assembly for a gas turbine engine includes an outer liner that at least partially defines a combustion chamber. The outer liner extends between an aft end and a forward end generally along an axial direction within an outer casing of the gas turbine engine. The outer liner includes an inner surface facing the combustion chamber and an outer surface facing away from the combustion chamber. The combustor assembly includes a radial damper assembly disposed against the outer liner at a plurality of circumferential points. |
| US11920786B2 |
Regenerative burner, industrial furnace and method for producing a fired article
A regenerative burner including: a combustion chamber; a heat exchange chamber; and a communication passage therebetween, the combustion chamber includes a tip of a fuel nozzle and a flame ejection port, and is configured such that fuel introduced from the fuel nozzle into the combustion chamber can be burned in the combustion chamber using combustion air introduced into the combustion chamber through the communication passage to eject flame from the flame ejection port; the fuel nozzle is configured such that fuel burned in the regenerative burner is introduced into the combustion chamber; and the heat exchange chamber comprises a heat accumulator interposed between the communication passage and an air port, and is configured such that combustion air can pass through the heat accumulator and then be introduced into the combustion chamber such that an exhaust gas passes through the heat accumulator and is discharged from the air port. |
| US11920782B2 |
Streamlined vaporizer cores
Vaporizer cores are disclosed including a housing and a chamber where the chamber includes a porous lattice structure that is thermally conductive. Further, the housing and the chamber including the porous lattice structure are formed as a single integral structure. Three-dimensional (3D) printing can be used to form the housing and the chamber including the porous lattice structure as a single integral structure. For certain embodiments, a concentric-circle fin design, a crisscross fin design, or a conical fin design is used to form the porous lattice structure for the vaporizer chamber. For further embodiments, techniques are implemented to resolve potential problems with 3D printing of the vaporizer cores. One example technique is encapsulation of the vaporizer core within a shell, such as a two-piece shell, to resolve potential problems with leaks. Disclosed embodiments for the vaporizer cores provide manufacturing, material, and design improvements to prior solutions. |
| US11920774B2 |
LED curing apparatus and cooling module
A cooling module, which is securable to one or more thermal transfer members for an LED curing apparatus, wherein the cooling module comprises a first finned heat sink and a second finned heat sink; wherein the first finned heat sink is removably securable to the second finned heat sink to provide at least one aperture therebetween, wherein each of a plurality of fins protrude from the first finned heat sink and from the second finned heat sink and each fin is substantially perpendicular to the length of the or each aperture, wherein the first finned heat sink is removably secured proximal to the second finned heat sink by at least one locking member, and wherein the or each locking member is inserted such that its length is parallel to the length of the or each aperture. |
| US11920772B2 |
Modular junction box for downlight luminaire
A universal junction box includes an upper body having a first connecting feature. A lower body releasably connects to the upper body having a second connecting feature configured to mate with the first connecting feature. The upper body and lower body forming a housing to receive an electrical connection. A first mounting feature is configured to selectively secure the housing to an associated frame or to an unassociated frame or other support structure. |
| US11920770B2 |
Infrared light module uniformity rotational test module
Example embodiments described herein involve a system for testing a light-emitting module. The light-emitting module may include a mounting platform configured to hold a light-emitting module for a camera. The mounting platform may also be configured to rotate. The system may further include a housing holding a plurality of photodiodes arranged in an array over at least a 90 degree arc of a hemisphere. The system may also include a controller configured to control the photodiodes and the rotation of the mounting platform. |
| US11920768B2 |
Multi-mount system for light
A mount system comprising a mount receiver, a light, and a mount attachment. The light includes a body, a head pivotably coupled relative to the body by a hinge, and a light emitting element mounted on the head. The mount attachment is configured to engage both the mount receiver and the light to secure the light to the mount receiver. |
| US11920767B2 |
Fixtures, power and control systems for same
Apparatus and methods for deployment of fixtures. The apparatus may include a system for controlling deployed fixtures. The system may receive user commands different devices in different formats. The fixtures may be independently addressable. The fixtures may be magnetically supported by a fixture support. A brace may join two or more fixture supports without reducing space available to support fixtures. The brace may join a fixture support to a fixture support accessory. An accessory may include a variable-angle junction. The fixture may include articulating joints for controlling the direction of a beam. The fixture may include a lens having an electrically controllable beam spread angle. The fixture may be stowable in the fixture support. The fixture may be slidable along a cord to adjust a height of the fixture. The fixture may include an extendable ring. The system may coordinate motions of the fixtures to follow a target. The fixture may include an elongated board. The elongated board may include a non-polar power socket. |
| US11920756B2 |
Light shielding component, and corresponding optical assembly, vehicle lamp and vehicle
One of the problems solved by an embodiment of the present invention is to solve the problem of light leakage. A light shielding component according to the present invention comprising a covering portion, and a snap-fit portion, wherein the covering portion is used to cover a light guide to block the transmission of light rays; and the snap-fit portion comprises at least one slot, which is used to fix the light shielding component. Compared with the prior art, the advantage of the solution of the present invention is that by using a light shielding component, the light beam leakage is better blocked, and a better visual effect is achieved. |
| US11920751B1 |
Tri-proof lamp with replaceable sensor end cap
A tri-proof lamp with replaceable sensor end cap includes a lamp body, an end cap, a light source board and a sensing module. The end cap is disposed at one end of the lamp body and includes a first portion and a second portion connected to each other. One end of the first portion has a cable outlet. The second portion has a connecting portion and a sensing portion connected to each other and the connecting portion is connected to the other end of the first portion. The light source board is disposed in the lamp body and includes a sensing module connecting port. The sensing module is disposed in the sensing portion and includes a sensing module plug connected to the sensing module connecting port. |
| US11920748B2 |
Flame effect device
A flame effect device (18) for a flame simulator apparatus of an electric fire (10) is provided. The flame effect device (18) comprises a spindle (20) having a longitudinal axis which is in-use rotatable in a flame simulator apparatus; and a plurality of reflector supports (22a,22b,22c,22d,22e), each reflector support (22a,22b,22c,22d,22e) comprising: a reflector support body (32) having at least one reflector mounting portion (28) thereon and a mounting aperture (34) to engage the reflector support (22a,22b,22c,22d,22e) with the spindle (20); and at least one reflector (26) to reflect light from an associated light source (24), wherein the at least one reflector (26) is mounted to the at least one reflector mounting portion (28), the plurality of reflector supports (22a,22b,22c,22d,22e) being engageable with the spindle (20), each reflector support (22a,22b,22c,22d,22e) of the plurality of reflector supports (22a,22b,22c,22d,22e) being selectably positionable along the longitudinal axis of the spindle (20). |
| US11920745B1 |
Lighting systems comprising connectable lighting devices
Lighting systems and connectable lighting devices enable size adjustment to an area illuminated by the lighting system. The connectable lighting system may include a plurality of lighting devices. A lighting device of the plurality of lighting devices may include a body defining a lighting side, a first sidewall positioned on a first side of the lighting side, and a second sidewall positioned on an opposite second side of the lighting side; at least one light emitting component configured to emit light through at least a portion of the lighting side; a first set of metal contacts at least partially embedded within the first sidewall of the body; and a second set of metal contacts at least partially embedded within the second sidewall of the body; and wherein at least one of: the first set of metal contacts are magnets or the second set of metal contacts are magnets. |
| US11920742B1 |
Bulb structure
The present disclosure provides a new bulb structure, including a bulb shell, a light source module and a power connection copper head. The light source module includes a light-emitting source inserted into the accommodation cavity of the bulb shell, and the light-emitting source is provided with a light source pin. The light source module further includes a PCB board, the PCB board is clamped into the upper end of the bulb shell, the light source pin is welded to the PCB board and the light source pin is electrically connected to the PCB board. The PCB board is welded with an extension pin, and the extension pin has one end electrically connected to the PCB board and the other end electrically connected to the power connection copper head. Through the above structural design, the present disclosure has advantages of novel structure design and simple preparation process. |
| US11920740B2 |
Centering ring for an LED retrofit for a vehicle light
A centering ring for an LED retrofit lamp is described. The lamp includes a ring-shaped body that includes an outer ring and an opening in a central region of the ring-shaped body that receives the LED retrofit lamp. The lamp also includes a recess formed in the outer rim of the ring-shaped body in at least two locations. |
| US11920737B2 |
Device and method for storing and for supplying fluid fuel
Device for storing and for supplying fluid fuel, comprising a reservoir of liquefied fuel gas in equilibrium with a gas phase, in particular hydrogen, a circuit for filling the reservoir, at least one circuit for tapping fluid from the reservoir, and at least one circuit for regulating the pressure in the reservoir, the filling circuit, tapping circuit and pressure-regulating circuit comprising a set of valves arranged in a housing separate from the reservoir, the housing being removably connected to the reservoir via a demountable mechanical coupling system, the tapping circuit, the pressure-regulating circuit and the filling circuit comprising a set of demountable fluidic connectors situated at the junction between the reservoir and the housing and configured to allow the separation between portions of circuits situated in the reservoir and in the housing during the demounting of the housing with respect to the reservoir. |
| US11920735B2 |
Method for thermally insulating an evacuable container
Method for thermal insulation of an evacuable container comprising an inner container, an outer container and a cavity disposed between the inner container and the outer container, wherein said method comprises a) using a vacuum pump to reduce a pressure in the cavity and after achieving a first value of the pressure interrupting the connection to the vacuum pump, b) subsequently making a connection from a reservoir container of the thermally insulating particulate material to a filling opening provided in the region of the cavity, c) setting the evacuable container into motion, wherein the thermally insulating particulate material flows into the cavity according to a) and the pressure in the cavity increases due to the air introduced with the thermally insulating particulate material, d) terminating the filling at a second value of the pressure by interrupting the connection from the cavity to the reservoir container, e) repeating step a), wherein the output of the vacuum pump with which the cavity is deaerated is controlled such that the profile over time of the mass flow exiting from the cavity of air introduced with the thermally insulating particulate material is at a maximum, f) subsequently repeating steps b)-e) up to the desired degree of filling and g) as the final step sealing the evacuated cavity. |
| US11920731B2 |
Distributor for a lubricant or fluid and a system with a distributor
A lubricant or fluid distributor may have a housing made in one piece and comprising an inner wall and an outer wall. The inner wall encloses an inlet chamber fluidly connected with an outside of the housing through a fluid inlet. A main chamber may be formed in between the outer wall and the inner wall, the main chamber fluidly connected with the inlet chamber and fluidly connected with the outside of the housing through one or more fluid outlets. A lubricant fitting member may be encapsulated within the inlet chamber. A system with the lubricant or fluid distributor may have a part to be lubricated. |
| US11920725B2 |
Calibration system and calibration support therefor
Disclosed are a calibration system (600a) and a calibration support (100a) therefor. The calibration support (100a) comprises: a base (10); a vertical frame assembly (20a), comprising a fixed vertical rod (22) and a movable vertical rod (24), wherein the fixed vertical rod (22) is mounted on the base (10), and the movable vertical rod (24) is capable of moving, within a preset range relative to the base (10), in the length direction of the fixed vertical rod (22); and a cross beam (30a), which is detachably mounted to one of a first mounting seat (35a) and a second mounting seat (36a) which are connected to the movable vertical rod (24), the cross beam (30a) being used for mounting a calibration element, and the calibration element being used for calibrating an advanced driver assistant system of a vehicle. The position of the first mounting seat (35a) is higher than the position of the second mounting seat (36a); and when moving relative to the base (10) in the length direction of the fixed vertical rod (22), the movable vertical rod (24) drives the first mounting seat (35a) and the second mounting seat (36a) to move relative to the base (10) in the length direction of the fixed vertical rod (22). |
| US11920723B2 |
Vacuum adiabatic body and refrigerator
A vacuum adiabatic body includes: a first plate member; a second plate member; a sealing part sealing the first plate member and the second plate member to provide a third space in a vacuum state; a supporting unit; a heat resistance unit for decreasing a heat transfer amount between the first plate member and the second plate member; and an exhaust port through which a gas in the third space is exhausted. The heat resistance unit includes a conductive resistance sheet capable of resisting heat conduction flowing along a wall for the third space, and a side frame fastened to the conductive resistance sheet to define at least one portion of the wall for the third space. Accordingly, a vacuum adiabatic body may be capable of resisting heat conduction. |
| US11920720B2 |
System and method for mitigating water hammer by looping surge pressure
A water hammer mitigation system includes a branch connection with ends coupled to a main pipeline, where a first end connects at a surge point on the main pipeline and a second end fluidly connects to the main pipeline at a distal point. A bi-directional surge relief device is disposed on the branch connection, and is operable to move to a first open configuration to permit pipeline fluid within the main pipeline to flow through the branch connection when surge point pressure reaches a designated pressure. The device can also move to a second open configuration when surge point pressure reaches another designated pressure. The device is closeable when surge point pressure is between the designated pressures. |
| US11920716B2 |
Fluid connector
A fluid connector, comprising a first connector body, a second connector body and a latching body which is configured to connect the first connector body to the second connector body, the latching body having a first non-destructively non-releasable latching device and a second non-destructively releasable latching device, the latching body being configured to be pushed both onto a radially outer side of the first connector body and onto a radially outer side of the second connector body. |
| US11920715B2 |
Quick connector with retainer and verifier
A coupling assembly includes a female quick connector and a male member, wherein the male member has a latching element, a sealing section and a tip, wherein the sealing section is disposed between the latching element and the tip. The quick connector includes a retainer having at least one retaining element. The male member is in a latching position if the latching element is latched onto the at least one retaining element. The quick connector includes a verifier which is axially movable along a verification path, wherein the verification path comprises at least one locking position and at least one releasing position. The verifier in the locking position limits a movement of a section of the retainer in radial direction, so that the retainer is not actuatable in the locking position but actuatable in the releasing position of the verifier. |
| US11920714B2 |
Sealing structure
A sealing structure includes an inner pipe, an outer pipe, and a sealing ring, where the outer pipe is detachably sleeved on the inner pipe, a slot for inserting a pipe is formed between an inner wall of the outer pipe and an outer wall of the inner pipe, and the outer wall of the inner pipe is provided with a sealing groove for placing the sealing ring; the sealing ring includes a main body provided with a lip; the sealing groove includes a first sealing groove and a second sealing groove, the first sealing groove and the second sealing groove are stepped; the bottom of the lip fits the bottom of the first sealing groove; and the bottom of the main body fits the bottom of the second sealing groove. |
| US11920713B2 |
Coupling
A coupling comprising a receiving element, a securing element, a retaining element and an insertion element, wherein the securing element is adapted to be displaceable between a release position and a locking position along a displacement axis, the securing element being adapted to engage the at least one retaining element in such a manner that a displacement of the securing element from the release position in the direction of the locking position is prevented, and wherein the insertion element is adapted to interact with the at least one retaining element upon insertion of the insertion element into the receiving space of the receiving element in such a way that a displacement of the securing element from the release position into the locking position is enabled. |
| US11920712B2 |
Shrink-fit collar
A shrink-fit ring, the two circumferential edges (10) of which are flanged, makes it possible to use thinner band thicknesses without the risk of buckling owing to its greater intrinsic strength. The circumferential edges (10) end in limbs (16) which point radially outwards and enclose an angle of approx. 70° to 90° with an unflanged centre portion (13) of the ring that is located axially further inwards. The flanging results in an extension of the diameter of the ring edges, wherein the ring edge regions (14) are bent outwards in a rounded manner and the edge surfaces (11) run at an angle of preferably approx. 0° to approx. 20° with respect to the ring axis (12). |
| US11920709B2 |
Expansion loop for copper piping system
An expansion loop for a piping system. The expansion loop has a first flexible conduit with a first end and a second end and a second flexible conduit with a first end and a second end. A first rigid conduit is connected between the first ends of the first and second flexible conduits. Additional rigid conduits are connected to both of the second ends of the flexible conduits. These additional rigid conduits include a stainless-steel elbow, a conversion conduit, and a copper conduit. The expansion loop may be installed wherein the flexible conduits are bent, when fluid flows, the flexible conduits straighten out and are not bent. |
| US11920702B2 |
Connecting element for a pipe arrangement and arrangement
A connecting element for a pipe arrangement, comprising a base body with at least one through channel, a receiving bore for receiving a pipe end of a pipe, wherein the receiving bore corresponds with the through channel, wherein the receiving bore has a larger cross section than the through channel, wherein a transition step is introduced into the base body between the through channel and the receiving bore, and an arrangement and a method for manufacturing an arrangement. |
| US11920696B2 |
Gate valve
A first opening and closing mechanism, which includes a first cam groove and a first cam roller and which causes a valve assembly to reciprocate between an intermediate position and a first closed position, and a second opening and closing mechanism, which includes a second cam groove and a second cam roller and which causes the valve assembly to reciprocate between the intermediate position and a second closed position, are provided so as to be operable separately, the first and second opening and closing mechanisms being disposed adjacent to each other in a thickness direction D of a gate valve. |
| US11920694B2 |
Antifreeze valve unit
An antifreeze valve unit has a valve body provided with at least one opening for the delivery of a fluid used in an air conditioning plant; this unit has a first thermostatic valve, fitted at a drain outlet to drain the fluid in function of the fluid temperature, and a second thermostatic valve fitted at the drain outlet to enable or prevent the drain of the fluid in function of the external environment temperature. This antifreeze valve unit operates reliably in any temperature condition of the inner fluid and of the external environment temperature, and enables the plant to be drained only if a real possibility of fluid freezing occurs. |
| US11920693B1 |
U motion gate valve
The present invention relates to a U Motion gate valve that maintains a tight seal on the outlet side when closing the valve through U Motion operation in the state that the tip and end of the main shaft are free ends using the principle of the class 3 lever. |
| US11920692B2 |
Slide valve and use of a slide valve
A slide valve for chemical and/or petrochemical plants, in particular of the round, oval or flat slide valve type, having a locking device (11) which is movable by a slide rod (12) into an open and closed position, and a drive which has an electric motor (13) for adjusting the slide rod (12), the locking device (11) having two lock plates (14, 15), between which a wedge arrangement (16) for pressing the lock plates (14, 15) against body seal seats (17) of the slide valve is arranged and connected to the slide rod (12), wherein the drive has a spindle drive (18) which is aligned with the slide rod (12) and connected thereto for transmitting an actuating force. |
| US11920689B2 |
Loose type pneumatic valve and loose type pneumatic valve module including the same
A loose type pneumatic valve and a loose type pneumatic valve module, the loose type pneumatic valve including a valve body including a pneumatic passage therein; a valve head on the valve body, the valve head being coupleable with an actuator; a stem on the valve head, the stem being configured to open and close the pneumatic passage; and at least one alignment socket on the valve head, the at least one alignment socket being configured to align the valve head with the actuator. |
| US11920685B2 |
Valve device
A valve device includes a rotation shaft, a valve body, and a biasing portion. The valve body is configured to be rotationally displaceable about the rotation shaft between a closed position and an open position. The biasing portion biases the valve body so as to cause the valve body to approach the closed position. The valve body includes an upstream wall arranged in a position upstream of the rotation shaft in a flow direction of the fluid when the valve body is in the closed position. The valve body includes a rotation end, which is an end distal from the rotation shaft and moves downstream in the flow direction of the fluid in response to a displacement of the valve body from the closed position to the open position, and the rotation end is shaped to project upstream when the valve body is in the closed position. |
| US11920684B1 |
Mechanically or hybrid mounted valve seat
A valve seat for use within a hydraulic fracturing pump includes a first portion including a strike face for interacting with a reciprocating component associated with the valve seat. The valve seat also includes a second portion having a recess to receive at least a portion of the first portion, the first portion being coupled to the second portion using a hybrid joining method that includes both a mechanical fastener to secure the first portion to the second portion and a joining process to secure the first portion to the second portion. |
| US11920678B1 |
Parking pawl pin bore support
A parking pawl assembly having a housing, a parking pawl having a pin bore, a support sleeve fitted in the pin bore, and a pivot pin inserted through the support sleeve. The pivot pin is attached to the housing, thus pivotally attaching the parking pawl to the housing. The parking pawl includes a first end and a second end spaced from the first end. The first end defines the pin bore having an interior bore surface. The support sleeve includes an exterior surface fitted to the interior bore surface of the parking pawl. The exterior surface of the support sleeve may include outer diameter rolled threads or other locking features. The interior bore surface of the parking pawl may include inner diameter rolled threads operable to receive the outer diameter rolled threads of the support sleeve. |
| US11920674B2 |
Shift device
In this shift device, in a case in which an external force has acted on a lever when an operating mechanism is causing the lever to pivot, a clutch mechanism permits rotation of a first detent plate with respect to a second detent plate, such that pivoting of the lever is permitted. Note that a restraining mechanism urges the lever toward a shift position. This enables to the restraining mechanism to urge the lever separately to the clutch mechanism, thereby enabling the degrees of freedom for setting a biasing load on the lever by the restraining mechanism to be increased. |
| US11920673B2 |
Electric drive apparatus
An electric drive apparatus includes a rotating electric machine and a transmission. The rotating electric machine includes a rotor, a stator and a first housing. The transmission includes a motive power transmitting unit, a second housing provided integrally with the first housing, and lubricating oil provided in the second housing to lubricate the motive power transmitting unit. The stator includes a stator coil that has first and second coil end parts respectively protruding from first and second axial end faces of a stator core. Each of phase windings of the stator coil has turn portions included in the first coil end part and joints included in the second coil end part. The second coil end part is located on the same axial side of the stator core as the transmission whereas the first coil end part is located on the opposite axial side of the stator core to the transmission. |
| US11920671B1 |
Lubrication system with a flow regulating floater container
A system and method for lubrication system are provided. The lubrication system includes a floater container including a floater compartment that contains a buoyant floater, where the floater container is coupled to a housing bulkhead and where the floater container includes an inlet opening in a first wall that is off-axis from a horizontal plane and forms an angle with a second wall. Further, the housing bulkhead includes an outlet opening positioned lower than the inlet opening and provides fluidic communication between the floater compartment and a rotating component compartment that contains a rotating component. |
| US11920669B2 |
Gearbox with bearing configuration for rail vehicle
The present disclosure provides a gearbox of a rail vehicle, which belongs to the technical field of gear transmission. The gearbox of the present disclosure comprises a driving shaft, a driven shaft, a first bearing seat and a second bearing seat; the gearbox further comprises: a first roller bearing, a ball bearing, a bearing inner retaining ring and a bearing outer retaining ring for drainage, which are arranged between the first bearing seat and the driving shaft; wherein, the bearing inner retaining ring and the bearing outer retaining ring are provided between the first roller bearing and the ball bearing along an axial direction of the driving shaft, and a first drainage channel is provided on the bearing outer retaining ring, a second drainage channel is provided on the first bearing seat; wherein, the lubricating oil can be guided into the first roller bearing and the ball bearing from the outside of the first bearing seat through the second drainage channel and the first drainage channel in sequence. The present disclosure can greatly improve the lubricating performance of the first roller bearing and the ball bearing on the driving shaft of the gearbox, and is particularly suitable for low-temperature working conditions. |
| US11920668B2 |
Systems and methods for implementing bulk metallic glass-based macroscale gears
Systems and methods in accordance with embodiments of the invention implement bulk metallic glass-based macroscale gears. In one embodiment, a method of fabricating a bulk metallic glass-based macroscale gear, where at least either the thickness of the gear is greater than 3 mm or the diameter of the gear is greater than 9 mm, includes: obtaining design parameters of the gear to be formed; selecting a bulk metallic glass from which the gear will be formed based on the obtained design parameters, where the selected bulk metallic glass is characterized by a resistance to standard modes of wear and a resistance to brittle fracture such that a gear can be formed from the selected bulk metallic glass that accords with the obtained design parameters; and fabricating the gear from the selected bulk metallic glass that accords with the obtained design parameters. |
| US11920667B2 |
Cam device, part manufacturing device, bearing manufacturing device, part manufacturing method, machine manufacturing method, and cam device miniaturization method
A cam device includes a cam, a cam roller, a rotary drive device, a linear motion guide device, and an action unit. A cam profile of the cam includes a rotary end at a circumferential one end, at which a camshaft is non-rotatable in a reverse direction by the cam roller, a cam surface from the rotary end to the circumferential other end, on which the cam roller is abuttable, and formed of a single CV curve from a vicinity of the rotary end to the circumferential other end of the cam surface, and a non-continuous section formed between the rotary end and the circumferential other end of the cam surface and not in contact with the cam roller. |
| US11920663B2 |
Drive unit
A drive unit includes a prime mover, a torque converter, and a torque converter casing. The torque converter is configured to amplify a torque generated by the prime mover. The torque converter is disposed to be rotatable. The torque converter casing is disposed to be non-rotatable. The torque converter casing accommodates the torque converter. The torque converter casing includes a first air intake port and a first air discharge port. The first air intake port is configured to draw air into the torque converter casing therethrough. The first air discharge port is configured to discharge the air inside the torque converter casing therethrough. The drive unit allows the torque converter to be cooled. |
| US11920650B2 |
Composite spacer for leaf spring suspension
A leaf spring vehicle suspension system includes a chassis rail and an axle. The suspension system also includes a first stage leaf spring. The suspension system further includes a second stage leaf spring. The suspension system yet further includes a third stage leaf spring operatively coupled at a first end and a second end to the chassis rail, wherein the first stage leaf spring is located below the third stage leaf spring and the second stage leaf spring is located below the first stage leaf spring. The suspension system also include a spacer in abutment with a leaf spring, wherein the spacer is formed of at least one composite material. |
| US11920648B2 |
Slip clutch device for an electric driving machine
A slip clutch device for an electric driving machine includes a rotation axis, an input side rotatable about the rotation axis, an output side rotatable about the rotation axis, and a slip clutch connecting the input side to the output side in a torque-limiting manner. The slip clutch includes an electrical insulation element for preventing an electrical disruptive discharge line between the input side and the output side, a friction disc, and a friction plate, pressed against the friction disc in a contact region in a frictionally engaged torque-transmitting manner. The friction disc or the friction plate is formed from an electrically insulating material in an insulation region extending radially over the contact region, and the insulation region is a bearing structure for radially transmitting torque. |
| US11920646B2 |
Method for operating a friction-locking shift element of a transmission, and control unit
A method for operating a friction-locking shift element of a transmission of a motor vehicle includes actuating the friction-locking shift element for engagement according to a pressure versus torque characteristic curve. The pressure versus torque characteristic curve has a first characteristic point (a touch point) and a second characteristic point (a contact point), defines a first characteristic curve range between the touch point and the contact point having a first functional dependence, and defines a second characteristic curve range at or after the contact point having a second functional dependence. Once the touch point is reached, the friction-locking shift element begins to transmit torque mainly due to drag torques. Whereas, once the contact point is reached, the friction-locking shift element begins to transmit torque mainly due to friction between shift-element halves of the friction-locking shift element. |
| US11920643B2 |
Two-way clutch assembly
The present invention discloses a clutch assembly which is comprised of (1) a cam plate which includes cams which are spaced about a central axis; (2) a rocker plate which includes at least one pocket, wherein the pocket includes a first rocker plate engagement surface and a second rocker plate engagement surface; and (3) at least one rocker which is pivotally situated within the pocket of the rocker plate, (4) a first solenoid, and (5) a second solenoid, wherein the solenoids can be activated or deactivated to allow for the clutch to be in a neutral position (to allow for free rotation in both clockwise and counterclockwise directions), to prevent rotation in a clockwise direction while allowing for free rotation in a counterclockwise direction, or to prevent rotation in a counterclockwise direction while allowing for free rotation in a clockwise direction. |
| US11920642B2 |
Roller freewheel unit for a vehicle
A roller freewheel unit for a vehicle includes an outer sleeve element, an inner ring element and a cage element for accommodating spring/roller elements. The inner ring element has at least one radially protruding sliding shoe element, which can be inserted into a corresponding receptacle of the cage element in the axial direction in order to interconnect the inner ring element and the cage element. The inner ring element may have multiple sliding shoe elements arranged on the circumference of the inner ring element, and the cage element may have correspondingly arranged receptacles. The outer sleeve element may be slid onto outer surfaces of the sliding shoe elements in such a manner that the outer sleeve element is centered and supported by the sliding shoe elements. |
| US11920638B2 |
Generator shaft assembly
A generator shaft assembly including a primary shaft, a disconnect shaft housed within the primary shaft, where a first end of the disconnect shaft is configured to couple with the primary mover and a second end of the disconnect shaft is configured to mate with the generator. A retainer ring housed within the primary shaft having at least a landing and a groove on an inner surface thereof and a retainer member positioned between the landing of the retainer ring and an outer surface of the disconnect shaft configured to limit axial motion of the disconnect shaft relative to the primary shaft. |
| US11920636B2 |
Sealing device
A sealing device is disposed between an inner member and an outer member of a rolling bearing that rotate relative to each other, and that acts to seal a gap between the inner member and the outer member. The sealing device includes an annular rigid part that is to be fixed to an inside of a hole of the outer member, the rigid part made from a rigid material; and an elastic part fixed to the rigid part, the elastic part made from an elastic material. The elastic part includes a seal lip having a truncated cone ring shape that is to be in slidable contact with the inner member or a member fixed to the inner member. Multiple bumps are formed on an inner peripheral surface of the seal lip, and are to be always in slidable contact with the inner member or the member fixed to the inner member. Clearances are provided between the seal lip and the inner member or the member fixed to the inner member in vicinities of the bumps. |
| US11920632B2 |
Endplay or preload settable lock nut
A lock nut is useable for setting a bearing to preload or endplay. A plurality of preload markings are circumferentially spaced apart on the nut. The distance between the preload marking corresponding to a preselected amount of preload applied or reduced on said bearing when the nut is (i) tightened to apply a preload force to said bearing or (ii) loosened to reduce a preload force on said bearing, respectively. A plurality of endplay markings are also circumferentially spaced apart on the nut. The distance between the endplay markings, corresponding to a preselected amount of endplay increased or reduced in said bearing when the nut is (i) tightened to reduce endplay on the bearing or (ii) loosened to increase endplay in said bearing. The use of endplay and preload markings enables setting of a bearing on an axle or spindle to either an endplay setting or a preload setting by adjusting the rotation of the lock nut according to the endplay markings or the preload markings, respectively. |
| US11920629B2 |
Method for fitting a snap fit arrangement and a corresponding fitting arrangement
A method is provided for fitting a snap fit arrangement, as well as a fitting arrangement for fitting the snap fit arrangement for joining a first part with a second part. The snap fit arrangement comprises an engagement hook which is arranged at the first part. The snap fit arrangement comprises a latch element which is arranged at the second part. When the snap fit arrangement closes, the engagement hook deforms elastically and engages into the latch element. In the method, an auxiliary tool is provided. The elastic deformation is caused in the engagement hook by means of the auxiliary tool. The first part is joined to the second part and retracting the auxiliary tool. Retracting causes a spring-back of the elastic deformation in the engagement hook. |
| US11920624B2 |
Zn-Ni as a coating layer on self-drilling screws of austenitic stainless steel
A self-drilling screw (10) having a head (20), a shaft (30) at least partially wearing a thread (35) and a drill point (40). The base material of the screw (10) including the drill point (40) is integrally manufactured from an austenitic 300 series steel with a surface hardness (uncoated) of 400-600 HV 0.3. The surface of the screw has a top coating of Zn—Ni with a Ni-content between 12-15% deposited on the austenitic base material. This self-drilling screw (10) is manufactured from a blank of raw austenite 300 series steel which is initially squeezed by cold forming to reduce its diameter in a first operation and, in following cold forming operations the head, the drill point and a thread are formed. |
| US11920623B2 |
Fastener assembly
A fastener assembly of the present disclosure includes a grommet including a head having a through-hole formed therein and at least one leg extending downward from the head; and a pin configured with a head and a shaft inserted into the grommet. The grommet and the pin are integrally formed by a connection tip. |
| US11920620B2 |
Connecting element
The invention relates to a connecting element for pressing into or embedding in a component, having a shank which extends along a longitudinal central axis of the connecting element, wherein the shank is provided with ribs extending in a radial direction with respect to the shank and wherein the shank has, at least partially, a polylobular cross section, wherein the periphery of the polylobular cross section is convexly curved along its entire length, is arranged between a circumscribed circle and an inscribed circle, and, as seen in the radial direction, has regions with a larger radius and regions with a smaller radius, wherein an angular position of the regions with a smaller radius and of the regions with a larger radius changes along the shank, as seen along the longitudinal central axis. |
| US11920617B2 |
Fluid systems and methods that address flow separation
Fluid systems and methods for addressing fluid separation are described. An example fluid system includes a main body and a fluid pressurizer. The main body has a first portion, a second portion, an injection opening, a suction opening, a channel that extends from the suction opening to the injection opening, and a side wall. The first portion has a first axis that extends along the side wall. The second portion has a second axis that extends along the side wall at an angle relative to the first axis such that when fluid flows over the main body flow separation is defined adjacent to the second portion. The injection opening is disposed at a first location relative to said flow separation. The suction opening is disposed at a second location relative to said flow separation. The channel extends from the suction opening to the injection opening. |
| US11920613B2 |
Tank, liquid circulation system and operating method
In at least one embodiment, the liquid circulation system comprises a rotor located within a tank, a stator having a plurality of coils outside the tank, and an exterior tank wall that is non-magnetic and that is located next to the rotor and between the rotor and the stator, wherein an axis (R) of rotation of the rotor is in parallel with the exterior tank wall, the coils of the stator are arranged along the axis (R) of rotation of the rotor so that the rotor is configured to be rotated by the stator in a touchless manner through the exterior tank wall by means of a varying electromagnetic field driven by the stator to circulate a liquid within the tank. |
| US11920606B2 |
Aircraft engine fuel pump
Fuel pump for an aircraft engine, comprising an inducer and a centrifugal impeller fixed together and having an axis of rotation, an annular space spacing axially the inducer and the impeller, and two contact portions between the inducer and the impeller disposed radially outside the annular space, a first plenum chamber and a second plenum chamber, in which the inducer and the impeller are spaced axially from each other, each being disposed between the two contact portions, the plenum chambers being symmetrical to each other with respect to the axis of rotation and in fluid communication with the annular space, the centrifugal impeller comprising a plurality of axial balancing holes distributed about the axis of rotation and opening out into the annular space at one end, and into a downstream space of the impeller at the other end. |
| US11920599B2 |
Thrust handling for electric submersible pumps
An electric submersible pump includes a plurality of centrifugal pump stages, each stage including a rotating impeller and a stationary diffuser mounted on a shaft coupled to a motor. An upthrust washer can be disposed axially between an impeller and its associated diffuser at or near a tip of the impeller, and the gap between the impeller tip and diffuser can define the end play or axial clearance for the pump. If the upthrust washer wears away, upthrust rubbing occurs at the impeller tip instead of proximate the pump shaft to advantageously help protect the shaft from damage or failure related to heat. In some ESPs, an upthrust bearing assembly can be located at the pump head. A downthrust washer can be disposed in an upstream facing groove of the impeller. The downthrust washer can have a thickness greater than 0.10 in. |
| US11920598B2 |
Coolant pump for a vehicle
A Pump for recirculating a cooling fluid of a vehicle comprises a pump body, which is fixed during use; an impeller mounted on a driven shaft; with a friction coupling of the electromagnetic type, made of a fixed electromagnet, a rotor and an armature. A pulley for taking up a rotational movement is connected to a movement source such as a shaft of the combustion engine of the vehicle and mounted on an outer bearing keyed onto the pump body. An electric motor is provided for driving the driven shaft independently of the movement take-up pulley; and a bell member is fastened to an end of the driven shaft opposite to that which carries the impeller.The friction coupling is designed to rotationally couple/decouple the pulley and bell member and the electric motor is arranged inside the bell member on the opposite side to the impeller relative to friction coupling. |
| US11920593B2 |
Compressor stop valve and associated system
A compressor system is provided that includes a contact cooled compressor and a coolant separator. The coolant separator is used to remove coolant fluid from a compressed flow stream produced by the contact cooled compressor during its operation. The coolant separator routes the removed coolant fluid back to the contact cooled compressor for further use. In some forms the coolant fluid is cooled prior to delivery back to the compressor. A stop valve can be provided in the coolant fluid return line to halt the flow of the fluid. A pressure sensitive member can be disposed to sense pressure of the coolant fluid that has been routed past the stop valve. Operation of the compressor can be changed as a result of the sensed pressure from the pressure sensitive member. Information from a temperature sensitive member can also be used to change operation of the compressor. |
| US11920592B2 |
Dry pump for gas and set of a plurality of dry pumps for gas
A dry pump for gases comprises a first rotor (1) comprising a first lobe portion (1A) and a first screw (1B), as well as a second rotor (2) comprising a second lobe portion (2A) and a second screw (2B). A casing delimits an internal volume in which are located together the first and second screws (1B, 2B) and the first and second lobe portions (1A, 2A). Each of the first and second screws (1B, 2B) comprises a threading invariable along its length. The first and second rotors (1, 2) turn in opposite directions and are located in successive configurations. In a first configuration of the rotors, the first and second lobe portions (1A, 2A), a portion of the first screw (1B), a portion of the second screw (2B) and the casing together delimit a chamber (30) which is closed. In a second configuration of the rotors, the chamber (30) has a smaller capacity than in the first configuration. In a third configuration of the rotors, the chamber (30) is displaced entirely at the first and second screws (1B, 2B) and isolated from the lobe portions. |
| US11920590B2 |
Scroll compressor
A scroll compressor is provided that may include an orbiting scroll having an orbiting wrap, and which performs an orbiting motion; and a fixed scroll having a fixed wrap to form a compression chamber including a suction chamber, an intermediate pressure chamber, and a discharge chamber, by being engaged with the orbiting wrap. In a state in which the orbiting scroll and the fixed scroll are concentric with each other, when a distance between the orbiting wrap and the fixed wrap is defined as an orbiting radius, there exists an offset section having an interval larger than the orbiting radius, between a side surface of the orbiting wrap and a side surface of the fixed wrap which faces the orbiting wrap. With such a configuration, even if the fixed scroll or the orbiting scroll is transformed due to thermal expansion, interference between the fixed wrap and the orbiting wrap at a portion having a large transformation amount may be prevented. This may prevent a frictional loss or abrasion between the fixed wrap and the orbiting wrap. Further, this may restrict or minimize a gap between the fixed wrap and the orbiting wrap at an opposite side to the suction chamber, resulting in enhanced compression efficiency. |
| US11920586B2 |
Fixing device of motor of air compressor
An air compressor is received in an accommodation box and contains a body, a cylinder, a motor, and a transmission mechanism. The body includes a first positioning orifice and a second positioning orifice. The cylinder is connected on the body and communicates with an air storage holder. The motor is fixed on the body, a small gear is received in the first positioning orifice, and a connection seat is accommodated in the first orifice. The transmission mechanism actuates a piston to move in the cylinder reciprocately so as to produce compressed air. The motor includes at least one locking extension for engaging the motor with the body. A first end of a respective one locking extension extends from the motor, and a second end of the respective one locking extension is engaged on the body, hence the motor is fixed on the body securely without using any screws. |
| US11920576B2 |
Cryopump and method of monitoring cryopump
A cryopump includes an accommodation space for a condensed layer of gas, a first-stage cryopanel having an inner surface of the first-stage cryopanel disposed so as to surround the accommodation space, and a second-stage cryopanel disposed so as to be surrounded by the inner surface of the first-stage cryopanel together with the accommodation space. A first-stage heat load is incident on the inner surface of the first-stage cryopanel from outside the cryopump through an intake port, and the gas enters the accommodation space from outside the cryopump. The first-stage cryopanel is cooled to a temperature higher than a condensation temperature of the gas, the second-stage cryopanel is cooled to a temperature of the condensation temperature or less, and the condensed layer is deposited. The cryopump monitors the amount of condensed gas in the accommodation space based on a change in the first-stage heat load. |
| US11920573B2 |
Pressure exchanger
A pressure exchanger (1) including a housing (2), a drive shaft (3) and a cylinder drum (4) rotatably arranged in the housing (2) is described, the cylinder drum (4) including two front faces and at least one cylinder (5) between the front faces, wherein the housing (2) includes a port flange (7, 8) at each end of the cylinder drum (4) and at least at one end of the cylinder drum (4) a pressure shoe (18) is arranged between the cylinder drum (4) and the port flange of this end. Such a pressure exchanger should be operated in a cost-effective manner. To this end an adjustable stop arrangement (19) is arranged between the pressure shoe (18) and the cylinder drum (4). |
| US11920570B1 |
Enhanced ocean thermal energy conversion (EOTEC) system
An improved Ocean Thermal Energy Conversion system (called OTEC) is presented herein by the addition of a closed heat transfer loop. In conventional OTEC, warm surface waters are used to vaporize a working fluid for use in a turbine, and cold waters are then brought up from deep water, typically more than 1000 meters, to condense the working fluid. In simple terms conventional OTEC brings the cooling potential up to the warm surface. The disclosed OTEC system brings the heat down to the deep cold waters by using a separate heat transfer fluid loop. We refer to this as Enhanced OTEC or E-OTEC. A key feature of the process is descending to the depths as a dense fluid and returning to the surface as a much lower density fluid, thereby gaining a gravitational boost in pressure and temperature. This leads to several technological, performance, and economic advantages over prior art. |
| US11920569B2 |
Energy storage and delivery system with an elevator lift system and method of operating the same
An energy storage and delivery system includes an elevator operable to move blocks from a lower elevation to a higher elevation to store energy and from a higher elevation to a lower elevation to generate electricity. A winch assembly is movably coupled to a cable that is coupled to the elevator. The winch assembly has planetary gear assemblies, brakes that selectively engage at least a portion of the planetary gear assemblies, and a spool coupled to the cable. A drive shaft extends between a motor-generator and the winch assembly. A brake is operable so that the spool rotates to reel-in the cable to raise the elevator to move a block from a lower elevation to a higher elevation to store energy or so that the spool rotates to reel-out the cable to lower the elevator to move a block from a higher elevation to a lower elevation to generate electricity. |
| US11920567B2 |
Rotor bearing housing, rotor bearing arrangement and wind turbine
A rotor bearing housing for a wind turbine has: a bearing body for receiving a rotor shaft of the wind turbine, a support body arranged under the bearing body and configured to be coupled at a first end to a base element in order to transmit a force flow between the bearing body and the base element. The base element is arrangeable under the support body for the purposes of rotatable fastening to a first end of a tower of the wind turbine, the bearing body and the support body together forming a single-piece body, and the bearing body and the support body being configured such that, if a geometrical central point of the first receptacle for a rotor bearing is projected onto a cross-sectional plane of the first end of the tower, the geometrical central point is arranged outside a diameter of the tower at the first end. |
| US11920562B2 |
Temperature estimation in a wind turbine
A method of estimating a temperature of a component of a wind turbine is provided, comprising, during a calibration period, receiving measurements of the temperature of the component and of one or more corresponding operational parameter; and calculating, using the measurements coefficients of a model of the temperature of the component. The model relates temperature at a current time to a temperature a preceding time, Tn−1. The model is segregated into separate bins based on wind speed or power generated by the wind turbine. The method further comprises using the model to estimate a temperature of the wind turbine. |
| US11920560B2 |
Transmission gearing for a wind power plant or an electric drive for vehicles
A transmission gearing includes a sun gear, a planetary unit and a high speed unit. The sun gear is mounted on a slowly rotating gear shaft. The planetary unit includes a planetary toothed gear wheel and a planetary shaft gear wheel, which are both mounted on a planetary shaft. The planetary shaft gear wheel has a diameter that is larger than that of the planetary toothed gear wheel and smaller than that of the sun gear. The planetary toothed gear wheel engages the sun gear. The high speed unit includes a quickly rotating gear shaft on which a high speed shaft gear is mounted. The high speed shaft gear has a diameter that is smaller than that of the planetary shaft gear wheel. A drive belt engages both the planetary shaft gear wheel and the high speed shaft gear. The slowly rotating gear shaft is parallel to the planetary shaft. |
| US11920559B2 |
Floating platform for high-power wind turbines
A floating platform for high-power wind turbines, comprising a concrete substructure, said concrete substructure forming the base of the platform, which remains semi-submerged in the operating position, and consisting of a square lower slab on which a series of beams and five hollow reinforced concrete cylinders are constructed, distributed at the corners and the center of said lower slab; a metal superstructure supported on the concrete substructure and forming the base for connection with the wind turbine tower, said tower being coupled at the center thereof; and metal covers covering each of the cylinders, on which the metal superstructure is supported and to which vertical pillars are secured, linked together by beams, which join at the central pillar by an element whereon the base of the wind turbine tower is secured. |
| US11920558B2 |
Rotor blade and method for assembly of a rotor blade
Rotor blade for a wind power plant. The rotor blade includes a plurality of curved laminated wooden modules attached to each other, where each curved laminated wooden module includes a plurality of laminated veneer lumber boards. Each curved laminated wooden module is curved in at least one direction, where each laminated veneer lumber board includes a first set of veneer plies, where the first set of veneer plies includes a plurality of veneer plies and where the wood grain is directed in a first direction, and a second set of veneer plies, where the second set of veneer plies includes a single veneer ply or several veneer plies arranged adjacent each other and where the direction of wood grain differs from the first direction. Beneficially, the rotor blade including curved laminated wooden modules can be obtained in an easy and cost-effective way. The rotor blade is further environmental friendly. |
| US11920557B2 |
Heating a wind turbine blade
A first aspect of the invention provides a wind turbine blade having a blade shell that defines a suction side, pressure side, leading edge, and a trailing edge of the blade. The blade further comprises a blade heating system comprising one or more heating elements configured to heat the blade in first and second heating areas, wherein the first heating area is closer to the leading edge than the second heating area is, and the heating system is configured to generate heat fluxes in the first and second heating areas such that the heat flux generated in the first heating area is lower than the heat flux generated in the second heating area. |
| US11920550B2 |
Solution mined cavity system
A solution mined cavity system and method are disclosed. The system comprises an underground cavity created by solution mining in salt deposits, an upper water reservoir, tubing structure adapted to lead water from the upper water reservoir into the underground cavity and out of the underground cavity, and a pumping device adapted to contribute to pumping water from the upper water reservoir via the tubing structure out of the cavity. |
| US11920549B2 |
Engine control method and engine control device
The control device (50) operates to: calculate the ignition timing of each cylinder (101) of an engine (100) based on whether or not knocking is occurring; set, as a reference ignition timing, the ignition timing of any of the cylinders (101) for which the ignition timing is on the advanced angle side relative to the most retarded angle ignition timing on the most retarded angle side and on the retarded angle side relative to the most advanced angle ignition timing on the most advanced angle side; set an allowable timing difference range that is a range of an allowable timing difference with reference to the reference ignition timing; and when determining that the ignition timing of a cylinder (101) falls outside the allowable timing difference range, correct the ignition timing so that the timing difference with respect to the reference ignition timing falls within the allowable timing difference range. |
| US11920548B2 |
Tip over engine lockout system
A system for preventing an engine included in a work machine from restarting, after the work machine is tipped over. A sensor included in the work machine is configured to detect a tipping incident. If a tipping incident is detected, the sensor sends out a signal configured to shut down the engine and a tilt signal configured to prevent the engine from restarting. The engine is only restarted if certain steps are undertaken by an operator and a reset switch is activated. |
| US11920545B2 |
Internal combustion engine with intake manifold injection, in particular hydrogen combustion engine with intake injection
An internal combustion engine has an intake manifold injection, at least two combustion chambers, at least one central rail for supplying fuel for the intake manifold injection, and at least one air distributor for supplying air to the individual combustion chambers. The central rail is attached to the air distributor, or the central rail and the air distributor are formed as an integral component. |
| US11920537B2 |
System and method for determining and adjusting fuel injection control parameters
A method of controlling an engine system includes controlling a fuel injector to perform a zero-fueling injector operation during operation of the engine, the zero-fueling injector operation including a non-zero injector on-time resulting in zero fueling by the injector, determining an injection system pressure change associated with the zero-fueling injector operation, modifying at least one fuel injection control parameter in response to the injection system pressure change, and using the modified fuel injection control parameter to control injection of fuel by the fuel injector during operation of the engine. |
| US11920536B1 |
Fuel pump with electronic controlled pressure regulation and failure mitigation
A fuel pump system for aircraft includes an auxiliary fuel pump in-line with the primary pump, and an electric motor driving the auxiliary fuel pump at an operational motor speed. The system includes an electric control circuit (ECC) and a pressure sensor to regulate the speed of the electric motor based on the output pressure from the sensor to maintain a constant predetermined output pressure. The system may have additional fault mitigation circuitry configured to automatically switch from a processor-controlled to a fixed voltage as a source of power driving the electric motor at either a regulated speed or a constant fixed speed, respectively. The system may include a switch having user-selectable operational modes, including ECC-controlled mode and a high boost mode selectable if the ECC fails. In high boost mode, the ECC is bypassed to drive the electric motor at a fixed safe speed. |
| US11920535B2 |
Apparatuses, methods, systems, and techniques of misfire detection using engine speed sensor
A system includes a reciprocating piston engine configured to output torque to drive a load. The system includes an engine speed sensor operatively coupled with the engine and configured to output an engine speed signal. The system includes an electronic control system operatively coupled with the powertrain. The electronic control system is configured to determine an engine acceleration in response to the engine speed signal, and detect a misfire of the engine in response to the engine acceleration. |
| US11920534B2 |
Controller and method for controlling vehicle
A CPU is configured to executes a filter regeneration process, a firing process, and a stopping process. The CPU is configured to stop rotation of a crankshaft of an internal combustion engine mounted on a vehicle on the condition that the vehicle is decelerating after termination of the firing process in the stopping process. |
| US11920532B2 |
Exhaust gas control apparatus for internal combustion engine and exhaust gas control method for the same
An exhaust gas control apparatus for an internal combustion engine includes: a catalyst which is capable of storing oxygen; a downstream air-fuel ratio sensor that detects the air-fuel ratio of outgoing exhaust gas flowing out of the catalyst; an air-fuel ratio control unit that controls the air-fuel ratio of incoming exhaust gas flowing into the catalyst; and a catalyst state estimation unit that estimates the activity of the catalyst. The air-fuel ratio control unit controls the air-fuel ratio of the incoming exhaust gas so that the air-fuel ratio of the outgoing exhaust gas detected by the downstream air-fuel ratio sensor is maintained at a target air-fuel ratio. The air-fuel ratio control unit sets the target air-fuel ratio to a richer value when the activity of the catalyst is equal to or higher than a predetermined value than when the activity of the catalyst is lower than the predetermined value. |
| US11920531B2 |
Method of determining engine torque
A method of controlling a vehicle engine comprising estimating a value for the actual engine torque, comparing this with a further calculated (expected) torque value, and controlling the engine consequent to said comparing, the value for the actual engine torque being determined from the following steps: ⋅a) from a crankshaft signal, providing a plot or signal indicative of instantaneous crankshaft speed; ⋅b) differentiating said plot or signal indicative of instantaneous crankshaft speed with respect to time to determine acceleration values; ⋅c) within a crankshaft/time interval, determining a maximum and a minimum acceleration value from step b); ⋅d) determining the difference between said maximum and minimum acceleration values; ⋅e) determining a torque value dependent on said difference from step d). |
| US11920530B2 |
Delaying cylinder reactivation
A method for delaying cylinder reactivation in a vehicle includes identifying, by a controller, a request to exit a cylinder deactivation state. The controller determines if the request is due to a transient condition. If the request is due to the transient condition, the controller analyzes at least one of the transient condition and a condition of the vehicle. The controller determines a first adjustment to the vehicle based on analyzing at least one of the transient condition and the condition of the vehicle. The first adjustment is configured to mitigate the transient condition. The controller implements the first adjustment. |
| US11920529B2 |
Control method and control apparatus for internal combustion engine
A first output limit value is determined as an intersection point of a knock-limit output line which is set according to an exhaust gas recirculation rate and ignition timing and an exhaust-temperature-limit output line which is set according to the exhaust gas recirculation rate and ignition timing; a second output limit value is determined as an intersection point of the knock-limit output line and an air-quantity-limit output line which is set according to the exhaust gas recirculation rate, ignition timing and atmospheric pressure; and a third output limit value is determined as an intersection point of the knock-limit output line and a thermal-management-limit output line which is set according to the exhaust gas recirculation rate, ignition timing and vehicle running speed. A value of the exhaust gas recirculation rate at which the condition “P1≥P2 or P1≥P3” is satisfied is set as a target exhaust gas recirculation rate. |
| US11920525B2 |
Liquid and hydrogen/methane fuel injector
Fuel injectors for gas turbine engines include an inner housing having a center body installed within the inner housing, an intermediate housing arranged radially outward from the inner housing, and an outer housing arranged radially outward from the intermediate housing. The center body is a hollow body structure defining a center body airflow passage therethrough, a first fluid passage is partially defined between an outer surface of the inner housing and an inner surface of the intermediate housing, a second fluid passage is partially defined within the intermediate housing, and a third fluid passage comprises the center body airflow passage, an inner airflow passage defined between an exterior surface of the center body and an interior surface of the inner housing, and an outer airflow passage that is defined by the outer housing and radially outward from the intermediate housing. |
| US11920519B2 |
Fire resistance device designed to be placed between one end of a mounting strut for an aircraft turbomachine and a cowling of the turbomachine delimiting an inter-flow compartment
A fire resistance device intended to be placed between a mounting strut of a double-flow aircraft turbomachine and a connecting cowling equipping this turbomachine, the connecting cowling being intended to connect an upstream ring delimiting an inter-flow compartment, to an arm that extends radially across a secondary flow of the turbomachine. The device includes two contacting lips extending along different lines, of which a first lip with a C-shaped section is integrated within a contact structure, and a second lip including at its end a protruding blocking portion protecting the contact structure. |
| US11920514B1 |
Gas turbine operation
A gas turbine engine including a fuel delivery system arranged to provide fuel; a combustor arranged to combust at least a proportion of the fuel; a primary fuel-oil heat exchanger arranged to have up to 100% of the fuel provided by the fuel delivery system flow therethrough; and a secondary fuel-oil heat exchanger arranged to have a proportion of the fuel from the primary fuel-oil heat exchanger flow therethrough. Fuel is arranged to flow from the primary fuel-oil heat exchanger to the secondary fuel-oil heat exchanger whereas oil is arranged to flow from the secondary fuel-oil heat exchanger to the primary fuel-oil heat exchanger. The method includes using at least one of the primary fuel-oil heat exchanger and the secondary fuel-oil heat exchanger to heat the fuel so as to adjust the fuel viscosity to a maximum of 0.58 mm2/s on entry to the combustor at cruise conditions. |
| US11920512B2 |
Powerplant and related control system and method
A hydrogen fueled powerplant including an internal combustion engine that drives a motor-generator, and has a two-stage turbocharger, for an aircraft. A control system controls the operation of the motor-generator to maintain the engine at a speed selected based on controlling the engine equivalence ratio. The control system controls an afterburner, an intercooler and an aftercooler to maximize powerplant efficiency. The afterburner also adds power to the turbochargers during high-altitude restarts. The turbochargers also include motor-generators that extract excess power from the exhaust. |
| US11920505B2 |
Heat exchange module
A heat exchange module including a corrugated top heat exchange substrate and a corrugated bottom heat exchange substrate, and tubes that extend in a width direction (W) between the top and bottom substrates in heat exchanging contact with ridges of the substrates. A top and a bottom casing member contacts the substrates and each has a transverse side wall with slits oriented in the transverse direction (T) and accommodating the tubes. The side walls of the top and bottom casing members overlap and are mutually connected by soldering or brazing. |
| US11920504B2 |
Scalable greenhouse gas capture systems and methods
Scalable greenhouse gas capture systems and methods to allow a user to off-load exhaust captured in an on-board vehicle exhaust capture device and to allow for a delivery vehicle or other transportation mechanism to obtain and transport the exhaust. The systems and methods may involve one or more exhaust pumps, each with an exhaust nozzle corresponding to a vehicle exhaust port. Upon engagement with the vehicle exhaust port, the exhaust nozzle may create an air-tight seal between the exhaust nozzle and the vehicle exhaust port. A first pipe may be configured to transport captured exhaust therethrough from the exhaust nozzle to. The captured exhaust may be at least temporarily stored in an exhaust holding tank connected to and in fluid communication with the first pipe. |
| US11920497B2 |
Ceramic component
A ceramic matrix composite includes a plurality of ceramic fibers and an interface coating disposed on the plurality of ceramic fibers. The interface coating includes a carbon-based layer disposed on each ceramic fiber of the plurality of ceramic fibers and a boron-nitride based layer disposed on the first carbon-based layer. The ceramic matrix composite also includes a ceramic matrix surrounding the plurality of ceramic fibers. A ceramic matrix composite and a method of forming a ceramic matrix composite component are also disclosed. |
| US11920496B1 |
Airfoil, and turbine blade and gas turbine including the same
Disclosed herein are an airfoil, and a turbine blade and gas turbine including the same. The airfoil includes a first cooling passage allowing a first cooling fluid introduced from the bottom of a leading edge to flow into a first serpentine channel formed on a pressure side, and to be then discharged to the rear of a trailing edge, and a second cooling passage allowing a second cooling fluid introduced from the bottom of a suction side to be divided and flow into at least two second serpentine channels formed on the suction side, and allowing the divided cooling fluids introduced into the at least two second serpentine channels to be joined at the bottom thereof and to be then discharged to the rear of the trailing edge. |
| US11920492B1 |
Asymmetric spacer to improve flange strength
A mounting assembly is provided. The mounting assembly includes a first flange; a second flange; a first asymmetric spacer; a second asymmetric spacer; and a bolt configured to pass through a void of the first asymmetric spacer starting at a first end, through at least one first opening of the first flange, through at least one second opening of the second flange, through a void of the second asymmetric spacer starting at a second end, and to be coupled to a nut, such that, in response to the nut being fastened to the bolt, the bolt bends due to a non-vertical slope of the first asymmetric spacer and a non-vertical slope of the second asymmetric spacer. |
| US11920477B2 |
Ceramic matrix composite-based seal
A seal includes a ceramic matrix composite ply having woven ceramic-based fibers in a ceramic-based matrix. The ceramic matrix composite ply has at least one bend formed about a bend axis and defines at least one rounded portion. A sealed assembly and a method of making a seal are also disclosed. |
| US11920474B2 |
Protecting trolley and construction method of rock burst prewarning protection system in non-contact tunnel construction
Provided are a protecting trolley and a construction method of rock burst prewarning protection system in non-contact tunnel construction. The protecting trolley includes a framework, a walking assembly, a rockfall buffering assembly, a spraying assembly and a rock burst prewarning system. The rockfall buffering assembly includes an arch frame in a fixed connection with the framework and a protecting net fixed on the arch frame. The spraying assembly includes a track car in connection with the rockfall buffering assembly and a spraying hose fixed on the track car, and the spraying hose sprays towards the surrounding rock. The rock burst prewarning assembly includes a thermosensitive infrared sensor used for detecting the temperature of the surrounding rock and a highly sensitive laser sensor used for detecting the deformation of the surrounding rock. |
| US11920472B2 |
Reasonable millisecond time control method for excavation blasting of tunnel
A reasonable millisecond time control method for excavation blasting of a tunnel is provided, and includes: acquiring physical mechanical parameters to establish a millisecond blasting model, and designing four dimensions blasting parameters of explosive quantity, hole number, inter-hole millisecond and inter-row millisecond; simulating, based on the millisecond blasting model, a blasting process of an explosive package using blasting parameters to obtain a blasting vibration curve; obtaining single-hole blasting vibration waveforms, solving a vibration synthesis curve through a vibration synthesis theory; comparing the vibration synthesis curve with the blasting vibration curve to obtain a coupling relationship of blasting parameters; determining a target group of explosive quantity and hole numbers, determining a target millisecond through the coupling relationship of blasting parameters, and relating a millisecond blasting control strategy to control, and it is used for tunneling project to reduce cut blasting vibration intensity and achieve precise and intelligent control of millisecond blasting. |
| US11920470B2 |
Straddle seat pit launch directional drill
Disclosed are small model pit launch horizontal direction drills suitable for drilling a substantially horizontal bore hole and laying pipe underground from within a surface dug pit. The devices comprise a stationary frame and a carriage component competent to move forward and back along the frame and drill and retrieve an attached drill stem through an aperture in the frame. The carriage components are configured to allow an operator to straddle the carriage and operate the device from a seated position within the frame component interior. |
| US11920468B2 |
Real time downhole water chemistry and uses
Method of monitoring produced water at each perforation or entry point by real time ion sensor deployed downhole to measure the content of water soluble ions. Methods of determining and differentiating nature of water breakthrough in oil production; such as between cycled injection water through a void space conduit, matrix swept injection water and formation water, especially as relates to offshore oil production. Real time ion sensors are deployed and when compared with known standards are used to monitor and remediate water breakthrough, prevent scale deposition, and the like. |
| US11920467B2 |
Minimization of drill string rotation rate effect on acoustic signal of drill sound
Systems and methods include a computer-implemented method for determining normalized apparent power. Drilling acoustic signals corresponding to a time domain and generated during drilling of a well. A fast Fourier transformation (FFT) is performed using the drilling acoustic signals to generate FFT data. Normalized FFT data is generated using normalization parameters and a drill string rotation rate record of a drill string used to drill the well. The drill string rotation rate is received during drilling. Normalized apparent power is determined from data points of a predetermined top percentage of the normalized FFT data within a lithological significant frequency range. The normalized apparent power is a measure of the power of the drilling acoustic signals and it is a function of the amplitude and frequency of the normalized FFT data. The lithological significant frequency range is a frequency range within which the drill sounds are more closely related with lithology. |
| US11920462B2 |
Water breakthrough in hydrocarbon wellbores
Disclosed are methods, systems, and computer-readable medium to perform operations including: generating, based on production data for a wellbore, (i) a water-oil-ratio with respect to time (WOR) dataset for the wellbore, (ii) a time-derivative dataset (WOR′) of the WOR dataset; generating a WOR log-log plot of the WOR dataset and a WOR′ log-log plot of the WOR′ dataset; identifying at least one trend in the WOR log-log plot and the WOR′ log-log plot; determining, based on the at least one identified trend, a first type of water breakthrough; generating, based on pressure data from a build-up pressure test in the wellbore, a log-log plot of time-derivative pressure data with respect to time (P′); determining, based on the P′ log-log plot, a second type of water breakthrough; correlating the first and second type of water breakthrough; and determining, based on the correlation, whether to perform a water treatment for the wellbore. |
| US11920461B2 |
Determining pressure in subterranean formations
A method for determining a pressure profile in a subterranean formation is described. The method includes drilling a wellbore in the subterranean formation; lowering a logging tool into the wellbore to measure resistivity values as a function of depth along the wellbore; identifying a plurality of porous zones from the wellbore based on petrophysical logs; converting the measured resistivity values to an amount of total dissolved solids for each of the plurality of identified porous zones; converting the amount of total dissolved solids to a pore fluid density; calculating a pressure based on a sum of the pore fluid densities derived along a length of the well; and generating a depth-based pressure profile. |
| US11920458B2 |
Window core for gamma ray detection in a downhole tool
A downhole tool includes a window cap located in a cover that is positioned between an electromagnetic radiation detector in the downhole tool and a geological formation into which a borehole is formed and where the downhole tool is to be positioned. The electromagnetic radiation detector is to detect an electromagnetic radiation from the geological formation. The downhole tool includes a window core positioned behind the window cap relative to an external environment of the downhole tool, wherein the window core is positioned between the window cap and the electromagnetic radiation detector. |
| US11920452B1 |
Downhole sand separator
A downhole separator separates solids from an inflow of downhole fluid resulting in a cleansed fluid which is directed to the intake of a subsurface pump. The downhole separator has a separator unit which has a sleeve member with a liner member disposed within the sleeve member, the liner member having an exterior surface immediately adjacent the inner surface of the sleeve member. The sleeve member has an opening which is aligned with an opening in the sleeve liner to form an inlet. A vortex guide is disposed inside an inner surface of the liner member. The vortex guide has a helical exterior which is in engaging contact of the inner surface, wherein a single helical passage is formed which extends from the inlet to a second end of the vortex guide. |
| US11920448B2 |
Apparatus and methods for electromagnetic heating of hydrocarbon formations
An apparatus and method for electromagnetic heating of a hydrocarbon formation. The method involves providing electrical power to at least one electromagnetic wave generator for generating high frequency alternating current; using the electromagnetic wave generator to generate high frequency alternating current; using at least one pipe to define at least one of at least two transmission line conductors; coupling the transmission line conductors to the electromagnetic wave generator; and applying the high frequency alternating current to excite the transmission line conductors. The excitation of the transmission line conductors can propagate an electromagnetic wave within the hydrocarbon formation. In some embodiments, the method further comprises determining that a hydrocarbon formation between the transmission line conductors is at least substantially desiccated; and applying a radiofrequency electromagnetic current to excite the transmission line conductors. The radiofrequency electromagnetic current radiates to a hydrocarbon formation surrounding the transmission line conductors. |
| US11920445B2 |
Well injection and production methods, apparatus and systems
A method and system for enhancing petroleum production are provided, in which a fracturing operation can be conducted in a formation through a string and then petroleum is displaced from the fractured formation by selectively injecting fluid into selected fractures in the formation while other non-selected fractures remain without fluid injection. The injected fluid flows out into the fractured formation and enhances recovery from the non-selected fractures. Petroleum is selectively collected from the non-selected fractures. |
| US11920442B2 |
Select fire switch form factor system and method
A wellbore select fire switch retaining member system and method with an integrated through wire and ground wire in a switch sub. The system/method includes a retaining member that has a form factor acceptable by a conventional switch sub. The retaining member incorporates an electrical connection to the center pin of a pressure switch. The system further includes a secondary piston aligned with a piston in the switch (switch piston) so that external pressure is fully acted upon the entire switch piston creating a reliable switch connection. Another system includes an integrated retaining member and switch module having a form factor compatible with existing switch subs. The integrated module inputs include a ground wire and a through wire and the outputs include a ground wire, through wire and an arming wire. |
| US11920441B2 |
Steering a wellbore using stratigraphic misfit heat maps
Systems and methods for using stratigraphic heat maps to steer a well being drilled. Data from one or more offset wells can be provided to a computer system and used with data from a well being drilled to generate one or more stratigraphic heat maps during the drilling of the subject well. The stratigraphic heat maps can be displayed and used to determine the location of the wellbore relative to one or more geological formations, including one or more target formations or within a target formation. Based on the use of the heat maps and the location of the wellbore relative to a target, the drill plan can be adjusted or updated and/or one or more drilling parameters or operations may be adjusted to drill the wellbore, such as to drill the wellbore to the target or to maximize the length of the wellbore within a target zone. |
| US11920440B2 |
Well-based potential energy conversion systems and methods
Potential energy conversion systems include a movable mass suspended by a line in a non-producing well, the line being coupled to a motor operable to lift the movable mass, and a generator operable to produce electricity when lowering the movable mass. Energy conversion methods include providing the potential energy conversion system; and storing potential energy by raising the movable mass, or releasing potential energy and converting the potential energy to electricity by lowering the movable mass. |
| US11920438B2 |
Intelligent power management system
A method may include obtaining, from a digital drilling program and by a drilling management network, a drilling operation sequence of the drilling rig. The drilling management network is coupled to a drilling rig, rig equipment, and various electric power generators. The method may further include determining, by the drilling management network, a power management sequence that matches an electric power capacity of the drilling rig to an electric power consumption of the rig equipment. The method may further include executing, by the drilling management network, the power management sequence to the rig equipment and the electric power generators. |
| US11920436B2 |
Differential fill valve and float collar with two deactivation sleeves
A downhole tool can be used as a fill valve to circulate a fluid, such as a spacer fluid, through the tool. The tool can include a top and bottom flapper valve and an inner and outer sliding sleeve. The sliding sleeves can be shifted together to allow the top flapper valve to close. Continued shifting of the inner sleeve can cause the bottom flapper valve to close. A cementing operation can then be performed through the tool. Sealing elements can be located between the outside of the inner sleeve and inside of the outer sleeve. Sealing elements can also be located between the outside of the outer sleeve and the inside of a tool mandrel. The sealing elements can prevent debris from becoming lodged within the tool. |
| US11920434B2 |
Downhole apparatus with a valve arrangement
A method comprising operating a first valve arrangement and a second valve arrangement from a locked first configuration, in which the first port is closed and the second port is closed, to a locked second configuration, in which the first port is open and the second port is closed, wherein the first valve arrangement comprises one or more locking devices configured to lock a first valve member of the first valve arrangement in place relative to the tubular body. The method comprising operating the first valve arrangement and the second valve arrangement from the locked second configuration to a third configuration, in which the first port is closed and the second port is open. |
| US11920433B2 |
Downhole apparatus with a valve arrangement
A valve arrangement is for a downhole apparatus having a tubular body having first and second ports in a wall thereof. The valve arrangement comprises a first valve arrangement associated with the first port and comprising a first valve; and a second valve arrangement associated with the second port comprising a second valve. The valve arrangement is configurable to lock in a first configuration with the tubular body, such that the first port is closed and the second port is closed; lock in a second configuration with the tubular body, such that the first port is open and the second port is closed; and lock in a third configuration with the tubular body, such that the first port is closed and the second port is open. |
| US11920432B2 |
Toe valve with vented atmospheric chamber
A toe valve for use in a wellbore includes: a tubular mandrel; a housing extending along a periphery of the mandrel; couplings for assembly as part of a casing or liner string; and a valve piston. The valve piston is: disposed in an annulus formed between the housing and the mandrel, movable between an open position and a closed position, and disposed between a valve port of the housing and a valve port of the mandrel in the closed position. The toe valve further includes: an atmospheric chamber for facilitating movement of the valve piston to the open position; a vent port formed through the housing and in fluid communication with the atmospheric chamber; and a flow control device disposed in the vent port and operable to prevent fluid flow from the wellbore into the atmospheric chamber and allow fluid flow from the atmospheric chamber into the wellbore. |
| US11920431B2 |
Valve assembly, a production tubing system and a production tubing sub
A valve assembly for connection to an opening provided in a housing of a well tool device includes a fluid communication channel, a flapper valve device, a flapper element supporting device, and a securing device. The fluid communication channel provides fluid communication from an outside of the housing to a bore provided on the inside of the housing. The flapper valve device includes a flapper element configured to be in a closed position in which the fluid communication channel is closed and an open position in which the fluid communication channel is open. The flapper element is biased to the closed position. The flapper element supporting device supports the flapper element when the flapper element is in the open position. The securing device secures the flapper valve device and the flapper element supporting device to the opening. The securing device includes a through bore forming a first part of the fluid communication channel. |
| US11920428B2 |
Systems for inter-fracture flooding of wellbores and methods of using the same
Some systems and methods include a tubular defining a passageway, one or more packers coupled to the tubular, and two or more valves coupled to the tubular. Some such systems are operable by increasing pressure within the passageway such that, responsive to the increasing pressure, one or more first ones of the valves open and fluid flows from the passageway, through the first valve(s), and into one or more first fractures of the wellbore, and reducing pressure within the passageway such that, responsive to the reducing pressure, the first valve(s) close and one or more second ones of the valves open and hydrocarbons flow from one or more second fractures of the wellbore, through the second valve(s), and into the passageway. The first and second valves can be unidirectional valves. |
| US11920426B2 |
Payload deployment tools
A payload deployment tool is provided. The tool includes a housing having a coupler configured to couple to a fluid delivery conduit; a pressure chamber in communication with the coupler; a plurality of payload chambers in communication with the pressure chamber, each of the payload chambers having an upstream opening and a downstream opening; and a plurality of upstream pressure-rupturable seals respectively covering the upstream openings. |
| US11920421B2 |
Subsea wellhead support system and associated method of installing a subsea wellhead support system
The invention relates to a subsea wellhead support system (1) comprising: —a foundation assembly (2); —a conductor housing (31) for supporting a wellhead (4); —a connection arrangement (5) between the foundation assembly (2) and the conductor housing (3′); wherein the connection arrangement (5) is configured to releasably connect the conductor housing (3′) to the foundation assembly (2), such that: —during installation of the subsea wellhead support system (1), the conductor housing (1) can be fixed relative the foundation assembly (2), and—after installation of the subsea wellhead support system (1), the connection arrangement (5) can be released from the foundation assembly (2) allowing the conductor housing (3′) to move parallel along a longitudinal direction of a throughgoing opening of the conductor housing (31). |
| US11920419B2 |
Downhole conveyance line cutter
A downhole conveyance line cutter operable to be conveyed downhole within a wellbore along a conveyance line that conveys a tool string within the wellbore, connect to the conveyance line, and cut the conveyance line. The downhole conveyance line cutter may comprise a body, a cutting member operable to cut the conveyance line, and a clamping mechanism operable to connect the downhole conveyance line cutter to the conveyance line. The clamping mechanism may comprise a clamping member pivotably connected with the body and an actuator operable to pivot the clamping member to cause the clamping member to engage the conveyance line thereby connecting the downhole tool to the conveyance line such that the downhole tool can be retrieved out of the wellbore via the conveyance line after the downhole tool cuts the conveyance line. |
| US11920416B2 |
Metal-to-metal annulus packoff retrieval tool system and method
A wellbore system includes an adapter configured to couple to a downhole component. The wellbore system also includes a retrieval tubular, having a bore extending therethrough. The wellbore system further includes a piston assembly coupled to the retrieval tubular, wherein the bore is in fluid communication with a cavity of the piston assembly. The wellbore system includes a stem configured to couple to a casing section, the casing section being supported by a hanger. The wellbore system also includes a sleeve forming at least a portion of the piston assembly, the sleeve configured to couple to the adapter such that, responsive to a force applied by the piston at the casing section, the sleeve applies an upward force to the adapter. |
| US11920415B2 |
Indexing mechanisms
An indexing mechanism includes a piston. An indexing sleeve encases a portion of the piston. The indexing mechanism is longitudinally fixed to the piston, and is rotatable relative to the piston. The indexing sleeve includes an indexing track. An indexing ring surrounds less than an entirety of the indexing sleeve. The indexing ring is rotatable relative to the piston. The indexing ring includes an indexing pin that extends into the indexing track. |
| US11920414B2 |
Downhole turbine for managed pressure drilling
A mud turbine apparatus includes a rotor including an inner ring configured to be positioned around a drill pipe, an outer ring that is positioned around and spaced apart from the inner ring, a plurality of magnets coupled to the outer ring, and a plurality of blades coupled to and extending between the inner ring and the outer ring. The apparatus also includes a stator including a housing configured to fit into an annulus between the drill pipe and a surrounding tubular, and to receive the outer ring at least partially therein, and a plurality of coils that communicate with the magnets, such that in a first mode of operation, the rotor rotates to assist fluid flow therethrough and decrease drilling fluid pressure in the annulus, and in a second mode of operation, the rotation of the rotor impedes fluid flow therethrough and increases drilling fluid pressure in the annulus. |
| US11920408B2 |
Cutter with geometric cutting edges
A cutting element includes a base and a cutting face at opposite axial ends, a side surface extending between the base and the cutting face, an edge formed between the cutting face and the side surface, an edge chamfer having a uniform size around the entire edge, and a geometric shape formed on the cutting face and defined by a concave boundary with respect to a longitudinal axis of the cutting element. The concave boundary includes multiple rounded vertices, each rounded vertex located proximate to the edge chamfer and forming a cutting tip and multiple geometric shape sides connecting the rounded vertices, wherein the geometric shape sides are concave with respect to the longitudinal axis. |
| US11920403B2 |
Sliding and pivot fenestration unit
A fenestration unit is disclosed. In various examples, the fenestration unit includes a plurality of panels, including first and second panels. In some examples, one or more of the plurality of panels is configured to slide relative to a frame of the fenestration unit to provide an opening in the fenestration unit. In various examples, each of the first and second panels are also configured to be pivoted relative to the frame such that the first and second panels can be hinged or otherwise pivoted open to increase the size of the opening in the fenestration unit. |
| US11920401B2 |
Slow close mechanism for sliding applications
A sliding door includes a frame and a slow close assembly. The frame is positioned along at least a portion of the sliding door and includes a protrusion configured to slide along with the sliding door. The slow close assembly is repositionable between an outward position and a compressed position. The slow close assembly includes a slow close mechanism, a spring, and a soft close latch. The slow close mechanism is laterally positioned within the slow close assembly. The spring is positioned at an end of the slow close assembly and provides an outward force onto the slow close assembly in an outward direction substantially perpendicular to the lateral direction. The soft close latch is configured to engage the protrusion as the protrusion slides along with the sliding door. The spring biases the slow close assembly into the outward position when the latch is not interfaced with the protrusion. |
| US11920394B2 |
Vertical stability roller for vertically stacking panels
In example implementations, an end cap for a panel of a vertically stacking panel door is provided. The end cap includes a body to be coupled to an end of a panel of a vertically stacking panel door, a first track wheel coupled to the body, a second track wheel coupled to the body, and a vertical stability roller coupled to the body, wherein the first track wheel, the second track wheel, and the vertical stability roller are arranged along a vertical line, wherein the first track wheel is located vertically above the second track wheel and the vertical stability roller is located between the first track wheel and the second track wheel. |
| US11920393B2 |
Hidden shower door with low-rail sliding assembly
Disclosed is a hidden shower door with a low-rail sliding assembly, including an upper rail assembly (10), a movable door assembly (20), a vertical frame assembly (30), and a bottom guide part (40), wherein the upper rail assembly (10) includes an upper rail (1010), a damping trigger (1020), and sliding assemblies (1030), and the sliding assemblies (1030) each are mounted in the upper rail (1010); the sliding assemblies (1030) each include pulleys (10311), pulley brackets (1060), adjusting screws (10312), a damper (1050), and a damper bracket (1040); the pulleys (10311) are mounted on the pulley brackets (1060). The two pulley brackets (1060) are connected and fixed to two ends of the damper bracket (1040) respectively, and the damper (1050) is mounted in a damper accommodating groove (1041) of the damper bracket (1040); the upper rail (1010) is provided with a first bottom plate (1011). |
| US11920392B1 |
Electrical bonding door hinges
A hinge assembly includes first and second hinge units and an electrically conductive pin. The first hinge unit is mounted to a frame structure of an enclosure and includes a pin support comprising a barrel, a knuckle, or both, a pin receptacle arranged in the pin support, and an electrically conductive structure disposed at least partly inside the pin support and adjacent the pin receptacle. The pin rotates in the pin receptacle. The second hinge unit is carried on the pin and is door mounted. The second hinge unit and door can be removed from the first. The electrically conductive structure is biased against the pin and remains in contact while the pin rotates, and is electrically connected to the enclosure when the first hinge unit is mounted to it such that the pin is electrically bonded to the enclosure while the pin rotates. |
| US11920389B2 |
Reversible latchbolt
A latch bolt with a bolt head that is removably mounted on a latch tail through the use of a reversibility assembly, such as bolt head adjustment mechanism, or the like. The reversibility assembly may comprise one or more locking members (e.g., within the bolt head, the latch tail, tail plate, and/or independent from the other components of the latch bolt) that allow the bolt head and/or the latch tail to be removed, rotated, and reassembled without opening the case of the mortise lock. The bolt head may comprise an anti-friction latch that is configured to pivot within the flanges of the bolt head in a way that maintains contact between the anti-friction lock and the strike plate. |
| US11920387B2 |
Motor vehicle handle arrangement and method for operating such a motor vehicle handle arrangement
A motor vehicle handle arrangement includes an actuating element, which is movable between a neutral position and an active position, a handle part, which is movable between a non-use position and an actuating position, and a mechanical restoring element. In a normal operation, the actuating element is designed to move the handle part from the non-use position into the actuating position. In the active position, it holds the handle part in the actuating position. An auxiliary restoring element is movably mounted and coupled in movement with the actuating element in such a way that, during a faulty operation in which the actuating element moves into the neutral position and the handle part is arranged remaining in its actuating position, it is designed, at least for a fraction of its movement, to move the handle part concomitantly in the direction of its non-use position. |
| US11920385B2 |
Sensor assembly and door lock device
The present invention is a sensor assembly that is used in a door lock device provided with a latch, a ratchet, a drive unit that drives the ratchet and releases the engagement of the ratchet and the latch, and a case that accommodates the drive unit, the sensor assembly being provided with a sensor that detects the action of the ratchet when the engagement of the ratchet and the latch is released, wherein the sensor assembly is provided with: a connector that holds connection conductors electrically connected to the sensor, and is attached to the case; a sensor base that holds the sensor; a plurality of electric wires that connect the plurality of connection conductors and a plurality of terminal portions of the sensor; and a waterproofing material that comprises a photo-curing resin for covering, along with the sensor base, connecting portions of the terminal portions and the electric wires. |
| US11920383B2 |
Restraint system
A restraint system includes an elongated member extending between a first end portion and a second end portion. A first handcuff is mounted to the elongated member at the first end portion of the elongated member, and a second handcuff is mounted to the elongated member at the second end portion of the elongated member. A first handle is positioned adjacent the first handcuff, and a second handle is positioned adjacent the second handcuff. |
| US11920382B2 |
Rotating support handle assembly for bottom-hinged door
A rotating support handle assembly for supporting a bottom-hinged door is disclosed. The rotating support handle assembly may comprise a handle member and a support member. The handle member may rotate from a first position to a second position, and the support member may be configured to contact a floor to provide support to the bottom-hinged door in the second position. |
| US11920379B2 |
Modular cylindrical lockset
An exemplary product line system includes a common platform and a plurality of component families, each of which includes a plurality of interchangeable component species configured for use with the common platform. The common platform includes an inside drive assembly and a chassis assembly including a chassis and an outside drive assembly. A lockset assembled from the system includes the common platform and a plurality of modular components. Each of the modular components corresponds to a respective one of the component families, and is provided as a selected species of the corresponding component family. The lockset has a function defined by the set of component species installed to the lockset. The function of the lockset can be changed by altering the set of component species installed to the lockset without disassembling the chassis assembly. |
| US11920378B2 |
Electronic lock
The present disclosure generally relates to a lock including a blocker (e.g., a bolt) useable to selectively prevent access through a portal such as a door. The blocker can be retained in a blocking position to prevent access through the portal by a retainer. In alternative embodiments, the blocker can also be retained in an open position to allow access through the portal. A retainer can be utilized to retain the blocker in the blocking position preventing access through the portal and can also be utilized, in certain embodiments, to retain the blocker in the open position to allow access through the portal. A retainer blocker can be utilized to maintain the retainer in position to retain the blocker (e.g., bolt) in a fixed position. An actuator may, in certain alternative embodiments, be employed to position the retainer blocker. In certain embodiments, the actuator is controlled by an electronic controller. |
| US11920376B2 |
Electronic door locks having bi-directional overruning clutches and methods of using the same
The present disclosure relates to a bi-directional overrunning clutch, electronic door locks having bi-directional overrunning clutches, and methods of using the same. In certain embodiments, the electronic door lock includes a first locking mechanism for driving an inner wheel through a first torque to rotate a rotatable shaft to operate a locking device on a door by a user from outside, a second locking mechanism for driving inner wheel through the first torque to operate the locking device from an inside, a third locking mechanism for driving an outer wheel rotatable coaxially around the rotatable shaft through a second torque to operate the locking device electronically, and the bi-directional overrunning clutch. When outer wheel rotates at second torque, inner wheel and rotatable shaft rotate along with outer wheel, and when inner wheel rotates at first torque, outer wheel does not rotate along with inner wheel and rotatable shaft. |
| US11920374B2 |
High security lock with slider to isolate lock pins from cylinder applied torque
A locking system uses a lock housing, a lock cylinder for rotation in the lock housing, pins to control the lock cylinder being in unlocked or locked states relative to the lock housing, and a key to control the position of the pins. The system further includes a slider or lock bar within the lock housing. The slider moves relative to the lock cylinder and the lock housing between (i) a cylinder locking position blocking rotation of the lock cylinder relative to the lock housing so as to isolate the pins from the torque applied to the lock cylinder while allowing the pins to be displaced between the locked and unlocked positions thereof and (ii) a pin locking position of the slider in which the pins are resisted from movement relative to the lock housing and the lock cylinder while rotation of the lock cylinder is uninhibited by the slider. |
| US11920373B2 |
Door outside handle assembly having sliding type door lock cap
An embodiment door outside handle assembly includes a door lock body configured to be attached to an outside of a door panel of a vehicle, a grip cover covering an outside of the door lock body and including a key hole configured to receive an emergency key, and a door lock cap on an outside of the grip cover, the door lock cap being slidable in a longitudinal direction of the vehicle to cover or uncover the key hole. |
| US11920371B2 |
Adjustable decorative lockset rose assembly
A rose assembly for a lockset configured to conceal and protect at least portions of a chassis that are positioned in a through-hole of an entryway device. The rose assembly can include at least a rose base and a rose plate. The rose plate can be assembled to the rose base at one of a plurality of orientations so that the rose assembly has an asymmetrical configuration. The rose assembly can include an indexing system to control the orientations at which the rose plate can be selectively secured to the rose base. The indexing system can include first and second male members and a plurality of female members, the first male member being sized to be matingly received in some, but not all, of the plurality of female members. The rose plate can be secured to the rose base by plate fasteners, magnets and/or double-sided tape. |
| US11920370B2 |
Underground temporary danger avoiding system for defending against short-duration and strong impact of ground fluid
The invention relates to a perforating device for thermoplastic plates, which relates to the technical field of a plate processing device. The device comprises an electromagnetic chuck, one side of the electromagnetic chuck is connected with the motion part, the other side of the electromagnetic chuck is connected with a mounting plate and a spike. When the electromagnetic chuck is powered on, the spike is attracted below the mounting plate by the electromagnetic force. A clamping part is arranged below the mounting plate, the thermoplastic plate is fixed by the clamping part, and a heating system is also provided to heat the thermoplastic plate. As the electromagnetic chuck is powered on or off, the spike can be attracted in or separated from the mounting plate, respectively. Therefore, the perforating device can make a new plate be pierced during the cooling and curing process of the perforated plate. |
| US11920368B2 |
Pool skimmer guard assembly
A pool skimmer guard assembly for keeping a pool skimmer free from obstructions includes a rod that is comprised of a resiliently bendable material. In this way the rod can be bent into a U-shape. Thus, the rod can be positioned in an intake of a pool skimmer having the rod curving outwardly from the intake. A pair of grips is each coupled to the rod such that each of the grips is positioned in the intake of the pool skimmer when the rod is bent into the U-shape. Each of the grips has a gripping edge that is perpendicularly oriented with the rod. In this way the gripping edge of each of the grips can engage a respective edge of the intake thereby inhibiting the rod from being dislodged from the intake. |
| US11920366B2 |
Water circulation system for a pool and a pool
A water circulation system for a pool comprises a water outlet assembly mounted to an inner wall of a pool, and in fluid communication with an external pump through a water outlet pipe. The water circulation system also includes an air inlet assembly mounted to the pool a preset distance from the water outlet assembly, and an air outlet assembly attached to the water outlet assembly and in fluid communication with the water outlet assembly. An air inlet passage connects the air inlet assembly to the air outlet assembly, so external air can enter the air inlet assembly and be introduced to the water outlet assembly through the air outlet assembly. Air is introduced to the water outlet by the air outlet when the water outlet assembly is blocked, reducing negative pressure at the water outlet and reducing risk that a portion of a user's body is drawn against or into the water outlet. |
| US11920361B2 |
Medical device docking station
A docking station for a medical device is described. In some examples, the docking station includes a frame and a base plate coupled to the frame. At least a portion of the base plate is coupled to a lower portion of the frame. In some examples, an electronic connector of the docking station is configured to couple to the medical device and to provide power to the medical device when the medical device is docked to the docking station. In some examples, a docking mechanism is coupled to an upper portion of the frame and configured to retain the medical device. |
| US11920360B2 |
Zipper pull system and methods of use
A system, comprises a first pulley and a first pulley mount constructed and arranged to couple the first pulley to a curtain including a zipper. The first pulley mount comprises a first portion and a second portion that are removably coupled to each other with a portion of the curtain between them when mounted to the curtain. A second pulley in included along with a second pulley mount constructed and arranged to couple the second pulley in position relative to the curtain. An elongated pull is coupled to the first pulley, the second pulley, and a zipper pull of the zipper. |
| US11920359B2 |
Framing buddy deck framing tool
A framing tool supports one end of beam member while the other end of the beam is secured to another beam or structure. The framing tool includes a support portion, a receiving portion and a strap. The strap wraps around a beam member to secure the beam member within the receiving portion. The support portion holds one end of the beam member in place so that an installer may secure the other end of the beam member without the aid of another installer. |
| US11920355B2 |
Building material attachment devices, systems, and associated methods of manufacture and use
Devices, systems, and associated methods for attaching materials (e.g., baffles, panels, etc.) to ceiling or side wall surfaces of a building and/or other substructure of a building are disclosed herein. In some embodiments, the systems include a clip having outwardly facing pockets configured to operably engage opposing protrusions of a channel of a support beam. The system can further include a locking device pivotably coupled to the clip and movable between an unlocked position and a locked position in which a portion of the locking device is positioned between the pockets to prevent the clip from inadvertently disengaging from the channel. |
| US11920353B2 |
Connection system and awning structure with connection system
An awning system includes an awning and a connection system for connecting the awning to a mounting structure. The awning includes a roller tube and an accessory element coupled to the roller tube. The connection system includes a receiving member and an adapter. The receiving member is coupled to the mounting structure and defines a receiving groove extending along an extension path. The adapter includes an engaging section coupled to the receiving groove and a receiving section coupled to the awning. A normal force between a contact area of the engaging section and the receiving groove increases when the engaging section rotates in one direction about the extension path such that the adapter is in a self-locked condition within the receiving groove. |
| US11920346B2 |
Module and method for producing a module, a building wall and a building
A module, in particular for a building, includes a wall having at least two, preferably parallel, wall outer sides, which are spaced apart from one another. At least one channel is disposed between the two wall outer sides and is filled with a self-curing material. A building including at least one module, a method for producing a module, a method for producing a building wall and a method for producing a building, are also provided. |
| US11920342B2 |
Exterior insulated finish wall assembly
An exterior insulated finish wall assembly includes an exterior panel member and an insert member. The exterior panel member includes a rigid insulative substrate having a body portion and a tail portion extending from the body portion, wherein a recess is defined by a sloped surface and a back surface of the tail portion. The insert member is disposed within the recess and is sized and shaped to correspond to the recess. A drainage channel is defined between the sloped and back surfaces of the tail portion and the insert member. |
| US11920341B2 |
Profile rail with reinforcing element
A rail assembly is provided, suitable for embedding in concrete, including a profile rail having a rail body, wherein the rail body has a first lateral wall, a second lateral wall, a first rail lip protruding from the first lateral wall, and a second rail lip protruding from the second lateral wall. The rail assembly has a reinforcing element with a force-absorbing body, wherein the force-absorbing body is positioned in front of the first lateral wall of the profile rail for contacting the first lateral wall of the profile rail with the force-absorbing body. A construction body having a concrete element, in which a rail assembly of this type is embedded is also provided, as is a method. |
| US11920336B2 |
Clean toilet and accessories
A toilet that includes a tank configured to hold water from a water supply; a reservoir fluidly connected to the tank and configured to hold a cleaning compound comprising a chemical compound and water from the water supply; and an actuator configured to control a flush cycle of the toilet upon a first activation, the actuator including at least one nozzle fluidly connected to the reservoir and configured to discharge an amount of the cleaning compound external to the tank upon at least one of the first activation or a second activation. |
| US11920333B2 |
Magnetic position sensor for aircraft toilet flush valve
Vacuum toilet flush valves. The disclosure uses a precise positioning of a magnet with respect to a flush valve plate in order to identify absolute alignment accurately. |
| US11920326B2 |
Systems and methods for determining control capabilities on an off-highway vehicle
Systems and methods for controlling operation of an off-highway vehicle are provided. A control method includes receiving an input command that includes at least one of a manual input command and an automatic input command, determining if an operator attention level is at a first attention level, a second attention level, or a third attention level, generating at least one output parameter based on the determined operator attention level and the input command, generating an output command based on the at least one output parameter, and outputting the output command to the first work function to control operation of the first work function based on the output command. |
| US11920324B2 |
Control method and control system for work machine
A first process acquires movement data including a position of a lead machine. A second process controls one or more work machines so that the one or more work machines follows the lead machine based on the movement data. |
| US11920321B2 |
System and method for automatically performing an earthmoving operation
A system for automatically performing an earthmoving operation may include a work vehicle having an implement that is articulable by the work vehicle over a stroke length, a user interface, and a controller communicatively coupled to the user interface. The controller may be configured to receive an operator input via the user interface associated with performing an earthmoving operation with the implement of the work vehicle according to one of a plurality of earthmoving styles. Additionally, the controller may be configured to control the operation of the work vehicle to perform the earthmoving operation with the implement within the worksite based at least in part on the one of the plurality of earthmoving styles. |
| US11920320B2 |
Implement and a method for obtaining information related to said implement
An implement connectable to a work vehicle includes an arm, a fastening arrangement arranged at a first part of the arm, and an attaching arrangement. The fastening arrangement is connectable to the work vehicle an attaching arrangement is arranged at second part of the arm. The attaching arrangement is attachable to a tool. The implement further includes a second hydraulic circuit configured to carry hydraulic fluid to at least one second hydraulic function. The first hydraulic function comprises a lifting function and a local control element. The implement further includes at least one second sensor arranged to obtain sensor signals at least related to the lifting function, a local control element and a digital interface to the work vehicle. The control element is arranged to receive and process the received sensor signals so as to determine a load weight and to feed the determined load weight to the digital interface. |
| US11920316B2 |
Anchor pier for manufactured building
An anchor pier for supporting a manufactured building, in which the anchor pier includes having a shaft with a connector and a helical flight proximate a driving tip, with a brace member attached to the connector and to the manufactured building with a connector, to transfer loading between the manufactured building and the ground. A method of supporting a manufactured building is disclosed. |
| US11920314B2 |
Bi-directional fish pass helix
A fish pass system includes a helical blade having an outside diameter and an inside diameter extending between a first side of the helical blade and a second side of the helical blade. The inside diameter controls a flow of water flowing in a direction from the first side to the second side, and the inside diameter defines an open center of the fish pass system. Fish traveling in an opposite direction to the direction of the flow of the water pass through the fish pass system by riding in a space between helical blades as the helical blades are rotating, and fish traveling in the direction of the flow of the water pass through the open center of the fish pass system by swimming or moving over the inside diameter of the helical blades. |
| US11920312B1 |
Docking guide for boat
A docking guide for a boat includes a platform having front and back sides, a first lateral side for mounting to a dock, and a second lateral side opposite the first lateral side. The platform has an opening, located between the first and second lateral sides, for receiving a front of the boat therein. The docking guide further includes at least one anchoring element secured to the platform on the second lateral side, a first deflector mounted to the platform thereabove to be partially in the opening near an intersection of the front and second lateral sides; and a second deflector mounted to the platform thereabove to be partially in the opening near an intersection of the front and first lateral sides. The second deflector is shifted towards the back side relatively to the first deflector so that, when the boat moves within the opening, it is forced in a parallel relationship with the dock by its contact with the first and second deflectors. |
| US11920307B2 |
Multi-ply tissue products having improved cross-machine direction properties
Provided are tissue webs, and products produced therefrom, that are generally durable, flexible and have improved cross-machine direction (CD) properties, such as CD tensile energy absorption (CD TEA), CD stretch and CD modulus. The inventive tissue products generally comprise multiple tissue plies, such as two or more plies, that have been prepared by through-air drying and more preferably by through-air drying without creping. Moreover, the plies may be produced in a through-air drying process that utilizes a transfer fabric positioned between the forming fabric and the through-air drying fabric where the transfer fabric imparts the nascent web with a high degree of CD strain. |
| US11920301B2 |
Woven papermaking fabric having intersecting twill patterns
Woven papermaking fabrics useful in the manufacture of fibrous structures, particularly wet-laid tissue products that allow the web contacting surface of the fabric to be woven with three-dimensional topography comprising protuberances that are oriented at an angle relative to both the machine direction (MD) axis and cross-machine (CD) axis of the fabric. The protuberances may be discrete or continuous and, in certain preferred embodiments, intersect one another to form discrete valleys there between. The valleys may have relatively steep sidewalls, such as wall angles greater than 22 degrees, and be relatively deep, such as valley depths greater than about 0.35 mm. |
| US11920298B2 |
Process and system for controlling temperature of a circulating foamed fluid
A method and system are disclosed for actively cooling a fluid, particularly a foamed fluid. The foamed fluid may comprise a foamed suspension of fibers that is used to form a web. The foamed suspension of fibers is fed around a recirculation loop and actively cooled using a heat exchanger. |
| US11920297B2 |
Method for treating a fibrous material comprising nanocellulose with an organic acid or organic acid salt
The present invention relates to a method for preparing a surface-treated fibrous material comprising nanocellulose, in which a fibrous material is surface treated with an organic acid or salt thereof. Fibrous materials as such are also provided. The present technology allows improved Water Vapor Transmission Rates (WVTR) for the fibrous material, while operating on an industrial scale. |
| US11920293B2 |
Garment with enhanced response characteristics for laser finishing
A fabric has enhanced response characteristics for laser finishing. The fabric can be denim for denim apparel such as jeans. Software and lasers are used to finish apparel made of the fabric to produce a desired wear or distressing pattern or other design. The fabric allows for relatively fast color change in response to the laser, color changes in hue from indigo blue to white, many grayscale levels, and maintains strength and stretch properties. A method used to make the fabric includes spinning, dyeing, and weaving yarns in such a way to obtain the desired enhanced response characteristics for laser finishing. |
| US11920292B2 |
Methods for obtaining colored or chromic substrates
The present invention provides a post-fabrication modification approach for the fabrication of colored and chromic materials and sensors using plasma surface modification to covalently bind the coloring agent to the substrate, thus avoiding leaching of the dye. Advantageously, in said methods, said coloring agent is a dye or pigment linked to a radical sensitive functional group, such as an alkenyl or alkynyl functional group, and is applied to the substrate prior to the gas plasma treatment. The methods envisaged herein are generic in nature, which allow the covalent immobilization of various dyes on different materials. The covalently coated materials after plasma surface modification, particularly the covalently coated chromic materials and sensors, can be used in many different applications, such as protective textile and wound dressing applications. |
| US11920289B2 |
Temperature control method for clothes drying treatment device, and clothes drying treatment device
A heating device of a clothes drying treatment device executes an on or off operation in a temperature interval. When the temperature in a drum reaches an upper limit value TDx of the temperature interval under an action of the heating device, the heating device is turned off and the heating device stops heating. The upper limit value TDx decreases as a number of off times x of the heating device increases. Accordingly, a higher initial off temperature is adopted for the heating device, the temperature in the drum rapidly increases to the drying temperature, a preheating time is shortened, and a certain coefficient is multiplied in following control parameters controlling on or off of the heating device. The coefficient is related to the number of on-off times, and the effect is achieved that the off temperature of the clothes dryer gradually decreases as the number of on-off times increases. |
| US11920284B2 |
Door assembly of laundry treatment device and laundry treatment device
A door assembly of a laundry treatment device and a laundry treatment device. The door assembly includes an outer frame, an inner frame and an observation window provided between the outer frame and the inner frame, a mounting assembly being provided between the outer frame and the inner frame, the observation window being rotatably sandwiched between the outer frame and the inner frame by means of the mounting assembly. With this arrangement, the observation window can be rotated relative to the inner frame and the outer frame without deviating from the space between the inner frame and the outer frame, such that in the process of rotating the entire door assembly 180° to switch the door opening direction, the mounting requirement of the observation window can be satisfied only by separately rotating the observation window 180°, rotating same and then mounting same back to the door assembly. |
| US11920281B2 |
Systems for appliance detergent dispensing
A washing machine includes a cabinet, a tub positioned in the cabinet, a basket assembly mounted in the tub, a manifold mounted in the cabinet, and a dispenser box slidably mounted to the manifold. The dispenser box is configured to provide selective access to an interior of the dispenser box, and a powder detergent chamber is configured for receiving powder detergent. A drawer is slidably mounted to the dispenser box within the interior of the dispenser box. The drawer defines a liquid detergent chamber. Liquid detergent chamber nests within the powder detergent chamber in the interior of the dispenser box. |
| US11920280B2 |
Washing machine appliance and scent-infusing assembly
A washing machine appliance may include a cabinet, a tub, a wash basket, a plurality of rotatable blades, and an infuser basket. The cabinet may define an opening. The tub may be disposed within the cabinet. The wash basket may be rotatably mounted within the tub to rotate about a rotation axis. The plurality of rotatable blades may be attached to the wash basket to generate a vortex airflow within the cabinet. The infuser basket may define an infuser compartment to hold a scent additive therein. The infuser basket may further defining a plurality of slots to permit the vortex airflow to flow through the infuser compartment within the cabinet. |
| US11920278B2 |
Washing machine
A washing machine includes a casing, a tub, a drum, a pump for sending water discharged from the tub, a gasket connecting an input port of the casing to an opening of the tub and having nozzles for spraying water into the drum, and a nozzle water supply pipe fixed to the gasket configured to guide water introduced through the opening into a first sub-flow and a second sub-flow. The nozzle water pipe includes first nozzle water supply ports, formed on a first flow path to which the first sub-flow is guided, for supplying the first sub-flow to any two or more nozzles among the plurality of nozzles, and second nozzle water supply ports, formed on a second flow path to which the second sub-flow is guided, for supplying the second sub-flow to other two or more nozzles among the plurality of nozzles. |
| US11920277B2 |
Pump mount system for a laundry treating appliance
A pump mount system for a laundry treating appliance having a cabinet and a pump located within the cabinet, a pump mount secured to the pump; a base mount spaced from the pump mount; at least one vibration isolator comprising a singular body having a first portion passing through a first opening on the pump mount, a second portion extending between the pump mount and the base mount, and a pin aperture passing through the vibration isolator; a pin removably received within the pin aperture; and at least one protrusion extending from at least one of the vibration isolator or the pin; wherein the at least one protrusion is engaged with at least one of the pin, the vibration isolator, or the base mount. |
| US11920276B2 |
Laundry treating apparatus
A laundry treating apparatus includes a first treating apparatus having a first front panel, and a first drum disposed therein for accommodating laundry therein; a second treating apparatus disposed below the first treating apparatus to support the first treating apparatus, wherein the second treating apparatus has a second front panel, and a second drum disposed therein for accommodating laundry therein; and a control panel disposed between the first front panel and the second front panel. The control panel communicates a signal with the first treating apparatus and the second treating apparatus. |
| US11920275B2 |
Method of operating a control panel of a laundry appliance
A laundry appliance includes a cabinet and a control panel mounted on the cabinet, the control panel having a plurality of controls that each may be activated to permit manipulation by a user or deactivated to prevent manipulation by the user. A method of operating the laundry appliance includes obtaining a desired automation level, determining a set of active controls of the plurality of controls that are associated with the desired automation level, and activating the set of active controls on the control panel for manipulation by the user of the laundry appliance. |
| US11920274B2 |
Distributed networked laundry machine control and operation
Methods, system and apparatus for the controlling laundry machines in a laundry facility. A user device receives a list of machines for a laundry facility and displays them on a machine control user interface. The user may then make a selection of a machine, a selection of an operation type and a selection of one or more operational parameters associated with the selected operation type. The selection of the operation type and the one or more operational parameters may be made on the user device or on the selected machine. The machine control user interface may then display the user selections, an estimated duration and a cost. The estimated duration and cost may be based on the selected machine, selected operation type and the one or more selected operational parameters. |
| US11920269B2 |
Template clamping apparatus
A template clamping apparatus is disclosed for clamping a fabric against a quilt making template. The apparatus includes a base which has an upper surface and a lower surface. A turntable is supported by the base, the turntable defining a working surface which is rotatable relative to the base. An arm is rigidly connected to the base, the arm having a first and a second end. A clamp is connected to the second end of the arm such that when the clamp is disposed in a loading disposition thereof, loading of the fabric between the quilt making template and the turntable is permitted. However, when the clamp is disposed in a clamping disposition thereof, the fabric is clamped between the quilt making template and the turntable. The arrangement is such that relative movement between the quilt making template and the fabric is inhibited while permitting the fabric sandwiched between the turntable and the quilt making template to rotate relative to the base so that cutting of the fabric in conformity with the quilt making template is facilitated. |
| US11920265B2 |
Multi-layer fabric
A multi-layer fabric, and an airbag formed of the multi-layer fabric are provided. The multi-layer fabric can provide an airbag capable of sufficiently protecting a driver or a passenger by minimizing damage caused by broken glass fragments when a vehicle is overturned. The multi-layer fabric includes an inflating part, and a co-woven part surrounding the inflating part. At least one layer of the inflating part includes a first region formed of two or more types of weaves comprising 1/1 plain weave. |
| US11920264B2 |
Yarn clearer and cutting device for a yarn clearer
The present invention relates to a yarn clearer for a workstation of a textile machine with a cutting device for clearing out defects from a yarn as well as a cutting device for a yarn clearer which can be arranged at a workstation of a textile machine, with a housing body having a housing basic body, a housing cover which covers the housing basic body at least in sections and together with the housing basic body delimits a housing interior and a first housing opening and a cutting device with a cutting medium carrier having a cutting knife, a cutting medium drive arranged in the housing interior for adjusting the cutting medium carrier between a cutting position remote from the housing and a rest position close to the housing and a drive element connecting the cutting medium drive and the cutting medium carrier and adjustably arranged in the first housing opening. In order to provide a yarn clearer with a cutting device as well as a cutting device which ensure reliable separation of the yarn when required, there is provision for the housing body to have a bearing section for adjustably receiving the cutting medium carrier and a second housing opening adjacent to the bearing section with an opening edge extending perpendicularly to the adjustment direction of the cutting medium carrier and abutting the cutting medium carrier. |
| US11920263B2 |
Methods, processes, and apparatuses for producing dyed and welded substrates
A dyeing and welding process may be configured to convert a substrate into a welded substrate having at least some color imparted thereto via a dye and/or coloring agent by applying a process solvent having a dye and/or coloring agent therein to the substrate, wherein the process solvent interrupts one or more intermolecular force between one or more component in the substrate. The substrate may be configured as a natural fiber, such as cellulose, hemicelluloses, and silk. The process solvent may include a binder, such as dissolved biopolymer (e.g., cellulose). After application of a process solvent comprised of a dye and/or coloring agent, the substrate may be exposed to a second application of a process solvent comprised of a binder, which second application may occur before or after a process temperature/pressure zone, process solvent recovery zone, and/or drying zone. |
| US11920262B2 |
Single-step process for the production of a carbon fiber precursor
An integrated and improved, single-step, process for the production of a carbon fiber precursor is described, specifically a process which starts from the comonomers and reaches the spinning step, obtaining the final precursor fiber. |
| US11920257B2 |
Method of evaluating cleanliness, method of determining cleaning condition, and method of manufacturing silicon wafer
A method of evaluating cleanliness of a member having a silicon carbide surface, the method including bringing the silicon carbide surface into contact with a mixed acid of hydrofluoric acid, hydrochloric acid and nitric acid; concentrating the mixed acid brought into contact with the silicon carbide surface by heating; subjecting a sample solution obtained by diluting a concentrated liquid obtained by the concentration to quantitative analysis of metal components by Inductively Coupled Plasma-Mass Spectrometry; and evaluating cleanliness of the member having a silicon carbide surface on the basis of a quantitative result of metal components obtained by the quantitative analysis. |
| US11920253B2 |
Methods of controllable interstitial oxygen doping in niobium
A method for vacuum heat treating Nb, such as is used in superconducting radio frequency cavities, to engineer the interstitial oxygen profile with depth into the surface to conveniently optimize the low-temperature rf surface resistance of the material. An example application is heating of 1.3 GHz accelerating structures between 250-400° C. to achieve a very high quality factor of 5×1010 at 2.0 K. With data supplied by secondary ion mass spectrometry measurements, application of oxide decomposition and oxygen diffusion theory was applied to quantify previously unknown parameters crucial in achieving the oxygen alloy concentration profiles required to optimize the rf surface resistance. RF measurements of vacuum heat treated Nb superconducting radio frequency cavities confirmed the minimized surface resistance (higher Q0) previously expected only from 800° C. diffusive alloying with nitrogen. |
| US11920252B2 |
SU-8 etching technique using molten salt
A method of decomposing a cured aromatic epoxy resin uses a molten salt bath at less than about 350° C. The molten salt bath includes a plurality of alkali metal hydroxides. The cured aromatic epoxy resin can be in intimate physical contact with a metal or alloy. The cured aromatic epoxy resin can be patterned by a lithographic method. The lithographic method can be multibeam interference lithography to form a three-dimensional photonic crystal template on a conductive substrate for electrodeposition of metal. Contacting the three-dimensional photonic crystal template with the electrodeposited metal with the molten salt bath can form a metal matrix device displaying a periodic pattern that is the inverse of the periodic pattern of the decomposed three-dimensional photonic crystal template. |
| US11920246B2 |
Seawater electrolysis enables Mg(OH)2 production and CO2 mineralization
A method for producing one or more hydroxide solids includes providing a catholyte comprising an electrolyte solution; contacting the catholyte with an electroactive mesh cathode to electrolytically generate hydroxide ions, thereby precipitating the one or more hydroxide solid(s); and removing the one or more hydroxide solids from the surface of the mesh where they may deposit. |
| US11920244B2 |
Device housing with metallic luster
The application discloses examples of a device housing of an electronic device including a magnesium-alloy substrate. The device housing further including a treatment layer applied over the magnesium-alloy substrate and a metallic coating layer applied over the treatment layer to provide a metallic luster. Further, a paint coating layer is disposed over a first portion of the metallic coating layer. Further, a top coating layer is applied over the paint coating layer and a visible second portion of the metallic coating layer. |
| US11920243B2 |
Method for manufacturing a sheet metal component from a flat steel product provided with a corrosion protection coating
A method for manufacturing a sheet metal component including: annealing a flat steel product comprising 0.05-0.5% C, 0.5-3% Mn, 0.06-1.7% Si, ≤0.06% P, ≤0.01% S, ≤1.0% Al, ≤0.15% Ti, ≤0.6% Nb, ≤0.01% B, ≤1.0% Cr, ≤1.0% Mo, ≤1.0% Cr+Mo, ≤0.2% Ca, ≤0.1% V, remainder iron and impurities in a continuous furnace under an atmosphere consisting of 0.1-15% hydrogen and remainder nitrogen with a specific dew point and temperature profile; applying a coating consisting of ≤15% Si, ≤5% Fe, in total 0.1-5% of at least one alkaline earth or transition metal and a remainder Al and unavoidable impurities; heating the flat steel product to >Ac3 and ≤1000° C. for a time sufficient to introduce a heat energy quantity >100,000-800,000 kJs; hot-forming the flat steel product to form the component; and cooling at least one section of the component at a cooling rate sufficient to generate hardening structures. |
| US11920241B2 |
Fluid handling structure and method for a gas phase deposition apparatus
A fluid handling structure for a gas phase deposition apparatus, the structure defining a flow path with an inlet and an outlet for transmitting pressurized fluid from said inlet to the outlet, wherein the structure includes an elongated slit and a series of nozzles through which pressurized fluid is allowed to enter the elongated slit, the inlet being upstream the series of nozzles, and wherein the outlet is formed downstream at a gap opening of the elongated slit allowing pressurized fluid to discharge from the elongated slit towards a substrate, wherein the series of nozzles are configured to provide a larger flow resistance than the elongated slit, and wherein the series of nozzles are adapted to form a series of jet flows directed towards one or more impingement surfaces of the structure when pressurized fluid is transmitted through the flow path. |
| US11920240B2 |
Substrate processing apparatus, state determination method and computer-readable recording medium
A substrate processing apparatus configured to process a substrate includes a functional component constituting a part of the substrate processing apparatus; a nozzle, provided on a surface of the functional component, allowing a gas to pass therethrough; a nozzle flow path which is connected to the nozzle of the functional component and through which the gas flows; a flow rate sensor configured to measure a flow rate of the gas flowing through the nozzle flow path; and a controller configured to make a determination upon a state of a distance between an interfering object and the functional component based on a measurement result obtained by the flow rate sensor. |
| US11920238B2 |
Sealing article comprising metal coating, method of making and method of using the same
A method of making a sealing article that includes a body and a coating layer disposed on at least one surface of the body. The body comprises a polymeric elastomer such as perfluoroelastomer or fluoroelastomer. The coating layer comprises at least one metal. The sealing article may be a seal, a gasket, an O-ring, a T-ring or any other suitable product. The sealing article is resistant to ultra-violet (UV) light and plasma, and may be used for sealing a semiconductor processing chamber. |
| US11920236B2 |
Coating machine and coating method
A composite coating layer for coating a NdFeB rare earth magnet includes a first coating layer and a second coating layer formed over a surface of the first coating layer. The first coating layer includes a Nd coating layer, a Pr coating layer, or an alloy coating layer including two or more of Nd, Pr, and Cu. The second coating layer includes a Tb coating layer. |
| US11920228B2 |
Copper alloy sheet, copper alloy sheet with plating film, and method for producing same
Providing a copper alloy plate, in which center Mg concentration at a center part in a plate thickness direction 0.1 mass % or more and less than 0.3 mass %, center P concentration is 0.001 mass % or more and 0.2 mass % or less, and the balance is composed of Cu and inevitable impurities; in which surface Mg concentration at a surface is 70% or less of the center Mg concentration; in which a surface layer part defined by a prescribed thickness from the surface has a concentration gradient of Mg of 0.05 mass %/μm or more and 5 mass %/μm or less increasing from surface toward center part of the plate thickness direction; and in which restraint of color change of the surface and increase of electrical contact resistance, and adhesiveness of a plating film are excellent due to maximum Mg concentration in the surface layer part is 90% of the center Mg concentration. |
| US11920227B2 |
PD alloy, PD alloy material and probe pin for electric and electronic devices, and methods for manufacturing the same
An object of the present invention is to provide a Pd alloy, a Pd alloy material, and a probe pin for electric and electronic devices in which specific resistance, hardness, and processability are balanced at a higher level than before, and methods for manufacturing the same. In order to achieve this object, the Pd alloy for electric and electronic devices according to the present invention having a composition comprising 50.1 mass % or more and 55.5 mass % or less of Pd, 6.3 mass % or more and 16.1 mass % or less of Ag, 30.0 mass % or more and 38.0 mass % or less of Cu, and 0.5 mass % or more and 2.0 mass % or less of In is adopted. |
| US11920220B2 |
High carbon content cobalt-based alloy
The present invention relates to a 3D-printed cobalt-based alloy product comprising carbon, tungsten and chromium with very good mechanical and thermal properties as well as a method of preparing the 3D-printed product and a powder alloy. The alloy has a high carbon content leading to high carbide content but small and evenly distributed carbides. A method facilitating 3D printing of high carbide content alloys such as the present alloy is also disclosed. |
| US11920218B2 |
High strength fastener stock of wrought titanium alloy and method of manufacturing the same
This invention generally relates to the field of nonferrous metallurgy, namely to titanium alloy materials with specified mechanical properties for manufacturing the aircraft fasteners. A stock for high strength fastener is manufactured from wrought titanium alloy containing, in weight percentages, 5.5 to 6.5 Al, 3.0 to 4.5 V, 1.0 to 2.0 Mo, 0.3 to 1.5 Fe, 0.3 to 1.5 Cr, 0.05 to 0.5 Zr, 0.15 to 0.3 O, 0.05 max. N, 0.08 max. C, 0.25 max. Si, balance titanium and inevitable impurities, having the value of aluminum structural equivalent [Al] eq in the range of 7.5 to 9.5, and the value of molybdenum structural equivalent [Mo] eq in the range of 6.0 to 8.5, where the equivalents are defined by the following equations: [Al] eq=[Al]+[O]×10+[Zr]/6; [Mo] eq=[Mo]+[V]/1.5+[Cr]×1.25+[Fe]×2.5. A manufacturing method for a stock for high strength fastener includes melting of titanium alloy ingot, production of forged billed from ingot at beta and/or alpha-beta phase field temperatures, hot rolling at a heating temperature of beta and/or alpha-beta phase field to produce a round stock, subsequent annealing of a rolled stock at a temperature of 550° C. to 705° C. (1022° F. to 1300° F.) for at least 0.5 hour followed by drawing to produce a wire with diameter up to 10 mm (0.394 inches) and subsequent annealing at a temperature of 550° C. to 705° C. (1022° F. to 1300° F.) for at least 0.5 hour. A technical result is production of a titanium alloy stock for high strength fastener having high ultimate tensile strength and double shear strength while maintaining a high level of plastic properties in the annealed condition. |
| US11920215B2 |
Easily-crushable copper powder and manufacturing method therefor
Provided is a copper powder manufactured by means of a wet method, wherein the absolute value of the zeta potential of the copper powder is at least 20 mV. The copper powder can be manufactured so as to reduce the burden of the steps of crushing a dry cake and classification, and there is a sufficient reduction in residual secondary particles. |
| US11920214B2 |
Plant and method for the recovery of exhausted refractory material
Plants and methods recover spent refractory material and comprise at least one receiving area for said refractory material, at least one material sieving area, at least one magnetic separation area, and at least one sorting area. Said receiving area communicates with a first sieving area divides said refractory material in at least two fractions based on sizes of said refractory material. A second sieving area divides a fine fraction into at least two sub-fractions. |
| US11920213B2 |
Method for recycling battery by incomplete extraction
Disclosed is an incomplete extraction method for recycling batteries, which may include: introducing a pretreatment gas into a device loaded with a waste battery powder, and bringing a gas outlet into communication with absorption liquid A and absorption liquid B in order; raising the temperature and introducing the pretreatment gas; reducing the temperature and introducing a reaction gas; raising the temperature, introducing the reaction gas, and then introducing the pretreatment gas; and reducing the temperature, and turning off the pretreatment gas; adding an extractant to absorption liquid A, mixing the mixture, taking organic phase A, adding a stripping agent, and taking aqueous phase A; and adjusting the pH to acidity, then adding an extractant, taking organic phase B, adding a stripping agent to obtain a stock solution enriched in Li, Mn, Ni and Co. |
| US11920211B2 |
Method for obtaining concentrated brine of minimum impurity content from brine found in natural salt flats and salt marshes, said method having minimum environmental impact and maximum lithium recovery
A procedure of minimum environmental impact and maximum lithium recovery for obtaining concentrated brines with minimal impurity content from brines that embed natural salt flats and salt marshes, the procedure wherein the following stages are comprised: a) building fractional crystallization ponds by solar evaporation; b) filling the ponds with natural brine; c) initially pre-concentrating natural brine to the maximum possible lithium concentration in the liquid phase without precipitating lithium-containing salts; d) cooling the pre-concentrated brine obtained in c) ensuring maximum precipitation of salts containing sulfate anion; e) chemically pre-treating the liquid phase of brine separated from precipitated salts by cooling to minimize sulfate anions in the liquid phase after cooling; f) finally pre-concentrating the pre-treated liquid phase to the maximum possible lithium concentration in it without precipitating lithium-containing salts; g) chemically treating the liquid phase of brine separated from precipitated salts at the stage f) to minimize the concentration of magnesium, calcium, boron and sulfate in the liquid phase; and h) concentrating the liquid phase obtained at the stage g). |
| US11920209B2 |
Carbide-free bainite and retained austenite steels, producing method and applications of same
One aspect, this invention relates to a carbide-free bainite and retained austenite steel including a composition designed and processed such that the carbide-free bainite and retained austenite steel meets property objectives comprising a yield strength in a range of about 1000-2000 MPa, a uniform ductility, a desired total elongation and hole-expansion ratio, a desired level of weldability and an austenite stability designed to have an austenite start temperature Msσ to be equal to an application temperature in range from about 50° C. to −50° C. The property objectives are design specifications of the carbide-free bainite and retained austenite steel. |
| US11920208B2 |
High strength and high formability steel sheet and manufacturing method
A cold-rolled and heat-treated steel sheet, has a composition comprising, by weight percent: n0.10%≤C≤0.25%, 3.5%≤Mn—≤6.0%, 0.5%≤Si≤2.0%, 0.3%≤Al≤1.2%, with Si+Al≥0.8%, 0.10%≤Mo≤0.50%, S≤0.010%, P≤0.020%, N≤0.008%. The cold-rolled steel sheet has a microstructure consisting of, in surface fraction: between 10% and 45% of ferrite, having an average grain size of at most 1.3 μm, the product of the surface fraction of ferrite by the average grain size of the ferrite being of at most 35 μm %, between 8% and 30% of retained austenite, the retained austenite having an Mn content higher than 1.1*Mn %, Mn % designating the Mn content of the steel, at most 8% of fresh martensite, at most 2.5% of cementite and partitioned martensite. |
| US11920206B2 |
Cold rolled flat steel product for packaging and method for producing a steel flat product
A cold rolled steel flat product for packaging made of a low carbon steel having a thickness of less than 0.49 mm and a method of making. The steel flat product has a martensite-free microstructure and represents a standard grade for packaging with tensile strengths from 300 to 550 MPa, which can be produced from a cold-rolled steel sheet with a carbon content from 0.01% to 0.1% by weight by inductive annealing of the steel sheet and subsequent water cooling for quenching the recrystallization-annealed steel sheet. To achieve flatness of 5 I-units or less, the induction annealed steel sheet is first primarily cooled in the manufacturing process to a take-off temperature at a rate of less than 1000 K/s, with the take-off temperature being below the transformation temperature of 723° C., and thereafter a secondary cooling by water cooling with a water temperature of less than 80° C. at a rate of more than 1000 K/s. |
| US11920204B2 |
Oxygen injection for reformer feed gas for direct reduction process
A direct reduction plant is disclosed. The direct reduction plant includes an oxygen injection system, a reformer, and a shaft furnace. The oxygen injection system includes an oxygen injection reactor and a main oxygen burner. The oxygen injection reactor is adapted to receive a gas mixture. The main oxygen burner is adapted to increase a temperature of the gas mixture by burning a mixture of fuel and oxygen fed to the main oxygen burner. The reformer is adapted to reform the gas mixture with the increased temperature. The shaft furnace is adapted to reduce iron ore using the reformed gas mixture. |
| US11920202B2 |
Unbiased identification of tumor rejection mediating neoepitopes
Described herein is an unbiased method of identifying tumor rejection mediating neoepitopes (TRMNs). Putative neoepitopes from a cancer cell exome sequence from a cancer patient are putative neoepitopes are unbiased by MHC binding and/or CD8T* reactivity. By plotting the putative neoepitope IC50s on one axis, and the non-mutated amino acid sequence IC50s on a perpendicular axis to provide a bivariate scatter plot, novel TRMNs are identified TRMNs the neoepitopes in the bivariate scatter plot which are in the space greater than 501 nM on the x-axis and greater than 501 nM on the y-axis. Peptides and nucleic acids for expressing peptides including the TRMNs are also described. |
| US11920196B2 |
Circulating microRNAs in knee osteoarthritis and uses thereof
A method comprising obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; and detecting a presence of or measuring a level of novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4). Also provided are methods where additional miRNAs are detected including novel miRNA 5 (SEQ ID NO: 5), novel miRNA 6 (SEQ ID NO: 6), novel miRNA 7 (SEQ ID NO: 7), novel miRNA 8 (SEQ ID NO: 8), novel miRNA 9 (SEQ ID NO: 9), novel miRNA 10 (SEQ ID NO: 10), novel miRNA 11 (SEQ ID NO: 11), novel miRNA 12 (SEQ ID NO: 12), novel miRNA 13 (SEQ ID NO: 13), hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p and/or hsa-miR-543. |
| US11920192B2 |
Single nucleotide detection method and associated probes
A method of sequencing a nucleic acid comprising (1) generating a stream of single nucleoside triphosphates by progressive enzymatic digestion of the nucleic acid; (2) producing at least one oligonucleotide used probe by reacting, in the presence of a polymerase, at least one of the single nucleoside triphosphates with a corresponding biological probe comprising (a) a first single-stranded oligonucleotide including an exonuclease blocking-site, a restriction endonuclease recognition-site located on the 5′ side of the blocking-site and including a single nucleotide capture-site e, and at least one fluorophore region and (b) a second and optionally a third single-stranded oligonucleotide each separate from the first oligonucleotide; (3) cleaving the first oligonucleotide strand of the used probe at the recognition-site with a restriction endonuclease; (4) digesting the first oligonucleotide component with an enzyme to yield fluorophores in a detectable state and (5) detecting the fluorophores released in step (4). |
| US11920191B2 |
Systems and methods for assessing biological samples
An instrument for biological analysis includes a base, an excitation source, an optical sensor, an excitation optical system, and an emission optical system. The base is configured to receive a sample holder comprising a plurality of biological samples. The optical sensor is configured to receive emissions from the biological samples in response to the excitation source. The instrument may additionally include a sensor lens enclosed by a lens case and a focusing mechanism including a gear that engages the lens case, the focusing mechanism being accessible outside the enclosure for adjusting a focus. The may instrument further include a sensor aperture dispose along an emission optical path and a blocking structure disposed to cooperate with the sensor aperture such that none of the reflected radiation from an illuminated surface near the sample holder is received by the optical sensor that does not also reflect off another surface of the instrument. |
| US11920188B2 |
Combinatorial microarray assay for clade variant detection
Provided herein is a method for detecting the presence of clade variants in the COVID-19 virus in a human sample and/or an environmental sample. Samples are processed to obtain total RNA. The RNA is used as a template in a combined reverse transcription and amplification reaction to obtain fluorescent COVID-19 virus amplicons. These amplicons are hybridized on a microarray with nucleic acid probes having sequences that discriminate among the various clade variants. The microarray is imaged to detect the clade variant. Also provided is a method of distinguishing each clade variant from others by generating an intensity distribution profile from the image, which is unique to each of the clade variants. |
| US11920176B2 |
Method for producing biogas from waste liquid/residue after diosgenin extraction from Dioscorea composita by aluminum chloride
Disclosed is a method for producing biogas from a waste liquid/residue after diosgenin extraction by aluminum chloride. Specifically, in a fermentation vessel, an anaerobic sludge and a waste residue from diosgenin extraction by aluminum chloride are added at a volatile solids ratio of (1-3):(1-2), or a seeding sludge and a diosgenin waste liquid are added with an organic loading having a VS:COD ratio of (1-2):(1-2); and then the above components are fermented at 35-37° C. for 5-25 d such that biogas is produced. According to the method of the present invention, the maximum cumulative biogas production rates are 255.4 mL/g VS for waste residue and 326.9 mL/g COD for waste liquid, and throughout the fermentation period, ammoniacal nitrogen values are below 1500 mg/L and pH variation is within the normal range, and the COD removal rate for the fermentation broth is 91.11%. |
| US11920170B2 |
Alpha-amylase combinatorial variants
Disclosed are compositions and methods relating to variant alpha-amylases. The variant alpha-amylases are useful, for example, for starch liquefaction and saccharification, for cleaning starchy stains in laundry, dishwashing, and other applications, for textile processing (e.g., desizing), in animal feed for improving digestibility, and for baking and brewing. |
| US11920162B2 |
Ex-vivo culture system and methods of using same
Ex-vivo culture systems are provided. Accordingly there is provided a culture system comprising a culture medium and a precision-cut tissue slice placed on a tissue culture insert, wherein the precision-cut tissue slice is maintained in a highly oxygenated atmosphere containing at least 50% oxygen and wherein said culture is rotationally agitated facilitating intermittent submersion of the tissue slice in the culture medium. Also provided are methods of culturing a tissue and methods of using the culture system for selecting a drug for the treatment of a disease. |
| US11920160B2 |
Pancreatic insulin-producing beta-cell lines derived from human pluripotent stem cells
Production of beta-cells from stem cells from pluripotent stem cells have always been significantly lacking in at least one of the following properties: 1) functional properties related to insulin-production and glucose signaling response, 2) mature phenotype such as biochemical markers or cell structures, 3) efficiency in production of differentiated cells. Described herein is multistep differentiation protocol which substantially overcomes all of the existing limitations. Pluripotent stem cells, including induced pluripotent stem cells (iPSCs), and embryonic stem cells (ESCs) can be differentiated using an embryoid body (EB) formation step, followed by B maturation via endothelial cells (EC) co-culturing and incubation with a sequential series of bone morphogenic protein (BMP)-related growth factor cocktails. The resulting cells displayed functional properties, including insulin-production and glucose signaling response, and mature phenotype of C-peptide expression. |
| US11920159B2 |
Methods for expanding hematopoietic stem cells using revitalized mesenchymal stem cells
A method for revitalizing mesenchymal stem cells (MSC) maintained in culture by transducing the MSC with vectors encoding a specific gene combination, as well as methods of use of MSC so revitalized in co-culturing hematopoietic stem cells. |
| US11920157B2 |
Applications of butylidenephthalide
Applications of butylidenephthalide (BP), comprising the use of BP in providing a kit for promoting differentiation of stem cells into brown adipose cells, and the use of BP in preparing a medicament, wherein the medicament is used for inhibiting the accumulation of white adipose cells, promoting the conversion of white adipose cells into brown adipose cells, inhibiting weight gain and/or reducing the content of triglycerides, glucose, and total cholesterol in blood. |
| US11920156B2 |
Engineered natural killer (NK) cells and compositions and methods thereof
The present invention provides engineered Natural Killer (NK) cells and methods of producing engineered NK cells. The engineered NK cells and compositions containing the engineered NK cells are useful for treating diseases such as cancer. |
| US11920149B2 |
Diaphragm-specific nucleic acid regulatory elements and methods and use thereof
The present invention relates to nucleic acid regulatory elements that are able to enhance diaphragm-specific expression of genes, in particular expression in diaphragm as such, or in combination with expression in cardiac muscle and/or skeletal muscle, methods employing these regulatory elements and uses of these elements. Expression cassettes and vectors containing these nucleic acid regulatory elements are also disclosed. The present invention is particularly useful for applications using gene therapy, more particularly diaphragm-directed gene therapy, and for vaccination purposes. |