Document Document Title
US11745235B2 Method and device for controlling a stretch reducing rolling mill for wall thickness compensation
A stretch reducing rolling mill for rolling pipes has a plurality of roll stands arranged in series in a conveying direction of a pipe. A wall thickness measuring device determines a wall thickness progression of the pipe prior to rolling. A control unit controls respective rotational speeds of the roll stands. A pipe position measuring device is arranged in front of the roll stands and continuously measures a current longitudinal coordinate of the pipe. The measured values of the longitudinal coordinate of the pipe are transmitted to the control unit. The control unit controls the rotational speeds of the roll stands based on both the determined wall thickness progression and the transmitted measured values of the current longitudinal coordinate of the pipe, in order to compensate for wall thickness variations of the pipe. A stretch reducing rolling mill is designed to carry out the method.
US11745232B2 Apparatus for washing containers
An apparatus for washing containers includes a support intended to be applied onto the upper edge of a container, a translating unit movable inside the container between a raised position and a lowered position, a rotating element carried by the translating unit and carrying a plurality of nozzles, and an actuation device including a vertical driving screw that controls the movement in the vertical direction of the translating unit and the rotation of the rotating member.
US11745228B2 Air knife systems
A gas knife system for an additive manufacturing system can include one or more gas delivery members configured to move relative to a build area of the additive manufacturing system, and an inlet conduit configured to supply gas to the one or more gas delivery members while the one or more gas delivery members are moved relative to the build area. The system can also include one or more gas collection members configured to move relative to the build area of the additive manufacturing system, and an outlet conduit configured collect gas from the one or more gas collection members while the one or more gas collection members move relative to the build area.
US11745225B1 System for identifying a golf ball having a radar detectable mark
A golf ball sorting system has a ball feeder, a ball mover, a detector, and a sorting system. The ball feeder may be configured to receive a plurality of golf balls. The ball mover may be configured to move each of the plurality of golf balls one at a time at a predetermined minimum speed. The detector may be configured to inspect each of the plurality of golf balls moved by the movement mechanism and output a detection result based on the inspection. The sorting system may be configured to receive the detection result and sort the plurality of golf balls based on the detection result to separate golf balls that include a mark that is not visible to an observer from golf balls that do not include a mark.
US11745223B2 Article sorting system
A system for sorting articles includes a plurality of article supporters attached to an endless chain. At least one diverting point is provided at which the articles may be removed. A plurality of lateral pushers are movable along the article supporter so as to selectively push the articles off the article supporters at the diverting point. A distributing mechanism initiates the movement of the lateral pushers. At least one diversion detection device is configured to identify a presence of each of the article supporters. A controller is configured to determine a slat number of each of the article supporters and to determine whether the article positioned on the article supporter associated with the detected slat number should be removed at the diverting point, and to actuate the distributing mechanism. The at least one diversion detection device is substantially aligned with the actuator in the direction of travel.
US11745211B2 Liquid ejection device and liquid ejection device control method
Provided is a liquid ejection device that includes a nozzle that ejects a liquid, a liquid conveying tube that conveys the liquid to the nozzle, an outer tube that is internally provided with the nozzle and the liquid conveying tube, and a first vibration applying unit that applies vibration to the nozzle or the liquid conveying tube. The first vibration applying unit is provided between the nozzle and the outer pipe or between the liquid conveying tube and the outer pipe.
US11745210B2 Pop-out sprinkler with vacuum actuated push-back
Disclosed is a sprinkler system including a controller, wherein when the sprinkler system is in a pressurized mode, the controller is configured for: rendering a first determination to transition the sprinkler system to a standby mode, and executing a first communication with a vacuum pump based on the first determination, the first communication directing the vacuum pump to activate, whereby fluid is drained from the sprinkler system.
US11745199B2 Dispensing device
A dispensing device (100) according to the invention comprises a reservoir (4) for a liquid or semi-liquid substance to be dispensed and a pumping mechanism (5) for dispensing the substance. The device is characterized in that it includes a housing (1), in which an upper body (2) and a lower body (3) are located, wherein a deformable reservoir (4) is located on or around the lower body (3) and the pumping mechanism (5) is located in the upper body (2). A supply valve (6) and a dispensing valve (8) are located in the lower body (3), and the supply valve (6) is connected by means of a lower channel (7) with the reservoir (4), and a dispensing valve (8) is connected by means of an upper channel (9) with the pumping mechanism (5).
US11745197B2 Dual compartment container adapter
An adapter receives two separate fluids from a container having two separate fluid compartments and combines the fluids into a single fluid stream for delivery to a spray fluid dispenser. The adapter comprises a unitary housing having a first open end for fluid connection to the container and a second open end for fluid connection to the spray fluid dispenser. The housing defines a manifold forming a fluid passageway therein between the first end and the second end. The manifold includes two separate first conduits formed at the first end. Each of the first conduits is connected to a respective one of the fluid compartments. The manifold further includes a second conduit in fluid communication with the second end for delivery of the combined fluids to the spray fluid dispenser. The first conduits are each in fluid communication with the second conduit.
US11745195B2 Spray nozzle device for delivering a restorative coating through a hole in a case of a turbine engine
An atomizing spray nozzle device includes an atomizing zone housing that receives different phases of materials used to form a coating. The atomizing zone housing mixes the different phases of the materials into a two-phase mixture of ceramic-liquid droplets in a carrier gas. The device also includes a plenum housing fluidly coupled with the atomizing housing and extending from the atomizing housing to a delivery end. The plenum housing includes an interior plenum that receives the two-phase mixture of ceramic-liquid droplets in the carrier gas from the atomizing zone housing. The device also includes one or more delivery nozzles fluidly coupled with the plenum chamber. The delivery nozzles provide outlets from which the two-phase mixture of ceramic-liquid droplets in the carrier gas is delivered onto one or more surfaces of a target object as the coating on the target object.
US11745185B2 Reagent container and automatic analyzing system
A reagent container according to an embodiment is used in an automatic analyzing system configured to measure a liquid mixture of a tested specimen and a reagent. The reagent container includes a case, a bag, and an outlet. The case is stored in a reagent storage. The bag is built in the case, is more flexible than the case, and is configured to contain the reagent. The reagent is taken out through the outlet.
US11745180B2 Microfluidic systems, pumps, valves, fluidic chips thereof, and applications of same
Microfluidic systems, pumps, valves and applications of the same are provided. The microfluidic system may be a pump or a valve having a fluidic chip and an actuator controlling the opening and closing of the fluidic channel in the fluidic chip. The actuator may be disposed to tilt from the fluidic chip, forming a tilted-rotor peristaltic pump. Alternatively, the actuator may be a rolling ball actuator, and different fluidic chips may be used in different applications. For example, the fluidic chip may be a spiral pump chip having spiral channels, a rotary peristaltic pump chip having multiple output channels, or a multi-port valve chip having one port interconnected with multiple different ports. An analytical valve chip may switchably interconnect bioreactor and rinse/calibration input channels to sensor and waste output channels. The actuator of a random-access valve can move from one valve position to another without opening or closing intermediate ones.
US11745176B2 Leak resistant droppers
In various implementations, a dropper for a bottle may include a bulb with a flange and an extended leg. The dropper may be used as a cap, in some implementations, with or without a skirt. The dropper may inhibit leaks from a bottle when the dropper is used as a cap for the bottle.
US11745173B2 Tin incorporated catalysts for gasoline engine exhaust gas treatments
A three-way catalyst article, and its use in an exhaust system for internal combustion engines, is disclosed. The catalyst article for treating exhaust gas comprising: a substrate comprising an inlet end and an outlet end with an axial length L; a first catalytic region comprising a first platinum group metal (PGM) component and a first PGM support material, wherein the first catalytic region comprises up to 5 wt. % Sn.
US11745172B2 Exhaust gas purification catalyst
A substrate (11) of an exhaust gas purification catalyst (10) includes inflow-side cells (21), outflow-side cells (22), and porous partition walls (23), each separating the inflow-side cell and the outflow-side cell. Catalyst portions (14, 15) are provided on the surfaces of the partition walls that each face the inflow-side cell and/or the surfaces of the partition walls that each face the outflow-side cell. In a cross section vertical to an exhaust gas flow direction, the percentage of the total area of voids, each void satisfying the expression L/{2(πS)1/2}≤1.1 (wherein L is the perimeter of the void in the cross section, and S is the area of the void in the cross section), is greater than 10% to 30% or less based on the apparent area of the catalyst portion present on the partition wall. The content of zirconium element in terms of oxide (amount of ZrO2) in the catalyst portions is from 35 mass % to 85 mass %.
US11745171B1 Metal-free photocatalyst and a method of preparation thereof
A method of preparing a photocatalyst. The method includes a sulfone-containing conjugated polyimide obtained by solvothermally imidizing 3-sulfonyldianiline 1,4,5, 8-naphthalenetetracarboxylic dianhydride with poly (amic acid) (PAA). The photocatalyst of the present disclosure can be used in an electrochemical cell for water oxidation processes.
US11745167B2 Polymer matrix composites comprising functional particles and methods of making the same
A polymer matrix composite comprising a porous polymeric network; and a plurality of functional particles distributed within the polymeric network structure, and wherein the polymer matrix composite has an air flow resistance at 25° C., as measured by the “Air Flow Resistance Test,” of less than 300 seconds/50 cm3/500 micrometers; and wherein the polymer matrix composite has a density of at least 0.3 g/cm3; and methods for making the same. The polymer matrix composites are useful, for example, as filters.
US11745162B2 Regenerable hydrogen sulfide adsorbent and preparation method thereof and application thereof
The present invention relates to a regenerable hydrogen sulfide adsorbent and a preparation method thereof. The preparation method specifically includes: 1) combining meta-aluminate as an active component with activated alumina as a carrier in a manner of impregnation, spray coating or solid phase mixing to obtain a precursor; 2) aging and drying the precursor, and finally performing roasting to obtain the adsorbent; and 3) processing the adsorbent to present a specific size and shape through shaping measures to meet industrial application requirements. Compared with the prior art, the adsorbent obtained according to the present invention can achieve an efficient removal effect on hydrogen sulfide gas at a material inlet, with a concentration adaption range of 0 to 1000 ppm and an effective removal precision of 0.1 ppm or below.
US11745160B2 Magnetically-controlled graphene-based micro-/nano-motor and fabrication method thereof
A method of fabricating a magnetically-controlled graphene-based micro-/nano-motor includes: (a) mixing FeCl3 crystal powder with deionized water to obtain a FeCl3 solution; (b) completely immersing a carbon-based microsphere in the FeCl3 solution; transferring the carbon-based microsphere from the FeCl3 solution followed by heating to allow crystallization of FeCl3 on the surface of the carbon-based microsphere to obtain a FeCl3-carbon-based microsphere; (c) heating the FeCl3-carbon-based microsphere in a vacuum chamber until there is no moisture in the vacuum chamber; continuously removing gas in the vacuum chamber and introducing oxygen; and treating the FeCl3-carbon-based microsphere with a laser in an oxygen-enriched environment to obtain the magnetically controlled graphene-based micro-/nano-motor. A magnetically-controlled graphene-based micro-/nano-motor is further provided.
US11745141B2 Photoelectrochemical device for the capture, concentration and collection of atmospheric carbon dioxide
The present disclosure relates to a carbon dioxide capture device comprising a first reactor and a second reactor both of which show a (photo)anode containing or connected to oxygen evolution and/or carbon dioxide evolution catalyst(s) and a (photo)cathode containing or connected to an oxygen reduction catalyst, wherein the first reactor comprises an anion exchange membrane placed between the porous (photo)anode and porous (photo)cathode, and the second reactor comprises a proton exchange membrane placed between the porous (photo)anode and porous (photo)cathode. On the porous (photo)cathode side of the first reactor there is a fluid inlet able to carry carbon dioxide, air and water, and on the side of the porous (photo)cathode of the second reactor there is a fluid outlet able to carry carbon dioxide and water.
US11745140B2 Water systems for onboard inerting systems of vehicles
Systems and methods for generating inerting gas on vehicles are described. The systems include a proton exchange membrane (PEM) inerting system, a pure water replenishment system configured to provide pure water to the PEM inerting system, wherein the pure water replenishment system is in fluid communication with the PEM inerting system to replenish water lost during operation of the PEM inerting system, and a control system configured to control operation of the pure water replenishment system to automatically replenish pure water to the PEM inerting system.
US11745136B2 System and method for treating a methane system to remove carbon dioxide, hydrogen sulfide, and water in a single process
A system and method for simultaneously removing water and acid gases from methane in a single process without requiring dehydration prior to acid gas removal. A feed stream comprising these components and little or no hydrocarbons heavier than methane is separated in a series of separators, including an absorber column using methanol as an absorber. A treated methane stream comprising at least 90%, more preferably at least 95%, most preferably at least 99%, of the methane from the feed stream and an acid gas waste stream comprising less than 10%, more preferably less than 5%, most preferably less than 1%, of the methane from the feed stream are produced. Using methanol as a physical solvent allows removal of water and acids gases in a single step using substantially less energy than conventional separation methods. The system and method are particularly useful in treating landfill gas feed streams.
US11745130B2 Filter kit, assembly, and method for installation within a support surface associated with a heat exchanger unit not limited to such as an air cooled liquid chiller
A filter and kit assembly for securing to one or more intake surfaces associated with a V-shaped heat exchanger unit. A screen includes a reinforced edge, within which is configured a plurality of spaced apart grommets aligning with and receiving therethrough engaging portions of the fasteners. In one variant, a frame is constructed for supporting the fasteners and attached filter and which is subsequently secured by clips against a flange surface surrounding the intake opening. In a further variant, the screen is configured in wrap-around fashion for supporting against first and second consecutively arranged intake openings along with an interconnecting intermediate flange surface.
US11745129B2 Air intake assembly and methods thereof
Disclosed herein are air intake assemblies for internal combustion engines. In some embodiments, an air intake assembly includes an air filter configured to produce filtered air, a sealed filter housing configured to house the air filter therein, and an intake tube configured to convey the filtered air to an internal combustion engine. The filter housing includes an air intake port configured to provide intake air to the air filter. The air filter is configured to remove particulate matter from the intake air and produce the filtered air. The air filter includes a multi-component coupling interface configured to accept an intake-end portion of the intake tube in the coupling interface. The filter housing includes an aperture configured to accept the coupling interlace of the air filter in the aperture. Also disclosed herein are methods of the air intake assemblies.
US11745126B2 Point-of-use solids interceptor
A solids interceptor and methods of using the same. The solids interceptor includes a tank including an open end, a wastewater inlet, and one or more wastewater outlets. A basket assembly is removably attachable to the tank via the open end between an operable position and a removed position. The basket assembly may seal the open end when in the operable position and expose the open end of the tank to a surrounding environment when in the removed position. A first and second outlet may extend away from an interior of the tank in a first and direction, respectively, with the second direction being oriented at an angle with respect to the first direction. The basket assembly may include a seal that is compressed about a circumferentially extending corner provided on the tank to thereby seal the open end of the tank and the plumbing system.
US11745125B2 Fuel filter passage for downward fuel flow direction
A center tube and a central fluid supply tube combination includes a center tube body defining a longitudinal length, and a central reservoir. The center tube also includes an apertured annular wall extending axially the majority of the longitudinal length, and a first annular solid wall extending axially from the apertured annular wall. A central fluid supply tube is disposed in the central reservoir, and includes a second annular solid wall that is radially surrounded by the apertured annular wall of the center tube. The second annular solid wall defines a supply passage with a fully circular flow flux.
US11745124B2 Cassette filter having a filter element with special folding
A cassette filter for cleaning a fluid includes: a frame; and a plurality of filter elements having a filter medium provided with a folding. The plurality of filter elements are accommodated in a frame such that at least two adjoining filter elements of the plurality of filter elements are arranged at an acute angle to one another and form a V-shaped arrangement. Each of the plurality of filter elements has folded edges which are formed by fold peaks and fold valleys and extend perpendicularly to legs of the acute angle. Each filter element of the plurality of filter elements is provided with foldings such that a height of the respective filter element is smaller at all edge regions than a height in a central region of the respective filter element, and smaller folding surfaces than the central region result at the edge regions.
US11745121B2 Inline demulsification device
Embodiments of the present disclosure describe an inline demulsification system (400, 430) including an inline flow conditioner (402,410) for separating a multiphase fluid into a liquid phase (420) and a gas phase (422), wherein the liquid phase (420) includes an emulsion; and an ultrasonic wave device (404), provided downstream from the flow conditioner (402, 410), including one or more ultrasonic probes (442) for emitting ultrasonic waves (452) towards the multiphase fluid, wherein the ultrasonic waves (452) demulsify at least a portion of the emulsion. Embodiments of the present disclosure also describe related systems and methods.
US11745119B2 Chromatography and synthesis column apparatus and method of assembly
Chromatography and synthesis columns, assemblies, components, and methods of assembly and disassembly are disclosed including a support assembly having lifting mechanisms in each of the legs to raise and lower a frame secured to the column, a swing arm and/or carriage guiding movement of a bottom plate of the column, a bolt-free coupling between the main tube and bottom plate of the column, and upper and lower slurry ports in the main tube of the column.
US11745117B1 Atmospheric water harvesting generator
An atmospheric water harvesting generator includes an adsorbent with a nanopore structure and a moisture-condensing substrate with an amphiphilic structure such that water can be efficiently harvested from the atmosphere even in a dry climate, the generator is easy to operate with little power, and the flow of air can be controlled with a simple control to efficiently and continuously harvest water.
US11745114B1 Adjustable weighted balloon handle
The present invention is directed to an adjustable weighted balloon handle that allows for a balloon to levitate an intermediate distance off the ground. The adjustable weighted balloon handle includes a plurality of strips having a plurality of perforations creating tabs, wherein the tabs may be removed to adjust the weight of the handle. The adjustable weighted balloon handle may solve a number of problems currently associated with helium and other lighter-than-air balloons. Namely, the adjustable weighted balloon handle may allow a user to levitate a balloon off the ground and not force the user to tether the balloon to a surface.
US11745109B2 Methods for controlling use of computing resources, such as virtual game consoles
An artificial intelligent agent can act as a player in a video game, such as a racing video game. The game can be completely external to the agent and can run in real time. In this way, the training system is much more like a real world system. The consoles on which the game runs for training the agent are provided in a cloud computing environment. The agents and the trainers can run on other computing devices in the cloud, where the system can choose the trainers and agent compute based on proximity to console, for example. Users can choose the game they want to run and submit code which can be built and deployed to the cloud system. A resource management service can monitor game console resources between human users and research usage and identify experiments for suspension to ensure enough game consoles for human users.
US11745104B2 Method and system for providing interactive content delivery and audience engagement
A method for interactive video content is disclosed. The method may include receiving a first video program stream from a first content provider server; displaying the first video program stream received from the first content provider server; displaying an on-screen tracking overlay selector, the on-screen tracking overlay selector including one or more selectable buttons, the one or more selectable buttons including a first selectable button associated with information from one or more third-party providers; receiving a second video program stream from a second content provider server, the second video program stream including embedded overlay content associated with the first selectable button from the at least one of the one or more third-party service providers; and displaying the second video program stream including the embedded overlay content associated with first selectable button from the at least one of the one or more third-party providers.
US11745100B2 Non-transitory computer readable medium, method of controlling a game, and information processing system with modification of identification images based on change to game parameter
A system that stores information related to a first plurality of game contents; receives a first user operation to select a second plurality of game contents from among the first plurality of game contents; controls a display to display a plurality of identification images based on information corresponding to the second plurality of game contents; receives a second user operation to change a first parameter corresponding to the second plurality of game contents; and modifies each of the plurality of identification images in accordance with the change to the first parameter.
US11745099B2 Systems and methods of transferring state data for applications
A computer system that includes at least two game devices is provided. A first game device is used by a user to play a game and a second game device is used to receive state data regarding playing the game on the first game device. The state data is continuously applied to a game that is executed on the second game device to allow for the user to seamlessly transition to playing the game on the second game device.
US11745092B2 Domino apparatus
A game piece assembly includes: a front surface formed in a first predetermined shape and including a predetermined number of pips, a back surface formed in a second predetermined shape, a side surface extending between the front and back surfaces, wherein the front surface, the back surface and the side surface define a hollow space that is configured to hold a prize therein in a closed configuration.
US11745091B2 Handheld touch apparatus with movable tactile features
A handheld touch apparatus for providing a variety of tactile sensations to the fingers and thumb of a hand of a user. The touch apparatus includes a multi-faceted block body having an outer surface defined by a plurality of planar faces joined together by radiused edges that meet together to form rounded corners. The block body is sized for holding within the palm of the user's hand and for being supported, rotated and manipulated by the fingers and thumb of the same hand. The touch apparatus further includes tactile features extending from the planar faces of the block body and that are selectively movable relative to their associated planar faces. The tactile features are contained within the volume of an imaginary sphere defined by the rounded corners and isolated from the tactile features on adjacent planar faces by the radiused edges of the block body.
US11745088B1 Traction pad system for skateboards and surfboards
A traction system comprising interchangeable hollow kick tails, mounting plates and traction pad material for mounting to the deck of a surfboard and skateboard, and a skateboard uniquely designed to have the same arched deck as a typical surfboard so that said mounting plates can be used to mount the hollow kick tails to surfboards and said skateboard. The kick tails are configured with a ramped face angled optimally for surfing. Different variations include a ramp to a flat top, a ramp to a vertical face, a ramp to an angled overhang and a ramp to a horizontal overhang. The wide ramp area design in the kick tails provides support for the entire rear foot while surfing and helps the surfer perform aggressive maneuvers without falling. The interchangeable kick tails can be removed from a surfboard and attached to a surfer's skateboard or removed from their skateboard.
US11745086B1 Onewheel support systems and apparatus
Apparatus and systems are provided that enhance the use of a one wheel skateboard. Some of the apparatus described provide lateral surfaces that engage outer portions of a user's feet. Other apparatus facilitate the engagement of common snowboard bindings to a one wheel skateboard, thereby widening the spectrum of tricks that can be performed.
US11745083B2 Physical balance training system using foot sensors, real-time feedback, artificial intelligence, and optionally other body sensors
A wearable, flexible, bio-sensing housing with physical feedback, with software running on a user's wirelessly connected smart device. The housing has embedded at least one of pressure, movement, temperature, velocity, and acceleration sensors, and at least one of a haptic, vibrational, audio, visual, kinesthetic, tactile, olfactory, thermal, vestibular, and somatosensory feedback mechanisms. The feedback being triggered by measurements from the sensors and predetermined parameters, as compared by the smart device's software and/or a connected server. With real-time measurements and real-time feedback directly to the user's body, the user can perform real-time adjustment of his activity to obtain optimal performance and/or health.
US11745082B2 Position-based laser range finder
Techniques are provided for implementing a system for determining the range to a target object and orienting a map. In implementations, GPS data is used to determine the location of the system and an approximate distance from that location to the target. Based on the approximate distance, one or more parameters of operation of the system may be set. Modes of operation may be entered to further adjust parameters of operation. An optical pulse may then be projected at the target and its reflections collected and analyzed to calculate a distance measurement. A visual display may be adjusted based on the calculated distance estimate to the target.
US11745078B2 Apparatus, systems, and methods for training a sports player
A training apparatus is disclosed that comprises an obstacle member defining a pass-under area for a sports player to pass a sport-projectile through when in use. The training apparatus comprises a first sensor that is configured to detect the sport-projectile passing through the pass-under area, and a controller that is configured to determine a pass-through direction of the sport-projectile that passes through the pass-under area based on data received from the first sensor. The training apparatus also comprises a lighting fixture indicating an instructed pass-through direction for the sports player to pass the sport-projectile through the pass-under area. A system for training a sports player is described that comprises a plurality of training apparatuses that are remotely configurable to define a training drill for a sports player and to collect training data from execution of the training drill. A method for training a sports player is also disclosed.
US11745077B1 System and method for a user adaptive training and gaming platform
A method for adaptive user training and gaming utilizing a media player is disclosed. The method includes operations of receiving, by control logic, data pertaining to selection of a first training program, transmitting, by the control logic, media instructions to cause activation of a media player configured to display visual data corresponding to the first training program, and transmitting, by the control logic, ball-throwing instructions to cause activation of a ball-throwing machine configured to impart motion to one or more balls in accordance with the first training program. The method includes additional operations of recording, by the control logic, an indication of the first training program in a player profile. Additional operations includes recording, by the control logic, training data indicating metrics associated with performance of the first training program.
US11745074B1 Golf swing training aid
A golf swing training aid comprises a set of components which include a substantially cylindrical grip bar with a first larger end tapering to a second smaller end so as to resemble the grip portion of a golf club. The grip bar has a first attachment eye at its first end. An extendable tensile member with first and second attachment affordances at its ends, such as clips or formed wire hooks, is attached to the first attachment eye at one end and a second attachment eye at the other end. A foot band attachment bracket has a second attachment eye and a base plane which is stepped upon for stability while a user exercises or practices golf swings while working against tensile resistance developed in the tensile member. The attachment component may be formed of sheet metal or made of formed metal wire in whole or in part.
US11745073B2 Punching-training device
A punching-training device is provided, including: a seat portion; a support portion, connected with the seat portion; a punched portion, connected with the support portion; and an elastic assembly, disposed on the support portion, the elastic assembly including a first elastic member and a second elastic member, at least one of the first elastic member and the second elastic member being movably relative to the support portion between a first position and a second position to change a relative position of the first elastic member and the second elastic member.
US11745070B2 Basketball goal assembly with return chute
A basketball return chute assembly includes a chute and a backboard attachment device. The chute is adapted to receive a ball from a basketball basket assembly attached to a backboard and direct the received ball back to a game player. The backboard attachment device is connected to the chute and is adapted to attach to the backboard, to place the chute beneath the basket assembly, and to cause the chute to direct the received ball in a direction away from the backboard. The backboard attachment device is connected to the chute via a hinge. The chute includes a slide with a knuckle at one end and the backboard attachment device includes a plate with another knuckle at one end. The slide is one leaf of the hinge, and the plate is the other leaf of the hinge. The hinge is held together using a pin inserted through the knuckles.
US11745067B2 Golf club heads and methods to manufacture golf club heads
Embodiments of golf club heads, golf clubs, and methods to manufacture golf club heads and golf clubs are generally described herein. In one example, a golf club head includes a body portion being hollow to define an interior cavity, a filler material in the interior cavity, and a face portion, which may include a face perimeter portion having a perimeter edge defined by a face toe edge, a face heel edge, a face top edge, and a face sole edge, a face recess portion on the back surface and having a recess perimeter portion at least partially surrounded by the face perimeter portion, and a plurality of back groove portions in the face recess portion. The plurality of back groove portions may extend proximate to the recess perimeter portion along at least 50% of the recess perimeter portion. Other examples and embodiments may be described and claimed.
US11745065B2 Iron type golf club head
Iron-type golf club heads are disclosed having a heel portion, a sole portion, a toe portion, a top-line portion, a front portion, a rear portion, and a striking face. The iron-type golf club heads include a localized stiffened region that is located on the striking face of the club head such that the localized stiffened region alters the launch conditions of golf balls struck by the club head in a way that wholly or partially compensates for, overcomes, or prevents the occurrence of a rightward deviation. In particular, the localized stiffened region is located on the striking face such that a golf ball struck under typical conditions will not impart a right-tending sidespin to the golf ball.
US11745062B2 Golf club head faceplates with lattices
Embodiments of golf club head faceplates comprising a lattice to improve the energy storage capabilities and minimize stress concentrations are described herein. The lattice can comprise a plurality of flexure shapes that facilitate in faceplate bending. The flexure shapes of the lattice can comprise a reentrant, concave, or non-convex shape. The lattice can comprise at least one repeating pattern of flexure shapes that can be interconnected or spaced apart. During golf ball impacts, the flexure shapes flex to store energy through linear and torsional bending.
US11745060B2 Golf club head with undercut and insert
The invention described herein is an iron-type golf club head having a back cavity and a multi-section back cavity insert that preserves more flexibility of the strike face and energy return to the golf ball.
US11745059B2 Golf ball pickup tool
A golf ball pickup tool is provided. The golf ball pickup tool can be extended to an appropriate length when picking up a golf ball and can be shortened when carrying. The grip 10 is sized so as to accommodate holder pieces 11a and 11b that are slidable along the slide guide 17. The holder pieces 11a and 11 b are joined and fixed to each other at one ends thereof and are urged so as to close the other ends. A golf ball is held between the other ends of the holder pieces 11a and 11b in the state of the holder pieces 11a and 11b being taken out of the grip 10.
US11745058B2 Methods and apparatus for coaching based on workout history
System and method for coaching based on workout history. Improved solutions enable intelligent management of a user's personal fitness journey based on workout recommendations that closely align with the user's traits. In one exemplary embodiment, workout data for a population of different individuals is analyzed to identify groups of similarly performing individuals. Each group of individuals is analyzed to generate an expected profile that approximates the physiological and/or psychological traits of the group. An expected profile includes heuristics and/or performance metrics that enable dynamic coaching during workouts. Subsequently thereafter, user's can be dynamically coached by their client device, based on the expected profile.
US11745057B2 Fitness systems and methods thereof
Systems and methods for fitness tracking are provided. An exercise apparatus is in networked communication with a fitness tracking computing system. The configuration and location of movable components of the exercise apparatus is determined based on sensors. This information is provided to the fitness tracking computing system via networked communication.
US11745054B2 Exercise device
An exercise device is described. An exercise device includes a body, the body having a top, a bottom, a first end located at one edge of the body, a second end located at an opposite edge of the body, and first and second sides extending between the first and second ends; one or more wheels; and an energy storage device applying resistive and restoring force to the one or more wheels. Optionally, a shaft can be present that rotationally locks two or more of the wheels.
US11745051B2 Track exercise device
A track exercise device with at least first and second substantially parallel tracks, and first, second, third, and fourth movable platforms. The first and third movable platforms are movable on the first track, and the second and fourth movable platforms are movable on the second track. Transverse attachments selectively and respectively attach the first and second movable platforms together on the first and second tracks and the third and fourth movable platforms together on the first and second tracks. Longitudinal attachments selectively and respectively attach the first and third movable platforms together on the first track and the second and fourth movable platforms together on the second track. A tilting adjustment selectively provides for inclined or flat movement of the first, second, third, and fourth movable platforms.
US11745050B2 Positioning device for a portable fitness equipment
A positioning device for a portable fitness equipment mainly provides a support frame for hanging the portable fitness equipment. The support frame includes a base and a support rod connected to each other, and there is an obtuse angle between the base and the support rod. The obtuse angle design allows the position where the support rod is connected to the base to bear less torque, which can effectively prevent the support rod from shaking or damage; and the portable fitness equipment can slide or can be fixed on the support rod, allowing users to adjust the portable fitness equipment to the most suitable height.
US11745049B2 Exercise devices for muscle isolation
An exercise device is provided to couple a user's limb to a resistance mechanism and to tighten on the user's limb by a force applied in opposition to the resistance mechanism. The device may include a strap including a first portion, a second portion, and a third portion. The strap may define an adjustable opening configured to receive the user's limb. The first portion and the third portion of the strap may be attached to a closed loop shape configured for coupling to the resistance mechanism. A fixed opening may be coupled to the strap, and the adjustable opening of the strap may be formed by passing the second portion of the strap through the fixed opening. The device may also include a flexible material coupled to the strap and defining a tube providing the fixed opening.
US11745045B2 Weight adjustable exercise device
A weight adjustable exercise device includes a base unit and a handle unit. Two magnetically attractive members are spacedly disposed on the base unit. Two weight sets are supported by the base unit, and respectively have a plurality of weights. The handle unit includes a handle shaft, two anti-rotation modules non-rotatably sleeved around two opposite end portions of the handle shaft and insertable downwardly in the base unit, two weight adjusting modules respectively mounted on the anti-rotation modules, and two indexing discs rotatably mounted on the weight adjusting modules. Each weight adjusting module has selector assemblies rotated with the handle shaft to selectively engage with or be disengaged from the corresponding weights. Each anti-rotation module has a magnet member removably engaged with the corresponding indexing disc and movable by a magnetically attractive force of the corresponding magnetically attractive member to be disengaged from the corresponding indexing disc.
US11745043B2 Locking mechanism
A lock mechanism which can be placed on a shaft, such as a bar or pole, in either a first direction or second direction, is secured to the shaft using two sets of balls which project out of apertures in an inner cylinder to frictionally engage the shaft. The balls are selectively retractable from their projecting position to allow the inner cylinder to slide on and/or be removed from the shaft. Biasing members, such as wavy springs, bias the two sides of the lock mechanism towards one another. In the locked configuration, the balls are forced by inclined surfaces within the two sides to project outwardly from the inner hollow cylinder. The inclined surfaces are aligned with two rows of apertures in the inner hollow cylinder, and they are inclined in opposite directions. Thus, either way the lock mechanism is installed or placed on the shaft, the balls will project out of the apertures in the inner hollow cylinder and will securely engage the shaft.
US11745036B2 Fire protection system
A fire protection system 100 includes one or more fire protection components 12 that can each generate messages indicating an event. Messages are determined to be indicative of either critical or non-critical events. Data associated with messages indicative of critical events is stored in a first collection of event data 32, while data associated with messages indicative of non-critical events is stored in a second different collection of event data 32.
US11745032B2 Detachable thrust device for opening a door
A thrust device for opening a door which can be assembled from a ready-to-assemble assembly of at least three parts by reversible attachment devices, which can be manually activated and deactivated, and able to maintain a rectilinear alignment of the lower and upper parts of the lower and upper support bars.
US11745029B2 Radiosurgical neuromodulation close to critical structures
Methods of treatment and treatment systems for performing radiomodulatory stereotactic radiosurgery to treat brain disorders in which target neural tissues associated with the brain disorder are sensitized to radiation by administration of a molecular substance and/or non-targeted critical structures are protected from radiation by a molecular substance, in order to treat disorders of brain circuitry. Specific embodiments disclose means for treating pain, obesity and drug addiction.
US11745019B2 Systems and methods to locate an implantable stimulator device inside a subject
Implementations provide a method that includes: placing a controller device over a surface region of the patient where the implantable wireless stimulation device has been implanted; configuring the controller device to (i) monitor a return loss representing electrical power reflected from the implantable wireless stimulation device to the controller device; (ii) compute a first path loss metric based on a first monitored return loss when the controller device is place over a first location within the surface region; (iii) compute a second path loss metric based on a second monitored return loss when the controller device is over a second location within the surface region; and (iv) generate a feedback to an operator to indicate whether the second path loss is smaller than the first path loss such that the controller device is placed at a location with more electrical energy non-inductively transferred to the implantable wireless stimulation device.
US11745016B2 Adjustment of analgesic stimulation parameters based on trust dynamic measurements
Systems and techniques are disclosed to establish programming of an implantable electrical neurostimulation device for treating pain of a human subject, through the use and adjustment of analgesic stimulation parameters based on trust dynamics and trust measurements. In an example, the system to establish programming of the neurostimulation device performs operations that: determine a trust measurement value that is derived from results of at least one commitment made with a human subject, via observable interactions; determine a modification of at least one neurostimulation programming parameter, based on the trust measurement value; and to cause the implantable neurostimulation device to implement the modification of the at least one neurostimulation programming parameter. Further examples are provided to produce and track the trust measurement value, as well as identify a pain susceptibility value and determine a receptiveness to analgesic effects based on these and other trust dynamics.
US11745015B2 Neurostimulator with titration assist
A method of neurostimulation titration. The method includes setting titration parameters for an electrical signal delivered by an implantable medical device, initiating titration with the titration parameters and an aggressiveness profile, performing titration by increasing at least one of a current amplitude, a frequency, a pulse width or a duty cycle of the electrical signal until a threshold is reached or a side effect is detected, pausing the titration while waiting for commands from the patient or caregiver, and resuming the titration in response to receiving authorization from an external device.
US11745011B2 Apparatus and method for positioning, implanting and using a stimulation lead
An introducing device for locating a tissue region and deploying an electrode is shown and described. The introducing device may include an outer sheath. An inner sheath may be disposed within the outer sheath. The inner sheath may be configured to engage an implantable electrode. In an example, the inner sheath may comprise a stimulation probe having an uninsulated portion at or near a distal end of the delivery sheath. The outer sheath may be coupled to a power source or stimulation signal generating circuitry at a proximal end. A clinician may control application of the stimulation signal to a tissue region via the outer sheath.
US11745010B2 Nerve stimulation device for current steering
A nerve stimulation system including at least one nerve interface device is disclosed. The device includes a cuff portion having an assembled position in which the cuff portion forms at least part of a passageway for receiving a nerve along a longitudinal axis passing through the passageway; and first and second rings of electrodes mounted on the cuff portion, each ring of electrodes including a plurality of electrodes, and wherein each electrode in the first ring has a corresponding longitudinally-aligned electrode in the second ring so as to form a plurality of pairs of electrodes spaced apart from each other along the longitudinal axis. The system includes a stimulation device in communication with the pairs of electrodes to generate different electrical signals for the pairs of electrodes and a control system that causes the different signals to causes different physiological responses.
US11745007B2 Multi-electrode stimulation therapy with reduced energy
A device for neurostimulation has a number N of electrodes. N is equal to or larger than 3. The device is configured to deliver via each electrode therapeutic electric phases of amplitudes I1, I2, . . . IN, with a frequency f and after each therapeutic electric phase a number of N−1 charge balancing electric phases. The charge balancing electric phases of the respective electrode each have a polarity that is opposite the polarity of the preceding therapeutic electric phase of the respective electrode. The device is configured to return for each electrode the current of each therapeutic electric phase in the other N−1 electrodes.
US11744995B2 Unidirectional catheter control handle with tensioning control
A catheter includes a tip electrode with a shell and a support member to provide a plenum chamber. The plug is formed with a U-shaped passage for a safety line to wrap around and secure the support member (with the shell affixed thereto) to the catheter. Additional passages are formed in the plug to accommodate components such as irrigation tubing, lead wire and thermocouple wire pair. A method of manufacture provides distal installation and/or anchoring of the safety line, lead wire and thermocouple wire pair in the support member prior to sealing the support member and mounting the shell.
US11744991B2 Compound curve navigation catheter
A catheter assembly for navigation including a flexible catheter having a proximal portion adjacent a proximal end and a distal portion adjacent a distal end and defining a longitudinal axis, the flexible catheter defining a lumen extending therethrough along a longitudinal axis and configured to enable translation of an instrument from the proximal end to the distal end. The flexible catheter defines a compound curve formed on the distal portion, wherein the compound curve includes an elbow bend and a radially curved portion. The elbow bend deflecting the distal portion of the flexible catheter from the longitudinal axis, while the radially curved portion extends from the elbow bend farther deflecting the distal portion about a center point. The catheter guide assembly for navigation includes a control handle disposed at the proximal end of the flexible catheter and is configured to advance and rotate the flexible catheter within a luminal structure.
US11744983B2 Catheter lock solution comprising sodium citrate and benzyl alcohol
This disclosure generally relates to catheters, methods of enhancing the patency of an intravascular catheter and compositions, methods, devices and kits relating to the infusion of a catheter lock solution into an indwelling catheter. Disclosed compositions, methods, devices and kits aid in diminishing the effects of microbial infection in catheters and occlusion of the catheters. A representative lock solution includes about 10% sodium citrate and about 1.5% benzyl alcohol. The solution has a density approximating the density of blood for retention of the solution in a catheter during the lock period.
US11744981B2 Internet of things (IoT) real-time response to defined symptoms
Systems, computer-implemented methods and/or computer program products that facilitate real-time response to defined symptoms are provided. In one embodiment, a computer-implemented method comprises: monitoring, by a system operatively coupled to a processor, a state of an entity; detecting, by the system, defined symptoms of the entity by analyzing the state of the entity; and transmitting, by the system, a signal that causes audio response or a haptic response to be provided to the entity, wherein transmission of the signal that causes the audio response or the haptic response is based on detection of the defined symptoms.
US11744975B2 Method of manufacturing an anesthesia face mask
Methods of manufacturing a mask include: providing a shell having an inlet formed on a body of the shell and a flange formed around a lower end of the body, the flange forming a surface on a bottom thereof; providing a first film substrate; providing a second film substrate; bonding the first film substrate to the second film substrate around an outer edge and around an inner edge shaped to fit around a nose and mouth of a patient; cutting the first film substrate and the second film substrate around the outer edge and the inner edge of the first film substrate and the second film substrate. The bonded and cut first film substrate and second film substrate form a first sheet that is joined to a second sheet. The shell is joined to the first sheet at the surface formed on the bottom of the flange.
US11744974B2 Liner for a respirator mask
A respirator mask liner is provided for positioning between a respirator mask and the face of a wearer. The mask liner includes a flexible sheet material having an outer perimeter edge portion and a hole that is spaced inwardly from the outer perimeter edge portion. At least one tab projects outwardly from portions of the perimeter edge portion, and may be unitarily formed with the sheet material. The mask liner is configured so that when it is to be placed between the face of the wearer and the respirator mask, the tab or tabs project outwardly beyond the gasket portion of the respirator mask, so that the tabs may be used for adjusting the liner or securing the liner to the mask. Optionally, the mask liner has a surface texture with a ribbed and undulating pattern of raised portions, and/or incorporates an anti-microbial substance.
US11744972B1 System and method for a tracheostomy tube with a secondary airflow opening and a dual cuff assembly
A cuff assembly for a tracheostomy tube includes an outer bladder and an inner cuff. The inner cuff is positioned adjacent to the tracheostomy tube, and the outer bladder is positioned adjacent to the inner cuff. The outer bladder is made with a less elastic material and operates at a higher relative pressure. The inner cuff is made with a more elastic or hyper-elastic material and operates at a lower relative pressure. A secondary airflow opening is formed on a lateral wall of the tracheostomy tube between the cuff assembly and a main distal opening of the tracheostomy tube.
US11744970B2 Airway device
An airway adjunct or airway assembly that comprises a gas administration tube and a gas sampling tube can be utilized to improve health care to a patient. The gas administration tube may be connected, for example, to an oxygen source. The gas sampling tube may be connected, for example, to capnography equipment. Internal terminal ends of the gas administration tube and gas sampling tube can be longitudinally offset from one another within the airway assembly, which may reduce diffusion of the exhaled gas to be sampled, thereby increasing monitoring accuracy. Some embodiments of the present disclosure comprise an airway adjunct adaptable to attach into or onto various types of airway devices.
US11744967B2 Intranasal delivery devices
The present disclosure provides devices for delivery of powder formulations and methods of manufacture and use of such devices.
US11744964B2 Electronic aerosol provision system and vaporizer therefor
A sub-assembly for an electronic vapor provision system includes a source of liquid for vaporization; and a vaporizer for vaporizing a portion of the liquid for inhalation by a user, the vaporizer including a wick component; and an electrical heating element embedded in the wick component. The wick component includes a sheet of a porous electrically-insulating material and is arranged to wick liquid from the source of liquid to a surface of the wick component adjacent to the embedded electrical heating element for vaporization.
US11744951B2 Syringe with injection dose adjustment function
A syringe with an injection dose adjustment function, the syringe comprising a medicine vial connecting apparatus and an adjustable propulsion apparatus; by means of assembling the medicine vial connecting apparatus and a medicine vial, and then installing the adjustable propulsion apparatus in the medicine vial connecting apparatus and extending the adjustable propulsion apparatus into the medicine vial, a rotating knob of the medicine vial connecting apparatus can drive a push rod of the adjustable propulsion apparatus to move backward to a predetermined scale; at a time of injection, pressing the push rod enables the medicine vial to output a predetermined dosage of medicinal liquid, such that the syringe can adjust the dosage of the injection according to requirements of different injection subjects.
US11744949B2 System and method for detecting applied force during injection
A medical device (100) includes an insulin pen (102), a pen needle (104) and a force sensor (106). The device also includes a microprocessor (206) to receive a signal from the force sensor (106). Audible and/or visual indicators (218, 220) provide feedback to a user to encourage proper injection technique. The device may also include an adaptor assembly comprising a sensor housing (306) and a first sensor (304) within the sensor housing, and a transfer needle assembly (308), the transfer needle assembly providing a connection (310) for a pen needle, and providing a fluid conduit between the pen needle (312) and the insulin pen (302). A second force sensor (314) is associated with a thumb button of the insulin pen (302).
US11744948B2 Nested syringe assembly
Provided is an apparatus, system, and method for a nested syringe assembly. The nested syringe assembly includes a first syringe having a cylindrical body defining an inner diameter and a second syringe having a cylindrical body defining an outer diameter. The outer diameter of the second syringe is less than the inner diameter of the first syringe. At least a portion of the cylindrical body of the second syringe is disposed within the cylindrical body of the first syringe.
US11744946B2 Dynamic super bolus generation
Techniques related to automatically generating a super bolus may include determining an amount of an augmented meal bolus to be delivered to a patient for regulating the patient's glycemic response to a meal. The amount of the augmented meal bolus may exceed a sufficient amount for counteracting a glucose level increase caused by the meal. In some embodiments, the techniques may further include determining a duration of a postprandial reduction period during which basal dosage deliveries to the patient are to be reduced. In some other embodiments, the techniques may further include delivering the augmented meal bolus to the patient prior to determining whether or not to cause reduction of basal dosage deliveries. More specifically, a glucose level of the patient may be obtained after delivery of the augmented meal bolus, and the obtained glucose level may be used to determine whether to reduce basal dosage deliveries.
US11744945B2 Glucose control system with automatic adaptation of glucose target
A glucose control system employs adaptation of a glucose target (set-point) control variable in controlling delivery of insulin to a subject to maintain euglycemia. The glucose target adapts based on trends in actual glucose level (e.g., measured blood glucose in the subject), and/or computed doses of a counter-regulatory agent such as glucagon. An adaptation region with upper and lower bounds for the glucose target may be imposed. Generally the disclosed techniques can provide for robust and safe glucose level control. Adaptation may be based on computed doses of a counter-regulatory agent whether or not such agent is actually delivered to the subject, and may be used for example to adjust operation in a bihormonal system during periods in which the counter-regulatory agent is not available for delivery.
US11744944B2 Wearable automated medication delivery system
Systems and methods for automatically delivering medication to a user. A sensor coupled to a user can collect information regarding the user. A controller can use the collected information to determine an amount of medication to provide the user. The controller can instruct a drug delivery device to dispense the medication to the user. The drug delivery device can be a wearable insulin pump that is directly coupled to the user. The controller can be part of or implemented in a cellphone. A user can be required to provide a confirmation input to allow a determined amount of insulin to be provided to the user based on detected glucose levels of the user. The sensor, controller, and drug delivery device can communicate wirelessly.
US11744943B2 Integrated insulin delivery system with continuous glucose sensor
Systems and methods for integrating a continuous glucose sensor 12, including a receiver 14, a medicament delivery device 16, a controller module, and optionally a single point glucose monitor 18 are provided. Integration may be manual, semi-automated and/or fully automated.
US11744942B2 Infusion devices and related methods and systems for preemptive alerting
A method for insulin therapy includes obtaining a current glucose measurement value of a user from a sensing arrangement, obtaining a determination of a current amount of active insulin in the body of the user, identifying an amount of future insulin deliveries to be delivered by an infusion device, determining a homeostasis metric based at least in part on the current glucose measurement value, the current amount of active insulin in the body of the user, and the amount of future insulin deliveries, wherein determining the homeostasis metric comprises predicting a change in the current glucose measurement value based on accounting for metabolism of the current amount of active insulin and the amount of future insulin deliveries, and generating an alert based at least in part on the homeostasis metric.
US11744938B2 Titration for medical infusion devices and systems
Titration schemes are carried out by medical infusion devices, such as ambulatory or implantable infusion devices. The titration schemes carried out by infusion systems and devices may take into account patient side effects in controlling the rate at which a medicament is delivered from the devices of systems.
US11744929B2 Personalized renal failure chronic care systems and methods
A personalized chronic care system including (i) a sensor; (ii) a data receiving device separate from the sensor and configured to receive data directly or indirectly from the sensor; (iii) a data analytics device separate from the sensor and including at least one algorithm configured to analyze the sensor data and provide an analyzed data outcome; and (iv) at least one output device separate from the sensor and in communication with the data analytics device, the at least one output device configured to receive and communicate the analyzed data outcome to a health care provider.
US11744927B2 Dissolvable microneedle arrays for transdermal delivery to human skin
A method of forming a microneedle array can include forming a sheet of material having a plurality of layers and micromilling the sheet of material to form a microneedle array. At least one of the plurality of layers can include a bioactive component, and the microneedle array can include a base portion and plurality of microneedles extending from the base portion.
US11744924B2 Stretchable nanocomposite skin material and related structures
A stretchable multiple-layer nanocomposite material is provided and includes at least a nanocomposite material layer comprising a network of nanotubes modified with an elastomeric polymer; and at least one additional layer laminated with the nanocomposite material layer. The number of nanocomposite layers and additional layers, the nature and composition thereof, may be varied in a surface direction and/or a thickness direction so as to provide tailored mechanical and physico-chemical properties to a resulting skin that can be used to produce morphing or deployable structures.
US11744916B2 Radiopaque polymers
The present disclosure relates to radiopaque PVA polymers where the PVA has a first pendant group and a second pendant group, wherein the first pendant group comprises a first phenyl group bearing 1 to 5 iodine atoms, and the second pendant group comprises either (a) a second phenyl group bearing 1 to 3 substituents selected from the group W and optionally 1 to 4 iodine substituents, the group(s) W and the optional iodines being the sole substituents of the second phenyl group. Each W is selected from —OH, —COOH, —SO3H, —OPO3H2, —O—(C1-4alkyl), —O—(C1-4alkyl)OH, —O—(C1-4alkyl)R2, —O—(C2H5O)qR1—(C═O)—O—C1-4alkyl and —O—(C═O)C1-4alkyl; wherein R1 is H or C1-4 alkyl; R2 is —COOH, —SO3H, or —OPO3H2; q is an integer from 1 to 4; wherein the group W may be in the form of a pharmaceutically acceptable salt; or (b) a pyridyl group; which is optionally in the form of a pyridinium ion.
US11744911B2 Scent warmer having sleeve for removably attaching decorative body to base and related methods
An embodiment of the present disclosure may include a base for a scent warmer. The base may include a base member and a stem extending upwardly from the base member. The stem may be configured to carry a heating element thereon. The base may also include an elastomeric sleeve surrounding at least a portion of the stem. The elastomeric sleeve may be configured to apply a retention force between a removable decorative body and the stem. The elastomeric sleeve may include a wall member sized and configured to abut against the stem and a plurality of ribs extending radially outward from the wall member.
US11744910B1 Disinfection apparatus and related methods of use
A disinfection apparatus disclosed herein includes a chamber and a conveyor belt adapted to convey an object through the chamber, in various aspects. A nozzle array comprising at least one nozzle is positioned beneath the conveyor belt to spray a disinfectant through apertures formed in the conveyor belt onto a surface of the object oriented toward the conveyor belt, the spray communicated upward through apertures formed in the conveyor belt, in various aspects. A blower array comprising at least one blower nozzle is positioned beneath the conveyor belt to blow an air jet through apertures formed in the conveyor belt onto the surface of the object to dry the disinfectant from the object, the air jet communicated upward through apertures formed in the conveyor belt. Related methods of disinfecting objects are also disclosed herein.
US11744907B2 Predicting peptide receptor radiotherapy using a gene expression assay
The present invention is directed to methods for providing a peptide receptor radiotherapy treatment recommendation for a subject having a neuroendocrine tumor by determining the expression level of each of at least 9 biomarkers comprising ARAF1, BRAF, KRAS, RAF-1, ATP6V1H, OAZ2, PANK2, PLD3, and ALG9. In some embodiments, the methods can further include determining the expression level of each of NAP1L1, NOL3, and TECPR2.
US11744902B2 Targeting technology to selectively express mRNAs in cardiomyocytes while avoiding stimulation of cardiac fibroblasts
Disclosed is a process of having mRNA selectively adsorbed and expressed in cardiomyocytes, by coupling an aptamer which selectively targets lipid nanoparticles containing the mRNA to cardiomyocytes and does not bind to fibroblasts, to lipid nanoparticles containing the mRNA; and administering the aptamer coupled to the lipid nanoparticles containing the mRNA to a host animal under conditions suitable for expression of the mRNA in cardiomyocytes. One preferred sequence for such an aptamer is: AGCCGTTCTGGGGGGTCGACGTTGCATCGTCA (SEQ ID NO:20), and wherein the mRNA encodes Stemin and/or YAP1(5SA).
US11744900B2 Preparation of maytansinoid antibody conjugates by a one-step process
The invention provides a one-step process for preparing a cell-binding agent cytotoxic agent conjugate comprising contacting a cell-binding agent with a cytotoxic agent to form a first mixture comprising the cell-binding agent and the cytotoxic agent and contacting the first mixture comprising the cell-binding agent and the cytotoxic agent with a bifunctional crosslinking reagent, which provides a linker, in a solution having a pH of about 4 to about 9 to provide a second mixture comprising the cell-binding agent cytotoxic agent conjugate, wherein the cell-binding agent is chemically coupled through the linker to the cytotoxic agent, free cytotoxic agent, and reaction by-products. The second mixture is then optionally subjected to purification to provide a purified cell-binding agent cytotoxic agent conjugate.
US11744897B2 Folate receptor targeted nanoparticle drug conjugates and uses thereof
The disclosure relates to nanoparticle drug conjugates (NDC) that comprise ultrasmall nanoparticles, folate receptor (FR) targeting ligands, and linker-drug conjugates, and methods of making and using them to treat cancer.
US11744892B2 Constrained conditionally activated binding proteins
The invention relates to COnditional Bispecific Redirected Activation constructs, or COBRAs, that are administered in an active pro-drug format. Upon exposure to tumor proteases, the constructs are cleaved and activated, such that they can bind both tumor target antigens (TTAs) as well as CD3, thus recruiting T cells expressing CD3 to the tumor, resulting in treatment.
US11744889B2 Skin microenvironment targeted delivery for promoting immune and other responses
Methods are provided for promoting, reducing, or desensitizing various immune responses by delivery of sub-immunogenic doses of an allergen, alone or with other agents, or by delivery of antigens and adjuvants to a cutaneous microenvironment of a subject. Microneedle arrays can be used in connection with this delivery.
US11744887B2 Coronavirus vaccine compositions and methods
Provided herein are nucleic acid molecules encoding viral replication proteins and antigenic coronavirus proteins or fragments thereof. Also provided herein are compositions that include nucleic acid molecules encoding viral replication and antigenic proteins, and lipids. Nucleic acid molecules provided herein are useful for inducing immune responses.
US11744886B2 Method for producing RNA compositions
The present invention relates to a method for producing a liquid composition comprising a nanoparticle comprising at least one RNA and at least one cationic or polycationic compound, advantageously on a large scale suitable for pharmaceutical applications. The present invention further concerns the use of the inventive method in the manufacture of a medicament or a vaccine. Furthermore, the invention relates to compositions containing the RNA-comprising nanoparticle, and to pharmaceutical compositions comprising the same.
US11744885B2 Vaccines for recurrent respiratory papillomatosis and methods of using the same
Provided herein are nucleic acid molecules encoding an HPV antigen. Also provided are vaccines against human papillomavirus (HPV) comprising the nucleic acids, methods of inducing immune responses, and methods for prophylactically and/or therapeutically immunizing individuals against recurrent respiratory papillomatosis (RRP). Pharmaceutical compositions, recombinant vaccines comprising DNA plasmid and live attenuated vaccines are disclosed as well as methods of inducing an immune response to treat or prevent RRP are disclosed.
US11744884B2 Live Salmonella typhi vectors engineered to express heterologous outer membrane protein antigens and methods of use thereof
The present invention provides compositions and methods of inducing an immune response in a subject in need thereof, comprising administering to the subject an immunologically-effective amount of a live Salmonella Typhi vector comprising a heterologous antigen from a pathogen, wherein the heterologous antigen comprises an outer membrane protein, an antigenic fragment thereof or a variant thereof, wherein the antigen is delivered to a mucosal tissue of the subject by an outer membrane vesicle.
US11744883B2 Intradermal combination vaccine against mycoplasma and porcine circovirus
The present invention provides a combination vaccine comprising one or more antigens of Mycoplasmahyopneumoniae, one or more antigens of Porcine circovirus, and pharmaceutically acceptable excipients and/or carriers, for use in the prevention and/or treatment of porcine enzootic pneumonia and/or Porcine Circovirus-Associated Diseases (PCVAD) by administration of the vaccine into the dermis of livestock, wherein the one or more antigens of porcine circovirus comprises the PCV2 ORF2 protein in an amount from 0.1 μg/dose to 10 μg/dose.
US11744878B2 Methods for treatment of COVID-19 syndrome
The invention relates generally to methods for treating and modulating the severity of COVID-19 syndrome. The methods comprise administering a therapeutically effective amount of a pharmaceutical composition to a human patient, the composition comprising secretin and a pharmaceutically acceptable carrier.
US11744875B2 Peptides and methods for treating disease
Bioactive peptides and methods for their use for preventing, treating, and/or reducing the incidence and/or symptoms of an autoimmune disease or disorder that may result from chronic inflammation, damage to β-cells of the pancreas, and other conditions that are implicated by the CD40-CD154 dyad. In particular, small peptides that are capable of interacting with CD40, thereby interfering with the ability of CD40 to interact with CD154, which impacts inflammation, autoimmunity, and disease progression. The use of such peptides in reducing diabetes mellitus, and in particular, the autoimmune inflammatory response that may be a driving factor thereof. Methods and materials for preventing and modulating diabetes mellitus and autoimmune diseases especially in dogs, cats, and horses.
US11744874B2 Formulated and/or co-formulated liposome compositions containing toll-like receptor (“TLR”) agonist prodrugs useful in the treatment of cancer and methods thereof
Formulated and/or co-formulated liposomes comprising TLR prodrugs and/or TLR Lipid Moieties and methods of making the liposomes are disclosed herein. The TLR prodrug compositions comprise a drug moiety, a lipid moiety, and linkage unit that inhibit Toll-Like Receptor (e.g., TLR1/2, TLR4, and/or TLR7). The TLR prodrugs can be formulated and/or co-formulated into a liposome to provide a method of treating cancer, immunological disorders, and other disease by utilizing a targeted drug delivery vehicle.
US11744868B1 Inonotus obliquus dextran, preparation method and application thereof
Disclosed are an Inonotus Obliquus dextran, a preparation method and application thereof, and relates to the field of medicines. The dextran has a structural formula as follows: By optimizing the extraction and isolation process, the present disclosure obtains an Inonotus Obliquus dextran, which is structurally determined to be a new polysaccharide. The Inonotus Obliquus dextran prepared by the present disclosure is combined with gemcitabine hydrochloride to inhibit tumor cells with anti-tumor activity against pancreatic cancer, in addition to reduce the dosage of chemotherapeutic drugs as well as the adverse effects of chemotherapeutic drugs.
US11744866B2 Methods of preventing and treating COVID-19 infection with probiotics
Methods of preventing and treating COVID-19 infection by administering probiotics. The probiotics can be administered via the following methods: fecal transplant, suppository, or orally. The probiotic contains one or more of the following microorganisms: Bifidobacterium, Clostridium, Veillonella, Ruminococcus, and Sutterella.
US11744865B2 Composition for inhibiting lipofuscin accumulation or removing lipofuscin
A composition for inhibiting lipofuscin accumulation or removing lipofuscin is disclosed. A Chryseobacterium sp. strain, a lysate of the Chryseobacterium sp. strain, a culture of the Chryseobacterium sp. strain, or an extract of the lysate or culture is included in the composition. The composition provides an anti-aging effect by inhibiting lipofuscin accumulation or removing lipofuscin. The composition also provides an effect of preventing, ameliorating or treating the diseases caused by the lipofuscin accumulation, such as skin hyperpigmentation, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, myocardial infarction and age-related macular degeneration.
US11744858B2 Medicine for treatment and/or prevention of ischemic diseases, method for improving angiogenesis-promoting activity of cells, or method for producing medicine
The present invention provides a sufficiently effective medicine for treatment and/or prevention of ischemic diseases, without performing isolation of therapeutic cells or removal of deleterious cells from blood cells/hemocytes. The blood cells and/or the hemocytes are subjected to the action of a saccharide. The saccharide is a monosaccharide, a disaccharide, a trisaccharide, a polysaccharides, or a copolymer containing a monosaccharide, a disaccharide, or a trisaccharide as a component. The saccharide is a copolymer of sucrose and epichlorohydrin.
US11744856B1 Compositions and methods to improve skin quality and appearance, cure skin and tissue damage, and use in therapy
Pharmaceutical and cosmetic compositions and methods are presented that have a carrier in combination with a media composition that is derived from distinct cell cultures. The distinct cell cultures are obtained from growing different cells that are distinct with respect to at least one of cell type, cell age, cell differentiation stage, and physiological condition. Thus, the composite medium will provide mediator molecules that are ordinarily not founds in their combination and that can be fine tuned to specific purposes.
US11744843B2 Identification and treatment of T-cell epitopes of short H2A oncohistones
The present disclosure describes methods of treating lymphoma that expresses a short histone H2A variant. In some embodiments, the method can comprise collecting a sample from a subject having or suspected of having lymphoma, detecting a short histone H2A variant (sH2A) expression level in the sample collected from the subject, and administering to the subject a therapeutically effective dose of an anthracycline agent, if the subject has sH2A variant expression level that is detectable. In other embodiments, the sH2A is the H2A.B variant. In other embodiments, the anthracycline agent can be aclarubicin.
US11744841B2 Use of trezastilbenoside in manufacture of product for treating and/or preventing disease of respiratory system
The present disclosure belongs to the biopharmaceutical field, and discloses uses of Trezastilbenoside in manufacture of a product for treating and/or preventing a disease of respiratory system, and particularly uses of Trezastilbenoside in manufacture of a product for treating and/or preventing a disease of respiratory system with symptoms of cough and/or expectoration and/or asthma. As indicated by the test results of the present disclosure, Trezastilbenoside has significant efficacy of relieving cough, eliminating phlegm, relieving asthma and anti-inflammation, and has a potential therapeutic effect on respiratory system diseases, thus possessing broad prospects in clinical application.
US11744840B2 N-palmitoyl-D-glucosamine in a micronized form
The present invention relates to an N-palmitoyl-D-glucosamine-based composition in a micronized form, optionally in combination with Curcumin.In particular, the present invention relates to N-palmitoyl-D-glucosamine in a micronized or co-micronized form with Curcumin. Such a product can be formulated in human or veterinary pharmaceutical compositions, dietetic products, food supplements, or foods for special medical purposes (FSMP), or in feeds, or nutritional supplements for animals for the treatment of chronic systemic inflammatory diseases, in humans and animals, resulting from dysfunctions of epithelia and synovial membranes.
US11744839B2 Method of increasing platelet counts of a subject
Method of increasing platelet counts in a subject, the method comprising administering to the subject a therapeutically effective amount of a compound that inhibits Biliverdin reductase B (BLVRB) activity by blocking a binding site of BLVRB or a pharmaceutically acceptable salt thereof, wherein the compound does not contain xanthene or acridine moiety is provided.
US11744836B2 Dry powder treprostinil for the treatment of pulmonary hypertension
A dry powder inhalation treatment for pulmonary arterial hypertension includes a dose of dry particles comprising greater than 25 micrograms of treprostinil enclosed in a capsule. The dry particles can include treprostinil, a wetting agent, a hydrophobicity modifying agent, a pH modifying agent and a buffer. A method of treating a patient having pulmonary arterial hypertension includes providing a patient a dry powder inhaler, providing the patient at least one capsule for use in the dry powder inhaler, the capsule including at least 25 micrograms of treprostinil.
US11744828B2 Regimens of tafenoquine for prevention of malaria in malaria-naïve subjects
Methods of prevention of symptomatic malaria in a malaria-naïve, G6PD-normal human subject comprising administering to the human subject a compound of Formula (I), a pharmaceutically acceptable salt thereof, or pharmaceutical composition comprising a compound of Formula (I). A compound of Formula (I) can be administered prior to potential exposure of a species of Plasmodium, during potential exposure of a species of Plasmodium, and after potential exposure of a species of Plasmodium. The methods of the invention also pertains to kits comprising specific doses of Formula (I), a pharmaceutically acceptable salt thereof or pharmaceutical composition comprising a compound of Formula (I), and instructions for administration of dosing quantity and frequency. The methods of the invention also pertain to determining doses of Formula (I) that meet the general regulatory requirement for a drug to be efficacious in the prevention of malaria in malaria-naïve subjects. The methods of the invention further pertain to using the described algorithm to derive dosing regimens which can provide protection against symptomatic malaria in malaria-naïve, G6PD-normal subjects.
US11744827B2 Cancer treatment via repositioned tricyclic anti-depressant-like drugs as anti-cancer agents and new combinations of such drugs
Methods and compositions for treating a lysosomal movement associated disease in an animal, in which the position of lysosomes can influence disease progression, comprising administering an effective amount of a first lysosome migration inhibitor or a pharmaceutically acceptable salt, solvate, clathrate, stereoisomer, enantiomer or prodrug thereof.
US11744817B2 High-dose statins for age-related macular degeneration
Methods of using a high-dose statin for treatment of AMD in a patient can be used to regress drusen and/or drusenoid pigment epithelial detachments (PEDs), to prevent atrophy of the RPE and/or one or more photoreceptors, to prevent vision loss and/or improve visual acuity, and/or to prevent progression from dry AMD to wet AMD.
US11744810B2 Methods of treating or preventing an attention disorder, cognitive disorder, and/or dementia associated with a neurodegenerative disorder
The present invention provides a method of treating or preventing an attention and/or cognitive disorder in a subject in need thereof, comprising administering to the subject a compound useful within the invention. The present invention further provides a method of treating or preventing dementia associated with a neurodegenerative disorder in a subject in need thereof, comprising administering to the subject a compound useful within the invention.
US11744807B2 Therapeutic compositions and methods for pulmonary fibrosis
The present invention discloses a method for therapeutic management of pulmonary fibrosis in mammals using a composition comprising iso-garcinol or octahydrocurcumin or a combination of iso-garcinol and octahydrocurcumin. The composition is very suitable for treating pulmonary fibrosis due to viral infections, specifically COVID 19 and for improving lung function during prognosis.
US11744806B2 Frigostable composition for iontophoretic transdermal delivery of a triptan compound
The present invention relates to frigostable compositions suitable for iontophoretic transdermal delivery of a triptan compound. The inventive compositions include a salt of a triptan compound, preferably sumatriptan succinate, a polyamine, a dicarboxylic acid, and water or an aqueous solvent mixture, with the composition being free of monocarboxylic acids. The invention further relates to the use of the composition as an integral component of an iontophoretic patch, preferably as an anodic reservoir of the patch.
US11744804B2 Microcapsule powder stable in gastric acid, method for preparing same, and use thereof
The present invention discloses a microcapsule powder stable in gastric acid, a method for preparing the same and use thereof. The microcapsule powder comprises a core material and a capsule material coated outside the core material, wherein the capsule material has a melting point of greater than 42° C., and the capsule material does not decompose or dissolve under the action of protease and gastric acid, but decomposes under the action of intestinal digestive enzymes. The core material is coated with the capsule material in the microcapsule powder, thus achieving high-efficiency coating of the core material by a single component. The microcapsule powder achieves conventional intragastric stability as well as favorable stability in an open environment at room temperature, thus solving the problem that the conventional embedding solution may only achieve intragastric stability, but the stability in an open environment at room temperature is low.
US11744791B2 Cosmetic composition comprising amide-based compound
Provided are a cosmetic composition for promoting lipid biosynthesis, a cosmetic composition for inducing differentiation of adipose precursor cells or stem cells into adipocytes, and a cosmetic composition for moisturizing the skin, all of which include an amide-based compound. The cosmetic composition according to the present invention can promote the lipid biosynthesis and can promote expression of PPAR-γ and cluster of differentiation 44, which are markers for labeling human adipose tissue-derived stem cells, to promote differentiation of the adipose tissue-derived stem cells into mature adipocytes, thereby improving a decreased volume and an impaired function of an adipose tissue caused due to the involution of the adipose tissue and giving a synergistic effect to the expression of a skin moisturizing factor.
US11744788B2 Method of encouraging growth and regrowth of hair in human males technical area
Methodology for encouraging hair growth in male humans, and more particularly to methodology which involves application of electromagnetic radiation, mechanical vibrations, along with applications of combined minoxidil, mint oil, (preferably menthol containing essential peppermint oil), ginger oil, lavender oil, castor bean oil, jojoba oil; melaleuca oil, cumin oil, D-alpha tocopherol (vitamin E) infused oil, biotin infused oil and a single selection, or dry mixture and/or liquid “tea” formed from selections from the group consisting of powdered saw palmetto; powdered horsetail; powdered ginger; powdered stinging nettles; powdered horny goat weed; powdered pueraria lobate; powdered Tribulus terrestris; powdered ashwagandha; powdered capsicum; powdered habenero; powdered green tea; powdered sage; powdered gingko biloba; powdered myrrh; powdered alpha-hydroxy; powdered Aloe vera; powdered wheat protein; powdered wheat starch; powdered casein, powdered keratin, powdered folic acid; powdered fenugreek seed and powdered biotin powdered ginseng Root; powdered vetiver grass; powdered caffeine; powdered Co-enzyme Q; powdered folate; powdered gotukola leaf; powdered milk thistle; powdered African pygeum; powdered stinging nettles; powdered gingko biloba; powdered myrrh; powdered alpha-hydroxy; powdered caffeine; powdered niacinamide (NAD) and/or niacin; and powdered Nigella sativa; powdered Eclipta alba; powdered Centella asiatica; powdered Phyllanthus emblica in water and alcohol, or an oil.
US11744786B2 Hygiene product pod and methods of using same
A hygiene product, a hygiene product pod, and a method of using the hygiene product pod, the hygiene product pod including a water soluble envelope and the hygiene product sealed in the envelope. The hygiene product includes a carrier comprising butylene glycol in an amount ranging from about 40 wt % to about 70 wt %, based on the total weigh of hygiene product, and an active agent including at least one surfactant.
US11744783B2 Nanoemulsions comprising fatty acid and n-acyl derivatives of amino acid salt
The present invention relates to novel oil-in-water nanoemulsions. The oil phase contains oil selected from the group consisting of triglyceride oil and/or petrolatum as well as C8 to C18 fatty acid; and the aqueous phase contains specific N-acyl derivatives of amino acid salt as emulsifier.
US11744781B2 Dental photopolymerizable composition for 3D printer
To provide a dental photopolymerizable composition which can prepare a dental restoration with excellent aesthetic and mechanical properties by optical three-dimensional modeling method (stereolithography). The dental photopolymerizable composition for 3D printer of the present invention comprises: a (a) (meth)acrylate-based polymerizable monomer consisting of a (a1) (meth)acrylate-based polymerizable monomer containing a urethane structure and a (a2) (meth)acrylate-based polymerizable monomer not containing a urethane structure, a (b) cohesive inorganic filler, and a (c) photopolymerization initiator, wherein; a ratio of the (a1) (meth)acrylate-based polymerizable monomer containing a urethane structure and the (a2) (meth)acrylate-based polymerizable monomer not containing a urethane structure in the (a) (meth)acrylate-based polymerizable monomer is 51 to 80: 49 to 20 pts.wt., a ratio of the (a) (meth)acrylate-based polymerizable monomer and the (b) cohesive inorganic filler is 50 to 91: 50 to 9 pts.wt., and the dental photopolymerizable composition for 3D printer contains 0.1 to 5 pts.wt. of the (c) photopolymerization initiator based on 100 pts.wt. of the (a) (meth)acrylate-based polymerizable monomer.
US11744779B1 Infant feeding measurement device
A system for monitoring infant feeding habit includes a nipple having an embedded pressure sensing passage and pressure sensing opening. The pressure sensing opening is proximate the nipple feeding opening. The pressure sensing passage allows monitoring of change in pressure of infant sucks and swallows throughout feeding.
US11744778B2 Pill dispenser for medications, vitamins and/or dietary supplements
A pill dispenser (10) has a core (12) with outward-facing compartments (14) arranged in rows and layers about a central axis. A first sleeve (22) overlying the core has an elongated slot (24) extending parallel to the central axis, and is rotatable relative to the first sleeve to align the slot with one of the rows of compartments. A second sleeve (26), coaxial with the first sleeve, has a pattern of staggered openings 28 positioned in an axial direction to align with a corresponding one of the layers. The second sleeve is rotatable relative to the first sleeve to bring each of the staggered openings into alignment with the elongated slot, thereby providing access to one of the compartments of the core. Preferably, the core includes a number of axially removable cartridges (30), each including a row of compartments, that can be inserted while the compartments contain pills.
US11744776B2 Multi chamber flexible bag and methods of using same
A method of preparing a pharmaceutical product in a single multiple chamber flexible bag. A pharmaceutical product is introduced in a liquid state into a first chamber of the flexible bag through a first port. The pharmaceutical product is lyophilized within the first chamber of the flexible bag to provide a lyophilized pharmaceutical product. The flexible bag has a second chamber and the first chamber and the second chamber are separated by a breakable seal. The second chamber further includes a reconstituting solution for reconstituting the lyophilized pharmaceutical product in the first chamber. A user may apply pressure to the flexible bag to break the seal and mix the lyophilized pharmaceutical product and the reconstituting solution to order to administer the pharmaceutical product to a patient.
US11744775B2 Pressure-regulating vial access devices and methods
In certain embodiments, a vial access device for removing liquid contents from a vial includes a piercing member extending from a base of an insertion member and a reservoir. The reservoir can be contained within the piercing member and the insertion member, such that the reservoir is introduced to the vial when piercing member is inserted into the vial. The piercing member is adapted to be opened inside the vial to expose the reservoir to the contents inside the vial. A locking mechanism can prevent the piercing member from being inserted into the vial unless the vial access device is fully coupled to the vial and/or prevent the piercing member from being withdrawn from the vial without uncoupling the vial access device from the vial.
US11744773B2 Puncture needle connector and connecting tube
A puncture needle connector (1) includes an outer cylinder (11), an inner cavity (1a) formed within the outer cylinder (11), an arm (15) provided at the outer cylinder (11), the arm (15) being elastically deformable by bending, and a claw (16) provided on the arm (15). The inner cavity (1a) is in communication with the outside via a first opening (21) and a second opening (22). When a puncture needle (210) is inserted into the inner cavity (1a) via a first opening (21), the claw (16) engages with an engagement structure (217) provided integrally with the puncture needle (210), a liquid-tight seal (25) is formed between an outer circumferential surface of the puncture needle (210) and an inner circumferential surface of the inner cavity (1a), and the puncture needle (210) and the second opening (22) are in communication with the each other.
US11744767B2 Exfoliating head with rolling elements
A skin treatment head includes treatment head surface; multiple bristles extending from the treatment head surface and defining a virtual edge face circumferentially surrounding the bristles and a virtual top face defining a first height of the bristles; and one or more rotatable elements extending from the treatment head surface and having a second height lower than the first height, such that in order to apply a tangential force to rotate the rotatable elements, the skin treatment head is tilted relative to a skin surface.
US11744766B2 Information processing apparatus and information processing method
A processing unit includes a direction decision unit and a guide information generation unit. The direction decision unit decides a direction in which a person who behaves without a sense of sight walks. The guide information generation unit generates guide information for the person who behaves without the sense of sight to walk in the decided direction. The present technology is applicable, for example, to a smartphone or the like used by the person who behaves without the sense of sight.
US11744763B2 Apparatus and/or method for positioning a hand for rehabilitation
Disclosed is a hand and arm support assembly for use by a user or patient to rehabilitate a hand of the patient. The hand and arm support assembly includes a hand actuator assembly and a forearm rest assembly. The hand actuator assembly provides a support for a hand engagement assembly having a housing and hand actuator rod engagement members projecting upwards therefrom to engage the hand of the patient. The housing is rotatable to accommodate the position of the patient's hand and the rod engagement members are adapted to travel along slots towards and away from one another. The forearm rest assembly includes a first carriage and a second carriage to support the forearm and elbow of the patient. The first and second carriage can pivot about an axis relative to the housing to further accommodate the position of the patient's arm and elbow.
US11744762B2 Gait activity learning assistance system and the application method thereof
A gait activity learning assistance system, and an application method thereof, includes a main body, at least one movement detecting module, a control module, at least one driving module and at least one dynamic measurement module. The system is able to guide and induce a user to learn gait autonomously by disposing at least one force-transmission unit on at least one limb position of the user, besides, the system is able to measure a dynamic change of the at least one force-transmission unit by the at least one dynamic measurement module while user receiving a gait assistance, and send them back to the control module immediately for a real-time analysis.
US11744760B2 Reclinable therapeutic massage chair
A therapeutic massage chair is reclinable between a horizontal and inclined position. The chair includes an upper back support member and a lower support member that is axially movable along a support frame, and is also rotatable about an axis which is perpendicular to the plane of the upper back support member. Electric linear actuators are provided to both axially move and oscillate the lower body support member.
US11744759B2 Method and apparatus for a medical chair for remote testing and diagnosis
A medical chair is provided for conducting and controlling in-depth medical exams from a remote location. Specifically, the medical chair allows for providing remote diagnoses and treatment, including a variety of testing procedures for patients with nonemergent but time sensitive illness or injury. The medical chair can be used in a semi-permanent, permanent, temporary, or mobile environment and includes stabilizing assemblies to adapt to any of these environments.
US11744755B2 Relocation module and methods for surgical equipment
Modules for housing electronic and electromechanical medical equipment including a system to measure and record administration of one or more IV medications or fluids for IV administration.
US11744754B2 Nursing bed for defecation and self-cleaning
A nursing bed for defecation and self-cleaning comprises a bed frame, a bed board device, a moveable cushion, a support frame, a bedpan, an excreta container; The bedpan is hung under the movable cushion through a support frame. When the patient wants to defecate, the patient only needs to remove a cushion and make the bedpan mouth of the bedpan facing the defecation hole of the moveable cushion, then the patient can defecate on the nursing bed; and further having a cleaning device a warm water supply device, using an electric heater to heat the cleaning water to an appropriate temperature to clean the patient's buttocks, thereby reducing the infection of germs, and also cleaning the excrement that attached to the bedpan to keeps the bedpan clean.
US11744750B2 Wheelchair with dynamic support system
A wheelchair is provided. First supports for supporting a user of the wheelchair are unevenly disposed to form a perimeter, and second supports for supporting the user of the wheelchair are unevenly disposed at least partially within the perimeter of the first supports. The first supports support the user when the first supports are in a raised position and the second supports are in a lowered position. The second supports support the user when the second supports are in a raised position and the first supports are in a lowered position. A alternation of supporting the user with the first supports or the second supports facilitates reduction of pressure sores of the user. In various embodiments, multiple groups of supports are used, the supports contour to a user's anatomy and/or the supports are pneumatic.
US11744748B2 Dryness layer laminate for absorbent articles
The present disclosure relates to absorbent garments having a dryness layer that can comprise one or more laminates and one or more channels to facilitate liquid acquisition and retention. Laminate(s) can include an absorbent lamina disposed between substrate laminae, each comprising tissue and/or a nonwoven. Some dryness layers can have a folded laminate that defines a longitudinally-extending channel. Some dryness layers can have two or more laminate strips that are laterally spaced apart along a width of the dryness layer such that one or more longitudinally-extending channels are defined therebetween.
US11744747B2 Absorbent article with dual core
An absorbent article. The absorbent article includes a topsheet having a body contacting surface, a backsheet joined to said topsheet, and an absorbent core disposed between the topsheet and the backsheet, wherein the absorbent core has an upper layer and a lower layer.
US11744746B2 Low-bulk, close-fitting, high-capacity disposable absorbent pant
A low bulk, high capacity disposable absorbent pant is disclosed. The pant may have a variety of combinations of features that contribute to imparting the pant with a more close-fitting, discreet appearance, particularly under outer clothing, more resembling that of an ordinary undergarment. The features may include an arrangement of relatively closely-spaced elastomeric strands in a belt structure; elastomeric strands in the belt structure having active portions that traverse forward and rearward portions of an absorbent pad assembly; an arrangement of elastomeric strands in the belt structure below the side seams; an arrangement of longitudinal elastic strands in the absorbent pad assembly that are closer to the longitudinal axis of the pant than to the side seams; and/or an absorbent core structure having portions that are tapered and/or channeled.
US11744743B2 Topsheets integrated with heterogenous mass layer
An absorbent article and method of making the absorbent article are disclosed. The absorbent article having a topsheet, a backsheet, and an absorbent core structure having one or more layers wherein at least one layer is a heterogeneous mass layer, wherein the topsheet and the heterogeneous mass are integrated such that they reside in the same X-Y plane.
US11744741B2 Negative pressure dressing and method of using same
The present invention relates to apparatuses and methods for treating a wound by applying reduced or negative pressure to the wound. The apparatus can include a wound cover, a fluid collection container, a vacuum pump, an inflation pump, and one or more conduits. The wound cover can be configured to move between at least a relatively rigid, generally raised position and a relatively flexible, generally collapsed position according to a predetermined program or in response to input from a user or one or more sensors. In some embodiments, the wound cover can be configured to move between at least the relatively rigid, generally raised position and the relatively flexible, generally collapsed position by adjusting the air pressure in one or more channels in the wound cover or by adjusting the length of piezoelectric or other length changing material supported by the wound cover.
US11744735B2 Devices, systems and methods for minimally invasive glaucoma surgery
Devices and methods useable for forming opening in trabecular meshwork of mammalian eyes.
US11744733B2 Small gauge surgical instrument with support device
A small gauge surgical instrument assembly is shown with advantages such as diminished “play” at the tip. A surgical instrument assembly is also shown with support along a length of the instrument that can be selected by the surgeon. In particular, very small and flexible instruments for vitreous surgery are shown with selectable stiffness, thus providing control as well as access to all parts of the vitreous cavity. Embodiments as shown are safer, and increase the variety of cases for which these instruments can be used.
US11744731B2 Ultrasonic ophthalmic device
An ophthalmic device comprises an ultrasonic transducer, an accommodation actuator, and a controller. When the ophthalmic device is mounted in or on an eye of a user, the ultrasonic transducer is positioned to direct ultrasonic signals towards ciliary processes in the eye and the accommodation actuator is positioned to focus light entering the eye. The controller is coupled to the ultrasonic transducer and the accommodation actuator. The controller includes logic that when executed by the controller causes the ophthalmic device to perform operations including emitting the ultrasonic signals from the ultrasonic transducer towards the ciliary processes, receiving reflected ultrasonic signals from the ciliary processes with the ultrasonic transducer, calculating a time of flight between emitting the ultrasonic signals and receiving the reflected ultrasonic signals, and adjusting an optical power of the accommodation actuator based on the time of flight.
US11744727B2 Device and method for opening an airway
The present invention provides devices and methods for creating and/or maintaining patency of the upper airway passage. The device is configured to fit under the chin of a subject at an external location corresponding approximately with the subject's internal soft tissue associated with the neck's anterior triangle. The device includes structural elements designed to optimize comfort, compliance and seal achieved through minimizing the pressure variation along the contact surface of the therapy device.
US11744725B2 Ostomy appliance
An ostomy appliance having a signal generator adapted to give a user or a health care professional a warning in time to change the appliance before leakage occurs by predetermining leakage or potential leakage of stomal fluids.
US11744722B2 Method of use for delivery system for radially constricting a stent graft
A stent graft delivery system includes a handle, a guidewire catheter extending distally from the handle, at least one tube, and at least one wire extending through the at least one tube, wherein each wire of the stent graft delivery system is configured as a loop at the distal end of the tube. The stent graft delivery system can be employed to implant stent grafts in a patient to thereby treat, for example, an aortic aneurysm spanning a region of an aorta that includes at least one arterial branch.
US11744721B2 Highly flexible stent
A stent includes wavy-line pattern bodies having a wavy-line pattern and arranged side-by-side in an axial direction LD, and coiled elements arranged between the wavy-line pattern bodies adjacent and extending in a spiral manner around an axis. All apices on opposite sides of the wavy-line pattern of the wavy-line pattern bodies that are adjacent are connected by way of the coiled element. When viewing in a radial direction RD, a circular direction CD of the wavy-line pattern bodies is inclined with respect to the radial direction RD, and a winding direction of one of the coiled elements located at one side in the axial direction LD with respect to the wavy-line pattern bodies and a winding direction of one other of the coiled elements located at the other side in the axial direction LD are opposite.
US11744719B2 Tibial trial for joint arthroplasty
A system and process for performing orthopedic surgery is provided that uses a tibial trial system in total knee arthroplasty for assessing optimal internal-external rotation and posterior tibial slope, and for measuring the rotation of a tibial trial throughout flexion-extension to determine and mark the best position for the final tibial component. The tibial trial system determines the internal-external location on a patient specific basis with improved component placement well within the present manual methods. One particular advantage to the tibial trial system is to assess the natural internal-external rotation that the tibial component will experience relative to the femoral component during flexion-extension as opposed to simply recording and balancing forces on a static tibial trial. The invention disclosed herein may also be adapted to be used with a computer assisted surgical device. Such surgical devices include active, semi-active, and haptic devices as well as articulating drill and saw systems.
US11744718B2 Method of trialing an orthopaedic prosthetic assembly
An orthopaedic surgical instrument system includes a tibial base trial and a tibial insert trial. An insert adaptor is sized to be positioned in an aperture defined in the tibial insert trial. The insert adaptor includes a base sized to be positioned over a post of the tibial base trial and a locking tab positioned in the base and configured to engage the post of the tibial base trial.
US11744716B2 Intervertebral implants
An interbody implant can comprise a cage and a porous structure. The cage can comprise an anterior segment, a medial segment, a posterior segment and a lateral segment contiguously connected to each other to define an interior space. The porous structure can be located in the interior space and can be bounded by the cage. The porous structure can comprise opposed superior and inferior surfaces exposed through the cage, an internal cavity located in an interior of the porous structure, and a plurality of ports connecting the internal cavity to the superior and inferior surfaces. A superior-inferior stiffness of the interbody implant can be defined by the porous structure. The porous structure can be compressed within a patient by movement of the spine to biologically stimulate bone growth in vertebrae adjacent the interbody implant. The implant can be configured for lateral, anterior and posterior insertion at different spine levels.
US11744714B2 Device and method for deployment of an anchoring device for intervertebral spinal fusion
A device and methods for intervertebral spinal fusion of adjacent intervertebral bodies. An intervertebral spacer is positioned within a narrow disc space between adjacent intervertebral bodies of a patient. The spacer is arranged with upper and lower guides. The guides are adapted to simultaneously guide the deployment of upper and lower anchors of an anchoring device into their respective intervertebral bodies. The spacer is also adapted to lock the upper and lower anchors to the spacer in the deployed position.
US11744713B2 Intervertebral spacer that dynamically promotes bone growth
A dynamic intervertebral spacer includes a ring which is split on an anterior portion. A posterior portion of the ring acts as a torsion spring. After implantation, the ring is able to act as a spring between superior and inferior vertebral bodies, thus allowing dynamic bone growth in fusion procedures.
US11744711B2 Spinal interbody devices with density gradients and associated methods
An interbody device configured for insertion between adjacent vertebrae includes a body comprising and exterior surface and an interior surface defining a cavity. The body comprises a visualization window extending between the exterior surface and the interior surface, where the visualization window comprises a lattice of radiopaque structures. A density of the lattice in a central region of the visualization window is less than in the density of the lattice in an outer region of the visualization window such that the visualization window is radiolucent through the central region.
US11744708B2 Surface topographies for altering the physiology of living cells
The invention pertains to surface topographies which can be used to modulate the morphology, proliferation, biochemical functioning, differentiation, attachment, migration, signaling, and/or cell death of a cell population by physical stimulation. Such topographies can be applied in vitro and in vivo to modulate cell behavior. Specific examples include implants provided with a topography of the invention which regulates the immune response, or an implant which increases osteogenesis. The invention furthermore pertains to objects which are used in vitro to modulate cell behavior.
US11744707B2 Methods for repairing anatomical joint conditions
The present invention relates generally to minimally invasive, cost-effective, adaptable methods, systems, and devices used to repair anatomical joint conditions. The repair may be necessitated by trauma, disease or other conditions. The anatomical joint may specifically include mammalian joints such as the knee, shoulder, elbow, wrist, finger, hip, spine, toe and ankle, for example. The methods, systems, and devices disclosed herein include leveraging the significant (and often unappreciated) role the subchondral bone plays in the health status of the afflicted anatomical joint.
US11744706B2 Spinal spacing implant, spinal spacer assembly, expander and insertion instrument, kit and methods of assembly and use
Spinal spacing implants, spinal spacer assembly, expander and insertion instruments, kits and methods of assembly and use are disclosed. The spinal implant replacement instrument kit including a distraction instrument, a spacer inserter, and a spinal implant. A distraction instrument includes a first inserter member, a second inserter member, a first arm coupled to the first inserter member, a second arm coupled to the second inserter member, a distraction system coupled to the first arm and second arm, a first handle coupled to the first arm and the distraction system, and a second handle coupled to the second arm and the distraction system. Spinal spacing implants, spinal spacer assemblies, and methods of assembling and using the implants assemblies, and instruments are also disclosed.
US11744705B2 Method of implanting a heart valve prosthesis
A method of implanting a percutaneous heart valve prosthesis via a catheter. The heart valve prosthesis includes a valve body frame made of a nickel-titanium alloy. The valve body frame is collapsible for fitting within the catheter. A flexible skirt is sutured to the valve body frame for blocking retrograde blood flow. A one-way valve is positioned within the valve body frame for permitting blood to flow from a first end of the valve body frame to a second end. The one-way valve is preferably formed by three flexible valve leaflets made from a pericardial material. A plurality of barbs is spaced about the periphery of the valve body frame. Each of the prongs points toward the first end of the valve body frame for preventing migration of the heart valve prosthesis towards an atrium of the heart.
US11744704B2 Method for delivering a prosthetic heart valve
A method of implanting a balloon expandable prosthetic valve within a native aortic valve includes introducing a delivery system into a femoral artery of a patient, the delivery system comprising an outer sleeve and a shaft extending through a lumen of the outer sleeve. A distal end portion of the shaft is positioned distal to a distal end of a steerable distal end portion of the outer sleeve. A prosthetic valve is crimped over a balloon disposed along the distal end portion of the shaft. The delivery system further comprises a first radiopaque marker inside the balloon and positioned adjacent a proximal end of the prosthetic valve and a second radiopaque marker inside the balloon and positioned adjacent a distal end of the prosthetic valve. The method also includes identifying a location of the prosthetic valve by monitoring the first and second radiopaque markers inside the balloon under fluoroscopy.
US11744703B2 Percutaneous implant retrieval system
Devices and methods for retrieving percutaneously implanted catheter systems such as a heart valve repair system. The devices include at least one locking connector at the distal end of a flexible elongated extension for coupling to an implanted tubular member. The locking connector may be a tubular anchor having a pair of distal prongs which are biased outward and face in a proximal direction, as well as an expandable auxetic midsection. Inserting the tubular anchor into the implanted tubular member flexes the distal prongs inward such that they prevent proximal movement of the tubular anchor. A user pulls on the proximal end of the tubular anchor to expand the auxetic midsection and lock the two pieces together. The devices and methods are particularly useful to attach extensions to implanted concentric tubes to enable relative axial force application.
US11744698B2 Extended depth of focus intraocular lenses and associated methods
A method improves depth of focus in a first eye only by adding a higher order aberration (HOA) to the first eye by adding a monofocal optical device to the first eye. The method may also correct a spherical aberration in a second eye by inserting a monofocal aspheric IOL. The HOA added to the first eye may be selected from the group consisting of spherical, trefoil and coma. Additionally, the monofocal optical device inserted into the first eye may comprise a monofocal aspheric IOL that adds spherical aberration to the first eye. The optical device inserted into the first eye may comprise a 20 D monofocal aspheric IOL that adds 0.4 μm of spherical aberration to the first eye at 6 mm entrance pupil and adds 0.1 μm of spherical aberration to the first eye at 4 mm entrance pupil.
US11744696B2 Implants and methods for mastopexy
A mastopexy implant for maintaining the breast in an elevated and aesthetically pleasing position includes a lower pole support comprising end portions which may be affixed to the chest wall or to a previously installed upper suspension strut. The implant is loaded in an insertion device. The insertion device is inserted through a small incision and into a subcutaneous pocket created in an inferior half of the breast. The lower pole support may have various constructs and in one embodiment includes a unitary conformable mesh having a plurality of arm or band members which are attached across the breast parenchyma and to the chest wall.
US11744695B2 Soft tissue attachment device
A device for attaching a soft tissue graft to bone includes a body with a smooth contoured first surface and a second surface opposite the first surface having a plurality of outwardly extending fixation members. The second surface is at least partially formed of a porous material adapted for bone ingrowth. A channel extends at least partially through the body in between the first and second surfaces for receiving a portion of the graft. The channel is at least partially formed of a porous material adapted for tissue ingrowth, bone ingrowth or a combination thereof.
US11744693B2 Esophageal stent including a valve member
An example medical device is disclosed. The example medical device includes a tubular scaffold. The scaffold includes a longitudinal axis, an inner surface and an outer surface. The medical device also includes a flexible valve extending radially inward from the inner surface of the scaffold. The valve includes an annular chamber extending circumferentially around the inner surface of the scaffold and is configured to shift from a closed configuration to an open configuration.
US11744691B2 System for treating embolism and associated devices and methods
Systems and methods for the intravascular treatment of clot material within a blood vessel of a human patient are disclosed herein. A method in accordance with embodiments of the present technology can include, for example, positioning a distal portion of a catheter proximate to the clot material within the blood vessel. The method can further include coupling a pressure source to the catheter via a tubing subsystem including a valve or other fluid control device and, while the valve is closed, activating the pressure source to charge a vacuum. The valve can then be opened to apply the vacuum to the catheter to thereby aspirate at least a portion of the clot material from the blood vessel and into the catheter.
US11744687B2 Oral irrigator
An oral irrigator has a first liquid container, a nozzle outlet, a pump driven by a drive to pump liquid from the liquid container to the nozzle outlet so that a liquid jet is emitted via the nozzle outlet, a first switch arranged so that the drive is powered when the first switch is actuated once and the oral irrigator is switched into an ON state, and so that powering of the drive is stopped and the oral irrigator is switched into an OFF state when the first switch is actuated once again, and a second switch arranged so that the drive is powered only while the second switch is continuously actuated by the user and powering is stopped when the second switch is released.
US11744686B2 Intraoral device
A dental mouthpiece is provided that may be attached to a high-suction dental adapter for the purpose of assisting the dental staff during dental procedures through chair-side, hands-free suction, and isolation. Such mouthpiece may include a main body portion, a cheek retractor portion, and a suction connector portion. In some embodiments, the main body portion, cheek retractor portion, and suction connector portion (and sub-portions thereof) may be molded in one piece, preferably by injection molding. In an exemplary embodiment, the mouthpiece may be made of a material that is flexible, translucent, conducive to injection molding, high heat-resistant, and autoclavable. Such a material may include silicone. Because the mouthpiece may be made of high heat-resistant and autoclavable material, such a mouthpiece may be reusable.
US11744683B2 Dental composite milling blanks with enhanced mechanical properties and methods of making the same
A dental resin composite comprising a thermally cured composition of polymeric resin monomers and inorganic fillers that comprise at least 80 wt % total filler loading is provided. Mill blocks made from the dental resin composite and produced via free radical polymerization under high-temperature (approximately 160° C. to 220° C.) and high-pressure process (approximately 300 MPa to 560 MPa) exhibited enhanced mechanical strength and good esthetics suitable for use in CAD/CAM indirect restorations such as, inlays, onlays, crowns and bridges.
US11744681B2 Foreign object identification and image augmentation for intraoral scanning
In a method of generating a virtual 3D model of a dental site, scan data comprising a plurality of images of a dental site is received during an intraoral scan. An analysis of an image is performed. A representation of a reference object with known properties is identified in the image based on the analysis. A virtual 3D model of the dental site is generated based on the plurality of images. The image and/or the virtual 3D model of the dental site is modified by adding additional data about the reference object to the intraoral image and/or the virtual 3D model based on the one or more known properties of the reference object. If the image is modified, it may be modified prior to generation of the virtual 3D model, and the virtual 3D model may be generated using the modified image.
US11744680B2 Dalman orthodontic bracket
An orthodontic bracket assembly treatment system comprising a bracket base and at least two rigid selectable bracket covers slidably engageable with the bracket base wherein the selectable at least two rigid selectable bracket covers are removably slidably couplable to said bracket base by slidably engaging the upper lip with the upper retention element and the lower lip with the lower retention element and wherein the width of the face of a first one of the at least two rigid selectable bracket covers is wider than the width of the face of a second one of the at least two rigid bracket covers and can be selectively releasably attached to the base during a treatment such that the treatment utilizes either the first bracket cover or the second bracket cover depending on a patient's treatment needs at a stage of the treatment.
US11744679B1 Orthodontics cover
An orthodontics cover shields a patient's mouth from orthodontic appliances. The orthodontics cover comprises an arched shaped strip that has a protective outer perimeter to shield the patient's mouth. The strip has an inner perimeter having a longitudinally extending channel. The channel is formed on the inner perimeter of the strip, between opposed longitudinal ends. The channel covers the exterior surface of the patient's orthodontics appliances, such as braces or wires. The opposed longitudinal ends of the strip have lateral side flanges that cover an end portion of the patient's orthodontics appliances, such as the end of an orthodontics wire, to prevent engagement with the patient's mouth.
US11744677B2 Arch adjustment appliance
The present disclosure provides method, systems, and devices for adjusting an arch of teeth. An appliance includes a removable shell formed of a first material having a number of cavities formed therein, wherein the number of cavities are shaped to receive teeth of a patient, and an arch element extending from the removable shell in a lingual direction and across at least a portion of the arch width of the removable shell, wherein the arch element is designed to expand an arch of the teeth of the patient, wherein the arch element has a width specific to a stage of a treatment plan.
US11744676B2 Dental appliances with repositioning jaw elements
The present disclosure provides method, computing device readable medium, and devices for dental appliances with repositioning jaw elements. An example of a removable dental appliance includes a shell having a number of tooth apertures configured to receive and reposition a number of teeth of a patient along one jaw of a patient, a repositioning jaw element that extends from a buccal or lingual surface of the shell, the element having a first outer surface oriented to face the tongue of the patient surface and a second outer surface oriented to face the cheek of the patient, and a reinforcement member formed along at least one of the first and second outer surfaces to provide reinforcement of the repositioning jaw element.
US11744674B2 Two-component mixing capsule, in particular for dental purposes
The disclosure relates to a two-component mixing capsule for intake and for mixing of two compositions with a capsule housing having a discharge spout at its front end, wherein the mixing capsule comprises a first mixing chamber and a second mixing chamber, wherein the two mixing chambers may be separated from each other for storage or for transport, by the first mixing chamber being rotatable into a first position in which the first mixing chamber is separated from mixing chamber, by a rotatably mounted handhold element, the rotational axis of which is approximately perpendicularly arranged to the longitudinal axis of the mixing capsule. The two mixing chambers form a common mixing chamber by rotating the first mixing chamber into a second position in which the central axes of the first and second mixing chamber are substantially coaxially arranged, wherein the composition may be discharged after mixing by attaching a squeezing piston.
US11744661B2 Robotic surgical tools with torsion cable actuation
A robotic surgical tool includes a drive housing having a first end, a second end, and a lead screw extending between the first and second ends, a carriage movably mounted to the lead screw at a carriage nut secured to the carriage, and an activating mechanism including a drive gear rotatably mounted to the carriage and rotatable to actuate the activating mechanism. A torsion cable extends between the drive gear and a drive input arranged at the first end, wherein rotating the drive input rotates the torsion cable and thereby transmits a torsional load along the torsion cable to the drive gear to actuate the activating mechanism.
US11744657B2 Infrared signal based position recognition system for use with a robot-assisted surgery
An improved device for regenerating an infrared signal transmitted over the air for use in detecting a 3-dimensional position of an object. The regeneration device includes an infrared signal transmitter and detector that receives from the object a responsive infrared signal in response to the infrared signal transmitted by the transmitter. A low pass filter receives the responsive infrared signal from the detector and outputs a low-pass filtered signal. A comparator compares the output of the infrared signal detector and output of the low pass filter and generates an output representing a logic state based on the comparison.
US11744656B2 Geared grip actuation for medical instruments
An actuation mechanism for a medical instrument includes a pinion and a face gear that move a push-pull element. The pinion has a mounting that permits rotation of the pinion by an external control system such as a robot. The face gear meshes with the pinion. The push-pull element may have a proximal end coupled to the face gear and a distal end coupled to a tool at a distal end of an instrument shaft. A manipulator coupled for manual rotation of the actuation mechanism may include a slip clutch to prevent manual application of excessive force to the actuation mechanism.
US11744655B2 Drill guide fixtures, cranial insertion fixtures, and related methods and robotic systems
A drill guide fixture may be configured to prepare a skull for attachment of a cranial insertion fixture. The drill guide fixture may include a central drill guide and a bone anchor guide at a base of the drill guide fixture. The central drill guide may define a central drill guide hole therethrough, wherein the central drill guide hole has a first opening at a base of the drill guide fixture and a second opening spaced apart from the base of the drill guide fixture. The bone anchor drill guide may define a bone anchor drill guide hole therethrough, and the bone anchor drill guide hole may be offset from the central drill guide hole in a direction that is perpendicular with respect to a direction of the central drill guide hole. Related cranial insertion fixtures, robotic systems, and methods are also discussed.
US11744654B2 Systems and methods for coupling components of a medical system
The systems and methods of the present disclosure are for use in a medical procedure, in which a connection mechanism is provided with a first end connected to a medical system interface at a first joint and a second end connected to an anatomic orifice device at a second joint. The anatomic orifice device is fixedly coupled to a patient. A flexible portion is provided between the first and second ends, the flexible portion being able to provide flexibility in at least one degree of freedom in response to movement of the anatomic orifice device.
US11744652B2 Visualization of predicted dosage
Various embodiments of an apparatus, methods, systems and computer program products described herein are directed to Field Visualization Engine. The Field Visualization Engine tracks one or more collimator poses relative to one or more Augmented Reality (AR) headset device poses. Each respective collimator pose and each respective headset device pose corresponds to a three-dimensional (3D) unified coordinate space (“3D space”). The Field Visualization Engine generates an AR representation of a beam emanating from the collimator based at least on a current collimator pose and a current headset device pose. The Field Visualization Engine further generates an AR visualization of emanation of the beam throughout an AR display of medical data.
US11744651B2 Systems and methods for navigation and visualization
A surgical system and method involve a robotic system that has a moveable arm that supports an end effector relative to a surgical site to remove material from a bone. A scanner scans the surgical site and detects a vessel on the bone. Controller(s) is/are coupled to the robotic system and the scanner. The controller(s) obtain image data of the bone and receive, from the scanner, positional information of the vessel on the bone. The controller(s) input the positional information of the vessel to the image data of the bone and generate a boundary for the vessel. The controller(s) register the boundary to the bone for navigation and control the robotic system to remove material from the bone with the end effector and prevent interaction between the end effector and the vessel with the boundary.
US11744646B2 Registration probe for image guided surgery system
Tools used within a surgical area may be equipped with sensors that allow them to be tracked within the magnetic field of an image guided surgery (IGS) system. The IGS system may be configured to detect various movement patterns of the tools, which may be mapped to and associated with corresponding actions or inputs to the IGS system. In one example, a registration probe may be moved along the x-axis and y-axis, with detected movements identified and received by the IGS system as movements of a mouse cursor on a display of the IGS system. In another example, the registration probe may be moved in a circular pattern, or quickly moved along any of the x-axis, y-axis, or z-axis, with each being configured to cause the IGS system to zoom a display, change a view, record video, or other actions.
US11744645B2 Surgical tool with a two degree of freedom wrist
Surgical tools that include a mechanisms for transmitting torque through an angle are disclosed. A surgical tool includes an instrument shaft, a drive shaft, an end effector, a driven shaft, and a coupling member. The instrument shaft is elongated along an instrument shaft axis. The drive shaft is mounted to the instrument shaft for rotation about a drive shaft axis. The end effector is coupled with the instrument shaft so that an orientation of the end effector can be varied relative to the instrument shaft. The driven shaft is coupled with the end effector to articulate a feature of the end effector via rotation of the driven shaft relative to the end effector. The coupling member couples the drive shaft with the driven shaft so that a rate of rotation of the drive shaft and a rate of rotation of the driven shaft about a driven shaft axis are equal.
US11744635B2 Sterile medical instrument charging device
A system includes a medical device and a charging device. A sterile barrier may be interposed between the medical device and the charging device. The medical device includes an integral power source and an active element. The charging device is configured to charge the integral power source. The charging device may charge the integral power source through direct contact between features of the charging device and features the medical device. The charging device may alternatively charge the integral power source wirelessly, such as through inductive coupling. The medical device may include conductive prongs that are retained by the charging device. The charging device may physically couple with the medical device via magnets. The medical device and the charging device may be provided together in a sterile package as a kit. The kit may also include a reclamation bag to facilitate reclamation of electrical components.
US11744632B2 Generator with regeneration device
An electrosurgical generator having an oscillating circuit that is excited by an excitation circuit with a frequency preferably close to the resonance frequency of the oscillating circuit. A regeneration circuit, which may be a voltage multiplier circuit, is used to stop the oscillation as suddenly as possible without losing the energy stored in the oscillating circuit.
US11744631B2 Systems and methods for controlled electrosurgical coagulation
The present disclosure includes an electrosurgical generator that controls treatment energy to be provided in a coagulation mode, where the treatment energy has an adjustable voltage ramp rate which can be set to a ramp rate in a range of voltage ramp rates. The generator receives signals from an instrument over time relating to load impedance. When the load impedance is above a threshold, the generator sets the adjustable voltage ramp rate to a ramp rate in the range of voltage ramp rates, and decreases, at the adjustable voltage ramp rate, a voltage of the treatment energy. When the load impedance is below the threshold, the generator sets the adjustable voltage ramp rate to a ramp rate in the range of voltage ramp rates, and increases, at the adjustable voltage ramp rate, the voltage of the treatment energy.
US11744629B2 Cryosystem comprising nanoparticles for treating a body part of an individual by cryotherapy
A cryo-system for treating a body part of an individual by cryotherapy, which includes two parts. The first part is either i) a cryo-probe suitable for internal cooling, which includes a penetrating segment in communication with a cryogen source and is at least smaller than 1/10th of the body part's biggest volume and/or at least one dimension smaller than 1 cm or ii) a cryo-probe suitable for external cooling, which includes a non-penetrating segment in communication with a cryogen source. The second part is either i) an assembly of at least two nanoparticles bound to each other or associated with each other via binding or associating material or ii) at least one nanoparticle, which includes iron and at least one other metal than iron. The assembly of at least two nanoparticles or the at least one nanoparticle may be cooled by the cryo-probe or by switching on the cryo-probe.
US11744628B2 Instruments and related methods for breaking reduction tabs
Instruments and related methods for breaking reduction tabs are disclosed herein, e.g., for breaking reduction tabs of a bone anchor or other implant. In some embodiments, the instrument can be configured to minimize the space needed to operate the instrument. For example, the instrument can be configured to receive a reduction tab that is to be broken while the instrument is coaxially positioned with respect to a bone anchor receiver to which the reduction tab is attached. As another example, the instrument can have a maximum outer transverse dimension that is less than, equal to, or only slightly greater than a corresponding dimension of a bone anchor from which a reduction tab is to be broken. Guide rods for positioning a tab breaker instrument over a reduction tab are also disclosed.
US11744624B2 Bone screw
Bone graft comprising cortical bone material having a screw shank with an external thread and a screw head. Screw head has an outer jacket surface which is rotationally symmetrical about a screw head axis and has an external thread. At least two recesses, which are distributed about the screw head axis, extend axially in the direction of the screw head axis and open into an end face of a free end of the screw head, for receiving an insertion tool. The recesses are each formed by side faces, which extend from the outer jacket surface in the direction of the screw head axis and merge into one another in a surface section close to the axis. By this design, introduction of an insertion torque is optimized and new surgical areas of application such as in intramedullary splinting, arthroscopic insertion and deep insertion of the graft into an bearing bone are possible.
US11744614B2 Catheter extraction
A catheter extraction tool has a head that can be placed in position to significantly surround a diameter of a catheter. The head is shaped to have a low enough profile above the catheter to allow the head to be slid down the catheter and into a subdermal region in which the catheter is subdermal with respect to a patient. The head of the catheter extraction tool is expanded sufficiently to slide the head over a catheter cuff located in the subdermal region. After the head of the catheter extraction tool slides over the catheter cuff, the head is contracted to engage the catheter so that a user can pull the catheter out of the patient using the catheter extraction tool.
US11744613B2 Catheter-based system for delivery and retrieval of a leadless pacemaker
Catheter-based delivery systems for delivery and retrieval of a leadless pacemaker include features to facilitate improved manipulation of the catheter and improved capture and docking functionality of leadless pacemakers. Such functionality includes mechanisms directed to deflecting and locking a deflectable catheter, maintaining tension on a retrieval feature, protection from anti-rotation, and improved docking cap and drive gear assemblies.
US11744611B2 Puncture system
The invention relates to a puncture system having an outer tubular body which is designed to remain in a body part of a living being, said puncture system comprising at least one inner tubular body and a puncture needle, wherein the inner tubular body is guided through a working lumen of the outer tubular body and is longitudinally displaceable relative to the outer tubular body, and the puncture needle is guided through a puncture lumen of the inner tubular body and the inner tubular body is longitudinally displaceable relative to the puncture needle. The puncture system has a manually actuatable element that can be moved by manual actuation at least into a fixing position and into a release position, wherein, in the fixing position, the longitudinal displaceability a1) of the inner tubular body relative to the outer tubular body and/or a2) of the puncture needle relative to the inner tubular body and/or a3) of the puncture needle relative to the outer tubular body is removed or reduced.
US11744609B2 High power atherectomy with multiple safety limits
An atherectomy system includes an electric drive mechanism that is adapted to rotatably actuate an atherectomy burr and a controller that is adapted to regulate operation of the electric drive mechanism. The controller regulates operation of the electric drive mechanism in accordance with a power input limit value that limits how much power can be put into an atherectomy burr and an energy input limit value that limits how much energy can be put into the atherectomy burr. The controller may also regulate operation of the electric drive mechanism in accordance with a dynamic torque limit.
US11744606B2 Tissue resecting instrument including an outflow control seal
A tissue resecting end effector includes a housing, a shaft extending from the housing, and a drive assembly operably coupled to the shaft such that a rotational input provided to the drive assembly effects the rotation and reciprocation of the shaft relative to the housing. The assembly includes a proximal portion translationally fixed and rotatably coupled to the housing and configured to receive the rotational input and to rotate relative to the housing in response thereto, a distal portion translationally and rotatably coupled to the housing and operably coupled to the proximal portion such that the rotation of the proximal portion relative to the housing effects rotation and reciprocation of the distal portion relative to the housing to thereby rotate and reciprocate the first shaft relative to the housing, and a seal member disposed on the proximal portion or the distal portion and configured to selectively establish a seal therebetween.
US11744599B2 Smart surgical instruments for artificial joint replacement
A smart surgical instrument for artificial joint replacement includes a femur resection device, a tibia resection device, and a detector having a shape corresponding to the resected surfaces of a femur and a tibia. The femur resection device includes a laser device such that the femur resection device can be aligned for resection of the femur without drilling an intramedullary hole, thereby preventing complications attributable to the intramedullary hole. The tibia resection device includes a laser device, thereby enabling an easy and fast surgical operation without using an extramedullary aligner used for alignment of a tibia during resection of the tibia. The detector includes a rotation detection means and a pressure detection means and is inserted between trials to allow numerical verification for medial and lateral balance of forces and a rotation state of the trials. The surgical instrument enables a precise, accurate, easy, and fast surgical operation.
US11744593B2 Method for authenticating the compatibility of a staple cartridge with a surgical instrument
A method for authenticating the compatibility of a staple cartridge with a surgical instrument is disclosed. The method can comprise inserting a staple cartridge into a surgical instrument, receiving a first signal from a first RFID tag on a first component of the staple cartridge with an RFID reader system, receiving a second signal from a second RFID tag on a second component of the staple cartridge with the RFID reader system, comparing the first signal and the second signal to stored data for a compatible staple cartridge, and locking a staple firing system of the surgical instrument if the first signal and the second signal do not match the stored data for a compatible staple cartridge.
US11744586B2 Surgical instrument with imaging device
A loading unit configured for engagement with a surgical instrument, and including a proximal body portion, an end effector, and an imaging device. The end effector is disposed in mechanical cooperation with the proximal body portion, and includes a first jaw member and a second jaw member. At least one of the first jaw member and the second jaw member is movable with respect to the other of the first jaw member and the second jaw member between an open position and an approximated position. The first jaw member includes a first tissue contacting surface, and the second jaw member includes a second tissue contacting surface. A distal portion of the first jaw member is disposed at a first angle with respect to the first tissue contacting surface. The imaging device is disposed on the distal portion of the first jaw member, and is configured to capture visual data.
US11744581B2 Powered surgical instruments with multi-phase tissue treatment
A surgical instrument that comprises an end effector comprising a first jaw, a second jaw, a staple cartridge, and at least one electrode. The surgical instrument further comprises a drive member, a motor assembly, and a control circuit. The control circuit is configured to cause the at least one electrode to deliver a therapeutic energy to the tissue in a first phase of a surgical treatment, cause the motor assembly to move the drive member to deploy staples into the tissue in a second phase of the surgical treatment, monitor a first tissue property in the first phase, and switch from the first phase to the second phase if at least one of two conditions is met, set a parameter of the second phase based on at least one measurement of the tissue property determined in the first phase, and monitor a second tissue property, in the second phase.
US11744578B2 Surgical instrument including a firing member having a plurality of layers
A surgical instrument comprising a surgical end effector that comprises a first jaw and a second jaw that is movably supported relative to the first jaw for selective movement between an open position and closed positions. The surgical instrument further comprises a closure member that is axially movable in response to closing and opening motions. The closure member comprises at least one opening cam that protrudes therefrom to movably engage a corresponding cam surface on the second jaw such that upon application of the opening motion, the at least one opening cam movably engages the corresponding cam surface to move the second jaw to an open position, even when the jaws are under a load.
US11744577B2 Suture thread products
There is provided a product comprising a suture thread which, prior to being used to form a surgical suture, is in a stressed state which gives the suture thread a tendency to undergo lengthwise viscoelastic contraction. The suture thread undergoes viscoelastic contraction when in use as a surgical suture and this may promote wound healing to a greater extent than a conventional suture thread which does not undergo viscoelastic contraction.
US11744576B2 Method and apparatus for applying a knot to a suture
A knot placement device allows a physician to apply a knot for securing two or more suture ends extending from an incision in a vessel or organ of a patient relative to each other in order to seal an opening in the vessel or organ. The knot placement device has a handle and an elongate shaft and a push rod slidably inserted in said shaft. A knot is disposed in the distal end of the shaft. An actuator on the handle may be depressed to distally advance said push rod relative to said shaft and thereby distally advance said knot. The knot may include a knot body having an inner cavity and a plug sized to fit securely within the inner cavity. In use, the plug may be inserted into the inner cavity of the knot body to fixedly hold two or more suture ends between the knot body and the plug.
US11744565B2 Surgical evacuation apparatus and method
A surgical evacuation apparatus and method for evacuating a biological material from a body cavity. The surgical evacuation apparatus has a shaft and a scoop extending from a distal end of the shaft. The shaft has a supply inlet for connecting to a pressurized fluid source and an outlet for connecting to a vacuum source. An evacuation channel extends from the scoop to the outlet. A fluid supply channel extends in the shaft from the supply inlet towards the distal end and intersects the evacuation channel proximate the scoop. Material desired to be removed from the body cavity is collected in the scoop by a user. The biological material collected in the scoop is broken up by a fluid stream from the supply channel and is drawn into the evacuation channel by a vacuum applied by the vacuum source and is removed from the body cavity.
US11744562B2 Biodegradable urine collector
A single-use, biodegradable, paper urine collector and method of using same, the urine collector including a funnel body having a sloped continuous sidewall, a sloped base, a top opening, a funnel hole located at the lowest region of the sloped base and, optionally, a urine sample container operatively coupled to the sloped base. To convey funneled urine into the container, a top edge of the container is positioned within the funnel hole and the base of the container is positioned outside the funnel body. The funnel body is configured to funnel a stream of urine through the top opening and along an interior surface of the funnel body toward and through the funnel hole.
US11744560B2 Sampling capsule
A sampling capsule is provided. The sampling capsule includes an enclosure, a sampling assembly, a sample drawing assembly and a control module. The sampling assembly includes a sample chamber arranged in the enclosure, an outer sampling port on the enclosure, a sampling tube connecting the outer sampling port and the sample chamber, and a sampling switch for opening or closing the connecting tube. The sample drawing assembly includes a sample drawing port on the enclosure and connected to the sample chamber, and a silicone plug fitted in the sample discharging port. The control module includes a microprocessor communicating with the sampling switch.
US11744559B2 System and method for unobtrusively determining a fertile window
A system for unobtrusively determining a fertile window includes a contact sensor in contact with the woman and configured to provide a signal indicative of respiration of the woman. A processor is configured to process the signal to obtain a biomechanical parameter indicative of the respiration, and determine the fertile window of the woman based on a change in the obtained biomechanical parameter.
US11744557B2 Ultrasound imaging system with tissue specific presets for diagnostic exams
An ultrasound system has user selectable tissue specific presets by which a user can condition the ultrasound system to be optimized for specific types of diagnostic exams. After an exam type has been selected and the exam commenced, a user manipulates imaging and workflow controls to better visualize the target anatomy. The user has the choice of setting up the system so that imaging and workflow settings are maintained when the tissue specific presets are changed, or to reset the imaging and workflow settings to default values upon a change of the tissue specific presets.
US11744552B2 Ultrasound diagnostic apparatus, medical image processing apparatus, and medical image processing method
An ultrasound diagnostic apparatus according to an embodiment includes processing circuitry configured to execute transmit aperture synthesis to conduct coherent summation on multiple received signals that are at different transmit apertures and in an identical scan line, evaluate a degree of consistency between phases of the received signals to calculate an evaluation value at each observation point, and correct a received signal having undergone the transmit aperture synthesis based on the evaluation value.
US11744551B2 Hand held ultrasound probe
A portable ultrasound probe is described having a mechanical transducer, rotating mirror, and mirror motor. The transducer can be used for diagnostic imaging and procedural guidance imaging. The probe has a light weight design for easy one-handed use, and can use external processors to provide proper image display with accompanying software.
US11744550B2 Ultrasound probe, acoustic lens, ultrasound diagnosis apparatus, and coupler for ultrasound probes
An ultrasound probe according to an embodiment includes a base material, a first organic layer, and a second organic layer. The base material contain polyolefin. The first organic layer is formed on the outer surface of the base material and contains epoxy resin and silicate oligomer. The second organic layer is formed on the outer surface of the first organic layer and has hydrophilicity.
US11744544B2 Devices, systems, and methods for vessel assessment
Devices, systems, and methods for visually depicting a vessel and evaluating a physiological condition of the vessel are disclosed. One embodiment includes obtaining, at a first time, a first image of the vessel, the image being in a first medical modality, and obtaining, at a second time subsequent to the first time, a second image of the vessel, the image being in the first medical modality. The method also includes spatially co-registering the first and second images and outputting a visual representation of the co-registered first and second images on a display. Further, the method includes determining a physiological difference between the vessel at the first time and the vessel at the second time based on the co-registered first and second images, and evaluating the physiological condition of the vessel of the patient based on the determined physiological difference.
US11744539B2 Ultrasound patch for detecting fluid flow
An ultrasound patch includes one or more transmit and receive piezoelectric transducer elements. In some embodiments, the transducer elements are positioned on a ramp on a patient pad of the patch that is configured to fit within an anatomic space between the trachea and the sternocleidomastoid muscle to orient the transducer elements toward a carotid artery. In some embodiments, a flexible phased array transducer includes a number of pillar piezoelectric elements joined by a flexible adhesive with metal electrodes deposited thereon. The phased array transducer is mounted to a flexible circuit board that allows the transducer to bend and conform to a subject's anatomy.
US11744537B2 Radiography system, medical imaging system, control method, and control program
A compression plate of a mammography apparatus has an upper surface which is irradiated with radiation, a lower surface which is opposite to the upper surface and comes into contact with the breast, and a surface which is parallel to the upper surface between the upper surface and the lower surface. In the compression plate, a compression plate scale for identifying an in-plane position of each surface is given to any one of the surfaces. A first display control unit of a console performs control to display a radiographic image captured by the mammography apparatus on a display unit. A second display control unit of the console performs control to display an image scale which indicates a position on the radiographic image corresponding to the in-plane position of the compression plate on the radiographic image displayed on the display unit.
US11744534B2 Mobile tomography imaging
A detector used for tomography imaging is mobile, allowing the detector to move about an object (e.g., patient to be imaged). A swarm of such detectors, such as a swarm of drones with detectors, may be used for tomography imaging. The trajectory or trajectories of the mobile detectors may account for the pose and/or movement of the object being imaged. The trajectory or trajectories may be based, in part, on the sampling for desired tomography. An image of an internal region of the object is reconstructed from detected signals of the mobile detectors using tomography.
US11744531B2 Systems and methods for focal spot motion detection in both x- and y-directions and correction
A method for estimating motion of an X-ray focal spot is provided. The acts of the method include acquiring image data by causing X-rays to be emitted from the X-ray focal spot of an X-ray source toward a radiation detector comprising multiple channels, wherein a subset of the channels each have a collimator blade positioned above the respective channel. The acts of the method also include independently estimating X-ray focal spot motion in an X-direction for the X-ray focal spot relative to an isocenter of the radiation detector and in a Y-direction along a direction of the X-rays for the X-ray focal spot relative to the isocenter based on respective channel gains for a first channel and a second channel of the subset of the channels.
US11744530B2 Radiographic dental jigs and associated methods
Example radiographic dental jigs include a generally vertical post traversed by a generally horizontal beam to create a cross that can be used for marking a dental patient's midline (vertical line centered between the eyes), incisal edge plane, and forward lip position. The jig is radiographically scanned along with multiple fiducial markers on the patient's jaw to generate a first scan result. In some examples, physical models of the patient's jaws are also scanned to generate upper and lower jaw images. The upper and lower jaw images are shifted to coincide with the first scan result. Portions of the first scan result, including an image of the dental jig, are superimposed onto the properly shifted upper and lower jaw images to create a composite image. The composite image shows the dental jig in proper relation to the patient's upper and lower jaws, thereby rendering a conventional stick bite virtually obsolete.
US11744529B2 Supplementary collision detection and prevention system for a medical imager
The present invention relates to a collision detection and prevention system for medical X-ray equipment, in particular a supplementary system that augments an existing safety system, which is useful when the X-ray equipment includes an auxiliary apparatus, such as a radiation shield, which may interfere with the existing collision detection and prevention system.
US11744524B2 Statistical display method for physiological parameter of monitoring apparatus, and monitoring apparatus
This disclosure provides a monitoring apparatus and a statistical display method for physiological parameter(s) thereof. The method may include receiving statistical setting information including a time range, a time interval, a classification rule, and a target parameter, and the classification rule may define one or more types of the target parameter; obtaining N group of target parameter result corresponding to N time interval from a result of historical physiological parameter, where the N time interval is included in the time range, and the N group of target parameter result may be a physiological parameter result corresponding to the target parameter in the result of historical physiological parameter; counting the number of each type of the target parameter in the N group of target parameter result according to the classification rule, and obtaining N group of statistical result corresponding to the N time interval for each target parameter.
US11744519B2 Biological information measurement device
A biological information measurement device includes a first light emitting portion that emits first light, a second light emitting portion that emits second light, a light receiving portion that receives the first light reflected by an epidermis of a skin, a dermis of the skin, and a subcutaneous layer, and the second light reflected by the epidermis and dermis of the skin, and a processing unit that calculates biological information by removing noise, from a first detection signal output based on the first light received by the light receiving portion, using a second detection signal output based on the second light received by the light receiving portion.
US11744518B2 Sealed package and method of forming same
Various embodiments of a sealed package and a method of forming such package are disclosed. The package can include a non-conductive substrate that includes a cavity disposed in a first major surface. A cover layer can be disposed over the cavity and attached to the first major surface of the non-conductive substrate to form a sealed enclosure. The sealed package can also include a feedthrough that includes a via between a recessed surface of the cavity and a second major surface of the substrate, and a conductive material disposed in the via. An external contact can be disposed over the via on the second major surface of the non-conductive substrate, where the external contact is electrically connected to the conductive material disposed in the via. The sealed package can also include an electronic device disposed within the sealed enclosure that is electrically connected to the external contact.
US11744516B2 Sensor for acquiring physiological signals
A device for acquiring and collecting physiological signals is disclosed. In at least one embodiment, the device provides an at least one sensor having a conductive layer comprising a conductive fabric of interlaced conductive and non-conductive fibers and a plurality of orifices throughout the conductive fabric, wherein the plurality of orifices are filled with a silicone rubber, and wherein the silicone rubber is attached to the conductive fabric without the use of an adhesive. An electrical connector is connected to the conductive layer, the electrical connector providing a separable interface between the conductive layer and an electronic instrument. The device further provides an electronic instrument for receiving and collecting signals acquired from the at least one sensor.
US11744515B2 Estimation of effectiveness of ablation adjacency
Methods for estimating of the effectiveness of catheter ablation procedures to form lesions, and particular lesions which together form an ablation segment of an ablation line. Lesion effectiveness parameters are received, and effectiveness, optionally the joint effectiveness, of corresponding ablations (optionally planned, current, and/or already performed) is estimated. In some embodiments, estimating is based on use by computer circuitry of an estimator constructed based on observed associations between previously analyzed lesion effectiveness parameters, and observed lesion effectiveness. Additionally or alternatively, estimators may be constructed based on analytic functions. The estimator is used by application to the received lesion effectiveness parameters.
US11744514B2 Device and method for calibrating a non-invasive mechanically tactile and/or thermal neurostimulation
A device for stimulating neurons that includes a stimulation unit that applies mechanically tactile and/or thermal stimuli to the body surface of a patient that stimulate neurons with a pathologically synchronous and oscillatory neural activity. The device includes a measuring unit that records measurement signals of neural activity of the stimulated neurons, and a controller that controls the stimulation unit and analyzes the measurement signals. The controller actuates the stimulation unit to scan at least one part of the body surface of the patient along a path and thereby periodically applies stimuli and also selects two regions or more regions on the patient's body surface along the path where the phase synchronization between the periodic application of the stimuli and the neural activity of the stimulated neurons have a local maximum using the measurement signals. The stimuli are then applied in a delayed manner in the two regions.
US11744510B2 System for imaging lesions aligning tissue surface
Methods, compositions and systems are provided for the imaging of cavity/tissue lesions, including without limitation cavity/tissue malignant lesions, e.g. cancers of the skin, mouth, colon, digestive system cervix, bladder, lung, etc.
US11744506B2 Systems and methods for analyzing concussion biomarkers
The various examples of the present disclosure are directed towards systems and methods for diagnosing brain health. An exemplary system includes a microscope, a processor, and a memory. The microscope outputs image data of a cornea of a patient. The memory has a plurality of stored code sections, which, when executed by the processor, include instructions for analyzing cornea image data to determine brain health. The instructions begin with receiving cornea image data from the microscope. The instructions then provide for determining at least one marker from the received cornea image data. The instructions then provide for outputting a brain health diagnosis based on the at least one marker.
US11744498B2 Catheter system
In one example, the disclosure relates to a catheter system comprising an elongated body defining a lumen. The elongated body comprising a proximal portion and a distal portion. An anchoring member is positioned on the proximal portion of the elongated body. The anchoring member configured to anchor the proximal portion of the elongated body to a patient. The catheter system includes one or more sensors positioned on the elongated body. The one or more sensors are configured to sense a parameter of a fluid within the lumen of the elongated body. The catheter system includes memory positioned on the elongated body, the memory configured to store patient-specific information.
US11744496B2 Method for classifying mental state, server and computing device for classifying mental state
A method of classifying a mental state of a user using a computing device, which includes a microphone, a camera, a display, a wireless communication unit, and a processor, and a mental state classification server is provided. The method comprises: by the microphone, detecting ambient noise of the user; by the camera, generating an image by photographing a face of the user; by the processor, checking whether each of ambient noise of the user, ambient brightness of the face of the user obtained from the image, and a face position of the user obtained from the image is suitable for a heart rate variability measurement environment; by the processor, controlling to display on the display images indicating whether each of the ambient noise, the ambient brightness, and the face position is suitable for the heart rate variability.
US11744494B2 Blood contaminant sequestration device with one-way air valve and air-permeable blood barrier with closure mechanism
Blood sample optimization systems and methods are described that reduce or eliminate contaminates in collected blood samples, which in turn reduces or eliminates false positive readings in blood cultures or other testing of collected blood samples. A blood sample optimization system can include a blood sequestration device located between a patient needle and a sample needle. The blood sequestration device can include a sequestration chamber for sequestering an initial, potentially contaminated aliquot of blood, and may further include a sampling channel that bypasses the sequestration chamber to convey likely uncontaminated blood between the patient needle and the sample needle after the initial aliquot of blood is sequestered in the sequestration chamber.
US11744488B2 NFC glucometer containing rechargeable battery
The disclosure refers to a medical device comprising a measurement unit adapted to measure a value of a physiological parameter, for example a blood glucose level, an energy storage unit providing energy supply for the measurement unit, an NFC antenna, an energy supply unit that controls the NFC antenna such that in the presence of an electromagnetic field of a pre-defined frequency range energy is withdrawn from the electromagnetic field surrounding the NFC antenna and stored in the energy storage unit, a charge control unit adapted to determine the electric charge contained in the energy storage unit, and a communication unit adapted to output a pre-defined visible, audible and/or tactile signal if the electric charge contained in the energy storage unit determined by the charge control unit is equal to or below a pre-defined minimum charge value.
US11744485B2 Lower limb loading assessment systems and methods
A lower limb loading assessment system having at least one motion sensor mounted to a subject's lower limb that is configured to sense the tibial shockwaves experienced by the lower limb as the subject performs a repetitive physical activity involving repetitive footstrikes of the lower limb with a surface. The motion sensor comprises an accelerometer that is configured to sense acceleration data in at least three axes and generate representative acceleration data over a time period associated with the physical activity. The acceleration data represents a series of discrete tibial shockwaves from the discrete footstrikes. A data processor receives the tibial shockwave data and processes that to generate output feedback data comprising data to assist the subject to minimize future loading in their lower limbs.
US11744478B2 Absolute intrathoracic impedance based scheme to stratify patients for risk of a heart failure event
A health care system acquires data determines whether a patient is at risk of hypervolemia or hypovolemia. The method comprises (a) acquiring from a device memory a patient's absolute intrathoracic impedance data over a pre-specified time period, (b) determining a running average of the intrathoracic impedance data over the pre-specified time period, and (c) determining by the system whether the running average of the intrathoracic impedance data over the pre-specified time period exceeds one of a first and second range, the first range being a higher value boundary of intrathoracic electrical impedance and the second range being a lower value boundary of intrathoracic electrical impedance.
US11744477B2 Non-invasive method of estimating intra-cranial pressure (ICP)
A non-invasive method of estimating intra-cranial pressure (ICP). The method including the steps of: a. non-invasively measuring pressure pulses in an upper body artery; b. determining central aortic pressure (CAP) pulses that correspond to these measured pressure pulses; c. identifying features of the ICP wave which denote cardiac ejection and wave reflection from the cranium, including Ejection Duration (ED) and Augmentation Index of Pressure (PAIx); d. non-invasively measuring flow pulses in a central artery which supplies blood to the brain within the cranium; e. identifying features of the measured cerebral flow waves which denote cardiac ejection and wave reflection from the cranium as Flow Augmentation Index (FAIx); f. calculating an ICP flow augmentation index from the measured central flow pulses; g. comparing the calculated ICP pressure augmentation index (PAIx) and flow augmentation index (FAIx) to measure (gender-specific) pressure and flow augmentation data indicative of a measured ICP to thereby estimate actual ICP; and h. noting any disparity between ED measured for pressure waves and ED measured for flow.
US11744472B2 Hemodynamic parameter estimation based on image data
The present approach relates to determining a reference value based on image data that includes a non-occluded vascular region (such as the ascending aorta in a cardiovascular context). This reference value is compared on a pixel-by pixel basis with the CT values observed in the other vasculature regions. With this in mind, and in a cardiovascular context, the determined FFR value for each pixel is the ratio of CT value in the vascular region of interest to the reference CT value.
US11744471B2 Optical-based physiological monitoring system
A non-invasive, optical-based physiological monitoring system is disclosed. In an embodiment, the non-invasive, optical-based physiological monitoring system comprises an emitter configured to emit light into a tissue site of a living patient; a detector configured to detect the emitted light after attenuation by the tissue site and output a sensor signal responsive to the detected light; and a processor configured to determine, based on the sensor signal, a first physiological parameter indicative of a level of pain of the patient.
US11744466B2 Method and apparatus for localizing brain tissue regions connected with a brain function
An apparatus is for localizing brain tissue regions connected with a brain function in a brain operating field. The apparatus includes a stimulation apparatus and a localization unit with a camera. The stimulation apparatus is configured to carry out a number of stimulation cycles. Each cycle includes a stimulation phase during which the brain function is stimulated and a rest phase during which there is no stimulation of the brain function. The localization unit records at least one stimulation image with the stimulated brain function and at least one reference image without the stimulated brain function during each stimulation cycle and uses the recorded stimulation and reference images to localize the brain tissue regions connected with the stimulated brain function. The stimulation apparatus is configured to output a feedback signal to the localization unit with at least the start of a stimulation cycle being evident from the feedback signal.
US11744463B2 Remote monitoring of analyte measurements
Methods and apparatus, including computer program products, are provided for remote monitoring. In some example implementations, there is provided a method. The method may include receiving, at a remote monitor, a notification message representative of an event detected, by a server, from analyte sensor data obtained from a receiver monitoring an analyte state of a host; presenting, at the remote monitor, the notification message to activate the remote monitor, wherein the remote monitor is configured by the server to receive the notification message to augment the receiver monitoring of the analyte state of the host; accessing, by the remote monitor, the server, in response to the presenting of the notification message; and receiving, in response to the accessing, information including at least the analyte sensor data. Related systems, methods, and articles of manufacture are also disclosed.
US11744462B2 Head-mounted vision detection equipment, vision detection method and electronic device
The present disclosure relates to head-mounted vision detection equipment, vision detection method and electronic equipment, which relates to the technical field of vision detection. The head-mounted vision detection equipment includes a virtual reality headset, a sound collection device and a fundus detection device that are arranged on the virtual reality headset, and a processor. The vision detection headset is configured to display content to be recognized under control of the processor; the sound collection device is configured to obtain a recognition voice of a wearer for the content to be recognized; the fundus detection device is configured to obtain a fundus image of the wearer; and the processor is configured to acquire the recognition voice and the fundus image.
US11744456B2 Dynamic visual acuity measuring device and dynamic visual acuity measuring method
A dynamic visual acuity measuring device includes a projector projecting an index image pattern, a reflecting mirror reflecting light from the projector, a screen receiving light from the reflecting mirror and displaying the index image pattern, a movable casing holding and maintaining relative positions of the projector, the reflecting mirror, and the screen, a fixed casing supporting the movable casing, and a rotating shaft linking the movable casing rotatably to the fixed casing. In this device, the index image pattern displayed on the screen is moved in one direction by the reflecting mirror being displaced and a direction of movement of the index image pattern is changed in a coordinate system fixed to the fixed casing by the rotating shaft being rotated.
US11744453B2 Methods and apparatus to detect bleeding vessels
According to one aspect, a processor device in communication with an endoscopic device obtains a spectrum image of bleeding in an upper gastrointestinal (GI) area of a patient. A filter is applied to the spectrum image to generate a pre-enhanced image. The filter enhances the spectrum image at one or more light wavelengths in the light spectrum. The pre-enhanced image is analyzed to identify an area of interest that represents a portion of the upper GI area with an active bleed. A contrast enhancement technique is applied to the area of interest in the pre-enhanced image to generate an enhanced contrast image. Spatial filters are applied to the enhanced contrast image to produce a final colorized image with defined blood vessels in the upper GI area of the patient.
US11744448B2 Apparatus and method for increasing heat dissipation capacity of a medical instrument
A method and apparatus for improving a heat dissipation capacity. An apparatus comprises an elongate member, a housing, and a heat pump device. The elongate member has a distal end and a proximal end. The housing is coupled to the proximal end of the elongate member. The heat pump device is disposed between the proximal end of the elongate member and the housing. The heat pump device is disposed at least partially outside the housing and is configured to transfer thermal energy between the elongate member and the housing. The heat pump device has a maximum outer diameter that is greater than a maximum outer diameter of the elongate member.
US11744443B2 Layered walls for rigidizing devices
A rigidizing device includes an elongate flexible tube, a stiffening layer positioned radially outwards of the elongate flexible tube, an outer layer over the elongate flexible tube and the stiffening layer, and a vacuum or pressure inlet between the elongate flexible tube and the outer layer and configured to attach to a source of vacuum or pressure. The elongate flexible tube includes a first reinforcement element and a second reinforcement element. The second reinforcement element is counterwound relative to the first reinforcement element. The rigidizing device is configured to have a rigid configuration when vacuum or pressure is applied through the inlet and a flexible configuration when vacuum or pressure is not applied through the inlet.
US11744442B2 Endoscope, endoscope head, and method for connecting a shaft to an endoscope head to produce an endoscope
An endoscope includes an endoscope shaft (3), which has a cylindrical shaft tube (4), and an endoscope head (2), which is arranged at a proximal end of the endoscope shaft (3). A distal end region (11) of the endoscope head (2), has a cylindrical interior (13) with a peripheral groove (15). The shaft tube (4) is inserted into the cylindrical interior (13) and folded into the peripheral groove (15). The groove (15) is not rotationally symmetrical. An endoscope head and a method for producing an endoscope are also provided.
US11744440B2 Information processing apparatus, information processing method, and endoscope system for processing images based on surgical scenes
An information processing apparatus, an information processing method, and an endoscope system capable of providing an optimal video image to an operator in accordance with surgical scenes are provided. A processing mode determination unit determines, in accordance with surgical scenes, a processing mode for an in-vivo image captured by an imaging apparatus including an imaging element arranged so as to enable pixel shift processing, and an image combining unit processes an image output from the imaging apparatus, in accordance with the processing mode. The present technology is applicable to, for example, an endoscope system for imaging a living body with an endoscope.
US11744435B2 Dishwasher
Disclosed herein is a dishwasher. The dishwasher includes a main body, a tub provided inside the main body, a basket provided inside the tub to store items, an injection assembly configured to spray water to wash the item in the basket, and a duct including a first body configured to supply water to the injection assembly and provided to extend along a first direction, and a second body to which water flows and provided to extend from the first body to along second direction. The duct is formed by coupling of a first housing provided to form at least a portion of the first body and the second body, and a second housing provided to form another portion of the first body and the second body.
US11744433B2 Bucket mountable hanger
A hanger assembly for hanging wash mitts, rags and the like above a bucket includes a top subassembly with a mast and spaced apart arms extending radially from the mast. A bottom subassembly includes a bucket engaging structure and a shaft, to which the mast of the top subassembly is coupled (e.g., rotatably coupled). The bucket engaging structure of the bottom subassembly may include in one embodiment a plate, a tail and a pair of legs for engaging the sidewall of the bucket, or in another embodiment a ring or disc that sits on the bottom of the bucket.
US11744432B1 Adjustable dusting tool and related method
A manual dusting tool incorporating a handle connected to an elongated bendable paddle member adapted for insertion into a textile sock structure for use in dusting hard-to-access surfaces. The bendable paddle member may be deformably bent in either one or two directions to adopt a curved or serpentine shape as may be desired for cleaning.
US11744431B2 Surface cleaning apparatus
A surface cleaning apparatus is provided with a base assembly, an upright assembly, and a fluid recovery system. The base assembly includes a base housing, a brush chamber, at least one brushroll in the brush chamber; and a removable brush housing. A portion of the brush chamber is removable with the brush housing.
US11744428B2 Vacuum cleaning apparatus
A vacuum cleaner includes a driving wheel, a cleaning part, a dust-collecting unit, a dust collection amount detection part, and a travel control part. The dust collection amount detection part detects the amount of the dust and dirt accumulated in the dust-collecting unit. The travel control part controls the driving of the driving wheel to make the vacuum cleaner travel autonomously. The travel control part makes the vacuum cleaner travel to a dust station in the case the amount of the dust and dirt detected by the dust collection amount detection part is equal to or more than a specified amount while the cleaning part performs cleaning. The travel control part further makes the vacuum cleaner undock from the dust station to restart the cleaning after the dust and dirt accumulated in the dust-collecting unit is transferred to a dust-collecting container at the dust station. The vacuum cleaning apparatus can adopt a downsized vacuum cleaner while ensuring convenience.
US11744427B2 Floor cleaning machine with solid chemical delivery system
A floor cleaning machine is provided. The floor cleaning machine includes a solution tank for a cleaning solution. A pre-canister sensor receives the cleaning solution and measures the concentration of any dissolved solids. A canister assembly receives a portion of the cleaning solution from the pre-canister sensor and dissolves portions of a solid chemical form into the cleaning solution thereby forming blended droplets. The canister assembly has a spray nozzle positioned vertically above the solid chemical form. A post-canister sensor receives a mixture of the cleaning solution from the pre-canister sensor and the blended droplets from the canister assembly. The post-canister sensor measures the concentration of any dissolved solids within the mixture of the cleaning solution from the pre-canister sensor and the blended droplets from the canister assembly. A comparison of the baseline and post-canister measurements outside of a desired range results in replacement of the solid chemical form.
US11744424B2 Robot and movable device capable of identifying surface type
There is provided a robot including a first light source, a second light source, an image sensor and a processor. The processor is used to calculate an image quality of an image frame captured by the image sensor when the second light source is being turned on. The processor then determines whether to switch the second light source back to the first light source according to the image quality to accordingly identify the material of an operation surface.
US11744423B2 Telescopic conductive tube
A telescopic conductive tube is provided, including a conductive assembly. The conductive assembly includes an isolating guide, an isolating restraining tube, a rail, a wire, a guiding rod and a conductive spring. The conductive spring is sleeved on the guiding rod and electrically connects with the wire. The guiding rod and the conductive spring are accommodated within the isolating restraining tube. The isolating restraining tube is accommodated within the isolating guide. The wire is accommodated within the rail. The isolating restraining tube has one end inserted into the rail. The rail is slidable relative to the isolating guide. When sliding into the isolating guide, the rail slides along an outer wall of the isolating restraining tube, and the conductive spring is compressed by a bottom of the rail.
US11744422B2 Vacuum cleaner
A vacuum cleaner includes an air treatment or debris removable assembly with a multi-layer filtration stage. The multi-layer filtration stage can include an outer mesh screen, a louvered exhaust grill, and a multi-layer filter. Optionally, an inner perforated exhaust grill is also provided. The debris removable assembly can further include a cyclonic filtration stage.
US11744421B2 Surface cleaning apparatus
A surface cleaning apparatus includes first and second pre-motor filters that are in parallel.
US11744417B2 Surface cleaning apparatus with different cleaning configuration
A reconfigurable surface cleaning apparatus has a removable portable surface cleaning unit wherein the portable surface cleaning unit has upper and lower longitudinally spaced apart mounting members.
US11744416B2 Lint removing device
A lint removing device, includes a body, a handle connected to the body, and a lint removing assembly located in the body. The handle is hollow with an opening at one end, while the other end of the handle is connected to an outer wall of the body. The handle includes an extended functional structure, and the extended functional structure includes a fixed portion and a protruding portion. The fixed portion is placed inside the handle. The protruding portion extends out of the handle opening for the extended function, and the protruding portion is fixed in the handle by the fixed portion after the protruding portion is retracted in the handle. The lint removing device with an extended function of the handle enables the lint removing device to expand other functions in addition to the lint removing function.
US11744415B2 Toilet seat
Disclosed is a flexible toilet seat including a top surface; a bottom surface; an inner edge, at which the top and bottom surfaces meet; an inner region, configured to elastically and vertically deform inward relative to the outer edge in response to an applied load; and an outer region supported by an upper surface of a toilet and configured to support the inner region.
US11744414B2 Hand dryer and display
The invention provides a plurality of display devices such as hand dryers, each with a programmed computer display, and all communicating to a central location via a high speed link system. A display screen is mounted to each of the hand dryers and viewable by a user while drying the user's hands. A processor is located within the housing and is in signal-communication with the display screen. The high-speed link system is in signal-communication with each processor and an external data source, wherein the data source communicates with the processor to change the image displayed on the display screen. Sensors communicate ambient conditions outside of the display screen to a database.
US11744413B2 Dispenser assembly
A dispenser includes a front panel and a body coupled to the front panel to form an interior cavity. The body includes a wall portion having a top portion. An opening is formed through the top portion, and a housing includes a first housing wall and a second housing wall that each extend from the top portion adjacent the opening and into the interior cavity. The first and second housing walls include first and second rails, respectively, which are coplanar and extend from the respective first and second housing walls in opposing directions relative to each other.
US11744412B2 Dispenser system
A dispenser includes a dispenser body that has an interior cavity in which a first chassis is configured to be translated relative to a second chassis along a central axis. The dispenser has a cartridge including a container and a pump that includes a drive flange defining a drive diameter. The dispenser includes an adaptor having a pair of legs that are configured to be coupled to the drive flange and the first chassis, and the adaptor and the drive flange are configured to prevent the drive flange from being translated independently of each other.
US11744411B2 Hand sanitizing station
A hand sanitizing station includes a conduit in fluid communication with a source of sanitizer, the conduit having a fluid outlet. In addition, the hand sanitizing station includes a valve coupled to the conduit and configured to control the volume of sanitizer that exits the fluid outlet, the valve having a control arm. Further, the hand sanitizing station includes a pedal, and a cable connected between the pedal and the control arm of the valve and configured to move the control arm when the pedal is depressed and open the valve a predetermined amount. Movement of the pedal from a first position to a second position causes sanitizer to flow by gravity from the conduit and out of the fluid outlet, and movement of the pedal from the second position back to the first position closes the valve.
US11744409B1 Oral care products organizer
The oral care products organizer comprises a housing, a tablet holder, a drawer, and a drawer insert. The oral care products organizer is a device for organizing and storing oral care products. As non-limiting examples, the oral care products may comprise one or more toothbrushes, a tube of toothpaste, dentures, and a plurality of denture cleansing tablets. The tablet holder may store the plurality of denture cleansing tablets. The dentures may be stored in the drawer insert within the drawer. The housing may store the one or more toothbrushes and the tablet holder under a cap that protects the one or more toothbrushes from exposure. The drawer may be inserted into a drawer aperture at the bottom of the housing for storage.
US11744403B2 Automated bin system for accepting food items in robotic kitchen workspace
A robotic kitchen system for preparing food items in combination with at least one kitchen appliance such as a fryer comprises an automated bin assembly, a robotic arm, and a basket held by the robotic arm. The automated bin assembly comprises at least one automated bin for holding the food items. A camera or sensor array collects image data of the food items in the bin(s). A central processor is operable to compute and provide directions to the first robotic arm and automated bin assembly based on the image data and stored data to (a) move the robotic arm to the bin; (b) actuate the bin to drop the food items from the bin into the basket; (c) and to move the basket into the fryer all without human interaction. Related methods are also described.
US11744398B2 System and method for real-time automatic scoring of physical and operational properties of automatic espresso coffee machines for both mechanical and end-user optimal use criteria
A system and method is provided for real time automatic scoring of physical and operational properties of automatic espresso coffee machines applicable both for a single machine and a network of machines. The scoring scheme includes semantic context based on automatic monitoring of operation process variables and end-user annotations and scoring criteria. The method is decoupled from the coffee machine's controlling apparatus and utilizes a sensory reading device that is able to communicate over standard and proprietary network protocols with sensors and with other devices of the same type over direct, peer to peer or standard network, and Internet connections.
US11744395B2 Double-hinged food press device, system and method
A double-hinged food press for extruding foodstuff through a grate and operational by hand while held aloft or placed on a work surface. An upward-curved plunger handle, combined with a receiver handle designed to rest on the surface, positions the press for the operation. Rollers enable the grate to be snapped smoothly over risers into and out of recesses in the receiver without undue wear and resulting loss of integrity. A raised lip of resilient material surrounding a plunger face further ensures a tight fit between the plunger and receiver cup. Resilient material between the plunger face and the hinge barrel of the grate ensures a tight fit between the two. Hinge pins may be removed by the user for replacement of the grate. Bosses can extend from the receiver unit for support on the surface to assist in operation of the press. An attachable paddle can be used to collect extruded material and to scrape it from the grate.
US11744391B2 Hook for hanging basket
A hook for hanging a basket. A hook includes a wing member which helps in pressing two arms for easy removal of the basket. The hook includes a one way hook for holding a metal loop firmly therein. The hook is inserted into the metal loop and upon insertion of the hook, the metal loop stays firmly in a place thereof held by the one way hook that restricts the metal loop coming out of the hook. The hook provides the combined benefits of both metal hanger and convenience of plastic hanger. The hook is easy and fast to attach and remove if necessary.
US11744389B2 Shelf and drawer assemblies for storing bottles
A shelf assembly includes a frame assembly having a side member, wherein the frame assembly is operable between stowed and extended positions. A rack assembly includes a first rack hingedly coupled to a second rack. The first rack and the second rack are pivotally coupled to the side member of the frame assembly, and the rack assembly is operable between first and second positions. The first rack and the second rack are angled towards a pivot axis defined between the first rack and the second rack when the rack assembly is in the second position. The rack assembly moves from the first position to the second position as the frame assembly moves from the stowed position to the extended position.
US11744386B2 Head and limb safety crib bumper system
The present invention relates to a novel crib bumper device which creates a safe and soft environment for an infant sleeping in a crib. The device is configured to fit snugly between the vertical slats of a crib. Specifically, the device comprises a foam component of adjustable length, with a flat back surface and an inside portion comprising elongated, mushroom-shaped columns sized to fit between the vertical slats of a crib. The flat outside surface is then secured around the perimeter of a crib via a hook and loop fastener strap.
US11744384B2 Inflatable air mattress with integrated control
An air bed system including a plurality of peripheral devices and a pump unit configured to adjust a firmness of an air mattress, the pump unit including a pump. The system further includes a controller configured to execute instructions that cause the pump unit to wirelessly pair with at least one of the plurality of peripheral devices. The pump unit is configured to receive at least one control signal addressed to the at least one of the plurality of peripheral devices, and transmit the at least one control signal to the addressed device.
US11744380B2 Foldable and shippable adjustable bed assembly
A bed assembly includes a foldable multi-section bed base and a compressible mattress. The decking of the bed base defines a cavity in a folded position, and the compressible mattress is contained within the cavity. The decking also including folded portions to further decrease the dimensions of the bed assembly in the folded position.
US11744376B2 Microclimate control systems and methods
A method and system for temperature control of a microclimate device are disclosed. The temperature control can be integrated into a reservation system for the microclimate device. A user interface can receive a user input of a temperature control setting. The user interface can be integrated into the microclimate device. A processor can receive the user input and control a heating and/or cooling device to execute the temperature control setting.
US11744375B2 Seat configuration
A seating configuration is described. The seating configuration includes a seat. The seat includes a feature to retain a user in a specific position on the seat. The seating configuration includes a first back support. The first back support is positioned adjacent a posterior pelvic area of the user. The seating configuration includes a second back support. The second back support is positioned adjacent to the thoracic area of the user. The seat, the first back support, and the second back support together can be configured to create a natural alignment of a spinal column of the user.
US11744374B2 Reconfigurable apparatus having a leaf spring with a working length that shortens to increase resistance to tilting of a backrest relative to a column, and process for assembling the reconfigurable apparatus
Disclosed herein is a reconfigurable apparatus that includes a backrest, a seat coupled with a column, a linkage statically attached to the backrest, a leaf spring in direct contact with the linkage, a first structure fixed to the column, and a second structure. The first and second structures each have one or more teeth. The chair is also configured such that when a weight is applied to the seat, the one or more teeth of the second structure move along the one or more teeth of the first structure to thereby shorten a working length of the leaf spring and provide an increased resistance to tilting of the backrest relative to the column. A process for assembling the reconfigurable apparatus is also described herein.
US11744373B2 Chair having a leaf spring with a fulcrum point that moves to shorten a working length of the leaf spring and increase resistance to tilting of a backrest portion of the chair relative to a column portion of the chair
Disclosed herein is a chair that includes a backrest portion, a seat portion coupled with the backrest portion, a column portion coupled with the seat portion, a linkage coupled with the backrest portion, a leaf spring in direct contact with the linkage, an arc-shaped toothed structure fixed translationally relative to the column portion, and a different toothed structure in contact with the arc-shaped toothed structure. The chair is also configured such that when a weight is applied to the seat portion, a fulcrum point of the leaf spring moves as the different toothed structure moves along the arc-shaped toothed structure to thereby shorten a working length of the leaf spring and provide an increased resistance to tilting of the backrest portion relative to the column portion. A process for assembling the chair and a weight-based tilt-resistance assembly for use with the chair are also described herein.
US11744370B2 Portable chair
A chair may include a frame, a seat pan, a backrest, a pair of arm rests, and a plurality of legs wherein at least two legs may each provided with an inner leg and an outer leg and the inner leg is configured to telescope out of the outer leg, wherein the at least two legs may include a leg locking system for locking the outer leg to the inner leg when the chair is in an unfolded position, wherein the leg locking system may include a trigger housing, a trigger, and a latch, and wherein the latch may be configured to engage a bushing on the inner leg.
US11744369B2 Reclining seating unit with wall-proximity capability
A wall-proximity reclining seating unit includes: a frame having a back member and a pair of arms; a backrest; a seat; a footrest; a reclining mechanism connected between the frame, backrest, seat, and footrest, the reclining mechanism configured to move the seating unit between: (a) an upright position, in which the footrest is retracted below a forward portion of the seat; (b) a TV position, in which the backrest substantially maintains its angle, the seat substantially maintains its angle, and the first footrest is disposed in front of the seat; and (c) a fully reclined position, in which the backrest is disposed at a shallower angle, the footrest remains positioned in front of the seat, and the seat is moved forward of its position in the TV position; and a linear actuator comprising an energizing unit, a rail, and a carriage connected with the reclining mechanism.
US11744363B2 Furniture with air filter support
A furniture apparatus includes an integrated holder for supporting and securing an air filter system adjacent the furniture apparatus to filter air exhaled between persons at or near the furniture apparatus.
US11744362B1 Adjustable and stowable storage shelf for a storage enclosure
A storage enclosure includes a first support member spaced from a second support member. The first support member includes a first rotating shelf support and the second support member includes a second rotating shelf support. A third support member is spaced from a fourth support member. The third support member includes a first fixed shelf support and a second fixed shelf support and the fourth support member includes a third fixed shelf support and a fourth fixed shelf support. A shelf includes a first end connected to the first rotating shelf support and the second rotating shelf support and a second end. The shelf is positionable in a first configuration and a second configuration.
US11744360B1 Table with cable passageways
A table has a shelf beneath a tabletop which holds charging strips, communication hubs, cords and/or other equipment in a storage compartment behind a divider wall. The divider wall has an opening forming a passageway for cords from the equipment that are used to power and/or communicate with electronic devices on the tabletop or in a cubby on the shelf ahead of the divider wall. The table also has a groove in the tabletop for holding electronic devices. The groove has one or more apertures through which cords pass from the equipment in the storage compartment to the electronic devices in the groove for providing power and/or communication. The table can be a desk, conference table, side table, end table, night stand, and any other piece furniture that has the tabletop and shelf with a divider wall and opening according to the present invention, such as wall shelves.
US11744352B1 Belt-attached item holder
A holder for a tool of the type having a belt clip includes a rigid base having a front side, a rear side, a top edge, a bottom edge, and two side edges. At least one rigid belt loop is fixed with the rear side of the rigid base and is open therethrough between side edges thereof for receiving a belt of a person. A rigid front panel is held away from the front side of the rigid base by at least two vertical standoffs. The rigid front panel includes a cut-out portion adapted to receive the belt clip of the tool therein. In use, with the rigid base fixed with the person's belt, the belt clip of the tool is positioned within the cut-out portion of the rigid front panel and then lowered until the belt clip is retained between the rigid front panel and the rigid base.
US11744337B2 Cantilever parasol
The invention discloses a cantilever parasol with reduced maintenance workload. When the reel mechanism requires maintenance, one only needs to detach the reel housing from the inclined rod, without a need to perform a separate disassembly operation to the cord spool assembly or a need to change a connection relationship between the inclined rod and the post, avoiding difficulty in re-assembling the inclined rod.The cantilever parasol includes a post, an inclined rod and a reel mechanism. The reel mechanism includes a reel housing is detachably connected with the inclined rod, and a cord spool assembly is rotatably installed in the reel housing and located on an outer side of the inclined rod. One end of the inclined rod is connected with the post, the inclined rod is provided with a cord hole, and a cord is passed through the cord hole and connected with the cord spool assembly.
US11744332B2 Fastener chain
A method for manufacturing a fastener stringer according to the present invention, include a dyeing step for dyeing a fastener stringer including an element row fixed to a side edge portion of a tape made of fiber, a dye cleaning step for removing excess dye from the fastener stringer, a water repellent treatment step for adhering a non-fluorine-based water repellent agent to the fastener stringer, and a pre-dyeing degreasing step for degreasing oil and fat adhered to the fastener stringer by a wet process.
US11744330B2 Composite cleat
A composite cleat includes a first component and a second component. The first component is made of a first material and is formed a first connecting portion extended along a longitudinal axis and a ground contact surface disposed at one end thereof. The second component is made of a second material different from the first material and is formed a second connecting portion fixedly connected with the first connecting portion and a threaded stud disposed at one end thereof.
US11744327B2 Footwear with dual shanks
Footwear for covering a foot of a wearer includes an outsole configured for supporting the foot of the wearer, an upper secured to the outsole and configured for covering the foot of the wearer, an insole located above the outsole within the upper, a midsole located above the outsole and below the insole and first and second laterally adjacent shanks located above the outsole and below the insole. The first shank angles forward and outward from the heel portion to a lateral side of the middle portion and the second shank angles forward and outward from the heel portion to a medial side of the middle portion to form an acute angle therebetween and provide balance and torsional stability for sides of the wearer's foot.
US11744324B2 Article of footwear with multiple durometer outsole
The present invention is directed toward an article of footwear having a sole structure effective to increase traction on a support surface. The article of footwear includes a sole structure comprising a first sole structure and a second sole structure. The article of footwear includes a forefoot region, midfoot region, and hindfoot region. The first sole structure is disposed in the forefoot and hindfoot regions. The second sole structure is disposed in the midfoot region. An extension of the second sole structure that extends through the forefoot region is substantially covered by the first sole structure. A plurality of lugs extend downwardly from the bottom surface of the first sole structure. At least one lug extends downwardly from the extension of the second sole structure through the first sole structure. The first sole structure and the second sole structure have different durometers.
US11744322B2 Sole of a shoe, particularly an athletic shoe
The invention relates to a sole (1) of a shoe, particularly of an athletic shoe, wherein the sole (1) has an extension in a longitudinal direction (L) and an extension in a vertical direction (V) perpendicular thereto, wherein a number of recesses (2) is introduced into the sole (1), wherein the recesses (2) extend in a transverse direction (Q) perpendicular to the longitudinal direction (L) and perpendicular to the vertical direction (V) and permeate the sole (1) at least in part. In order to influence the spring behaviour of the sole in a desired, specified manner, according to the invention, there is a first group of recesses (2′) which, without external forces on the sole (1), are larger in the vertical direction (V) than in the longitudinal direction (L), and that there is a second group of recesses (2″) which, without external forces on the sole (1), are smaller in the vertical direction (V) than in the longitudinal direction (L), wherein at least in sections, at least one row (3, 4) of recesses (2′, 2″) is arranged adjacent to each other in the longitudinal direction (L), wherein a recess (2″) of the second group is arranged between two recesses (2′) of the first group.
US11744317B2 Sandal with heel strap
A Sandal with Heel Strap with several orthotic benefits is provided. The sandal has a unique combination of features what will be useful for the treatment and prevention of plantar fasciitis. The Sandal with Heel Strap has a medial split in the medial heel section of the sole. The medial split is designed so that it absorbs more energy than the other parts of the heel and promotes a lateral to medial rotation of the heel portion during the wearer's gait. In a preferred embodiment, the sandal will include a rocker bottom sole and raised bed for the big toe that begins its rise at the metatarsophalangeal joint. In an additional preferred embodiment, the sole of the sandal will also include a metatarsal bar that supports the traverse arch and an upward bend that begins to rise from the sole at a point just forward of the end of the medial split and intersects with the metatarsal bar.
US11744314B2 Method for producing conformal visor with integrated ophthalmic lenses and corresponding visor
The present invention refers to methods for producing a conformal visor (1b) with at least one integrated ophthalmic lens (2, 2a, 2b), wherein the at least one ophthalmic lens (2, 2a, 2b) is built up on the planar visor (1a) from layers of printing ink in an additive manufacturing scheme, wherein the layers are obtained through a targeted placement of droplets of printing ink at least partially side by side. The present invention further relates to a corresponding conformal visor (1b) with at least one integrated ophthalmic lens (2, 2a, 2b).
US11744313B2 Protective helmet
A protective helmet including a visor attached to the external sides of the helmet shell. The shell includes substantially flat mount surfaces on each side which correspond with substantially flat portions on the respective ends of the visor. A fastener hole on the shell aligns with an access hole on the visor so that the two elements can be releasably fastened. The access hole provides space for a fastener to protrude out from the surface of the shell, allowing the visor to sit flush against the shell when fastened together. The helmet may include chin straps which are attached to the inner surface of the shell. The helmet may also include a catch strip on the front of the visor which protrudes from the visor such that it can prevent a cloth helmet cover (sometimes used in games such as Roller Derby) from easily sliding off the helmet.
US11744309B2 Illuminated hard hat
An exemplary illuminated hard hat for providing visibility to workers is presented. The illuminated hard hat allows for the Illumination of the hard hat. Since, the illumination come from inside of the hard hat there no distracting lights to the face. The illuminated hard hat is lightweight and cost effective. The illuminated hard hat further protects workers from injury while meeting OSHA requirements required by law. The illuminated hard hat is useful for construction workers, road workers, mountain climbers as well as anyone who desires to wear a hard hat. While the illuminated hard hat is intended for hard hats, it can also be adapted to be used in any kind of hat worn by people.
US11744307B2 Size measurement device and size measurement system
[Problem] There are provided a size measurement apparatus and a size measurement system that even a user who has no specialized measurement technique can easily handle.[Solution Means] A size measurement system includes a size measurement apparatus (10) configured to be attached to a body of a user to measure a size and the like of the body of the user and output sensor measurement information representing the measured size and the like, a user terminal (20) configured to be operated by the user who measures the body, and a management server (30) configured to manage size information, shape information, and the like of apparel merchandise and provide merchandise search result information that is user size information as body size information of the user based on the sensor measurement information and information concerning merchandise matching the size.
US11744306B2 Systems and methods for magnetic attachment of a hair piece
Systems, devices, and methods including: a clasp, the clasp comprising: a body; one or more magnets of the clasp attached to an outside portion of the body; and a middle portion configured to extend away from the body such that hair is configured to go between the middle portion and the body to secure the clasp to the hair; a stay, the stay comprising: one or more magnets of the stay; where the clasp is detachably attached to the stay via the one or more magnets of the clasp and the one or more magnets of the stay; and where the stay is configured to attach to a hair piece.
US11744304B2 Underarm sweat pad
To configure a pad so as to be gentle to the skin, to prevent stretching and/or tearing of the front surface sheet, and to not reduce liquid permeability and air permeability. [Solution] An underarm sweat pad in which an absorbent is interposed between a front surface sheet and a back surface sheet and which is used folded in two at a folding line and attached to the inside of the axillary portion of a garment. The front surface sheet is composed of a hydrophilic cellulose fiber. Adhesive regions, in which an adhesive for bonding the front surface sheet to the absorbent is applied, are formed as stripes that are parallel to the folding line and are spaced at intervals in the direction that is orthogonal to the folding line.
US11744299B2 Safety-monitoring garment system
A safety-monitoring garment system is used to thoroughly monitor the health and performance of a user. The system includes a garment, at least one health-monitoring sensor, at least one performance-tracking sensor, a microcontroller, a user controller, and a portable power source. The garment is preferably a jacket for the user. The at least one health-monitoring sensor continuously monitors the vitals of the user, and the at least one performance-tracking sensor monitors the performance status of the user. The microcontroller stores, analyzes, and delivers the data from the at least one health-monitoring sensor and the at least one performance-tracking sensor to an external computing device. The user controller manages the at least one health-monitoring sensor and the at least one performance-tracking sensor. The portable power source provides the necessary power for the at least one health-monitoring sensor, the at least one performance-tracking sensor, the microcontroller, and the user controller.
US11744296B2 Smoking article
A smoking article is provided and has opposed lighting and mouth ends. A mouth end portion is disposed at the mouth end and a heat generation portion is disposed about the lighting end. An outer wrapping material is wrapped at least about the heat generation portion and extends toward the mouth end portion, to define a cylindrical rod. An aerosol-generating portion is disposed within the outer wrapping material and between the heat generation and mouth end portions. The aerosol-generating portion is configured to generate an aerosol in response to heat received from the heat generation portion. Heat from the heat generation portion for aerosol formation is provided by igniting a combustible fuel element (e.g., a plurality of parts or pieces of clean burning carbonaceous material) located within an enclosed heat generation cartridge.
US11744292B2 Electronic vapour inhaler including a control arrangement that recognizes an inserted cartridge or capsule
A cartridge for an electronic vapour inhaler is provided and includes an elongate induction heatable element and a flavour-release medium adhered to a surface of the elongate induction heatable element. The induction heatable element can include a tube having a wall with inner and outer wall surfaces and the flavour-release medium can be adhered to the outer or inner wall surface.
US11744286B2 Electronic cigarette (e-cigarette) capable of holding, heating, and quantitatively supplying gelled electronic liquid (e-liquid)
An electronic cigarette (e-cigarette) capable of holding, heating, and quantitatively supplying a gelled electronic liquid (e-liquid) is provided. The e-cigarette includes an upper housing, a lower housing, a gel container, a press and reset mechanism, and an aerosol channel. The gelled e-liquid is supplied quantitatively to a heating chamber by manually pressing the press and reset mechanism. The user can adjust the time interval between pressing and releasing the press and reset mechanism according to the needs of the user for each inhalation by adjusting the length of the gelled e-liquid stick supplied to the heating chamber. Besides, a holder is provided therein with heating plates at different positions, and the holder also serves as a heating element. The design avoids the need to provide the heating element and the heating chamber separately, which reduces the volume of the smoking device.
US11744283B2 Method of piercing a cigar
A cigar tool includes a piercing rod, a handle, and a cover attachable over the piercing rod. The piercing rod is pointed to penetrate a densely packed cigar. The handle includes a fixed portion and a sliding portion, and squeezing the fixed and sliding portions together releases the cover exposing the piercing rod. The cover may be a simple cylindrical key fob or an added feature of a cigar lighter or ash tray.
US11744276B2 Method of making a nicotine containing sheet
A method of making a nicotine containing sheet is provided, including steps of combining a source of nicotine salt having a cellulose content of less than about 5% by weight on a dry weight basis with a separate source of fibrous material having a nicotine salt content of less than about 5% by weight on a dry weight basis to form a mixture; and drying the mixture to form a sheet.
US11744273B2 Sweetness enhancing volatile compositions and methods of increasing perceived sweetness of a comestible
Sweetener compositions and sweetness enhancing compositions including combinations of isolated volatile compounds are provided. Also provided are methods of increasing the perceived sweetness of a comestible by adding to/including in the comestible a sweetness enhancing composition effective to increase the perceived sweetness of the comestible, where the sweetness enhancing composition includes a combination of isolated volatile compounds.
US11744271B2 Processed leguminous materials
Disclosed are methods of processing raw leguminous materials, such as pea flour, pea concentrate, or pea isolate, to reduce non-volatile flavor components and in particular bound saponin compounds. The methods includes select processing steps by steam cooking a raw slurry to form a cooked slurry and drying the cooked slurry to form a processed material. An amount of non-volatile flavor components in the processed material is less than an amount of non-volatile flavor components in the raw materials.
US11744270B2 Cooling particulate material with nitrogen
Particulate material is cooled by passing into the material a coolant stream of liquid nitrogen having a gaseous product around at least a portion of the liquid nitrogen, wherein the coolant stream is formed outside the particulate material in a nozzle body from which the coolant stream is passed into the particulate material.
US11744267B2 Flavoring composition concentrates
Rapidly dissolving flavoring composition concentrates are provided. The flavoring composition concentrates have a flavor, a solvent system, a flavor carrier system, and a densifier. The densifier is an acid modifier present in an amount such that it optimizes the rate of dispersion of the concentrate in water.
US11744266B2 Coated particles
The present patent application relates to novel red-orange coated particles, which are mainly used in (dry) formulations for instant beverages. The advantage of these coated particles is that they are red to orange as such (also in the formulations for instant beverages, wherein they can be identified by the naked eye as individual discrete colored particles), but upon dissolution of the instant beverage powder, the particles will dissolve as well and will not interfere with or change the intended color of the ready-to drink instant beverages made from the instant beverage dry powders.
US11744263B2 Animal feed additives comprising a polypeptide having protease activity and uses thereof
The present invention relates to animal feed or animal feed additives comprising polypeptides having protease activity and uses thereof. It also relates to the methods for producing the proteases and for using the proteases to improve animal performance and the nutritional value of an animal feed.
US11744262B2 Method for producing chocolate composition, a chocolate product and a chocolate composition
A method for producing a chocolate composition having dry cocoa solids content of 55% or less by weight. The method includes a first step of providing a first mixture comprising dry non-fat cocoa solids component and plant-based component, a second step of grinding the first mixture and a third step of adding a fat component and a sweetener component to the first mixture for providing the chocolate composition.
US11744261B2 Freeze-dried coffee powder and a method for the manufacture thereof
The present invention provides a method for the manufacture of a freeze-dried coffee powder, the method comprising: providing a coffee extract having from 40 wt % to 55 wt % solids; adding gas to the coffee extract in an amount of from 1 NL/kg to 5 NL/kg of coffee extract, to provide a gas-containing coffee extract at above atmospheric pressure; depressurising the gas-containing coffee extract to form a foamed coffee extract; cooling the foamed coffee extract to below −40° C. without shear, or with low shear, to form a frozen coffee extract, grinding the frozen coffee extract to a powder; and drying the powder, wherein the step of cooling the foamed coffee extract to below −40° C. comprises: (i) cooling the foamed coffee extract to a first temperature; (ii) cooling the foamed coffee extract from the first temperature to a second temperature lower than the first temperature; and (iii) cooling the foamed coffee extract from the second temperature to below −40° C., wherein the first temperature is 1° C. above a freezing point of the foamed coffee extract and wherein the second temperature is 3° C. below the freezing point, wherein step (ii) has a duration of from 5 to 90 minutes, preferably 10 to 60 minutes.
US11744260B2 Method of producing naturally wood smoked cheese
A smoked block of cheese is prepared by exposing the curds to smoke. The smoked block of cheese is evenly smoked and obtained in a shorter period of the time than is required to evenly smoke an entire block of cheese.
US11744256B2 Device and method for imparting smoked flavors to beverages and foodstuffs
Disclosed is a smoker device for imparting smoked flavors to beverages and foodstuffs can include a base having at least a wall defining a first end and a floor with an opening defining a second end, a cover capable of being positioned over the base first end, thereby defining an enclosed cavity, and a conduit portion defining an open channel at a first end and closed at a second end, the first end connecting to a perimeter of the base floor opening, creating a passageway from the enclosed cavity to the channel. Also disclosed is a method for using the smoker device to impart smoked flavors to beverages and foodstuffs.
US11744252B2 Self-clearing dough ball loader
A comestible processing machine including a loader plate comprising a plurality of spaced apart openings passing through the loader plate, a first flattener and a second flattener pivotably attached to the loader plate at each of the openings, a sensor configured to detect a comestible disposed within one or more of the plurality of openings, and an actuator coupled to the loader plate and configured to assist in removal of the comestible from the one or more of the plurality of openings.
US11744250B2 Insect inhibitory proteins
Pesticidal proteins exhibiting inhibitory, suppressive, and toxic activity against Lepidopteran pest species are disclosed, and include, but are not limited to, TIC4064 and TIC4064 amino acid sequence variants. DNA constructs are provided which contain a recombinant nucleic acid sequence encoding one or more of the disclosed pesticidal proteins. Transgenic plants, plant cells, seed, and plant parts resistant to Lepidopteran infestation are provided which contain recombinant nucleic acid sequences encoding the pesticidal proteins of the present invention. Methods for detecting the presence of the recombinant nucleic acid sequences or the proteins of the present invention in a biological sample, and methods of controlling Lepidopteran species pests using any of the TIC4064 and TIC4064 amino acid sequence variant pesticidal proteins are also provided.
US11744242B2 Living body specimen transport device
A living body specimen transport device for receiving multiple living body specimens has a frame, a rotating bracket, and a storage assembly. The rotating bracket can be rotated with respect to the frame. The storage assembly can receive a container with a living body specimen and be rotated with respect to the rotating bracket. A center of gravity of the storage assembly is lower than a pivoting point where the rotating bracket is mounted on the frame and a pivoting point where the storage assembly is mounted on the rotating bracket. With such structure, even when the living body specimen transport device is vibrated and shaken during transporting and then the frame of the living body specimen transport device is tilted or turned over, the rotating bracket and the storage assembly can rotate to be vertical by themselves, which keeps the living body specimen being soaked in the preservation solution.
US11744239B2 Configurable nozzle assembly and methods of same
A configurable nozzle includes a nozzle body having a reception chamber configured to receive an application mixture. The nozzle body includes a nozzle orifice. At least one orifice assembly is coupled with the nozzle body, the at least one orifice assembly includes an orifice plate movably coupled with the nozzle body. The orifice plate extends along at least a portion of the nozzle orifice, and movement of the orifice plate changes one or more of the size or shape of the nozzle orifice. An orifice actuator is coupled with the orifice plate, and the orifice actuator is configured to move the orifice plate.
US11744238B2 Blower spray device
A blower spray device is provided having a housing which comprises an electrically driven blower and a spray nozzle, and having a liquid supply line opening into the spray nozzle. The housing has a funnel-shaped intake channel and a tubular blow-out channel, and an electrical valve is provided in the liquid supply line to activate and deactivate the liquid supply to the spray nozzle. An electronic controller having a regulating unit for the electric blower is further provided to adjust the air flow velocity.
US11744236B2 Magnetic braking mechanism, bait casting reel and fishing tool
Disclosed is a magnetic braking mechanism which includes a spool, a magnetic braking assembly arranged on a side of the spool, the magnetic braking assembly includes a magnet assembly for generating magnetic induction lines and a centrifugal adjusting assembly for automatically adjusting a spacing between the magnet assembly and an inner wall of the spool according to a rotation speed of the spool, so as to adjust range of the magnetic induction lines cut by the spool, thereby automatically adjusting magnitude of a braking force. The centrifugal adjusting assembly allows the magnet assembly to move close to or away from the inner wall of the spool in the radial direction, so as to control strength of the magnetic induction lines near the inner wall of the spool, thereby adjusting the magnitude of the breaking force. Further disclosed are a bait casting reel and a fishing tool.
US11744234B2 Aquarium system and methods to increase light intensity due to motion
An aquarium system includes a tank, a motion sensor, and a light source. The motion sensor is adapted to sense motion within a predetermined distance from the tank. The light source has a controllable intensity projecting light into the tank. The intensity varies responsive to motion sensed by the motion sensor. When the motion sensor senses movement, the light is on at 100% intensity. After some period of no-motion, such as about 60 seconds, the lighting slowly dims to around 20% of full brightness. When it senses movement again, the lighting slowly ramps up to 100% intensity.
US11744233B2 Pollen feeding system for bees
A cover assembly for covering a container of pollen substitute comprises a lid member for engaging the container of pollen substitute. The lid member has an opening for bees to access the container contents and a removable cap element covers the lid member opening to divert water from entering the lid member opening while leaving a gap for bees to enter between the cap element and the lid member. A combination nectar feeder and pollen feeder is also provided. The cover assembly may be configured with ornamental shapes to approximate the design of a flower.
US11744232B2 Beehive
A beehive providing improved humidity and moisture control within the hive box through incorporation of a condensation chamber, improved temperature stability through enhanced airflow, enhanced colony health through improved control of temperature and humidity, and reduction of physical damage to bees during routine maintenance and harvesting tasks through novel construction geometry.
US11744230B2 Leash attachment system for dog collar or harness
A dog leash attachment system for selectively and releasably attaching a dog leash to a dog collar or harness, wherein the dog leash and the dog collar or dog harness each comprises a portion of a fastener device further comprising at least one magnetic attachment component and at least one mechanical attachment component. One portion of the fastener device is attached in fixed relation to the dog leash at a position proximal to the distal end of the dog leash. Another magnet is disclosed for use in maintaining a portion of the fastener device proximally to the collar or harness when the leash is not in use.
US11744229B2 Restraining system with a retraction mechanism
A single-unit restraining system for exercising control over a subject is provided. The restraining system comprises an attachment element adapted to be removably attached around a subject and encasing a retraction mechanism configured to extend and retract a tether element. The retraction mechanism comprises a multi-spool configuration which allows spooling or coiling of the tether element into the attachment element without requiring the tether element to complete 360-degree revolutions around a vertical axis. Tension forces associated with spooling the tether element are reduced and potential harm to the subject is reduced. The restraining system is configured to detach from the subject upon detecting tension forces exceeding a threshold amount.
US11744227B1 Animal water dispenser apparatus and process for providing fresh water to an animal
An animal water dispenser apparatus has a container with an inlet opening and an outlet opening, and a water hose connected to the inlet opening. The inlet opening is positioned below the outlet opening. The water hose is adapted to pass fresh water into an interior of the container. The outlet opening is adapted to allow water from the interior of the container to be released outwardly of the container. A fresh water source can be connected to the water hose so as to pass fresh water under pressure through the water hose and into the interior of the container.
US11744222B2 Cartridge configured to form a part of a teatcup, and a teatcup
A teatcup, configured to be attached to the teat of an animal to be milked, and a cartridge for said teatcup, where the cartridge has an elongated sleeve with having an upper end section and a lower end section, and a barrel that is pre-mounted in the elongated sleeve (8) and forming an inner space for receiving the teat such that a pulsation chamber is formed between the elongated sleeve and the barrel, where the cartridge also has a head member at the upper end section with a lip surrounding an opening into the inner space, where the elongated sleeve has a flange extending outwardly at the upper end section, and the head member has a plurality of locking members each configured to grip the flange, each of the locking members extending towards the lower end section and beyond the flange.
US11744221B2 Grape plant named ‘Compassion’
A grape plant designated as ‘Compassion’ or a progeny thereof are provided herein. Also provided are pollen, tissues or cells of the plant. The plants or plant parts may be used for breeding or creating transgenic plants. Products made using the grapes of the plant are also provided.
US11744219B1 Alfalfa variety AFX174083
A novel alfalfa variety designated AFX174083 and seed, plants and plant parts thereof are provided. Methods for producing an alfalfa plant comprise crossing alfalfa variety AFX174083 with another alfalfa plant. Methods for producing an alfalfa plant containing in its genetic material one or more traits transgenes or locus conversions introgressed into AFX174083 through backcross conversion and/or transformation are provided and the alfalfa seed, plant and plant part produced thereby. Alfalfa seed, plants or plant parts produced by crossing alfalfa variety AFX174083 or a locus or trait conversion of AFX174083 with another alfalfa plant or population are disclosed. Alfalfa populations derived from alfalfa variety AFX174083, methods for producing other alfalfa populations derived from alfalfa variety AFX174083 and the alfalfa populations and their parts derived by the use of those methods.
US11744218B2 Soybean variety 01091749
The invention relates to the soybean variety designated 01091749. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01091749. Also provided by the invention are tissue cultures of the soybean variety 01091749 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01091749 with itself or another soybean variety and plants produced by such methods.
US11744215B2 Soybean variety 01084068
The invention relates to the soybean variety designated 01084068. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01084068. Also provided by the invention are tissue cultures of the soybean variety 01084068 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01084068 with itself or another soybean variety and plants produced by such methods.
US11744211B2 Soybean cultivar 92310017
A soybean cultivar designated 92310017 is disclosed. The invention relates to the seeds of soybean cultivar 92310017, to the plants of soybean cultivar 92310017, to the plant parts of soybean cultivar 92310017, and to methods for producing progeny of soybean cultivar 92310017. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar 92310017. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar 92310017, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar 92310017 with another soybean cultivar.
US11744208B1 Maize hybrid X00R805CY
A novel maize variety designated X00R805CY and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X00R805CY with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X00R805CY through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X00R805CY, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X00R805CY are provided. Methods for producing maize varieties derived from maize variety X00R805CY and methods of using maize variety X00R805CY are disclosed.
US11744201B1 Radish cultivar TBG 55
A radish cultivar designated TBG 55 is disclosed. The invention relates to the seeds of radish cultivar TBG 55, to the plants of radish cultivar TBG 55 and to methods for producing a radish plant by crossing the cultivar TBG 55 with itself or another radish cultivar. The invention further relates to methods for producing a radish plant containing in its genetic material one or more transgenes and to the transgenic radish plants and plant parts produced by those methods. This invention also relates to radish cultivars or breeding cultivars and plant parts derived from radish cultivar TBG 55, to methods for producing other radish cultivars, lines or plant parts derived from radish cultivar TBG 55 and to the radish plants, varieties, and their parts derived from the use of those methods. The invention further relates to hybrid radish seeds, plants, and plant parts produced by crossing cultivar TBG 55 with another radish cultivar.
US11744200B2 Integrated ceiling device with mechanical arrangement for a light source
An integrated ceiling device includes integrated ceiling device including an electronic device housing, a heat dissipating structure, a light source, and a reflection/refraction assembly. An air gap is defined between the electronics housing and other components allowing ambient air to flow therethrough for cooling.
US11744196B2 Plant cultivating apparatus
A plant cultivating apparatus according to some embodiments of the present disclosure includes a main body, a shelf, and a cultivation container. The cultivation container has a medium formed therein and is supplied with water from the shelf. Specifically, the main body has a cultivation space of a predetermined size formed therein. The shelf is configured to supply and discharge water to and from the cultivation space. The cultivation container is placed to be supported on the shelf, and configured to receive or discharge water from or to the shelf. The cultivation container includes a water flow guide protruding downward from a bottom surface of the cultivation container and having an opening formed at the protruded lower end, and a wick accommodated inside the water flow guide and configured to absorb and hold water introduced through the opening.
US11744192B2 Supporting device on a supporting pole, in particular for containment wires of a row
A supporting device on a supporting pole, in particular for at least one wire for containing row, which includes wire-holding element formed by shaped thread-like body comprising resting portion adapted to be removably rested, in use, on first portion of outer surface of supporting pole and supporting means for containment wire extending from opposite sides with respect to resting portion, and pulling and anchoring element formed by shaped thread-like body including engagement portion adapted to interact, in use, with second portion of outer surface of supporting pole opposite to first portion and elastically deformable anchoring means which extend substantially perpendicularly and from opposite sides with respect to engagement portion and adapted to cooperate with second portion of outer surface of supporting pole.
US11744188B2 Binding wrap and method for hydrating cut flowers
A binding wrap for maintaining the hydration of cut flowers is disclosed. The wrap is formed by folding a flexible, absorbent sheet over and around the stems of cut flowers. An assembly of a bouquet of cut flowers with a flexible, absorbent binding wrap folded around its stems is also disclosed as is a method of forming such a wrap.
US11744184B2 Roll conditioner adjustment system for an agricultural harvesting machine
A crop conditioning device for an agricultural harvesting machine. The crop conditioning device includes a frame, a first conditioning roll, and a second conditioning roll. The crop conditioning device also includes a tension member operably connected to the second conditioning roll. The tension member is configured for applying a tension force on the second conditioning roll. The crop conditioning device also includes a tension actuator operably connected to the tension member. The tension actuator is configured for adjusting the tension force applied by the tension member. The crop conditioning device also includes a pair of control rods respectively connected to the pair of lateral ends of the second conditioning roll. The crop conditioning device also includes a pair of roll-gap actuators respectively and operably connected to the pair of control rods. The pair of roll-gap actuators are configured for pivoting the second conditioning roll to adjust the roll gap.
US11744176B1 Lawnmower blade lock
Method and apparatus for a blade lock for use with a lawnmower. The blade lock includes an adjustable intermediate shaft having a hook-like component on one end for holding the blade of the lawnmower and a clamp-like member on the opposite end for attachment to the deck of the lawnmower. The shaft portion includes a plurality of fasteners which allow the shaft to be adjustable in length.
US11744173B2 Crop cutting knives for agricultural combine harvester
A cutting knife includes a base coupled to a head unit of an agricultural combine harvester. The cutting knife includes a blade extending away from the base. The blade includes an edge and a plurality of cutting teeth formed from the edge. The plurality of cutting teeth includes a first grouping of teeth positioned along the edge having a first pitch. The plurality of cutting teeth includes a second grouping of teeth positioned along the edge having a second pitch less than the first pitch. The first grouping of teeth is positioned closer to an end of the blade opposite the base than the second grouping of teeth.
US11744172B2 Adjustable infeed deck cover
A clean out system of a header for an agricultural vehicle including at least one cover having a plurality of perforations and at least one actuating member connected to the at least one cover. The at least one actuating member is configured for moving the at least one cover between a first position to completely cover at least one cutout of the frame of the header for blocking the unwanted material from exiting the header, a second position to at least partially uncover the at least one cutout for permitting the unwanted material to pass through the at least one cutout, and a third position to align at least one perforation of the plurality of perforations with the at least one cutout for permitting the unwanted material to pass through the at least one cutout and the at least one perforation of the plurality of perforations.
US11744170B2 Handheld spreader with removable sifter
Handheld spreaders and methods of operating the same. The spreader can include a cup to hold particulate material and having an open upper end, a scoop assembly provided proximate the open upper end of the cup and including a scoop for directing particulate material being dispersed from the cup, and a sifter assembly removably coupled to the scoop assembly for metering an amount of the particulate material being dispersed from the cup. When the sifter assembly is removed from the scoop assembly, the scoop remains attached to the cup to direct particulate material being provided into the cup via the open upper end. The method can include opening the cup by removing the sifter assembly from the scoop assembly, placing particulate material into an open interior of the cup, closing the cup by replacing the sifter assembly, and dispersing the particulate material through the sifter assembly.
US11744169B2 Particulate material metering system for an agricultural implement
A particulate material metering system includes a controller configured to determine a radius of curvature of a path of a lead vehicle coupled to an agricultural implement. The controller is configured to determine a lead time of the lead vehicle relative to the agricultural implement based on a speed of the lead vehicle and/or the agricultural implement. The controller is configured to determine a radius of curvature of a path of the agricultural implement based on the radius of curvature of the path of the lead vehicle at a determination time, in which the determination time is a current time minus an offset time, and the offset time is based on the lead time. The controller is configured to determine target particulate material flow rates of respective metering devices of the particulate material metering system based on the radius of curvature of the path of the agricultural implement.
US11744168B2 Enhanced management zones for precision agriculture
The present invention is a system and method for agricultural management-zone delineation to be done over broad geographic extents without overly-localized field-specific data. The instant innovation guides precision agricultural sampling and management by delineating enhanced management zones based upon remote sensing and artificial intelligence and combining the two with data derived from an existing countrywide soil survey database. In an embodiment, the instant innovation uses artificial intelligence from multiple sources to provide granular zone detail. Output of the present innovation can be aggregated to produce management zone sizes that have a level of uncertainty compatible with the needs of the customer-farmer and implementable given the capabilities of available equipment.
US11751490B2 Fabricating a qubit coupling device
A qubit coupling device includes: a dielectric substrate including a trench; a first superconductor layer on a surface of the dielectric substrate where an edge of the first superconductor layer extends along a first direction and at least a portion of the superconductor layer is in contact with the surface of the dielectric substrate, and where the superconductor layer is formed from a superconductor material exhibiting superconductor properties at or below a corresponding critical temperature; a length of the trench within the dielectric substrate is adjacent to and extends along an edge of the first superconductor layer in the first direction, and where the electric permittivity of the trench is less than the electric permittivity of the dielectric substrate.
US11751487B2 Semiconductor device and method of forming the same
A semiconductor device includes a storage element layer and a selector. The selector is electrically coupled to the storage element layer, and includes a first insulating layer, a second insulating layer, a third insulating layer, a first conductive layer and a second conductive layer. The first insulating layer, the second insulating layer and the third insulating layer are stacked up in sequence, wherein the second insulating layer is sandwiched in between the first insulating layer and the third insulating layer, and the first insulating layer and the third insulating layer include materials with higher band gap as compared with a material of the second insulating layer. The first conductive layer is connected to the first insulting layer, and the second conductive layer is connected to the third insulating layer.
US11751478B2 Method of manufacturing power generation element, power generation element, and power generation apparatus
A method of manufacturing a power generation element includes a first step of disposing a support unit that supports a vibration unit in one end portion of the vibration unit in one direction, and disposing a weight unit in the other end portion of the vibration unit in the one direction in a substrate including the vibration unit capable of vibrating, a second step of disposing a piezoelectric unit that generates power due to vibration in a portion of the vibration unit on an opposite side from the support unit side in a thickness direction of the substrate after the support unit and the weight unit are disposed in the vibration unit, and a third step of extracting a power generation element from the substrate by cutting an outer edge of the vibration unit in the thickness direction of the substrate after the piezoelectric unit is disposed in the vibration unit.
US11751476B2 Electron buffering material and organic electroluminescent device comprising the same
The present invention relates to an electron buffering material and an organic electroluminescent device comprising the same in an electron buffer layer. It is possible to provide an organic electroluminescent device having excellent luminous efficiency and lifespan characteristics by using the electron buffering material according to the present invention.
US11751475B2 Organic compound, display panel and display apparatus
The present disclosure provides an organic compound, having a structure represented by Formula 1, in which L1, L2, and L3 are each independently selected from a single bond, or C4-C30 arylene; X1, X2, and X3 are each independently selected from CRa, or N, and at least one of X1, X2, or X3 is N; Ar1, Ar2, and Ar3 are each independently selected from C6-C60 aryl, a structure represented by Formula 2, or a structure represented by Formula 3; at least one of Ar1, Ar2, or Ar3 is the structure represented by Formula 2, and at least one of Ar1, Ar2, or Ar3 is the structure represented by Formula 3; X4, X5, X6, and X7 are each independently selected from CRb, or N, and at least one of X4, X5, X6, or X7 is N; # indicates a bonding position; and Ra and Rb are specifically defined in the specification.
US11751474B2 Compound and organic light emitting display device
The present disclosure relates to the field of organic electroluminescence materials and particularly relates to a compound and an organic light emitting display device. The compound has a structure represented by Formula (I): and, m, n, p, q, r, s, u, and v are each independently selected from 0 or 1, at least one of r and s is 1, at least one of u and v is 1, L1, L2, L3, and L4 are each independently selected from substituted or unsubstituted C6-C40 aryl, or substituted or unsubstituted C3-C40 heterocyclyl, and A1, A2, A3, and A4 each are independently selected from an electron acceptor unit.
US11751472B2 Aromatic amine derivative and elecroluminescence device using the same
Provided are a novel aromatic amine derivative having a specific structure and an organic electroluminescence device in which an organic thin layer comprising a single layer or plural layers including a light emitting layer is interposed between a cathode and an anode, wherein at least one layer of the above organic thin layer contains the aromatic amine derivative described above in the form of a single component or a mixed component. Thus, the organic electroluminescence device is less liable to be crystallized in molecules, improved in a yield in producing the organic electroluminescence device and extended in a lifetime.
US11751470B2 Compound and organic light emitting device comprising the same
There are provided a novel compound represented by the following Chemical Formula 1 and an organic light emitting device using the same, wherein m, n, R, R4, R5, L1 and Ar1 to Ar3 are defined therein.
US11751469B2 OLED display panel, manufacturing method thereof, and OLED display device
An organic light-emitting diode (OLED) display panel, a manufacturing method thereof, and an OLED display device are provided. At least one of a substrate or a backplate in the OLED display panel has a reduced thickness, thereby increasing light transmittance of an electronic element area. Furthermore, an area where a camera lens is disposed can display normally and an under-display camera can be realized without defining a hole. Therefore, a screen-to-body ratio is increased, and a technical problem is solved: in conventional OLED display panels, the hole needs to be defined on the area where the camera lens is disposed, leading to a display effect being affected.
US11751465B2 Mask frame assembly and method of manufacturing organic light-emitting display apparatus using the same
Provided are a mask frame assembly in which deformation of a frame may be reduced, and a method of manufacturing an organic light-emitting display apparatus using the mask frame assembly. The mask frame assembly includes a frame of a rectangular shape, the frame including an opening and a lower surface including first grooves extending in a first direction, a plurality of first auxiliary sticks extending in the first direction across the opening, wherein a first end and a second end of each of the first auxiliary sticks are bonded to an upper surface of the frame, a mask on the plurality of first auxiliary sticks, and a plurality of second auxiliary sticks arranged in the first grooves, wherein one end and an opposite end of each of the plurality of second auxiliary sticks are bonded to a bottom surface in each of the first grooves.
US11751461B2 Display motherboard, fabricating method and aligning method of display motherboard
The present disclosure provides a display motherboard, a method for fabricating the same, and a method for aligning the same. The display motherboard includes an array substrate on which an alignment mark and a color film layer are provided. A portion of a black matrix of the color film layer in an alignment mark area includes a first light-shielding portion and a second light-shielding portion. The first light-shielding portion covers the alignment mark, and the second light-shielding portion covers an area outside the alignment mark, where upper surfaces of the first light-shielding portion and the second light-shielding portion are not in the same plane. When the display motherboard is aligned in the subsequent processes, since the black matrix forms the same pattern as the alignment mark due to a height step, when the exposure machine exposures, the pattern can be directly captured for alignment.
US11751457B2 Organic light emitting display device including organic pattern on sidewall of substrate and method of manufacturing organic light emitting display device
An organic light emitting display device includes: a substrate including: pixel regions; connection regions between adjacent pixel regions from among the pixel regions, respectively; and a region having a through-opening, the region being defined by the adjacent pixel regions, and the connection regions respectively between the adjacent pixel regions; a sub-pixel structure on the substrate at each of the pixel regions; and an organic pattern on a side wall of the substrate, the side wall being adjacent to the through-opening.
US11751456B2 White organic light-emitting diode display substrate including switching TFT and light-shielding layer arranged to prevent negative drift
An OLED display substrate, a manufacturing method and a display device are provided. The OLED display substrate includes a base substrate and a plurality of pixel units arranged on the base substrate, each pixel unit includes a plurality of subpixel units, and each subpixel unit includes a switching TFT and a bottom-emission OLED, the OLED display substrate further includes a light-shielding layer arranged between the OLED and the switching TFT, and an orthogonal projection of the light-shielding layer onto the base substrate completely covers an orthogonal projection of a semiconductor region of the switching TFT onto the base substrate.
US11751452B2 Display device
According to one embodiment, a display device includes a first substrate, a second substrate opposing the first substrate, a wiring substrate connected to the first substrate, a cover member located on an opposite side to the first substrate so as to interpose the second substrate therebetween and a conductive layer maintained at a predetermined potential, and the first substrate includes an extension portion extending further from the second substrate, the wiring substrate is connected to the extension portion, the cover member includes a first surface opposing the extension portion, and the conductive layer overlaps the extension portion in plan view.
US11751447B2 Display apparatus
A display apparatus may include the following elements: a substrate including a display area and a peripheral area outside the display area; first data lines lengthwise in a first direction and arranged on the display area; first wires arranged on the display area; and a driving circuit arranged on the peripheral area and electrically connected through the first wires to the first data lines. Branches may protrude from bodies of the first wires. Two branches among the branches may protrude toward each other. End edges of the two branches may be spaced apart in a second direction different from the first direction.
US11751446B2 Display device having first, second, third and fourth transistors, and electronic apparatus
The display device includes a pixel circuit provided corresponding to a data line and a scanning line, the pixel circuit includes first to fourth transistors and a display element, and the first transistor supplies a current in accordance with a voltage between a gate node and a source node to the display element via the fourth transistor, the second transistor is disposed between the data line and the gate node of the first transistor and is turned on and off in accordance with a potential of the scanning line, the third transistor is disposed between the data line and a drain node of the first transistor, and the fourth transistor is disposed between the drain node of the first transistor and the display element.
US11751445B2 Display device
A display device includes: a first conductive layer on a resin substrate layer; a planarization film on the first conductive layer; and OLEDs on the planarization film. There is provided a second conductive layer in a frame area surrounding a display area. The second conductive layer is in contact with second electrodes of the OLEDs on the planarization film and also in contact with the first conductive layer in an external side of the planarization film. The second electrode is electrically connected to the first conductive layer via the second conductive layer. The planarization film includes, in the frame area, a portion where there is provided a trench. The first conductive layer is exposed from the planarization film in the trench. The second electrode is electrically connected to the first conductive layer via the second conductive layer in the trench.
US11751444B2 Display device
A flexible display device includes a first display region, a second display region, a curved portion, a first high power supply voltage trunk wiring line, and a second high power supply voltage trunk wiring line. A plurality of first high power supply voltage lines branch from the first high power supply voltage trunk wiring line and extend to the first display region, a plurality of second high power supply voltage lines branch from the second high power supply voltage trunk wiring line and extend to the second display region, and the first high power supply voltage trunk wiring line and the second high power supply voltage trunk wiring line are electrically connected to each other via a first curved portion conductive layer formed in the curved portion.
US11751438B2 Conductive oxide overhang structures for OLED devices
Sub-pixel circuits and methods of forming sub-pixel circuits that may be utilized in an organic light-emitting diode (OLED) display are described herein. The overhang structures are permanent to the sub-pixel circuit. The overhang structures include a conductive oxide. A first configuration of the overhang structures includes a base portion and a top portion with the top portion disposed on the base portion. In a first sub-configuration, the base portion includes the conductive oxide of at least one of a TCO material or a TMO material. In a second sub-configuration, the base portion includes a metal alloy material and the conductive oxide of a metal oxide surface. A second configuration of the overhang structures includes the base portion and the top portion with a body portion disposed between the base portion and the top portion. The body portion includes the metal alloy body and the metal oxide surface.
US11751432B2 Display device, flexible display panel and manufacturing method therefor
The present disclosure relates to the technical field of display, and provided thereby are a display device, a flexible display panel and a manufacturing method therefor. The flexible display panel comprises a flexible substrate and a plurality of pixel islands arranged in an array on the flexible substrate; the pixel islands have a display region and a peripheral region surrounding the display region, and each pixel island comprises a driving layer, a first electrode layer, a light emitting layer and a second electrode layer that are sequentially stacked on the flexible substrate; the first electrode layer comprises a first electrode located in the display region and a peripheral electrode located in the peripheral region; the peripheral electrode surrounds the display region, and a surface of the peripheral electrode away from the flexible substrate is provided with a barrier structure surrounding the display region, a preset spacing being present between the barrier structure and the display region; and the light emitting layer is intermittently provided in a region directly opposite to the barrier structure and a region located within a range of the preset spacing.
US11751431B2 Display apparatus and electronic device including the same
A display apparatus includes a display panel module including a front surface displaying an image and a rear surface opposite the front surface, and a heat dissipation member disposed on the rear surface of the display panel module and including a first portion, that is in contact with the display panel module, and a second portion that is spaced farther apart from the display panel module than the first portion is. The heat dissipation member includes at least one portion that is bent between the first portion and the second portion with respect to a bending axis parallel to the rear surface.
US11751430B2 Display device
A display device includes a display panel including a first area including a peripheral region and an emission region of a pixel of a first group; and a second area including a peripheral region and an emission region of a pixel of a second group; at least one insulating layer disposed on the display panel and overlapping the second area; an organic layer disposed on the at least one insulating layer and overlapping the second area; and a light blocking pattern disposed on the organic layer and overlapping the second area. A first opening corresponding to the emission region of the pixel of the second group is formed in the organic layer, and a first light blocking opening corresponding to the first opening is formed in the light blocking pattern.
US11751427B2 Electronic device
A display device includes a light-emitting element layer on the substrate and having a display area for displaying images, and a sealing layer covering the light-emitting element layer. The sealing layer includes a first inorganic film, an organic film on the first inorganic film, a second inorganic film on the organic film, and a third inorganic film. The first inorganic film and the second inorganic film are in contact with each other around the organic film. The third inorganic film, without overlapping with the display area, covers a peripheral portion of the organic film.
US11751420B2 Display device capable of facilitating substrate bonding with alignment key and method of fabricating the same
A display device is provided. An embodiment of a display device includes a first substrate, a second substrate disposed on the first substrate, first and second partition walls disposed on the second substrate, the second partition wall being disposed outside the first partition wall, a first trench disposed inside the first partition wall and having a first width, a second trench disposed between the first and second partition walls and having a second width greater than the first width; an alignment key disposed to overlap the second trench; a first spacer disposed on the alignment key, and a sealing member disposed along an edge between the first substrate and the second substrate without overlapping the alignment key, wherein the first spacer partially overlaps the first partition wall, the second partition wall, and the sealing member.
US11751419B2 Flexible display device having non-flexible substrate having base layer including inorganic film between resin layers
In a non-flexible substrate (10) including a base layer (2), the base layer (2) includes a portion where a first resin layer (2a), an inorganic film (2b′), and a second resin layer (2c) are layered in this order, and at an end portion of the base layer (2), the second resin layer (2c) is formed in contact with a glass substrate (1).
US11751417B2 Organic device and method of manufacturing the same
A device comprising a first layer, a sealing layer and a resin layer stacked in that order and an organic layer arranged between the first layer and the sealing layer in a pixel region is provided. The first, sealing and resin layers have openings for exposing an electrode in a peripheral region. The sealing layer includes second and third layers each having a water permeability lower than the first layer, and a fourth layer arranged between the second layer and the third layer and having a defect density lower than the second layer. A step of the second layer arranged above the end of the opening of the first layer is covered with the fourth layer and a step of the third layer arranged above the end of the opening of the first layer is covered with the resin layer.
US11751416B2 Display device, method of manufacturing display device, and guide structure used therein
A display device including a display panel having a first surface and a second surface opposite to the first surface, a guide structure disposed on the first surface of the display panel, and a window disposed on the second surface of the display panel, in which the guide structure includes a guide film configured to apply a preliminary pressure to the display panel, and a cover panel disposed between the guide film and the display panel, the cover panel including a cushion layer.
US11751415B2 Materials for forming a nucleation-inhibiting coating and devices incorporating same
An opto-electronic device includes a substrate, a first electrode disposed over the substrate, a semiconducting layer disposed over the first electrode, a second electrode disposed over the semiconducting layer, the second electrode having a first portion and a second portion, a nucleation inhibition coating disposed over the first portion of the second electrode; and a conductive coating disposed over the second portion of the second electrode, wherein the nucleation inhibition coating is a compound of Formula (I).
US11751414B2 Display device
An display device may include a substrate including an active area and an inactive area surrounding the active area, a plurality of thin film transistors disposed in the active area, each of the thin film transistor including a semiconductor layer and a first electrode, a light emitting elements disposed in the active area, each of the light emitting element including an anode electrode and an organic light emitting layer, a connection area and a peripheral area disposed in the inactive area, and a first reflective electrode disposed in the connection area.
US11751412B2 Quantum dot light-emitting device and preparation method thereof
The present disclosure relates to the technical field of display, and discloses a quantum dot light-emitting device and a preparation method thereof. The quantum dot light-emitting device includes a first electrode layer, a quantum dot light-emitting layer, an electron transport layer, a second electrode layer and a third electrode layer which are sequentially arranged in a stacked manner, wherein the side, facing away from the first electrode layer, of the third electrode layer is configured as a light exiting side; the second electrode layer and the third electrode layer are transparent electrode layers; and the work function of the second electrode layer is greater than the LUMO energy level of the electron transport layer and smaller than the work function of the third electrode layer.
US11751408B2 Methods of forming microelectronic devices, and related microelectronic devices, memory devices, and electronic systems
A method of forming a microelectronic device comprises forming a microelectronic device structure comprising a first control logic region comprising first control logic devices, and a first memory array region vertically overlying the first control logic region and comprising an array of vertically extending strings of memory cells. An additional microelectronic device structure comprising a semiconductive material is attached to an upper surface of the microelectronic device structure. A portion of the semiconductive material is removed. A second control logic region is formed over the first memory array region. The second control logic region comprises second control logic devices and a remaining portion of the semiconductive material. A second memory array region is formed over the second control logic region. The second memory array region comprises an array of resistance variable memory cells. Microelectronic devices, memory devices, and electronic systems are also described.
US11751403B1 Common mode compensation for 2T1C non-linear polar material based memory bit-cell
To compensate switching of a dielectric component of a non-linear polar material based capacitor, an explicit dielectric capacitor is added to a memory bit-cell and controlled by a signal opposite to the signal driven on a plate-line.
US11751402B2 Ferroelectric capacitors with backend transistors
An integrated circuit includes a backend thin-film transistor (TFT) a ferroelectric capacitor electrically connected to the backend TFT. The backend TFT has a gate electrode, source and drain regions, a semiconductor region between and physically connecting the source and drain regions, and a gate dielectric between the gate electrode and semiconductor region. The ferroelectric capacitor has a first terminal electrically connected to one of the source and drain regions, a second terminal, and a ferroelectric dielectric between the first and second terminals. In an embodiment, a memory cell includes this integrated circuit, the gate electrode being electrically connected to a wordline, the source region being electrically coupled to a bitline, and the drain region being the one of the source and drain regions. In an embodiment, an embedded memory includes wordlines, bitlines, and a plurality of such memory cells at crossing regions of the wordlines and bitlines.
US11751398B2 Memory structure and operation method thereof
A memory structure including a substrate, a gate structure, a charge storage layer, and a first control gate is provided. The substrate has a fin portion. A portion of the gate structure is disposed on the fin portion. The gate structure and the fin portion are electrically insulated from each other. The charge storage layer is coupled the gate structure. The charge storage layer and the gate structure are electrically insulated from each other. The first control gate is coupled to the charge storage layer. The first control gate and the charge storage layer are electrically insulated from each other.
US11751395B2 Vertical semiconductor device and method for fabricating the vertical semiconductor device
A vertical semiconductor device includes: a lower structure; a multi-layer stack structure including a source layer formed over the lower structure and gate electrodes formed over the source layer; a vertical structure penetrating the multi-layer stack structure and including a channel layer insulated from the source layer; a vertical source line spaced apart from the vertical structure to penetrate the multi-layer stack structure and contacting the source layer; and a horizontal source channel contact suitable for coupling the source layer and the channel layer and including a first conductive layer and a second conductive layer that include different dopants.
US11751391B2 Methods for fabricating a 3-dimensional memory structure of nor memory strings
A process for building a 3-Dimensional NOR memory array avoids the challenge of etching a conductor material that is aimed at providing local word lines at a fine pitch. The process defines the local word lines between isolation shafts that may be carried out at a lower aspect ratio than would be required for etching the conductor material.
US11751390B2 Manufacturing method of semiconductor device including stepping structure and supporting structure
A method of manufacturing a semiconductor device includes: forming a first patterned stack structure including a cell region, a first portion in a first contact region, and a second portion in a second contact region, the second portion of the first patterned stack structure including a first opening; forming a second patterned stack structure including a third portion over the cell region and the second contact region of the first patterned stack structure; forming a second opening penetrating the third portion of the second patterned stack structure, the second opening being coupled to the first opening; and forming a third opening penetrating the first portion of the first patterned stack structure when the second opening is formed.
US11751385B2 Three-dimensional memory devices and fabricating methods thereof
A method for forming a 3D memory device is provided. The method comprises forming a sacrificial layer on a substrate, forming an alternating dielectric stack on the sacrificial layer, forming a plurality of channel holes vertically penetrating the alternating dielectric stack and the sacrificial layer, and forming a first channel layer in each channel hole. The method further comprises forming a second channel layer on the first channel layer in each channel hole, such that a merging point of the second channel layer is higher than a bottom surface of the alternating dielectric stack. The method further comprises removing the sacrificial layer to form a horizontal trench, and forming a selective epitaxial growth layer in the horizontal trench.
US11751383B2 Methods of forming microelectronic devices, and related microelectronic devices and electronic systems
A method of forming a microelectronic device comprises forming a microelectronic device structure comprising memory cells, digit lines, word lines, and isolation material. Contact structures are formed to extend through the isolation material. Some of the contact structures are coupled to some of the digit lines, and some other of the contact structures are coupled to some of the word lines. Air gaps are formed to be interposed between the contact structures and the isolation material. An additional microelectronic device structure comprising control logic devices and additional isolation material is formed. After forming the air gaps, the additional microelectronic device structure is attached to the microelectronic device structure. Additional contact structures are formed to extend through the additional isolation material and to the contact structures. The additional contact structures are in electrical communication with the control logic devices. Microelectronic devices, electronic systems, and additional methods are also described.
US11751380B2 Semiconductor memory structure
A semiconductor memory structure includes a semiconductor substrate, a bit line disposed on the semiconductor substrate, and a capacitor contact disposed on the side of the bit line. The capacitor contact includes a semiconductor plug disposed on the semiconductor substrate, a metal plug disposed on the semiconductor plug, a metal silicide liner extending along the sidewalls and bottom of the metal plug, and a nitride layer disposed on the metal silicide liner. The top surface of the metal silicide liner is lower than the top surface of the metal plug. The nitride layer surrounds the top portion of the metal plug.
US11751373B2 Tracing device
A tracing device includes an appropriateness determination section configured to determine whether an image processing, which is executed in a production process of a board product by a board work machine, satisfies an appropriateness condition indicating reliability of a result of the image processing when the result of the image processing stays within a permissible range in which the result of the image processing is determined normal and an information management section configured to record image data used in the image processing as traceability information according to the result of the determination made by the appropriateness condition determination section.
US11751372B2 Electrical verification of electronic components
The present invention provides a component mounting machine -comprising a picking tool for picking electronic components from a source of electronic components and placing them onto a workpiece, a verification unit for measuring an electrical property of an electronic component picked and held by the picking tool. The verification unit comprises a board, a plurality of test electrodes arranged on a surface of said board and a system for measuring an output signal from the test electrodes upon contact between a picked electronic component and at least two of said test electrodes. Further, at least one test electrode arranged on a flexible portion of the board that is configured to flex upon engagement between a picked electronic component and said at least two test electrodes.
US11751371B2 Component mounting device
A component mounting device includes a control device configured to execute a recognition data creation process and a pickup process. In the recognition data creation process, the control device creates the recognition data by obtaining the angle information of the component, causing the imaging device to operate so as to image the component, and rotating the captured image so obtained to the reference angle based on the angle information. In the pickup process, the control device causes the head to operate so as to pick up the component after the supply state of the component is determined based on the captured image obtained by causing the imaging device to operate so as to image the component, the recognition data created in the recognition data creation process, and the angle information.
US11751369B2 Liquid metal infiltration rework of electronic assembly
Provided is a method for removing an electronic component from a printed wiring board. The method comprises applying an embrittlement agent to a lead of an electronic component that is soldered to the printed wiring board. The electronic component is removed from the printed wiring board by breaking the embrittled lead.
US11751367B2 Microelectronic package electrostatic discharge (ESD) protection
Embodiments may relate to a microelectronic package comprising: a die and a package substrate coupled to the die with a first interconnect on a first face. The package substrate comprises: a second interconnect and a third interconnect on a second face opposite to the first face; a conductive signal path between the first interconnect and the second interconnect; a conductive ground path between the second interconnect and the third interconnect; and an electrostatic discharge (ESD) protection material coupled to the conductive ground path. The ESD protection material comprises a first electrically-conductive carbon allotrope having a first functional group, a second electrically-conductive carbon allotrope having a second functional group, and an electrically-conductive polymer chemically bonded to the first functional group and the second functional group permitting an electrical signal to pass between the first and second electrically-conductive carbon allotropes.
US11751363B2 Power module operable in a hazardous environment
A power module and method of forming the same. The power module includes an extruded tube with internal and external fins, first and second opposing surfaces defining ends thereof, and an internal slot for housing a power converter. The power module includes a bottom plate having a first depression to receive a first O-ring to provide a first liquid-tight fluid seal at the first opposing surface for an electrically insulting oil encapsulating the power converter. The power module includes a cable interface plate having a second depression to receive a second O-ring to provide a second liquid-type fluid seal at the second opposing surface for the electrically insulting oil encapsulating the power converter. The power module includes an end cap to mate with the cable interface plate and accept a conduit fitting to enable an electrical cable to be routed from within the end cap to an external connection point.
US11751362B2 Thermally activated retractable EMC protection
A system and a method of providing electromagnetic compatibility (EMC) protection. A removable component is inserted into an end product. The removable component includes a retractable EMC protection apparatus. In response to the insertion of the removable component a shape memory alloy on the EMC protection apparatus is heated to a temperature above the activation temperature of the shape memory alloy. The shape memory alloy then changes from a first shape to a second shape in response to the heating. In response to the change in the shape of the shape memory alloy an EMC protection component of the EMC protection apparatus is inserted into an enclosure opening of the removable component.
US11751350B2 Systems and methods for providing a robust computer processing unit
The present invention features a robust customizable computing system comprising: a processing control unit; an external object; and means for operably connecting the processing control unit to the external object, the processing control unit introducing intelligence into the external object, thus causing the external object to perform smart functions. The processing control unit preferably comprises: (a) an encasement module comprising a main support chassis having a plurality of wall supports and a plurality of junction centers containing means for supporting a computer component therein, a dynamic back plane that provides support for connecting peripheral and other computing components directly to a system bus without requiring an interface, means for enclosing the main support chassis and providing access to an interior portion of the encasement module; (b) one or more computer processing components disposed within the junction centers of the encasement module; and (c) means for cooling the interior portion of the encasement module.
US11751348B2 Casing for electrical apparatus and power control apparatus
Provided are a casing for an electrical apparatus for housing an electrical apparatus includes: a casing body having an opening; a cover body that includes a flat plate-like cover portion having a rectangular shape for covering the opening, and outer side surface cover portions that are continuous to respective sides of the flat plate-like cover portion and cover outer side surfaces of the casing body; and first ribs that are provided on the outer side surfaces of the casing body covered by the outer side surface cover portions and extend along the respective sides, and a power control apparatus that includes the casing for an electrical apparatus and the electrical apparatus housed in the casing for an electrical apparatus.
US11751345B2 Thermal isolation of flight recorder memory core
Various systems may benefit from appropriate thermal protection. For example, various flight recorder systems may benefit from thermal isolation of a flight recorder memory core. A system can include a memory core of a flight recorder. The system can also include an inner chamber housing the memory core. The system can further include an outer chamber housing the inner chamber with a vacuum between the inner chamber and the outer chamber. The system can additionally include a signal path from avionics equipment to the memory core through the outer chamber and the inner chamber. The system can also include a power path for the memory core through the outer chamber and the inner chamber.
US11751344B1 Chamfer and lock-in features for electronics boxes
An electronics box for insertion into a wall box includes a housing having a top surface, a bottom surface, a rear surface, at least one side surface, and an intermediate surface disposed part way between the top surface and the bottom surface and extending inward from the at least one side surface. A chamfer surface is disposed between an edge of the bottom surface and an edge of the rear surface, and is disposed at a particular angle with the respect to the bottom surface and has a particular length. The particular angle and the particular length are selected such that the housing is able to be tilted and then inserted into the wall box with the chamfer surface clearing the wall box.
US11751342B2 Display device
A display device includes a display panel and a transparency control panel. The display panel includes a first bonding area. The transparency control panel is disposed below the display panel and includes a second bonding area. The first bonding area is not shielded by the transparency control panel, and the second bonding area is not shielded by the display panel.
US11751341B2 Electronic apparatus and structure
An electronic apparatus includes a bottom cover, a main board provided with a stud, a screw, a washer, and a sponge. The screw has a head portion having a diameter larger than that of an attachment hole, a male screw portion configured to be screwed into a first female screw portion, and a columnar portion having a diameter smaller than a root diameter of the male screw portion. The washer has a flange portion having a diameter larger than that of the attachment hole, a cylindrical portion having a diameter smaller than that of the attachment hole, and a second female screw portion which the male screw portion is screwable into and passable through. The head portion abuts on the bottom cover to fix the bottom cover by the male screw portion. The flange portion is between the stud and the bottom cover.
US11751338B1 Panel-molded electronic assemblies
A method of encapsulating a panel of electronic components such as power converters reduces wasted printed circuit board area. The panel, which may include a plurality of components, may be cut into one or more individual pieces after encapsulation with the mold forming part of the finished product, e.g. providing heat sink fins or a surface mount solderable surface. Interconnection features provided along boundaries of individual circuits are exposed during the singulation process providing electrical connections to the components without wasting valuable PCB surface area. The molds may include various internal features such as registration features accurately locating the circuit board within the mold cavity, interlocking contours for structural integrity of the singulated module, contours to match component shapes and sizes enhancing heat removal from internal components and reducing the required volume of encapsulant, clearance channels providing safety agency spacing and setbacks for the interconnects. Wide cuts may be made in the molds after encapsulation reducing thermal stresses and reducing the thickness of material to be cut during subsequent singulation. External mold features can include various fin configurations for heat sinks, flat surfaces for surface mounting or soldering, etc. Blank mold panels may be machined to provide some or all of the above features in an on-demand manufacturing system. Connection adapters may be provided to use the modules in vertical or horizontal mounting positions in connector, through-hole, surface-mount solder variations. The interconnects may be plated to provide a connectorized module that may be inserted into a mating connector.
US11751337B2 Wireless power of in-mold electronics and the application within a vehicle
A functional vehicle component and related methods include a transmitter coil and a molded part. The molded part includes a first thermoformed film, a molded polymeric structural layer arranged under the film, a printed electronic circuit arranged under the film and adjacent the structural layer, an optional second thermoformed film, and graphics on the first film. The electronic circuit includes a receiver coil, conductive traces, and electronic elements. The first film is arranged to cover the polymeric structural layer and the electronic circuit to thereby define an exposed surface of the molded part. The first film and/or the graphics camouflages the circuit. The transmitter coil is connected to an external power source, and is arranged on the molded part such that the receiver coil is inductively coupled to the transmitter coil so as to wirelessly power the electronic elements of the circuit.
US11751336B2 Method for applying a pattern to a substrate
An apparatus is disclosed for transferring a pattern of a composition containing particles of an electrically conductive material and a thermally activated adhesive from a surface of a flexible web to a surface of a substrate. The apparatus comprises: respective drive mechanisms for advancing the web and the substrate to a nip through which the web and the substrate pass at the same time and where a pressure roller acts to press the surfaces of the web and the substrate against one another, a heating station for heating at least one of the web and the substrate prior to, or during, passage through the nip, to a temperature at which the adhesive in the composition is activated, a cooling station for cooling the web after passage through the nip, and a separating device for peeling the web away from the substrate after passage through the cooling station, to leave the pattern of composition adhered to the surface of the substrate.
US11751327B2 Electrically conductive film
The invention relates to an electrically conductive film (10) having an electrically nonconductive substrate layer (12), and an electrically conductive metal layer (14) that has a structure produced by material removal and that on a first side is joined, at least in sections, to the substrate layer (12).
US11751325B2 Substrate for medical device and medical device
A substrate for a medical device, a portion of which is brought into contact with or inserted into a subject. The substrate includes a patient circuit conductively connected to the portion that is configured to be brought into contact with or inserted into the subject, and a ground-side circuit configured to perform at least one of transmission of a signal, reception of a signal, and supply of electric power on the patient circuit. The ground-side circuit is grounded by a protective ground to ensure safety of a manipulator of the medical device. The substrate also includes an insulating layer between the patient circuit and the ground-side circuit providing insulation between the patient circuit and the ground-side circuit, and an isolated circuit provided apart from the patient circuit and the ground-side circuit on the insulating layer and having a different reference potential from the patient circuit and the ground-side circuit.
US11751321B2 Resin multilayer substrate
A resin multilayer substrate includes a multilayer body including resin base-material layers in a thickness direction, a side-surface conductor on at least a side surface of the multilayer body and made of a metallic material with a coefficient of thermal expansion whose difference from a coefficient of thermal expansion of the resin base-material layers in a plane direction is smaller than a difference from a coefficient of thermal expansion of the resin base-material layers in the thickness direction, a circuit component in the multilayer body and defining a circuit, and inner conductors in the multilayer body, located between the side-surface conductor and the circuit component along the side-surface conductor, and at least partially overlapping each other when viewed in the thickness direction, each of the inner conductors being one of a dummy conductor and a ground conductor.
US11751320B2 Automation field device
An automation field device comprises a housing that surrounds an inner space; a sensor- and/or actuator element arranged at the housing; an electronic circuit arranged in the housing and having a round, outer contour and a plurality of spring contacts in an edge region. The inner contour of the housing and the edge contour of the first circuit board are adapted to one another so that the first circuit board is introducible into the housing with a main plane orthogonal to a longitudinal axis of the housing. The spring contacts are so arranged on the first circuit board and embodied to hold the first circuit board in the inner space and to produce an electrical connection between the first circuit board and the housing to drain away disturbance currents from the first circuit board.
US11751311B2 Gaming machine installations and light panel for use with gaming machines
A method and system provide accent lighting at a bank of gaming machines. A plurality of LED panels are provided to be assembled in a number of different configurations for a series of LED panels. An electronic controller coupled to communicate through said data communication interface with the series of LED panels. The electronic controller is programmed to transmit signals to LED drivers of the LED panels, receive a loop-back signal transmitted from a final one of the LED panels, based on timing of said received loop-back signal automatically identify a configuration of the series of LED panels from said number of possible configurations, and transmit commands for activating the LED drivers of the LED panels based on the identified configuration.
US11751309B2 Light source driving device
A light source driving device performs a switching control on a third switch of a second control unit by using a control signal of a fourth control unit (overvoltage protection circuit), so as to allow the third switch to be turned on by the control signal of the fourth control unit only in a partial section in which an overvoltage occurs, and then turns off the third switch, thereby quickly releasing the blocking of light emission from the light source so as to be capable of returning to a light emitting state.
US11751305B2 Biologically safe control of LED lamps
A control signal for controlling a light emitting device is PWM modulated in time, the PWM modulation comprising PWM pulses and PWM periods. The PWM pulse instantaneous frequency of a PWM pulse is the reciprocal of the instantaneous PWM period of the PWM pulse. The PWM pulse instantaneous frequency depends on the PWM duty cycle of the PWM pulses of the control signal. The PWM pulse instantaneous frequency of the PWM pulses is a first PWM pulse instantaneous frequency at a first PWM duty cycle of the control signal, and is a second PWM pulse instantaneous frequency at a second PWM duty cycle of the control signal. In an operating condition, the first PWM duty cycle is less than the second PWM duty cycle and the first PWM pulse instantaneous frequency is less than the second PWM pulse instantaneous frequency.
US11751301B2 LED driving circuit and LED lamp
An LED driving circuit and an LED lamp are provided. The driving circuit comprises a power input unit coupled to an input voltage; a voltage conversion unit coupled to the power input unit and converting the input voltage into a conversion voltage; a power output unit coupled to the LED light source; a first thermistor unit connected between the power input unit and the voltage conversion unit; a second thermistor unit connected between the voltage conversion unit and the power output unit, where the second thermistor unit and the conversion voltage generates a driving current passing through the LED light source; where the resistance of the first thermistor unit is positively correlated to its sensed temperature, and the resistance of the second thermistor unit is positively correlated to its sensed temperature to stabilize the driving current.
US11751298B2 Light-emitting device
An upper surface of a lateral wall portion of a substrate includes a first upper surface portion exposed from a light-transmissive member in a first region, a second upper surface portion exposed from the light-transmissive member in a second region, and a third upper surface portion located between the first upper surface portion and the second upper surface portion in a second direction, and an upper surface of an outer peripheral portion of the light-transmissive member includes a first outer peripheral surface portion located in the first region. An area of the first upper surface portion of the lateral wall portion is greater than an area of the first outer peripheral surface portion of the outer peripheral portion of the light-transmissive member. A bonding member is disposed between the third upper surface portion of the lateral wall portion and the first lower surface portion of the light-transmissive member.
US11751294B2 Door opening speed controller and automatic opening structure for an appliance
An appliance includes a hinge module between a main body and a pull-down door. The hinge module includes a housing, a rotational axis member disposed in the housing serving as a center of rotation between the pull-down door and the main body, an inner link housing movably disposed in the housing that moves with the opening of the pull-down door in a direction of the rotational axis member, and a damper installed in the inner link housing, the damper including a piston and a cylinder and providing damping force according to a relative movement of the piston and the cylinder. Any one of the piston and the cylinder of the damper moves with the inner link housing and the other of the piston and the cylinder of the damper moves by a predetermined distance as the inner link housing moves and then is interfered by the housing so as not to move further, and the piston and the cylinder of the damper starts damping, wherein the predetermined distance corresponds to an opening angle of the pull-down door in which the damping is started.
US11751293B2 Turntable system for hybrid cooking appliance with microwave and induction heating features
A cooking appliance includes a cabinet that defines a cooking chamber. A magnetron is mounted within the cabinet and is in communication with the cooking chamber to direct a microwave thereto. An induction heating coil is mounted within the cabinet and is in communication with the cooking chamber to direct a magnetic field thereto. A turntable rotatably mounted in the cooking chamber at a center of the turntable. A motor is operatively coupled to the turntable and is mounted within the cabinet outside of the cooking chamber and adjacent to the induction heating coil. The motor is offset from the center of the turntable, as a result of the offset the motor is positioned outside of the magnetic field from the induction heating coil.
US11751285B2 Method and apparatus for connecting user terminals as a group and providing service including contents associated with the group
A connection service providing method includes outputting, by a first user terminal from among a plurality of user terminals, a connection request signal to at least one second user terminal among the plurality of user terminals through an inaudible frequency range based on a trigger signal for initiating a connection between the plurality of user terminals; and connecting the at least one second user terminal and the first user terminal as a group; and providing a connection service associated with the group on the first user terminal.
US11751284B2 Cooperative relay in sidelink networks
Apparatus, methods, and computer-readable media for cooperative relay in sidelink networks are disclosed herein. An example method for wireless communication at a first user equipment (UE) includes receiving, from a second UE, a groupcast signal comprising a resource allocation assigned to a plurality of sidelink UEs including the first UE. The example method also includes communicating, with a remote apparatus on a first resource included in the resource allocation, a first relay signal comprising at least a portion of the groupcast signal, in which the first relay signal corresponds to at least a portion of a second relay signal communicated with the remote apparatus on a second resource included in the resource allocation by at least one other sidelink UE of the plurality of sidelink UEs.
US11751283B2 System and method for switching master and slave roles of devices for use in wireless communications
A system and method for switching master and slave roles of devices for use in wireless communications. The method includes: establishing a monitoring link for communications between a master device and a host device; and initiating a role exchange request, in which a time point for role exchange is appointed, by the master device or a slave device via the monitoring link when role switching between the master device and the slave device is triggered, and replying with a request receipt acknowledgment packet for the receipt of the role exchange request by the other device via the monitoring link. The system includes the master device, the slave device, and the host device, wherein the master device includes a master processing module; and the slave device includes a slave processing module. The role exchange between the master device and the slave device keeps energy consumptions of the two devices evened out.
US11751282B2 Activating sidelink relay MAC-CE
The apparatus of wireless communication may be a UE configured to activate a MAC-CE transmitted over an SL relay after waiting a time period by receiving an activation request for a command in association with a third UE in a first MAC-CE relayed from a second UE, transmitting, to the second UE, a second MAC-CE including an activation response to the third UE in response to the activation request, and activating the command after transmitting the activation response. The UE may wait a time period after transmitting the activation response before activating the command. The UE may receive an HARQ ACK from the third UE in response to the transmitted activation response or an HARQ ACK from the second UE in response to the transmitted activation response, and wait a time period after receiving the HARQ ACK before activating the command.
US11751277B2 Method and apparatus for selecting Bandwidth part (BWP) for subsequent transmission in pre-configured resources based Small Data Transmission (SDT) in a wireless communication system
A method and apparatus are disclosed. In an example from the perspective of a User Equipment (UE), the UE receives a first Radio Resource Control (RRC) message from a network node, wherein the first RRC message is indicative of a first uplink (UL) Bandwidth Part (BWP) of a cell. In response to initiation of a procedure to use a configured grant (CG) resource in RRC inactive state, the UE performs BWP switching from a second UL BWP of the cell to the first UL BWP of the cell. The UE performs, on the first UL BWP, a first UL transmission using the CG resource. In response to completion of the procedure, the UE performs BWP switching from the first UL BWP of the cell to the second UL BWP of the cell.
US11751274B2 Method for managing a communication channel
A method for managing a communication channel used by a plurality of Wi-Fi devices of a Wi-Fi network of the backhaul type for implementing a backhaul network in said Wi-Fi network. A first Wi-Fi device in the plurality performs the method and comprises: detecting a disconnection from an initial channel used by the plurality of Wi-Fi devices for implementing the backhaul network of a second Wi-Fi device in the plurality connected directly to the first Wi-Fi device; listening on a backup channel, to which the second Wi-Fi device is able to migrate to implement the backhaul network in the event of detection, by the second Wi-Fi device, of a radar signal on the initial channel; causing the first Wi-Fi device to migrate to the backup channel in the event of reception on the backup channel by the first Wi-Fi device of a frame containing an identifier of the second device.
US11751270B2 Apparatus and method for achieving higher security on re-pairing
For providing data of an apparatus for applications, routing of the data via a communication node is provided. In this case, the apparatus communicates the data wirelessly to the communication node. This necessitates pairing the apparatus with the communication node beforehand, which is carried out with the aid of an installation key. The data transfer itself is then secured with a connection key defined during the pairing. If replacing or reconnecting the communication node necessitates carrying out re-pairing, at least one criterion relating to the reachability of the communication node is checked and the lack of reachability as per the criterion is made into the prerequisite for using the installation key instead of the connection key for re-pairing. At least one embodiment of the invention increases protection against interferers wanting to access the apparatus in an unauthorized manner.
US11751269B2 Methods providing UE state indication upon delivery failure and related networks and network nodes
Systems, methods, and apparatus for operating RAN and CN nodes are disclosed. An example method of operating a RAN node includes receiving, from a CN node, a PDU for a wireless device that is in an inactive state. The RAN node pages the wireless device in response to receiving the PDU from the CN node. The RAN node sends a non-delivery message to the CN node in response to failure of the paging for the wireless device, where the non-delivery message includes an indication that the wireless device is in the inactive state.An example method of operating a CN node includes the CN node sending a PDU for a wireless device to a RAN node. The CN node then receives a non-delivery message from the RAN node, where the non-delivery message includes an indication that the wireless device is in an inactive state.
US11751265B2 Trigger response mechanism for non-simultaneous-transmission-and-reception multi-link devices
A station (STA) affiliated with a multi-link device (MLD) that belongs to a non-simultaneous-transmission-and-reception (NSTR) link pair receives a trigger frame from an access point (AP). The STA determines whether to respond to the trigger frame. In response to determining to respond to the trigger frame, the STA transmits a trigger-based (TB) physical-layer protocol data unit (PPDU) with at least one restriction.
US11751256B2 Method for transmitting and receiving signal in wireless communication system supporting unlicensed band, and apparatus supporting same
The present disclosure relates to a wireless communication system. More specifically, the present disclosure relates to: a method for transmitting a physical random access channel (PRACH) in at least one carrier from among a first carrier group on the basis of a channel sensing result, receiving a random access response (RAR) in at least one carrier from among a second carrier group in response to the transmission of the PRACH, and transmitting a physical uplink shared channel (PUSCH) on the basis of the RAR; and an apparatus therefor.
US11751249B2 Random access diversity
Methods, systems, and devices for wireless communication are described. For a user equipment with a number of M greater than or equal to two antennas, a signal is transmitted from at least a first antenna and a second antenna at a first time with an initial relative phase state including a first relative phase rotation between the signals transmitted by the first and second antennas. In response to a determination that a response signal was not received at the user equipment, the signal is retransmitted from at least the first antenna and the second antenna with a subsequent relative phase state among the transmitting antennas, including a second different relative phase rotation, at a second time. The second time may be the next subsequent retransmission of the signal or may be a retransmission following one or more retransmissions using the first relative phase rotation.
US11751248B2 Random access method, apparatus, and device
The present disclosure relates to random access methods, apparatus, and devices. One example method includes adjusting a sweeping parameter of a receive beam when at least one target receive beam is determined based on prior information, and sweeping the receive beam based on the adjusted sweeping parameter. The prior information includes at least one of cell historical information or cell handover information. The sweeping parameter includes at least one of a sweeping frequency, a sweeping sequence, a beam direction, or a beam width. The receive beam includes the at least one target receive beam. The receive beam is used to receive a random access preamble sent by a terminal. After a base station receives, on the receive beam, the random access preamble sent by the terminal, the terminal randomly accesses the base station for data communication.
US11751247B2 Wireless station and communication method for determining transmission to another wireless station in a cell in view of an interference cell
A wireless station that belongs to a communication cell includes a receiver which, in operation, receives a trigger frame transmitted from an access point that belongs to an interference cell and a controller which, in operation, determines, based on at least one parameter included in the trigger frame and reception power value of the trigger frame received at the wireless station, whether the wireless station is allowed to transmit to other wireless station that belongs to the communication cell, wherein the at least one parameter includes a value set based on transmit power value of the trigger frame transmitted from the access point.
US11751245B2 Method and wireless communication system for handling timer operation
The present disclosure relates to a communication method and system for converging a 5th-Generation (5G) communication system for supporting higher data rates beyond a 4th-Generation (4G) system with a technology for Internet of Things (IoT). The present disclosure may be applied to intelligent services based on the 5G communication technology and the IoT-related technology. Accordingly, the embodiments herein disclose a method for handling a timer operation in a wireless communication system. The method includes receiving, by a UE, a signaling message from a base station. The signaling message includes an information about acquired COT of the base station. Further, the method includes indicating, by the UE, about the acquired COT to a MAC layer from a physical layer. The physical layer indicates one of the base station has acquired the COT for transmission and the base station has missed a transmission opportunity due to a LBT failure.
US11751242B2 Radio-unlicensed multi-channel access for low-radio frequency-capable user equipment
New radio (NR) unlicensed (NR-U) multi-channel access is disclosed for low-radio frequency (RF)-capable user equipment (UE). A base station may enable multi-channel access when single operator operations cannot be guaranteed within a shared communication spectrum. The primary and secondary channels are defined within the shared communication channel. The base station may then transmit a configuration message to one or more low-RF UEs that identifies the charnels and directs the UEs to monitor the primary channel for a successful listen before talk (LBT) indicator. The base station performs an LBT procedure on the primary channel and the secondary channel and signals the low-RF UEs to re-tune to the secondary channel for communication during a current transmission opportunity.
US11751240B2 Method of transmitting uplink signal from user equipment in a wireless communication system supporting unlicensed band and apparatus supporting the same
Disclosed herein is a method of transmitting a UL signal from a user equipment (UE) in a wireless communication system supporting an unlicensed band and apparatuses for supporting the same. More specifically, the present invention provides an embodiment in which the UE performs autonomous uplink transmission and scheduled uplink transmission through the unlicensed band, a method of adjusting contention window size when the UE perform the autonomous uplink transmission through the unlicensed band, and an embodiment of performing the autonomous uplink transmission based on the method.
US11751239B2 Wireless communication method and device
The embodiments of the disclosure provide a method for wireless communication and a device, which may select at least one of a random access sequence or a random access resource by use of quality of a signal in a second signal set when a link for a signal in a first signal set is too poor to be available. The method includes that: a terminal reports, in a first protocol layer, a first event to a second protocol layer, here, the first event is used to indicate that quality of a signal in a first signal set is poor enough to meet a first condition; and under the condition that the terminal determines, in the second protocol layer, occurrence of a second event based on an occurrence situation of the first event, the terminal determines, in the second protocol layer, at least one of a random access sequence or a random access resource for transmission based on a signal reporting situation provided by the first protocol layer about a second signal set, here, the random access sequence is a contention-based random access sequence or a contention-free random access sequence and the random access resource is a contention-based random access resource or a contention-free random access resource, and the second event is used to indicate that link quality corresponding to the signal in the first signal set is poor enough to meet a second condition.
US11751238B2 System and method for beam-based physical random-access
A method in a wireless device for performing random access to a network node. The method comprises receiving a set of downlink beam-specific reference signals, BRS, from the network node, and determining a preferred BRS based on the received signal power for each BRS. The method also comprises selecting, based on the preferred BRS, a random-access resource to be used for transmitting a random-access attempt to the network node, as well as using the selected random-access resource when transmitting a random-access attempt to the network node, whereby the selection of random-access resource indicates to the network node which downlink beam is preferred by the wireless device to be used for downlink transmissions.
US11751237B2 Method and apparatus for priority handling between a prioritized MAC CE and a SR for data in a wireless communication system
A method and apparatus for priority handling between a prioritized MAC CE and a SR for data in a wireless communication system is provided. A wireless device determines a prioritized Media Access Control (MAC) Control Element (MAC CE) which is prioritized over a data in Logical Channel Prioritization. The wireless device triggers Scheduling Request (SR) for requesting resource for the data. Based on that Physical Uplink Control Channel (PUCCH) transmission of the triggered SR is overlapped with uplink transmission of a first MAC PDU including the prioritized MAC CE, the wireless device (1) prioritizes the uplink transmission of the first MAC PDU over the PUCCH transmission of the triggered SR transmission, and (2) performs the uplink transmission of the first MAC PDU.
US11751226B2 User terminal and radio communication method
A user terminal according to one aspect of the present disclosure includes: a transmitting/receiving section that performs transmission and/or reception based on an Uplink-Downlink (UL-DL) configuration; and a control section that controls switching of the UL-DL configuration based on update information of the UL-DL configuration notified via a higher layer signaling, and the control section performs the switching at a timing that comes after a specific timing and satisfies a given condition. According to one aspect of the present disclosure, even when a UL-DL configuration is semi-statically configured to be changed in an RRC connected state, it is possible to reflect the change at an appropriate timing.
US11751224B2 Synchronization signal block resource selection according to mobility state
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, an integrated access and backhaul (IAB) node may identify one or more resources for transmitting one or more synchronization signal blocks (SSBs), the one or more resources being associated with a mobility state of the IAB node. The IAB node may transmit the one or more SSBs in the one or more resources. Numerous other aspects are provided.
US11751222B2 Method and apparatus for performing SL communication on basis of resources allocated by base station in NR V2X
Provided are a method by which a first device performs wireless communication, and an apparatus supporting same. The method may comprise the steps of: receiving, from a base station, first downlink control information (DCI) for activating a configured sidelink (SL) grant, wherein the first DCI includes information related to a physical uplink control channel (PUCCH) resource for reporting SL hybrid automatic repeat request (HARD) feedback to the base station; transmitting a medium access control protocol data unit (MAC PDU) to a second device through a physical sidelink shared channel (PSSCH) on the basis of the configured SL grant; receiving, from the base station, second DCI for deactivating the configured SL grant; transmitting, to the base station, an SL confirmation medium access control (MAC) control element (CE) in response to the second DCI; and determining whether the PUCCH resource related to at least one SL resource allocated by the configured SL grant is valid on the basis of the time at which the SL confirmation MAC CE was transmitted.
US11751221B2 Detecting the number of transmit antennas in a base station
Data is scrambled at a transmitter according to one of a number of predetermined scrambling sequences which are associated with a particular one of a number of predetermined transmit antenna diversity schemes (i.e., a specific number of transmit antenna ports). Received data is decoded using one or more of the known transmit antenna diversity schemes and the scrambled data is descrambled according to a corresponding descrambling sequence (related to the scrambling sequence). Based on the descrambled data, the receiver determines which transmit antenna diversity scheme (i.e., the number of antenna ports) is used by the transmitter. In one specific embodiment, CRC parity data is scrambled in the transmitter and the receiver descrambles the recovered CRC parity data according to a descrambling sequence, computes CRC parity data from the received data, and compares the descrambled CRC parity data to the newly computed CRC parity data.
US11751219B2 Radio frequency allocation among wireless user equipment and integrated access and backhaul mobile terminations
A wireless access node serves wireless User Equipment (UEs) and wireless Integrated Access and Backhaul Mobile Terminations (IAB MTs). A radio exchanges access communications with the UEs over a frequency channel. The radio receives an IAB request from one of the IAB MTs, and in response, a controller allocates the frequency channel into a UE subchannel and an MT subchannel. The radio now exchanges access communications with the UEs over the UE subchannel and exchanges backhaul communications with the wireless IAB MT over the MT subchannel. The controller reallocates the frequency channel when an IAB MT is added to give the new IAB MT its own MT subchannel. The controller reallocates the frequency channel when an IAB MT is removed to increase the size of the UE subchannel.
US11751217B2 Radio interface protocol architecture aspects, quality of service (QoS), and logical channel prioritization for 5G new radio
Disclosed herein are new radio (NR) Data link architecture options including, for example, NR radio bearer models, NR logical channel models, and MAC and HARQ models. Further described are packet flows mapping to data radio bearers (DRBs), and a new flow encapsulation protocol in the user plane. In some embodiments, DRBs with different quality of service (QoS) are pre-established, but not activated. This allows a given user equipment (UE) to use these DRBs for packet data network (PDN) flows without a large overhead. Pre-established DRBs can be an extension to default bearer concept with the decision of pre-establishment of DRBs based on UE capability, subscription profile, operation policy, installed apps, etc.
US11751214B2 Apparatus and system to create a transport block utilizing an input apparatus
According to one aspect of the present invention, an apparatus is disclosed including a transmitter that transmits a transport block (TB) using a physical uplink shared channel based on a downlink control information, a processor that applies a same symbol allocation across a plurality of slots when transmission of the TB is carried out over the plurality of slots, and an input apparatus that accepts an input, wherein the TB contains information based on the input. In other aspects, a system including an apparatus and a base station is also disclosed.
US11751211B2 Method for processing physical resource and user equipment
The present application provides a method for processing a physical resource, a user equipment, and a base station. The method for processing a physical resource includes the following steps: determining scheduled physical resource blocks (PRB) based on indication information of carrier sensing result of at least one received frequency sub-band and indication information of physical resource blocks; and receiving data on the scheduled PRBs.
US11751210B2 Transmission method and apparatus for MIMO system
A communication technique for convergence between an IoT technology and a 5th generation (5G) communication system for supporting a higher data transmission rate beyond a 4th generation (4G) system, and a system thereof is provided. The method includes intelligence services (for example, smart homes, smart buildings, smart cities, smart cars or connected cars, healthcare, digital education, retail businesses, security and safety related services, and the like.) On the basis of a 5G communication technology and an IoT-related technology. A method includes determining a scheduling-related parameter for at least one user, and transmitting scheduling information indicating the scheduling-related parameter to a radio unit (RU), wherein the scheduling information includes a first section extension field including information relating to a user equipment identifier (ueID) related to the at least one user, and a second section extension field including information relating to a number of ueIDs corresponding to each user.
US11751209B2 Acknowledgement feedback for multi-component carrier scheduling with separate feedback-related control fields
Methods, systems, and devices for wireless communications are described. A user equipment (UE) may provide hybrid automatic repeat request (HARQ) feedback for multiple physical channels (e.g., multiple physical downlink shared channels (PDSCH)) scheduled via cross component carrier scheduling. A base station may transmit downlink control information (DCI) messages via physical downlink control channel (PDCCH), to the UE to schedule the multiple PDSCH over multiple component carriers. The UE may monitor for the multiple PDSCH over the multiple component carriers, respectively. The UE may identify resource allocations to use for HARQ feedback transmissions associated with the multiple PDSCH, based on the DCI messages received. The DCI may include a number of control fields that the UE may use to determine resource allocations to use for the HARQ feedback transmissions. The UE may thus improve coverage for wireless communications by supporting HARQ feedback for multiple PDSCH scheduled via cross component carrier.
US11751205B2 Beam indication for semi-persistent transmissions
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment (UE) may receive information identifying a virtual control resource set (CORESET) or a virtual search space for a semi-persistently scheduled shared channel. The UE may receive the semi-persistently scheduled shared channel using a default beam that is selected based at least in part on the virtual CORESET or the virtual search space. Numerous other aspects are provided.
US11751200B2 Physical channel structures for sidelink communication
A method of sidelink transmission can include receiving a physical sidelink shared channel (PSSCH) associated with a first two-stage sidelink control information (SCI) at a first user equipment (UE) from a second UE over a sidelink. The first two-stage SCI indicates a physical layer identity (L1-ID) of the second UE. The method can further include determining based on the L1-ID of the second UE a time-frequency resource for transmitting a physical sidelink feedback channel (PSFCH) carrying a hybrid automatic repeat request (HARQ) feedback corresponding to reception of the PSSCH, and transmitting the PSFCH with the determined time-frequency resource. In an embodiment, transmission of the PSSCH from the second UE is a groupcast transmission or a unicast transmission.
US11751199B2 Method and apparatus for carrier assignment, configuration and switching for multicarrier wireless
As part of carrier assignment and configuration for multicarrier wireless communications, a single uplink (UL) primary carrier may provide control information for multiple concurrent downlink (DL) carriers. Optionally, control information for each DL carrier may be transmitted over paired UL carriers. Carrier switching of UL and/or DL carriers, including primary and anchor carriers, may occur during normal operation or during handover, and may occur in only the UL or only the DL direction. A unidirectional handover is performed when only an UL carrier or only a DL carrier is switched as part of a handover. Switching of UL and/or DL carriers may be from one component carrier or a subset of carriers to another component carrier, another subset of carriers, or all carriers in the same direction.
US11751196B2 Method for transmitting/receiving downlink data in wireless communication system, and device therefor
Disclosed in the present invention are a method for transmitting/receiving downlink data in a wireless communication system, and a device therefor. Specifically, a method of receiving downlink data by user equipment (UE) in a wireless communication system comprises the steps of: receiving configuration information; receiving downlink control information (DCI), the DCI comprising a transmission configuration indication (TCI) field, and multiple TCI states being indicated on the basis of the TCI field; and receiving multiple transmission occasions of an identical transport block on the basis of the DCI. The multiple transmission occasions are received through a time-domain resource on the basis of time division multiplexing (TDM), and the number of the multiple transmission occasions is determined on the basis of the number of the multiple TCI states.
US11751189B2 System and scheme on group based identity and scrambling for UE cooperation transmission
Systems and methods are provided to achieve data scrambling and transmission identification in the SL for UE cooperation (UC), in which one or more cooperating UEs help with a transmission to a target UE. Corresponding configuration schemes are also provided. In addition, systems and methods are provided to achieve data DMRS sequence generation and transmission identification in SL for UC, in which one or more cooperating UEs help with a transmission to a target UE. Corresponding configuration schemes are also provided. Furthermore, systems and methods of SL control channel scrambling and identification for UE cooperation are provided.
US11751188B2 Beam sweep boundary alignment handling
This disclosure provides systems, methods, and apparatuses, including computer programs encoded on computer storage media, for wireless communication. In one aspect of the disclosure, a method for wireless communication includes shifting, based on a partial overlap between a scheduled downlink transmission occasion and a scheduled uplink transmission occasion that each include a first and second repetition, a first repetition boundary of one transmission occasion of the downlink transmission occasion or the uplink transmission occasion, and performing full duplex communication with repetition based on the shifted first repetition boundary. In some implementations, shifting includes shifting an entirety of the one transmission occasion. In some implementations, shifting the first repetition boundary changes a number of consecutive symbols included in the first repetition of the one transmission occasion. In some implementation, the method includes adding a third repetition boundary to the one transmission occasion. Other aspects and features are also claimed and described.
US11751186B2 Single layer uplink non-codebook based precoding optimization
A configuration to reduce a timeline for non-codebook based uplink precoding procedures. The apparatus measures an NZP-CSI-RS over one or more beams from a base station. The apparatus determines a single beam for communication with the base station based on measurement of the NZP-CSI-RS. The apparatus transmits a PUSCH using the single beam and based on determining the single beam for communication with the base station. The apparatus may receive a configuration from the base station to perform a SRS-less non-codebook based uplink precoding procedure. The UE may transmit the PUSCH using the single beam and without transmitting an SRS further based on the configuration from the base station. The apparatus may skip transmission of an SRS between measurement of the NZP-CSI-RS and transmission of the PUSCH.
US11751181B2 Integrated circuit, apparatus and method for communication using resource block groups
A scheduling apparatus and a scheduling method, wherein the amount of signaling for frequency resource allocation information can be reduced while maintaining system throughput performance. In a base station apparatus, a scheduling section allocates frequency resources to frequency allocation target terminals based on set frequency allocation units, and a frequency allocation parameter setting section adjusts the set frequency allocation units set in the scheduling section based on cluster numbers. Due to this, in each cluster number, frequency resources can be allocated based on the most suitable frequency allocation units with respect to the signaling bit number. As a result, the amount of signaling for frequency resource allocation information can be reduced. Further, system throughput can be maintained by making the cluster number, which is a parameter having little effect on system throughput, a setting parameter for frequency allocation units.
US11751180B2 Transmit filter bypass mode scanning
A user equipment (UE) may communicate using different radio access technologies on adjacent frequency bands. The UE may determine that the UE is not receiving wireless signals for a second radio access technology that utilizes a second frequency band adjacent to a first frequency band for a first radio access technology. The UE may place a transmitter of the UE in a filter bypass mode in which a transmit signal bypasses a transmit filter for the first radio access technology in response to determining that the wireless signals for the second radio access technology are not received. The UE may scan, using a receiver for the second radio access technology, while in the filter bypass mode, the second frequency band for a signal for the second radio access technology between scheduled transmissions for the first radio access technology.
US11751179B2 Optimization of carrier aggregation capabilities for support of different bands defined in the same frequency range
Various designs for optimization of carrier aggregation (CA) capability signaling are discussed. A user equipment (UE) configured for CA determines to signal supported CA combinations that include a band, the band being one of a first band and a second band. The first band is a superset of the second band. The UE signals the supported CA combinations that include the band to the network. A base station receives a signal indicating the CA combinations supported by the UE that include the band. The base station determines CA combinations that include the first band and CA combinations that include the second band based on the CA combinations received from the UE.
US11751176B2 Beam sweeping with slot aggregation
Methods and systems include beamformed wireless communications to and from a user equipment electronic device. During operation of the user equipment electronic device, a change in slot aggregation is made. Using the aggregated slots, the user equipment electronic device and/or a wireless network utilize beam sweeps to determine a best beam pairing by repeating a shared channel in the aggregated slots with a beam sweep of multiple beams between the user equipment electronic device and the wireless network.
US11751172B2 Method and apparatus for sidelink resource control
In a method of sidelink resource control, a first core network configured based on a first radio access technology receives a sidelink control request from a first user equipment that accesses the first core network using the first radio access technology, the sidelink control request requesting sidelink control information for a second radio access technology that is not supported by the first core network. The sidelink control information for the second radio access technology is obtained directly from a second core network outside the first core network, the second core network being configured based on the second radio access technology, and the sidelink control information for the second radio access technology being provisioned by the second core network. The obtained sidelink control information for the second radio access technology is provided, via the first radio access technology and in response to the sidelink control request, to the first user equipment.
US11751171B2 Feedback-based broadcasting of network coded packets with sidelink
Methods, systems, and devices for wireless communications are described. A network node may transmit, to a set of user equipment (UE), a set of network encoded packets generated using a set of packets. A UE of the set of UEs may receive subsets of network encoded packets from the network node and from UEs of the set of UEs forwarding network encoded packets. The UE may decode the subsets of network encoded packets and may determine a set of successfully decoded packets. The UE may transmit feedback to the network node that indicates successfully received or decoded packets. The network node may receive the feedback and may determine a subset of the set of packets that was successfully decoded for each UE providing the feedback. The network node may generate an updated set of network encoded packets and may transmit the updated set to the set of UEs.
US11751169B2 Techniques for optimized fast Fourier transform windows
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a first user equipment (UE) may receive, from a second UE and using a first fast Fourier transform (FFT) window configuration, a physical sidelink control channel (PSCCH) signal associated with a physical sidelink shared channel (PSSCH) signal. The UE may identify, based at least in part on the reception of the PSCCH signal, one or more values of one or more parameters estimated from the PSCCH signal. The UE may select, based at least in part on the one or more values of the one or more parameters, a second FFT window configuration to be used to receive the PSSCH signal. The UE may receive, from the second UE, the PSSCH signal using the second FFT window configuration, Numerous other aspects are described.
US11751167B2 Paging occasion design in new radio
The present disclosure relates to a user device, a base station, and data transmission and reception methods to be performed by a user device and a base station in a communications system. The user device comprises circuitry which, in operation, receives paging occasion configuration from the base station, including at least one parameter for configuring a predefined time-domain pattern for receiving paging occasion within a paging cycle; and performs reception of paging signal in the paging occasions within the predefined time-domain pattern configured according to the received paging occasion configuration.
US11751165B2 Wireless communications network, infrastructure equipment, communications device and methods
A method for operating an infrastructure equipment forming part of a radio access network part of a wireless communications network is provided. The method comprising configuring a notification area of a radio access network part by determining one or more base stations and/or one or more of non-terrestrial network parts which form part of the notification area, the base stations and/or the non-terrestrial network parts of the notification area being for use in transmitting signals to a communications device from the wireless communications network, determining, based on the notification area and on a present time, which one of the base stations and/or the non-terrestrial network parts of the notification area is presently serving the communications device, and transmitting a paging message to the serving base station or serving non terrestrial network part for subsequent transmission to the communications device.
US11751161B2 Terminal device locating method, terminal device, system and server
The present application discloses a terminal device locating method, a terminal device, a system, an emergency locating server, an electronic device and a storage medium, and relates to locating and information flow technologies. A specific implementation solution is: acquiring dialing information of a call of a terminal device, sending information related to a location of the terminal device through a non-network channel to an emergency locating server if the call is determined to be an emergency call according to the dialing information, where the information related to the location of the terminal device is used to locate the terminal device and obtain locating information of the terminal device.
US11751158B2 Integrated access backhaul (IAB) nodes with negative propagation delay indication
Embodiments include methods for downlink (DL) transmission by a network node in an integrated access backhaul (IAB) network. Such methods include receiving, from an upstream node in the network, first timing offset information related to communications between the network node and the upstream node. Such methods include transmitting a DL signal or channel, to one or more downstream nodes, based on a DL transmission timing for the network node. The DL transmission timing is determined from the network node's DL reception timing of signals or channels transmitted by the upstream node and a second function of the first timing offset information, which is determined based on a first function of the first timing offset information (when the first function is greater than a threshold) or on an alternate timing offset (when the first function is not greater than the threshold). Embodiments also include network nodes configured to perform such methods.
US11751155B2 Techniques for indicating time offsets in wireless communications
Aspects described herein relate to communicating a demodulation reference signal (DMRS) corresponding to a downlink control channel, buffering, based on receiving the DMRS, samples of a downlink data channel associated with the downlink control channel, and processing, during on a time period indicated based at least in part on a sequence of the DMRS, at least a portion of the samples of the downlink data channel. Another aspect relates to determining, based at least in part on a sequence of the DMRS, a time offset from the downlink control channel to a downlink data channel, and determining, based at least in part on the time offset, a time period based on which to transmit or start processing samples of the downlink data channel.
US11751150B2 Synchronization signal block indexing schemes
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment (UE) may detect a synchronization signal block (SSB) within a discovery reference signal (DRS) transmission window that includes more than 64 candidate SSB positions; determine an index value of the SSB based at least in part on an indexing scheme for SSBs that are included in the DRS transmission window, wherein the indexing scheme includes one of a consecutive indexing scheme or a non-consecutive indexing scheme; and determine a cell timing based at least in part on the index value. Numerous other aspects are described.
US11751149B2 User terminal and radio communication method
To prevent occurrence of delay and/or increase in power consumption at the time of access to a network in future radio communication systems, one aspect of a user terminal according to the present disclosure includes: a receiving section that receives a synchronization signal block including a broadcast channel in a certain sync raster; and a control section that controls, based on certain bit information of a certain information element included in the synchronization signal block, a sync raster to be detected by variably interpreting bit information included in at least one of the certain information element and another information element.
US11751145B2 Method and apparatus for controlling power of IAB node in wireless communication system
The disclosure relates to a communication technique for convergence between an IoT technology and a 5G communication system for supporting a higher data transmission rate beyond a 4G system, and a system thereof. The disclosure may be applied to intelligence services (e.g., smart homes, smart buildings, smart cities, smart cars or connected cars, healthcare, digital education, retail businesses, security and safety related services, etc.) according to a 5G communication system and an IoT related technology. In addition, the disclosure provides a method and an apparatus for controlling power of an IAB node in a wireless communication system.
US11751144B2 Preferred device selection
Disclosed are methods, systems, and computer-readable medium to perform operations for selecting a device to prioritize for a high power link. The operations include detecting, in proximity of a mobile device, a first and second available devices. The operations also include establishing a respective connection with each of the first and second available device using a first radio access technology (RAT). Further, the operations include determining, using the respective connections, one or more metrics associated with first available device and the second available device, where the one or metrics comprise a respective angle of arrival at the mobile device corresponding to the first available device and the second available device. Further, the operations include determining, based at least on the one or more metrics, to establish a high power link with the first available device using a second RAT, where the second RAT utilizes more power than the first RAT.
US11751141B2 Discontinuous reception operation for sidelink communication
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment (UE) may transmit an indication that the UE is to transition to a sidelink discontinuous reception (DRX) sleep mode. The UE may transition to the sidelink DRX sleep mode based at least in part on transmitting the indication. Numerous other aspects are provided.
US11751139B2 Wireless communication method and wireless communication terminal using variable-length wake-up frame
A wireless communication terminal for wireless communicating includes a first wireless transceiver transmitting and receiving a signal through a first waveform, a second wireless receiver receiving a signal through a second waveform different from the first waveform, and a processor. The processor may be configured to start receiving a variable length Wake-Up frame through the second wireless receiver, from a base wireless communication terminal of a basic service set (BSS) to which the wireless communication terminal belongs, determine whether or not a Frame Body field of the Wake-Up frame includes an identifier of the wireless communication terminal, when an ID field of the Wake-Up frame indicates an identifier of a group including the wireless communication terminal, and wake up the first wireless transceiver based on the Wake-Up frame, when the Frame Body field of the Wake-Up frame includes the identifier of the wireless communication terminal.
US11751137B2 Wireless access point, terminal device, and method for waking up terminal device by wireless access point
A wireless access point, a terminal device, and a method for waking up a terminal device by a wireless access point. The terminal device includes a primary radio frequency circuit and a wake-up radio (WUR) radio frequency circuit. The WUR radio frequency circuit only receives a radio signal and operates on a specified channel. If the WUR radio frequency circuit receives a wake-up frame on the specified channel and the terminal device is a to-be-woken-up terminal device, the WUR radio frequency circuit wakes up the primary radio frequency circuit. The wake-up frame includes an identifier of the to-be-woken-up terminal device. The primary radio frequency circuit operates on an operating channel of the primary radio frequency circuit after being woken up.
US11751133B2 Techniques for setting a quantity of bits for an adaptive low-resolution analog-to digital converter (ADC) in higher band operation
This disclosure provides systems, methods and apparatus, including computer programs encoded on computer storage media, for setting a resolution for an analog-to-digital converter (ADC) of a user equipment (UE) based on a modulated reference signal received from a base station (BS) during a first (for example, initial) symbol period of a slot. In one aspect, the first symbol period of the slot and a cyclic prefix (CP) of the first symbol period may be relatively longer in time than other symbol periods and other CPs of the slot and, in some implementations, the BS may transmit a configuration to the UE allocating a portion of the first symbol period for the transmission of the modulated reference signal. The UE may demodulate the modulated reference signal, calibrate an automatic gain control (AGC) of the UE, and set the resolution of the ADC of the UE based on the modulated reference signal.
US11751129B2 Multiple network mode selection devices
Systems and methods for multiple network mode selection devices in accordance with embodiments of the invention are disclosed. In one embodiment of the invention, a multiple network mode selection device includes a processor, a radio module connected to the processor, and network determination process storage connected to the processor and configured to store one or more network determination processes, wherein the processor is configured to connect to a first network using the radio module, execute a network determination process selected from the one or more network determination process, reprogram the radio module in response to the executed network determination process, and connect to a second network using the radio module, where the second network is separate from the first network.
US11751127B2 Indoor localization based on previous activities
A method for indoor localization based on previous activities. The method includes acquiring a target observation from a target user, adding the target observation to a target observations list of a plurality of observations lists, obtaining a target cluster for the target user, verifying that the target cluster satisfies a localization condition, replacing the target cluster with a substitute cluster responsive to the target cluster not satisfying the localization condition, obtaining an estimated location of the target user based on the target cluster responsive to the target cluster satisfying the localization condition, obtaining the estimated location based on the plurality of observations lists responsive to the substitute cluster not satisfying the localization condition, and storing the estimated location in a database. The target observation is acquired utilizing an access point.
US11751126B2 Batch-wise frequency scanning
Methods, systems, and devices for wireless communications are described. A user equipment (UE) may identify that the UE is to scan one or more frequency bands during a cell acquisition procedure. The UE may receive one or more over-the-air signals, each of the one or more over-the-air signals having a respective bandwidth that includes a corresponding plurality of channels from a frequency band of the one or more frequency bands. The UE may process individual ones of the one or more over-the-air signals. The UE may evaluate, in corresponding batches for each of the individual ones of the one or more over-the-air signals, each of the corresponding pluralities of channels for cell acquisition. The UE may acquire a cell via batch-wise evaluation of the corresponding pluralities of channels.
US11751124B2 Method and system for controlling a mobile communication device in a moving vehicle
Disclosed herein is a method and system for detecting, monitoring and/or controlling one or more of mobile services for a mobile communication device (also referred to herein as a Controllable Mobile Device or CMD), and in particular, when the device is being used and the vehicle, operated by the user of the device, is moving. The present method and system determines whether the vehicle is being operated by a user that may also have access to a mobile communication device which, if used concurrently while the vehicle is in operation, may lead to unsafe operation of the vehicle. If the mobile services control system determines that a vehicle operator has potentially unsafe access to a mobile communication device, the mobile services control system may restrict operator access to one or more services that would otherwise be available to the operator via the mobile communication device.
US11751122B2 Wireless gateway supporting public and private networks
An interface device may provide a first wireless network and a second wireless network in a user's premise. The interface device may encourage some user devices to connect to the second wireless network without controlling the user devices. For example, the interface device may receive a request from a device to access its first wireless network. The interface device may then determine whether the device is a premise device by, for example, searching a database of device registration information. The interface device may determine that the device is a premise device and deny the request to access the first wireless network. The device may then be available to access the second wireless network.
US11751121B2 Radio access control method, apparatus, and system
Embodiments of the present invention provide a radio access control method. The method includes that a terminal device receives access control information sent by an access network device, wherein the access control information indicates a barred service type and a barred data transmission attribute to the terminal device; and the terminal device determines whether to send a radio resource control (RRC) connection request to the access network device based on the barred service type and the barred data transmission attribute; wherein the data transmission attribute comprises a transmission scheme type, the transmission scheme type is used to indicate a transmission scheme used by the terminal device for transmitting service data used by the terminal device. Thereby improving network resource utilization.
US11751108B2 Execution of reduced signaling handover
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment (UE) may determine that a reduced signaling handover condition has occurred. The UE may execute a reduced signaling handover from a source base station to a target base station based at least in part on determining that the reduced signaling handover condition has occurred. Numerous other aspects are described.
US11751105B2 Network handover method and apparatus
This application provides a network handover method and an apparatus. Before a terminal device is handed over from a first network to a second network, the terminal device sets up a first tunnel to a first interworking device, where a communication identifier, of the terminal device, in the first tunnel is a first identifier the first identifier is an identifier used in the first network by the terminal device, and the first interworking device is an interface device in the first network and oriented toward a network other than the first network. After the terminal device is handed over from the first network to the second network, the terminal device sends an update request to the first interworking device, where the update request to update the communication identifier to a second identifier, and the second identifier is an identifier used in the second network by the terminal device.
US11751104B2 Method and apparatus for accessing a random access channel by selectively using dedicated or contention-based preambles
A method and apparatus for accessing a random access channel (RACH) during handover are disclosed. A handover procedure is initiated and a maximum handover interruption timer is activated. A dedicated preamble is transmitted in an attempt to access the RACH on a condition that the dedicated preamble is reserved in a current random access opportunity and the maximum handover interruption timer has not expired. A contention-based preamble is transmitted in an attempt to access the RACH on a condition that a dedicated preamble is not reserved in a current random access opportunity. If the maximum handover interruption timer has expired, a contention-based preamble is transmitted in an attempt to access the RACH.
US11751103B2 Variable application of quality of service
Methods, systems, and apparatuses are described for variably selecting and managing a quality of service framework within a network. A network data store may be accessed to obtain information indicating current network conditions, network policies, and/or device scripts. This information may be used to determine whether and when to allocate network resources, such as bandwidth, for particular services within the network to implement quality of service based on current network/link conditions.
US11751102B2 Resource reservation for sidelink communication
Wireless communications systems and methods related to resource reservation for sidelink communication over a shared radio frequency band are provided. The method of wireless communication performed by a user equipment (UE) includes performing, in a shared radio frequency band, a listen-before-talk (LBT) for a first channel occupancy time (COT) and transmitting, during the first COT, a COT structure indicator, wherein the COT structure indicator reserves at least one resource within a second COT different than the first COT.
US11751100B2 Techniques for integrated access and backhaul (IAB) nodes
Various embodiments herein provide techniques for integrated access and backhaul (IAB) nodes. For example, embodiments include techniques associated with: rate-proportional routing for network coding; utilizing multiple routes in IAB networks; user equipment (UE) and parent selection for efficient topology in IAB networks; establishing efficient IAB topologies; and/or adaptive coded-forwarding for network coding. Other embodiments may be described and claimed.
US11751096B2 Congestion control method and device, and base station
Provided are a congestion control method and device, and a base station. The congestion control method includes: determining whether a traffic data flow transmitted by a base station is congested; setting an Internet protocol (IP) data packet in the traffic data flow when the traffic data flow transmitted by the base station is congested, where the set IP data packet is used for indicating that the traffic data flow transmitted by the base station is congested. The present disclosure solves the problem in the existing art that user throughput is affected because a base station only determines whether the base station is congested.
US11751092B2 Flexible mapping of logical end-points
Various communication systems may benefit from differentiated quality of service management. For example, specific applications run on a user equipment in a 5G radio access network may benefit from the flexible differentiated quality of service management. A method includes determining a service flow setup, and mapping traffic through the service flow by a common convergence sublayer entity to at least one radio convergence sublayer entity. The method also includes controlling the traffic through the service flow.
US11751088B2 Channel state information (CSI) measurements and CSI reporting in licensed assisted access (LAA)
Techniques for channel state information (CSI) reporting are discussed. One example apparatus at a user equipment can derive, for one or more subframes of a license assisted access (LAA) secondary cell (SCell), one or more channel measurements based on reference signals (e.g., cell-specific reference signals (CRS) or CSI reference signals (CSI-RS)), in those subframes; generate CSI that comprises a channel quality indicator (CQI) based on an average of the one or more channel measurements from multiple subframes comprising a first subframe and a later second subframe, wherein each orthogonal frequency division multiplexing (OFDM) symbol of a second slot of the first subframe is occupied, wherein each of a first three OFDM symbols of the second subframe are occupied, and wherein each OFDM symbol between the first subframe and the second subframe is occupied; and generate a CSI report that indicates the set of CSI parameters.
US11751087B2 Predicting whether a user of a wireless telecommunication network will report a problem
Presented here is a method to predict whether a user of a wireless telecommunication network will report a problem or issue associated with the wireless telecommunication network. A processor can obtain multiple key performance indicators (KPIs) describing a user experience with the wireless telecommunication network. The processor can calculate at least a daily value of each KPI according to a rule specific to the KPI. The processor can create an image representing a value of each KPI, where a first axis of the image identifies the KPI, and where a second axis of the image represents the daily value of the KPI. The processor can predict whether the user of the wireless telecommunication network will report the problem by providing the image to a machine learning model and receiving a prediction from the machine learning model whether the user of the wireless telecommunication network will report the problem.
US11751086B2 Uplink clear channel assessment status as a new uplink control information for new radio-unlicensed
Uplink clear channel assessment (CCA) status is disclosed as a new uplink control message for new radio (NR) unlicensed (NR-U) operations. When an opportunity for potential uplink transmissions arises for a user equipment (UE), the UE will perform a CCA procedure on available uplink resources. The UE reports the results of the CCA procedure to a serving base station via an uplink control message, such as an uplink control information (UCI), physical uplink control channel (PUCCH), or the like. The serving base station may then use the CCA results in scheduling uplink transmissions and reserving uplink resources.
US11751083B2 Techniques for layer one reporting in wireless communications systems
Methods, systems, and devices for wireless communication are described. For example, the described techniques provide for a base station to determine and indicate to a UE (e.g., via control signaling) a configuration for layer one (L1) reporting of non-serving cells including, for example, a number of beams or cells for which the UE is to report metrics. The UE may receive the control signaling and measure or otherwise obtain metrics for beams of a serving cell of the UE, at least one non-serving cell of the UE, or beams of a non-serving cell of the UE. The UE may also identify an index associated with at least the one non-serving cell or indices of beams of the non-serving cell which the UE may use to identify the metrics in a L1 report. Accordingly, the UE may generate and transmit an L1 report to the base station.
US11751082B2 Reporting of information related to sounding reference signals (SRS) timing adjustments
Disclosed are techniques for wireless communication. In an aspect, a UE transmits, at a first time during a measurement window for positioning purposes, a first uplink reference signal in accordance with a first timing adjustment parameter, wherein the first time is offset from a downlink frame time of a base station by an amount of the first timing adjustment parameter, determines whether to use a second timing adjustment parameter, transmits, in response to the determination to use the second timing adjustment parameter, at a second time during the measurement window, a second uplink reference signal in accordance with a second timing adjustment parameter, wherein the second time is offset from the downlink frame time of the base station by an amount of the second timing adjustment parameter, and transmits a report indicating that the second timing adjustment parameter has been applied to at least the second uplink reference signal.
US11751081B2 Load information interaction method and device, processor and storage medium
Provided are a method and a device for load information interaction, a processor and a storage medium. The method includes: sending, by a first network node, a load request message to a second network node, where the load request message is used for indicating configuration information used by the second network node in reporting load information to the first network node; and receiving, by the first network node, the load information reported by the second network node according to the configuration information. The second network node and the first network node belong to different logical nodes in a network. The technical problem that load management cannot be performed when the second network node and the first network node belong to different logical nodes in related technology is solved, and the maximum performance of the network is fully exhibited.
US11751078B2 Apparatus and method for measurement in wireless communication system
The present disclosure relates to a pre-5th-Generation (5G) or 5G communication system to be provided for supporting higher data rates beyond 4th-Generation (4G) communication system such as long-term evolution (LTE). The disclosure relates to the collection and reporting of measurement information in a wireless communication system, in which an operation method of a terminal may include receiving configuration information for a logged minimization drive test (MDT) disclosed by a secondary node (SN), storing a measurement result by performing the logged MDT in one of a radio resource control (RRC) idle mode or an RRC inactive mode, based on the received configuration information, transmitting a message including an indicator for indicating that the stored measurement result exists after the terminal is switched to the RRC connected mode, receiving a request message for requesting the logged MDT measurement result, and transmitting a message for reporting the logged MDT measurement result.
US11751077B2 Method, computer program, apparatus, and vehicle for generating a quality of service map
A method, computer program, apparatus, and transportation vehicle for generating a quality of service (QoS) map. A radio link is used between a first and second mobile transceiver. The method includes determining information related to a density of mobile transceivers in an area surrounding the first mobile transceiver, information related to an availability of different radio access technologies (RATs) in the area surrounding the first mobile transceiver, and information related to a distance between the first and the second mobile transceivers; obtaining information related to a QoS of the radio link for the different RATs and determining a relationship between the information related to the density, the information related to the distance, and the information related to the QoS of the radio link for the different RATs; and storing the information related to the relationship for the different locations of the first mobile transceiver to obtain the QoS map.
US11751062B1 Security apparatus and methods for wireless data exchange
A method of authenticating a first device at a second device for two wirelessly communicating devices, the method comprising: determining the distance between the two devices based on a property of a received communication; at each device, determining at least one shared physical layer property of the communication channel between the two devices; and authenticating the first device based on the determined distance between the two devices and the determined physical layer property of the communication channel.
US11751061B2 Systems, apparatuses and methods for secure wireless pairing between two devices using embedded out-of-band (OOB) key generation
Devices, systems and methods are provided to implement key generation for secure pairing between first and second devices using embedded out-of-band (OOB) key generation and without requiring the devices to have input/output (IO) capability to enter authentication information. Bluetooth Smart or Low Energy (BLE) OOB pairing option can be used for pairing medical devices with added security of OOB key generation. The OOB key generation comprises providing first and second devices with the same predefined credential and secure hashing algorithm, and making input of the hashing algorithm of the first and second devices the same. The first device transmits unique data to second device (e.g., via BLE advertising) to share and compute a similar input. The first and second devices use the credential and shared data with the hashing function to generate a key that is the same at each of first and second devices.
US11751060B2 Identity recognition method and apparatus
An identity recognition method includes: establishing, by a first device, a connection with a second device in response to detecting that the second device enters a preset first distance range; performing identity authentication on the second device based on the connection; and determining that the second device is a device with a preset user authority in response to determining that the identity authentication is passed and detecting that the second device enters a preset second distance range and the second device is within a preset direction range of the first device; herein the preset second distance range is within the preset first distance range.
US11751059B1 Subscriber identification module (SIM) application authentication
A method of authenticating access of an electronic device to an application server based on a subscriber identity module (SIM) associated with the electronic device. The method receiving an authentication challenge from an application executing on the device by a SIM application toolkit (SAT) executing on the device, transmitting a random number and an authentication value of the challenge to a SIM of the device by the SAT, receiving a response from the SIM by the SAT, transmitting an authentication response to the application by the SAT, where the authentication response comprises the response received from the SIM, generating an application key by the SAT based at least in part on the response received from the SIM, and transmitting the application key to the application by the SAT, whereby the application executing on the electronic device establishes a communication session with an application server via an access communication network.
US11751055B2 User plane integrity protection in cellular networks
Integrity protection is used to assist in ensuring the secure transmission of wireless data within a cellular network. Instead of performing integrity protection on each packet data unit (PDU) transmitted/received within a PDU session, integrity protection is performed on a portion of PDUs transmitted within a cellular network. For instance, partial integrity protection may be performed on at least one predetermined PDU (e.g., the first, second, fourth, . . . ) that is transmitted via a Physical Downlink Shared Channel (PDSCH)/Physical Uplink Shared Channel (PUSCH) during a communication session. By performing partial integrity protection, user data may be transmitted more quickly throughout the cellular network, compared to performing full integrity protection, while still providing integrity protection.
US11751045B2 Method for synchronizing status of UE in a communication network
The present disclosure relates to synchronizing a temporary identity in the UE and the network when the UE is RRC Inactive state over 3GPP access and temporary identity of the UE is changed over a Non-3GPP access in a scenario when the UE is connected to the same AMF via 3GPP and non-3GPP access.
US11751044B2 Call routing while roaming on a 5G wireless telecommunication network
Disclosed is a system and method to route a call from a roaming UE on a 5G network. The system receives from a UE belonging to a home network an indication of a call to a dialed number. The call requires information associated with the UE that is not available to the first wireless telecommunication network, because the UE is roaming on a visitor network. The indication of the call includes a unique identifier of the visitor network. The system can determine based on the unique identifier that the UE is roaming and send a request to the visitor network to provide instructions on how to route the received call. Upon obtaining the instructions on how to route the received call, the system routes the received call.
US11751043B2 Device and method for providing network slice interworking in wireless communication system
A pre-5th-Generation (5G) or 5G communication system for supporting higher data rates Beyond 4th-Generation (4G) communication system such as Long Term Evolution (LTE), in which a method performed by a user equipment (UE) includes transmitting, to a first base station (BS), a packet data network (PDN) connection request message, receiving, from the first BS, information on a first single-network slice selection assistance information (S-NSSAI) selected by a combination of a packet data network gateway control plane entity (PGW-C) and a session management function (SMF) from among the UE's at least one subscribed S-NSSAI, transmitting, to a second BS, a registration request message including a requested NSSAI in which the first S-NSSAI is included, and receiving, from the second BS, a registration accept message including an allowed NSSAI in which a second S-NSSAI mapped to the first S-NSSAI is included.
US11751040B2 System and method for detecting a cellular device
Methods and systems for cellular device detection are presented. A wideband receiver is operable to acquire a block of digitized samples in an uplink frequency band. The wideband receiver is also operable to applying one or more computational kernels to the block of digitized samples, thereby determining a possible uplink transmission from the cellular device. The cellular device is confirmed when the bandwidth of the possible uplink transmission is verified and a cellular basestation, associated with the possible uplink transmission, is located.
US11751038B2 Automatic emergency reporting system for vehicle
An automatic emergency reporting system for a vehicle includes a determiner, a normality transmitter, a detector, and an emergency transmitter. The determiner determines a quality of communication between a communication terminal of the vehicle and a server. The normality transmitter transmits rich information available in the server from the communication terminal in a normal state. The detector detects an emergency of the vehicle. The emergency transmitter transmits emergency information from the communication terminal to the server after the detection. The emergency transmitter transmits the rich information with the emergency information in response to the detection of the emergency of the vehicle in a state in which a status of the communication with the server is satisfactory. The emergency transmitter transmits the emergency information in response to the detection of the emergency of the vehicle in a state in which the status of the communication with the server is not satisfactory.