| Document | Document Title |
|---|---|
| US11599012B2 |
Connecting device of accessory that is detachably attached to accessory shoe device of electronic apparatus, accessory, accessory connecting mechanism, and electronic apparatus system
A connecting device of an accessory by which improvement in mechanical strength is compatible with arrangements of many connection terminals. The connecting device is detachably attachable to an accessory shoe device of an electronic apparatus. An engagement member is attachable to the accessory shoe device by sliding in a first direction. A holding member is fixed to the engagement member by fastening members. A connecting plug has connection terminals and is arranged at a front part in the first direction of the holding member. The fastening members are arranged at positions that are spaced apart from each other in a second direction that perpendicularly intersects with the first direction. A width of the holding member is shorter than a width of the engagement member in the second direction, and the connection terminals are arranged in an area between the positions of the fastening members. |
| US11599007B2 |
Dual-aperture zoom digital camera with automatic adjustable tele field of view
Devices disclosed herein feature a Wide camera with a Wide field of view (FOVw), a folded Tele camera with a Tele field of view (FOVT) smaller than the FOVw and including an optical path folding element (OPFE). The device may be configured to rotate the OPFE to thereby shift FOVT relative to FOVw in response to recognition of an object or subject of interest detected in FOVw or FOVT. The device can have high resolution in this overlapping FOV either by fusing the Wide and Tele images or by capturing and saving the Tele image. |
| US11599004B2 |
Privacy film, display apparatus, and method of displaying image in display apparatus
A privacy film includes a first conductive layer; an emitting angle limiting spacer layer on the first conductive layer; a second conductive layer on a side of the emitting angle limiting spacer layer away from the first conductive layer; and a plurality of light diffuser particles in a space between the first conductive layer and the second conductive layer. The emitting angle limiting spacer layer includes a plurality of spacers defining a plurality of light emitting regions. The second conductive layer is spaced apart from the first conductive layer by a first distance. A maximum height of the plurality of spacers relative to a surface of the first conductive layer facing the second conductive layer is less than the first distance. The second conductive layer is spaced apart from a surface of a respective one of the plurality of spacers facing the second conductive layer by a second distance. |
| US11598997B2 |
Electro-optical device and electronic apparatus
A liquid crystal apparatus includes a scan line extending in a ±X direction, a data line extending in a ±Y direction that intersects with the ±X direction, a TFT having a semiconductor layer in which, at a position overlapping with the scan line in plan view, one source drain region and a channel region extend along the ±X direction, and at a position overlapping with the data line in plan view, another source drain region extends along the ±Y direction, and a first upper capacitance element and a second upper capacitance element provided at a position overlapping with the data line, so as to overlap with the other source drain region in plan view. |
| US11598996B2 |
Light-adjusting glass and smart vehicle window
The present disclosure provides a light-adjusting glass and a smart vehicle window. The light-adjusting glass has a transmittance adjustment region and an encapsulation region; the light-adjusting glass includes: a first and second substrates opposite to each other, and a dye liquid crystal layer between the first and second substrates in the transmittance adjustment region, and a frame sealant in the encapsulation region; the first substrate includes a first base and a first electrode layer on a side of the first base proximal to the dye liquid crystal layer; the second substrate includes a second base and a second electrode layer on a side of the second base proximal to the dye liquid crystal layer; a conductive structure is provided in the frame sealant; a first and second voltage transmission structures electrically insulated from each other are on the first base. |
| US11598994B2 |
Display device
A display device including a first display substrate including a switching element disposed on a first base, a height difference generation pattern disposed on the switching element to overlap with the switching element, a color filter layer disposed on the height difference generation pattern and covering the height difference generation pattern, an organic layer disposed on the color filter layer and including a protruding part overlapping the height difference generation pattern, and a pixel electrode disposed on the organic layer, electrically connected to the switching element, and not overlapping the protruding part; a second display substrate including a second base facing the first base; a liquid crystal layer disposed between the first and second display substrates; and a column spacer disposed between a first surface of the second base facing the first base and the organic layer and overlapping the protruding part. |
| US11598992B2 |
Active matrix substrate and a liquid crystal display
The present invention provides a liquid crystal display that can reduce occurrence of quality problems and improve adhesive strength between substrates. The present invention is a liquid crystal display including a first substrate, a second substrate, and a seal. The first substrate includes a shift register monolithically formed on an insulating substrate, a plurality of bus lines, a first end, and a display region. The shift register includes a plurality of multistage-connected unit circuits and wiring connected to the plurality of unit circuits, and is arranged in a region between the first end and the display region. At least one of the unit circuits includes a clock terminal, an output terminal, an output transistor, a second transistor, and a bootstrap capacitor. The output transistor and the bootstrap capacitor are arranged in a region between the first end and one of the wiring and the second transistor. |
| US11598987B2 |
Display device
The present disclosure provides a display device including a liquid crystal layer having a first surface and a second surface opposite to each other, and the second surface has a light entrance region and a light outgoing region; a reflector within the liquid crystal layer and adjacent the first surface; a light absorbing layer on the first surface of the liquid crystal layer, the light absorbing layer including a first shielding layer, a second shielding layer and a filling layer therebetween, the second shielding layer is between the first shielding layer and the liquid crystal layer and has a first opening therein, and the liquid crystal layer is configured to modulate light incident from the light entrance region into first refracted light under a first voltage; and modulate the light incident from the light entrance region into second refracted light under a second voltage different from the first voltage. |
| US11598985B1 |
Systems with adjustable window transmission and haze
A system such as a vehicle, building, or electronic device system may have a support structure with one or more windows. The support structure and window may separate an interior region within the system from a surrounding exterior region. Control circuitry may receive input such as user input and may adjust an adjustable layer in the window based on the input. The adjustable layer may have a polymer matrix layer with embedded cells. The cells may include intermixed guest-host liquid crystal cells and liquid crystal cells. The guest-host liquid crystal cells and liquid crystal cells may have different liquid crystal materials and/or different sizes that allow the guest-host liquid crystal cells and liquid crystal cells to electrically switch states at different respective threshold voltages. Based on the user input or other input the control circuitry can adjust a drive signal across the adjustable layer to change light transmittance and haze. |
| US11598983B2 |
Display device
A display device including: a display panel including a first area, a second area spaced apart from the first area, and a bent third area between the first and second areas; a first support film coupled to a bottom surface of the display panel and overlapping the first area; and a second support film coupled to the bottom surface of the display panel, overlapping the second area, and spaced apart from the first support film by a gap, the gap overlapping the third area, a top surface of the first support film facing the display panel and an inner side of the first support film form a first angle, a top surface of the second support film facing the display panel and an inner side of the second support film form a second angle, which is greater than the first angle, and the first support film includes a protruding pattern. |
| US11598981B2 |
Analyzing microtextured regions of optically anisotropic materials
Images of samples that are illuminated with polarized light are captured. Azimuth and inclination data are extracted from the captured images. The azimuth and inclination data are used to quantify MTRs. |
| US11598979B1 |
Dual port constrained acoustic volume
A portable eyewear electronic device that includes a speaker module and methods of assembly of the device are presented. The electronic eyewear device includes a speaker module that emits acoustic radiation that is channeled through a carrier contained within a temple to one or more acoustic ports near a user's ear. |
| US11598978B2 |
Optical lens
An optical lens intended to be placed before a wearer's eye and having a front surface and a rear surface, the rear surface being the surface intended to be the closest to the wearer's eye when the optical lens is placed before a wearer's eye, the optical lens having a mineral glass element on the front surface and further comprising an eye protector that is configured to prevent any piece of the mineral glass element from reaching the wearer's eye when the element is broken, said eye protector comprising a polymer wafer arranged on the rear surface. |
| US11598976B1 |
Object recognition for improving interfaces on an eyewear device and other wearable and mobile devices
A wearable or a mobile device includes a camera to capture an image of a scene with an unknown object. Execution of programming by a processor configures the device to perform functions, including a function to capture, via the camera, the image of the scene with the unknown object. To create lightweight human-machine user interactions, execution of programming by the processor further configures the device to determine a recognized object-based adjustment; and produce visible output to the user via the graphical user interface presented on the image display of the device based on the recognized object-based adjustment. Examples of recognized object-based adjustments include launch, hide, or display of an application for the user to interact with or utilize; display of a menu of applications related to the recognized object for execution; or enable or disable of a system level feature. |
| US11598971B2 |
Image device with a compact homogenizer
A compact light source for a projection display is disclosed enabling eye-glass display using a Fresnel mirror reflecting light without a distance as conventional prism type reflector. |
| US11598968B2 |
Image display device having maximum emission angle of image light smaller than maximum viewing angle of virtual image
The image display device includes an image generating unit that emits first image light, a pupil expanding element that expands a diameter of a light flux included in the first image light from the image generating unit to obtain second image light, a first light condensing optical system that condenses the second image light and forms an intermediate image, and a second light condensing optical system that condenses light from the intermediate image and generates a virtual image on eye of a viewer, in a plane including at least the image generating unit, the pupil expanding element, and the eye of the viewer, a maximum emission angle of the first image light is smaller than a maximum viewing angle of the virtual image, and the diameter of the light flux included in the second image light is greater than that of a light flux included in the virtual image. |
| US11598967B2 |
Positioning and stabilising structure and system incorporating same
A head-mounted display system includes a head-mounted display unit and a positioning and stabilising structure structured and arranged to hold the head-mounted display unit in an operational position over a user's face in use. The positioning and stabilising structure includes a rear support structure adapted to contact posterior regions of a user's head and a forehead support connector, which includes a forehead support strap, which extends generally along and in the direction of the sagittal plane and connects the rear support structure to a superior edge region of the head-mounted display unit. The forehead support connector further includes a forehead support rigidiser that provides rigidification to a portion of the forehead support connector. |
| US11598966B2 |
Light projection system including an optical assembly for correction of differential distortion
A light projection system includes a light source configured to emit image light and an optical assembly configured to provide positive optical power to the image light and optically correct the image light. The optical assembly comprises a plurality of optical elements configured to correct differential distortion related to the image light across a field of view (FOV) within a threshold amount. The differential distortion is corrected based in part on asymmetry of the plurality of optical elements relative to an optical axis shared by the plurality of optical elements. |
| US11598964B2 |
Freeform varifocal optical assembly
A freeform varifocal optical assembly includes at least three optical modules including a first plurality of optical elements including Pancharatnam-Berry phase (PBP) lenses, polarization sensitive hologram (PSH) lenses, metamaterials, or combinations thereof. The plurality of optical elements of each optical module include a property associated with a Zernike polynomial. Each of the first and the three optical modules are configurable between a plurality of optical powers. The freeform varifocal optical assembly is configurable to output a predetermined wavefront in response to an input wavefront. |
| US11598959B2 |
Light shielding film for head-up display (HUD) and HUD system for vehicle
Provided is a light shielding film for head-up display (HUD), the light shielding film including a plurality of light shielding materials configured to transmit a first directional light propagating from a view in front of a vehicle in a first direction and block at least a portion of a second directional light propagating from an external light source in a second direction that is opposite to a third direction in which light is output from a display panel for HUD included in the vehicle, at least one gradient of the plurality of light shielding materials corresponding to the first direction, and a transparent material that fills a space between the plurality of light shielding materials. |
| US11598957B2 |
Facial expressions from eye-tracking cameras
Systems and methods for synthesizing an image of the face by a head-mounted display (HMD), such as an augmented reality device, are disclosed. The HMD may be able to observe only a portion of the face with an inward-facing imaging system, e.g., the periocular region. The systems and methods described herein can generate a mapping of a conformation of the portion of the face that is not imaged based at least partly on a conformation of the portion of the face that is imaged. The HMD can receive an image of a portion of the face and use the mapping to determine a conformation of the portion of the face that is not observed. The HMD can combine the observed and unobserved portions to synthesize a full face image. |
| US11598956B2 |
Eyeball tracking system and eyeball tracking method
An eyeball tracking system is provided, which includes: an illumination light source, configured to transmit an illumination light ray to a beam scanner; the beam scanner, configured to project the illumination light ray onto an entrance pupil optical apparatus; the entrance pupil optical apparatus, configured to reflect, reproduce, or refract the illumination light ray, so that the reflected, reproduced, or refracted illumination light ray illuminates an eyeball; a photoelectric detector, configured to: collect a receive optical power value of an eyeball reflection light ray, and send the receive optical power value to a controller; and the controller, configured to: receive the receive optical power value sent by the photoelectric detector, determine, based on the receive optical power value, an optical power reference value, and determine a current gaze direction of the eyeball based on the optical power reference value. |
| US11598955B2 |
System and method of operating a display of an information handling system
In one or more embodiments, one or more systems, one or more methods, and/or one or more processes may provide, by first multiple light emitting diode (LED) pixels of a display, first light emissions; provide, by second multiple LED pixels of the display, second light emissions; determine a gaze point associated with eyes of a user and associated with the display; and configure multiple liquid crystal display pixels of the display within a distance from the gaze point to: block the second light emissions to a first eye of the eyes of the user, block the first light emissions to a second eye of the eyes of the user, permit transmission of the first light emissions to the first eye of the eyes of the user, and permit transmission of the second light emissions to the second eye of the eyes of the user. |
| US11598954B2 |
Non-telecentric emissive micro-pixel array light modulators and methods for making the same
Emissive micro-pixel spatial light modulators with non-telecentric emission are introduced. The individual light emission from each multi-color micro-scale emissive pixel is directionally modulated in a unique direction to enable application-specific non-telecentric emission pattern from the micro-pixel array of the emissive spatial light modulator. Design methods for directionally modulating the light emission of the individual micro-pixels using micro-pixel level optics are described. Monolithic wafer level optics methods for fabricating the micro-pixel level optics are also described. An emissive multi-color micro-pixel spatial light modulator with non-telecentric emission is used to exemplify the methods and possible applications of the present invention: ultra-compact image projector, minimal cross-talk 3D light field display, multi-view 2D display, and directionally modulated waveguide optics for see-through near-eye displays. |
| US11598951B2 |
Optical unit
An optical unit includes: a base which includes a main surface; a mirror device which includes a movable mirror portion and is disposed on the base; a frame member that is provided on the main surface so as to surround the mirror device; and a window member that is bonded to the frame member and has a flat plate shape. The frame member includes a first wall portion which is provided on the main surface and includes a first top surface on the side opposite to the main surface, a second wall portion which is provided on the main surface so as to face the first wall portion and includes a second top surface on the side opposite to the main surface. |
| US11598949B2 |
Actuator and light scanning apparatus
An actuator including a beam configured to support an object to be driven, and a drive source to which a drive signal is input, wherein the drive signal includes a drive waveform in a shape of sawtooth waveform, a rising of the drive waveform in the shape of sawtooth waveform includes a first staircase waveform and a second staircase waveform continuing from the first staircase waveform, the first staircase waveform generates oscillation of a ringing suppressing waveform for suppressing a ringing waveform to be generated in the second staircase waveform, and the object to be driven is driven to swing in a direction of rotating around the predetermined axis by driving the drive source. |
| US11598947B2 |
Relay optical system for rigid endoscope
A relay optical system 20 for a rigid endoscope includes a lens fixing frame 21 and a plurality of lenses 22. The lens fixing frame 21 has a plurality of tubular bodies 26. The plurality of tubular bodies 26 are joined coaxially to each other. The plurality of lenses 22 are located at positions other than a joint position jp of the tubular bodies 26 in an axis direction of the lens fixing frame 21. The plurality of lenses 22 are located in the lens fixing frame 21 so as to have a coincident optical axis. The plurality of lenses 22 do not include a cemented lens. |
| US11598944B2 |
Light sheet microscope and method for imaging an object
A light sheet microscope includes an object slide, and optical illumination and detection systems. The optical illumination system includes an illumination objective configured to illuminate a first object plane that is oblique relative to a slide plane with a light sheet. The optical detection system includes a detection objective and an image sensor device. The image sensor device is configured to define a first image plane which is orthogonal to an optical axis of the detection objective and to define a second image plane which is tilted relative to the first image plane. The detection objective is configured to image a focal plane onto the first image plane and to image a second object plane of the object onto the second image plane, the focal plane being coincident with the first object plane, and the second object plane being parallel to or coincident with the slide plane. |
| US11598935B2 |
Imaging optical lens assembly including nine lenses of −++−++−+−, ++−++−−+−, −+−++−−+−, −+−++−++−, +−−++−−+− or +−−++−++− refractive powers, image capturing unit and electronic device
An imaging optical lens assembly includes nine lens elements which are, in order from an object side to an image side along an optical path: a first lens element, a second lens element, a third lens element, a fourth lens element, a fifth lens element, a sixth lens element, a seventh lens element, an eighth lens element and a ninth lens element. The first lens element has positive refractive power. The eighth lens element with positive refractive power has an image-side surface being convex in a paraxial region thereof. The ninth lens element has an image-side surface being concave in a paraxial region thereof, and the image-side surface of the ninth lens element has at least one convex critical point in an off-axis region thereof. |
| US11598931B2 |
Lens moving apparatus
A lens moving apparatus including a housing; a bobbin disposed in the housing; a coil disposed on the bobbin; a magnet disposed on the housing to correspond to the coil; an upper elastic member coupled to an upper portion of the bobbin and an upper portion of the housing; and a damper coupled to the first elastic member and the housing. Further, the upper elastic member comprises a connector connecting the bobbin and the housing and a protrusion extending toward the housing, and the damper is coupled to the protrusion and the housing |
| US11598927B1 |
Optoelectronic device
An optoelectronic device includes a carrier, an electronic component, a photonic component and a supportive component. The electronic component is electrically coupled to the carrier. The photonic component is electrically coupled to the electronic component. The supportive component is disposed outside the photonic component and the electronic component and configured to support an optical component. |
| US11598924B2 |
Retention assembly for securing POF fiber within a connector
An optical connector assembly having a connector housing with a first and second end. First end accepts a ferrule assembly, and second end accepts a retention assembly. There is a longitudinal bore from a distal to proximal end of connector. Bore accepts a POF optical fiber therein at distal end and fiber is inserted proximally until fiber bottoms-out at proximal end of ferrule. Retention body accepts one or more retention caps, or retention body contains at least one retention wing set to secure fiber to connector. |
| US11598923B2 |
Fiber optical connector
A fiber optical connector includes a connector housing and an optical-fiber component. The connector housing comprises a receiving space. One end of the connector housing forms a connector opening communicating with the receiving space. Two side walls of the connector housing comprise a plurality of buckling portions adjacent to the connector opening. The optical-fiber component is positioned in the receiving space. The optical-fiber component comprises a sleeve piece. The sleeve piece comprises a block member and a threaded portion. The block member is assembled in the connector opening and the block member fully received inside the receiving space. Two sides of the block member respectively form an engaging portion. Each of the engaging portions is engaged with the corresponding buckling portion, and the threaded portion is exposed on the peripheral surface of a tail portion of the sleeve piece and out of the connector opening. |
| US11598922B2 |
Optical receptacle and optical transceiver
There are provided an optical receptacle having an optical fiber including a first portion on another end surface side, a third portion on one end surface side, and a second portion between the first portion and the third portion; a core diameter at the first portion is smaller than the core diameter at the third portion; the core diameter at the second portion increases from the first portion side toward the third portion side; a first elastic member is provided between the optical fiber and an inner wall of a through-hole; a holder holds the another end surface side of a fiber stub; and the sleeve holds the one end surface side of the fiber stub. |
| US11598920B2 |
Opto-mechanical transducer apparatus and corresponding method
An embodiment apparatus comprises an optically transparent substrate having first and second surfaces; a piezoelectric membrane, arranged at the first surface, that oscillates in response to a light beam propagated through the substrate; at least one reflective facet facing the substrate and arranged at the piezoelectric membrane; and an optical element receiving the light beam at an input end and guiding the light beam towards an output end coupled to the second surface. The optical element incorporates a light focusing path focusing the light beam at a focal point at the piezoelectric membrane, and at least one light collimating path collimating the light beam onto the at least one reflective facet. The optical element guides light reflected from the at least one reflective facet to the input end, the reflected light indicating a position of the optical element with respect to the focal point. |
| US11598913B2 |
Light-emitting module
A light-emitting module includes: a plurality of light sources; and a lightguide plate including a plurality of light source placement sections, in each of which at least one light source is arranged, arrayed in a first direction and a second direction orthogonal to the first direction. The lightguide plate defines at least one first-A light control groove and at least one first-B light control groove that extend parallel to the second direction between a first light source placement section and a second light source placement section adjacent to the first light source placement section in the first direction, and at least one second-A light control groove and at least one second-B light control groove that extend parallel to the first direction between the first light source placement section and a third light source placement section adjacent to the first light source placement section in the second direction. |
| US11598911B1 |
Transporting light within circuit board profile
Embodiments described herein relate to a system for positioning indicator lights of a network device. The system may include a circuit board, which may include a circuit board edge positioned behind a front panel of the network device, two surfaces; and a side of the circuit board edge positioned between the two surfaces. The system may also include a hole through the circuit board near the circuit board edge, a cutout extending from a portion of the hole to the side of the circuit board edge, a LED coupled to the surface of the circuit board and adapted to emit light into the hole, and a lightpipe disposed in the hole to receive light emitted from the LED into a first end of the lightpipe. The lightpipe may direct the light from a second end of the lightpipe toward an opening in the front panel of the network device. |
| US11598908B2 |
Interference filter module
An interference filter module comprises two optical fiber collimators arranged on an optical axis so as to be opposed to each other, interference filters, and a casing including a main body portion and filter holding portions to be mounted into the main body portion, which are configured to hold the interference filters. Two interference filters including a kth filter when counted from a front end and a k-th filter when counted from a rear end are determined as a k-th set. The two interference filters of the k-th set are accommodated in two filter holding portions, each of which is a k-th holding portion when counted from the front end and the rear end, respectively. The two filter holding portions have rotation axes in directions orthogonal to a fore-and-aft direction and are rotatably held by the casing. The rotation axes of the filter holding portions are orthogonal to each other. |
| US11598907B2 |
Light body
A method for producing a half mirror includes forming a reflection region by which light is reflected and a transmission region through which the light is transmitted on a surface of a transparent plate Only the reflection region is coated with a plating. The coating includes a masking step of coating a position of the transparent plate corresponding to the transmission region with a masking material, a plating step of coating the entire surface which includes the transmission region which has been coated with the masking material and the reflection region with the plating, a plating removing step of removing the plating to a depth in which the masking material is exposed after the plating step, and a masking material removing step of removing the masking material after the plating removing step. |
| US11598906B1 |
Multilayer optical barrier
A liquid lens architecture includes a transparent substrate, a multilayer thermoplastic polyurethane (TPU)-based membrane overlying at least a portion of the transparent substrate, and a liquid layer disposed between and abutting the transparent substrate and the multilayer thermoplastic polyurethane-based membrane. The TPU-based membrane may exhibit a reversible elastic response to imposed strains of up to approximately 2% and is configured to limit the transpiration of fluid to less than approximately 10−2 g/m2/day. |
| US11598901B2 |
Information presenting method, information presenting device, and information presenting program
A storage unit stores ranking information including an index value relating to past rainfall and a corresponding date-time and damage information including details of damage that occurred due to past rainfall and a corresponding date-time. A real-time data reception unit acquires a spot value and a forecast value of current precipitation. Also, a comparison operation unit computes an index value relating to current rainfall using the acquired spot value and forecast value. The comparison operation unit specifies, with reference to the ranking information, the date-time of an index value relating to past rainfall whose similarity to the computed index value relating to current rainfall is not less than a threshold value. An information output unit presents, with reference to the damage information, details of damage that occurred in a period whose difference from the specified date-time of the index value relating to past rainfall is in a predetermined range. |
| US11598898B2 |
Determining a well operator land area
Techniques for determining an operator position for a hydrocarbon production area include identifying an entity name; determining a plurality of land areas associated with the entity name based on at least one public data set, at least one of the land areas including a hydrocarbon-bearing land area; determining a position associated with the entity name for each of the plurality of land areas based on the at least one public data set and at least one private data set, the position including an operator position or a non-operator position; determining at least a portion of the plurality of land areas in which the determined position associated with the entity name includes the operator position; aggregating the determined portion of the plurality of land areas to generate an operator land area for the entity name; and generating a graphical representation of the generated operator land area to present to a user. |
| US11598891B2 |
Low frequency and ultra low frequency seismic source having multiple operating heads for marine exploration
A seismic source having two or more operating heads with a firing chamber pressure vessel of compressed air for generating seismic oscillations at low and ultra-low frequencies (ULF) for marine seismic exploration. The multi-headed sound source increases low frequency signal in ranges from below 1 Hz to around 7 Hz to provide greater penetration of the seismic signal through complex overburden such as salt or basalt, improve velocity model building with methods such as Full Wave Inversion, improve the ability to build blocky reservoir models, and improve resolution by reducing side lobes. |
| US11598890B2 |
Ion beam profiling system and related methods
An ion beam profiling system include a beam profiling element, an ion sensitive element electrically isolated from the beam profiling element, an ion source configured to emit an ion beam at the beam profiling element and the ion sensitive element, and a current measuring device coupled to the ion sensitive element. The beam profiling element includes a plate of material having two parallel major surfaces, a first slit aperture extending through the plate of material and having a first longitudinal length extending in a direction parallel to the two parallel major surfaces, and a second slit aperture extending through the plate of material and having a second longitudinal length extending in a direction parallel to the two parallel major surfaces, wherein the first longitudinal length of the first slit aperture is perpendicular to the second longitudinal length of the second slit aperture. |
| US11598887B2 |
Method for measuring radioactivity of radioactive waste
The present invention relates to a method for measuring radioactivity of radioactive waste, the method comprising an adsorption step (A) of selectively adsorbing a radioactive substance comprising at least one from among radioactive iodine and radioactive cesium from radioactive waste containing radioactive substances on an adsorption member for adsorbing a radioactive substance, and a measurement step (B) of measuring radioactivity of the radioactive substance. |
| US11598883B2 |
Memory optimized GNSS correlator
A personal navigation device includes a correlator for processing GNSS signals from a constellation of satellites A signal is received from a navigation beacon containing a repeating code word, in which the code word includes a number N of samples corresponding to N phases, and in which reception of each code word occurs within a defined time period T. The sequence of N code samples is correlated with a known code word to determine a maximum value of correlation for a particular phase of the received signal. The correlation is performed using a correlator of size M, in which M is less than N, such that N/M=P complete correlations for a partial code phase are performed such that each correlation of a partial code phase is performed within a time period of approximately T/P. All P correlations of partial code phases are completed within time T. |
| US11598882B2 |
System and method for remotely locating objects (SEEKR)
This problem has been addressed before, but the way of doing so is flawed and incomplete. Only larger objects can be tracked, neglecting items such as glasses, TV remotes, and headphones. Some also solely use Bluetooth tracking, which can be quick and precise, but is unreliable. Items lost far away from people with Bluetooth active their phone cannot be found using this method. This is not an option for most small, easily misplaced items.Various embodiments of the device (in one case using the name SeekR) allow for tracking of all these difficult-to-keep-track-of items. The device's small size allows it to attach to all of these items that existing solutions cannot, e.g., on the frame of glasses, e.g., the bridge, temple and/or temple tips. The device also incorporates assisted global positioning system (AGPS), which is much more reliable than tracking devices that solely use Bluetooth technology, and, in many cases, using AGPS results in identifying the location of a lost item faster than using Bluetooth (or other short distance wireless communication systems). The AGPS system used in various embodiments combines trilateration and global positioning system (GPS) technology to determine a more accurate device location in less time than using GPS systems alone. |
| US11598880B2 |
Detecting fault states of an aircraft
An apparatus for detecting a fault state of an aircraft is provided. The apparatus accesses a training set of flight data for the aircraft. The training set includes observations of the flight data, each observation of the flight data includes measurements of properties selected and transformed into a set of features. The apparatus builds a generative adversarial network including a generative model and a discriminative model using the training set and the set of features, and builds an anomaly detection model to predict the fault state of the aircraft. The anomaly detection model is trained using the training set of flight data, simulated flight data generated by the generative model, and a subset of features from the set of features. The apparatus deploys the anomaly detection model to predict the fault state of the aircraft using additional observations of the flight data. |
| US11598877B2 |
Object recognition device and vehicle control system
A vehicle includes a LIDAR. An object recognition device: sets a space having a height from an absolute position of a road surface as a noise space; classifies a LIDAR point cloud into a first point cloud included in the noise space and a second point cloud outside the noise space; extracts a fallen object candidate being a candidate for a fallen object on the road surface based on the first point cloud; extracts a tracking target candidate being a candidate for a tracking target based on the second point cloud; determines whether horizontal positions of the fallen object candidate and the tracking target candidate are consistent with each other; integrates the fallen object candidate and the tracking target candidate whose horizontal positions are consistent with each other, to be the tracking target; and recognizes the fallen object candidate not integrated into the tracking target as the fallen object. |
| US11598876B2 |
Segmenting ground points from non-ground points to assist with localization of autonomous vehicles
According to an aspect of an embodiment, operations may comprise receiving, from a LIDAR mounted on a vehicle, a first 3D point cloud comprising points of a region around the vehicle as observed by the LIDAR. The operations may also comprise accessing an HD map comprising a second 3D point cloud comprising points of the region around the vehicle. The operations may also comprise segmenting LIDAR ground points from LIDAR non-ground points in the first 3D point cloud. The operations may also comprise segmenting map ground points from map non-ground points in the second 3D point cloud. The operations may also comprise determining a pose of the vehicle by matching the LIDAR ground points to the map ground points and by matching the LIDAR non-ground points to the map non-ground points. |
| US11598875B2 |
Multipath light test device for TOF module, depth error measuring method and system
A multipath light test device for a time of flight (TOF) module includes: a light-splitting plate configured to split light emitted from the TOF module; a first reflector plate connected to the light-splitting plate and forming a first angle with the light-splitting plate; and a second reflector plate disposed on one side opposite to the first reflector plate and forming a second angle with the first reflector plate; one part of the emitted light from the TOF module is returned to the TOF module along a first optical path after being reflected by the light-splitting plate with a first reflectivity; and the other part of the emitted light from the TOF module is transmitted through the light-splitting plate and incident to the first reflector plate and then returned to the TOF module along a second optical path. |
| US11598871B2 |
3D sonar systems and methods
Techniques are disclosed for systems and methods to provide accurate and compact three dimensional (3D) capable multichannel sonar systems for mobile structures. A 3D capable multichannel sonar system includes a multichannel transducer and associated processing and control electronics and optionally orientation and/or position sensors disposed substantially within the housing of a sonar transducer assembly. The multichannel transducer includes multiple transmission and/or receive channels/transducer elements. The transducer assembly is configured to support and protect the multichannel transducer and associated electronics and sensors, to physically and/or adjustably couple to a mobile structure, and/or to provide a simplified interface to other systems coupled to the mobile structure. Resulting sonar data and/or imagery may be displayed to a user and/or used to adjust a steering actuator, a propulsion system thrust, and/or other operational systems of the mobile structure. |
| US11598869B2 |
Systems and methods for acoustic and/or electromagnetic imaging
A method for use in acoustic imaging, comprising: transmitting, from a transmitter, a first sound wave pulse at a first frequency determined by a maximum sampling rate of a receiver; transmitting at least one second sound wave pulse at a frequency substantially equal to the first frequency, the first and at least one second sound wave pulses being transmitted substantially within a fraction of a sample interval of the receiver; receiving and sampling, at the receiver, a reflection of at least two of the first and at least one second pulses to generate a set of receiver samples; and expanding the set of receiver samples, based on the first frequency and a total number of the first and at least one second pulses transmitted, to generate an expanded sample set with a larger number of samples than the set of receiver samples. |
| US11598868B2 |
Microwave single pixel imager (MSPI)
A microwave single pixel imager apparatus and method of using same. Sampling a targeted scene includes the following. A plurality of modulated antenna patterns is generated using a reflectarray. A plurality of antenna temperatures respectively corresponding to the plurality of modulated antenna patterns is measured. A retrieved scene corresponding to the sampled targeted scene is generated. Generating a retrieved scene corresponding to the sampled targeted scene includes the following. The plurality of modulated antenna patterns and the corresponding plurality of antenna temperatures are fed into a compressive sensing imaging algorithm. |
| US11598867B2 |
Seeker sequential lobing radar antenna system
A radar antenna includes a plurality of horns in the annular space of a munition nose cone. The horns are disposed near the exterior surface of the nose cone. In a further aspect, the nose cone may be injection molded or additively manufactured so that the horns are embedded a known distance from the exterior surface. In a further aspect, the horns placed in either a transmit mode or a receive mode so as to maintain a minimum special separation between transmitting horns and receiving horns. |
| US11598865B2 |
Sensor assembly with cleaning
A sensor assembly includes a housing including a first chamber and a second chamber fluidly connected to the first chamber, a first sensor disposed in the second chamber and including a first sensor window facing outward from the second chamber, and a second sensor outside and fixed relative to the first chamber and the second chamber. The second sensor includes a second sensor window. The housing includes an intake from an exterior environment to the first chamber, a first outlet from the second chamber to the exterior environment, and a second outlet from the second chamber to the exterior environment. The first outlet is positioned to direct air across the first sensor window, and the second outlet is positioned to direct air across the second sensor window. |
| US11598864B2 |
Method and system for testing LiDAR sensors
A system and method for testing a Light Detection and Ranging (LiDAR) sensor is disclosed. The system includes the LiDAR sensor radiating a plurality of LiDAR rays, a plurality of bars positioned at a predetermined distance from the LiDAR sensor, and a testing device. The method includes triggering a LiDAR sensor to radiate a plurality of LiDAR rays. The method further includes determining at least one intersection point at each of a plurality of bars upon intersection of at least one LiDAR ray from the plurality of LiDAR rays with each of the plurality of bars. The method further includes computing at least one operational parameter for the LiDAR sensor based on the intersection points, and determining one or more test results based on the one or more operational parameters. |
| US11598861B2 |
Optical distance detection
In an optical detection system, a reference waveform can be used for automated analysis of a received waveform. The reference waveform can be adjusted (e.g., distorted) using information about one or more of a receive channel configuration or other aspects of the receive channel signal, facilitating a more effective comparison between a received impulse and the reference waveform. Such a comparison can be used in a time-to-digital conversion (TDC) technique, such as to provide delay values that can then be used to determine a distance between the illuminated target and an optical transceiver. Other techniques can be used to enhance range accuracy or resolution, such as using automated techniques for control of one or more of receive channel gain, summing or averaging (aggregation of received signals), or bias compensation (e.g., DC balancing). |
| US11598858B2 |
Light detector, light detection system, lidar device, and vehicle
According to one embodiment, a light detector includes a conductive layer, a first element, a second element, a first member, a first insulating part, and a second insulating part. The conductive layer includes a first conductive portion and a second conductive portion. The first element includes a first semiconductor layer and a second semiconductor layer. The second element includes a fourth semiconductor layer and a fifth semiconductor layer. The first member is provided between the first element and the second element and electrically connected to the conductive layer. The first member is conductive. The first insulating part is provided between the first element and the first member. The second insulating part is provided between the second element and the first member. |
| US11598857B2 |
Integrated lidar image-sensor devices and systems and related methods of operation
A Light Detection and Ranging (LIDAR) apparatus includes a detector having a first pixel and a second pixel configured to output respective detection signals responsive to light incident thereon, and receiver optics configured to collect the light over a field of view and direct first and second portions of the light to the first and second pixels, respectively. The first pixel includes one or more time of flight (ToF) sensors, and the second pixel includes one or more image sensors. At least one of the receiver optics or arrangement of the first and second pixels in the detector is configured to correlate the first and second pixels such that depth information indicated by the respective detection signals output from the first pixel is correlated with image information indicated by the respective detection signals output from the second pixel. Related devices and methods of operation are also discussed. |
| US11598854B2 |
Surveying system
A surveying system comprises an object to be measured having a retro-reflector and a surveying instrument main body for emitting a distance measuring light and performing a measurement based on a reflected distance measuring light, wherein the surveying instrument main body comprises a distance measuring light projecting module, a photodetector, a measuring unit, an optical axis deflector which has a reference optical axis and deflects a distance measuring optical axis, a projecting direction detecting module which detects a deflection angle and a deflection angle direction of the distance measuring optical axis, and an arithmetic control module, and wherein the arithmetic control module is configured to control the optical axis deflector, to perform a two-dimensional scan with the distance measuring light, to detect the deflection angle direction of the distance measuring light at a moment of detecting a photodetecting signal by the projecting direction detecting module, and to move an approximate center of the two-dimensional scan in the detected deflection angle direction. |
| US11598847B2 |
LiDAR apparatus and method of operating the same
A light detection and ranging (LiDAR) apparatus and a method of operating the LiDAR apparatus are provided. The LiDAR apparatus includes a light transmitter configured to irradiate a laser pulse towards an object, the laser pulse being generated based on a reference signal; a light receiver configured to receive the laser pulse reflected from the object and configured to obtain a first signal from the received laser pulse; and at least one processor configured to convert the first signal and the reference signal respectively into unipolar signals and configured to detect a flight time of the laser pulse based on a correlation between the converted first signal and the converted reference signal. |
| US11598841B1 |
System and method for distributed dual-function radar-communication
A system for distributed dual-function radar-communication comprises a plurality of dual-function radar transmitters positioned within a region of interest, each configured to transmit at least one radar waveform, with each transmitter for having a minimum transmit power, a maximum transmit power, and a working transmit power, a plurality of radar receivers positioned within the region of interest, each configured to receive the radar waveforms, at least one controller communicatively connected to at least one connected transmitter of the plurality of dual-function radar transmitters, configured to calculate a vector of transmit power values for the plurality of dual-function radar transmitters. A method of transmitting a radar waveform is also disclosed. |
| US11598840B1 |
System and process to passively determine the 3-dimensional position, the course line and the speed of a signal source
A system and process determine the 3-dimensional position, the course line and possibly the speed of an energy source. Embodiments use an antenna array system that includes receiver transducers positioned to form an equilateral triangle with a receiver transducer at each point of the triangle. Each transducer is independent, and there may be no electrical connection between each transducer in the antenna array. Each transducer may be connected directly to a computer for signal analysis to provide for case decision and display of the appropriate information and steps to follow to determine the appropriate action required by the computer operator. By detection of a single signal from a sound or light source, the 3-dimensional position and a course line of that signal source can be determined under certain circumstances. |
| US11598838B2 |
Detection device
A detection device includes at least one detection module communicatively coupled with a communication device. The detection module includes a controller circuit communicatively coupled with a first antenna. The first antenna receives first electromagnetic signals from a first plurality of antennae located within an interior of a first vehicle. The first antenna receives second electromagnetic signals from a second plurality of antennae located and within an interior of a second vehicle. The controller circuit determines a position of the communication device within the interior of the first vehicle relative to locations of the first plurality of antennae based on the first electromagnetic signals received by the first antenna. The controller circuit determines a position of the communication device within the interior of the second vehicle relative to locations of the second plurality of antennae based on the second electromagnetic signals received by the first antenna. |
| US11598832B2 |
Magnetic resonance signal transmission line connection structure and magnetic resonance imaging device having same
MR signal transmission line connection structure. A first connector fixed to a bed of an MR imager and connectable to an MR imaging. A second connector, which is disposed at an opposite side of an opening side of a chamber of the MR imaging device allowing entry of the bed, connected to a signal receiver for MR signals by a cable. The first connector has a first connection terminal, and the second connector has a second connection terminal. When the bed moves into the chamber, the first connector abuts the second connector such that the first connection terminal is connected to the second connection terminal, and an MR signal received by the coil is conveyable to the signal receiver via the first and second connection terminals. When the MR imaging ends, the bed moves back out of the chamber, breaking the connection between the first and second connection terminals. |
| US11598831B2 |
Active switching for RF slice-selecting
A magnetic resonance (MR) imaging system includes a transmit radio frequency (RF) coil assembly comprising multiple capacitor banks each coupled to at least one diode that is characterized by a high breakdown voltage such that when the transmit RF coil assembly applies at least one slice-selecting RF pulse to a portion of a subject placed in the magnet to select a particular slice for MR imaging, the capacitor banks are selectively adjusted to improve an RF transmission characteristics of the RF coil assembly in transmitting the at least one slice-selecting RF pulse. The MR imaging system may further include a receive radio frequency (RF) coil assembly configured to, in response to at least the slice-selecting RF pulse, receive at least one response radio frequency (RF) pulse emitted from the selected slice of the portion of the subject; a housing; a main magnet; gradient coils; and a control unit. |
| US11598825B2 |
System for determining at least one rotation parameter of a rotating member
The invention relates to a system comprising a coder that has an alternation of North and South magnetic poles separated by transitions extending along a helix of pitch p and of angle α, the magnetic track having Npp pairs of North and South poles and a polar width Lp measured along a normal to the transitions which are: Npp=πa/l and Lp=p·cos α. The invention also includes at least one sensor able to detect the rotating magnetic field in a plane perpendicular to the magnetic track and to the transitions by means of a mounting of at least two sensitive magnetic elements. The mounting being disposed at a radial reading distance from the magnetic track and being arranged to deliver signals in quadrature. |
| US11598824B2 |
Magnetic field sensor apparatus and method
Methods and apparatuses are provided, in which a magnetic field is measured using a coil in a first operating mode and a magnetic field is generated using the coil in a second operating mode in order to test a further magnetic field sensor. |
| US11598821B2 |
Leakage current detection from bias voltage supply of microphone assembly
The present disclosure relates in a first aspect to a method of detecting leakage current from a DC bias voltage circuit of an integrated circuit for a capacitive microelectro mechanical systems (MEMS) transducer. A test signal with a predetermined frequency and level is superimposed on a first DC bias voltage generated by the DC bias voltage circuit. |
| US11598819B2 |
Method for ascertaining a charge state of a battery system, battery system
Ascertaining a charge state of a battery system that includes at least one battery cell and one additional energy store that is connected in series with the at least one battery cell and can be switched in and out. One method includes switching in the additional energy store; measuring a voltage of the additional energy store at predefined time intervals; ascertaining a capacity change of the additional energy store with reference to the measured voltage and to a characteristic voltage curve of the additional energy store; ascertaining a charge throughput of the additional energy store with reference to the ascertained capacity change of the additional energy store; and ascertaining the charge state of the battery system with reference to the ascertained charge throughput. |
| US11598818B2 |
Determination of the aging of an electric storage system
A method for determining an aging of a battery having a variable state of charge within a cycling window forming a portion of a nominal operating domain. The method comprises: getting a tracking of a state of charge of the battery as a function of time over an interval of time, where the tracking comprises an alternation of calls for charging and discharging within the cycling window; for a plurality of calls over the time interval, getting a value of an electric measure indicative of energy exchanged by the battery during said call and estimating a state of health of the battery during said call based on said value; and determining an aging of the battery, on the basis of the estimated states of health. |
| US11598815B2 |
Battery test system and battery test method
This application relates to a battery test system and a battery test method. The battery test system according to an embodiment comprises: an extrusion apparatus configured to be disposed on a first surface of a battery; and a pressure apparatus, disposed above the extrusion apparatus, where the pressure apparatus is configured to apply a predetermined force to the battery in predetermined duration through the extrusion apparatus. The battery test system and the battery test method provided in this application are able to more reasonably evaluate the safety of the soft package battery and identify the risk caused by the defect of the soft package battery. |
| US11598802B2 |
Output terminal fault detection circuit
A circuit includes a gain stage, first and second amplifiers, and a comparison circuit. The gain stage has an input and an output. The first amplifier has an input and an output. The input of the first amplifier is coupled to the input of the gain stage. The second amplifier has an input and an output. The input of the second amplifier is coupled to the output of the gain stage. The comparison circuit is coupled to the outputs of the first and second amplifiers. The comparison circuit is configured to compare signals on the outputs of the first and second amplifiers and to generate a fault flag signal responsive to the output signal from the first amplifier being different than the output signal from the second amplifier. |
| US11598799B2 |
High-voltage interlock system and detection method thereof
The present disclosure provides a high-voltage interlock system and a detection method thereof. The high-voltage interlock system includes a target control device and at least one non-target control device connected in sequence. The target control device includes a detection unit, a current generation controller, a current generator, and a second high-voltage component. A controller in the target control device generates a pulse drive signal for driving the current generation controller, receives a detection result signal output from a current detector, and determines a fault of a high-voltage interlock circuit according to the detection result signal; the current generation controller generates an alternating voltage signal according to the pulse drive signal; the current generator outputs an alternating current signal according to the alternating voltage signal; the current detector acquires a voltage signal across a detection resistor set and outputs the detection result signal. |
| US11598796B2 |
System for measuring a parameter with an electrical meter
A system and method for measuring a parameter level is provided. The system including an electricity meter, the meter having an electricity measurement sensor having a source side and a load side. A socket and a collar are provided. The collar being electrically connected between the socket and the electricity meter, the collar having at least one first connector for a first phase of electricity and at least one second connector for a second phase of electricity, the first connector and second connector being electrically coupled to the load side, and a sensor electrically connected to at least one of the at least one first connector and the at least one second connector. |
| US11598781B2 |
Method for predicting the risk of incidence of chronic kidney disease
The present invention relates to means and methods suitable for risk prediction of chronic kidney disease (CKD) using Pro-Enkephalin or fragments thereof as biomarker. The risk prediction methods of the invention are intended for healthy subjects and for subjects suffering from diseases such as hypertension, cardiovascular diseases and events, diabetes, metabolic syndrome, obesity, or autoimmune diseases. Subject matter of the invention is also a method of predicting the worsening or improvement of kidney function or dysfunction in healthy and diseased individuals. |
| US11598780B2 |
Engineering lymphocytes with specific alpha and beta chains on their t-cell receptor
Provided herein are methods to identify TCR-recognizing cancer-specific antigens, and TCR-engineered T cells having antigen-specific cytotoxic activity. Provided herein are engineered T lymphocytes produced by the methods described herein. Provided herein are methods of treating cancer in a subject comprising administering the engineered T lymphocytes described herein. Provided herein are antibodies, or fragments thereof, produced by the methods described herein. Provided herein are methods of treating cancer in a subject comprising administering the antibodies described herein to a subject. In some embodiments, the therapeutic compositions (e.g., engineered lymphocytes, antibodies, etc.) and methods herein are provided as part of a kit or system. |
| US11598779B2 |
Detection of cancer biomarkers using nanoparticles
Methods for identifying and detecting potential disease specific biomarkers from biofluids. The methods involve in vivo administration of nanoparticles to a subject in a diseased state or incubating nanoparticles in a biofluid sample taken from a subject in a diseased state and analysis of the biomolecule corona formed on said nanoparticles. The methods distinguish between a healthy and diseased state in a subject, such as, for example, the presence of a tumor in a human subject. |
| US11598774B2 |
Methods of diagnosis and treatment of Alzheimer's Disease
Provided are methods of mitigating, reversing or eliminating in a subject one or more symptoms associated with cognitive impairment associated with amyloid deposits in the brain (e.g., olfactory dysfunction as a risk factor of dementia, mild cognitive impairment, Alzheimer's Disease) by detecting and targeting gram negative bacteria in the brain. |
| US11598771B2 |
Self-referencing sensor for chemical detection
Provided herein is a sensing apparatus comprising, at least one LSPR light source, at least one detector, and at least one sensor for LSPR detection of a target chemical. The sensor comprises a substantially transparent, porous membrane having nanoparticles immobilized on the surface of its pores, the nanoparticles being functionalized with one or more capture molecules. There is further provided a self-referencing sensor for distinguishing non-specific signals from analyte binding signals. The self-referencing sensor comprising one or more nanoparticles having at least two distinct LSPR signals. |
| US11598768B2 |
Compositions and methods for passive optical barcoding for multiplexed assays
Compositions comprising multiple hydrogel particles having substantially the same diameter, but with each subgrouping of particles from the multiple hydrogel particles having different associated values for one or more passive optical properties that can be deconvoluted using cytometric instrumentation. Each hydrogel particle from the multiple hydrogel particles can be functionalized with a different biochemical or chemical target from a set of targets. A method of preparing hydrogel particles includes forming droplets and polymerizing the droplets, with optional functionalization. |
| US11598764B2 |
Bracket, thrombelastography device, and support system
A bracket, a thrombelastography device, and a support system are disclosed. The device comprises: a fixed support part (101), a movable support part (102), and a connection part (103). The connection part comprises a first fixing connection member (1031) and a second fixing connection member (1032). The first fixing connection member is fixedly connected to the fixed support part; the second fixing connection member is fixedly connected to the movable support part; the first fixing connection member is connected to the second fixing connection member in point contact fashion, such that the first fixing connection member and the second fixing connection member can rotate relative to each other; the movable support part is fixedly connected to a supported object; when driven by the supported object, the movable support part rotates relative to the fixed support part by means of the point contact between the first fixing connection member and the second fixing connection member. The thrombelastography device comprises a rotational shaft and a bracket. The rotational resistance to the supported object when it rotates can be reduced. |
| US11598750B2 |
Eddy current flaw detection device and eddy current flaw detection method
An eddy current flaw detection device according to an embodiment includes: a first exciter/detector that is supplied with alternating current and can induce eddy current in a tested object by generating a magnetic field change in the tested object; a second exciter/detector disposed opposite side of the first exciter/detector sandwiching the tested object therebetween. The second exciter/detector can detect a change in a reactive magnetic field generated by the eddy current. The first and second exciter/detectors each may have a coil including a helical coil wire, and the coil wire of the first exciter/detector may be thicker than the coil wire of the second exciter/detector. |
| US11598749B2 |
Mass spectrometric system with ion mobility analyzer at elevated pressure
The invention provides hybrid mass spectrometric systems which comprise an ion source, a first trapped ion mobility spectrometry (TIMS) analyzer and a mass analyzer, wherein the TIMS analyzer is located and operated in a first vacuum chamber at an elevated pressure above 500 Pa, and methods for operating the hybrid mass spectrometric systems. |
| US11598746B2 |
Gas sensor
In one embodiment, a gas sensor includes a sensing layer having a first region containing PdCuSi, and a second region which is provided outside the first region and contains PdCu. |
| US11598745B2 |
Electrochemical gas sensor assembly
Various example embodiments described herein relate to an electrochemical gas sensor. The electrochemical gas sensor can include a sensor cap having one or more solid features disposed on a surface of the sensor cap. The electrochemical gas sensor can include a counter electrode configured to generate a gas during use of the electrochemical gas sensor. The electrochemical gas sensor can include a vent assembly adapted to release at least a portion of the gas generated at the counter electrode out from the electrochemical gas sensor. The vent assembly can include a vent conduit and a vent membrane that defines a passage for the gas to flow from an extended portion of the counter electrode, to the vent conduit, via the vent membrane, so as to be vented from the electrochemical gas sensor. |
| US11598744B2 |
Sensor
According to one embodiment, a sensor includes a sensor part and a first circuit. The sensor part includes a base body, a fixed electrode fixed to the base body, a supporter fixed to the base body, and a movable part supported by the supporter. The movable part includes a movable region including a movable electrode facing the fixed electrode, and a first support region provided between the movable region and the supporter. The first support region includes a first electrode, and a second electrode insulated from the first electrode. The first circuit is configured to perform a first operation of applying a voltage between the first electrode and the second electrode. |
| US11598743B2 |
Soil monitoring sensor including single probe and temperature compensation and method of operating the same
Disclosed are a soil monitoring sensor and a method of operating the same. The soil monitoring sensor includes a first probe formed to extend in a first direction, and including a first electrode and a second electrode; a first resonance circuit connected to the first electrode and the second electrode of the first probe, and configured such that a first AC signal is applied thereto; a second resonance circuit having the same impedance as the first resonance circuit, and configured such that a second AC signal is applied thereto; and a determination circuit configured to receive a first electrical signal formed in the first resonance circuit, to receive a second electrical signal formed in the second resonance circuit, and to generate a first determination value for the state of the soil based on the first resonant frequency and the second resonant frequency. |
| US11598740B2 |
Server apparatus, odor sensor data analysis method, and computer-readable recording medium
A server apparatus 10 is communicably connected to a terminal apparatus 20 that collects sensor data from an odor sensor 40. The server apparatus 10 includes an analyzer holding unit 11 that holds a plurality of analyzers for analyzing specific odor analysis targets, based on sensor data, an analyzer management unit 12 that determines preprocessing to be performed on the sensor data, by selecting an analyzer according to the environment of the odor sensor 40, and causes the terminal apparatus 20 to execute the preprocessing, an analysis execution unit 13 that executes analysis processing of the designated odor analysis target, by applying the selected analyzer to the preprocessed sensor data, and an analysis result transmission unit 14 that transmits information indicating a result of the analysis processing to the terminal apparatus 20. |
| US11598738B2 |
Apparatus and method for detecting defective component using infrared camera
Disclosed is an apparatus for detecting a defective component includes an infrared camera configured to capture an image of a test-target component in a production process, and a processor configured to measure a temperature of the component based on the image captured by the infrared camera and identify that the component of which temperature is out of a range of a reference value is defective. In addition, a database of various causes of defect is established, and an expected cause of defect for a defective component or a retest component is reasoned out from the database based on the measured temperature. |
| US11598737B2 |
Analyzing apparatus and analyzing method
An analyzing apparatus includes a memory unit that stores analysis conditions of each standards specifying analysis conditions for each analytical technique, a control unit, and an analysis unit that performs an analysis in accordance with a predetermined analytical technique. The control unit reads out the analysis conditions of the standard, and the control unit displays analysis conditions in time sequence, the displayed analysis conditions being necessary for the analysis and selected from out of the read-out analysis conditions, or the control unit prompts to input the analysis conditions in time sequence. When the analysis conditions are input, the control unit determines whether or not the input analysis conditions comply with the read-out analysis conditions, and in a case where a result of the determination is positive, the control unit displays a next analysis condition being necessary for the analysis, or the control unit prompts to input the next analysis condition. |
| US11598736B2 |
Systems and methods for determining grain density of an untreated rock sample using a gas porosimeter and nuclear magnetic resonance
Techniques for determining grain density of a rock sample include identifying an untreated rock sample that includes a solid matrix and a fluid entrained within the solid matrix; measuring, using a gas porosimeter, a grain density of the untreated rock sample; measuring, using nuclear magnetic resonance (NMR), a volume of the fluid entrained within the solid matrix; and determining, based on the measured grain density of the untreated rock sample and the measured volume of the fluid, a grain density of the solid matrix of the untreated rock sample. |
| US11598734B2 |
Joint nanoscale three-dimensional imaging and chemical analysis
A method for in-situ joint nanoscale three-dimensional imaging and chemical analysis of a sample. A single charged particle beam device is used for generating a sequence of two-dimensional nanoscale images of the sample, and for sputtering secondary ions from the sample, which are analysed using a secondary ion mass spectrometry device. The two-dimensional images are combined into a three-dimensional volume representation of the sample, the data of which is combined with the results of the chemical analysis. |
| US11598731B2 |
Inspection method for electrode structural body
The disclosure provides an inspection method determining whether there is a defect in an electrode structural body including a cathode electrode layer, an electrolyte layer and an anode electrode layer electrode by an image processor. The inspection method includes a step of scanning the electrode structural body along a scanning direction to obtain a continuous transmission image, a step of digitizing a shade of each pixel of the transmission image, a step of calculating a difference value between a grayscale of a specific pixel and a median value of grayscales of comparison pixels located in front or rear of the specific pixel along the scanning direction, and a step of determining presence or absence of the defect according to the difference value and a predetermined threshold value. |
| US11598730B2 |
Combined image generation of article under examination and image of test item
Among other things, one or more techniques and/or systems for generating a three-dimensional combined image is provided. A three-dimensional test image of a test item is combined with a three-dimensional article image of an article that is undergoing a radiation examination to generate the three-dimensional combined image. A first selection region of the three-dimensional article image is selected. The three-dimensional test image of the test item is inserted within the first selection region. Although the test item is not actually comprised within the article under examination, the three-dimensional combined image is intended to cause the test item to appear to be comprised within the article. |
| US11598729B2 |
X-ray inspection device
An X-ray inspection apparatus suppresses anomalies in inspection results caused by the X-ray inspection apparatus being used while an unsuitable setting is in effect. The X-ray inspection apparatus is provided with an inspection unit, a setting unit, a storage unit, an assessment unit, and a notification unit. The inspection unit inspects an irradiated article using detection data obtained by detecting X-rays. The setting unit sets a setting value used in inspection of the article by the inspection unit. The storage unit stores a detection value based on the detection data. The assessment unit assesses, on the basis of the detection value stored in the storage unit, whether or not the setting value set by the setting unit is suitable. When the assessment unit has assessed that the setting value is not suitable, the notification unit issues a notification to indicate that the setting value is not suitable. |
| US11598728B2 |
Multi-sensor pipe inspection system and method
An approach for collecting disparate data within a pipe involves a sensor arrangement configured to be deployed within the pipe. The sensor arrangement includes a plurality of sensors configured to detect disparate data related to the pipe. Each sensor of the plurality of sensors is coupled to a respective collection computer on the sensor arrangement. A synchronization module is configured to synchronize the disparate data. A database is configured to store the synchronized data. A processor is configured to process the synchronized data. A user interface configured to present the synchronized data to a user. |
| US11598727B1 |
Solution glow discharge plasma chamber with lens
An aspect of some embodiments of the present invention relates to a plasma chamber for containing a solution electrode glow discharge (SEGD) apparatus, the plasma chamber comprising a hollow body and a lens. The hollow body is configured to enclose a plasma generated between a solid electrode and a solution electrode, and includes at least one viewing port for letting light generated from the plasma leave the hollow body. The lens is disposed at or near the viewing port, the lens being configured to collect light from the plasma and direct the light onto a light receiving unit. |
| US11598722B2 |
Multi-point detection system
A multi-point detection system includes one or more light sources, one or more light sensors, and a controller. The light sources are configured to emit an array of collimated light beams, and the light sensors define an array of lines of view. Each of the lines of view intersect different ones of the collimated light beams at respective detection nodes. The light sensors are operable to emit sensor signals responsive to received scattered light from interaction of the collimated light beams with an analyte at the detection nodes. The controller is connected to receive the sensor signals and configured to determine from the scattered light whether the analyte contains a contaminant. |
| US11598720B2 |
Computer-implemented method and system for spectroscopic analysis of biological material
A computer-implemented method for spectroscopic analysis of biological material is provided that includes analyzing samples of biological material from a plurality of sources, and delivering samples of biological material to at least one flow cell for spectroscopy, and determining whether the spectroscopic analysis for each sample of the plurality of samples is or is predicted to be ambiguous in that it is affected by at least two non-discriminable factors. If such a determination is made, a disambiguating step can be performed. |
| US11598717B2 |
Systems and methods for discrimination of tissue targets
Systems for and methods for detecting samples and other compounds of interest are disclosed herein. The system can include an illumination source that is configured to emit light in a variety of different wavelength bands, an optical filter, a camera chip, and an optical path configured to direct the light emitted by the first illumination source at a target and direct the light reflected from the target to the at least one camera chip. The illumination source and the optical filter are transitionable between a first tuning state corresponding to a target tissue and a second tuning state corresponding to a background tissue. The system can be configured to record images at the different tuning states and generate a score image corresponding to the target tissue based on the recorded images. |
| US11598713B2 |
Particle size measurement method, particle size measurement apparatus, and particle size measurement program
Provided are a particle size measurement method, a particle size measurement apparatus, and a particle size measurement program in which a needless measurement time period is omitted by setting an appropriate measurement time period in accordance with a particle size to be measured. The particle size measurement method includes: a test measurement step; an autocorrelation function calculation step; a setting step of setting a part of a plurality of measurement timings set in advance as measurement timings to be used for main measurement, based on a time period required until an autocorrelation function falls below a predetermined threshold value and a preliminary time period set and added to the time period; a main measurement step of measuring a main measurement intensity of scattered light during a main measurement time period; and a particle size calculation step of calculating a particle size of a sample. |
| US11598708B2 |
Determine particle size distribution by size exclusion chromatography
A method and an apparatus for characterising a sample comprising particles is disclosed. The method comprises performing a first measurement on the sample using a first particle characterisation technique; flowing the sample from the first particle characterisation technique to a particle separating device; separating the sample with the particle separating device; and performing a second measurement on the separated sample. The apparatus is configured to perform the method, and comprises a measurement system for performing measurements according to a first particle characterisation technique and a particle separating device for separating samples comprising particles. |
| US11598707B1 |
Medical analyzer and coagulation profiler
A medical analyzer and coagulation profiler performs various interrogations on specimens. A motor with reduction gearing moves and a video camera observes the samples, the cartridges or parts thereof. Changes in images are compared and recorded with a central processor that controls a display. Power supply, temperature controller, motor and gearing are mounted in a box which attaches to a smartphone. The smartphone provides the video camera, illumination and central processor that control the movement, temperature and display. The device makes testing simpler for small hospitals, clinics, ambulances, remote locations and individuals and controls a number of parallel or serial devices operating simultaneously or sequentially. A cartridge insertion actuates a circular motion to generate a blood profile based on changes. Change is analyzed with a video camera and processor such as in a smartphone and is plotted to show an amplitude and time. A smartphone provides a specific movement pattern. |
| US11598706B2 |
Devices and methods for determining the density of insulation
The present disclosure relates to devices and methods for determining the density of insulation. For example, one aspect of the disclosure is a device that includes a first unit that includes a sound generator and a second unit that includes a sound sensor and a probe. The probe is configured to be inserted into insulation such that the sound sensor is outside of the insulation and is configured to detect sound that is generated by the sound generator outside of the insulation and transmitted through the insulation and the probe to the sound sensor. The device also includes a control system configured to cause the sound generator to generate the sound and to use the sound detected by the sound sensor to generate output that represents the density of the insulation. |
| US11598698B1 |
Air testing collector
A process for testing an air source by providing a bag to collect a sample of gas. Connecting the filled bag to a collector assembly that has a fraction of the interior volume of the bag. Forcing the air sample from the bag over a media dish inside the collector assembly. Removing the media for further analysis. Both the bag and the collector assembly have one way exhaust valves to prevent over-pressure and allow a limited flow through of the sample. |
| US11598694B2 |
Abnormality diagnosis system for rotary electric machine
The present invention provides an abnormality diagnosis system capable of identifying an abnormality occurrence site in a rotary electric machine by use of output of sensors mounted to a bearing of the rotary electric machine. The abnormality diagnosis system includes: a rotary electric machine that has a main shaft secured to a center of a rotor and supported by a bearing; a vibration sensor that measures a vibration value of the bearing; a speed sensor that measures a rotational speed value of the main shaft; and an abnormality diagnosis apparatus that diagnoses abnormality in the rotary electric machine based on the vibration value and the rotational speed value. The abnormality diagnosis apparatus includes: a database that records the vibration value, the rotational speed value, and measurement times of the vibration value and the rotational speed value, as a data group of one unit, the vibration value and the rotational speed value measured within a predetermined time period; and an abnormality determination section that makes determination of abnormality, if a first threshold is exceeded by a difference in maximum vibration value in one speed range of interest between a past data group and a newer data group of a plurality of data groups recorded in the database, and makes no determination of abnormality, even if the first threshold is exceeded by a difference in maximum vibration value outside the speed range of interest. |
| US11598683B2 |
Hydraulic braking device to be placed on test benches for industrial screwdrivers and relevant test bench
A hydraulic braking device for testing industrial screwdrivers is arranged on a braking simulation bench, the braking device being controlled by an actuator and by a hydraulic control circuit which supplies pressure to the device on the basis of the indications of an electronic elaboration unit of the bench. Such a braking device is provided with coupling means for the screwdriver to be subjected to test and measurement transducers controlled by a processing unit, suitable for measuring the torque exerted by the screwdriver and the rotation angle, and such a device includes a memory which can be read and/or written by the bench electronic elaboration unit. |
| US11598682B2 |
Sensor device and method for monitoring a clamping force exerted by a clamping element of a clamping device on a component
A sensor device (16a-16d) is provided for monitoring a clamping force (F) exerted by a clamping element (11a-11d) of a clamping device (12a-12d) on a component (14), with at least one strain gauge (30a-30d), which can be arranged on a surface (90, 91) of the clamping element (11a-11d) of the clamping device (12a-12d) and is deformable under the clamping force (F), a transmission module unit (36) based on electromagnetic transmission technology connected to the at least one strain gauge (30a-30d) for detecting a voltage (U5) that is indicative of a deformation (f) of the at least one strain gauge (30a-30d), and an antenna element (38) connected to the transmission module unit (36) for transmitting a signal that is indicative of the detected voltage (U5), and for receiving electromagnetic energy for electrical supply of the transmission module unit (36) and at least one strain gauge (30a-30d). |
| US11598681B2 |
Sensor with time-sharing regional shielding function, electronic skin and robot
The present application relates to a sensor with a time-sharing regional shielding function and a robot. The sensor comprises a plurality of sensor units, each of which comprises regions contained in four multifunctional layers. Four parallel-plate capacitors are contained in the multifunctional layers. The multifunctional layers realize the regional shielding function through the time-sharing switching of analog switches and the control of a bus. |
| US11598679B2 |
Temperature measuring device using optical fiber Bragg grating sensor
A temperature measuring device using an optical fiber Bragg grating sensor is proposed, which includes: an optical fiber wound one or more times on a ring part, which has a preset diameter by rotating a part of the optical fiber once, thereby maintaining a predetermined shape; a housing in which the optical fiber is arranged; and an optical fiber Bragg grating sensor provided in a straight line part of the optical fiber, and thus the present invention prevents deformation of the optical fiber and the optical fiber Bragg grating sensor, which are arranged to be spaced apart at a predetermined distance in the housing, even when deformation occurs in the housing according to a change in the outside temperature, thereby accurately measuring temperature without distortion. |
| US11598678B1 |
Distributed temperature sensor with shortened sensing regions
A distributed temperature sensor system has a pulsed laser coupled to a circulator, the circulator having a laser input and coupling energy to an optical reference coil in series with a measurement fiber having loops or helical turns, the circulator having a backscatter signal port coupling backscattered reflections from the measurement fiber. The backscatter signal port is coupled to a switch and mux, the switch and mux selecting either an anti-Stokes filter or a Stokes filter, the output of the mux coupled to a photodetector, the photodetector coupled to a histogram processor synchronized to the pulsed laser enable. The histogram processor uses the anti-Stokes and Stokes histogram counts associated with a sensor region to estimate a temperature of that sensor region. |
| US11598677B2 |
Tracking system and marker device to be tracked by the tracking system
A tracking system for tracking a marker device for being attached to a medical device is provided, whereby the marker device includes a sensing unit comprising a magnetic object which may be excited by an external magnetic or electromagnetic excitation field into a mechanical oscillation of the magnetic object, and the tracking system comprises a field generator for generating a predetermined magnetic or electromagnetic excitation field for inducing mechanical oscillations of the magnetic object, a transducer for transducing a magnetic or electromagnetic field generated by the induced mechanical oscillations of the magnetic object into one or more electrical response signals, and a position determination unit for determining the position of the marker device on the basis of the one or more electrical response signals. |
| US11598675B1 |
Cable system comprising in-line sensors
A cable having a sensor for measuring variables comprises an insulation displacement contact (IDC) that is at least partially enclosed within a sensor housing having the sensor disposed therein. The IDC comprises one or more IDC sheath prongs that extend through an insulating sheath to the conducting wire of the cable. The IDC continuously extends from an IDC longitudinal first end to an IDC longitudinal second end. The sensor housing comprises a first housing side and a second housing side. When the IDC is at least partially enclosed by the sensor housing, a first housing side longitudinal first end and a second housing side longitudinal first end are proximate the IDC longitudinal first end, and a first housing side longitudinal second end and a second housing side longitudinal second end are proximate the IDC longitudinal second end. |
| US11598668B2 |
Method and apparatus for monitoring a spectral radiometer
The invention relates to a method for monitoring a spectroradiometer (4), in particular for measuring light-emitting test objects (1), in which the spectral data of the test objects (1) are captured by means of an optical system, wherein the radiometric, photometric and/or colorimetric quantities of the test objects (1) are ascertained from the spectral data. The problem addressed by the invention is that of specifying a method for monitoring a spectroradiometer (4), where it is not the continuous recalibration of the spectroradiometer (4) but the monitoring of when a calibration is necessary that is paramount. The invention solves this problem by virtue of changes in the wavelength scale, in the light throughput and/or in the spectral sensitivity of the spectroradiometer (4) being detected by way of a reference light source (5), integrated into the optical system, with a defined spectrum. Optionally, at least one detector integrated into the optical system can additionally monitor the stability of the reference light source (5). Moreover, the invention relates to a device for carrying out the method. |
| US11598667B2 |
Compact multi-band optical measuring unit
In an embodiment a measuring unit includes a light emitting LED component including a housing occupying a housing surface G and an LED chip located within the housing, the LED chip including a light emitting light surface L and being configured to emit light; a photodetector configured to detect reflected light reflected from a measured object originating from the LED component and output a measurement signal dependent on a detection of the reflected light; and an integrated circuit configured to evaluate the measurement signal, wherein the LED component, the photodetector, and the integrated circuit are combined into an integrated unit; and a conversion layer disposed in the housing and located above the LED chip, the conversion layer configured to convert the light into multiband light, wherein a ratio L/G of is greater than or equal to 0.8, and wherein the measuring unit is configured to optically measure at least one property of the measured object. |
| US11598664B2 |
Injector pressure calibration system and method
A calibration system for calibrating a pressure output of a fluid injector having a housing configured for connecting to the fluid injector; a drive member engagement portion configured for contacting a drive member of the fluid injector; a compressible member, which may have a known modulus of compression, connected at its proximal end to the drive member engagement portion, wherein the compressible member is compressed with movement of the drive member of the fluid injector between a first, uncompressed position and a second, at least partially compressed position of the fluid injector in a distal direction; and a sensor connected to the compressible member is described. The sensor is configured for measuring at least one of a force imparted by the drive member and a displacement of the drive member when the compressible member is in the second, at least partially compressed position. The system may generate a calibration curve for the drive member of the fluid injector and allow the generation of a fault condition. Methods for calibrating a fluid injector are also described. |
| US11598663B2 |
Transducer for non-invasive measurement
A transducer for non-invasive measurement includes: a shear-type piezoelectric element; and a host material. The shear-type piezoelectric element is mounted to a first face of the host material. A second face of the host material is mountable to a wall of a vessel that holds a liquid. When the second face of the host material is mounted to the wall of the vessel, the transducer when activated at an activation frequency launches a Lamb wave into the wall of the vessel. The transducer is designed such that a phase velocity of the Lamb wave in the wall of the vessel is greater than a speed of sound in the liquid held by the vessel. |
| US11598660B2 |
Powder dispensing fixture
A fixture for dispensing a powder is disclosed. The fixture has a base and a beam with a first end, a second end, and a fulcrum disposed between the first and second ends and coupled to the base. The fixture also has a load transfer beam having a first end and a second end that is fixedly coupled to the base. A force sensor is coupled to the load transfer beam. The beam can rotate about the fulcrum with respect to the base and the second end of the beam makes a point contact with the first end of the load transfer beam. |
| US11598659B2 |
Sonic anemometer
Techniques are described herein for displacing liquid away from a signal path of sonic signals in a signal anemometer. A sonic anemometer may include a membrane positioned between a sonic transducer and the open environment. The membrane may be formed of a hydrophobic material that repels the liquid. The membrane may also include a plurality of pores that impede the flow of liquid through the membrane but enables sonic signals to pass through the membrane. The sonic anemometer may also include a reflector that displaces liquid away from the signal path of the sonic anemometer. The reflector may include one or more pores that wick liquid away from the signal path. |
| US11598658B2 |
Flow sensor system including spring contacts
A flow sensor sub-assembly for sensing flow of a fluidic medicament is disclosed. The flow sensor sub-assembly includes a first spring contact and a second spring contact. The spring contacts are secured to a base that has a circuit for conducting an electrical signal to and from the spring contacts to a microprocessor. The first spring contact is in electrical communication with a first piezo element and the second spring contact is in electrical communication with a second piezo element. The first spring contact has a first contact force against the first piezo element and the second spring contact has a second contact force against the second piezo element, and the first and second contact forces are equivalent. A circuit board for interfacing to a flow sensor having a plurality of piezo elements for transmitting a flow signal indicative of flow of fluidic medicament is also disclosed. |
| US11598653B2 |
Rotational angle detection apparatus and rotating machine apparatus
A rotational angle detection apparatus is provided with a magnet disposed so as to be rotatable integrally with an axis of rotation, having a substantially circular shape when viewed along the axis of rotation, and including a magnetization vector component in a direction orthogonal to the axis of rotation; a magnetic sensor that outputs a sensor signal on the basis of change in a magnetic field accompanying rotation of the magnet; and a rotational angle detector that detects a rotational angle of the rotating body on the basis of the sensor signal output by the magnetic sensor; wherein the magnet has a curved inclined surface with a concave shape along the axis of rotation from a prescribed position on the outer side in a radial direction toward the axis of rotation, and when a circular virtual plane orthogonal to the axis of rotation and centered at the axis of rotation is established at a position opposed to the curved inclined surface, the magnetic sensor is disposed at a position at which the amplitudes of a magnetic field intensity Hr in a radial direction and a magnetic field intensity Hθ in a circumferential direction on the virtual plane are substantially the same, and the magnetic field intensities Hr and Hθ in the radial direction and/or the circumferential direction is output as the sensor signal. |
| US11598652B2 |
Monitoring of distributed power harvesting systems using DC power sources
A system includes a central analysis station and a display. The central analysis station may be configured to receive a unique identifier and performance data from each of a plurality of solar panels. The central analysis station may detect a problem in at least one of the plurality of solar panels based on the performance data. A display may be configured to display a status of the at least one of the plurality of solar panels based on the detected problem. |
| US11598646B2 |
Apparatus and method for providing traffic information
An apparatus and a method for providing traffic information are provided. The apparatus includes a traffic data database (DB) that stores traffic data and a processor connected to the traffic data DB. The processor generates a prediction model to predict a traffic flow and determines an appropriate data input range for a target time point in the future using the prediction model. Additionally, the processor extracts past traffic data from the traffic data DB based on the determined appropriate data input range, predicts a traffic flow at the target time point based on the extracted past traffic data and provides the predicted traffic flow as traffic information. |
| US11598644B1 |
Wearable electronic navigation system
The methods and systems disclosed herein provide a server that periodically monitors a user's location using one or more beacons while periodically monitoring hazardous conditions using a variety of electronic sensors, such as thermographic imaging. When the user is within a predetermined proximity of a hazardous condition the server transmits an instruction to an electronic wearable device to present a notification (e.g., haptic, noise, and the like) warning the user of the hazardous condition. |
| US11598639B2 |
System for offsite navigation
A navigation service generates a route for navigating from a route origin to a route destination using a private roads repository. A ghost road is along the route, and a ghost origin and a ghost destination of the ghost road is identified. Using an application programming interface of a base roads engine, a request for a route is sent from the ghost origin to the ghost destination. From the base roads engine and in response to the request, a replacement section from the ghost origin to the ghost destination is received. The ghost road is replaced with the replacement section to create an updated route, which is presented. |
| US11598636B2 |
Location information display device and surveying system
A head-mounted display device has more convenient functions, which is usable in, e.g., surveying. An eyeglass display device includes a display unit and an operation content receiving unit. The display unit is configured to be placed on the head of a user and to be viewed by the user. The operation content receiving unit receives content of operation performed by the user. The display unit displays an image that shows a location relationship between positioning information of a target positioned by a location measuring device by using laser light and a predetermined placement planned location of the target. Multiple coordinate systems are prepared for a coordinate system of the displayed image. The operation content receiving unit receives designation of one coordinate system from among the multiple coordinate systems by the user. |
| US11598635B2 |
Magnet mounting and retention system for tool
A tool, such as a level, with magnets embedded in a working surface is provided. For example, the magnets assist in coupling the level to magnetic workpieces. The magnets are placed in a chamber with a floor having a periphery and internal walls extending from the floor periphery. Flanges extend from internal wall of the chamber toward a central axis or point and partially further define the chamber volume. Flanges may be created by depressing surface of the level near the chamber, thus deforming the level body surface to create a channel and a flange from the material displaced from the channel. |
| US11598624B2 |
Feeding device of hole inspection device
According to one implementation, a feeding device of a hole inspection device having a probe includes an attaching jig, a movement mechanism, and a positioning jig. The probe is inserted into a hole to be inspected of an object in a central axis direction of the hole, for inspecting the hole. The attaching jig attaches the hole inspection device to the feeding device. The movement mechanism linearly reciprocates the hole inspection device together with the attaching jig. The positioning jig positions the movement mechanism to the object. A moving direction of the attaching jig and the hole inspection device is made parallel to the central axis direction of the hole by positioning the movement mechanism. |
| US11598618B1 |
Time delay systems, methods, and devices
A damper system for a pyrotechnic time delay may comprise: a firing pin; a moveable housing defining a chamber therein; a fixed piston comprising a piston head disposed in the chamber, a first rod extending from the piston head axially outward of the moveable housing, and a second rod configured to fixedly couple to a housing; a first spring extending axially from the moveable housing to the firing pin; and a second spring extending axially from the moveable housing to the firing pin. |
| US11598610B2 |
Mounting device for a telescopic sight on a hunting or sports weapon with at least one resilient stay bolt
A mounting device for the detachable mounting of a telescopic sight on a weapon consisting of a weapon-side base rail and a telescopic sight-side mounting rail connected thereto via at least one locking element wherein at least one clamping force acting perpendicularly to the surface of the two rails can be generated by actuating the locking element resulting in a positive and non-positive connection between the two rails wherein a clamping shaft of the locking element is held rotatably in the one rail and supports at least one wedge recess which, during rotating actuation of the locking element can be brought into non-positive engagement with a recess of a stay bolt which is arranged on the opposite rail, wherein the locking element during clamping or locking between the weapon-side base rail and the mounting rail mounted positively thereon, additionally generates a displacement force acting in the axial direction (longitudinal direction) of the two rails wherein further the stay bolt is mounted in a spring-loaded manner in a rail-side guide part in an axially displaceable manner. |
| US11598608B2 |
Encoded signal detection and display
A target marking system includes a light source emitting a thermal beam having a predetermined temporal modulation, and an optics assembly directing the thermal beam to impact a target, the target directing radiation to the optics assembly in response to the impact. A portion of the radiation having the predetermined temporal modulation. The target marking system further includes a detector configured to distinguish the portion of the radiation having the predetermined temporal modulation from a remainder of the radiation, the portion of the radiation passing to the director through the optics assembly. The system also includes a readout integrated circuit, the detector directing an input signal to the readout integrated circuit, and the readout integrated circuit producing a digitally enhanced output signal in response to receipt of the input signal. |
| US11598605B2 |
Stabilizing grip for shooting device
In some embodiments, a grip for a shooting device comprises a first body portion configured for attachment to the shooting device and a second body portion engaged with the first body portion. The second body portion is moveable with respect to the first body portion between first and second positions. A biasing member is arranged to bias the second body portion to the first position. In some embodiments, the second body portion comprises a guard defining a guard cavity and at least a portion of the first body portion is oriented in the guard cavity. |
| US11598593B2 |
Fractal heat transfer device
A heat sink comprising a heat exchange device having a plurality of heat exchange elements each having a surface boundary with respect to a heat transfer fluid, having a fractal variation therebetween, wherein the heat transfer fluid is induced to flow with respect to the plurality of fractally varying heat exchange elements such that flow-induced vortices are generated at non-corresponding locations of the plurality of fractally varying heat exchange elements, resulting in a reduced resonance as compared to a corresponding heat exchange device having a plurality of heat exchange elements that produce flow-induced vortices at corresponding locations on the plurality of heat exchange elements. |
| US11598591B2 |
Heat exchanger and method for manufacturing a heat exchanger core with manifold
The invention relates to a heat exchanger comprising first fluid inlets, first fluid outlets, second fluid inlets and second fluid outlets. Each of the first fluid inlets, the first fluid outlets, the second fluid inlets and the second fluid outlets are arranged on four different sides of a heat exchanger core. A manifold covers one of the four different sides of the heat exchanger core, wherein a first sidewall of the manifold is arranged at an angle smaller than 90 degree to the one side of the heat exchanger core which is covered by the manifold. An edge of the heat exchanger core between the one side of the heat exchanger core which is covered by the manifold and a neighbouring side of the four different sides of the heat exchanger core forms a common weld line with a connecting edge of the first sidewall of the manifold. The invention also relates to a method for manufacturing a heat exchanger comprising a heat exchanger core and a manifold. |
| US11598580B2 |
Convection furnace
The present invention relates to a furnace device for heating a plate, in particular a metal plate, by convection. The furnace device has a housing, in which a temperature control region for temperature-controlling a component part and an adjustment region are formed, wherein the adjustment region has a temperature control device for adjusting a temperature of a temperature control fluid. Further, the furnace device has a positioning device for positioning the plate in the temperature control region in a predetermined orientation, and a ventilator, which is arranged in the housing and which is adapted to circulate the temperature control fluid in the housing between the temperature control region and the adjustment region such that the temperature control fluid is flowable in a flow direction along a surface of the plate. |
| US11598566B2 |
Revolving ice maker
An ice maker for freezing water into ice pieces, the ice maker including an elongated cage having a central revolving axis about which the elongated cage revolves. The elongated cage having a first end, a second end and at least one elongated slot extending between the first end and the second end. An ice tray is configured to be received in the at least one elongated slot. The ice tray includes a plurality of cavities for receiving water to be frozen into ice pieces. A motor is coupled to the elongated cage for revolving the elongated cage about the central revolving axis. A controller is connected to the motor for controlling the revolving of the elongated cage about the central revolving axis. |
| US11598564B2 |
Refrigeration system
A refrigeration system includes a main refrigeration circuit for holding refrigerant fluid, the main refrigeration circuit including: a compression device 12, a heat rejecting heat exchanger 14, an expansion device 18 and a heat absorbing heat exchanger 16. In addition, the refrigeration system includes a buffer tank 20 attached to the main refrigeration circuit, with valves 22, 24 for controlling flow of refrigerant fluid between the main refrigeration circuit and the buffer tank 20. The refrigeration system is arranged such that the valves 22, 24 are controlled to transfer refrigerant fluid between the main refrigeration circuit and the buffer tank 20 based on a measure of sub-cooling in the main refrigeration circuit. |
| US11598562B2 |
Compressor with oil equalizing pipe, parallel compressor set, and oil equalizing method
The present disclosure provides a compressor with an oil equalizing pipe, a parallel compressor set, and an oil equalizing method. The compressor includes at least one oil equalizing pipe, an opening at one end of the oil equalizing pipe is formed in a target oil level of an oil sump, and the opening at the other end of the oil equalizing pipe is formed in a suction port; and when the oil level of the oil sump of the compressor is higher than the target oil level, the extra oil enters the suction port through the oil equalizing pipe. Compared with the prior art, the present disclosure has the advantages that, when the compressor is running, the gas in the suction port flows, so that the pressure at the suction port is less than the pressure on the surface of the oil sump; when the oil level of the oil sump of the compressor is higher than the target oil level, the extra oil enters the suction port through the oil equalizing pipe under the action of the above pressure difference, a part of the oil enters vortex and is discharged from the compressor via the exhaust port, and the oil discharged from the compressor returns to the other compressor lack of oil through a pipeline, thereby achieving oil balance between different compressors. |
| US11598560B2 |
Refrigerant cycle apparatus
A refrigerant cycle apparatus, that circulates a flammable refrigerant in a refrigerant circuit, includes: a gas-side cutoff valve; a liquid-side cutoff valve, where the gas-side cutoff valve and the liquid-side cutoff valve are disposed on opposite sides of a first portion of the refrigerant circuit; a detection unit that detects refrigerant leakage from the first portion into a predetermined space; and a control unit that sets a cutoff state in the gas-side cutoff valve and the liquid-side cutoff valve when the detection unit detects the refrigerant leakage from the first portion into the predetermined space. The cutoff leakage rate at the gas-side cutoff valve is higher than the cutoff leakage rate at the liquid-side cutoff valve. |
| US11598559B2 |
Heat source-side unit and refrigeration apparatus
A heat source-side unit (10) includes a heat source-side circuit (11). The heat source-side circuit (11) includes a compression unit (20) including a lower-stage compression element (23) and a higher-stage compression element (21), an intermediate heat exchanger (17) disposed on a refrigerant path between the lower-stage compression element (23) and the higher-stage compression element (21), and a bypass passage (23c) connected to a suction pipe (23a) and a discharge pipe (23b) each connected to the lower-stage compression element (23). At startup of the compression unit (20), a first action is performed for stopping the lower-stage compression element (23) and operating the higher-stage compression element (21). This configuration thus suppresses occurrence of liquid compression at startup of a compressor. |
| US11598552B2 |
Standoff regulator
A standoff comprising a handle that is adjustably associated with a bracket, with the handle self-latching in relation to bracket at a desired position and at a desired quantifiable torque in relation to the bracket. |
| US11598551B2 |
Air grille for an HVAC system with a collapsible filter holder
The present disclosure envisages an air grille. The air grille comprises a front face and a duct face end. The duct face end is in the opposite of the front face. A plurality of flaps are configured on the duct face end, wherein the flaps are capable of collapsing. During shipping the flaps are collapsed whereas before installation the flaps are uncollapsed to facilitate containment of an air filter. The air grille has first thickness when the flaps are collapsed and second thickness when the flaps are uncollapsed, wherein the first thickness is less than the second thickness. |
| US11598550B2 |
Heat pipe thermal transfer loop with pumped return conduit
A heat pipe system including a heat pipe having a first end and a second end for transferring working fluid from the first to the second end, a first reservoir in fluid communication with the first end for holding working fluid in liquid form, a first heat exchanger for transmitting thermal energy from a heat source to working fluid in the first reservoir to vaporize the fluid, a second heat exchanger for transmitting thermal energy from vaporized working fluid to a heat sink thereby condensing the fluid, a return conduit and a pump for pumping the condensed working fluid along the return conduit, where the heat pipe, the return conduit and the first reservoir form a hermetically sealed circuit. A method of transferring thermal energy using a heat pipe system is also disclosed. |
| US11598549B2 |
Thermal cycling system and control method of the thermal cycling system
A heat cycle system and a control method. The heat cycle system includes: driving devices, one or a plurality of outdoor units, and a plurality of indoor units, which are connected by pipelines; a bypass pipeline for the plurality of indoor units, a bypass valve being disposed in the bypass pipeline; a pressure sensor that senses a pressure difference ΔPo across the plurality of outdoor units; and a controller that is preset with a pressure difference set value ΔPset, wherein the controller calculates a pressure offset parameter ΔP=ΔPo−ΔPset and adjusts an opening degree of the bypass valve based on the pressure offset parameter ΔP so that the pressure offset parameter ΔP approaches zero, and wherein the controller is preset with a first pressure offset threshold P1, and the controller is configured such that closed indoor units enter a bypass mode one by one when ΔP>P1, until ΔP≤P1. |
| US11598545B2 |
Time-based and sound-based prognostics for restrictions within a heating, ventilation, and air conditioning system
A device is configured to operate a Heating, Ventilation, and Air Conditioning (HVAC) system. The device is further configured to determine that the amount of time to close a pressure switch exceeds a time threshold value. The device is further configured to receive an audio signal from a microphone while operating the HVAC system, to identify an audio signature for the combustion air inducer, and to determine the audio signature for the combustion air inducer is present within the audio signal. The device is further configured to determine a fault type based on the determination that the audio signature for the combustion air inducer is present within the audio signal, to identify a component identifier for a component of the HVAC system that is associated with fault type, and to output a recommendation identifying the component identifier. |
| US11598543B2 |
Sensor device and secured wireless communication protocol for air quality sensor devices
A sensor device comprises a radio circuit; air-quality detectors; a microcontroller; a building management system (BMS) integration module, the BMS integration module including a transceiver distinct from the radio circuit and a co processor distinct from the microcontroller; and a memory that configures the sensor device to: transmit, during a first time period, a wake-up signal, wherein the wake-up signal includes at least a packet number; send, during a second time period, an acknowledgment (ACK) signal, wherein the ACK signal is sent in reference to a synchronized time slot and a packet number; transmit, during a third time period, at least sensor reading data of least one air quality detector, wherein the sensor reading data is encrypted using at least an encryption key stored in the memory; receive, during a fourth time period, a sleep signal; and enter into a sleep mode upon receipt of the sleep signal. |
| US11598541B2 |
Powerless humidification module for air cleaner capable of preventing leakage of water
Disclosed is a powerless humidification module for an air cleaner which is capable of preventing leakage of water into the air cleaner. A powerless humidification module for an air cleaner which is detachably mounted on an upper portion of a body of the air cleaner and is capable of preventing leakage of water includes a base cover having a first opening opened toward the air cleaner and a second opening opened toward a side surface of the first opening, a cistern part located in the interior of the base cover and located such that a space defined between an inner partition wall and an outer partition wall having predetermined heights such that water supplied to one side thereof is stored surrounds a periphery of the first opening whereby water supplied to one side thereof is stored, and a humidification filter located in the second opening. |
| US11598540B2 |
Apparatus and method for improving air quality in street canyons
A double skin façade (DSF) for a building is disclosed. The DSF has a first façade, a second façade, and a gap extending therebetween. Movement of air is driven in an upward direction toward an upper end of the DSF, causing movement of air contaminants from a lower end of the DSF to the upper end of the DSF, and thereby enhancing the air quality of the street canyon by removing air contaminants from a street level adjacent the building. Also disclosed is a building having a DSF, and a method of enhancing air quality in a street canyon by constructing a DSF on a building. |
| US11598539B2 |
Air moving device with bypass intake
An air moving device has a housing with a primary flow path and a secondary flow path that extends from a secondary inlet of the housing and empties into an inner outlet adjacent the primary flow path. An impeller assembly rotates a blade to cause air to enter the housing and flow along the primary flow path. The flow of air through the primary flow path creates a low pressure region at the inner outlet of the secondary flow path, causing air to flow through the secondary flow path and mix with the air in the primary flow path. The mixture of air flows through a downstream portion of the primary flow path having an expanded width compared to an upstream portion of the primary flow path and exits the housing. Stator vanes may extend longitudinally within the housing to cause columnar air flow. The device may be used for destratification of thermal gradients of air within an enclosure, such as a home or warehouse. |
| US11598535B2 |
Humidity control unit and method
In a method and apparatus for conditioning air for an enclosure, a first ambient airstream is cooled by a cooling coil of a refrigerant cooling system to reduce temperature and humidity, passed through a segment of a rotating desiccant wheel to reduce moisture content and increase temperature, and then supplied to the enclosure. The desiccant wheel is regenerated by a second ambient airstream heated with a condenser coil of the refrigerant system and then passed through a regeneration segment of the desiccant wheel. A bypass plenum allows a third ambient airstream to be selectively heated and cooled independent of the evaporator coil and desiccant wheel in the first plenum. Heated air bypassed from the second ambient airstream or an independent heater can perform the selective heating in the bypass plenum. The airstream in the bypass plenum is then supplied with the air treated in the first plenum to the enclosure. |
| US11598530B2 |
Cooktop appliance and heating element having a thermostat
A cooktop appliance and heating element, as provided herein may define a heating zone having a thermostat positioned therein. The thermostat may include a base, a bimetallic disk, and a conductive spring. The base may extend axially between a first end and a second end. The bimetallic disk may be disposed within the base. The conductive spring may be disposed within the base in biased engagement with the bimetallic disk to motivate the bimetallic disk towards the first end within the base. The conductive spring may include a first layer and a second layer. The first layer may extend from a contact end proximal to the bimetallic disk to a joinder end connected to the first terminal. The second layer may extend from a biasing end proximal to the bimetallic disk to a secured end fixed within the base. |
| US11598527B2 |
Reducing noise from a combustor of a gas turbine engine
A method of reducing noise from a combustor of a gas turbine engine includes the steps of establishing a maximum noise limit that may be for a particular frequency range. A primary fuel flow percentage, which may be emitted from a fuel nozzle arrangement having various groupings of simplex and duplex nozzles, is then established. An immersion depth measured between an aft rim of a swirler and a distal tip of the fuel nozzles may then be reduced thereby reducing the noise amplitude. |
| US11598521B2 |
Method and device for automatically adapting a flame to variable operating conditions
Process for combusting a fuel with an oxidant and burner for the implementation thereof, process wherein at least one stream of the fuel is injected through at least one first perforation, a main flow of oxidant is injected below or above the one or more streams of the fuel through at least one second perforation, an auxiliary flow of the oxidant is introduced into contact with the at least one fuel stream so as to generate an initial flame by an initial partial combustion of the fuel with the auxiliary flow of the oxidant, this initial partial combustion being completed downstream of the initial flame by means of the at least one main stream of the oxidant, the flow rate of the main flow of the oxidant or the ratio between the flow rate of the main flow of the oxidant and the flow rate of the auxiliary flow of the oxidant being adjusted depending on the emission intensity of the initial flame. |
| US11598517B2 |
Electronic module group
An electronic module group can include an electronic module including a first housing defining a housing cavity; a power supply driving module positioned within the housing cavity; and a first concentric terminal connected in electrical communication with the power supply driving module by a first wire and a second wire; and a second concentric terminal rotatably connected in electrical communication with the first concentric terminal, the second concentric terminal configured to transmit power to the first concentric terminal. |
| US11598516B1 |
Folding grow light
A folding grow light has a main body with a main body housing. A driver is installed to the main body. The folding grow light has a right folding arm and a left folding arm. The right folding arm holds at least three linear arrays of LED lights perpendicular to the right folding arm. The left folding arm holds at least three linear arrays of LED lights perpendicular to the left folding arm. A right front main joint and a right rear main joint connect the main body to the right folding arm. The right folding arm rotates from a first position that is folded in a vertical orientation to a second position that is unfolded in a horizontal orientation. |
| US11598514B2 |
Downlight apparatus
A downlight apparatus includes a base housing, a light module and a rotation shaft. The base housing has an inner hemisphere surface. The light module has an exterior hemisphere surface. The light module has a light source emitting a light. The rotation shaft has a first end fixed to the light module. The base housing has a shaft hole for the rotation shaft to pass through and rotate in the shaft hole. The rotation shaft has a second end attached to the base housing. A rotation axis of the rotation shaft is aligned with a radial direction of the exterior hemisphere surface for changing a light direction of the light by rotating the light module along the rotation shaft. |
| US11598512B1 |
Domestic appliance and light assembly
An appliance or light assembly may include a bulb bracket within which a light bulb is receivable and a wall panel. The bulb bracket may include a cylindrical base defining a base radius and a plurality of resilient tabs. The plurality of resilient tabs may be selectively deflectable inward. The wall panel may define an assembly aperture. The assembly aperture may include a plurality of arc segments and a plurality of expanded notches. The plurality of arc segments may be spaced apart from an aperture axis. The plurality of expanded notches may be circumferentially spaced apart by the plurality of arc segments. The plurality of expanded notches may extend outward from the plurality of arc segments. Each expanded notch may define an angular distance. Each expanded notch may include a curved segment and a blunt segment. |
| US11598510B2 |
Collar for a recessed light fitting
The present disclosures provides a collar for positioning at least partially around a recessed light fitting and between the recessed light fitting and a structural body. The collar comprises a plurality of collar portions each of which are configured to surround a portion of the recessed light fitting. |
| US11598507B2 |
High intensity light-emitting diode luminaire assembly
A lighting assembly that includes a heatsink housing, a plurality of light emitting diode (LED) modules, and a power supply disposed within a power supply casing, wherein the power supply is for providing power to the LED modules. Each LED module includes a plurality of LEDs and is thermally connected to the heatsink housing. The power supply casing includes a structure for cooling the power supply. |
| US11598504B2 |
LED optics system
A LED-based lighting assembly uses minimized distance between an LED source and a diffuser to reduce form factor size, and convex optics, elliptical diffusion and lateral recycling to produce from mini- or micro-chip LEDs a uniform geometrical shape for lit-pixel display of information at high definition. A less than one-to-one (1:1) ratio of LED chip distance and vertical distance between chip and diffuser is achieved with desired uniformity of lit-pixel displays. Reduced distance between diffuser and LEDs and an improved optic provide for more dense yet compact configuration of LEDs in lighting components of automobile grilles and emblems and other lit branding or safety devices in commercial and residential applications. |
| US11598503B1 |
Multi-directional adjustable solar outdoor projection light
A multi-directional adjustable solar outdoor projection light capable of adjusting its lighting range, angle and sensing direction includes a support assembly, and a key light, and a solar power module which are pivoted to the top of the support assembly. Both sides of the key light are pivoted with a fill light capable of adjusting the angles of elevation and depression and the front and rear directions of a projected light relative to the key light, and the support assembly is pivoted is an axially rotatable sensor, thus improving the convenience of use and expanding the lighting range of the solar outdoor projection light. |
| US11598502B1 |
Lamp platform assembly
A lamp platform assembly for emitting at least one light beam in various patterns, directions or orientations may include multi-positional support platform. At least one lamp unit may be carried by the support platform. Each lamp unit may be selectively positional to direct an emitted light beam in a selected direction or orientation. At least one electrical system may electrically interface with the at least one lamp unit. The at least one electrical system may be configured to provide electrical power to the at least one lamp unit. |
| US11598499B1 |
LED strip lamp having removable power supply module
A strip lamp includes an illuminating lamp and a power supply module. The illuminating lamp includes a lamp body, a light guide plate, a control panel, an LED lamp panel and a PCBA mainboard. The LED lamp panel and the PCBA mainboard are installed in the lamp body. The light guide plate is disposed over the lamp body and is located on a light emitting side of the LED lamp panel. The PCBA mainboard is provided with a first interface at an end of the lamp body. An opening matched with the first interface is formed in a position, closed to the first interface, of the lamp body. The charging PCB is provided with a second interface extending out of a connector of the power supply module. The independent rechargeable power supply module is used to supply power to the illuminating lamp. |
| US11598497B2 |
Light string
A light string is provided. The light string includes a plurality of light-emitting components, a first polyvinyl chloride covered wire and a second polyvinyl chloride covered wire. The light-emitting components are configured to emit light having a same color or different colors. A first polyvinyl chloride covered wire is electrically connected to a first terminal of each of the light-emitting components and a first power terminal of a power supply component. The first polyvinyl chloride covered wire receives a first voltage from the first power terminal of the power supply component. The second polyvinyl chloride covered wire is electrically connected to a second terminal of each of the light-emitting components and a second power terminal of the power supply component. The second polyvinyl chloride covered wire receives a second voltage from the second power terminal of the power supply component. |
| US11598494B2 |
Illuminated panel
The disclosure relates in general to illuminated panels resembling windows, and more particularly, to a system containing a light source, a diffuser and a panel combined in such a fashion as to resemble a window, skylight or curtain wall. |
| US11598489B2 |
Light bulb apparatus
A light bulb apparatus includes a bulb shell, an antenna, a driver, a light source plate and a bulb cap. The light source plate has a first layer and a second layer. The LED module is disposed on the first layer. The second layer includes a metal portion. The metal portion carries heat generated by the LED module for heat dissipation. The antenna is disposed upon the first layer. A bulb cap is connected to an external power. The driver is electrically connected to the antenna for receiving a wireless signal. The driver converts the external power to a driving current supplied to the LED module. |
| US11598486B2 |
Hydrogen discharge system for a truck and truck comprising such system
Hydrogen discharge system for a truck and truck comprising such system The invention concerns a hydrogen discharge system (14) for a truck, this system comprising a pipe (16) provided with at least one discharge opening (162), a deflector (18), that is rotatably mounted with respect to the pipe and that includes a vent, for venting hydrogen exiting through the discharge opening. The system further includes a balancing weight (22) secured to the deflector (18), so as to maintain the deflector in a configuration wherein the vent is facing upwards with respect to the ground, in order to always discharge hydrogen upwards relative to the ground. |
| US11598485B2 |
LH2 offloading with auto-purge and pre-cooling
A computer-controlled method of automatically purging and precooling a hydrogen fuel line prior to transferring hydrogen fuel from a source to a storage tank includes purging moisture from a hydrogen fuel line. The hydrogen fuel line is configured to fluidically couple a hydrogen tanker storage tank and a fueling station storage tank, the hydrogen storage tanker storage tank and the fueling station storage tank configured to store liquid hydrogen. The method also includes pre-cooling the hydrogen fuel line, causing hydrogen fuel to flow through the hydrogen fuel line to re-fill the fueling station storage tank, and expelling residual hydrogen fuel from the hydrogen fuel line when the fueling station storage tank re-filling is complete. |
| US11598478B2 |
Component rack for a display
The present disclosure describes a component rack for, e.g., electronic devices. The component rack includes an upper rail; a lower rail, the upper rail and the lower rail extending relative to a first axis; at least one end cap coupled to an end of the upper rail and the lower rail; wherein the at least one end cap comprises a first panel slidably couplable to a second panel and movable along a second axis between a collapsed position and an extended position, the second axis extending transversely to the first axis. |
| US11598476B2 |
Vacuum adiabatic body and refrigerator
A vacuum adiabatic body includes a heat exchange pipeline and a sealing plug. The heat exchange pipeline includes at least two pipelines which pass through a first plate and a second plate to allow a refrigerant to move between inner and outer spaces. The sealing plug allows the heat exchange pipeline to pass through a first point of the first plate and a second point of the second plate without contacting a third space. |
| US11598475B2 |
Caliper pig for detecting geometrical deformation of a pipeline
A caliper pig for detecting geometrical deformation of a pipeline is disclosed. The caliper pig includes a body and a first sensor arm assembly. The first sensor arm assembly includes a primary caliper sensor ring adapted to be mounted on the body. Further, the first sensor arm assembly includes a plurality of sensor arms adapted circumferentially distributed on the primary caliper sensor ring. Each of the plurality of sensor arms includes a sensing arm adapted to be in contact with an internal surface of the pipeline and a pair of magnets adapted to rotate along the sensing arm. Each of the plurality of sensor arms includes a sensing unit configured to detect a change in magnetic field based on the movement of the sensing arm. The sensing unit is configured to generate an output indicative of an angle of deflection of the sensing arm while traversing on the internal surface of the pipeline. |
| US11598474B2 |
Systems and methods for maintaining pipes
A motorized apparatus for use in maintaining a pipe includes at least one drive portion including a body assembly, a plurality of leg assemblies coupled circumferentially around the body assembly, a plurality of drive mechanisms coupled to the plurality of leg assemblies, and a drive portion coupling mechanism. The motorized apparatus also includes at least one maintenance portion including a body, at least one maintenance device coupled to the body, and a maintenance portion coupling mechanism configured to engage the drive portion coupling mechanism. The at least one drive portion is releasably coupled to the at least one maintenance portion by engaging the drive portion coupling mechanism with the maintenance portion coupling mechanism. The drive portion coupling mechanism and the maintenance portion coupling mechanism are each configured to engage another coupling mechanism when the drive portion coupling mechanism and the maintenance portion coupling mechanism are uncoupled from each other. |
| US11598470B2 |
Dual layer hose with venting port
A hose assembly includes an inner core tube, a metal outer tube, a first coupling member, and a first collar. The first coupling member has an inboard nose portion extending into a first end of the inner core tube. The metal outer tube surrounds the inner core tube and terminates at a first end axially inward of the first end of the inner core tube, with an outer cavity disposed between the inner core tube and the metal outer tube. The first collar has an outboard clamping portion surrounding the nose portion for clamping retention of the first end of the inner core tube therebetween, and an inboard venting portion welded to the first end of the metal outer tube, with the inboard venting portion including a venting port in fluid communication with the outer cavity. |
| US11598465B2 |
Quick connector structure
A quick connector structure includes a fitting connector, a connector, and a U-shaped positioning snap pin. The fitting connector is a pipe connector, a three-way valve connector, or a washing machine valve connector. The fitting connector is combined with a pipe body. The U-shaped positioning snap pin ensures the stability of the connection between the fitting connector and the connector. The quick connector structure enables rapid positioning and assembly, reducing the assembly difficulty in a smaller or concealed space and achieving the effects of assembly stability and convenience. |
| US11598462B2 |
Locking mechanism for tubular body
A locking member is mounted to the housing to be able to move in the outer diameter direction by a tapered portion of the tubular body, when the tubular body is inserted. The housing is equipped with slits formed to pass a curved portion bent in the inner diameter direction disposed at a leading-end side of the locking member and to lock with the engagement portion of the tubular body mounted on the housing. A gap is disposed between the curved portion, and the end portion of the slit positioned at a side in an opposite direction to the leading-end side of the locking member, so that there is no contact while at least the locking member is moving. |
| US11598460B2 |
Multi-lumen hose and connector nipple
A multi-lumen hose connector nipple and a multi-lumen hose equipped therewith. The multi-lumen hose connector nipple includes a nipple basic section through which a plurality of separate fluid conduits extend in each case between a first and a second nipple connector side, a plurality of hose lumen plug-in sockets integral with the nipple basic section, which sockets extend juxtaposed on the first nipple connector side with an intermediate hose lumen wall accommodation space left therebetween, wherein a socket interior space of each of the hose lumen plug-in sockets is assigned to a respective one of the fluid conduits and opens out axially, and a socket strutting structure within the socket interior space of at least one of the hose lumen plug-in sockets. |
| US11598456B1 |
Pipe connection with split swivel ring
A pipe connection swivel joint assembly includes a pipe member having an end flange with a conical proximal surface. A split ring assembly includes a pair of swivel ring halves each having a conical inner surface disposed against the conical proximal surface of the pipe member. The pair of swivel ring halves further include a plurality of mounting holes extending axially through the pair of swivel ring halves and a plurality of ring fastening holes. An outer ring is connected to the pair of swivel ring halves by a plurality of split ring fasteners engaged with the plurality of ring fastening holes. The outer ring supports a pair of distance plates that are disposed between opposing ends of the pair of swivel ring halves. |
| US11598455B2 |
Leak-proof tube fitting assembly structure
A leak-proof tube fitting assembly structure includes a liquid tube, a liquid tube fitting, and a nut for locking and connecting the liquid tube and the liquid tube fitting. The liquid tube fitting has a first connecting end, a first threaded connecting portion and a second connecting end that are axially arranged in sequence in a forward direction. The first threaded connecting portion has a first external thread. Thereby, the sealing performance of the connection of the liquid tube and the liquid tube fitting is improved to prevent leakage. |
| US11598452B2 |
Multilayer tubular structure having better resistance to extraction in biofuel and use thereof
The present invention relates to a multilayer tubular structure (MLT) intended for the transport of fluids, in particular of petrol, especially alcohol-containing petrol, comprising, from the outside inwards, at least one barrier layer (1) and at least one inner layer (2) located below the barrier layer, said inner layer (2), or all the layers (2) and the other optional layers located below the barrier layer, containing on average from 0 to 1.5% by weight of plasticizer relative to the total weight of the composition of the layer (2) or to the total weight of all the compositions of the layers (2) and the other optional layers located below the barrier layer, respectively, said inner layer (2) predominantly comprising at least one polyamide of aliphatic type or consisting of more than 75% of aliphatic units, said aliphatic polyamide being chosen from: a polyamide denoted A, having a mean number of carbon atoms per nitrogen atom, denoted CA, of from 4 to 8.5, advantageously from 4 to 7; a polyamide denoted B, having a mean number of carbon atoms per nitrogen atom, denoted CB, of from 7 to 10, advantageously from 7.5 to 9.5; a polyamide denoted C, having a mean number of carbon atoms per nitrogen atom, denoted CC, of from 9 to 18, advantageously from 10 to 18; with the proviso that when said inner layer (2) comprises at least three polyamides, at least one of said polyamides A, B and C is excluded. |
| US11598451B2 |
Manifold system
A manifold system with a manifold body having a length greater than a width and a height of the manifold body, a top surface with a first groove extending along a length of the manifold body, a bottom surface with a second groove extending along a length of the manifold body, at least one mounting hole extending through one of a first side surface or a second side surface of the manifold body and through one of the first groove or the second groove, a plurality of connection fittings including at least one connection fitting on each of the first and second side surfaces of the manifold body, at least one internal passage way within the manifold body fluidly connecting at least two of the plurality of connection fittings, and at least one fastening element removably engaged within the at least one mounting hole. |
| US11598444B2 |
Device for controlling fluid flow
A device for controlling the flow of a fluid through a conduit from an upstream side of the device to a downstream side of the device is provided. The device includes an upstream valve casing defining an inlet, a downstream valve casing defining an outlet aperture, and a valve core secured between the upstream valve casing and the downstream valve casing. The upstream valve casing, the downstream valve casing and the valve core are formed as discrete parts. The valve core includes a housing defining a control volume. The valve member is mounted on the housing and positioned on the upstream side of the outlet aperture, the valve member being arranged to move reciprocally to selectively open and close the outlet aperture, thereby controlling flow of the fluid through the outlet aperture. |
| US11598434B2 |
Umbrella check valve assembly having retention plate
A check valve assembly includes a first port fitting and a second port fitting with a base secured therebetween. The base has an annular sleeve encircling a seat, the seat having a central mounting hole and one or more flow channels passing therethrough. An umbrella valve includes a flexible sealing disk having an outer surface and an opposing inner surface, a mounting stem extending from the inner surface and projecting into the mounting hole of the base, the sealing disk being movable between a first position wherein at least a portion of the sealing disk sits on the seat so as to cover the one or more flow channels and a second position wherein the sealing disk is resiliently flexed so as to at least partially uncover the one or more flow channels. A retention plate is disposed between first port fitting and the seat of the base so that the retention plate sits against the outer surface of the sealing disk. |
| US11598430B2 |
Valve device, flow rate control method, fluid control device, semiconductor manufacturing method, and semiconductor manufacturing apparatus using the valve device
A valve device capable of precisely adjusting a flow rate includes: an operating member for operating a diaphragm and provided movably between a closed position at which diaphragm closes a flow path and an open position at which diaphragm opens the flow path; a main actuator that receives pressure from a supplied drive fluid and moves the operating member to the open position or the closed position; an adjusting actuator for adjusting the position of the operating member positioned in the open position by using a passive element which expands and contracts in response to a given input signal; a position detecting mechanism for detecting the position of the operating member with respect to a valve body; and an origin position determining unit that uses a valve closed state in which the diaphragm contacts to valve seat to determine an origin position of the position detecting mechanism. |
| US11598429B2 |
Eclipse valve assembly
An eclipse valve includes at least two reciprocating obturator plates captured in a sealed housing. The obturator plates fill the width of a cavity within the housing and can be moved between aligned and unaligned positions. Each of the obturator plates have an opening through the plate, and when the obturator plates are aligned, the openings through the plates are aligned with each other, and with front and rear openings in the housing, allowing flow through the valve. The plates can be moved to reduce the overlap of the openings through the plates within the housing in an eclipse manner to adjust the rate or amount of flow, and to shut off flow by completely un-aligning the openings. |
| US11598427B2 |
Butterfly valve
A butterfly valve includes a body and a gear box cover, the body having a fluid conduit and a gear platform supported on and over the fluid conduit, the gear platform configured to support a gear assembly for actuating a valve disk between an open position and a closed position, the gear box cover defining an internal cavity, the internal cavity sized to house the gear assembly, the gear box cover configured to be removably mounted to the platform such that the internal cavity is between the gear box cover and the platform. |
| US11598425B2 |
Mechanical seal for sealing a fluid-conducting channel and/or space and method for monitoring the wear of a mechanical seal
The disclosure relates to a mechanical seal for sealing a fluid-conducting channel and/or space extending in a stationary component and/or a rotating component from the environment, having a slide ring which is supported in the axial direction against a counter ring in a sealing manner and, to compensate for wear on its front-end seal face or on a counter face, is supported against the counter ring elastically and movably in the axial direction with this seal face;having a position sensor to detect the position of the slide ring in the axial direction. The disclosure is characterized in that a temperature sensor is provided on a leakage side of the seal face facing away from the channel and/or space, which sensor at least indirectly detects a temperature which is dependent on the magnitude of a leakage flow passing from the channel and/or space via the seal face. |
| US11598423B2 |
Dynamic seal
Systems and methods are disclosed that include providing an outer tubular member, an inner tubular member telescopically disposed within the outer tubular member, and an annular seal disposed between the outer tubular member and the inner tubular member, the annular seal being resilient to permit relative movement between the outer tubular member and the inner tubular member, and the annular seal having in a radial cross-section: a first annular leg portion terminating at an end that is radially inward or radially outward, the first annular leg portion comprising a first open loop; and a second annular leg portion extending from the first annular leg portion and terminating at an end that is the other of radially inward or radially outward, the second annular leg portion comprising a second open loop. |
| US11598422B2 |
Face seal fitting having a polyimide sealing component for facilitating a face seal
A face seal fitting operable to join first and second conduits together and to provide a face seal, the face seal fitting comprising a body comprising a fluid passageway, and a coupling portion having an end defining a mating face; a gland comprising a fluid passageway, and an end having a mating face operable to be seated against the mating face of the body; a polyimide sealing component configured to be situated between the body and the gland; and a compression nut fittable over the gland and coupleable to the body, the compression nut being operable, upon torqueing to achieve a threshold compression load, to cause the mating face of the gland to seat against the mating face of the body, and to compress and elastically deform the polyimide sealing component to be flush with the mating faces of the body and the gland to form a face seal. |
| US11598415B2 |
Parking lock
A gearwheel (10), in particular a parking interlock gear, includes an annular body (1). The annular body includes a first toothing (2), arranged on an outer circumference of the annular body, for engaging a locking pawl (20), and a second toothing (3), arranged on an inner circumference of the annular body, for the form-locking connection to a shaft (30). |
| US11598414B2 |
Method of and system for controlling gear shifting in response to change of driving mode
In one aspect, a method of controlling gear shifting in response to a driving mode change, the method including determining a maximum number of allowable low-level gear-shifting steps according to a result of determining a state of a transmission, computing an immediate post-gear-shifting expected speed of a turbine for each step included that is within the maximum number of allowable low-level gear-shifting steps, using a current speed of an output shaft of the transmission and a gear ratio of each step and comparing the computed expected speed of the turbine with a preset allowable speed thereof for each step, setting the lowest-level gear-shifting step, among gear-shifting steps at which the expected speed of the turbine and the allowable speed thereof satisfy a predetermined condition, is set to be a target gear-shifting step, and executing gear-shifting control for shifting a current gear-shifting step down to the target gear-shifting step. |
| US11598413B2 |
Electromechanical gear selection device comprising an actuator
A method for setting a gear in a transmission of a power tool, the power tool including an electric motor as well as a controller for setting the rotational speed of the electric motor. A transmission includes an operating device for selecting a gear in the transmission, a shift fork as well as an actuator, the operating device including a signal transmitter as well as a sensor for receiving a signal of the signal transmitter. The method includes: setting the operating device from a first position to a second position for selecting a gear in the transmission; detecting a signal by the at least one sensor according to the second position of the operating device; transmitting a signal to the controller; setting the rotational speed of the electric motor from a first value to a second value by the controller; positioning the operating device from the second position into a third position; detecting a signal by the sensor according to the third position of the operating device; transmitting a signal to the actuator; and setting the shift fork from a first position to a second position with the aid of the actuator for the purpose of changing from a first gear into a second gear. |
| US11598412B2 |
Spherical mounted cylindrical roller bearing system
A planetary gear system is provided in one example embodiment and may include a planet gear further comprising a bearing system, the bearing system further comprising an inner bearing assembly comprising a spherical bearing and an outer race; an outer bearing assembly comprising a plurality of cylindrical roller bearings, an inner race, and an outer race; and a race element comprising an inner surface and an outer surface, wherein the outer surface of the race element is the inner race for the outer bearing assembly and the inner surface of the race element is associated with the outer race for the inner bearing assembly. |
| US11598410B2 |
Drive device
A drive device includes a first catch tank above a first gear and including a first bent portion bent between the first gear and a second gear, and a second catch tank below the first catch tank and including a second bent portion that is bent downward. A space above the second bent portion communicates with a space above the first bent portion. A third catch tank is above the second gear, and includes a third bent portion that is bent toward between the first gear and the second gear. A space above the third bent portion communicates with the space above the first bent portion. A fourth catch tank is in front of the second gear and above the third gear, and includes a fourth bent portion that is bent downward. |
| US11598409B2 |
Systems and methods for providing adjustable lubrication to a tandem axle
Methods and systems are provided for adjusting a lubrication system based on an axle configuration of a tandem axle with a disconnect feature. In one example, a method may include adjusting an oil level in an axle sump of a tandem axle based on an axle configuration of the tandem axle (e.g., whether the tandem axle is operating with one of a 6×4 axle configuration and a 6×2 axle configuration), the axle sump selectably coupled to an external reservoir via a first passage and a second passage, the first passage including an electric pump, the second passage including a valve, and the tandem axle coupled to a drivetrain of a motor vehicle. In this way, an amount of oil in the axle sump may be adjusted based on the tandem axle configuration. |
| US11598403B2 |
Isolation device with selected angle between spring stop and damping member
In an aspect, an isolation device is provided for a belt and a component shaft in an engine. The device includes a hub, a pulley, an isolation spring and a damping member that is fixed rotationally relative to the hub and is engageable frictionally with the pulley. Torque transmission through the spring below a selected non-zero torque, irrespective of hub load on the pulley, drives a change in radius of the helical coils of the spring that is sufficiently small that the spring avoids pressing the damping member against the pulley. Torque transmission through the spring above the selected non-zero torque, irrespective of hub load on the pulley, drives a change in radius of the helical coils that is sufficiently large that the isolation spring applies a radial force to press the damping member against the pulley so as to generate frictional damping. |
| US11598400B2 |
Nut with flexible fingers and self-aligning members
A nut assembly for use with lead screws is provided. The nut assembly includes a nut member and an adjustment arrangement that can independently adjust the biasing of flexible fingers of the nut member. |
| US11598396B2 |
Method of aligning and seating industrial belts and belt gripping tool therefor
A belt pulling tool is comprised of a handle, a body and two prongs, the handle and body each having two ends with one end of each being attached to the other forming a longitudinal length and the two prongs being attached to the body orthogonal to the length, wherein at least one prong is configured to be moved and fixed along a portion of the length of the body. The belt pulling tool is useful for aligning, seating and setting the tension of belts for industrially belt driven machinery. In performing the method, the belt is inserted between the gap between the prongs of the tool and the tool is rotated about an axis centered in the gap and running parallel to the prongs projecting from the body of the tool to engage the belt and cause the rotation of the sheaves, thus allowing the sheaves to be aligned using alignment tools and allowing the belt to properly seat. Once seated and aligned, the tension may be set using a belt tension gauge. |
| US11598394B2 |
Wheel head transmission for a wheel head of a motor vehicle drive axle, and wheel head
A wheel head transmission (1) comprising a first and second shafts (W1, W2) which are connected to one another via a planetary transmission (PG). The wheel head transmission (1) comprises first and second planetary stages (P1, P2), which include a first element (E11, E12), a second element (E21, E22) and a third element (E31, E32). The first element (E11) of the first planetary stage (P1) is connected to the first shaft (W1) for conjoint rotation, the second element (E21) of the first planetary stage (P1) and the third element (E32) of the second planetary stage (P2) are connected to one another and the second shaft (W2) for conjoint rotation. The third element (E31) of the first planetary stage (P1) and the first element (E12) of the second planetary stage (P2) are connected together for conjoint rotation, and the second element (E22) of the second planet stage (P2) is immobilized. |
| US11598391B2 |
Rope sling shackle body
A rope sling shackle body for a heavy load rope sling shackle for suspending on a rope sling. The shackle body includes two opposite end portions each with a through-opening for receiving a bolt, a central arc which extends between the end portions and which has, at least in a rope receiving region, an arc bottom and arc flanks that are arranged on either side thereof and are spaced apart from one another. The central arc has a convexly rounded rope supporting face on its inner side at least in the rope receiving region that extends from a top edge of one arc flank to a top edge of the other arc flank. At least one reinforcement rib is arranged between the arc flanks and is divided into two partial ribs that support the arc flanks on the arc bottom. A spacing between the partial ribs extends down to the arc bottom. |
| US11598387B2 |
Method of controlling pressure variation in working fluids in a fluid circuit undergoing working pressure variations
Described herein is a fluid circuit device. The device incorporates at least one pressure balancing valve located between at least two fluid volumes that can be in a pressure differential arrangement wherein the at least one pressure balancing valve acts to address a pressure differential by opening a fluid volume or volumes to a third pressure equalising volume. In use, the fluid circuit device may in one embodiment be used in an energy absorbtion apparatus. |
| US11598384B2 |
System and method to disconnect and brake a rotating device
A disconnect mechanism comprises an input shaft defining a drive axis, a disconnect shaft selectively engaged with the input shaft to be driven about the drive axis by the input shaft, and a disconnect ramp operatively connected to the disconnect shaft to axially move the disconnect shaft between at least a first axial position and a second axial position. A disconnect pawl is selectively engaged with the disconnect ramp shaft, and a brake is selectively engaged with the disconnect shaft in the second axial position. |
| US11598382B2 |
Adaptive centrifugal brake assemblies
An adaptive centrifugal brake assembly is disclosed. The adaptive centrifugal brake assembly controls rotational speed of a shaft. The brake assembly is adaptive and changes braking force based at least in part on torque applied to the shaft and/or the speed of rotation of the shaft. In some embodiments, the adaptive centrifugal brake assembly includes an adaptive mechanism such as a leaf spring that enables the assembly to be adaptive. |
| US11598377B2 |
Motor shaft adapter
Motor shaft adapters include a cylindrical shaft sleeve with a tubular body defined between inner and outer cylindrical surfaces, and frame adapters that include a section of structural tubing and flanges having sides aligned to the sides of the structural tubing section and fixed at respective ends of the section of structural tubing into assembly between a motor and gearhead. Key slot apertures are defined by opposing body end-walls of the tubular body and through the inner and outer cylindrical surfaces of the sleeve. A shaft key has outer sidewalls that include opposing outer sleeve aperture sidewall portions that enable the shaft key sidewall portions to fit within and to thereby engage the sleeve via the key slot aperture. The key sidewalls further include a base pair of opposing key seat engagement portions that fit within and engage opposing sidewalls of a key seat aperture defined within a workpiece shaft. |
| US11598376B2 |
High retention force serviceable plug-on joint assembly
A joint assembly includes a first member having splines formed therein. A second member includes splines formed thereon and is coupled to the first member. The splines of the first member engage the splines of the second member. An access window is formed on the first member. A ring retains the first member to the second member. A seal extends across a joint between the first member and the second member and covers the access window. A portion of the ring is accessible through the access window following removal of the seal, where the ring can be manipulated to release the first member from the second member. |
| US11598368B2 |
Sensor bearing unit
A sensor bearing unit includes a bearing having a first ring and a second ring, and an impulse ring provided with a target holder, with a target mounted on the target holder, and with a sleeve secured to the first ring. The target holder having a mounting portion secured to the first ring of the bearing. The target holder has at least anti-rotation feature axially spaced apart from a free end of the mounting portion and cooperating with a complementary anti-rotation feature of the first ring so as to prevent angular movement of the impulse ring relative to the first ring. The anti-rotation feature of the target holder extends into the complementary anti-rotation feature of the first ring. |
| US11598366B2 |
Dust cover and sealing structure
A dust cover and a sealing structure for improving sealing performance by stabilizing a posture of a seal section. A seal section 130 includes: an inner peripheral seal part 131 which is slidable with respect to an outer peripheral surface of a shaft part 310; a dust lip part 132 which is slidable with respect to an end surface of a first flange part 340; and an auxiliary dust lip part 133 provided on an radially inner side of the dust lip part 132, and the auxiliary dust lip part 133 is configured to be slidable with respect to a curved surface 310a which connects the shaft part 310 and the first flange part 340 to each other. |
| US11598361B2 |
Stamped housings to facilitate assembly and related methods
Connector housings and connector assemblies for mechanically connecting a pin to a housing with or without electrical conductivity. A connector housing can be formed by attaching two housing sections together with one or both housing sections formed at least in part by a stamping process. The connector housing can have an outer contour, such as an outer perimeter, with one or more sides and with a joining section connecting two adjacent sides together. The two or more sides can be used for handling, aligning, and/or assembling of the connector housing to a cavity. |
| US11598360B2 |
Fastening clip
The present application provides a fastening clip, which comprises a fastening pin and a fastening sleeve. The fastening pin can be inserted into the fastening sleeve, the fastening sleeve comprises a base and two pairs of retaining wings, the two pairs of retaining wings respectively extend downward from a lower surface of the base, and outer sides of at least one of the two pairs of retaining wings have raised ribs extending in a circumferential direction. The fastening clip of the present application can firmly fasten at least two plates. |
| US11598358B2 |
Method for creating a press connection arrangement, press connection arrangement and method for creating a clamping connection as well as the clamping connection itself and the use thereof
The invention relates to a method for creating a press connection arrangement and a clamping connection, the method including a plurality of steps, as well as a press connection arrangement and a clamping connection per se. |
| US11598357B2 |
Resilient mounting clips, panel mount systems including the same, and associated methods
Resilient mounting clips, panel mount systems including the same, and associated methods. A resilient mounting clip includes a support structure engagement portion and a panel engagement portion with a plurality of edge extensions and a plurality of outboard panel supports. Each outboard panel support extends from a respective edge extension. Each outboard panel support is configured to move at least substantially parallel to a compression axis when the respective edge extension resiliently flexes with respect to the support structure engagement portion. A panel mount system includes at least one support structure, at least one resilient mounting clip, and at least two panels received by each mounting clip. A method of assembling a panel mount system includes positioning and securing a resilient mounting clip on a support structure and receiving each of a first panel and a second panel with the resilient mounting clip. |
| US11598355B1 |
Holder
A holder comprises a housing, a first clamping arm, a second clamping arm, a first elastic member and a second elastic member. The bottom of the housing is provided with a supporting arm. The first clamping arm is movably mounted in the housing and extends from one side of the housing to form a first clamping part and extends from the other side of the housing to form a first pressing part. The second clamping arm is arranged similarly, to form a second clamping part and a second pressing part; and the second clamping part is opposite to the first clamping part. The first elastic member is mounted in the housing to exert an elastic force towards the second clamping arm on the first clamping arm. The second elastic member is mounted in the housing to exert an elastic force towards the first clamping arm on the second clamping arm. |
| US11598354B2 |
Hydraulic machine
A hydraulic machine. A boom actuator includes a large chamber and a small chamber. A recovery unit receives fluid discharged from the large chamber and then recovers energy. A recovery line connects the large chamber and the recovery unit. An accumulator is connected to a first point on the recovery line. A discharge valve is disposed on the recovery line between the first point and the recovery unit. A first sensor measures a pressure in the accumulator. A controller controls opening and closing of the discharge valve. The controller performs anti-bouncing control of: determining a target pressure in the accumulator corresponding to a load pressure applied to fluid in the large chamber by a load according to a predetermined correspondence; and controlling the opening and closing of the discharge valve such that the pressure in the accumulator measured by the first sensor reaches the target pressure. |
| US11598352B2 |
Hydraulic component connection device
An assembly system for components of a pressurized fluid supply system for an agricultural vehicle includes a body having at least one fluid duct connectable at one end to a pressurized fluid supply and having a socket at the other end. A detachable component such as an accumulator or oil filter is connectable in releasable mechanical engagement with the body to receive pressurized fluid from the at least one fluid duct. The engagement results from insertion of at least a portion of the component into the socket and rotation of the component to a locked position. The body has at least one discharge duct extending therethrough. In a partially rotated position of the component portion within the socket, the component remains mechanically attached to the body and the fluid duct and discharge duct are in fluidic connection, discharging accumulated pressure in the fluid duct. |
| US11598351B2 |
Hydraulic accumulator
A hydraulic accumulator, in particular in the form of a piston accumulator, has an accumulator housing (10) and a separating element (20) arranged in the housing. The separating element is in the form of a piston, which separates a fluid side (22) from a gas side (24). At least the gas side (24) can be inspected, at least in part, by at least one sight glass (34, 36) that is fixed in the accumulator housing (10). |
| US11598336B2 |
Method of making a two-piece counterweight for a scroll compressor
A method of manufacturing a two-piece counterweight for a scroll compressor is provided. The method includes molding an outer plate, and molding a base having a first opening configured to receive a scroll compressor drive shaft having a longitudinal axis. The method further includes configuring the base for assembly and attachment to the drive shaft. The method also includes attaching the outer plate to the base such that the outer plate is axially offset from the base. In a particular embodiment of this method, the base and outer plate are molded from powdered metal. In certain embodiments, the base and outer plate include one or more openings aligned to permit attachment by inserting a mechanical fastener through the aligned openings. In alternate embodiments, the base and outer plate are attached via brazing or welding. |
| US11598331B2 |
Electroactive polymer actuator for multi-stage pump
A two-stage pump system is provided using electrostatic actuators. The system includes a pair of hydraulically-amplified, self-healing, electrostatic (HASEL) actuators in fluid communication with one another. Each actuator includes a deformable shell defining a working fluid compartment storing a dielectric fluid. Two electrodes are disposed on opposite sides of the deformable shell. A pair of fluid transfer bladders are disposed adjacent the respective pair of HASEL actuators, each including a fluid-impermeable membrane defining a transfer fluid chamber, and a biasing member disposed in the transfer fluid chamber. When individually actuated in an alternating two-stage pattern, the two electrodes of each respective HASEL actuator move from a neutral position to an attracted position, displacing dielectric fluid through the first transfer conduit and between working fluid compartments, thereby pumping the transfer fluid from an inlet to an outlet. |
| US11598327B2 |
Compressor system with heat recovery
A system includes a first working fluid compressor configured to pressurize a working fluid, and a prime mover coupled to the first working fluid compressor and configured to provide a mechanical input into the first working fluid compressor. An exhaust assembly is coupled to the prime mover and is configured to receive exhaust heat from the prime mover, the exhaust assembly including a generator configured to generate electric current based on the exhaust heat received by the exhaust assembly. A second working fluid compressor includes an electric motor electrically and synchronously coupled to the generator and configured to pressurize the working fluid. |
| US11598326B2 |
Pressure adjustment apparatus and method
A pressure adjustment apparatus including a pump, a selector valve coupled to the pump, and a chamber in selective fluid communication with the pump through the selector valve is disclosed. The pump includes a pump body that defines a variable volume therein, the pump body further defining a first aperture and a second aperture therethrough. The selector valve includes a first check valve disposed in a first fluid channel of a plurality of fluid channels, the first check valve being oriented to permit flow through the first fluid channel only in a first flow direction, the first flow direction being a flow direction out of the variable volume, and a second check valve disposed in a second fluid channel of the plurality of fluid channels, the second check valve being oriented to permit flow through the second fluid channel only in a second flow direction. |
| US11598324B2 |
Electric drive pump for well stimulation
An electric drive pump system includes a power end and a detachable transmission assembly. The transmission assembly is mounted to the power end and is configured to provide rotational power to the power end through a plurality of electric motors. The plurality of electric motors use a gearbox to drive an output spline that engages the power end. A control module is used to regulate the performance characteristics of the plurality of electric motors. A temperature regulation assembly is configured to regulate the temperature of the transmission assembly and the power end. |
| US11598323B2 |
Method for pumping an aqueous fluid through an electroosmotic membrane
A method of pumping an aqueous fluid through an electroosmotic membrane situated between a cathode and an anode includes oxidizing water to O2 at the anode and reducing O2 at the cathode. A potential difference E between the cathode and the anode is 1.4 V or less. |
| US11598321B2 |
Hall-effect thruster
A Hall-effect thruster assembly includes a plurality of magnetic sources for creating a magnetic circuit. The plurality of magnetic sources are positioned between a first end and a second, opposite end of the Hall-effect thruster. The plurality of magnetic sources define a longitudinal axis extending through the first end and the second end. The first end is configured as a discharge end. A mount assembly is coupled to the second end. The mount assembly is configured to secure the plurality of magnetic sources to a spacecraft. A magnetic element is supported by the mount assembly. The magnetic element is positioned relative to the plurality of magnetic sources by the mount assembly. |
| US11598316B2 |
Electric heating apparatus for deicing, method for manufacturing the same, blade and wind turbine including the same
An electric heating apparatus for deicing, a method for manufacturing the electric heating apparatus for deicing, a blade and a wind turbine including the same. The electric heating apparatus for deicing includes: a heat generating module, including a heat generating element and a bus bar for conducting electricity to the heat generating element, where the bus bar includes a lead-out portion for connecting an external power source; a thermally conductive encapsulating layer, which is insulated and is to cover the heat generating module except the lead-out portion; and a first substrate and a second substrate, respectively arranged below and above the thermally conductive encapsulating layer, so that the heat generating module and the thermally conductive encapsulating layer are arranged between the first substrate and the second substrate. |
| US11598315B2 |
Triboelectric nanogeneration module, and combined wind turbine and method thereof
A triboelectric nanogeneration module, and a combined wind turbine and a method thereof. The triboelectric nanogeneration module includes a rotating disc, and moving friction plates and fixed friction plates that are oppositely arranged outside the radial direction of the rotating disc. A nano-friction material layer is arranged on the surface of each of the moving friction plates and the fixed friction plates. Driving devices are arranged on the rotating disc in the circumferential direction at intervals. The driving devices are used for extruding the moving friction plates to move to the positions at which the moving friction plates are in contact with the fixed friction plates. The moving friction plates are connected to reset devices used for separating the moving friction plates from the fixed friction plates. The moving friction plates perform straight reciprocating movement under the action of the driving devices and the reset devices. |
| US11598310B2 |
Method for controlling a wind turbine, wind turbine, and wind park
A method for operating a wind turbine, an associated wind turbine, and an associated wind park are provided. The wind turbine has a tower with tower loads acting thereon and an aerodynamic rotor which generates a rotor thrust. The method has a step of reducing the rotor thrust. The reduction of the rotor thrust is performed while considering the effect of the reduction of the rotor thrust on the tower loads. Thus, the reduction of the rotor thrust is avoided in cases which result in undesirable or even counter-productive effects on the tower loads. |
| US11598307B1 |
Method and system for improving fouled spark plug detection
Methods and systems to determine a presence or absence of engine misfire or spark plug fouling are presented. In one example, rates of change in engine speed are arranged in engine data blocks and root mean square values for the rates of change in engine speed are determined. The presence or absence of engine misfire or spark plug fouling may be based at least in part on the root mean square values. |
| US11598299B1 |
Fuel filter
A fuel filter for a fuel system includes a cylindrical frame having a pair of circular openings at longitudinal ends of the frame and a filter membrane, with the frame including a circumferential wall having an aperture and the filter membrane being disposed about an outwardly facing side of the wall and over the aperture. The frame includes tabs, such as deformable tabs, disposed adjacent at the openings for retaining the filter membrane on the frame, and the filter membrane overlaps itself when circumferentially disposed about the wall. |
| US11598295B1 |
Pump driven crankcase ventilation system
Engines and engine systems for managing blow-by gas and/or moisture therein, and methods of operating the same are disclosed. The engine systems may include an air intake system including a compressor such as a turbocharge and a charge air cooler. The engine system may also include an engine such as combustion engine have a crankcase. During combustion blow-by gas may be captured in the crankcase and recirculated back to the air intake system. The blow-by gas may be diluted by additional air such as fresh air prior to being recirculated. The system may also include a pump to facilitate recirculation. |
| US11598289B1 |
Propellant volume and mixture ratio control
Systems and methods for determining bi-propellant volume and adjusting a mixture ratio are discussed herein. A controller can calculate an adjusted mixture ratio and command the rocket engine to implement the adjusted mixture ratio by opening or closing valves of the propellant tanks, which changes the volumetric flow rates of each of the propellants. The adjusted mixture ratio can be calculated by an algorithm based on sensed or calculated data associated with each propellant. The adjusted mixture ratio can be used to evenly deplete the propellants to reduce the amount of each propellant remaining after a mission and to improve propellant use, which allows for an increase in a non-propellant payload. |
| US11598286B2 |
Geared gas turbine engine arrangement with core split power ratio
A gas turbine engine according to an example of the present disclosure includes, among other things, a propulsor section, a compressor section including a low pressure compressor and a second compressor section, and a turbine section including a low pressure turbine and a high pressure turbine. The low pressure turbine drives the low pressure compressor and the gear arrangement to drive the propulsor. A core split power ratio is provided by power input to the high pressure compressor divided by a power input to the low pressure compressor measured in horsepower. |
| US11598285B2 |
Methods and systems for generating power and thermal management having combined cycle architecture
Methods and apparatus for cooling a surface on a flight vehicle and generating power include advancing the vehicle at a speed of at least Mach 3 to aerodynamically heat the surface. A first working fluid circulates through a first fluid loop that heats the first working fluid through a first heat intake thermally coupled to the surface and expands the first working fluid in a first thermal engine to generate a first work output. A second fluid loop has a second working fluid that receives heat from the first working fluid and a second thermal engine to generate a second work output. The first and second work outputs are operably coupled to first and second generators, respectively, to power primary or auxiliary systems on the flight vehicle. |
| US11598282B1 |
Systems and methods for optimizing vessel fuel consumption
An optimum engine configuration is determined, based on a predicted required power, for a seafaring vessel having a plurality of thrust engines. The predicted required power is determined by inputting vessel operational data, environmental data, and voyage data to a required power model. At least some of the vessel operational data and environmental data is received from a plurality of sensors positioned onboard the vessel. The optimum engine configuration is selected from a plurality of candidate engine configurations. Each candidate engine configuration includes a specified number of thrust engines running and a specified power output level of each thrust engine. The optimum engine configuration is selected based on a candidate total predicted fuel consumption of each candidate engine configuration. The candidate total predicted fuel consumption amount is determined as a sum of the engine-specific predicted fuel consumptions determined for each running thrust engine of that candidate engine configuration. |
| US11598281B2 |
Method for operating a drive device and corresponding drive device
A method for operating a drive device having a drive unit producing exhaust gas and an exhaust gas posttreatment device designed as a vehicle catalytic converter for posttreatment of the exhaust gas. A first measured value describing the residual oxygen content in the exhaust gas is measured by a first lambda sensor arranged upstream of the exhaust gas posttreatment device and a second measured value describing the residual oxygen content in the exhaust gas is measured by a second lambda sensor arranged downstream of the exhaust gas posttreatment device. The combustion air ratio of a fuel-air mixture used to operate the drive unit is set during an at least temporarily performed normal operating mode on the basis of the first measured value, the second measured value, and a threshold value for the second measured value. |
| US11598278B2 |
Method to elevate idle speed to launch a vehicle with manual transmission
A method of controlling an idle speed for an engine of a vehicle includes the steps of sensing a vehicle speed. At least one of a parking brake position and a clutch position is also sensed. When it is determined that the vehicle speed is below a maximum vehicle speed, and either the parking brake is released or the clutch is depressed, the engine idle speed is increased from a base idle speed to a launch idle speed. |
| US11598277B2 |
System and method for reducing engine knock
A method includes operating a spark ignition engine and flowing low pressure exhaust gas recirculation (EGR) from an exhaust to an inlet of the spark ignition engine. The method includes interpreting a parameter affecting an operation of the spark ignition engine, and determining a knock index value in response to the parameter. The method further includes reducing a likelihood of engine knock in response to the knock index value exceeding a knock threshold value. |
| US11598271B1 |
Methods and systems for a multi-pressure fuel injection system
Various methods and systems are provided for a method for a multi-pressure fueling system. In one example, the multi-pressure fueling system includes providing a first fuel delivery pressure enabling high pressure direct injection of a fuel at a first injector and a second fuel delivery pressure insufficient for high pressure direct injection, at a second injector, based on engine operation. |
| US11598270B2 |
Method for operating a drive device and corresponding drive device
An internal combustion engine with a plurality of cylinders is a drive device in which the drive torque available can be reduced. The ignition timing which is set at the internal combustion engine is adjusted in the retarded direction starting from an initial ignition timing until the ignition timing corresponds to a threshold ignition timing. To reduce the drive torque further, at least one cylinder, among the plurality of cylinders, is deactivated by suspending fuel injection into the cylinder, and the remaining cylinder(s) continue to be operated with fuel injection using the ignition timing. The remaining cylinders of the internal combustion engine which continue to be operated are supplied with a quantity of fuel which is larger in comparison with an initial quantity of fuel present before the cylinder deactivation, to set a substoichiometric fuel/oxygen ratio. |
| US11598264B2 |
Systems and methods to enhance intake air flow to a gas turbine engine of a hydraulic fracturing unit
Systems and methods to increase intake air flow to a gas turbine engine of a hydraulic fracturing unit when positioned in an enclosure may include providing an intake expansion assembly to enhance intake air flow to the gas turbine engine. The intake expansion assembly may include an intake expansion wall defining a plurality of intake ports positioned to supply intake air to the gas turbine engine. The intake expansion assembly also may include one or more actuators connected to a main housing of the enclosure and the intake expansion assembly. The one or more actuators may be positioned to cause the intake expansion wall to move relative to the main housing between a first position preventing air flow through the plurality of intake ports and a second position providing air flow through the plurality of intake ports to an interior of the enclosure. |
| US11598263B2 |
Mobile gas turbine inlet air conditioning system and associated methods
A system, as well as associated methods, for increasing the efficiency of a gas turbine including an inlet assembly and a compressor may include a housing configured to channel airstream towards the inlet assembly, an air treatment module positioned at a proximal end the housing, and at least one air conditioning module mounted downstream of the air treatment module for adjusting the temperature of the airstream entering the compressor. The air treatment module may include a plurality of inlet air filters and at least one blower configured to pressurize the air entering the air treatment module. |
| US11598262B2 |
Intake duct for a gas-fuelled or diesel-fuelled turbine equipped with a water saturation structure
The invention concerns an air inlet duct (10) for a compressor (12) of a gas or fuel oil turbine, including: two transition sections (S3, S4) in fluid communication with one another for the circulation of a flow of air through said sections (S3, S4), each of said sections (S3, S4) being self-supporting, a structure (20) for injecting a mist of liquid particles, configured to be disposed between said sections (S3, S4) and in contact with said sections (S3, S4), the structure (20) being removable independently of demounting said sections (S3, S4). The invention also concerns a gas or fuel oil turbine assembly comprising an inlet duct (10) of this type and a method of maintaining an inlet duct (10) of this type. |
| US11598255B2 |
Converter for converting reciprocating motion into rotary motion, and motor, generator unit, and vehicle
The present converter for converting reciprocating motion into rotary motion comprises a pair of rotors counter-rotating in axial alignment, said rotors having rotor magnets and auxiliary rotor magnets fastened thereon, and a pair of rods moving reciprocally in opposite directions relative to one another along the axis of rotation of the rotors, said rods having rod magnets and auxiliary rod magnets fastened thereon, wherein at least some of the rotor magnets and/or the rod magnets are arranged such that their poles are disposed on several concentric cylindrical working surfaces simultaneously. |
| US11598251B2 |
Turbine wastegate having a fluidic sealing arrangement and a method of testing thereof
A turbine comprising: a turbine housing, a wastegate passage connecting the turbine inlet and the turbine outlet; and a wastegate valve comprising a movable valve member. The wastegate valve has an open state in which a first gas may pass between a turbine inlet a turbine outlet via the wastegate passage and a closed state in which the valve member substantially prevents said first gas from passing between the turbine inlet and the turbine outlet. The valve member is mounted to an actuation member that passes through a bore of the turbine housing. The actuation member is movable to move the wastegate valve between the open and closed states. The turbine comprises a fluid conduit configured to deliver a second gas to the bore to form a fluidic seal between the bore and the actuation member to substantially prevent the passage of said first gas along the bore. |
| US11598250B2 |
Exhaust system for an engine
A valve for use in an engine exhaust conduit. The valve includes a base portion and a body portion extending from the base portion. The base portion is configured for pivotably mounting the valve within the engine exhaust conduit. The base portion defines a valve pivot axis. The valve is pivotable about the valve pivot axis during use. The body portion has an upstream side and a downstream side opposite the upstream side. The upstream side is exposed, during use, to fluid flow in the engine exhaust conduit. The body portion has a generally pointed shape defining a rounded tip at a location of the body portion furthest from the base portion in a length direction of the valve. The length direction of the valve is generally perpendicular to the valve pivot axis. |
| US11598249B1 |
Methods and systems for multi-fuel engine
A method and system are provided for adjusting a speed of a turbocharger compressor using an electric motor in response to a relative substitution rate of first and second fuels in a multi-fuel engine. |
| US11598242B2 |
All-terrain vehicle and exhaust assembly for all-terrain vehicle
The present disclosure relates to an all-terrain vehicle and an exhaust assembly for an all-terrain vehicle. The all-terrain vehicle includes: a frame, a V-type twin-cylinder engine and an exhaust assembly. The V-type twin-cylinder engine has a first exhaust port and a second exhaust port, and a cylinder corresponding to the first exhaust port is located in front of a cylinder corresponding to the second exhaust port. The V-type twin-cylinder engine is mounted on the frame. The exhaust pipe group has a first end coupled to the first exhaust port, a second end coupled to the second exhaust port, and a third end coupled to a pipe of the muffler. The exhaust pipe group is divided into at least two exhaust pipes, and adjacent exhaust pipes are flexibly coupled. |
| US11598241B2 |
Fluid level wake-up functionality
A reduction device includes a housing defining an input chamber configured to receive exhaust from a power source, an output chamber, an exhaust channel configured to direct the exhaust from the input chamber to the output chamber, and a longitudinal axis. The reduction device also includes a treatment unit disposed in the exhaust channel and along the longitudinal axis. The treatment unit is configured to at least partly remove pollutant species from the exhaust. The reduction device also includes an attenuation component disposed in the housing and radially outward of the treatment unit. The attenuation component is fluidly connected to the exhaust channel, and is configured to attenuate a range of frequencies corresponding to operation of the power source. Additionally, the exhaust channel prohibits exhaust entering the input chamber from exiting the housing without passing through the treatment unit. |
| US11598239B2 |
Crossflow PNA-SCR aftertreatment device
An exhaust aftertreatment system includes a cross-flow selective catalytic reduction catalyst. The cross-flow selective catalytic reduction catalyst includes a housing and a substrate assembly. The substrate assembly includes a plurality of first substrate layers defining a plurality of first flow channels and a plurality of second substrate layers defining a plurality of second flow channels. The exhaust aftertreatment system includes a passive NOx adsorber. The passive NOx adsorber includes a housing. The housing includes an inlet in exhaust gas receiving communication with the plurality of first flow channels of the cross-flow selective catalytic reduction catalyst. The housing includes an outlet in exhaust gas providing communication with the plurality of second flow channels of the cross-flow selective catalytic reduction catalyst. The passive NOx adsorber includes a substrate positioned in the housing. The substrate includes a passive NOx adsorber washcoat. |
| US11598238B2 |
Exhaust gas purification device
An exhaust gas purification device includes a first catalyst, a second catalyst, a bypass pipe, a hydrocarbon adsorbent, and a switching controller. The first catalyst is provided in an exhaust pipe. The second catalyst is provided downstream of the first catalyst in the exhaust pipe. The bypass pipe branches from a first portion of the exhaust pipe. The first portion is located upstream of the second catalyst. The bypass pipe is recoupled to a second portion of the exhaust pipe. The second portion is located upstream of the second catalyst. The hydrocarbon adsorbent is provided in the bypass pipe. The switching controller is configured to switch a flow path of an exhaust gas to the bypass pipe based on a deterioration degree of the first catalyst. |
| US11598237B2 |
Automatic draining of water-fuel separator via downstream injection system
A diesel engine system includes an engine, an exhaust system connected to the engine, and a water-fuel separator. The exhaust system has an aftertreatment device, an exhaust pipe upstream of the aftertreatment device, and a fuel injector connected to the exhaust pipe. The water-fuel separator has a filter configured to separate water from fuel and a reservoir configured to store the separated water. The reservoir is in fluid communication with the fuel injector. |
| US11598229B2 |
Internal combustion engine valve system and method
A valve system/method suitable for an internal combustion engine (ICE), compressor pump, vacuum pump, and/or reciprocating mechanical device is disclosed. The system/method is optimized for construction of a four-stroke ICE. The rudimentary system incorporates a unitized intake and exhaust engine block cover (UEC) that enclose an intake rotary valve cylinder (IVC) and exhaust rotary valve cylinder (EVC) that control intake/exhaust flow through a respective intake rotary valve port (IVP) and an exhaust rotary valve port (EVP) into and out of a combustion cylinder that provides power to a piston and crankshaft. An intake multi-staged valve (IMV) and exhaust multi-staged valve (EMV) provide intake and exhaust flow control for the IVC/IVP and EVC/EVP. An enhanced system may include a variety of intake/exhaust port seals (IPS/EPS), forced induction (FIN), forced discharge (FID), centrifugal advance (CAD), and/or cooling channel spool (ICS/ECS). |
| US11598228B2 |
Rocker arm assembly with valve bridge
A rocker arm assembly selectively opening first and second engine valves. The assembly includes a rocker arm and a valve bridge operably associated with the rocker arm and including a main body and a lever rotatably coupled to the main body. The main body is configured to engage the first engine valve, and the lever is configured to engage the second engine valve. |
| US11598227B2 |
Articulated chain with sleeve joints arranged at an angle
An articulated chain with alternating inner chain links and outer chain links which are each connected to each other by means of a chain joint, wherein each outer chain link comprises at least two outer link plates and two chain studs connecting them to each other, each inner chain link comprises at least two inner link plates and two joint sleeves connecting them to each other, and for forming a chain joint, one chain stud each of the outer chain link extends through a joint sleeve of the inner chain link. The joint sleeves of the inner chain links are embodied as winding sleeves and firmly connected to the inner link plates, wherein the sleeve joints of the two winding sleeves are positioned on the same side of a link plate's longitudinal axis and face each other, and the sleeve joints are arranged at a distance to the link plate's longitudinal axis and at a distance to an upper apex or to a lower inflection point of the winding sleeve. |
| US11598220B2 |
Discharge door control ring for aircraft turbomachine and turbomachine comprising the same
A control ring for controlling discharge gates for an aircraft turbine engine extends around a casing of the turbine engine and includes a connector for connecting to the gates. The control ring includes metal sectors and composite material sectors. The metal sectors may be connected to one another by the composite material sectors and the connector may be carried by the metal sectors. |
| US11598216B2 |
Ceramic matrix composite airfoil cooling
Airfoils for gas turbine engines are provided. In one embodiment, an airfoil formed from a ceramic matrix composite material includes opposite pressure and suction sides extending radially along a span and defining an outer surface of the airfoil. The airfoil also includes opposite leading and trailing edges extending radially along the span. The pressure and suction sides extend axially between the leading and trailing edges. The leading edge defines a forward end of the airfoil, and the trailing edge defining an aft end of the airfoil. Further, the airfoil includes a trailing edge portion defined adjacent the trailing edge at the aft end of the airfoil; a plenum defined within the airfoil forward of the trailing edge portion; and a cooling passage defined within the trailing edge portion proximate the suction side. Methods for forming airfoils for gas turbine engines also are provided. |
| US11598213B1 |
Rotor assembly for a gas turbine engine and method for assembling same
A rotor assembly for a gas turbine engine includes a turbine shaft disposed about a longitudinal axis, a first rotor and a second rotor configured for rotation about the longitudinal axis, and an intermediate shaft positioned radially between the turbine shaft and the second rotor. The second rotor is mounted to and axially adjacent the first rotor. The intermediate shaft is mounted to the turbine shaft on an inner radial side of the intermediate shaft. The intermediate shaft is mounted to the second rotor on an outer radial side of the intermediate shaft. |
| US11598212B2 |
Method for balancing a set of blades
A method for balancing a set of blades intended to be arranged on a bare disc of an aircraft engine, the bare disc comprising a defined number of numbered cells (ai) intended to receive the same defined number of blades, which can have a spread of mass, the method comprising the following steps:—sorting the blades by monotonic order of their mass (mi) to form an ordered set of blades,—separating the ordered set of blades in a balanced manner into four lobes constituted by a first large lobe, by a second large lobe, by a first small lobe and by a second small lobe, the blades being classified into each lobe according to a current placement order, and—arranging the four lobes on the bare disc by making the current placement order of the blades correspond to the numbered cells of the bare disc. |
| US11598211B2 |
Cylinder bore surface structures for an opposed-piston engine
A cylinder for an internal combustion opposed-piston engine includes a bore, either as part of the cylinder directly or of a liner. The bore has a surface for guiding a pair of pistons disposed for opposing movement in the cylinder. The cylinder bore has three zones of surface finishes: an inner zone extending between and including exhaust and intake ports, where only piston compression rings travel on the bore surface; two instances of an outer zone where only piston oil control rings travel on the bore surface; and two instances of a port zone where both types of rings travel on overlapping paths in the same bore surface portion. Each zone may have a particular surface finish that is tailored to specific requirements including oil control, ring wear, and scuff resistance relevant to the zone. |
| US11598210B1 |
Tunnel protection structure suitable for active fault areas and high ground stress areas
Disclosed is a tunnel protection structure suitable for active fault areas and high ground stress areas, and relates to the technical field of tunnel engineering construction. The tunnel protection structure comprises at least one protection unit, wherein a plurality of protection units are sequentially connected and distributed along the axial direction of a tunnel, and the protection units comprise a radial protection ring and two axial protection rings which are fixedly arranged between a lining structure and surrounding rock and are distributed along the axial direction of the tunnel; the radial protection ring comprises a plurality of radial buffer energy consumption layers which are sequentially sleeved along the radial direction of the tunnel; and the axial protection ring comprises a plurality of axial buffer energy consumption layers which are sequentially and fixedly connected along the axial direction of the tunnel. |
| US11598202B2 |
Communications using electrical pulse power discharges during pulse power drilling operations
A pulse power drilling system includes a pulse power drill string to be positioned in a borehole formed in a subsurface formation. The pulse power drill string is to drill the borehole based on periodic pulsing of an electrical discharge into the subsurface formation. The pulse power drill string includes a generator to generate electrical power, an electrode to emit the electrical discharge out to the subsurface formation based on the electrical power, and a controller communicatively coupled to the generator and the electrode. The controller is to control at least one discharge parameter of the electrical discharge to encode a data communication within the electrical discharge. |
| US11598201B2 |
Autonomous tool
A method, system, and apparatus for determining the location of a tool traveling down a wellbore by measuring a first borehole magnetic anomaly with respect to time at two known locations on a tool, comparing the time difference between the two measurements, then calculating the velocity of the tool based on the comparison, then further calculating the distance traveled by the tool in the wellbore based on the velocity calculation, then executing a series of commands at a predetermined location in the wellbore. |
| US11598197B2 |
Integrated surveillance and control
A method of managing oilfield activity with a control system is provided having a plurality of virtual sensors and integrating the virtual sensors into a virtual sensor network. The method includes determining interdependencies among the virtual sensors, obtaining operational information from the virtual sensors, and providing virtual sensor output to the control system based on the determined interdependencies and the operational information. |
| US11598192B1 |
Methodology to consolidate sand or proppant with resin in two steps
Systems and methods are directed to proppant flowback control. A method includes coating resin onto proppant at a well site and pumping the coated proppant into a wellbore during a fracking operation. The method further includes pumping an activator for the resin into the wellbore to displace the coated proppant into at least one fracture during the fracking operation. The pumping of the coated proppant and the pumping of the activator are performed separately. |
| US11598191B2 |
Independent control for simultaneous fracturing of multiple wellbores
A system and method for independent control of simultaneous fracturing for multiple wellbores is disclosed. In certain embodiments, a first clean pumping unit and a first dirty pumping unit are fluidically coupled to a first wellbore, wherein the first clean pumping unit pumps a first fluid to the first wellbore and the second clean pumping unit pumps a second fluid to the first wellbore. In certain embodiments, a second clean pumping unit and a second dirty pumping unit are fluidically coupled to a second wellbore, wherein the second clean pumping unit pumps the first fluid to the second wellbore and the second dirty pumping unit pumps. In certain embodiments, a controller controls a pumping rate of at least one of the first clean pumping unit and the first dirty pumping unit based on a desired parameter of a combined fluid pumped to the first wellbore. |
| US11598189B2 |
Control, integration, and modulation systems and methods for regulating hydraulic fracturing systems when combined with a pressure exchange system
A method for optimizing pressure exchange includes providing a first pressure exchange system comprising an energy recovery device (ERD). A second system supplies high-pressure fluid, energized by a positive displacement pump, to the ERD. A third system supplies low-pressure fluid to the ERD. The first system energizes the low-pressure fluid with the high-pressure fluid to form a high-pressure fracking fluid, which is delivered from the first system to a well-head. A rate of required flow is input into a control system, which determines a rate of flow of the high-pressure fluid, a rate of flow of the low-pressure fluid, and an actual rate of flow of the fracking fluid at the well-head. The control system then adjusts to equilibrium: the rate of flow of the high-pressure fluid based on the actual rate of flow; and the rate of flow of the low-pressure fluid based on the actual rate of flow. |
| US11598187B1 |
Membrane-based systems and methods for increasing the mass transfer rate of dissolved gases
This disclosure relates to membrane-based systems for transporting dissolved gases to a formation and methods for increasing a mass transfer rate of gases in a formation. The membrane-based system may include an aqueous injection well, a diffusion-based membrane, a gas, and an aqueous solution. |
| US11598186B2 |
Enhanced carbon dioxide-based geothermal energy generation systems and methods
A system comprises an injection well for accessing reservoir at a first temperature; a production well in fluid communication with the reservoir; a working-fluid supply system providing a non-water based working fluid to the injection well at a second temperature lower than the first temperature, wherein exposure of the working fluid to the first temperature heats the working fluid to a third temperature and at least a portion of the working fluid at the third temperature is produced as a production fluid; and an energy recovery system that converts energy contained in the production fluid to electricity or heat, wherein the energy recovery system includes a waste heat recovery apparatus that recovers waste heat and uses it to heat the production fluid to a fourth temperature that is higher than the third temperature, wherein the waste heat is recovered from equipment of or a process stream. |
| US11598185B2 |
Methods for adaptive optimization of enhanced oil recovery performance under uncertainty
Methods are provided for adaptive optimization of enhanced oil recovery project performance under uncertainty. Predictive physics-based reservoir simulation is used to estimate performance of the project. Input parameters of the model are divided into control variables and uncertain variables. The reservoir model is optimized to obtain values of control variables maximizing mean value of a chosen performance metric under initial uncertainty of formation and fluid properties. An efficient frontier can characterize dependence between the optimized mean value of the performance metric and its uncertainty expressed by the standard deviation. Global sensitivity analysis (GSA) is then applied to quantify and rank contributions from uncertain input parameters to the standard deviation of the optimized values of the performance metric. Additional measurements can be performed to reduce uncertainty in the high-ranking parameters. Constrained optimization of the model with reduced ranges of uncertain parameters is performed and a new efficient frontier is obtained. |
| US11598180B2 |
Experimental device and experimental method for natural gas hydrate solid-state fluidized mining and crushing
The invention discloses an experimental device for natural gas hydrate solid-state fluidized mining and crushing, the experimental device comprising a power liquid supply module, a hydrate suction module, a pipeline conveying module, a hydrate fluidized crushing module, a secondary processing module and an experimental data information collection and processing module. An experimental method for the experimental device comprises: turning on the power liquid supply module, the hydrate suction module, the pipeline conveying module, the hydrate fluidized crushing module and the secondary processing module, and collecting pressure and flow data at a plurality of locations by the experimental data information collection and processing module. The present invention has the following beneficial effects: a jet solid-state fluidized mining process is simulated, and a plurality of pressure and flow detection points and sampling ports for crushed samples are provided at the same time so as to facilitate parameter collection; a plurality of component parameters are flexibly variable, including changing a drag-back speed of a moving slider, shape parameters of jet nozzles, and a pressure and flow of a power liquid; a spray head is designed to simplify the experimental device, and a dynamic process of jet crushing may be observed from a side surface of an experimental tank. |
| US11598177B2 |
Wellbore system, a member and method of making same
A member that is a single element for controlling flow through an inflow control device, has anisotropic density configured to move the member relative to the inflow control device such that the inflow control device allows, fully blocks, or partially blocks flow from a zone to a production string based on a density of a fluid flowing into the inflow control device from the zone. |
| US11598174B2 |
Fracturing fluid delivery system
A fracturing fluid delivery system is provided. In one embodiment, the system includes a wellhead assembly, a fracturing fluid supply line, a vertical branch extending upward from the fracturing fluid supply line, and a fluid conduit coupling the vertical branch in fluid communication with the wellhead assembly. The fluid conduit may extend linearly from the vertical branch to the wellhead assembly. Additional systems, devices, and methods are also disclosed. |
| US11598173B2 |
Frac system with flapper valve
A frac system including a frac tree. The frac tree includes a frac head. The frac head defines a first inlet, a second inlet, and an outlet. The frac head receives frac fluid through the first inlet and directs the frac fluid to the outlet fluidly coupled to a wellhead. A valve couples to the second inlet of the frac head. A flapper valve is within the frac head. The flapper valve moves between an open position and a closed position to control fluid flow to the valve through the second inlet. The flapper valve aligns with a first axis of the outlet and the second inlet in the closed position and aligns with a second axis of the first inlet in the open position. |
| US11598168B2 |
Two part bonded seal for static downhole tool applications
A seal assembly and methods of use, wherein the seal assembly is formed of an elastomeric enclosure within which a primary cavity is defined. A second cavity in the form of a crushable container is deployed within the primary chamber. An elastomeric compound is contained in one cavity and an elastomeric hardener contained in the other cavity. Upon application of an external force to the elastomeric enclosure, the enclosure is elastically deformed from a first shape to a second shape, wherein the second shape positions the elastomeric enclosure into a sealing configuration between adjacent annular surfaces. The external force also crushes the container, to cause mixing of the elastomeric compound and elastomeric hardener. Once the reaction is complete, the hardened compound retains the deformed shape of the elastomeric enclosure to maintain a seal between the annular surfaces. |
| US11598166B2 |
Float equipment assemblies and methods to isolate downhole strings
A float equipment assembly includes an inner string that provides a fluid flow path through the float equipment assembly. The float equipment assembly also includes an opening through which a fluid flowing through the inner string exits the float equipment assembly. The float equipment assembly further includes a moveable member, which when repositioned, isolates the inner string. The float equipment assembly further includes a dissolvable material that initially prevents repositioning of the moveable member, where the moveable member is repositioned after a threshold portion of the dissolvable material has dissolved. |
| US11598164B2 |
Flexible basket drill bit breaker
A bit breaker for making or breaking a connection between a drill bit and a drill string, and the bit breaker includes a support structure that has a bit aperture through which a portion of the drill bit may pass. The support structure also includes basket apertures positioned circumferentially around the bit aperture. The bit breaker also includes a flexible member that passes through the basket apertures of the support structure to form a basket extending from one side of the support structure that can receive a drill bit. Relative rotation between the support structure and the flexible member causes the flexible member to tighten to make or break the connection between the drill bit and the drill string. |
| US11598163B2 |
Catwalk tubular measurement and method of use
A carrier assembly for a catwalk assembly includes a carrier. The carrier assembly includes a skate to move a tubular member along the carrier. The carrier assembly includes a proximity sensor positioned to detect the end of the tubular member as it moves along the carrier. The carrier assembly includes a skate position sensor. The length of the tubular member may be determined by measuring the position of the skate relative to the proximity sensor when the end of the tubular member passes the proximity sensor. |
| US11598159B2 |
Coupling for connecting downhole tubulars
A coupling for connecting downhole tubulars includes a tubular body, and at least one thread of a male screw thread formed on an outer surface of the body, and a female screw thread formed in an inner surface of the body. The at least one thread has a thread-form including a crest, a root, and a pair of flanks. The crest and the root are each cambered about a respective first and second camber radius. Each camber radius is greater than an outer diameter of the coupling. |
| US11598158B2 |
Angled transmission line tension anchor for drill string components
An apparatus for retaining a transmission line within a drill string component includes a drill string component comprising a bore having an internal diameter. A slot is formed in the internal diameter to receive a transmission line. A first feature within the slot is configured to engage a corresponding second feature on the transmission line and thereby retain an end of the transmission line. The first feature comprises a first angled surface configured to contact and engage a corresponding second angled surface of the second feature. The first and second angled surfaces are oriented such to keep the transmission line retained within the slot when tension is placed on the transmission line. A corresponding system is also disclosed. |
| US11598152B2 |
Real-time fault diagnostics and decision support system for rotary steerable system
A method and system for a rotary steerable system (RSS). The method may comprise disposing the RSS into a borehole, identifying a failure from the one or more tracking measurements, the mechanical operation of the RSS, or the one or more sensors from a diagnostic review. Additionally, the method may further comprise flagging the failure with a failure code and reporting the failure and its mitigation actions to personnel in real time. The system may comprise one or more sensors configured to measure a location the RSS in a formation from one or more tracking measurements and monitor a mechanical operation of the RSS. The system may further comprise an information handling system. |
| US11598151B2 |
Downhole power drilling tool having multi-stage dual plunger eccentric gear mechanism
A downhole power drilling tool includes a flow distribution shaft, an outer pipe and a multi-stage eccentric gear driving mechanism which are coaxially arranged, the flow distribution shaft is suspended and supported in the outer pipe by the multi-stage eccentric gear driving mechanism. |
| US11598148B2 |
Retractable support connector
An improved roller shade system provides increased support, additional adjustments and/or increased safety. The slip plate allows the brake to slip forward and minimize damage to the clutch spring when a user pulls too hard on the hembar. The center drive mechanism extends through a bracket to allow the drive shaft to distribute power in both directions and drive two shade tube simultaneously. The tube adapter absorbs force from the spinning shade tube to minimize damage to the other components and the bead chain. The sprocket has a back wall supporting the sprocket, allowing the sprocket 130 to rest on the back flange of the sun gear to minimize pressure on the gears. An adjustment arm is adjusted to help level the shade band. The shade bands may be removed without disturbing the other shade bands in the system. A height of a hembar may be adjusted by rotating a rod within the hembar. |
| US11598147B2 |
Roller blind shaft
A novel roller blind shaft is provided, comprising a roller blind having a reel, a lower curtain rod, a curtain fabric arranged between the reel and the lower curtain rod, and a driving device for driving the reel to rotate. A bearing seat is correspondingly provided at both ends of the reel. The novel roller blind shaft comprises: moving devices, which are respectively a first moving device and a second moving device arranged parallel to each other, arranged on the bearing seats at both ends of the reel and perpendicular to the reel and configured to drive the reel to move back and forth to adjust a gap between the curtain fabric and the wall, and a control device electrically connected to the first and second moving devices and configured to synchronously control the first and second moving devices to synchronously drive the reel to move back and forth. |
| US11598134B2 |
Door closer arrangement
The aim of the invention is to achieve a door closer arrangement (1) where the force needed for opening the door (2) is not so substantial. The invention comprises a door closer (6), a slide rail (7), and an arm (8) that connects the door closer with the slide rail. The arrangement comprises also a second rail (9), which is arranged to form a slide slope for the door closer (6) and the auxiliary spring arrangement. |
| US11598133B2 |
Self-aligning door bogie
A door roller includes a carriage member comprising a plurality of bores, and a plurality of roller assemblies connected to the carriage member, each roller assembly of the plurality of roller assemblies including a pivot bearing rotatably disposed within a bore of the plurality of bores and a pair of rollers coupled to the pivot bearing. Each wheel assembly is configured to pivot relative to the carriage member. |
| US11598132B2 |
Double shaft 180 degrees rotation sheet metal mechanism
The present disclosure is directed to a system for providing substantially 180 degrees, or more, of rotation between a sheet metal door mounted on a sheet metal sidewall of a chassis, relative to the chassis. The system includes a first and a second shaft passing through a module positioned between the door and the sidewall, whereby the door rotates about the two shafts, where the two shafts are not axially aligned. The chassis may hold sleds of a server, and the door may further comprise multiple linking modules, such that the sleds are coupled to the linking modules when the door is in a closed position, and the sleds are slid home within the chassis. |
| US11598128B2 |
Flush handle device for controlling vehicle door latch
A vehicle door device includes: a latch mechanism configured to be switchable between a latch state and an unlatch state; a door handle configured to be movable between a first position and a second position; a door handle projecting mechanism configured to move the door handle from the first position to the second position when a press portion provided on an outer surface of the door handle or in a peripheral portion of the outer surface of the door handle is pressed; and an electrical unlatch operation mechanism including a switch and an electric actuator, the switch being operated by the door handle or the door handle projecting mechanism when the press portion is pressed, and the electric actuator being configured so that, when the switch is operated, the electric actuator is operated to switch the latch mechanism from a latch state to an unlatch state. |
| US11598126B2 |
Product merchandising systems with enhanced security features
This disclosure is directed to product merchandising systems that are designed to prevent brute force attempts to steal a product on display. The merchandising systems include security features that enhances the strength of the connection between a puck assembly and a base assembly and between the base assembly and a display surface. The merchandising systems are suited for withstanding brute force pulling attacks on the puck assembly and the base assembly. |
| US11598124B2 |
Multipoint locking door hardware
A lock system includes an active panel center gearbox. The active panel center gearbox includes a deadbolt, a deadbolt drive to extend or retract the deadbolt, an upper drive assembly, a lower drive assembly, a latch bolt, a handle assembly to retract the latch bolt and to extend or retract the lower and the upper driver assemblies, a reverse action rocker coupling the lower and the upper drive assemblies so they move in different directions, a mishandling bolt, and a mishandling plate. When the mishandling bolt extends, it lowers the mishandling plate. When the mishandling plate lowers, it engages the deadbolt to prevent the deadbolt from extending, it engages the handle assembly to prevent the lower drive assembly from extending, and it engages the reverse action rocker to prevent the upper drive assembly from extending. |
| US11598121B2 |
Electronic lock state detection systems and methods
An electronic key may include a partial capacitor comprising a capacitive metal plate in communication with a processor. The capacitive metal plate of the partial capacitor is configured to form a capacitor with a corresponding capacitive metal plate of a lock when brought into proximity with the metal plate of the lock. Data may be transferred from the key to the lock using a capacitor formed by combining the two metal plates, wherein a common ground is established between the metal plate of the key and the metal plate of the lock through a parasitic capacitance present between the key and lock circuitry. Audit trail data may be recorded based on usage of the key. |
| US11598119B2 |
Securable deadbolt, hinge, and sliding assemblies
Various disclosed embodiments include a lock assembly. The lock assembly includes a lock bolt. The lock bolt has a lock bolt body and having a bolt security engagement feature formed as part of the lock bolt body. The lock assembly also includes a receiver. The receiver has a receiving area for receiving at least a portion of the lock bolt and the receiver has a receiver security engagement feature formed as part of the receiver. The receiver security engagement feature is complementary to the lock bolt security engagement feature. |
| US11598117B2 |
Gate corner insert
A gate assembly is disclosed including a gate rail and an upright including a plurality of walls defining a cavity therebetween. A first of the walls includes an opening that is configured to receive the gate rail therethrough such that the gate rail extends into the cavity. The gate assembly further includes a gate corner insert configured for insertion into the cavity of the upright through a second opening of the upright. The gate corner insert includes a base and a plurality of protrusions extending from the base. The base and the plurality of protrusions define a second cavity therebetween with first and second protrusions of the plurality of protrusions defining a third opening in communication with the second cavity. The third opening and the second cavity are configured to receive the gate rail therein for removable attachment to the gate corner insert. |
| US11598116B1 |
Mounting system for separating and connecting fencing slabs
A mounting system for separating and connecting fencing slabs which includes an end beam assembly having opposite sidewalls each having an elongated slot portion recessed within the beams. Additionally, at least one gate partition with distal ends is inserted within the recessed portion of the end beam. The distal end of the partitions includes a cap which conforms to the shape of the slot portion thereby allowing for the partition to be slidably inserted therein. Once inserted, a spacer member is then inserted within the slot portion to create spacing between the partitions inserted to the end beams when forming the fencing structure. A slidable cover is also included to entirely cover a side of the end beam when not in use. The system is utilized to form a desired fencing structure. |
| US11598115B2 |
Wire strand attachment clip
A wire strand attachment clip including a wire catch that defines a wire strand receiving and holding area configured to receive a wire strand, and a plurality of attachment arms connected to and extending from the wire catch that are dimensionally and biasingly configured to be positioned on a support post to attach the wire strand to that support post such that the attachment arms engage multiple surfaces of the support post. |
| US11598110B2 |
Tiered pool system
A diving pool includes a first tiered section extending to a first depth of the diving pool, a second tiered section extending to a second depth of the diving pool that is deeper than the first depth, and a cover. The cover can be releasably positioned within the diving pool at a depth of the diving pool to isolate a shallower portion of the diving pool above the cover at the depth from a deeper portion of the diving pool below the cover at the depth. |
| US11598104B2 |
System and method for aligning and leveling tile
A tile aligning and leveling system that uses an under tile base re-usable upright connecting tab, which is detachably connected to said under tile base, a re-usable flexible edge slotted cap configured to slip over the connecting tab and latch thereto as the cap is slid further down the connecting tab. The cap has an edge slot so that the connecting tab can be separated from the cap, by merely sliding the cap, so that the connecting tab passes through the slot. A flexible spring-like portion of the cap provides increased force on the tile even if undesired elongation of the connecting tab occurs. |
| US11598102B2 |
Panel support system and method
It is known to secure a panel 1 within a trough 3 by placing one edge of the panel 1 within the trough 3 and filling the trough with resin 21. Once hardened, the resin 21 holds the panel 1 in place securely. However, panels 1 thus secured cannot be removed easily if damaged. The present invention provides a barrier 11, 13 for preventing flow of liquid resin 21 along a length of a trough 3, and for receiving a panel 1 thereon. A panel 1 may therefore be secured within a trough 3 with a reduced amount of resin 21. |
| US11598100B1 |
Roof sheath connecting apparatus and associated method of use
An apparatus for connecting roof sheathing, including: (a) a left side member, wherein the left side member includes a length, a top surface, and a bottom surface; (b) a first upright member, wherein the first upright member includes a length, an outer surface, and an inner surface, and wherein the first upright member emanates contiguously and substantially orthogonally from the left side member; (c) a second upright member, wherein the second upright member includes a length, an outer surface, and an inner surface, and wherein the second upright member emanates contiguously from and substantially parallel to the first upright member; and (d) a right side member, wherein the right side member includes a length, a top surface, and a bottom surface, and wherein the right side member emanates contiguously and substantially orthogonally from the second upright member. |
| US11598099B2 |
Exposed structure heating apparatus and methods of making and use
Structure heating systems and methods of making and use. One embodiment has a unitary or integral roof edge heating element with a single heating cable mounted in a heating cable channel running laterally through the heating element and a roof edge heating panel extending from the portion of the heating element bearing the heating cable. Another embodiment includes a single heating cable mounted in a heating element surrounded by a heating element cover. Some embodiments can reduce the amount of heat transfer contact with supporting roof or adjacent structure, reducing heat transfer to the supporting roof or other adjacent structure. |
| US11598097B2 |
Colored solar-reflective roofing granules, roofing products including them, and methods for making them
The present disclosure relates to roofing granules, such as colored solar-reflective roofing granules, and to methods for making and their use in roofing products. One aspect of the disclosure provides a collection of colored solar-reflective roofing granules, wherein substantially each roofing granule includes an inner layer of a porous ceramic material, the pore size and material of the inner layer being selected such that the inner layer is substantially reflective of infrared radiation; and disposed about and substantially surrounding the inner layer, an outer layer of a substantially colored ceramic material, the outer layer of substantially colored ceramic material being substantially transmissive to infrared radiation, the collection of colored solar-reflective roofing granules having a L* of no more than 60 and a solar reflectivity of at least 30%. |
| US11598095B2 |
High solids color face and edge coatings for building panels
Described herein is a coated building panel having a body and a surface coating atop the body, the surface coating comprising inorganic pigment and a polymeric dispersant comprising a polymer backbone and pendant side chains extending from the polymer backbone; wherein the surface coating comprises a liquid carrier in an amount less than about 1 wt. % based on the total weight of the surface coating. |
| US11598090B2 |
Deck framing system
A deck framing system includes a perimeter support member that has a joist support wall and a web wall extending perpendicularly from the joist support wall and an overhang wall extending perpendicularly from the web wall. First and second joist support brackets include a joist support portion and a pair of attachment wings, where each one of the pair of attachment wings contacting the web wall of the perimeter support member. First and second joists each include a deck support wall and a lower wall. The deck support walls of the first and second joists are disposed between the overhang wall and the joist support portions, and the lower walls are disposed between the joist support portions and the joist support wall. |
| US11598088B2 |
Fire-stopping product
A fire-stopping material for use in sandwich panels is provided, wherein the fire-stopping material comprises a resilient, porous material at least partially impregnated with an intumescent agent. A panel for an internal wall and an internal wall are also provided, comprising the fire-stopping material disposed between two substantially parallel boards, such as plaster boards. A method of providing a service penetration through an internal wall is also provided. |
| US11598084B2 |
Metal shear connector structure for adjacent concrete panels
Adjacent concrete wall panels are connected at the vertical joint by a shear connector structure that includes a metal connector angle embedded in a corner portion of one of the panels, and one or more threaded nuts or studs are welded to a flange of the angle. A metal shear connector plate has a hole for each threaded nut or stud and elongated holes or slots for the other concrete panel. After the panels are erected and positioned, the connector plate is bolted to the studs and self-tapping concrete anchor screws are inserted into the slots and threaded into holes formed in the other panel. The studs are formed by machinery weld studs to form a bore with threads at the welded end of each stud. |
| US11598082B2 |
Column cap
A column cap connector for mounting and securing a beam to a post of a building including a central web portion and upwardly extending walls disposed along longitudinal edges thereof, wherein a lower portion of the beam fits within the walls, downwardly extending legs formed from the seat and alternatively from the seat and the walls of the connector attach the connector to the post with projecting tabs attached to the seat to support the connector on the post. |
| US11598081B2 |
Cable feed control mechanism for drain cleaner
A drain cleaner including a cable configured to be inserted into a drain, a drum supporting the cable, a first motor operable to rotate the drum, and a cable feed control mechanism configured to feed the cable in a linear direction along a first axis. The cable feed control mechanism includes a second motor, a drive wheel rotatable by the second motor about a second axis that is perpendicular to the first axis, and a driven wheel rotatable about a third axis that is parallel to the second axis. The drive wheel and the driven wheel are configured to engage the cable to feed the cable along the first axis. |
| US11598079B2 |
Flush toilet
A flush toilet includes a toilet main body and a control unit. The toilet main body includes a skirt, a rear storage configured to store at least a part of the control unit, and an opening to which a drain pipe is connected is formed penetrating, in a front-rear direction, a portion below a center in a left-right direction of a rear wall of the skirt. The rear storage forms a discharge socket storage on a front side of the opening in a region below a center of the rear storage in the left-right direction. And a side wall surface in the discharge socket storage protrudes more in a center direction of the opening than a side wall surface in the opening, to reduce an opening cross-sectional area of the discharge socket storage to be smaller than an opening cross-sectional area of the opening. |
| US11598078B2 |
Flushing assembly, water supply assembly, lower position water suction assembly, water tank, check valve for use in a toilet, and method, device, and storage medium for controlling toilet water consumption
The present disclosure provides a water supply assembly of a toilet comprising a water input pipe, a water tank, a water suction pump and a water output pipe; wherein the water input pipe is connected to the water tank; clean water enters the water tank through the water input pipe; the water tank is connected to the water suction pump connected to the water output pipe; the water suction pump pumps the clean water inside the water tank into the water output pipe; the water tank comprises a main water tank portion, an auxiliary water tank portion, and a water equalizing pipe connecting between and through the main water tank and the auxiliary water tank. The present disclosure provides a flushing assembly, a water suction assembly, and a check valve for use in the toilet. The present disclosure provides a method, device, and storage for controlling toilet water consumption. |
| US11598077B2 |
Apron front sink with interchangeable faces
A sink includes a basin configured to hold water, an apron extending from a front of the basin and having a plurality of walls and a rear surface defining an opening in a front of the apron, and a panel assembly removably received in the opening, where an outer perimeter of the panel assembly is spaced apart from an inner perimeter of the plurality of walls of the apron. |
| US11598075B2 |
Recycling device and a method therein for recycling used water from a used water source
A recycling device (200) for recycling used water from at least one used water source (100, 101) is provided. The recycling device (200) comprises a first water tank (210) arranged to receive used water from the at least one water source (100), and sensor means (211) arranged to measure the water quality of used water in the first water tank (210). The recycling device (200) is characterized in that it comprises a second water tank (220) arranged to store used water within the recycling device (200), and a water pump (240) and one or more valves (231, 232, 233, 234, 235; 301). The pump (240) and one or more valves (231, 232, 233, 234, 235; 301) arranged in the recycling device (200) such that used water is able to be stored in the second water tank (220), or recycled out of the recycling device (200) from the first water tank (210) or from the second water tank (220), when the water quality of the used water is above a determined threshold level. Also, a method and a computer program performed and executed in the recycling device (200) for recycling used water from at least one used water source (100, 101) are also provided.Furthermore, a recycling system (400) comprising a recycling device (200) and at least one used water source (100, 101) and a recycling system (400) comprising a recycling device (200), at least one used water source (100, 101) and at least one water consumption device (100, 102) are also provided. |
| US11598074B2 |
Tooth mounting structure for bucket and tooth for bucket
A tooth mounting structure for a bucket includes a tooth adapter and a tooth. The tooth adapter includes a mounting portion mounted to the bucket and a nose portion extending from the mounting portion. The tooth includes an internal space for inserting the nose portion. The nose portion includes a rectangular tip portion, a rectangular base end portion and an octagonal connecting portion. An inner surface of the tooth is formed along an outer surface of the nose portion. |
| US11598072B2 |
Work vehicle debris accumulation control systems
A debris accumulation control system is provided for usage within a work vehicle including an operator station and a work vehicle compartment. In embodiments, the work vehicle debris accumulation control system includes a display device located in the operator station of the work vehicle, a three dimensional (3D) imaging device having a field of view (FOV) encompassing a debris-gathering region of the work vehicle compartment, and a controller operably coupled to the display device and to the 3D imaging device. The controller is configured to: (i) utilize 3D imaging data provided by the 3D imaging device to estimate a debris accumulation risk level within the work vehicle compartment; and (ii) generate a first visual alert on the display device when the debris accumulation risk level surpasses a first predetermined threshold. |
| US11598069B2 |
Microdredging system and method of using the same
Microdredging systems comprising a pumping platform and loading platform. In certain embodiments, system operates autonomously and is adapted to allow the loading platform undock from the pumping platform for disposal of the removed sediment. |
| US11598068B2 |
Drawbar assembly for a motor grader
A drawbar assembly for a motor grader is provided. The drawbar assembly defines a longitudinal axis and includes a first frame member and a second frame member. The first frame member is adapted to be movably coupled to main frame of the motor grader. The first frame member includes a first base member extending along longitudinal axis and a first mating portion bent away relative to first base member to extend transversely relative to longitudinal axis. The second frame member includes a second base member extending along longitudinal axis and a second mating portion bent away relative to second base member to extend transversely relative to longitudinal axis. The second mating portion is configured to mate with first mating portion to form a connection joint therebetween, facilitating the first frame member and second frame member to be conjoined to together support a circle assembly of the motor grader thereunder. |
| US11598067B2 |
Quick coupler circuit of construction machine with automatic pressurization system
A quick coupler circuit includes a cylinder to attach and/or detach an attachment to and/or from a construction machine by expansion and/or contraction, a flow pump to supply fluid to the cylinder, a valve through which fluid for operating the cylinder passes, a spool valve which includes a spool, to move along an axial direction, and to form a pressure at a node of the flow pump according to movement of the spool, an electronic proportional pressure reducing valve to control the spool valve, a switch to perform an ON/OFF operation, and a controller to output a control current to the electronic proportional pressure reducing valve in response to the operation of the switch. The controller is maintains control current which it outputs during the switch's ON operation for a predetermined period of time after the switch's OFF operation. |
| US11598063B2 |
Pile guide and adjustable mounting
A pile guide has a collar with a void therein. A planar flange extends from a side of the collar. A first guide and a second guide form opposing guides constructed and arranged for receiving the planar flange of the pile guide therein. The planar flange is in a slidable relationship within the opposing guides, and the bracket is constructed and arranged for mounting to a dock. The opposing guides pivot relative to the dock during installation and allow pivoting of the pile guide relative to the dock or other mounting. The distance and angle of the collar relative to the dock or other mounting can be adjusted to accommodate for positioning of pile guides due to positioning of piles relative to a dock or other structure. |
| US11598054B2 |
Road finishing machine with indirect lighting of a working area
A road finishing machine comprises a tractor and a screed hinged to the tractor to be towed behind the tractor. At the tractor, a main control platform of the road finishing machine is provided which offers space for an operator and comprises operational controls for controlling functions of the road finishing machine. The main control platform has a roof, wherein a lighting unit with a light source is provided at the roof. The lighting unit comprises a housing which accommodates the light source and has a reflector. The reflector is configured to reflect light emitted by the light source into a working area of the screed so that the working area of the screed is illuminated indirectly. |
| US11598050B2 |
Process for providing coating layer comprising micro fibrillated cellulose
The present invention relates to a new process for providing a coating layer on a moulded article comprising fibers. In the present invention, a coating dispersion is prepared that comprises microfibrillated cellulose (MFC), a slip aid and at least one hydrocolloid. |
| US11598049B2 |
Process of producing nanofibrillated cellulose with low energy consumption
The present invention refers to the separation of cellulose pulp into distinct fractions with different draining and morphological characteristics, as well as the use of part of these fractions for the production of nanocellulose. The process in reference combines the unitary operations of fiber separation, thickening to a certain consistency, draining and drying of the cellulosic pulp with the high drainage ability and production of nanocellulose from high primary fines content pulp. The process may consider any cellulosic pulp fiber derived from short or long fiber woods such as Eucalyptus, Corymbia, Birch, Aspen, Pinus, recycled fibers, etc., their residues such as bark, sawdust, etc. |
| US11598047B2 |
Process for producing fibrous material with antimicrobial properties
The application relates to a process for producing fibrous material with antimicrobial properties, wherein in the first step coniferous resin acid composition is emulsified into aqueous solution with emulsifier and wetting agent, and in the second step thus formed emulsion is transferred into fibrous material by impregnation. Further, the application relates to an aqueous antimicrobial composition for use as a water-soluble concentrate in the treatment of fibrous materials, and to a fibrous material with antimicrobial properties, and to its use in e.g. fabrics, fur, leather, clothes, canvas, tissues, plastics, webs, accessories, packaging materials, wallpapers, food-related products, household products, footwear, construction materials, insulating materials and medical products. |
| US11598042B2 |
Laundry treating appliance with induction heat
A laundry treating appliance comprising a combination washer/dryer having a cabinet defining an interior, a tub provided within the interior, and a drum rotatably provided within the tub and defining a treating chamber, and a method of operation which includes a washing cycle, a spinning cycle and a drying cycle. |
| US11598041B2 |
Microbubble generator and laundry treating device
A microbubble generator and a laundry treating device. The microbubble generator includes: an air dissolving tank, having an air dissolving cavity defined therein, and an inlet and an outlet configured to allow water to flow in and out, the inlet being located above the outlet; a baffle, provided in the air dissolving tank, at least partially located between the inlet and the outlet in a horizontal direction, and provided with a gap and/or a through hole; and a cavitator, provided outside the air dissolving tank and connected with the outlet, or provided at the outlet. |
| US11598032B2 |
Web support, production method therefor, and patterning method
A web support with a high degree of patterning freedom and excellent durability, a production method therefor, and a patterning method. The web support is used when applying a pattern to a nonwoven substance by jetting a high-pressure water stream on a web. The web support production method comprises: a step of preparing a flat metal base material; a step for forming, by etching, a first water conduction hole and second water conduction hole that pass through the front surface of the base material to the back surface, and a recess on the front surface of the base material that includes the first water conduction hole and that corresponds to the pattern; and a step for forming the base material into a cylindrical main body section by welding the edges of the base material to each other. |
| US11598031B2 |
Article including multi-component fibers and hollow ceramic microspheres and methods of making and using the same
An article comprising hollow ceramic microspheres and multi-component fibers is disclosed. The multi-component fibers are adhered together, and the hollow ceramic microspheres are adhered to external surfaces of the multi-component fibers. A method of making the article and use of the article for insulation are also disclosed. |
| US11598027B2 |
Methods and systems for forming a composite yarn
A method and system for forming composite yarns having selected performance characteristics including cut resistance and/or fire/heat resistance. The composite yarn will include a core of one or more filaments and a fiber bundle wrapped about the core and integrated with one or more additional filaments that help bind the fibers about the core. An additional filament or other composite yarn can be plied together therewith to form the finished composite yarn. The core filament(s) will be selected from cut and/or fire/heat resistant materials, while the fibers of the fiber bundle and the additional filament(s) wrapped about the core can be selected from natural or synthetic fibers or filaments having additional desired properties. |
| US11598026B2 |
Spun-blown non-woven web
A spun-blown non-woven web is disclosed which is formed from a plurality of fibers formed from a single polymer having an average fiber diameter ranging from between about 0.5 microns to about 50 microns; a basis weight of at least about 0.5 gsm; a tensile strength, measured in a machine direction, ranging from between about 20 g to about 4,200 g; a ratio of tensile strength, measured in the machine direction, to basis weight of at least about 20:1; and a ratio of percent elongation, measured in the machine direction, to fiber diameter of at least about 15. |
| US11598022B2 |
Vapor phase epitaxy method
A vapor phase epitaxy method of growing a III-V layer with a doping that changes from a first conductivity type to a second conductivity type on a surface of a substrate or a preceding layer in a reaction chamber from the vapor phase from an epitaxial gas flow comprising a carrier gas, at least one first precursor for an element from main group III, and at least one second precursor for an element from main group V, wherein when a first growth height is reached, a first initial doping level of the first conductivity type is set by means of a ratio of a first mass flow of the first precursor to a second mass flow of the second precursor, then the first initial doping level is reduced to a second initial doping level of the first or low second conductivity type. |
| US11598017B2 |
Method of plating
There is provided a method of plating comprising: a process of bringing a sealing portion of a seal provided to prevent a contact of a substrate holder that holds a substrate from coming into contact with a plating solution, into contact with pure water; and a process of detecting a leak of the seal, based on presence or absence of a short circuit of a leak detection electrode placed inside of the substrate holder after the sealing portion is brought into contact with the pure water and before the substrate is brought into contact with a chemical solution. |
| US11598014B2 |
Electrolytic remote ion source and ion recycle (ISIR) module
An ion source and ion recycle module includes an electrolyte reservoir, an eluent recovery chamber, and an ion exchange connector. The electrolyte reservoir includes a chamber containing an aqueous electrolyte solution including an electrolyte having a chamber inlet and a chamber outlet, and a first electrode. The chamber inlet is fluidically connected to a source chamber of an electrolytic eluent generator and configured to receive depleted electrolyte solution from the source chamber of the electrolytic eluent generator. The chamber outlet is fluidically connected to the source chamber of the electrolytic eluent generator and configured to provide recycled electrolyte solution to the electrolytic eluent generator source chamber. The eluent recovery chamber including a second electrode and configured to receive an eluent solution including eluent counter ions from the eluent generator; and the ion exchange connector including an ion exchange membrane stack. |
| US11598013B2 |
Electrochemical hydrogen compressor and method for operating electrochemical hydrogen compressor
An electrochemical hydrogen compressor includes: a cell including a proton conductive electrolyte membrane having a pair of principal surfaces, a cathode disposed on a first one of the principal surfaces of the electrolyte membrane, and an anode disposed on a second one of the principal surfaces of the electrolyte membrane; a voltage applicator that applies a voltage between the anode and the cathode; a dew point adjuster that adjusts a dew point of a hydrogen-containing gas to be supplied to the anode; and a controller that, when the temperature of the cell increases, controls the dew point adjuster to increase the dew point of the hydrogen-containing gas. |
| US11598005B2 |
Deposition apparatus including an off-axis lift-and-rotation unit and methods for operating the same
A deposition chamber includes a vacuum enclosure, an electrostatic chuck having a flat top surface located within a vacuum enclosure, a lift-and-rotation unit extending through or laterally surrounding the electrostatic chuck at a position that is laterally offset from a vertical axis passing through a geometrical center of the electrostatic chuck, a gas supply manifold configured to provide influx of gas into the vacuum enclosure, and a pumping port connected to the vacuum enclosure. |
| US11598000B2 |
Method, materials and process for native oxide removal and regrowth of dielectric oxides for better biosensor performance
Methods of removing native oxide layers and depositing dielectric layers having a controlled number of active sites on MEMS devices for biological applications are disclosed. In one aspect, a method includes removing a native oxide layer from a surface of the substrate by exposing the substrate to one or more ligands in vapor phase to volatize the native oxide layer and then thermally desorbing or otherwise etching the volatized native oxide layer. In another aspect, a method includes depositing a dielectric layer selected to provide a controlled number of active sites on the surface of the substrate. In yet another aspect, a method includes both removing a native oxide layer from a surface of the substrate by exposing the substrate to one or more ligands and depositing a dielectric layer selected to provide a controlled number of active sites on the surface of the substrate. |
| US11597997B2 |
Apparatus, method, and recording medium storing command for controlling thin-film deposition process
The present disclosure discloses an apparatus. The apparatus according to the present disclosure may include a communication interface, one or more memories, and one or more processors. The one or more processors may be configured to: control the thin-film deposition devices to execute the thin-film deposition process by accessing the memory and executing a recipe; obtain in-process thin-film state data of the thin film from the thin-film measurement result received via the communication interface during the thin-film deposition process; and derive post-process thin-film state data of the thin film from the process condition data, the sensing data, and the in-process thin-film state data using a first correlation model. |
| US11597995B2 |
Method of manufacturing mask and method of manufacturing display device
Provided are a method of manufacturing a mask that has a high precision configured to minimize a shadow effect, and a method of manufacturing a display device. The method of manufacturing a mask includes: tensioning a mask sheet; bonding the mask sheet that is tensioned to a mask frame; and forming an opening in the mask sheet by irradiating laser light on the mask sheet such that an inner wall of the opening has a slope with respect to a surface of the mask sheet. |
| US11597994B2 |
Method of manufacturing display apparatus
A method of manufacturing a display apparatus includes: sequentially fixing a display substrate and a mask assembly to a carrier; transporting the mask assembly and the display substrate to a deposition unit via the carrier; and depositing a deposition material on the display substrate by passing the deposition material through the mask assembly, by using the deposition unit. |
| US11597993B2 |
Monolayer-by-monolayer growth of MgO layers using mg sublimation and oxidation
A MgO layer is formed using a process flow wherein a Mg layer is deposited at a temperature <200° C. on a substrate, and then an anneal between 200° C. and 900° C., and preferably from 200° C. and 400° C., is performed so that a Mg vapor pressure >10−6 Torr is reached and a substantial portion of the Mg layer sublimes and leaves a Mg monolayer. After an oxidation between −223° C. and 900° C., a MgO monolayer is produced where the Mg:O ratio is exactly 1:1 thereby avoiding underoxidized or overoxidized states associated with film defects. The process flow may be repeated one or more times to yield a desired thickness and resistance×area value when the MgO is a tunnel barrier or Hk enhancing layer. Moreover, a doping element (M) may be added during Mg deposition to modify the conductivity and band structure in the resulting MgMO layer. |
| US11597988B2 |
Apparatus and methods for depositing molten metal onto a foil substrate
A web coating platform for depositing molten metal on flexible substrates is provided. The web coating platform can be used for manufacturing solid lithium anodes for use in energy storage devices, for example, rechargeable batteries. The coating platform can be designed for double-sided coating of a continuous flexible substrate (e.g., a copper foil) with molten lithium followed by double-sided lamination or passivation. The coating platform integrates novel coating elements unique to handling and processing molten metals. For example, some implementations of the present disclosure incorporate double-sided molten metal coating elements, which include at least one of a molten metal application assembly (e.g., kiss roller, slot-die, Meyer bar, and/or gravure roller), a primary melt pool assembly, a secondary melt pool assembly, and an engagement mechanism. |
| US11597985B2 |
Aluminum alloy composition and manufacturing method thereof
The present disclosure provides a manufacturing method of an aluminum alloy composition. The manufacturing method includes the following steps in the sequence set forth: (S1) providing an aluminum master alloy, wherein the aluminum master alloy comprises aluminum and copper; (S2) adding chromium to the aluminum master alloy and performing a first melting; (S3) adding a tantalum-chromium alloy and performing a second melting; and (S4) adding silver and performing a third melting to form the aluminum alloy composition. |
| US11597982B2 |
Production process of fine-grained austenitic stainless steel
A process of producing a fine-grained austenitic stainless steel, the process comprising a step of subjecting a fine-grained austenitic stainless steel comprising: C: 0.15 wt % or less, Si: 1.00 wt % or less, Mn: 2.0 wt % or less, Ni: 6.0 to 14.0 wt %, Cr: 16.0 to 22.0 wt %, and Mo: 3.0 wt % or less, with the balance being Fe and inevitable impurities, and having an average grain size of 10 μm or lower, to an annealing treatment at a temperature from 600° C. to 700° C. for 48 hours or longer. |
| US11597981B2 |
Preparing method of engine valve
A method of preparing an engine valve is provided. The method includes hot forging a heat resistant steel at 1,150 to 1,250° C. to mold a valve, aging the molded valve and hollowed-out processing the aging valve. Additionally, the method includes nitride-heating the hollow valve and grinding a surface of a neck of the nitride-heated valve to remove a nitride layer. |
| US11597979B2 |
Methods and compositions for detecting risk of cancer relapse
The present invention relates to methods and compositions for reducing the risk of cancer relapse in a subject who has received cancer treatment. It is based, at least in part, on the discovery that a restricted fraction of the gut microbiota, including the bacteria Streptococcus anginosus, Parvimonas micra, Acidaminococcus intestini, Eubacterium limosum, Clostridium glycyrrhizinilyticum, Desulfosporosinus lacus, Eubacterium biforme, Anaerofustis stercorihominis, Pseudoramibacter alactolyticus, Peptococcus niger, Armatimonas rosea, Saccharofermentans acetigenes, Finegoldia magna, Levyella massiliensis, Gallicola barnesae, Murdochiella asaccharolytica, and Eubacterium brachy are associated with a reduced risk of cancer relapse. |
| US11597978B2 |
Personalized pain management and anesthesia: preemptive risk identification and therapeutic decision support
Methods and compositions disclosed herein generally relate to methods of improving clinical and economic outcomes to address adverse effects related to anesthesia, analgesics, opioids, and inadequate pain relief. Embodiments of the invention relate to the association between genes, specific polymorphisms of genes, and non-genetic factors with inadequate pain relief and anesthesia-, analgesic, and/or opioid-related adverse effects. Embodiments of the invention can be used to determine and manage patient risk factors for development of adverse perioperative effects and can allow for personalized anesthesia and pain management for improvement of pain control and reduction of anesthesia-, analgesic-, and opioid-related adverse outcomes. These methods and compositions apply to non-surgical pain management with opioids. Therefore, patients who are genetically predisposed to risk of inadequate pain relief and/or serious side effects from anesthesia, analgesics, and/or opioids can be identified and individualized treatment plans developed for implementation by the clinician to improve clinical and economic outcomes. |
| US11597973B2 |
Compositions and methods for detecting rare sequence variants
In some aspects, the present disclosure provides methods for identifying sequence variants in a nucleic acid sample. In some embodiments, a method comprises identifying sequence differences between sequencing reads and a reference sequence, and calling a sequence difference that occurs in at least two different circular polynucleotides, such as two circular polynucleotides having different junctions, as the sequence variant. In some aspects, the present disclosure provides compositions and systems useful in the described methods. |
| US11597968B2 |
Ribonucleic acid (RNA) interactions
The invention relates to a method for analysing ribonucleic acid (RNA) interactions comprising: a) cross-linking base-paired nucleotides of at least one RNA molecule and/or at least one pair of RNA molecules using a tagged, reversible cross-linking agent (preferably tagged-psoralen) under ultraviolet irradiation; b) fragmenting the said cross-linked RNA molecule(s); c) using said tag to extract said cross-linked RNA fragment(s); d) ligating the said cross-linked RNA fragment(s) to produce cross-linked ligated RNA chimera(s); e) reversing the cross-linking of the said agent to the said RNA molecule(s); f) preparing a sequence library by sequencing the ligated RNA chimera molecule(s) or pair(s); and g) analysing the sequence library to determine RNA interactions. Also disclosed is a method of studying a subject by analysing RNA interactions and attributing them to a clinical picture, or a drug discovery method by attributing an efficacy score to the drug based upon determined RNA interactions. |
| US11597966B2 |
Non-invasive diagnosis of graft rejection in organ transplant patients
The invention provides methods, devices, compositions and kits for diagnosing or predicting transplant status or outcome in a subject who has received a transplant. |
| US11597961B2 |
Rapid colorimetric diagnostic test for C. difficile
In certain aspects, provided herein are methods and kits for detecting the presence of C. difficile in a biological sample. Also provided herein are methods of selecting of identifying a subject that would benefit from C. difficile treatment. |
| US11597959B2 |
Methods for increasing mannose content of recombinant proteins
The present invention relates to methods of upregulating the high mannose glycoform content of a recombinant protein during a mammalian cell culture by manipulating the mannose to total hexose ratio in the cell culture media formulation. |
| US11597955B2 |
Systems and methods for producing a sugar stream
An improved dry grind system and method for producing a sugar stream from grains or similar carbohydrate sources and/or residues, such as for biofuel production. In particular, a sugar/carbohydrate stream, which includes a desired Dextrose Equivalent (DE) where DE describes the degree of conversion of starch to dextrose (aka glucose) and/or has had removed therefrom an undesirable amount of unfermentable components, can be produced after saccharification and prior to fermentation (or other sugar conversion process), with such sugar stream being available for biofuel production, e.g., alcohol production, or other processes. In addition, the systems and methods also can involve the removal of certain grain components, e.g., corn kernel components, including protein, oil and/or fiber, prior to fermentation or other conversion systems. In other words, sugar stream production and/or grain component separation occurs on the front end of the system and method. |
| US11597952B2 |
Method for the production of carboxylic acids under unsterile conditions
The aim of the invention is to provide a method for biotechnological production of carboxylic acids, in which the acid-forming micro-organisms are cultured in an unsterile manner in a submerged phase containing waste water containing all carbon and nutrient medium components necessary for the production of the carboxylic acid, which method avoids the disadvantages of known methods and enables high product concentrations and productivity while at the same time the resources of water and power are being conserved. This aim is achieved, according to the invention, in that micro-organisms are used that are cultured under unsterile conditions in a culture medium containing waste water with the addition of carbon-rich compounds. |
| US11597943B2 |
Transgenic plant exhibiting enhanced growth and method for producing same
A transgenic plant which exhibits a growth capacity which is enhanced compared to that of a host plant, and has a chimeric protein of a peptide containing an amino acid sequence derived from a motor domain of myosin XI of a donor plant 1, which is a plant species other than the host plant, and a peptide containing an amino acid sequence derived from a domain other than the motor domain of myosin XI of a donor plant 2, which is the host plant or a plant species other than the host plant, the transgenic plant being characterized in that the motor domain loop 2 region has EEPKQGGKGGGKSSFSSIG or EEPKQGGGKGGSKSSFSSIG, and in addition to these sequences, has an amino acid sequence in which one to six amino acids have been deleted, replaced or added. |
| US11597939B2 |
Binary vectors and uses of same
The invention relates to binary vectors based on compatible and autonomous origins, specifically based on the pBBR1 and RK2 replication origins. These binary vectors are useful for having a wide range of hosts, for their maintenance in Agrobacterium sp. and Escherichia coli, and as a new tool for plant synthetic biology as well as a flexible framework for assembly, transfer and characterization of multiple DNA elements. The binary vectors disclosed are small, preferably less than 3.8 kb in size, stable, include an origin compatible with the most commonly used binary T-DNA vectors, comply with current standards for plant synthetic biology, and allow the administration of multiple T-DNA cassettes by means of the multiplexing of the vectors. The present invention also relates to methods for transferring and expressing nucleic acid sequences using said binary vectors, and to the uses of the same. |
| US11597937B2 |
System and method of modular cloning
System for producing a nucleic acid construct of interest, said system comprising: a set of n entry DNAs numbered 1 to n, n being an integer of at least 2, each of said n entry DNAs comprising in this order: (i) a type IIs restriction endonuclease recognition site followed by the cleavage site thereof; (ii) a sequence portion linking the cleavage site of said recognition site of item (i) with the cleavage site of the recognition site of the following item (iii), and (iii) a cleavage site of a further type IIs restriction endonuclease recognition site followed by the recognition site of said cleavage site; the cleavage sites of the type IIs restriction endonuclease recognition sites of item (iii) of entry DNAs 1 to n−1 are complementary to the cleavage sites of the type IIs restriction endonuclease recognition sites of item (i) of entry DNAs 2 to n, respectively; the cleavage site of the type IIs restriction endonuclease recognition site of item (iii) of entry DNA n is complementary to the cleavage site of the type IIs restriction endonuclease recognition site of item (i) of entry DNA 1 for allowing annealing of complementary single-stranded overhangs formed by restriction at recognition site (i) of entry DNA 1 and at recognition site (iii) of entry DNA n; said system further comprising a destination vector comprising in this order: (I) a type IIs restriction endonuclease recognition site followed by the cleavage site thereof; (II) a vector backbone preferably comprising a selectable marker gene, said vector backbone linking the cleavage sites of said recognition sites of items (I) and the following item (III); (III) a further cleavage site of a type IIs restriction endonuclease recognition site followed by the recognition site of said cleavage site, and (IV) optionally, an insert between the recognition sites of item (III) and item (I); said cleavage sites of items (I) and (III) being different and non-complementary, said recognition sites of items (I) and (III) being preferably recognitions sites of the same endonuclease. |
| US11597933B2 |
Combination therapy of lymphoma
The present disclosure provides for methods and compositions for treating cancer. A subject having lymphoma is administered an EZH2 inhibitor and an HDAC inhibitor. The combination of the EZH2 inhibitor and the HDAC inhibitor produces a synergistic effect on the cancer compared to the effect of the EZH2 inhibitor or the HDAC inhibitor alone. |
| US11597926B2 |
Thiophosphoramidites
The present invention relates to a compound of formula (II) or (IIb) Wherein X, Y, Rx, Ry, R5 and Nu are as defined in the description and in the claims. The compound of formula (II) can be used in the manufacture of oligonucleotides. |
| US11597924B2 |
Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
The application provides improved methods of genome editing. The genome editing systems described herein comprise a RNA-guided nuclease molecule and a Repair-Modulating Enzyme Molecule (RMEM). |
| US11597921B2 |
Automated cell processing methods, modules, instruments, and systems
In an illustrative embodiment, automated multi-module cell editing instruments are provided to automate multiple edits into nucleic acid sequences inside one or more cells. |
| US11597919B2 |
Systems, methods and compositions for sequence manipulation with optimized functional CRISPR-Cas systems
The invention provides for systems, methods, and compositions for altering expression of target gene sequences and related gene products. Provided are structural information on the Cas protein of the CRISPR-Cas system, use of this information in generating modified components of the CRISPR complex, vectors and vector systems which encode one or more components or modified components of a CRISPR complex, as well as methods for the design and use of such vectors and components. Also provided are methods of directing CRISPR complex formation in eukaryotic cells and methods for utilizing the CRISPR-Cas system. In particular the present invention comprehends optimized functional CRISPR-Cas enzyme systems. |
| US11597915B2 |
Material and method for producing cell receiving scaffold
A printable composition for the manufacture of cell-receiving scaffolds comprising about 0.3 wt % to about 3.0 wt % of one or more collagens; about 5.0 wt % to about 40.0 wt % of one or more monomers; about 0.5 wt % to about 2.0 wt % of a photo initiator; and 0 wt % to about 75 wt % of a vehicle comprising a protic solvent, by weight of the printable composition; wherein the printable composition has a resolution of about 100 microns or less when printed, a photo speed (Dp/Ec) of about 0.1-5 mm (Dp) and about 10-100 mJ/cm2 (Ec) when printed, and a green strength of at least about 5 kPa after drying. The present technology further includes methods of manufacturing a three-dimensional cell-receiving scaffold using the printable composition. |
| US11597912B2 |
Method of producing regulatory T cells by culturing regulatory T cells obtained from umbilical cord blood
The present disclosure provides a method for producing a population of regulatory T cells comprising culturing an initial population of regulatory T cells obtained from umbilical cord blood in a media comprising an oligonucleotide having the sequence of AATCGTAACCGTCGTATCGGCGAT (SEQ ID NO: 1) to expand the initial population of regulatory T cells, and a method of treating an autoimmune disease comprising administering to a subject in need thereof an effective amount of a composition comprising the regulatory T cells prepared by the above method. |
| US11597911B2 |
Expansion of populations of T cells by the use of modified serum free media
This invention relates, inter alia, to compositions of low serum or serum free media and methods for the expansion of T cell populations and methods for using such populations of cells. In some aspects, the invention relates to compositions and methods for the selective expansion of T cell subpopulations. |
| US11597910B2 |
Medical instrument, cell culture method, fluorine-containing cyclic olefin polymer and fluorine-containing cyclic olefin polymer composition for it, and cultured cells
Medical instrument includes a substrate, in which cells are in contact with or held on a surface of the substrate, and at least the surface of the substrate which holds the cells is formed of a fluorine-containing cyclic olefin polymer which contains a repeating structure unit represented by Formula (1), wherein in Formula (1), at least one of R1 to R4 is fluorine, an alkyl with 1 to 10 carbon atoms which contains fluorine, an alkoxy with 1 to 10 carbon atoms which contains fluorine, or an alkoxyalkyl with 2 to 10 carbon atoms which contains fluorine, R1 to R4 are selected from hydrogen and certain non-fluorinated groups when R1 to R4 do not contain fluorine, R1 to R4 may be the same as or different from each other, and R1 to R4 may be bonded to each other to form a cyclic structure. |
| US11597908B2 |
Freeze-resistant yeast and uses thereof
Freeze-resistant baker's yeast (Saccharomyces cerevisiae) strains and uses thereof. For example, for the preparation of fresh or frozen dough products, e.g., bread. The freeze-resistant baker's yeast strains, which are, e.g., obtainable from specific deposited strains, e.g., by breeding these strains with each other or with other Saccharomyces cerevisiae strains. Methods of using said strains or methods of preparing a dough or a dough product or a yeast product are also provided. |
| US11597905B2 |
Cell culture and tissue engineering systems with controlled environmental zones
An automated cell culture and tissue engineering system comprising defined and separate environmental zones provide for increased control and maintenance of the internal environment of the system such that the temperature, air flow and gases surrounding the bioreactor module form one zone that is maintained separately to a second zone formed surrounding the reagent fluid reservoir. The system further comprises means for elimination and/or management of condensation within the second zone of the system. |
| US11597904B2 |
Liquid filtration system with integrated bleed function
A liquid filtration system according to the present invention comprises a bioreactor; a filter configured to filter liquid passing therethrough; a perfusion pump configured to move liquid between the bioreactor and the filter; a liquid line providing fluidic communication between the bioreactor, perfusion pump and filter; and a bleed outlet provided on the liquid line, the bleed outlet configured to provide means to remove liquid selectively from the system under the action of the perfusion pump. With the liquid filtration system according to the present invention, both the filtering and bleed functions may be performed under the action of a single pump, thereby significantly reducing the complexity and cost of the components required. |
| US11597897B2 |
Water-soluble film and water-soluble unit dose article made therefrom
Water-soluble film and unit dose articles made therefrom, where the water-soluble film includes a water-soluble polymer, where the water-soluble polymer includes a blend of a caseinate polymer and a polyvinyl alcohol homopolymer. |
| US11597893B2 |
Solid laundry softener composition
Solid laundry softening compositions and applications of use are disclosed. Solid laundry softening compositions combine quaternary ammonium compounds with an inorganic carrier to provide a flowable powder for solidification in a pressed or extruded solid composition. A high loading of quaternary ammonium compound in the inorganic carrier, including an inorganic salt, can be further combined with softening boosters, processing aids, surfactants, and/or additional functional ingredients to provide stable solid compositions. |
| US11597892B2 |
Method for washing hard article
The present invention provides a method for washing a hard article, the method including: the contact step of bringing a detergent liquid obtained by mixing (a) a potassium internal olefin sulfonate and (b) water having a hardness of 5° DH or more, into contact with the hard article, and the step of rinsing the hard article after the contact step with water having a hardness of 5° DH or more, wherein the detergent liquid at 30° C. or more is brought into contact with the hard article in at least a part of the contact step. |
| US11597890B2 |
Base stocks and oil compositions containing the same
This disclosure relates to base stocks comprising a C28-C32 hydrocarbon fraction and optionally a C42-C48 hydrocarbon fraction produced by dimerization and trimerization of a linear C14 mono-olefin, a linear C16 mono-olefin, or a mixture thereof, in the presence of a Lewis acid, oil compositions comprising such base stock(s), and processes for making such base stocks. |
| US11597887B2 |
Environment-friendly marine fuel
For the shipping industry, these fuels provide solutions to long outstanding technical problems that heretofore hindered supply of low sulfur marine fuels in quantities needed to meet worldwide sulfur reduction goals. Marine shipping use of high sulfur bunker oils is reported as largest source of world-wide transportation SOx emissions. When ships on the open seas burn cheap low grade heavy bunker oils high in sulfur, nitrogen and metals, the SOx, NOx, and metal oxides go to the environment. This invention converts essentially all of each barrel of crude feed to a single ultraclean fuel versus conventional refining where crude feed is cut into many pieces, and each piece is sent down a separate market path meeting various different product specifications. When in port, ships can use these fuels to generate and sell electricity to land based electrical grids to offset fuel cost in an environment-friendly manner. |
| US11597885B2 |
Methods of whole crude and whole crude wide cut hydrotreating and dewaxing low hetroatom content petroleum
Methods of refining a whole crude oil stream. The methods involve first processing the crude either through a hydrotreating reactor comprising a dewaxing reactor bed or a flash evaporation separator. The treated streams are then further processed through a demetalization reactor bed, a hydroprocessing reactor bed, or both. The stream can then be still further processed via additional hydrotreating, distillation, or both. |
| US11597874B2 |
Photochromic curable composition
A photochromic curable composition comprising a radically polymerizable monomer having at least one oxetanyl group in one molecule, a photochromic compound and radically polymerizable monomers other than the above polymerizable monomer, and a photochromic cured body obtained by polymerizing the photochromic curable composition. |
| US11597871B1 |
Aqueous well treatment composition and method for treating a sandstone formation
Provided is a method for treating a sandstone formation with a well treatment composition. The method may include introducing a pre-flush pill, introducing the well treatment composition, introducing a post-flush fluid, and maintaining the wellbore such that the well treatment composition interacts with the sandstone formation. Further provided is a method that may introduce the well treatment composition as two pills, such as an organic acid pill and an inorganic acid pill. The well treatment composition may include an aqueous solution of an ammonium salt, an inorganic acid, an organic acid, and optionally one or more of a pH adjuster, a mutual solvent, a surfactant, and a corrosion inhibitor. |
| US11597868B2 |
Composition for remediating iron sulfide in oilfield production systems
A composition for inhibiting corrosion and/or removing hydrocarbonaceous deposits in oil and gas applications is provided. The composition comprises an iron sulfide dissolver, an organic solvent, and a corrosion inhibitor. |
| US11597860B2 |
Magnetizable abrasive particle and method of making the same
Magnetizable abrasive particles are described comprising ceramic particles having outer surfaces comprising a coating of unsintered polyion and magnetic particles bonded to the polyion. In favored embodiments, the magnetic particles have a magnetic saturation of at least 10, 15, 20, 25, 30, 35, 40, 45 or 50 emu/gram. In another embodiment, an abrasive article is described comprising a plurality of magnetizable abrasive particles as described herein retained in a binder material. Also described are method of making magnetizable abrasive particles and methods of making an abrasive article comprising magnetizable abrasive particles. |
| US11597859B2 |
Solvent cement formulations having extended shelf life
Disclosed are solvent cement formulations having beneficial stability and performance characteristics that include a thermoplastic resin, one or more organic solvents, an inhibitor of an oxidation-reduction reaction, and a heat stabilizer. |
| US11597855B2 |
Thermally activatable latently reactive adhesive film
The invention relates to a thermally activatable reactive adhesive film comprising a carrier film made of thermoplastic polyurethane, which is coated on at least one side with a latently reactive, thermally activatable adhesive compound. |
| US11597852B2 |
Clay-polyacrylate composites suspension via in situ polymerization
The present disclosure relates to a clay-polyacrylate composite comprising layers of clay intercalated with polyacrylate, wherein the layers of clay comprises at least one organosilane coupling agent comprising an acrylate moiety; and wherein the polyacrylate comprises a first acrylate monomer and a second acrylate monomer having different solubility. A surfactant-free method of synthesizing the said clay-polyacrylate composite and a method for coating are also provided. In a preferred embodiment, the first acrylate monomer is a hydrophilic acrylate monomer, e.g. 2-hydroxyethyl acrylate, and the second acrylate monomer is a hydrophobic acrylate monomer, e.g. 2-ethylhexyl acrylate. The clay-acrylate composite can be used for forming a barrier coating, which exhibits low water and low oxygen permeability. |
| US11597850B2 |
Ink fluid set for printing on offset media
The present disclosure provides an ink fluid set containing an aqueous pretreatment composition and an aqueous inkjet ink. This ink fluid set is particularly suitable for printing on offset coated media. |
| US11597849B2 |
Quantum dot material and method of curing
Print materials described herein include a first polymerization initiator comprising an initiator material having a thermal decomposition rate and a peak photo-initiated decomposition rate, wherein the thermal dissociation rate is higher than the peak photo-initiated decomposition rate; a vinylic monomer; a polyfunctional monomer; scattering particles; and quantum dots. Methods of making a quantum dot material using such print materials, and of incorporating into light emitting devices, are also described. |
| US11597847B2 |
Plasma-curable offset printing ink composition, method for producing printed matter using same, and printing method
A plasma-curable ink composition for offset printing having high reactivity with plasma and capable of being hardened into a sufficiently dried state even in the use of plasma generated by a remote-type plasma generator, and a method for producing printed matter and a method for printing information using the same. The plasma-curable ink composition for offset printing comprises a pigment, a binder resin, and at least one specific ingredient selected from the group consisting of castor oil, polymerized oil, and alkyd resins having an acid value of 10 mg KOH/g or more. |
| US11597846B2 |
Methods and compositions for inhibiting corrosion on metal surfaces
Methods and compositions for inhibiting corrosion of a metal product are provided. The metal product can be contacted with water that includes at least one carbonate and/or bicarbonate salt, or otherwise has components that increase the alkalinity of the water. In addition, or as an alternative, the water can include a stannous corrosion inhibitor. The water can be evaporated off of a surface of the metal product to provide a residual of the salt on the surface and/or a protective stannous film on the surface. |
| US11597840B2 |
Emulsions of beta-ketocarbonyl-functional organosilicon compounds
Aqueous emulsions contain: (A) β-ketocarbonyl-functional organosilicon compounds having at least one Si—bonded radical A of the formula (Si)-L1-[X1-L2-]yX2 (I) where L1 are divalent, Si—C-bonded C1-18 hydrocarbon radicals, L2 are divalent C1-6 hydrocarbon radicals, X1 is a radical —O—, —NZ—, —NR2— or —S—, X2 is a radical —O—Z, —NH—Z, —NR2—Z, —S—Z, Z is a radical —C(═O)—CHR3—C(═O)—CH2R3, R2 is a monovalent C1-18 hydrocarbon radical, R3 is a monovalent, optionally substituted C12 hydrocarbon radical atoms, y is 0, 1, 2 or 3 (B) at least one salt of a saturated or unsaturated fatty acid having at least 10 carbon atoms, and (C) water, with the proviso that no nonionic emulsifier having an HLB of less than 15 is present. |
| US11597839B2 |
Methods for making an object and formulations for use in said methods
The present invention relates to formulations for use in 3-D printing using radiation from visual display screens. The formulations comprise titanocene photoinitators and co-initiators. The invention also relates to methods of forming 3-D objects using said formulations. |
| US11597838B2 |
Matted polyamide-pud
Polymers are disclosed that incorporate portions of secondary or tertiary polyamide segments connected with polyisocyanates. These polymers have enhanced matting properties. The enhanced matting properties are from creating an inherently matt surface from the polymer without the use of any separate fine particle size matting additives. Conventional matting agents such as fine particle size silica usually results in loss of physical properties such as haze development and porosity in the coating from the matting agent. Composites and hybrids of these polymers and other polyamides, polyurethane with vinyl polymers (acrylates) are also disclosed and claimed. |
| US11597837B2 |
Thermosetting resin composition for semiconductor package, prepreg and metal clad laminate using the same
The present disclosure relates to a thermosetting resin composition for a semiconductor package including a modified phenylene ether oligomer or a modified poly(phenylene ether) having ethylenically unsaturated groups at both ends thereof; a thermosetting resin; a predetermined elastic (co)polymer; and an inorganic filler, and a prepreg and a metal clad laminate including the same. |
| US11597833B2 |
Thermoplastic resin composition for laser welding, molded article made of same, and composite molded article
Provided is a thermoplastic resin composition suitable for laser welding which has a laser transparency, a good laser weldability, mechanical properties, a high hydrolysis resistance, a laser-welded composite molded article such as a composite article obtained by laser-welding molded resin parts, and a method of laser welding such molded resin articles. The thermoplastic resin composition contains (A) polybutylene terephthalate, (B) polycarbonate, (C) reinforcing fiber, (D) epoxy compound, (E) carbodiimide compound, and (F) phosphorus-based stabilizer. |
| US11597829B2 |
Resin composition for fiber-reinforced composite materials and fiber-reinforced composite material using same
Provided is a resin composition that exhibits satisfactory impregnability into reinforcing fibers, while having rapid curability, and that is suitable for fiber-reinforced composite materials producing molded articles having high heat resistance. A two-pack resin composition for fiber-reinforced composite materials is configured of a base material including an epoxy resin (A) and a (meth)acrylate compound (B) having three or more (meth)acryloyl groups in a molecule, and a curing agent including an amine compound (C) represented by the following general formula (1), a mass ratio of the base material to the curing agent being within the range of from 85:15 to 65:35, Wherein the epoxy resin (A) includes 75% by mass to 100% by mass of a bisphenol A epoxy resin; the base material has a viscosity of 10,000 mPa·s or less; and the curing agent has a viscosity of 800 mPa·s or less. X—(CH2NH2)n (1) (In the formula, X represents an n-valent organic group having 1 to 16 carbon atom; and n represents 2 or 3). |
| US11597827B2 |
Resin composition, pellet, composite molded article, method for manufacturing composite molded article and tank
To provide a resin composition, a pellet, a composite molded article, a method for manufacturing a composite molded article and a tank, all capable of enabling tight joining and integration of the polyacetal resin molded article and the polyethylene resin molded article, and of suppressing formaldehyde emission and occurrence of mold deposit. The resin composition contains a resin ingredient and melamine, the resin ingredient containing a polyacetal resin and a maleic anhydride-modified polyethylene resin, the polyacetal resin and the maleic anhydride-modified polyethylene resin following a mass proportion of (20 to 49):(80 to 51), and molar concentration of the maleic anhydride group capable of reacting with amino group of melamine contained in the resin composition being 5 to 25 μmol/g. |
| US11597825B2 |
Resin composition, sheath cable, and wire harness
A resin composition includes a resin component including an ethylene-(meth)acrylate copolymer and at least either an ethylene-propylene-diene terpolymer or ethylene acrylate rubber. A content of the ethylene-(meth)acrylate copolymer with respect to a total content of the ethylene-(meth)acrylate copolymer and at least either the ethylene-propylene-diene terpolymer or the ethylene acrylate rubber is 35% by mass or greater and 90% by mass or less. A tensile stress at 19% strain of the resin composition is 2.0 MPa or less, and a tensile stress at break of the resin composition is 10.3 MPa or greater. |
| US11597823B2 |
Acrylic rubber composition
An acrylic rubber composition comprising 0.05 to 3.0 parts by weight of a fluorine-containing compound having a melting point of 30 to 100° C., based on 100 parts by weight of acrylic rubber. The acrylic rubber composition that can improve the dispersibility of a processing aid in the compound and the rubber compound handling properties during open roll operation without using a silicone-based processing aid, which causes bleeding of vulcanizates, and that satisfies the various characteristics, such as dimensional stability and heat resistance, of vulcanizates. |
| US11597820B2 |
Rubber composition and tire comprising sustainable resources and related methods
Recycled elements and/or renewable resources, such as recycled carbon black or recycled carbon black and recycled particulate rubber, are incorporated into a rubber composition. The rubber composition can be used to manufacture tires or various tire components including tire subtreads. |
| US11597814B2 |
Heat resistant aerogel materials
The present disclosure provides an aerogel composition which is durable and easy to handle, which has favorable performance in aqueous environments, and which also has favorable combustion and self-heating properties. Also provided is a method of preparing an aerogel composition which is durable and easy to handle, which has favorable performance in aqueous environments, and which has favorable combustion and self-heating properties. Further provided is a method of improving the hydrophobicity, the liquid water uptake, the heat of combustion, or the onset of thermal decomposition temperature of an aerogel composition. |
| US11597812B2 |
Method for preparing ultra high molecular weight polyethylene composite materials
The present invention provides a method for preparing an ultra high molecular weight polyethylene (UHMWPE) composite material including the following steps: providing a substrate material having medical grade ultra high molecular weight polyethylene powders, drying the substrate material to obtain fully dried UHMWPE powders, and pressing the fully dried UHMWPE powders to form a UHMWPE board; immersing the UHMWPE board into a graphene oxide solution and performing an ultrasonic induction by an ultrasonic processor such that the graphene oxide solution infiltrates into the UHMWPE substrate to obtain an ultra high molecular weight polyethylene composite material with excellent biocompatibility and tribological properties. The graphene oxide can be adsorbed and evenly spread on the surface of UHMWPE substrate by ultrasonic induction to form a lubricating film which can effectively reduce wear. |
| US11597809B2 |
Method for preparing nano attapulgite and phenolic aerogel and method for preparing abrasion-resistant vehicle tire
A method for preparing an aerogel comprising nano attapulgite and phenolic aldehyde and a method for preparing abrasion-resistant vehicle tire. 80-100 weight distributions of rubber, 3-8 weight distributions of SiO2.nH2O, 3-6 weight distributions of an anti-aging agent, 3-4 weight distributions of a heat stabilizer, 3-5 weight distributions of a compatibilizing agent, and 3-12 weight distributions of the aerogel comprising the nano attapulgite and the phenolic aldehyde is selected as a raw material of the abrasion-resistant rubber material to prepare rubber composite material for the abrasion-resistant vehicle tire. |
| US11597803B2 |
Superabsorbent polymer and method for preparing the same
The present invention relates to a superabsorbent polymer that not only has excellent basic absorption performance, but also exhibits more improved absorption speed, permeability, etc., and a method for preparing the same. The superabsorbent polymer includes a base polymer powder including: a first crosslinked polymer of water soluble ethylenically unsaturated monomers having acid groups of which at least a part are neutralized; and a surface crosslink layer that is formed on the base polymer powder, and further includes a second crosslinked polymer in which the first crosslinked polymer is additionally crosslinked by a C2-5 alkylene carbonate, wherein an absorption degree, SFC, an absorption speed, and a porosity fulfill specific ranges. |
| US11597802B2 |
Foam control composition
Foam control compositions along with formulations thereof and their use in various applications, including a method for making a foam control composition comprising a cross-linked polyorganosiloxane material including a dispersed silica filler, including the steps of: A) preparing a hydrosilylation reaction mixture by combining the following components: (i) silica filler, (ii) a polyorganosiloxane having at least two reactive substituents capable of addition reaction with component (iii) via hydrosilylation, (iii) a polyorganosiloxane having at least three reactive substituents capable of addition reaction with component (ii) via hydrosilylation, and (iv) a hydrosilylation catalyst; B) conducting a hydrosilylation reaction of components (ii) and (iii) until the reaction mixture at least partially gels to form a hydrosilylation reaction product; C) shearing the hydrosilylation reaction product of step B); and D) combining the hydrosilylation reaction product of step C) with a (v) silicone resin and an (vi) condensation catalyst to form a condensation reaction mixture and conducting a condensation reaction between the (v) silicone resin and the hydrosilylation reaction product of step C) to form a condensation reaction product. |
| US11597798B2 |
Porphene, a heterocyclic analog of graphene, methods of making and using the same
Methods of forming a porphene polymeric material are provided. The resulting material can be a porphene or a metalloporphene polymeric material. The structure of the polymer can be selected based on a material provided in the monomer material. Methods of using the polymeric material are also provided. |
| US11597797B2 |
Liquid blend for reaction injection molding, method for producing reaction injection molded body, and reaction injection molded body
The present invention provides: a reaction injection molding liquid mixture comprising a norbornene-based monomer, a metathesis polymerization catalyst that includes tungsten as a center metal, an activator, and an ether compound represented by a formula (1), wherein R1 to R4 are independently an alkyl group having 1 to 6 carbon atoms, the reaction injection molding liquid mixture comprising the activator and the ether compound in a molar ratio (ether compound/activator) of 0.7/1 to 30/1; a method for producing a reaction injection molded product comprising a reaction injection molding step that includes subjecting the reaction injection molding liquid mixture according to any one of claims 1 to 4 to bulk polymerization inside a mold; a reaction injection molded product obtained using the method for producing a reaction injection molded product. Consequently, the present invention provides: a reaction injection molding liquid mixture that makes it possible to obtain a reaction injection molded product that has an excellent surface (surface state) and exhibits excellent strength while preventing a situation in which the resin remains on the surface of the mold when the resin is removed from the mold, a method for producing a reaction injection molded product using the same, and a reaction injection molded product obtained using the method. |
| US11597790B2 |
Synthesis of isoprene-butadiene copolymer rubbers
It has been unexpectedly found that certain neodymium catalyst systems can be used to copolymerize isoprene and 1,3-butadiene to produce random isoprene-butadiene copolymer rubbers which are not tapered. These random isoprene-butadiene copolymer rubbers have properties which are beneficial for use in rubber formulations for manufacturing a wide variety of rubber products, such as tires, hoses, conveyor belts, power transmission belts, and shoe soles. These random isoprene-butadiene rubbers are synthesized by copolymerizing (a) isoprene monomer or a substituted isoprene monomer and (b) 1,3-butadiene monomer in the presence of a neodymium catalyst system, wherein the neodymium catalyst system is prepared by (1) reacting a neodymium carboxylate with an organoaluminum compound in the presence of a conjugated diolefin monomer to produce neodymium-aluminum catalyst component, and (2) subsequently reacting the neodymium-aluminum catalyst component with an alkyl aluminum chloride to produce the neodymium catalyst system. |
| US11597784B2 |
Enhanced yield, structural control, and transport properties of polynorbornenes for natural gas upgrading through Mizoroki-Heck cross-couplings
Gas separation membranes are provided and more particularly, a series of addition-type and ROMP type polynorbornenes with substituents derived from Mizoroki-Heck reactions are provided and have particular utility as gas separation membranes for natural gas upgrading. |
| US11597782B2 |
Processes for producing high propylene content PEDM using tetrahydroindacenyl catalyst systems
The present disclosure provides methods for producing an olefin polymer by contacting a C3-C40 olefin, ethylene and a diene with a catalyst system including an activator and a metallocene catalyst compound comprising a substituted or unsubstituted indacenyl group and obtaining a C3-C40 olefin-ethylene-diene terpolymer typically comprising from 1 to 35 mol % of ethylene, from 98.9 to 65 mol % C3-C40 olefin, and, optionally, from 0.1 to 10 mol % diene. Preferably, a propylene-ethylene-ethylidene norbornene is obtained. |
| US11597781B2 |
Photocurable composition for making layers with high etch resistance
A photocurable composition can comprise a polymerizable material and a photoinitiator, wherein the polymerizable material can comprise at least one acrylate monomer including at least one cyano group (CN-acrylate monomer). The presence of a low amount of the CN-acrylate monomer between 10 wt % and not greater than 30 wt % can lower the contact angle of the composition and may improve the etch resistance of a photo-cured layer made from the photocurable composition. |
| US11597779B2 |
Methods for producing a viscose dope from microbial cellulose
A method for producing a microbial cellulose pulp for the production of viscose dope, the method comprising the step of: exposing a microbial cellulose to a volume of water to form the microbial cellulose pulp for the production of viscose dope, wherein the cellulose concentration in the microbial cellulose pulp is less than 0.040 g of cellulose per mL of pulp. |
| US11597775B2 |
Preparations and methods for treating a GD2 positive cancer
The present invention relates to preparations and methods for treating a GD2 positive cancer by administering a preparation comprising a chimeric or humanized anti-GD2 antibody to a patient, wherein the patient is not concomitantly treated with Interleukin-2 (IL-2 wherein a GD2 positive cancer is treated in the patient. Furthermore, the invention relates to preparations and methods for the treatment of a GD2 positive cancer in a patient, wherein a preparation comprising an anti-GD2 antibody is administered to the patient as a continuous infusion, without concomitantly administering IL-2. The present invention further relates to preparations and methods for the treatment of a GD2 positive cancer in a patient, wherein the one or more anti-GD2 antibody treatment periods is/are preceded, accompanied, and/or followed by one or more treatment periods with a retinoid. |
| US11597772B2 |
Obinutuzumab treatment of a DLBCL patient subgroup
The present invention relates to obinutuzumab (or its functional equivalents) for use in the treatment of a particular biomarker-defined DLBCL patient and a novel DLBCL patient subgroup, respectively. The present invention further relates to a method for treating DLBCL with obinutuzumab (or its functional equivalents) in a patient in need thereof, wherein said patient is a particular biomarker-defined DLBCL patient or belongs to a novel biomarker-defined DLBCL patient subgroup. The present invention further relates to the use of obinutuzumab (or its functional equivalents) for the preparation of a pharmaceutical composition for the treatment of DLBCL in the particular biomarker-defined DLBCL patient/novel DLBCL patient subgroup. The present invention further relates to a method for identifying a particular DLBCL patient/novel DLBCL patient subgroup and a method for diagnosing a novel form of DLBCL and a particular DLBCL patient/novel DLBCL patient subgroup, respectively. |
| US11597771B2 |
Monoclonal antibody directed to FGFR1
The present invention relates to antibodies with specificity for FGFR1. More particularly, the invention relates to monoclonal antibodies that bind specifically to and neutralize human, macaque and mouse forms of FGFR1 with high affinity. The invention also relates to nucleic acids encoding said antibodies, vectors for expression of these nucleic acids, and host cells for producing said antibodies. Further, the invention relates to the use of said antibodies in the diagnosis and/or treatment of cancers. |
| US11597770B2 |
Anti-E-selectin antibodies, compositions and methods of use
The invention provides antibodies, and antigen-binding fragments thereof, that specifically bind to E-selectin. The invention includes uses, and associated methods of using the antibodies, and antigen-binding fragments thereof. |
| US11597769B2 |
Nanobody based imaging and targeting of ECM in disease and development
Methods for developing disease-related nanobodies and related products and kits are provided. The disease-specific proteins are extracellular matrix (ECM) proteins, domains or epitopes that are associated with various aspects of disease and are not present, or are present in very low quantities, in non-diseased individuals. Highly effective nanobodies capable of specifically binding to these ECM protein epitopes useful in in vivo imaging assays, the detection, diagnosis and treatment of diseases as well as monitoring therapeutic progress in a patient with a disease are provided herein. |
| US11597768B2 |
Immunotherapy for hepatocellular carcinoma
Disclosed herein is method for the prevention, delay of progression or treatment of hepatocellular carcinoma in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of an anti-PD-1 antibody, which is an antibody or a fragment antigen binding thereof, specifically binding to human PD-1. |
| US11597763B2 |
Anti-Kv1.3 antibodies, and methods of production and use thereof
Anti-Kv1.3 antibodies (mAbs), particularly mAbs that specifically bind to Kv1.3 with high affinity and/or inhibit Kv1.3 function, are disclosed. The amino acid sequences of the CDRs of the light chains and the heavy chains, as well as consensus sequences for these CDRs, of these anti-Kv1.3 mAbs are provided. Additionally, canonical structures for CDRs in the VH and VL regions of anti-Kv1.3 antibodies are provided. The disclosure also provides nucleic acid molecules encoding the anti-Kv1.3 mAbs, expression vectors, host cells, methods for making the anti-Kv1.3 mAbs, and methods for expressing the anti-Kv1.3 mAbs. Finally, methods of using the anti-Kv1.3 mAbs as therapeutics, such as for preventing or treating an autoimmune disorder, are disclosed. |
| US11597760B2 |
Method of detecting the presence of complement C5
An objective of the invention is to provide anti-C5 antibodies and methods of using the same. The invention provides anti-C5 antibodies and methods of using the same. In some embodiments, an isolated anti-C5 antibody of the present invention binds to an epitope within the β chain of C5 with a higher affinity at neutral pH than at acidic pH. The invention also provides isolated nucleic acids encoding an anti-C5 antibody of the present invention. The invention also provides host cells comprising a nucleic acid of the present invention. The invention also provides a method of producing an antibody comprising culturing a host cell of the present invention so that the antibody is produced. The invention further provides a method of producing an anti-C5 antibody comprising immunizing an animal against a polypeptide which comprises the MG1-MG2 domain of the β chain of C5. Anti-C5 antibodies of the present invention may be for use as a medicament. Anti-C5 antibodies of the present invention may be for use in treating a complement-mediated disease or condition which involves excessive or uncontrolled activation of C5. Anti-C5 antibodies of the present invention may be for use in enhancing the clearance of C5 from plasma. |
| US11597758B2 |
Fermentation process for antibody production
A feedback control mechanism for a fermentation of yeast cells to make recombinant proteins uses a respiratory quotient measurement which adjusts the levels of oxygenation and/or fermentable sugar feed. The feedback control mechanism permits well controlled cultures that produce good amounts of product while avoiding toxic accumulation of ethanol. Additionally, recombinant proteins so produced have excellent qualitative properties, such as excellent homogeneity and proper inter-subunit assembly. |
| US11597754B2 |
Use of the CD2 signaling domain in second-generation chimeric antigen receptors
The present invention provides compositions and methods for treating cancer in a human. The invention includes relates to administering a genetically modified T cell expressing a CAR having an antigen binding domain, a transmembrane domain, a CD2 signaling domain, and a CD3 zeta signaling domain. The invention also includes incorporating CD2 into the CAR to alter the cytokine production of CAR-T cells in both negative and positive directions. |
| US11597752B2 |
Peptides and combination of peptides and scaffolds thereof for use in immunotherapy against colorectal carcinoma (CRC) and other cancers
The present invention relates to peptides, proteins, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated T-cell peptide epitopes, alone or in combination with other tumor-associated peptides that can for example serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses, or to stimulate T-cells ex vivo and transfer into patients. Peptides bound to molecules of the major histocompatibility complex (MHC), or peptides as such, can also be targets of antibodies, soluble T-cell receptors, and other binding molecules. |
| US11597751B2 |
Glycan-binding proteins and related compositions and methods
Glycan-binding proteins, and compositions thereof, are generally described, including methods of making and using such proteins. The proteins may include scaffolds based on easily evolvable DNA-binding proteins, with binding sites able to specifically bind to mono- or disaccharides, such as monosaccharide-binding determinants, disaccharide-binding determinants, more complex carbohydrates, etc. In certain aspects, a protein may be generated starting from a small DNA-binding protein, such as Sso7d. Such glycan-binding proteins may have numerous applications, including in enzyme-linked immunosorbent assays (ELISAs), glycan characterization, cell selection, flow cytometry, histology, imaging, arrays, affinity purification, enzyme-linked visualization, binding to a target for pharmaceutical purposes, etc. |
| US11597749B2 |
Peptide compositions and methods of use
Provided herein are compositions including peptides, pharmaceutical preparations thereof, and methods of preventing photoreceptor death therewith and protecting of retinal cells, including, but not limited to, photoreceptors and retinal pigment epithelium, from Fas- or TRAIL-mediated apoptosis. |
| US11597747B2 |
Heavy vitamin B12 derivatives
The invention discussed in this application relates to vitamin B12-based compounds that are useful as quantitative standards, particularly for the assessment of vitamin B12 deficiency. |
| US11597743B2 |
Glycosyltransferase inhibitors for treatment of solid tumors
The present invention relates to methods of treating bacterial infections and cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a compound of Formula I. Also provided are methods of inhibiting dolichyl-phosphate N-acetylglucosaminephosphotransferase (DPAGT1) in an individual in need thereof, comprising administering to the individual a therapeutically effective amount of a compound of Formula I: |
| US11597741B2 |
Processes and materials for the synthesis of sugar esters found in natural tobacco
A process and materials method for making a glucose tetraester may include reacting glucose with a carboxylic acid to create a glucose pentaester. The glucose pentaester was reacted with a basic reagent to create a glucose tetraester. Glucose was reacted with a carboxylic acid anhydride in the presence of 4-dimethylaminopyridine to create a glucose pentaester product. The glucose pentaester reaction product was separated. The glucose pentaester reaction product was reacted with a basic reagent, wherein the reaction steps may take place at a temperature of about 0° C. to about 60° C. and about ambient pressure, wherein the ratio of the carboxylic acid to the glucose was from about 5:1 to about 50:1, and wherein the ratio of the glucose pentaester to the basic reagent was from about 1:50 to about 1:150. |
| US11597737B2 |
Small molecule inhibitors selective for polo-like kinase proteins
Disclosed are small molecule PLK inhibitors that can target the polo box domain (PBD). Inhibitors can have an atomic mass of about 1000 Da or less and a general structure of For instance, the inhibitors can include an alkyl benzamido benzoic acid core structure. |
| US11597733B2 |
Compounds and compositions for the treatment of parasitic diseases
The present invention provides a compound of formula (Ia) or a pharmaceutically acceptable salt thereof; a method for manufacturing the compounds of the invention, solid forms, combinations of pharmacologically active agents, pharmaceutical compositions and methods of using such compounds and solid forms thereof to treat or prevent parasitic diseases, for example malaria. |
| US11597728B2 |
Monoacylglycerol lipase modulators
Bridged compounds of Formula (I) and Formula (II), pharmaceutical compositions containing them, methods of making them, and methods of using them including methods for treating disease states, disorders, and conditions associated with MGL modulation, such as those associated with pain, psychiatric disorders, neurological disorders (including, but not limited to major depressive disorder, treatment resistant depression, anxious depression, bipolar disorder), cancers and eye conditions. wherein R2, R3 R4, R5 and R6 are defined herein. |
| US11597724B2 |
Herbicidally active 3-phenylisoxazoline-5-carboxamides of tetrahydro and dihydrofuran carboxylic acids and esters
The invention relates to 3-phenylisoxazoline-5-carboxamides of tetrahydro- and dihydrofurancarboxylic acids and esters of the general formula (I) and their agrochemically acceptable salts and to their use in the crop protection sector. |
| US11597723B2 |
Pyrazole derivatives for the treatment of cystic fibrosis
The present invention relates to compounds of Formula (I) or pharmaceutically acceptable salts or solvates thereof. It further discloses a pharmaceutical composition comprising the compounds of Formula (I) and their uses, in particular to modulate CFTR protein or ABC protein activities. |
| US11597720B2 |
Tetrahydronaphthalene and tetrahydroisoquinoline derivatives as estrogen receptor degraders
The present disclosure relates to bifunctional compounds, which find utility as modulators of estrogen receptor (target protein). In particular, the present disclosure is directed to bifunctional compounds, which contain on one end at least one of a Von Hippel-Lindau ligand, a cereblon ligand, inhibitors of apoptosis proteins ligand, mouse double-minute homolog 2 ligand, or a combination thereof, which binds to the respective E3 ubiquitin ligase, and on the other end a moiety which binds the target protein, such that the target protein is placed in proximity to the ubiquitin ligase to effect degradation (and inhibition) of target protein. The present disclosure exhibits a broad range of pharmacological activities associated with degradation/inhibition of target protein. Diseases or disorders that result from aggregation or accumulation of the target protein are treated or prevented with compounds and compositions of the present disclosure. |
| US11597702B2 |
Substituted pyrazoles FFA4/GPR120 receptor agonists
Disclosed are compounds of formula (I) or a pharmaceutically acceptable salt thereof: These compounds have FFA4/GPR120 receptor (FFA4) agonistic properties. Also disclosed are pharmaceutical compositions including these compounds, chemical processes for preparing them and their use in the treatment or prophylaxis of diseases associated with FFA4 receptor activity in animals, in particular humans. |
| US11597701B2 |
Integrin ligands and uses thereof
Synthetic αvβ6 integrin ligands of Formula I having serum stability and affinity for integrin αvβ6, which is a receptor expressed in a variety of cell types, are described. The described ligands are useful for delivering cargo molecules, such as RNAi agents or other oligonucleotide-based compounds, to cells that express integrin αvβ6, and thereby facilitating the uptake of the cargo molecules into these cells. Compositions that include αvβ6 integrin ligands and methods of use are also described. |
| US11597700B1 |
Compound for organic electronic element, organic electronic element using the same, and an electronic device thereof
Provided are a novel compound capable of improving the luminous efficiency, stability and lifespan of a device, an organic electronic element using the same, and an electronic device thereof. |
| US11597699B2 |
MEK inhibitors and methods of their use
Disclosed are compounds of Formula (I) and pharmaceutically acceptable salts and solvates thereof. Such compounds are MEK inhibitors and are useful in the treatment of proliferative diseases, such as cancer. Also disclosed are pharmaceutical compositions containing such compounds as well as methods of using the compounds and compositions of the invention in the treatment of cancer. |
| US11597695B2 |
Method of preparing hydroxyalkylcarboxylic acid esters
A method of preparing an ester by reacting a carboxylic acid with a (C1-C36)alcohol in the presence of a catalyst that is suitable for preparing carboxylic acid esters of monomeric carboxylic acids in high yield. The method reduces by-products of the reaction, in particular esters of dimeric, trimeric and/or oligomeric carboxylic acids. The method requires a minimal excess of alcohol and does not require removal of water and/or carboxylic acid ester from the reaction mixture. The method is particularly suitable for the reaction of hydroxyalkylcarboxylic acids and fatty alcohols. |
| US11597690B2 |
Molten salt catalytic compositions and methods for the cracking of carbon-containing feedstocks
A catalyst composition includes a metal catalyst dispersed in a molten eutectic mixture of alkali metal or alkaline earth metal carbonates or hydroxides. A process for the catalytic cracking of hydrocarbons includes contacting in a reactor system a carbon-containing feedstock with at least one catalyst in the presence of oxygen to generate olefinic and/or aromatic compounds; and collecting the olefinic and/or aromatic compounds; wherein: the at least one catalyst includes a metal catalyst dispersed in a molten eutectic mixture of alkali metal or alkaline earth metal carbonates or hydroxides. A process for preparing the catalyst includes mixing metal catalyst precursors selected from transition metal compounds and rare-earth metal compounds and a eutectic mixture of alkali metal or alkaline earth metal carbonates or hydroxides and heating it. A use of the catalyst in the catalytic cracking process of hydrocarbons. |
| US11597684B2 |
Waterproofing system
A waterproofing system including a functional layer S1 including 10-80 wt.-% of at least one thermoplastic polymer P1 and 10-80 wt.-% of at least one solid particulate filler F, wherein the surface of the functional layer S1 has an Auto-correlation length of waviness W(Sal) of at least 50 μm. Further, a method for producing a waterproofing system and to the use of a mechanical surface treatment step to increase the waviness factor, determined as the ratio of the Root mean square roughness of waviness W(Sq) to the square of the Auto-correlation length of waviness W(Sal), of a surface of a functional layer S1. |
| US11597682B2 |
Building materials comprising agglomerated particles
Roofing granules comprising agglomerated inorganic material, and building materials, such as shingles, that include such roofing granules. By fabricating roofing granules from agglomerating inorganic material it is possible to tailor the particle size distribution so as to provide optimal shingle surface coverage, thus reducing shingle weight and usage of raw materials. Additionally, the use of agglomeration permits the utilization of by-products from conventional granule production processes. |
| US11597680B2 |
Fiber cement flooring products and methods for the production thereof
The present invention relates to fiber cement flooring products. In particular, the present invention provides fiber cement flooring products, at least comprising cement and fibers, characterized in that these fiber cement flooring products comprise amorphous silica in an amount of between about 2 weight % and about 15 weight % compared to the total dry weight of the fiber cement composition of said fiber cement flooring product. The present invention further relates to methods for the production of such fiber cement flooring products as well as uses of such fiber cement flooring products in the building industry. The present invention further relates to fiber cement formulations and fiber cement materials, which are suitable for the production of fiber cement products for flooring applications. |
| US11597676B2 |
Glass-ceramic compositions and laminated glass articles incorporating the same
According to one embodiment, a glass-ceramic composition may include from about 60 mol. % to about 75 mol. % SiO2; from about 5 mol. % to about 10 mol. % Al2O3; from about 2 mol. % to about 20 mol. % alkali oxide R2O, the alkali oxide R2O including Li2O and Na2O; and from 0 mol. % to about 5 mol. % alkaline earth oxide RO, the alkaline earth oxide RO including MgO. A ratio of Al2O3 (mol. %) to the sum of (R2O (mol. %)+RO (mol. %)) may be less than 1 in the glass-ceramic composition. A major crystalline phase of the glass-ceramic composition may be Li2Si2O5. A liquidus viscosity of the glass-ceramic composition may be greater than 35 kP. The glass-ceramic composition may be used to form the glass clad layer(s) of a laminated glass article. |
| US11597659B2 |
Device for treating high-concentration organic wastewater by catalytic hydrothermal gasification
Disclosed is a device for treating high-concentration organic wastewater by catalyst hydrothermal gasification, including a CHG reactor, a temporary wastewater storage tank and a condensing heat exchanger which are sequentially in loop connection. The CHG reactor includes a shell, a thermocouple, a water distribution device, and a packing support. The device of the present disclosure can quickly convert the high-concentration organic wastewater into clean energy or harmless gas at a low temperature under the action of a catalyst, so that the energy consumption of a treatment process is greatly reduced, and the treatment efficiency is improved. The device has potential application prospect. |
| US11597657B2 |
Nitrogen-doped TiO2 nanoparticles and the use thereof in photocatalysis
The invention relates to a photocatalyst that is active under irradiation with UV light, visible light and sunlight, comprising a powder or a ready-to-use nanometric suspension of nitrogen-doped TiO2, wherein the brookite crystalline phase is also present and whose doping nitrogen content (% by weight) is sufficient to ensure photocatalytic activity in the visible region. The photocatalyst can be easily applied to substrates of varying nature. |
| US11597656B2 |
Methods for modifying silicon particles
The invention relates to methods for producing non-aggregated, modified silicon particles by treating non-aggregated silicon particles which have volume-weighted particle size distributions with diameter percentiles d50 of 1.0 μm to 10.0 μm at 80° C. to 900° C. with an oxygen-containing gas. |
| US11597655B2 |
SiC member
A technology for securing favorable appearance of a SiC member, the SiC member includes: a first SiC layer having a first upper surface having a concavo-convex shape and a first lower surface; and a second SiC layer having a second upper surface and a second lower surface, the second lower surface being in contact with the first upper surface and having a concavo-convex shape corresponding to that of the first upper surface. The second SiC layer has a recess concaved from the second upper surface toward the second lower surface side and a flat bottom surface, and the bottom surface of the recess is placed upward of the second lower surface. |
| US11597650B2 |
Method for preparing lithium bis(fluorosulfonyl)imide
The present invention relates to a novel method for preparing lithium bis(fluorosulfonyl)imide and, more specifically, to a method for preparing lithium bis(fluorosulfonyl)imide, capable of simply and economically preparing lithium bis(fluorosulfonyl)imide, which is a lithium salt to be used in an electrolyte solution for a lithium secondary battery, in a high yield and with high purity. According to the present invention, the novel method for preparing lithium bis(fluorosulfonyl)imide can resolve the problem of a conventional technique by reacting a bis(chlorosulfonyl)imide compound, which is a starting material, with a fluorination reagent, and then immediately treating the same with an alkali reagent without purification or concentration, and has an effect of enabling lithium bis(fluorosulfonyl)imide to be simply and economically prepared in a high yield and with high purity. |
| US11597648B2 |
MEMS device manufacturing method and mems device
A MEMS device and a MEMS device manufacturing method are provided for suppressing damage to device parts. An exemplary method of manufacturing a resonance device includes radiating laser light from a bottom surface side of a second substrate to form modified regions inside the second substrate along dividing lines of a first substrate, which has device parts formed on a top surface thereof, and the second substrate, the top surface of which is bonded to the bottom surface of the first substrate via bonding portions. The method further includes dividing the first and second substrates along the dividing lines by applying stress to the modified regions. The bonding portions are formed along the dividing lines and block the laser light. |
| US11597646B2 |
Microfluidic device with manifold
A device includes: a die including a microfluidic device; a polymer substrate formed around the die; and a separate fluid manifold attached to the polymer substrate over the die and on a same side of the substrate as the die, the manifold to deliver fluid to the die. |
| US11597645B2 |
Breakaway assembly
A breakaway assembly including a first connector and a second connector releasably coupleable to the first connector. The assembly is movable between a first configuration in which the first and second connectors are releasably coupled and together define a fluid path through which fluid is flowable, wherein the fluid path includes an at least partially radially extending portion, and a second configuration in which the first and second connectors are not coupled together. The assembly is configured to move from the first configuration to the second configuration when a predetermined separation force is applied to the assembly. The assembly further includes a closure valve positioned in one of the first or second connectors, wherein the closure valve is configured to be in an open position when the assembly is in the first configuration to allow fluid to flow therethrough, and to move to a closed position blocking the at least partially radially extending portion of the fluid path when the assembly moves to the second configuration to generally block the flow of fluid therethrough. |
| US11597642B2 |
Material dispensing device for automated beverage preparation apparatus
A material dispensing device, a material output volume detecting device, and a related damper device for use in an automated beverage preparation apparatus are disclosed. The material output volume detecting device includes: a damper device arranged to operably buffer liquid material flowing therethrough; and a flowmeter arranged to operably measure the flow of liquid material outputted from the damper device. The damper device includes: a damper base having a material entrance hole, a material exit hole, and a material buffer chamber positioned between the material entrance hole and the material exit hole; a diaphragm covered on the material buffer chamber; and a fastening element positioned on the diaphragm and having a hollow portion. When the volume of liquid material within the material buffer chamber exceeds a predetermined amount, the diaphragm deforms to protrude outward, so that a part of the diaphragm enters the hollow portion of the fastening element. |
| US11597639B2 |
Transport apparatus
A transport apparatus includes a body; a fork having one portion supported by the body and another portion protruded from the body; a lifting unit; a control unit; a primary rotatable member mounted at a front end portion of the fork; an auxiliary rotatable member mounted at a rotatable-member-attaching position of the fork closer to a front end portion or a rear end portion of the fork compared to the primary rotatable member; and a step detection unit, disposed at a detection-unit-attaching position of the fork closer to the front end portion or closer to the rear end portion of the fork compared to the auxiliary rotatable member, and the step detection unit configured to detect a step member of a carriage base. The control unit lowers the fork using the lifting unit in response to a detection of the step member by the step detection unit. |
| US11597638B2 |
Oscillating axle for lift device
A machine includes a chassis having a first end and an opposing second end, an axle pivotally coupled to the first end of the chassis, a first actuator coupled to the first end of the chassis, and a second actuator coupled to the first end of the chassis. The chassis defines a longitudinal center axis. The axle is configured to rotate about the longitudinal center axis. The first actuator is positioned on a first lateral side of the longitudinal center axis. The first actuator is extendable to selectively engage a first contact point on the axle. The second actuator is positioned on an opposing second lateral side of the longitudinal center axis. The second actuator is extendable to selectively engage a second contact point on the axle. |
| US11597631B2 |
Magnet assemblies of electromechanical actuators for elevator systems having encapsulated switch
Magnet assemblies of electromechanical assemblies for elevator systems are described. The magnet assemblies include a magnet, at least one rail engagement block, and an encapsulating body encapsulating the magnet and the at least one rail engagement block, wherein the encapsulating body is formed from a non-magnetic material. A target extension is formed from the material of the encapsulating body and extends away from the magnet and the at least one rail engagement block. A proximity switch target is held within the target extension for detection by a proximity switch. |
| US11597630B2 |
Or relating to stairlifts
The disclosure defined by this invention relates to an electronic control facility for a stairlift. The control facility includes an installation mode in which a number of steps to be undertaken at the time of installation of the stairlift are defined. The control facility also includes a user mode in which the operation of the stairlift is controlled by a user. According to the invention, the control facility is configured so that the user mode cannot be entered until all steps in the installation mode have been completed. |
| US11597622B2 |
Medium discharging apparatus, medium processing apparatus, and recording system
A medium discharging apparatus includes a first tray in which a medium is received and placed, a second tray in which the medium discharged from the first tray is received, a discharging mechanism, a curl suppressing member, a link mechanism, a movement mechanism and a cam mechanism. The discharging mechanism discharges the medium from the first tray toward the second tray. The curl suppressing member suppresses curling of the medium discharged from the first tray to the second tray by the discharging mechanism. The curl suppressing member is provided in the link mechanism. The movement mechanism is configured to move the link mechanism and the curl suppressing member in both the discharge direction and a return direction opposite to the discharge direction. The cam mechanism guides movement of the link mechanism. |
| US11597621B1 |
Post-processing apparatus
A post-processing apparatus includes a conveyance unit, a discharge port, a tray, an elevation unit, a detection unit, and a control unit. The conveyance unit conveys a print medium supplied from an image forming apparatus. The discharge port discharges the print medium conveyed by the conveyance unit. The tray is stacked with the print medium discharged from the discharge port and can be raised and lowered in a vertical direction. The elevation unit raises and lower the tray in the vertical direction. The detection unit detects a top surface of an uppermost print medium of one or more sheets of print media stacked on the tray. The control unit controls the conveyance unit and the elevation unit and hold a relative position of the top surface with respect to the discharge port if the print medium is discharged from the discharge port at a first position. The control unit causes the conveyance unit to convey the print medium at a first speed if a discharge time from a first timing indicating the timing relating to discharge of the print medium from the discharge port to a second timing indicating the timing when the print medium is detected by the detection unit is a first time and causes the conveyance unit to convey the print medium at a second speed different from the first speed if the discharge time is a second time. |
| US11597617B2 |
Medium feeding apparatus, image reading apparatus, and medium feeding method
A medium feeding apparatus includes a feed roller that feeds media. A separation roller nips the media together with the feed roller to separate it and is rotated in a first direction to feed the media. A motor applies driving torque to the separation roller in a second direction opposite to the first direction. A torque limiter, when rotation torque applied to the separation roller in the first direction exceeds a preset upper torque limit, causes the separation roller to rotate at idle in the first direction independently of the driving torque. During feeding operations, including feeding of first and second media, a controller that controls the motor provides a break period in which the motor is not driven. The break period contains the timing when a rear edge of the first medium leaves a nip position between the feeding and separation rollers. |
| US11597616B2 |
Feeding device and image forming apparatus
A feeding device includes a loading portion, a lifting mechanism, a conveying unit, a sheet detector, a near-end detector, and process circuitry. The loading portion stacks a plurality of sheets. The lifting mechanism lifts the loading portion. The conveying unit conveys the sheets on the loading portion. The sheet detector detects presence or absence of the sheets on the loading portion at a specified height position. The sheet count detector detects a number of sheets conveyed by the conveying unit. The near-end detector detects a near-end state in which a stack height of the sheets on the loading portion is a specified value or less. The process circuitry controls the lifting mechanism based on a detection result of the sheet detector before the near-end state is detected, and controls the lifting mechanism based on a detection result of the sheet count detector after the near-end state is detected. |
| US11597614B2 |
Center of gravity based drone loading for multiple items
A method for loading an Unmanned Aerial Vehicle with multiple items is disclosed. The method includes determining a weight, size, and Center of Gravity of each of the multiple items. The method also includes positioning the multiple items relative to one another such that a combined Center of Gravity of the multiple items will be positioned within a predetermined region. The method further includes loading the multiple items onto the Unmanned Aerial Vehicle with the combined Center of Gravity of the multiple items positioned within the predetermined region. |
| US11597609B2 |
System and method for slat installation/removal
Systems and methods are provided for conveyor operation and maintenance that employ one or both of a “smart shoe” technology where one or more conveyor shoes incorporate features, such as an RFID tag, and a “missing pin detection” technology where one or more pin components of conveyor shoes incorporate features, such as an RFID tag, allowing selective wireless tracking and identification capability. A conveyor system comprises a shoe management system allowing interactions directly with one or more RFID readers, which can detect, store and/or monitor information associated with “smart shoe” and/or “missing pin detection” RFID tags, where interface between this application and the reader can be implemented via a socket interface. System and method also or optionally provide for unique slat installation and removal. |
| US11597607B2 |
Automated material handling system having carrier pollution management function
An automated material handling system includes: at least one state detecting sensor disposed inside or outside the carrier to detect an internal state of the carrier including a degree of pollution in the carrier; a carrier interface to transmit a carrier state value; a carrier controller including a controller interface disposed on the plate to obtain a carrier state value by communicating with the carrier interface, and a carrier control unit configured to generate carrier management information including the carrier state value obtained through the controller interface and current location information of the carrier and output the carrier management information to a server; and a server configured to analyze an internal pollution state of the carrier based on the carrier management information provided by the carrier controller. |
| US11597606B2 |
System and method for managing migration of road barriers
A road barrier transfer machine includes an improved capstan control system that reduces unwanted migration of road barrier spans without requiring inaccurate visual observations and reliance on outdated scripts. The barrier transfer machine includes a moveable chassis, an entry snout, an exit snout, a conveyor system, a capstan system, and the capstan control system. The capstan control system automatically operates the capstan system or provides instructions to an operator of the machine to maintain the tension and compression of a road barrier span within desired ranges to reduce unwanted migration of the span. |
| US11597603B2 |
Rotating and locking conveyor side guard system
A rotating and locking conveyor side guard system may include an elongate side guard of sheet material having three longitudinal bolt slots therethrough, one at each end and one at the center, and three bolts for securing the side guard to a side of a conveyor through the bolt slots. With the bolts loosened, a user may slide the side guard from side to side, relative to the conveyor, and rotate the side guard about the center bolt to a substantially perpendicular orientation to allow access to an interior of the conveyor through the side of the conveyor. It may then be rotated in a second direction until the first and second bolt slots engage corresponding bolts, in a locked position, to prevent rotation of the side guard. Some systems may include multiple side guards end-to-end in series, each side guard sharing a bolt with each adjoining side guard. |
| US11597601B2 |
Fenestration lowering device
Example aspects of a fenestration-lowering device and a method for using a fenestration-lowering device are disclosed. The fenestration-lowering device can include a frame; a support platform configured to move relative to the frame; and a hydraulic lowering mechanism configured to move the support platform. The method for using the fenestration-lowering device can include providing a hydraulic lowering mechanism for moving a support platform of the fenestration-lowering device from a raised orientation to a lowered orientation; setting a fenestration product on the support platform in the raised orientation; activating the hydraulic lowering mechanism to move the support platform from the raised orientation to the lowered orientation; and removing the fenestration product from the support platform. |
| US11597598B2 |
Handling robot
A handling robot used in a field of warehouse logistics comprises a mobile chassis, and a storage shelf. The storage shelf is mounted to the mobile chassis and comprises a plurality of layered plate components distributed at different heights. The handling robot further comprises a handling device configured to transport a material to a layered plate of the plurality of layered plate components, and a lift component configured to drive the handling device to lift relative to the storage shelf. |
| US11597594B2 |
Lawn refuse bag insert
Example aspects of a lawn refuse bag insert, a lawn refuse disposal assembly, and method for using a lawn refuse disposal assembly are disclosed. The lawn refuse bag insert can comprise a bag stand defining a top stand end and a bottom stand end and comprising an end wall and a first side wall, the first side wall hingedly coupled to the end wall; and a first rake detachably coupled to the bag stand, wherein the lawn refuse bag insert is formed as a blank. |
| US11597589B2 |
Dry bulk hopper system
There is disclosed a dry bulk hopper system that includes a generally frustoconical bottle and a base having a tapered wall that defines a cradle for holding the bottle. The bottle has locking tabs disposed at bottom end thereof that cooperate with engagement ledges to secure the bottle to the base when the bottle has been received into the base in a first orientation, but not in a second orientation. Extruded support columns are disposed inside an interior of the base to distribute loads created by material in the bottle when the system is raised by a forklift. |
| US11597585B2 |
Valve for dispensing a flowable product from a pressurized container
A valve dispenses flowable product from a container. The valve includes a mounting cup for mounting the valve on the container, a seal supported on the mounting cup, and a valve stem extending through the seal. The seal and the valve stem define a generally annular passage section of the valve passage that extends longitudinally along the valve axis radially between the valve stem and the seal. At least one of the valve stem and the seal includes a baffle extending transverse to the valve axis, the baffle defining a flow restriction along the generally annular passage section. |
| US11597584B2 |
Method and apparatus for delivering fluid to an individual
Herein is disclosed an apparatus and method for delivering a fluid to an individual in such a manner that sloshing of the fluid is substantially suppressed, even when the fluid has been only partially consumed. The apparatus includes a reservoir for containing the fluid and a valve in fluid communication with the reservoir. A biasing mechanism exerts a force upon the reservoir, causing it to contract and force fluid through the valve, when the valve is opened. The biasing mechanism and reservoir are housed within a body, according to some embodiments. |
| US11597582B1 |
Double wall insulated beverage housing system with temperature maintenance
The double walled vacuum insulated beverage housing system provides an aperture for receiving a heat transfer unit. The heat transfer unit also provides an aperture for receiving a beverage vessel within the heat transfer unit. The heat transfer unit stores a heat transfer material including but not limited to a fluid, gel, phase change material, or other substance that can be heated or cooled depending upon the desired effect on the beverage. A retention shoulder secures the heat transfer unit adjacent an insulating chamber to insulate both the heat transfer unit and the beverage. |
| US11597576B2 |
Packaging for pressure and gas sensitive products
Disclosed are improved devices, systems and methods for storing, protecting and/or dispensing/delivering products that are particularly sensitive to pressure changes, alterations in gas distributions and/or partial pressures, physical impacts, temperature changes and/or other variations in the ambient environment. |
| US11597572B2 |
Food product packaging
Food products can be stored and sold in packaging. For example, a perishable food product can be stored in a first compartment of a packaging, and a second food product can be stored in a second compartment. The first compartment can include a modified atmosphere to increase the shelf life of the food product in the first compartment. The second compartment can be under normal atmosphere. This allows a more perishable food product to be stored in the first compartment, and a prepackaged, or otherwise less perishable food product to be separately stored in the second compartment, while extending the shelf life of the food products. The first product could be a sandwich, and the second product be one or more condiments for the sandwich. |
| US11597569B2 |
Can comprising a first, dispense opening and second, vent opening and a single pull tab
A can for containing a liquid has a top end having a dispense area defined by a first score line and a pull tab coupled to the top end by a rivet. The pull tab has a puncturing end for breaking the first score line and pushing into the interior of the can without detaching the dispense area to open a dispense aperture. A vent area is defined by a second score line and positioned on the opposite side of the rivet. The first and second score lines are separated by at least one torsion stripe of the can top material for acting as a hinge by torsion upon lifting the actuating end of the pull tab. As the dispense aperture is opened by pushing the dispense area into the interior of the can, a vent aperture is opened by pulling the vent area outwards. |
| US11597566B2 |
Seal box with good sealing effect and easy to open
A seal box with a good sealing effect and easy to open comprises a box body and a sealing cover, wherein the box body is formed with an opening, a sealing mechanism is disposed between the opening of the box body and the sealing cover, the sealing cover is detachably mounted at the opening of the box body, and the sealing mechanism is in a locked and sealed state; and a quick opening mechanism is further disposed between the box body and the sealing cover. By means of the quick opening mechanism, users can easily and quickly operate the operating end of an opening element to force the parts, between the area where the opening end is located of the sealing cover and the opening of the box body, of the sealing mechanism to be separated. |
| US11597564B2 |
Adjustable recording herb and spice shaker
A shaker device includes a storage body, a lid, and a measurement system. The storage body also includes an opening and a hollow area. The storage body is configured to retain and selectively dispense an amount of a material disposed in the shaker device. The opening is disposed on a terminal end of the storage body. The lid is selectively disposed over the opening. The measurement system is configured to identify an amount of the material within the shaker device. |
| US11597561B2 |
Compound bottles
An apparatus includes an exterior portion, an interior portion, a first top, and a second top. The exterior portion includes an exterior wall, an exterior top end coupled to the exterior wall, and an exterior bottom closed end coupled to the exterior wall. The interior portion nests within the exterior portion and includes an interior wall having a geometry smaller than the exterior portion, an interior bottom closed end coupled to the interior wall, and an interior top end coupled to the interior wall opposite the interior bottom closed end. The first top closes the interior top end to form an interior space within the interior portion. The first top includes a first opening. The second top includes a second opening. The second top engages with the exterior bottom end in a stored position and engages with the exterior top end in a containing position. |
| US11597560B2 |
Crate with retractable wall
A container includes a wall extending upward from a base. The wall includes a frame and a first wall portion pivotably connected to the frame. The wall further includes a latch selectively connecting the first wall portion to the frame. The latch is movable vertically relative to the frame to selectively release the first wall portion from the frame. |
| US11597556B2 |
Container preform with tamper evidence finish portion
A preform is provided for blow-molding to form a container. The preform includes a finish portion for rotatably engaging a closure to seal contents within an interior of the container. The finish portion comprises a cylindrical body that begins at an opening to the interior and extends to and includes a tamper evidence ledge. A mirror polished sealing surface inside the finish portion cooperates with a plug seal of the closure to seal the container. Threads outside the finish portion engage with similar threads inside the closure. Thread starts of the threads reduce potential damage to the threads during installation of the closure. The thread starts may include a start pitch that is greater than a thread pitch of the threads. A handling valley disposed between the threads and the tamper evidence ledge facilitates air-conveying the container along a manufacturing assembly line. |
| US11597554B2 |
Dynamic adjustment of wrap force parameter responsive to monitored wrap force and/or for film break reduction
A method, apparatus and program product monitor a wrap force during a wrap cycle to dynamically control the dispense rate of a packaging material dispenser to meet a desired containment force to be applied to a load. A conversion may be performed between wrap force and containment force for the monitored wrap force or a containment force parameter to facilitate the performance of a comparison between the monitored wrap force and a containment force parameter associated with the desired containment force to be applied to the load. A wrap force parameter may also be dynamically adjusted, and in some instances, the dynamic adjustment may be responsive to monitored wrap force, and may be used to meet a load containment force requirement for a load. In other instances, the dynamic adjustment may be responsive to monitored packaging material breaks to reduce the occurrence of packaging material breaks. |
| US11597552B1 |
Right-sized thermoformed cavities for packaging items
An actuator system for fabricating a cavity within thermoplastic material includes a plurality of actuators arranged in an array. When dimensions of an item are determined, the actuator system may be programmed with data regarding such dimensions to fabricate a cavity for the item. A subset of the actuators, and distances by which each of the actuators is to be extended, may be selected based on dimensions of the item, in order to fabricate a cavity within the thermoplastic material that may accommodate the item therein. Additionally, the actuators and the distances may be selected based on intrinsic or extrinsic data regarding the item, and a cavity fabricated within the thermoplastic material may include one or more buffer zones or protective regions that are specifically formed with respect to aspects of the item. |
| US11597551B2 |
Air extracting device and method for calculating remaining time required for extracting action
An air extracting device (2) at least includes a processor (21), a motor (23), an air-extracting unit (24), and a wireless transmitting unit (25), and a method of the air extracting device (2) for calculating remaining time required for extracting action includes following steps: activating the motor (23) after the air extracting device (2) and a sealed bag (1) are jointed together; driving the air-extracting unit (24) to execute an extracting action by the activated motor (23) for extracting air from the sealed bag (1); monitoring load current of the motor (23) by the processor (21) while executing the extracting action; calculating a remaining time required for the extracting action by the processor (21) according to a variation of the load current; and, transmitting the remaining time required for the extracting action to a mobile device (4) through the wireless transmitting unit (25) for displaying thereon. |
| US11597547B2 |
Strapping apparatus
A strapping apparatus for strapping articles with a strapping band having a base plate provided for arranging on an article, a tensioning device with which a band tension can be applied to the strapping band, and a sealing device for permanently connecting two band layers to each other. |
| US11597545B2 |
Cable tie tool
A cable tie tool has a first operating unit, a second operating unit, a pivoting shaft, a torsion spring, a cutting assembly, and an extension spring. The second operating unit has two guiding holes aligned to each other. The pivoting shaft is mounted in the guiding holes, is pivotally connected the first and the second operating units, and is movable along the guiding holes. The torsion spring abuts against and pushes the first and the second operating units. The cutting assembly has an activating element pivotally connected to the second operating unit and a cutting element movably mounted in the second operating unit and driven by the activating element. The extension spring is connected between the activating element and the second operating unit. When the extension spring is stretched, the activating element blocks the pivoting shaft from moving along the guiding holes. |
| US11597544B2 |
Turntable system
Several embodiments of turntable systems for loaded pallets are disclosed. In some embodiments, a first ramp leads up to the turntable and a second ramp leads down from the turntable on the opposite side. In other embodiments, at least two turntables are positioned adjacent one another, optionally with a bridge surface connecting them so that a pallet lift can be driven from one turntable to the other to place one pallet on one turntable and another pallet on the other turntable according to a method disclosed herein. A validation system without a turntable includes a plurality of cameras about a periphery of a platform weight sensor. |
| US11597539B2 |
Methods for attitude control of a satellite in survival mode without a priori knowledge of the local time of the satellite's orbit
A method for attitude control of a satellite in inclined low orbit in survival mode is disclosed, the satellite including at least one solar generator, at least one solar sensor, magnetic torquers capable of forming internal magnetic moments in a satellite reference frame having three orthogonal axes X, Y, and Z, and inertial actuators capable of forming internal angular momentums in the satellite reference frame. The at least one solar sensor has a field of view at least 180° wide within the XZ plane around the Z axis, the method including a step of attitude control using a first control law, a step of searching for the sun by means of the at least one solar sensor, when a first phase of visibility of the sun is detected, and a step of attitude control using a second control law. |
| US11597537B2 |
Launch vehicle with solar cells, manufacturing method and transport method
A launch vehicle to transport at least one payload into an earth orbit, wherein the launch vehicle comprises a plurality of solar cells on its outer surface. Furthermore, a manufacturing method for a launch vehicle with a plurality of solar cells on its outer surface and a transport method for at least one payload using a launch vehicle with a plurality of solar cells on its outer surface are provided. |
| US11597531B2 |
Magnetic refueling boom positioning
Described are systems and methods for magnetically assisted boom refueling. In certain examples, a magnetic refueling receiver is disclosed that includes a refueling receptacle configured to receive a portion of a refueling boom and a receptacle magnet disposed around at least a portion of a perimeter of the refueling receptacle. In another example, a magnetic refueling boom is disclosed that includes a refueling boom structure that includes a first end configured to be inserted into a refueling receiver and a pipe magnet disposed around at least a portion of a perimeter of the refueling boom structure. |
| US11597530B2 |
Catalytic fuel tank inerting systems
Fuel tank inerting systems are described. The systems include a fuel tank having an inerting system flow path connected to the fuel tank. A catalytic reactor is arranged along the inerting system flow path configured to receive a reactant mixture of first reactant and a second reactant to generate inert gas. A condenser heat exchanger is arranged between the catalytic reactor and the fuel tank to cool an output from the catalytic reactor. A first ejector is configured to receive the first reactant and the second reactant and output the reactant mixture through an outlet. A second ejector is configured to receive an inert gas and the second reactant to output a mixture of the second reactant and the inert gas. |
| US11597527B2 |
Aircraft hybrid propulsion fan drive gear system DC motors and generators
An aircraft propulsion system is disclosed and includes a first gas turbine engine including a first input shaft driving a first gear system, a first fan driven by the first gear system, a first generator supported on the first input shaft and a fan drive electric motor providing a drive input to the first fan, a second gas turbine engine including a second input shaft driving a second gear system, a second fan driven by the second gear system, a second generator supported on the second input shaft and a second fan drive electric motor providing a drive input to the second fan and a controller controlling power output from each of the first and second generators and directing the power output between each of the first and second fan drive electric motors. |
| US11597526B2 |
Control systems for hybrid electric powerplants
A control system for a hybrid electric powerplant of an aircraft can include a master controller configured to receive one or more power settings and to output a heat engine setting and an electric motor setting and a heat engine controller operatively connected to the master controller. The heat engine controller can be configured to receive the heat engine setting and to control a heat engine system as a function of the heat engine setting to control torque output by a heat engine. The system can include an electric motor controller operatively connected to the master controller. The electric motor controller configured to receive the electric motor engine setting and to control an electric motor system as a function of the electric motor setting to control torque output by an electric motor. The master controller can include a protection control module configured to provide one or more protection commands to directly control one or more heat engine protection systems and one or more electric motor protection systems. |
| US11597525B2 |
Attenuators for aircraft cable and ejection seat arm restraint assemblies
An arm restraint assembly for an ejection seat may comprise a primary arm configured to pivot about a primary arm pivot joint, a first cable portion coupled to the primary arm, and an attenuator coupled to the first cable portion. The first cable portion may be configured to pivot the primary arm about the primary arm pivot joint. The attenuator may include a housing and a plunger having a head located in the housing. The head of the plunger may be biased toward a first end of the housing. |
| US11597523B2 |
Air management system
An air management system with a set of compressed air sources for supplying pressurized air to air consumer equipment. In particular, either an air bleed system, electrical compressors, or a combination thereof may perform such supplying of compressed air depending on the aircraft operation condition. |
| US11597521B2 |
Aircraft restraint systems with unfixed default mode
A modal restraint system for an occupant of a seat of an aircraft. The modal restraint system includes a strap feeder unit and a strap selectively retractable into and extendable from the strap feeder unit. The strap feeder unit is adapted to switch between a plurality of modes including an unfixed mode and a fixed mode. The strap is extendable from and retractable into the strap feeder unit in the unfixed mode. The strap is substantially unextendable from the strap feeder unit in the fixed mode. The strap feeder unit is in the unfixed mode by default. The strap feeder unit is operable to switch from the unfixed mode to the fixed mode in response to a precautionary event including detection of an operational parameter that is beyond a predetermined threshold, thereby reducing freedom of movement of the occupant relative to the seat. |
| US11597516B1 |
Airborne multi-rotor delivery system
An airborne delivery system employs unmanned aerial vehicles (UAVs) released from an airborne platform, such as a Joint Precision Airdrop System (JPAD), to more accurately deliver supplies. The airborne delivery system is configured to be mounted on a JPAD, or similar airborne platform. As with a conventional JPAD, the JPAD is then released from an airborne vehicle. After a certain amount of flight time, one or more UAVs are released mid-flight from the airborne delivery system. |
| US11597514B2 |
Unmanned aircraft having reduced acoustic signatures
Unmanned aircraft have aligned forward and aft propulsion systems possessing different performance and/or noise characteristics. According to some embodiments, unmanned aircraft have a forward engine and a forward tractor propeller and an aft engine and an aft pusher propeller. Selected ones of forward and aft propulsion systems will thus be provided to have greater and lesser operational flight performance characteristics and greater and lesser noise signature characteristics, respectively, as compared to the other. For example, the forward propulsion system may be provided with the greater operational flight performance and higher signature characteristics as compared to the aft propulsion system, while conversely the aft propulsion system may be provided with a lesser flight performance and lower noise signature characteristics as compared to the forward propulsion system. |
| US11597512B2 |
Aircraft having VTOL, translational and traverse flight
An aircraft capable of Vertical Take-Off and Landing (VTOL) and traverse flight. The aircraft generally includes a fixed outer structure including at least a generally cylindrical wing having an internal body situated within the fixed outer structure. A space is defined between the internal body and the fixed outer structure. Within this space are one or more rotatable ring impellers that create(s) thrust sufficient to achieve lift for the aircraft. |
| US11597510B2 |
Ducted fans having fluidic thrust vectoring
A ducted fan assembly includes a duct having an inlet, an inner surface, an expanding diffuser and an outlet. A fan disposed within the duct between the inlet and the expanding diffuser is configured to rotate about a fan axis to generate airflow. An active flow control system includes a plurality of injection zones circumferentially distributed about the inner surface. The expanding diffuser has a diffuser angle configured to create flow separation when the airflow is uninfluenced by the active flow control system such that the airflow has a thrust vector with a first direction that is substantially parallel to the fan axis. Injection of pressurized air from one of the injection zones asymmetrically reduces the flow separation between the airflow and the expanding diffuser downstream of that injection zone such that the thrust vector of the airflow has a second direction that is not parallel to the first direction. |
| US11597509B1 |
Vertical take-off and landing aircraft and methods of taking-off, landing, and aircraft control
An aircraft that closely integrates thrust and aerodynamics to achieve VTOL flight, forward flight, and smooth transitions from VTOL to forward flight. The invention combines a Box wing, Ducted Rotors and movable Flaperons for VTOL and sustained forward flight of an aircraft. In forward flight, the concept uses a plurality of fixed Ducted Rotors to not only provide thrust, but also enhance dynamic lift and controllability by interacting closely with the two fixed primary lifting bodies of each ducted wing section. In VTOL flight and transitioning to forward flight, the Ducted Rotors direct air through movable Flaperons attached to the trailing end of the ducted wings, providing smooth power, controllability, and aircraft orientation throughout transition. Throughout all phases of flight, differential actuation of Ducted Rotors and Flaperons provide control. |
| US11597501B2 |
Deployable noise shield panels
Technologies for providing noise shielding are described herein. In some examples, noise shields are installed proximate to one or more of the main engines of the aircraft. The noise shields can be extended during terminal operations and retracted during flight operations. |
| US11597500B1 |
Method of making a variable camber control surface
A variable camber wing for mounting to a vehicle chassis has an actuator shaft and a static pin extending from the chassis. The wing's nose segment defines a proximal edge and a distal edge and has a channel therethrough between the proximal and distal edges, an arcuate aperture therethrough aft of the channel, and a second aperture therethrough aft of the arcuate aperture. The wing has a first linkage defining a clevis on a proximal end and hingeably connected to the nose segment. The clevis can rotatably engage with the static pin extending through the arcuate aperture. A second linkage defines a second clevis on a proximal end and a distal edge. The second linkage is configured to hingeably connect to the first linkage. |
| US11597499B2 |
Morphing airfoil system
A morphing airfoil system includes an airfoil including a bulkhead and an airfoil body extending from the bulkhead, at least one inflatable/deflatable bladder positioned within the airfoil body, and a bladder pressurization mechanism configured for controlling pressurization of the at least one bladder. The system also includes one or more processors and a memory communicably coupled to the one or more processors and storing an airfoil control module including instructions that when executed by the processor(s) cause the processor(s) to control operation of the bladder pressurization mechanism to increase or decrease internal pressure in the at least one bladder to change a configuration of the airfoil. |
| US11597498B2 |
Aircraft fuel tank aperture sealing
A seal for sealing an aircraft fuel tank, an aircraft wing rib and stringer sealing assembly, an aircraft wing fuel tank, an aircraft structural wing box, an aircraft wing, and a method of sealing an aperture are disclosed. The seal is for sealing a wing rib to a stringer passing through an aperture in the rib at a variable position in the aperture. The seal includes self-adjustment means to absorb any tolerance when forming the seal, upon the stringer being assembled into the aperture in the rib. |
| US11597492B2 |
Sliding door
Systems and methods include providing an aircraft with a fuselage having a sliding door system disposed on at least one side of the fuselage. The sliding door system includes a forward sliding door having an upper slide rail and a lower slide rail, a rearward sliding door having an upper slide rail and a lower slide rail, an upper rail coupled to each of the upper slide rail of the forward sliding door and the upper slide rail of the rearward sliding door, a lower rail coupled to each of the lower slide rail of the forward sliding door and the lower slide rail of the rearward sliding door, and a plurality of actuators coupled to each of the upper rail and the lower rail and configured to displace and retract the forward sliding door and the rearward sliding door linearly with respect to the fuselage. |
| US11597491B2 |
Wall covering panel for an aircraft with integrated insulation
A wall covering panel for a nose of an aircraft. The panel comprises a rigid carrying framework preferably having an alveolar structure obtained by 3-D printing, a décor carried by the carrying framework and an acoustically and thermally insulating padding fixed to the carrying framework, and also attachments for fixing the carrying framework to the primary structure of the aircraft. Preferably, the panel also integrates systems, such as electrical route portions or ventilation route portions that traverse the panel from one side to the other or lead to an outlet equipment item also integrated in the panel. Only the carrying structure of the panel, which carries the décor, the insulating padding and any route portions and equipment items, is fixed to the primary structure of the aircraft. The number of attachments is low; the kitting-out and the finishing of the nose of the aircraft are greatly simplified. |
| US11597486B1 |
Tiller for outboard motor
A tiller for an outboard motor includes a tiller body that is elongated along a longitudinal center axis between a proximal end and a distal end. A throttle grip is on the distal end of the tiller body. A trim switch assembly is located at a distal end of the throttle grip. The trim switch assembly includes a momentary switch and a driver. The driver is configured to output current to activate a trim relay on the outboard motor in response to actuation of the momentary switch. |
| US11597485B2 |
Retractable control fins for underwater vehicles
Techniques are disclosed for providing retractable control fins on an underwater vehicle. The retractable control fins can be extended away from a main hull portion of the underwater vehicle and retracted inwards to a stowage region within the hull portion to protect the fins from damage and reduce an overall outer diameter (e.g., in the case of a cylindrical body) of the underwater vehicle. In some embodiments, the control fins are folded inwards to reduce the vehicle diameter. In other embodiments, the control fins are pulled inwards using a rotating structure designed to slide the control fins through an opening and into an inner portion of the hull to reduce the vehicle diameter. The retraction of the fins through the various retraction mechanisms reduces the envelope diameter of the underwater vehicle. |
| US11597484B2 |
Small underwater vehicle having a hovering system using the tube type launcher and method for assembling the same
An underwater vehicle having a hovering system using a tube type launcher. The underwater vehicle includes a streamlined body and a hovering system connected to a rear of the streamlined body to generate a kinetic force of the streamlined body. The hovering system includes an extension shaft extended to be connected to the rear, a connection assembly connected to the rear through the extension shaft, and an auxiliary propeller assembly connected to the connection assembly. |