Document | Document Title |
---|---|
US08940985B2 |
Guitar neck joint routing system
A guitar neck joint routing system. The system includes a probe and router assembly comprising a gantry, a probe, and a plurality of routers, and a guitar neck and body nest comprising clamps and vacuum grips for holding a guitar neck and guitar body in place for taking measurements and routing a dovetail joint. |
US08940981B2 |
Plants and seeds of hybrid corn variety CH286440
According to the invention, there is provided seed and plants of the hybrid corn variety designated CH286440. The invention thus relates to the plants, seeds and tissue cultures of the variety CH286440, and to methods for producing a corn plant produced by crossing a corn plant of variety CH286440 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH286440. |
US08940977B2 |
Plants and seeds of hybrid corn variety CH175075
According to the invention, there is provided seed and plants of the hybrid corn variety designated CH175075. The invention thus relates to the plants, seeds and tissue cultures of the variety CH175075, and to methods for producing a corn plant produced by crossing a corn plant of variety CH175075 with itself or with another corn plant, such as a plant of another variety. The invention further relates to genetic complements of plants of variety CH175075. |
US08940975B2 |
Tomato variety picus
The invention provides seed and plants of the tomato variety designated Picus. The invention thus relates to the plants, seeds and tissue cultures of tomato variety Picus and to methods for producing a tomato plant produced by crossing a plant of tomato variety Picus with itself or with another tomato plant, such as a plant of another variety. The invention further relates to seeds and plants produced by such crossing, and also relates to parts of a plant of tomato variety Picus including the fruit and gametes of such plants. The invention also relates to tomato variety FDS 14-2081, and to seeds and plants produced by crossing a plant of tomato variety FDS 14-2081 with itself or another tomato plant. The present invention is also directed to tomato variety FDS 14-2090, and to seeds and plants produced by crossing a plant of tomato variety FDS 14-2090 with itself or another tomato plant. |
US08940974B2 |
Tomato variety EX01419137
The invention provides seed and plants of the tomato variety designated EX01419137. The invention thus relates to the plants, seeds and tissue cultures of tomato variety EX01419137 and to methods for producing a tomato plant produced by crossing a plant of tomato variety EX01419137 with itself or with another tomato plant, such as a plant of another variety. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of a plant of tomato variety EX01419137 including the fruit and gametes of such plants. The invention also relates to tomato variety CHI 14-2079. The present invention is also directed to tomato variety CHD 14-2080. |
US08940973B2 |
Soybean variety XB32AC13
A novel soybean variety, designated XB32AC13 is provided. Also provided are the seeds of soybean variety XB32AC13, cells from soybean variety XB32AC13, plants of soybean XB32AC13, and plant parts of soybean variety XB32AC13. Methods provided include producing a soybean plant by crossing soybean variety XB32AC13 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety XB32AC13, methods for producing other soybean varieties or plant parts derived from soybean variety XB32AC13, and methods of characterizing soybean variety XB32AC13. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety XB32AC13 are further provided. |
US08940972B2 |
Soybean variety XB29K13
A novel soybean variety, designated XB29K13 is provided. Also provided are the seeds of soybean variety XB29K13, cells from soybean variety XB29K13, plants of soybean XB29K13, and plant parts of soybean variety XB29K13. Methods provided include producing a soybean plant by crossing soybean variety XB29K13 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety XB29K13, methods for producing other soybean varieties or plant parts derived from soybean variety XB29K13, and methods of characterizing soybean variety XB29K13. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety XB29K13 are further provided. |
US08940968B1 |
Soybean variety XB35E13
A novel soybean variety, designated XB35E13 is provided. Also provided are the seeds of soybean variety XB35E13, cells from soybean variety XB35E13, plants of soybean XB35E13, and plant parts of soybean variety XB35E13. Methods provided include producing a soybean plant by crossing soybean variety XB35E13 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety XB35E13, methods for producing other soybean varieties or plant parts derived from soybean variety XB35E13, and methods of characterizing soybean variety XB35E13. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety XB35E13 are further provided. |
US08940966B2 |
Soybean cultivar XB36AW12
A soybean cultivar designated XB36AW12 is disclosed. The invention relates to the seeds of soybean cultivar XB36AW12, to the plants of soybean cultivar XB36AW12, to the plant parts of soybean cultivar XB36AW12, and to methods for producing progeny of soybean cultivar XB36AW12. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar XB36AW12. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar XB36AW12, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar XB36AW12 with another soybean cultivar. |
US08940964B2 |
Soybean cultivar S110181
A soybean cultivar designated S110181 is disclosed. The invention relates to the seeds of soybean cultivar S110181, to the plants of soybean cultivar S110181, to the plant parts of soybean cultivar S110181, and to methods for producing progeny of soybean cultivar S110181. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar S110181. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar S110181, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar S110181 with another soybean cultivar. |
US08940963B2 |
Production of hetero-oligomeric proteins in plants
Process of producing in a plant, in plant tissue, or in plant cells a hetero-oligomeric protein comprising at least a first and a second protein subunit, said process comprising expressing in plant cells at least said first and said second protein subunit by (i) providing to said plant, said plant tissue or said plant cells a plus-sense single-stranded RNA viral vector encoding at least said first and said second protein subunit or (ii) providing to said plant, said plant tissue or said plant cells a first and a second plus-sense single-stranded RNA viral vector, said first viral vector encoding at least said first protein subunit, said second viral vector encoding at least said second protein subunit, whereby at least said first viral vector and said second viral vector are non-competing viral vectors. |
US08940962B2 |
Chimeric promoter comprising FMV enhancer and HSP81-2 promoter and plants transformed therewith
The present invention provides novel promoters for use in plants. Specifically, the present invention provides novel chimeric promoters comprising combinations of plant viral enhancer elements and plant promoters. The present invention also provides DNA constructs; transgenic cells, plants, and seeds containing these novel chimeric promoters; and methods for preparing and using the same. |
US08940961B2 |
Plant transformed with hardy (HRD) gene having enhanced drought tolerance
Transgenic plants with novel phenotypes, especially plants with enhanced drought and pathogen resistance. Provided are transgenic crop plants having integrated in their genome a chimeric gene, wherein the chimeric gene includes a transcription regulatory sequence active in plant cells operably linked to a nucleic acid sequence encoding a protein having the sequence of SEQ ID NO: 3 or a protein at least 70% identical to SEQ ID NO: 3 or an ortholog or a functional fragment thereof. In addition to enhanced drought tolerance the transgenic plants may show enhanced disease resistance and enhanced root structure. Also, a method for generating a transgenic plant by insertion of the chimeric gene. |
US08940959B2 |
Disposable absorbent articles having inkjet printed wetness indicators
The present invention relates to disposable absorbent articles. The disposable absorbent articles include: (a) a body contacting surface; (b) a garment contacting surface opposite the body contacting surface; and (c) an inkjet printed wetness indicator which is seen through either the body contacting surface or the garment contacting surface. The wetness indicator includes a central graphic and a background graphic, the central graphic having at least one permanent ink composition and the background graphic having at least one water soluble ink composition. |
US08940956B2 |
Methods and systems for processing crude oil using cross-flow filtration
Methods and systems for processing crude oil comprise adding water to the crude oil to produce an emulsion comprising brine and oil and solids; separating oil from brine including producing brine comprising a rag layer; separating the rag layer into a hydrocarbon emulsion having finer solids and brine comprising larger solids; and passing the hydrocarbon emulsion along a cross-flow filter to produce a retentate comprising brine and solids and a permeate comprising hydrocarbon. |
US08940953B2 |
Process for conversion of lower aliphatic ethers to aromatics and lower olefins
The invention relates to a process for converting a feed stream consisting of reactive components and an optional feed diluent to a product stream comprising aromatic hydrocarbons and C2-C3 olefins, wherein the reactive components comprise at least 90 vol % of an aliphatic ether selected from the group consisting of methyl tertiary butyl ether and ethyl tertiary butyl ether, the process comprising the step of contacting the feed stream with a catalyst composition comprising a zeolite catalyst, wherein the zeolite catalyst is a zeolite modified by Ga and an element M1 selected from the group consisting of Zn, Cd and Cu. |
US08940950B2 |
Method and apparatus for obtaining aromatics from diverse feedstock
The process relates to the use of any naphtha-range stream containing a portion of C8+ aromatics combined with benzene, toluene, and other non-aromatics in the same boiling range to produce toluene. By feeding the A8+ containing stream to a dealkylation/transalkylation/cracking reactor to increase the concentration of toluene in the stream, a more suitable feedstock for the methylation reaction can be produced. This stream can be obtained from a variety of sources, including the pygas stream from a steam cracker, “cat naphtha” from a fluid catalytic cracker, or the heavier portion of reformate. |
US08940946B2 |
Method for producing high-purity 1,5-pentanediol
The present invention has an object to provide a method for efficiently producing high-purity 1,5-pentanediol by reacting tetrahydrofurfuryl alcohol with hydrogen. This manufacturing method for producing high-purity 1,5-pentanediol comprises: step (I): a step of obtaining a crude reaction product by a hydrogenolysis reaction of tetrahydrofurfuryl alcohol with hydrogen carried out in the presence of a copper-containing catalyst with reaction temperature of 200 to 350° C. and reaction pressure of 1 to 40 MPa until conversion rate of tetrahydrofurfuryl alcohol reaches 80% or less; step (II): a step of separating tetrahydrofurfuryl alcohol and crude 1,5-pentanediol (A) from the crude reaction product obtained in the step (I), and then, supplying recovered tetrahydrofurfuryl alcohol as a raw material for the step (I); and step (III): a step of obtaining the high-purity 1,5-pentanediol by distillation of the crude 1,5-pentanediol (A) obtained in the step (II). |
US08940943B2 |
Cosmetic preparations
The invention relates to compounds of the general formula (I), where R1 is a branched alkyl(ene) radical having from 10 to 22 carbon atoms and having at least one branch in position 1, 2, 3 or 4 relative to the oxygen atom, R2 is a linear or branched alkyl(ene) radical having from 1 to 13 carbon atoms and R1 and R2 are selected so that the total number of carbon atoms in formula (I) is from 11 to 23. The compounds of the invention are suitable for preparation of or in cosmetic and/or pharmaceutical preparations, in particular as oily substances. R1—O—R2 (I) |
US08940937B2 |
Method for producing selectively functionalized carbon nanotubes
Disclosed is a novel method for the selective molecular conversion of raw material carbon nanotubes containing a mixture of metallic carbon nanotubes and semiconductive carbon nanotubes in a manner that is based on the electrical properties or diameter of the carbon nanotubes.The present invention causes a photoreaction of raw material carbon nanotubes containing a mixture of metallic carbon nanotubes and semiconductive carbon nanotubes with a disulfide or a sulfide of the following formula (I) or (II) (wherein R1 and R2 each independently represent a hydrocarbon group that may have a substituent) in an organic solvent that contains the raw material carbon nanotubes and the disulfide of the formula (I) or the sulfide of the formula (II), so as to selectively functionalize the metallic carbon nanotubes, or functionalize the carbon nanotubes diameter selectively. |
US08940936B2 |
Aryloxy phenoxy acrylic compound having HIF-1 inhibition activity, method for preparing same, and pharmaceutical composition containing same as an active ingredient
The present invention relates to a compound inhibiting HF-1 activity, a preparation method of the same, and a pharmaceutical composition comprising the same as an active ingredient. The compound of the present invention demonstrates anticancer activity not by non-selective cytotoxicity but by inhibiting the activity of HIF-1, the transcription factor playing an important role in cancer cell growth and metastasis. Accordingly, the compound or the pharmaceutically acceptable salt thereof according to the present invention inhibits HIF-1 activity, and therefore can be used as a therapeutic agent for solid tumors such as colon cancer, liver cancer, stomach cancer and breast cancer. In addition, the compound or the pharmaceutically acceptable salt thereof according to the present invention can be used as an active ingredient for a therapeutic agent for diabetic retinopathy or arthritis which may become worse when hypoxia-induced VEGF expression by HIF-1 increases. |
US08940935B2 |
Bis-urea gelators for curable ink applications
The disclosure provides curable inks including a bis-urea gelator having the structure of Formula I. wherein R and R′ each, independently of the other, is a saturated aliphatic hydrocarbon group selected from the group consisting of (1) linear aliphatic groups, (2) branched aliphatic groups, (3) cyclic aliphatic groups, (4) aliphatic groups containing both cyclic and acyclic portions, any carbon atom of the saturated aliphatic hydrocarbon group may be optionally substituted with an alkyl group (cyclic or acyclic), wherein (1) and (2) groups have a carbon number of from about 1 to about 22 carbons, and wherein (3) and (4) groups have a carbon number of from about 4 to about 10 carbons; and X is selected from the group consisting of: (i) an alkylene group, (ii) an arylene group, (iii) an arylalkylene group, and (iv) an alkylarylene group. |
US08940934B2 |
Production process of α-hydroxy acids
An object of the present invention is to provide a production process of an α-hydroxy acid having a sufficient quality as a polymer raw material, which process does not produce a large amount of waste as a byproduct and is economical.The present invention provides a production process of an α-hydroxy acid having a step of adding a basic metal to an α-hydroxy acid ammonium salt to yield an α-hydroxy acid metal salt and a step of desalting the α-hydroxy acid metal salt to yield the α-hydroxy acid. |
US08940933B2 |
Method for producing polyoxyalkylene alkyl ether carboxylic acid and salt thereof
The present invention provides a method for producing polyoxyalkylene alkyl ether carboxylic acid and a salt thereof, including supplying polyoxyalkylene alkyl ether, oxygen, and water to a continuous stirred tank reactor containing a noble metal catalyst to oxidize the polyoxyalkylene alkyl ether with oxygen, in which the molar ratio of the salt of polyoxyalkylene alkyl ether carboxylic acid to the polyoxyalkylene alkyl ether in the continuous stirred tank reactor is controlled to 0.33 to 49. |
US08940929B2 |
Preparation method of high-optical purity N2-[1 -(S)-ethoxycarbonyl-3-phenylpropyl]-N6-trifluoroacetyl-L-lysine
Disclosed is a preparation method of high-optical purity N2-[1-(S)-ethoxycarbonyl-3-phenylpropyl]-N6-trifluoroacetyl-L-lysine. The method includes: adding crude N2-[1-(S)-ethoxycarbonyl-3-phenylpropyl]-N6-trifluoroacetyl-L-lysine to one or more organic solvents, and then reacting with an organic acid to form a salt, which is precipitated, thereby achieving the purpose of separation and purification; next, adding the obtained solid or mother concentrate into deionized water, and then adding an inorganic base or an organic base for basification, so as to adjust the pH value, removing the organic acid, filtering, washing and drying, to obtain the high-optical purity N2-[1-(S)-ethoxycarbonyl-3-phenylpropyl]-N6-trifluoroacetyl-L-lysine, where the molar ratio of 1S-isomer to 1R-isomer is equal to or greater than 99:1. |
US08940928B2 |
Method of synthesizing levorotatory p-hydroxyphenylglycine compounds
The present invention relates to the field of chemical synthesis, particularly to a method of synthesizing levorotatory p-hydroxyphenylglycine compounds, which eliminates the subsequent processes of resolution, racemization processings, etc., simplifies operational steps; and acids with small organic molecule are chosen as catalyst in the second step, which not only is conducive to the realization of a industrialized production, but also makes the ee value of the end products be 88.1˜98.0% by determining the catalyst, the reaction solvent, the reactive substance, the reaction temperature, and the reaction duration; non-aqueous solvent is used in the second step, to avoid the discharging of phenol-containing waste water, thus environmental pollution is reduced. |
US08940926B2 |
Method for producing carbamate, method for producing isocyanate, carbamate production system, and isocyanate production system
A method for producing carbamate including a urea production step; a carbamate-forming step; an ammonia separation step of absorbing the gas with water in the presence of carbonate to produce a gas absorption water, and separating ammonia; an aqueous alcohol solution separation step of separating an aqueous alcohol solution from the gas absorption water; an ammonia/carbon dioxide separation step of separating carbon dioxide gas from the aqueous ammonia solution in the gas absorption water from which the aqueous alcohol solution is separated; an aqueous ammonia solution reusing step of mixing the aqueous ammonia solution and carbonate with the water to be used for production of the gas absorption water. |
US08940923B2 |
Method for the synthesis of diacids or diesters from natural fatty acids and/or esters
Disclosed herein a process for the synthesis of diacids or diesters of general formula ROOC—(CH2)x-COOR, in which n represents an integer between 5 and 14 and R is either H or an alkyl radical of 1 to 4 carbon atoms, starting from long-chain natural monounsaturated fatty acids or esters comprising at least 10 adjacent carbon atoms per molecule, of formula CH3—(CH2)n-CHR1—CH2—CH═CH—(CH2)p-COOR, in which R represents H or an alkyl radical comprising from 1 to 4 carbon atoms, R1 is either H or OH, and n and p, which are identical or different, are indices between 2 and 11. |
US08940919B2 |
Compound, method for producing the same, and method for producing oseltamivir phosphate
A compound represented by the following general formula (1), and a method for producing the compound represented by the general formula (1), the method comprising: reacting together a compound represented by the following general formula (2), a compound represented by the following general formula (3), and a compound represented by the following general formula (4): wherein R1 represents any of a protective group of a carboxyl group, and a hydrogen atom, R2 and R3 each independently represent any of a protective group of an amino group, and a hydrogen atom, and R4 represents any of a protective group of a carboxyl group, and a hydrogen atom. |
US08940914B2 |
Esters of 5-hydroxymethylfurfural and methods for their preparation
Disclosed are compositions and methods for the production of mono-esters and di-esters from the reaction of HMF and a reactant selected from a diacid or a diacid derivative; typical reactants are PAN, phthaloyl dichloride, dimethyl phthalate, maleic acid, and maleic anhydride or mono-esters that can be prepared from HMF and MAN. |
US08940909B2 |
Indicator platform
A novel indicator platform comprises a plurality of 1H-lndol-3-yl indicator compounds that are capable of converting to a signalophore compound in response to an external stimulus. In one class of indicator compounds, the resulting signalophores are 2-benzylideneindoline compounds that are formed by an intermolecular Aldol-type process; in a further class of indicator compounds, the resulting signalophores are 10H-indolo[1,2-a]indole compounds that are formed by an intramolecular Aldol-type process. The indicators can be used in a wide array of applications relating, for example, to biological systems or optical data storage. |
US08940908B2 |
Method for preparing tetrazole methanesulfonic acid salts, and novel compound used in same
A method for preparing tetrazole methanesulfonic acid salts includes an acylation reaction using a novel 4-iodine-4H-chromene-2-carbothionic acid S-benzothiazole-2-yl ester. The method is advantageous that it can shorten a reaction time and improve safety as compared to conventional methods, and can prepare high-purity tetrazole methanesulfonic acid salts at a high yield rate without using a column chromatography method. |
US08940905B2 |
Method for preparing organic/inorganic hybrid functionalized solids having a triazole ring
A process is described for the preparation of a functionalized hybrid solid with an organic-inorganic matrix, crystallized, bearing at least one reactive group based on a triazole ring, from a hybrid solid with an organic-inorganic matrix, MOF—NH2, comprising: i/ introduction, in a polar solvent S1, of said crystallized hybrid solid MOF—NH2, of at least one organic compound Q containing a nitride function N3 and at least one intermediate reagent R containing a nitrite function NO2, ii/ reaction of said reaction mixture, iii/ introduction in the reaction mixture of at least one reagent A bearing an alkyne function or an activated cyanide function, at least one Cu-based catalyst C and at least one polar solvent S2, iv/ reaction of said reaction mixture, v/ filtration and then washing and vi/ drying of said crystallized functionalized hybrid solid. |
US08940903B2 |
Niacin conjugated fatty acid mixtures and their uses
The invention relates to niacin conjugated fatty acid mixtures; compositions comprising an effective amount of a niacin conjugated fatty acid mixture; and methods for treating or preventing an metabolic disorder comprising the administration of an effective amount of a niacin conjugated fatty acid mixture. |
US08940900B2 |
2,2,2-tri-substituted acetamide derivatives as glucokinase activators, their process and pharmaceutical application
Compounds of the present disclosure are 2,2,2-tri-substituted acetamide derivatives of formula (I), its polymorphs, stereoisomers, prodrugs, solvates, pharmaceutically acceptable salts and formulations thereof, useful as Glucokinase activator. Processes of their preparation are also described in the disclosure. The disclosure also describes method to characterize partial glucokinase activators. |
US08940899B2 |
Process for the preparation of 5-substituted 1-alkyltetrazolyl oxime derivatives
The present invention relates to a process for the preparation of 5-substituted 1-alkyltetrazolyl oxime derivatives. |
US08940896B2 |
Tetra-cyclic carboline derivatives useful in the inhibition of angiogenesis
In accordance with the present invention, tetracyclic caboline derivatives that inhibit the expression of VEGF post-transcriptionally have been identified, and methods for their use provided. In one aspect of the invention, these compounds useful in the inhibition of VEGF production, in the inhibition of angiogenesis, and/or in the treatment of cancer, diabetic retinopathy or exudative macular degeneration are provided. In another aspect of the invention, methods are provided for the inhibition of VEGF production, the inhibition of angiogenesis, and/or the treatment of cancer, diabetic retinopathy or exudative macular degeneration using the compounds of the invention. |
US08940895B2 |
Heterocyclic fluorescent dyes and method of production thereof
The invention relates to novel compounds of formula (III) that can be used as heterocyclic dyes of unique structure and properties. These dyes can be obtained in a three-step synthesis from simple substrates. |
US08940894B2 |
Aminothiazole compounds as kinase inhibitors and methods of using the same
The present invention relates to an industrial process of preparing pharmaceutical compounds having the formula I: which are useful as certain tyrosine kinase inhibitors and more particularly as c-kit and bcr-abl inhibitors. The groups R1 and R2, identical or different, represent each a hydrogen, halogen atom, an alkyl, an alkoxy, a trifluoromethyl, an amino, an alkylamino, a dialkylamino, a solubilising group; m is 0-5 and n is 0-4; the group R3 represents an aryl or an heteroaryl group as described in claims herein. |
US08940886B2 |
Specific ligand for annexin 2
The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2. |
US08940881B2 |
Method for producing chitin nanofibers, composite material and coating composition each containing chitin nanofibers, and method for producing chitosan nanofibers, composite material and coating composition each containing chitosan nanofibers
The present invention provides a method for producing chitin nanofibers, which includes the steps of deproteinizing a material derived from a chitin-containing organism by an alkali treatment, deashing a deproteinized integument by an acid treatment, optionally treating the deashed integument under acidic conditions, and then subjecting to a fiber-loosening treatment. The present invention also provides chitin nanofibers obtained by the method, and a composite material and a coating composition each containing the same. The present invention provides a method for producing chitosan nanofibers, which includes, in addition to the above steps, a deacetylation step and chitosan nanofibers obtained by the method, and a composite material and a coating composition each containing the same. |
US08940877B2 |
Method to produce an immunoglobulin preparation with improved yield
The present invention provides improved methods for the manufacturing of IVIG products. These methods offer various advantages such as reduced loss of IgG during purification and improved quality of final products. In other aspects, the present invention provides aqueous and pharmaceutical compositions suitable for intravenous, subcutaneous, and/or intramuscular administration. In yet other embodiments, the present invention provides methods of treating a disease or condition comprising administration of an IgG composition provided herein. |
US08940875B2 |
Process for protein extraction
The invention includes a process for extracting a target protein from Escherichia coli cells that includes lowering the pH of a whole E. coli cell solution to form an acidic solution, disrupting the cells to release the protein into the acidic solution, and separating the cellular debris from the released protein to obtain a protein product enriched in the heterologous target protein. The invention also includes addition of a solubility enhancer. |
US08940873B2 |
Crystalline anti-human IL-12 antibodies
The invention relates to batch crystallization methods for crystallizing an anti-hIL-12 antibody that allows the production of the antibody on an industrial scale, antibody crystals obtained according to the methods, compositions containing the crystals, and methods of using the crystals and the compositions. |
US08940872B2 |
Antibody binding specifically to TDP-43 aggregate
The present invention provides an antibody that specifically binds to an abnormal TDP-43 protein aggregate, an agent comprising the antibody for detecting a TDP-43 proteinopathy lesion, and a method for detecting or diagnosing a TDP-43 proteinopathy lesion by using the antibody. |
US08940867B2 |
Pan-antiviral peptides
Methods for preparing viral neuraminidase inhibitors including antiviral peptides by specifically chemically modifying disulfide bonds in precursor molecules. A method of inhibiting viral neuraminidases by administering a viral neuraminidase inhibitor comprising an antiviral peptide prepared by the above methods and inhibiting the viral neuraminidase. Therapeutics for inhibiting viral neuraminidases, including effective amounts of viral neuraminidase inhibitors including antiviral peptides derived from selectively chemically modified disuifide bonds in precursor molecules, and present in a pharmaceutically acceptable carriers. |
US08940865B2 |
Myocardial peptide, preparation method and uses thereof
Disclosed are two myocardial peptides, whose amino acid sequences are Trp-Ser-Asn-Val-Leu-Arg-Gly-Met-Gly-Gly-Ala-Phe and Lys-Gly-Ala-Trp-Ser-Asn-Val-Leu-Arg-Gly-Met-Gly-Gly-Ala-Phe respectively, wherein the latter can be obtained by extracting from myocardial peptides solution. The myocardial peptides can be used in the produce of a medicament for preventing and/or treating myocardial ischemia. |
US08940863B2 |
Selective anticancer chimeric peptides which bind neuropilin receptor
It is an object of the present invention to provide a substance usable as an anticancer agent or DDS, which has intracellular stability, which is capable of evading side effects from functional disorder with respect to normal cells, or which has instantaneous effect. The inventors developed a novel chimeric peptide targeting cancer cells which overexpress EGFR or the like using a binding peptide such as a peptide sequence binding to EGFR, and a lytic peptide sequence, thereby solving such an object. Particularly, by using a chimeric peptide including an EGF receptor-binding peptide or the like and a cytotoxic peptide, this object was solved. |
US08940860B2 |
Single-chain insulin agonists exhibiting high activity at the insulin receptor
Single chain insulin analogs are provided having high potency and specificity for the insulin receptor. As disclosed herein optimally sized linking moieties can be used to link human insulin A and B chains, or analogs or derivatives thereof, wherein the carboxy terminus of the B25 amino acid of the B chain is linked to the amino terminus of the A1 amino acid of the A chain via the intervening linking moiety. In on embodiment the linking moiety comprises a polyethylene glycol of 6-16 monomer units and in an alternative embodiment the linking moiety comprises a non-native amino acid sequence derived form the IGF-1 C-peptide and comprising at least 8 amino acids and no more than 12 amino acid in length. Also disclosed are prodrug and conjugate derivatives of the single chain insulin analogs. |
US08940858B2 |
Fibrous microcapsules and methods of assembly and use thereof
The present invention relates to assembly of peptide amphiphiles and biopolymers into fibrous microcapsules, and uses thereof. In particular, the present invention provides devices, compositions, and methods for interfacial self-assembly of peptide amphiphiles and biopolyments into fibrous microcapsules, and uses thereof. |
US08940851B2 |
Highly transparent silicone mixtures that can be cross-linked by light
Silicone fibers suitable for use as optical fibers are prepared by crosslinking an extruded mixture of a silicone resin and an organopolysiloxane, both containing aliphatically unsaturated groups, an organopolysiloxane bearing Si—H groups, and a light activatable trimethyl(methylcyclopentadienyl) platinum catalyst. |
US08940850B2 |
Energy storage device
An energy storage device comprises a capacitor having a dielectric between opposite electrodes and a nonconductive coating between at least one electrode and the dielectric. The nonconductive coating allows for much higher voltages to be employed than in traditional EDLCs, which significantly increases energy stored in the capacitor. Viscosity of the dielectric material may be increased or decreased in a controlled manner, such as in response to an applied external stimulus, to control discharge and storage for extended periods of time. |
US08940849B2 |
Polymers of isropene from renewable resources
It has been found that certain cells in culture can convert more than about 0.002 percent of the carbon available in the cell culture medium into isoprene. These cells have a heterologous nucleic acid that (i) encodes an isoprene synthase polypeptide and (ii) is operably linked to a promoter. The isoprene produced in such a cultured medium can then be recovered and polymerized into synthetic rubbers and other useful polymeric materials. The synthetic isoprene containing polymers of this invention offer the benefit of being verifiable as to being derived from non-petrochemical based resources. They can also be analytically distinguished from rubbers that come from natural sources. The present invention more specifically discloses a polyisoprene polymer which is comprised of repeat units that are derived from isoprene monomer, wherein the polyisoprene polymer has δ13C value of greater than −22‰. |
US08940847B2 |
Low viscosity high solids copolymer
A copolymer is made by feeding one or more added olefinic monomers into a reaction vessel containing a non-homopolymerizable olefinic monomer heated to a temperature of at least about 100° C. The process may be performed in a batch or continuous fashion, may use an unpressurized reactor, may be performed without added solvent, and may form a copolymer whose number average molecular weight is less than about 4,000 amu and whose polydispersity is less than about 3. |
US08940843B2 |
Pump for loop reactor
The present invention relates the use of a pump in a loop reactor for the production of polyethylene, as well as a reactor comprising such pump and methods for producing polyolefin by means of such reactor. The pump according to the invention is characterized in that it is an axial flow impeller circulation pump, wherein the impeller comprises 6 blades and wherein the pump is fixed on a spring supported frame. Use of the pump according to the present invention allows for preparation of homogeneous polyethylene products that meet high quality standards from the complicated ethylene polymerization mixtures while at the same time being produced with low energy consumption. |
US08940835B2 |
Thermoplastic elastomer composition and pneumatic tire using same
Provided is a thermoplastic elastomer composition that can be suitably used for the inner liners of pneumatic tires and exhibits high air barrier properties and high fatigue durability. The present invention is a thermoplastic elastomer composition comprising a thermoplastic resin composition and a rubber composition dispersed in the thermoplastic resin composition, wherein the thermoplastic resin composition comprises a polyamide and an ethylene-vinyl alcohol copolymer or a poly(vinyl alcohol), the rubber composition comprises a halogenated isoolefin-p-alkylstyrene copolymer and is cross inked. The thermoplastic resin composition preferably comprises 1 to 25% by weight of the ethylene-vinyl alcohol copolymer or the poly(vinyl alcohol). The thermoplastic elastomer composition preferably comprises 100 parts by weight of the thermoplastic resin composition and 80 to 200 parts by weight of the halogenated isoolefin-p-alkylstyrene copolymer. |
US08940833B2 |
Polyester-based, pressure sensitive adhesive
A pressure sensitive adhesive (PSA) comprising: (A) 50 to 99 weight percent (wt %) of a partially aromatic polyester comprising at least two hydroxyl groups per polymer chain and having a: (1) Storage modulus of >0.33 Megapascals (MPa) at 23° C., (2) Mn of 20,000 to 200,000 grams per mole (g/mol), and (3) Glass transition (Tg) temperature of −60° C. to 20° C.; (B) 1 to 40 wt % of at least one of a plasticizer or tackifier; and (C) 0.1 to 10 wt % of a crosslinker with a functionality of >2.5; with the provisos that the PSA has a: (i) Tg of −60° C. to 10° C.; (ii) Storage modulus of <0.33 MPa at 23° C.; (iii) Rubbery plateau in excess of its Tg; and (iv) Melt flow in excess of 70° C. |
US08940832B2 |
Polymers and use thereof as dispersants having a foam-inhibiting effect
The invention relates to polymers that can be obtained by polymerizing the monomers (A), (B), and (D), and optionally (C), where (A) is a monomer of formula (I), wherein A stands for C2 to C4 alkylene, B stands for a C2 to C4 alkylene different from A, R stands for hydrogen or methyl, m stands for a number from 1 to 500, n stands for a number from 1 to 500, (B) is an ethylenically unsaturated monomer that contains at least one carboxylic acid function, (C) is optionally a further ethylenically unsaturated monomer different from (A) and (B), (D) is a monomer of formula (II), wherein D stands for C2 to C4 alkylene, E stands for a C2 to C4 alkylene group different from D, F stands for a C2 to C4 alkylene group different from E, R stands for hydrogen or methyl, o stands for a number from 1 to 500, p stands for a number from 1 to 500, q stands for a number from 1 to 500, and wherein the weight fraction of the monomers is 35 to 99% for the macromonomer (A), 0.5 to 45% for the monomer (B), 0 to 20% for the monomer (C), and 1 to 20% for the monomer (D), and to the use of said polymers as defoamers for inorganic solid suspensions. |
US08940830B2 |
Fast drying emulsion systems
The drying time for aqueous asphalt emulsions used in the roofing and other waterproofing industries is shortened by separately applying an emulsion breaking agent to the substrate to be waterproofed, to the aqueous asphalt emulsion after it is applied, or both. |
US08940829B1 |
Powdered coatings compositions
Provided are compositions of matter which exist in a powdered, free-flowing form to which water is added preferable just prior to the time of use, to yield flowable liquid compositions which are spreadable, dispersible or sprayable onto various substrates. In some embodiments such free-flowing compositions contain water-soluble styrene/acrylic acid copolymers, and can surprisingly comprise relatively large amounts of water on the order of about 20% or more, while remaining in the form of a free-flowing powder prior to their combination with additional water to yield the spreadable, dispersible or sprayable liquid compositions. By the present disclosure, shelf life concerns are eliminated, as the compositions provided have an essentially indefinite shelf life, and transportation and handling ease are greatly increased over prior art compositions due to less weight by the absence of large relative quantities of water present in prior art compositions. |
US08940827B2 |
Thermosetting polymer-based composite materials
The present invention relates to a lead-free, non-toxic and arc resistant composite material having a thermosetting polymer, at least one heavy particulate filler, at least one light particulate filler and, optionally, at least one arc resistant filler. The composite material may be utilized in manufacturing articles used in radiation shielding and other applications where arc resistant and dielectric strength are desired. |
US08940824B2 |
Heat-stabilized acrylate elastomer composition and process for its production
Polyamide-filled acrylate copolymer compositions comprising a continuous acrylate copolymer phase and a discontinuous polyamide phase are produced by a melt mixing process. When crosslinked with diamine curatives the polyamide-filled acrylate copolymer compositions exhibit enhanced resistance to heat aging compared to carbon black-reinforced acrylate copolymer compositions. |
US08940820B2 |
Process for stabilizing hypophosphite
A process for stabilizing hypophosphite salt is provided, which comprises the following steps: a) washing the hypophosphite salt at least one time under a controlled pH value of 4-11, preferably 5-8, as the said hypophosphite salt in an aqueous solution and/or in a solid state; and b) drying the said hypophosphite salt under reduced pressure to remove the volatiles. The process can prevent or minimize the formation of a dangerous quantity of phosphine from hypophosphite salts, more particularly in the flame retardant of the application. The flame retardant polymer composition is also provided, which comprises a polymer and the hypophosphite salt stabilized by the above process. |
US08940819B2 |
Additive composition and thermoplastic compositions comprising the same
A thermoplastic additive composition comprises an acetal compound and at least one co-additive. The acetal compound can be the product of the reaction between an alditol or a C1-substituted alditol and a benzaldehyde. The co-additive can be a fatty acid amide compound, a fatty acid ester compound, and/or a fluoropolymer. A thermoplastic composition comprises a thermoplastic (e.g., one or more polyolefins) and an additive composition as described above. |
US08940815B2 |
Reinforced and conductive resin compositions comprising polyolefins and poly(hydroxy carboxylic acid)
A resin composition comprising a polyolefin, carbon nanotubes and poly(hydroxy carboxylic acid). The invention also covers a process for preparing a resin composition comprising a polyolefin, carbon nanotubes and poly(hydroxy carboxylic acid) by (i) blending a poly(hydroxy carboxylic acid) with carbon nanotubes to form a composite (ii) blending the composite with a polyolefin. The use of poly(hydroxy carboxylic acids) as a compatibilizer to blend carbon nanotubes into polyolefins is also claimed. |
US08940811B2 |
Curable liquids and inks for toys and food packaging applications
A free radical curable liquid for inkjet printing of food packaging materials includes no initiator or otherwise one or more initiators selected from the group consisting of non-polymeric di- or multifunctional initiators, oligomeric initiators, polymeric initiators, and polymerizable initiators; wherein the polymerizable composition of the liquid consists of: a) 25-100 wt % of one or more polymerizable compounds A having at least one acrylate group G1 and at least one second ethylenically unsaturated polymerizable functional group G2 different from the group G1; b) 0-55 wt % of one or more polymerizable compounds B selected from the group consisting of monofunctional acrylates and difunctional acrylates; and c) 0-55 wt % of one or more polymerizable compounds C selected from the group consisting of trifunctional acrylates, tetrafunctional acrylates, pentafunctional acrylates and hexafunctional acrylates. |
US08940807B2 |
Method for producing metal oxide organic compound composite
A method for obtaining a metal oxide organic compound composite includes dissolving a hydrated yttrium chloride and an epoxide in a solvent, and obtaining a gel including the metal oxide organic compound composite. |
US08940799B2 |
Adjusting drug loading in polymeric materials
Drug loading of polymeric materials can be adjusted by selection of materials and/or adjusting processing steps in formation of an implantable drug-loaded device. |
US08940794B2 |
Methods and compositions for treating Raynaud's disease
In various embodiments, methods and compositions for treating Raynaud's disease and Raynaud's phenomenon are provided. Topical administration of a semisolid composition comprising a prostaglandin E1 compound provides the desired relief of the Raynaud's disease or Raynaud's phenomenon without the possible complications of systemic administration. The semisolid composition can be administered as needed, or in a regimen of several doses per day. |
US08940793B2 |
4-[(haloalkyl)(dimethyl)ammonio]butanoates and use thereof in the treatment of cardiovascular disease
4-[(Haloalkyl)(dimethyl)ammonio]butanoates of formula wherein Hal is Cl or F, n=1 or 2, method for preparing thereof and use thereof for treating cardiovascular disease. |
US08940792B2 |
Antimicrobial composition and methods for using same
An aqueous composition adapted to kill bacteria in both planktonic and biofilm states is lethal toward a wide spectrum of gram positive and gram negative bacteria as well as other microbes. The composition, which is slightly to moderately acidic, includes a significant amount of one or more surfactants and large amounts of osmotically active solutes. The composition can be applied directly to a site of bacterial growth. Even when the bacteria is in biofilm form, the surfactant component(s) begin to kill the bacteria before the macromolecular matrix is removed or dislodged from the site. |
US08940786B2 |
Non-aqueous taxane nanodispersion formulations and methods of using the same
Non-aqueous, ethanol-free taxane nanodispersion formulations are provided. Nanodispersion formulations of embodiments of the invention include a taxane, an oil, a non-ionic surfactant, a non-aqueous solvent, and an organic acid component, wherein the organic acid component is soluble in the non-aqueous solvent and the amount by weight of non-ionic surfactant is equal to or greater than the amount by weight of non-aqueous solvent. Also provided are methods of using the nanodispersion formulations, as well as kits that include the nanodispersion formulations. Non-aqueous, ethanol-free docetaxel nanodispersion formulations are provided. Nanodispersion formulations of embodiments of the invention include docetaxel, an oil, a non-ionic surfactant, a non-aqueous solvent, and an organic acid which is soluble in the non-aqueous solvent and is substantially free of any conjugate base. Also provided are methods of using the nanodispersion formulations, as well as kits that include the nanodispersion formulations. |
US08940784B2 |
Water-soluble CC-1065 analogs and their conjugates
This invention relates to novel analogs of the DNA-binding alkylating agent CC-1065 and to their conjugates. Furthermore this invention concerns intermediates for the preparation of said agents and their conjugates. The conjugates are designed to release their (multiple) payload after one or more activation steps and/or at a rate and time span controlled by the conjugate in order to selectively deliver and/or controllably release one or more of said DNA alkylating agents. The agents, conjugates, and intermediates can be used to treat an illness that is characterized by undesired (cell) proliferation. As an example, the agents and the conjugates of this invention may be used to treat a tumor. |
US08940777B2 |
Pest controlling composition and method of controlling pest
A pest controlling composition comprising tolclofos-methyl and a neonicotinoid compound represented by the formula (1) as active ingredients. |
US08940772B2 |
Nicotine lozenge composition
The present invention relates to nicotine lozenge compositions comprising reduced levels of buffering agents from traditional nicotine lozenges and which provide optimal oral pH and prompt nicotine absorption in a smaller, more convenient dosage form. |
US08940768B2 |
Antifungal triazole derivatives
Disclosed are novel triazole derivatives. Exhibiting excellent antifungal activity and in vivo safety, they are useful for the treatment or prevention of fungal infections caused by a wide spectrum of fungi. |
US08940766B2 |
Methods for preventing and/or treating lysosomal storage disorders
The present invention provides methods for preventing and/or treating lysosomal storage disorders using 5-(fluoromethyl)piperidine-3,4-diol, 5-(chloromethyl)piperidine-3,4-diol, or a pharmaceutically acceptable salt, solvate, or prodrug thereof, or any combination of two or more thereof. In particular, the present invention provides methods for preventing and/or treating Gaucher's disease. |
US08940764B2 |
Compositions and methods of treating retinal disease
Compositions and methods for treating macular degeneration and other forms of retinal disease whose etiology involves the accumulation of A2E and/or lipofuscin, and, more specifically, for preventing the formation and/or accumulation of A2E are disclosed. |
US08940763B2 |
Combinations of solifenacin and salivary stimulants for the treatment of overactive bladder
Disclosed herein are pharmaceutical compositions comprising a therapeutically effective amount of extended release solifenacin, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of pilocarpine, or a pharmaceutically acceptable salt thereof. Also disclosed herein are methods of treating a patient suffering from overactive bladder, the method comprising identifying a patient in need thereof, and administering to the patient a therapeutically effective amount of extended release solifenacin, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of pilocarpine, or a pharmaceutically acceptable salt thereof. Also disclosed herein are methods of alleviating a side effect of treatment for overactive bladder in a patient suffering therefrom, the method comprising identifying a patient in need thereof, and administering to the patient a therapeutically effective amount of extended release solifenacin, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of pilocarpine, or a pharmaceutically acceptable salt thereof. |
US08940755B2 |
Therapeutic combinations and methods including IRM compounds
The present invention provides therapeutic combinations that include an immune response modifier (IRM) component and an anti-inflammatory component. The inventions further provide methods of treating a condition by administering to one having the condition a therapeutic combination that includes an IRM component and an anti-inflammatory component. |
US08940753B1 |
Methods for treating pruritis
The present invention relates to methods for treating pruritus with anti-pruritic compositions. |
US08940750B2 |
Inhibitors of bruton's tyrosine kinase
Described herein are irreversible kinase inhibitor compounds, methods for synthesizing such irreversible inhibitors, and methods for using such irreversible inhibitors in the treatment of a B-cell proliferative disorder or a mast cell proliferative disorder having the structure of Formula (A1) |
US08940748B2 |
Iminothiadiazine dioxide compounds as BACE inhibitors, compositions, and their use
In its many embodiments, the present invention provides certain iminothiadiazine dioxide compounds, including compounds Formula (I): and include stereoisomers thereof, and pharmaceutically acceptable salts of said compounds stereoisomers, wherein each of R1, R2, R3, R4, R5, R9, ring A, ring B, m, n, p, -L1-, -L2-, and -L3- is selected independently and as defined herein. The novel iminothiadiazine dioxide compounds of the invention have surprisingly been found to exhibit properties which are expected to render them advantageous as BACE inhibitors and/or for the treatment and prevention of various pathologies related to β-amyloid (“Aβ”) production. Pharmaceutical compositions comprising one or more such compounds (alone and in combination with one or more other active agents), and methods for their preparation and use in treating pathologies associated with amyloid beta (Aβ) protein, including Alzheimer's disease, are also disclosed. |
US08940746B2 |
Liquid formulations of salts of 1-[2-(2,4-dimethylphenylsulfanyl)phenyl]-piperazine
Liquid formulations of lactic acid addition salts of 1-[2-(2,4-dimethylphenylsulfanyl)-phenyl]piper-azine are provided. |
US08940744B2 |
Pyrazolopyrimidine compounds as kinase inhibitors
The present disclosure provides compounds of Formula (IA) and/or pharmaceutically acceptable salts thereof that are tyrosine kinase inhibitors, in particular BTK, and are potentially useful for the treatment of diseases treatable by inhibition of tyrosine kinases such as cancer, inflammatory diseases such as arthritis, and the like. Also provided are pharmaceutical compositions containing such compounds and/or pharmaceutically acceptable salts thereof and processes for preparing such compounds and pharmaceutically acceptable salts thereof. |
US08940742B2 |
Heterocyclic compounds and uses thereof
Compounds and pharmaceutical compositions that modulate kinase activity, including PI3 kinase activity, and compounds, pharmaceutical compositions, and methods of treatment of diseases and conditions associated with kinase activity, including PI3 kinase activity, are described herein. |
US08940741B2 |
Inhibitors of bruton's tyrosine kinase
This application discloses 6-(2-Hydroxymethyl-phenyl)-2-methyl-2H-pyridazin-3-one derivatives according to generic Formula I: wherein, variables X, R, and Y4, are defined as described herein, which inhibit Btk. The compounds disclosed herein are useful to modulate the activity of Btk and treat diseases associated with excessive Btk activity. The compounds are further useful to treat inflammatory and auto immune diseases associated with aberrant B-cell proliferation, such as rheumatoid arthritis. Also disclosed are compositions containing compounds of Formula I and at least one carrier, diluent or excipient. |
US08940739B2 |
Compound of a reverse-turn mimetic and a production method and use therefor
This invention relates to novel compounds of reverse-turn mimetics, having pyrazino-triazinone as a basic framework, and a method of preparing the same, and the use thereof to treat diseases such as cancer, in particular, acute myeloid leukemia. |
US08940738B2 |
Pyrimidone compounds
A pyrimidone derivative represented by general formula (I) or a pharmaceutically acceptable salt thereof: wherein X represents hydrogen atom and Y represents hydroxyl group, or X represents fluorine atom and Y represents hydrogen atom; R1 represents a C1-6 alkyl group; R2 represents a morpholin-4-yl group which may be substituted, or the like, which is used for preventive and/or therapeutic treatment of a disease caused by tau protein kinase 1 hyperactivity such as a neurodegenerative diseases (e.g. Alzheimer disease). |
US08940731B2 |
Substituted pyridyl amide compounds as modulators of the histamine H3 receptor
Certain substituted pyridyl amide compounds are histamine H3 receptor modulators useful in the treatment of histamine H3 receptor-mediated diseases. |
US08940730B2 |
Methods and compositions of treating a Flaviviridae family viral infection
Briefly described, embodiments of this disclosure include compounds, pharmaceutical compositions, methods of treating a host infected with a virus from the Flaviviridae family of viruses, methods of inhibiting HCV replication in a host, methods of inhibiting the binding of NS4B polypeptide to the 3′UTR of HCV negative strand RNA in a host, methods of treating liver fibrosis in a host, and the like. |
US08940729B1 |
Abuse deterrent and anti-dose dumping pharmaceutical salts useful for the treatment of attention deficit/hyperactivity disorder
A pharmaceutical composition comprising a drug substance consisting essentially of a pharmaceutically acceptable organic acid addition salt of an amine containing pharmaceutically active compound wherein the amine containing pharmaceutical active compound is selected from the group consisting of racemic or single isomer ritalinic acid or phenethylamine derivatives and the drug substance has a physical form selected from amorphous and polymorphic. |
US08940727B2 |
Benzazepine compound
An object of the present invention is to provide a novel benzazepine compound or a salt thereof, which has excellent vasopressin antagonistic activity.The benzazepine compound or a salt thereof of the present invention is represented by Formula (1): wherein R1, R2 and R5 may be the same or different and each represents H or D; and R3 and R4 each represents a C1-6 alkyl group, a C1-6 deuteroalkyl group, or a C1-6 perdeuteroalkyl group. |
US08940721B2 |
Compositions and methods of treating retinal disease
Compositions and methods for treating macular degeneration and other forms of retinal disease whose etiology involves the accumulation of A2E and/or lipofuscin, and, more specifically, for preventing the formation and/or accumulation of A2E are disclosed. |
US08940715B2 |
Lipid-regulating agent and use thereof
The object of the present invention is to provide a lipid-regulating agent or a composition for regulating the amount of lipids comprising the agent. The present invention solves the above object by providing a lipid-regulating agent comprising a cyclic tetrasaccharide and/or its saccharide-derivative(s) and a composition for regulating the amount of lipids comprising the lipid-regulating agent. |
US08940714B2 |
Cyanocobalamin low viscosity aqueous formulations for intranasal delivery
A stable pharmaceutical mercury-free aqueous solution of cyanocobalamin comprised of cyanocobalamin and water wherein said solution of cyanocobalamin is suitable for intranasal administration, has a viscosity less than about 1000 cPs, and wherein said solution of cyanocobalamin has a bioavailability of cyanocobalamin when administered intranasally of at least about 7% relative to an intramuscular injection of cyanocobalamin with the proviso that the solution is essentially free of mercury and mercury-containing compounds. The present invention is also directed towards a method for elevating the vitamin B12 levels in the cerebral spinal fluid (CSF) comprising administering intranasally a sufficient amount of a mercury-free cyanocobalamin solution so as to increase the average ratio of vitamin B12 in the CSF to that in the blood serum (B12 CSF/B12 Serum×100) to at least about 1.1 comprising intranasally administering an aqueous solution of a cyanocobalamin, wherein said solution of cyanocobalamin has a bioavailability of at least 7% relative to an intramuscular injection of a cyanocobalamin. |
US08940711B2 |
Micro-RNA family that modulates fibrosis and uses thereof
The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease. |
US08940708B2 |
Treatment of hepatocyte growth factor (HGF) related diseases by inhibition of natural antisense transcript to HGF
The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Hepatocyte Growth Factor (HGF), in particular, by targeting natural antisense polynucleotides of Hepatocyte Growth Factor (HGF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of HGF. |
US08940705B2 |
Method of treating disease and selectively modulating transcriptional regulation by a glucocorticoid receptor by administering aclacinomycin and dexamethasone
The invention relates to assays to detect selective gene regulation by ligand dependent transcription factors. The invention also relates to selective modulators of the glucocortocoid receptor for treatment of inflammation and allergic and immune-mediated diseases. |
US08940704B2 |
Advantageous salts of μ-opiate receptor peptides
The subject invention provides advantageous new salts of mu-opiate receptor peptides. These salts have been found to have excellent properties in terms of their crystal structure, stability, solubility, lack of impurities and/or the ability to be produced, with these advantageous properties, in amounts sufficient for the production of therapeutic compositions. |
US08940703B2 |
Inhibitors of TLR signaling by targeting TIR domain interfaces
TIR-domain decoy peptides and TIR domain peptides are disclosed, as well as methods of using the peptides in the regulation of toll-like receptor (TLR) activation and signaling. |
US08940699B2 |
Model systems and treatment regimes for treatment of neurological disease
The invention provides animal models and clinical trials for assessing agents for potential use in treating and effecting prophylaxis stroke and other neurological diseases, particularly those mediated at least in part by excitoxitity. The invention also provides preferred dosage and infusion regimes and pharmaceutical compositions for clinical application of such agents. |
US08940695B2 |
Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
The present invention provide purified Flt4 receptor tyrosine kinase polypeptides and fragments thereof, polynucleotides encoding such polypeptides, antibodies that specifically bind such polypeptides, and uses therefor. |
US08940688B2 |
Fluorinated tripeptide HCV serine protease inhibitors
The present invention relates to compounds of Formula I, or a pharmaceutically acceptable salt, ester, or prodrug, thereof: which inhibit serine protease activity, particularly the activity of hepatitis c virus (HCV) NS3-NS4A protease. Consequently, the compounds of the present invention interfere with the life cycle of the hepatitis c virus and are also useful as antiviral agents. The present invention further relates to pharmaceutical compositions comprising the aforementioned compounds for administration to a subject suffering from HCV infection. The invention also relates to methods of treating an HCV infection in a subject by administering a pharmaceutical composition comprising the compounds of the present invention. |
US08940685B2 |
Method for preparing active peptides from corn germ proteins
The present invention discloses a method for producing antihypertensive active peptides with corn germ protein as the material. The method comprises an alkali-heat treatment and continuous enzymolysis of the corn germ protein. The components with molecular weight less than 1000 Da in the active peptides obtained according to the present method account for more than 92%, and alanine-tyrosine (Ala-Tyr, AY) as the characteristic peptide fragments in the antihypertensive peptides accounts for more than 0.6%, so that the active peptides have a good ACE inhibitory activity in vitro as well as stability against temperature, pH and major gastrointestinal digestive enzymes, and have a significant effect of lowering blood pressure on spontaneous hypertension rats in vivo. The active peptides can be applied as a new functional nutrient to development and production of food, health food and pharmaceutical. |
US08940684B2 |
Cross-linked collagen comprising an antifungal agent
The disclosure describes collagen constructs comprising antifungal agents, preferably, copper, and related methods. |
US08940683B2 |
Localized therapy of lower airways inflammatory disorders with proinflammatory cytokine inhibitors
The present invention is drawn to methods and compositions for treating inflammatory disorders of the lower airways, comprising administering an effective amount of an agent, which modulates the expression and/or activity of a proinflammatory cytokine or fragment thereof, preferably in a human. The proinflammatory cytokine contemplated by the invention includes IL-1, IL-6, IL-8 and TNF-alpha. The present invention describes a kit comprising a delivery device and a pharmaceutical composition for administration of the agent. The pharmaceutical composition includes at least one proinflammatory cytokine inhibitor, optionally one or more additional active ingredients, and at least one pharmaceutically active carrier. The delivery device further comprises a nebulizer, an inhaler, a powder dispenser, an intrapulmonary aerosolizer and a sub-miniature aerosolizer. |
US08940677B2 |
Compact fluid laundry detergent composition
Compact liquid or gel-form laundry detergent compositions processes for manufacturing such compositions, wherein the compositions comprise at least a stabilization system against phase splitting having an alkanolamine and a coupling polymer component and preferably a stabilization system against phase splitting having an alkanolamine, a coupling polymer and a crystalline structurant component. |
US08940673B2 |
Skin cleansing composition
The present invention provides a skin cleansing composition comprising the following components (A), (B), and (C): (A) (a1) an alkenylsulfonic acid having 12 to 22 carbon atoms or its salt, (a2) an alkylsulfonic acid having 12 to 22 carbon atoms or its salt, or a mixture of them, (B) an alkyl ether carboxylic acid represented by the following formula (1) or its salt: R1—O—(CH2CH2O)n—CH2—COOX (1) wherein R1 represents an alkyl group having 4 to 22 carbon atoms, n denotes a number from 0 to 20, X represents a hydrogen atom, an alkali metal, an alkali earth metal, ammonium, or organic ammonium, and n denotes a number of 0.5 or more and less than 4 on average; and (C) water. |
US08940664B2 |
Oil release with polyethylene oxide segment-containing N-lauroyl amino acid-based compounds
Chemical compounds that are N-lauroyl amino acids containing a polyethylene oxide segment were found to have oil-releasing activity. Solutions containing these compounds may be introduced into oil reservoirs or onto oil-contaminated surface sites to release oil from oil-coated surfaces. The released oil may be recovered for further processing or waste disposal. |
US08940658B2 |
Catalyst for producing unsaturated carboxylic acid and a process for producing unsaturated carboxylic acid using the catalyst
Provided is a catalyst for producing unsaturated carboxylic acid, which excels in mechanical strength and attrition loss and is capable of producing the object product at a high yield. This catalyst is formed of a catalytically active component comprising molybdenum and vanadium as the essential ingredients and inorganic fibers, which are supported on an inert carrier, said catalyst being characterized in that said inorganic fibers comprise at least an inorganic fiber having an average diameter less than 1.0 μm and another inorganic fiber having an average diameter ranging from 1.5 to 7 μm. |
US08940656B2 |
CoP2 loaded red phosphorus, preparation and use of the same
Disclosed are a photocatalyst of CoP2 loaded red phosphorus, a preparation method thereof, and a method for photocatalytic hydrogen production from water under visible light irradiation over the photocatalyst of CoP2 loaded red phosphorus. |
US08940655B2 |
Porous oxide microparticles and composites thereof and methods of making and using same
Provided are substantially spherical, porous oxide microparticles having a plurality of substantially spherical voids, substantially spherical, porous oxide-organic polymer composite microparticles having a plurality of substantially spherical organic polymer domains. The microparticles can be made using a microdispersive suspension polymerization step to make microparticles having an organic polymer shell and a plurality of discrete substantially spherical organic nanoparticles. The microparticles can be used as polymerization catalyst supports. |
US08940654B2 |
Catalyst components for the polymerization of olefins and catalysts therefrom obtained
A catalyst component for the polymerization of olefins obtained by: (a) reacting in a inert hydrocarbon suspension medium a Mg(OR1)(OR2) compound, in which R1 and R2 are identical or different and are each an alkyl radical having 1 to 10 carbon atoms, with a tetravalent transition metal compound having at least a Metal-halogen bond, used in amounts such that the molar ratio metal/Mg is from 0.05 to 10, thereby obtaining a solid reaction product dispersed in a hydrocarbon slurry, (b) washing the solid reaction product dispersed in a hydrocarbon slurry with a liquid hydrocarbon, (c) contacting the washed solid reaction product obtained in (b) with a tetravalent titanium compound and (d) contacting the product obtained in (c) with an organometallic compound of a metal of group 1, 2 or 13 of the Periodic Table. |
US08940651B2 |
Lithium silicate materials
Lithium silicate materials are described which can be easily processed by machining to dental products without undue wear of the tools and which subsequently can be converted into lithium silicate products showing high strength. |
US08940649B2 |
Coating treatment method, non-transitory computer storage medium and coating treatment apparatus
A coating treatment method includes: a first step of rotating a substrate at a first rotation number; a second step of rotating the substrate at a second rotation number being slower than the first rotation number; a third step of rotating the substrate at a third rotation number being faster than the second rotation number and slower than the first rotation number; a fourth step of rotating the substrate at a fourth rotation number being slower than the third rotation number; and a fifth step of rotating the substrate at a fifth rotation number being faster than the fourth rotation number. A supply of a coating solution to a central portion of the substrate is continuously performed from the first step to a middle of the second step or during the first step, and the fourth rotation number is more than 0 rpm and 500 rpm or less. |
US08940642B2 |
Method of multiple patterning of a low-K dielectric film
Methods of multiple patterning of low-k dielectric films are described. For example, a method includes forming and patterning a first mask layer above a low-k dielectric layer, the low-k dielectric layer disposed above a substrate. A second mask layer is formed and patterned above the first mask layer. A pattern of the second mask layer is transferred at least partially into the low-k dielectric layer by modifying first exposed portions of the low-k dielectric layer with a first plasma process and removing the modified portions of the low-k dielectric layer. Subsequently, a pattern of the first mask layer is transferred at least partially into the low-k dielectric layer by modifying second exposed portions of the low-k dielectric layer with a second plasma process and removing the modified portions of the low-k dielectric layer. |
US08940638B2 |
Substrate wiring method and semiconductor manufacturing device
In a substrate wiring method, copper is embedded all the way to the lowest parts of a wiring pattern formed on a substrate. The method is used to wire a substrate in a processing chamber kept in a vacuum state, the substrate having a wiring pattern formed thereon. The method includes a preprocessing step in which the wiring pattern on the substrate is cleaned using a desired cleaning gas and an embedding step in which, after the preprocessing step, metal nanoparticles are embedded in the wiring pattern using a clustered metal gas. |
US08940637B2 |
Method for forming through silicon via with wafer backside protection
Semiconductor devices with through silicon vias (TSVs) are formed without copper contamination. Embodiments include exposing a passivation layer surrounding a bottom portion of a TSV in a silicon substrate, forming a silicon composite layer over the exposed passivation layer and over a bottom surface of the silicon substrate, forming a hardmask layer over the silicon composite layer and over the bottom surface of the silicon substrate, removing a section of the silicon composite layer around the bottom portion of the TSV using the hardmask layer as a mask, re-exposing the passivation layer, and removing the hardmask layer and the re-exposed passivation layer to expose a contact for the bottom portion of the TSV. |
US08940636B2 |
Through hole vias at saw streets including protrusions or recesses for interconnection
A semiconductor package includes a semiconductor wafer having a plurality of semiconductor die. A contact pad is formed over and electrically connected to an active surface of the semiconductor die. A gap is formed between the semiconductor die. An insulating material is deposited in the gap between the semiconductor die. An adhesive layer is formed over a surface of the semiconductor die and the insulating material. A via is formed in the insulating material and the adhesive layer. A conductive material is deposited in the via to form a through hole via (THV). A conductive layer is formed over the contact pad and the THV to electrically connect the contact pad and the THV. The plurality of semiconductor die is singulated. The insulating material can include an organic material. The active surface of the semiconductor die can include an optical device. |
US08940635B1 |
Structure and method for forming interconnect structure
A method for forming a semiconductor structure includes providing a semiconductor substrate and forming a dielectric layer over the semiconductor substrate. An opening is formed in the dielectric layer. A conductive line is formed in the opening, wherein the conductive line has an open void formed therein. A sealing metal layer is formed overlying the conductive line, the dielectric layer, and the open void, wherein the sealing metal layer substantially fills the open void. The sealing metal layer is planarized so that a top surface thereof is substantially level with a top surface of the conductive line. An interconnect feature is formed above the semiconductor substrate, wherein the interconnect feature is electrically coupled with the conductive line and the sealing metal layer-filled open void. |
US08940630B2 |
Method of making wire bond vias and microelectronic package having wire bond vias
Microelectronic components and methods forming such microelectronic components are disclosed herein. The microelectronic components may include a plurality of electrically conductive vias in the form of wire bonds extending from a bonding surface of a substrate, such as surfaces of electrically conductive elements at a surface of the substrate. |
US08940629B2 |
Ball grid array semiconductor package and method of manufacturing the same
In a method of manufacturing a ball grid array (BGA) semiconductor package, micro balls are mounted onto a respective plurality of through-holes formed in a substrate, and a semiconductor device is mounted on a die pad portion of the substrate. The semiconductor device and the micro balls are electrically connected with bonding wires. The semiconductor device, the die pad portion, the bonding wires, and parts of the micro balls are sealed together with an insulating resin to form an encapsulation member. The encapsulation member and the substrate are then cut into individual BGA semiconductor packages. |
US08940628B2 |
Method of manufacturing interconnection and semiconductor device
A method of manufacturing an interconnection of an embodiment includes: forming a via which penetrates an interlayer insulation film on a substrate; forming an underlying film in the via; removing the underlying film on a bottom part of the via; forming a catalyst metal inactivation film on the underlying film; removing the inactivation film on the bottom part of the via; forming a catalyst metal film on the bottom part of the via on which the inactivation film is removed; performing a first plasma treatment and a second plasma treatment using a gas not containing carbon on a member in which the catalyst metal film is formed; forming a graphite layer on the catalyst film after the first and second plasma treatment processes; and causing a growth of a carbon nanotube from the catalyst film on which the graphite layer is formed. |
US08940625B2 |
Low temperature polysilicon thin film and manufacturing method thereof
An embodiment of the present invention relates to a low temperature polysilicon thin film and a manufacturing method thereof. The manufacturing method comprises: forming a buffer layer on a substrate (S11); forming a seed layer comprising a plurality of uniformly distributed crystal nuclei on the buffer layer by using a patterning process (S12); forming an amorphous silicon layer on the seed layer (S13); and performing an excimer laser annealing process on the amorphous silicon layer (S14). |
US08940623B2 |
Process for obtaining an array of nanodots
A process for obtaining an array of nanodots (212) for microelectronic devices, characterized in that it comprises the following steps: deposition of a silicon layer (210) on a substrate (100, 132), formation, above the silicon layer (210), of a layer (240) of a material capable of self-organizing, in which at least one polymer substantially forms cylinders (242) organized into an array within a matrix (244), formation of patterns (243) in the layer (240) of a material capable of self-organizing by elimination of the said cylinders (242), formation of a hard mask (312) by transfer of the said patterns (243), production of silicon dots (212) in the silicon layer (210) by engraving through the hard mask (312), silicidation of the silicon dots (212), comprising deposition of a metal layer (510). |
US08940622B2 |
Method for manufacturing compound semiconductor device and detergent
A method for manufacturing a compound semiconductor device, the method includes: forming a compound semiconductor laminated structure; removing a part of the compound semiconductor laminated structure, so as to form a concave portion; and cleaning the inside of the concave portion by using a detergent, wherein the detergent contains a base resin compatible with residues present in the concave portion and a solvent. |
US08940616B2 |
Bonding method using porosified surfaces for making stacked structures
A bonded device having at least one porosified surface is disclosed. The porosification process introduces nanoporous holes into the microstructure of the bonding surfaces of the devices. The material property of a porosified material is softer as compared to a non-porosified material. For the same bonding conditions, the use of the porosified bonding surfaces enhances the bond strength of the bonded interface as compared to the non-porosified material. |
US08940615B2 |
Method of forming isolation structure
The present invention provides a method of forming an isolation structure. A substrate is provided, and a trench is formed in the substrate. Next, a semiconductor layer is formed on a surface of the trench. A nitridation is carried out to form a nitridation layer in the semiconductor layer. Lastly, an insulation layer is filled into the trench. |
US08940609B2 |
MOS device and method of manufacturing the same
A semiconductor device and method of forming the semiconductor device are disclosed, where the semiconductor device includes additional implant regions in the source and drain areas of the device for improving Ron-sp and BVD characteristics of the device. The device includes a gate electrode formed over a channel region that separates first and second implant regions in the device substrate. The first implant region has a first conductivity type, and the second implant region has a second conductivity type. A source diffusion region is formed in the first implant region, and a drain diffusion region is formed in the second implant region. |
US08940608B2 |
Methods for fabricating integrated circuits with drift regions and replacement gates
Methods for fabricating integrated circuits are provided. In an embodiment, a method for fabricating an integrated circuit includes providing a semiconductor substrate including a first region of a first doping type, a second region of the first doping type spaced from the first region, a drift region of the first doping type positioned between the first region and the second region, and regions of the opposite doping type. A mask covering both the drift region and the regions of the opposite doping type is formed. Then, a source/drain ion implantation is performed into the first region and the second region. The mask prevents the drift region and the regions of the opposite doping type from receiving the source/drain ion implantation. |
US08940607B2 |
Manufacturing method of trench type power transistor device with super junction
The present invention provides a manufacturing method of a trench type power transistor device with a super junction. First, a substrate of a first conductivity type is provided, and then an epitaxial layer of a second conductive type is formed on the substrate. Next, a through hole is formed in the epitaxial layer, and the through hole penetrates through the epitaxial layer. Two doped drain regions of the first conductivity type are then formed in the epitaxial layer respectively at two sides of the through hole, and the doped drain regions extend from a top surface of the epitaxial layer to be in contact with the substrate. |
US08940601B2 |
Manufacturing method of semiconductor device
A manufacturing method of a semiconductor device includes the following steps. Firstly, a lower electrode is formed over a substrate (semiconductor substrate). Successively, the lower electrode is primarily crystallized. Successively, a capacitance dielectric layer is formed over the lower electrode after primarily crystallized. Successively, the capacitance dielectric layer is secondarily crystallized. Then, an upper electrode is formed over the capacitance dielectric layer. |
US08940598B2 |
Low temperature coefficient resistor in CMOS flow
A method for adding a low TCR resistor to a baseline CMOS manufacturing flow. A method of forming a low TCR resistor in a CMOS manufacturing flow. A method of forming an n-type and a p-type transistor with a low TCR resistor in a CMOS manufacturing flow. |
US08940594B2 |
Semiconductor device having v-shaped region
Among other things, a semiconductor device or transistor and a method for forming the semiconductor device are provided for herein. The semiconductor device comprises one or more v-shaped recesses in which stressed monocrystalline semiconductor material, such as silicon germanium, is grown, to form at least one of a source or a drain of the semiconductor device. The one or more v-shaped recesses are etched into a substrate in-situ. The semiconductor device comprises at least one of a source or a drain having a height-to-length ratio exceeding at least 1.6 when poly spacing between a first part of the semiconductor device (e.g., first transistor) and a second part of the semiconductor device (e.g., second transistor) is less than about 60 nm. |
US08940589B2 |
Well implant through dummy gate oxide in gate-last process
The present disclosure relates to methods for fabricating a field-effect transistor. The method includes performing a pocket implantation to a semiconductor substrate; thereafter forming a polysilicon layer on the semiconductor substrate; and patterning the polysilicon layer to form a polysilicon gate.The field-effect transistor (FET) includes a well of a first type dopant, formed in a semiconductor substrate; a metal gate disposed on the semiconductor substrate and overlying the well; a channel formed in the semiconductor substrate and underlying the metal gate; source and drain regions of a second type dopant opposite from the first type, the source and drain regions being formed in the semiconductor substrate and on opposite sides of the channel; and a pocket doping profile of the first type dopant and being defined in the well to form a continuous and uniform doping region from the source region to the drain region. |
US08940588B2 |
Bulk FinFET ESD devices
Aspects of the disclosure provide a dual electrostatic discharge (ESD) protection device in fin field effect transistor (FinFET) process technology and methods of forming the same. In one embodiment, the dual ESD protection device includes: a bulk silicon substrate; a shallow trench isolation (STI) region formed over the bulk silicon substrate; a first ESD device positioned above the STI region; and a second ESD device positioned below the STI region, wherein the first ESD device conducts current above the STI region and the second ESD device conducts current below the STI region. |
US08940582B2 |
Stackable electronic package and method of fabricating same
An electronic package includes a first layer having a first surface, the first layer includes a first device having a first electrical node, and a first contact pad in electrical communication with the first electrical node and positioned within the first surface. The package includes a second layer having a second surface and a third surface, the second layer includes a first conductor positioned within the second surface and a second contact pad positioned within the third surface and in electrical communication with the first conductor. A first anisotropic conducting paste (ACP) is positioned between the first contact pad and the first conductor to electrically connect the first contact pad to the first conductor such that an electrical signal may pass therebetween. |
US08940577B2 |
Programmable metallization cells and methods of forming the same
A programmable metallization cell (PMC) that includes an active electrode; a nanoporous layer disposed on the active electrode, the nanoporous layer comprising a plurality of nanopores and a dielectric material; and an inert electrode disposed on the nanoporous layer. Other embodiments include forming the active electrode from silver iodide, copper iodide, silver sulfide, copper sulfide, silver selenide, or copper selenide and applying a positive bias to the active electrode that causes silver or copper to migrate into the nanopores. Methods of formation are also disclosed. |
US08940571B2 |
Thermoelectric conversion element
P-type semiconductor sheets and n-type semiconductor sheets formed by mixing a powder of semiconductor material, a binder resin, a plasticizer, and a surfactant are prepared. In addition, separator sheets formed by mixing a resin such as PMMA and a plasticizer are prepared. Through holes are formed in each of the separator sheets and then filled with a conductive material. Thereafter, the p-type semiconductor sheet, the separator sheet, the n-type semiconductor sheet and the separator sheet are stacked. The resultant laminated body is cut into a predetermined size and then subjected to a baking process. |
US08940569B2 |
Dual-gate bio/chem sensor
A dual gate extremely thin semiconductor-on-insulator transistor with asymmetric gate dielectrics is provided. This structure can improve the sensor detection limit and also relieve the drift effects. Detection is performed at a constant current mode while the species will be detected at a gate electrode with a thin equivalent oxide thickness (EOT) and the gate bias will be applied to the second gate electrode with thicker EOT to maintain current flow through the transistor. As a result, a small change in the charge on the first electrode with the thin EOT will be translated into a larger voltage on the gate electrode with the thick EOT to sustain the current flow through the transistor. This allows a reduction of the sensor dimension and therefore an increase in the array size. The dual gate structure further includes cavities, i.e., microwell arrays, for chemical sensing. |
US08940566B2 |
Semiconductor device, display device, and production method for semiconductor device and display device
The semiconductor device (100) according to the present invention includes a gate electrode (102) of a TFT, a gate insulating layer (103) formed on the gate electrode (102), an oxide semiconductor layer (107) disposed on the gate insulating layer (103), a protecting layer (108) formed on the oxide semiconductor layer (107) by a spin-on-glass technique, and a source electrode (105) and a drain electrode (106) disposed on the protecting layer (108). Via a first contact hole (131) formed in the protecting layer (108), the source electrode (105) is electrically connected to the oxide semiconductor layer (104), and via a second contact hole (132), the drain electrode (106) is electrically connected to the oxide semiconductor layer (104). |
US08940564B1 |
Method of manufacturing organic light-emitting diode (OLED) display
A method of manufacturing an organic light-emitting diode (OLED) display is disclosed. In one aspect, the method includes forming a color filter on a thin film transistor substrate, forming an organic planarization layer on the color filter, and performing a vacuum heat-treatment on the color filter and organic planarization layer. The method also includes forming a first electrode on the organic planarization layer, forming an organic light-emitting layer on the first electrode, and forming a second electrode on the organic light-emitting layer. The vacuum heat-treatment is performed at a temperature in the range of about 150° C. to about 300° C. under a pressure substantially equal to or lower than about 10−3 Torr before the organic light-emitting layer is formed. |
US08940558B2 |
Techniques for quantifying fin-thickness variation in FINFET technology
Techniques for quantifying ΔDfin in FINFET technology are provided. In one aspect, a method for quantifying ΔDfin between a pair of long channel FINFET devices includes the steps of: (a) obtaining Vth values for each of the long channel FINFET devices in the pair; (b) determining a ΔVth for the pair of long channel FINFET devices; and (c) using the ΔVth to determine the ΔDfin between the pair of long channel FINFET devices, wherein the ΔVth is a function of a difference in a Qbody and a gate capacitance between the pair of long channel FINFET devices, and wherein the Qbody is a function of Dfin and Nch for each of the long channel FINFET devices in the pair, and as such the ΔVth is proportional to the ΔDfin between the pair of long channel FINFET devices. |
US08940557B2 |
Method of fabricating wafer level package
A method of fabricating a wafer level package includes preparing a wafer including a plurality of first semiconductor chips, mounting a plurality of second semiconductor chips on the wafer, disposing the wafer on a lower mold and disposing an upper mold so as to surround edges of a top surface of the wafer, dispensing a molding member on the wafer, and pressurizing the molding member by using a plunger so as to fabricate a wafer level package in which a top surface of each of the plurality of second semiconductor chips is exposed. |
US08940556B2 |
Electrical bias methods and apparatus for photovoltaic device manufacture
A apparatus and method for manufacturing a photovoltaic module includes components for heating the module and applying an electrical bias to the module to improve photovoltaic module performance and manufacture multiple photovoltaic modules with similar performance. |
US08940552B2 |
Methods and ophthalmic devices with organic semiconductor layer
This invention discloses methods and apparatus to form organic semiconductor transistors upon three-dimensionally formed insert devices. In some embodiments, the present invention includes incorporating the three-dimensional surfaces with organic semiconductor-based thin film transistors, electrical interconnects, and energization elements into an insert for incorporation into ophthalmic lenses. In some embodiments, the formed insert may be directly used as an ophthalmic device or incorporated into an ophthalmic device. |
US08940549B2 |
Immunoassay reagent for KL-6 assay
The present invention aims to provide an assay reagent and an assay for accurately measuring KL-6, in particular, an assay reagent and an assay for accurately measuring KL-6 in samples containing a rheumatoid factor and/or a nonspecific substance other than the rheumatoid factor. KL-6 in samples that contain a rheumatoid factor and/or a nonspecific substance other than the rheumatoid factor can be accurately measured using an immunoassay reagent comprising a solution at a pH of 4.0 to 5.5 containing a rheumatoid factor interference inhibitor and a solution of an insoluble carrier on which anti-KL-6 antibodies are immobilized. |
US08940543B2 |
Diagnostic tool and process for assessing thermal urea gasification performance
Disclosed are methods and apparatus for treating and analyzing a gas stream to determine the effectiveness of urea gasification. The apparatus will be capable of performing the method and will include: means for introducing an aqueous solution of urea into a reactor having hot gases therein and subjecting the aqueous to temperatures for a time to assure the gasification of the aqueous urea and form a thermal gasification product stream containing NH3 and HNCO; means for taking a sample stream from the gasification product stream; means for contacting the sample stream with a hydrolysis catalyst in the presence of sufficient water to convert HNCO to NH3 and form an ammonia sample stream; and means for analyzing the ammonia sample stream for NH3. The methods and apparatus can also be used to control a urea gasification process and/or to signal anomalous operation. |
US08940542B2 |
Sensor
A sensor for detecting and/or quantifying the amount of analyte in a sample, the sensor including: a sensing region; and a barrier layer including a reactive oxygen species (ROS)-quenching, analyte-permeable membrane having an ROS-quenching agent adsorbed to the membrane; wherein the sensor is adapted so that the sample enters the sensing region of the sensor through the barrier layer. |
US08940539B2 |
Reagent preparation and dispensing device and methods for the same
A reagent preparation and dispensing device includes a body. A reagent reservoir containing a reagent is disposed within the body. A solution reservoir containing a solution is disposed within the body. The device further includes an activator movably coupled with the body to open the reagent reservoir and the solution reservoir, The activator is operable to mix the solution with the reagent to form a specified amount of a reagent mixture. A dispensing reservoir tip is coupled with the body. The dispensing reservoir tip is sized and shaped to hold the specified amount of the reagent mixture and dispense the specified amount of the reagent mixture from the device. |
US08940537B2 |
Undifferentiated stem cell culture systems
The present disclosure provides methods for maintaining and propagating undifferentiated pluripotent stem cells (SC) in suspension. The methods comprise culturing such SC in a non-adherent culture dish under conditions comprising a basic serum free medium and one or more of a basic medium, a serum replacement, an extra cellular matrix component and a factor supporting expansion of said SC. A specific and preferred culture condition comprise supplementing Neurobasal™ medium with KO serum replacement (KOSR). These conditions allowed for large scale and long term propagation of undifferentiated pluripotent SC. The culture system comprising suspended undifferentiated pluripotent SC were found to have many applications including in methods for directed as well as spontaneous differentiation of the SC into somatic cells. Also disclosed herein is a method of deriving SC, preferably human embryonic SC from human embryos via the formation of cell clusters. |
US08940536B2 |
Methods for making somatic cells more susceptible to reprogramming
The invention provides methods for reprogramming somatic cells to generate multipotent or pluripotent cells. Such methods are useful for a variety of purposes, including treating or preventing a medical condition in an individual. The invention further provides methods for identifying an agent that reprograms somatic cells to a less differentiated state. |
US08940534B2 |
Immortalized avian cell lines for virus production
The present invention relates to immortalized avian cell lines suitable for production of biologicals or viruses for vaccination. In particular, the cell lines are derived from primary cells which are transformed with at least two viral or cellular genes, one of which causes cell cycle progression whereas the other interferes with innate protective mechanisms of the cell induced by dysregulated replication. The invention moreover relates to the production of said immortalized cell lines and their use for producing biologicals or viruses for vaccination. |
US08940532B2 |
Biological graft transferring instrument and method for transferring biological graft
A biological graft transferring instrument for transferring a biological graft includes a main body, a displacement member capable of being displaced relative to the main body, and a belt-shaped member which is wound around the forward end and base end of the displacement member and is joined to the main body. The biological graft is placed on the belt-shaped member at the forward end of the displacement member. |
US08940528B2 |
Petri-dish for cell cultivation and microscopy
A dish for cell cultivation and microscopy is provided, comprising a ring and an outer ridge upwardly and axially protruding therefrom, wherein the ring is covered at its bottom side with a transparent membrane and, thus, forms a recess delimited by the inner side of the ring and the membrane, characterized in that the recess is filled with an adhesive filling. Alternatively, a dish for cell cultivation and microscopy is provided, comprising a base and an outer ridge protruding upwardly and axially at its rim, wherein the base and the outer ridge are made of a transparent plastic, the base together with the inner side of the outer ridge forms a recess filled with an adhesive filling, and the thickness of the base and the filling together is less than about 1 mm. |
US08940518B2 |
Photobioreactor
A method of operating a closed photobioreactor for cultivation of phototrophic microorganisms. The photobioreactor comprises a culture liquid and is partially or completely surrounded by water of a water body. A density difference between the culture liquid and the surrounding water is provided so that the position of the photobioreactor in the water body is controlled. A closed photobioreactor for cultivation of phototrophic microorganisms. The photobioreactor is adapted to comprise a culture liquid and to be partially or completely surrounded by water of a water body. The photobioreactor comprises means for determining the density difference between the culture liquid and the surrounding water. |
US08940511B2 |
Yeast strain for production of four carbon alcohols
Yeast cells with a reduced general control response to amino acid starvation were found to have increased tolerance to butanol in the growth medium. The reduced response was engineered by genetic modification of a gene involved in the response, a GCN gene, to eliminate activity of the encoded protein. Yeast strains with an engineered butanol biosynthetic pathway and a genetic modification in a gene involved in the general control response to amino acid starvation, which have increased butanol tolerance, are useful for production of butanol. |
US08940510B2 |
Spray dried microbes and methods of preparation and use
The invention provides spray-dried preparations of microbes and methods of using those microbes. |
US08940508B2 |
Enhancement of biomass production by disruption of light energy dissipation pathways
The invention provides a method of producing biomass or at least one biomolecule comprising culturing a photosynthetic microorganism that comprises a disrupted Non-Photochemical Quenching (NPQ) process, and isolating biomass or at least one biomolecule from the culture. |
US08940504B2 |
Host cell protein knock-out cells for production of therapeutic proteins
The present invention relates to methods and means for making Vitamin K-dependent protein compositions which are devoid or substantially devoid of protein contaminants. In particular, methods and means useful for the reduction or elimination of protein contaminants also being Vitamin K-dependent proteins are described. |
US08940501B2 |
Methods for ligation and uses thereof
The present invention relates to methods for ligation. The invention provides novel reagents and methods for ligating an acyl donor compound with an acyl acceptor compound. Provided acyl donor compounds comprise a transamidase recognition sequence that allows ligation with a nucleophilic acyl acceptor in the presence of transamidase. The invention further provides kits comprising acyl donor compounds and optionally comprising other reagents for ligation. |
US08940500B2 |
Methods for identifying stem cells by detecting fluorescence of cells and syncytia
Methods are disclosed for the characterization of the stage of development or pathology of a tissue sample, and for identifying pluripotent metakaryotic stem cells, comprising detecting fluorescence of cells and syncytia in fixed samples treated with a non-fluorescent Schiff's base reagent in the absence of extraneous or exogenously added fluorescent dyes. |
US08940496B2 |
Method for detecting microorganisms belonging to Mycoplasma pneumoniae and/or Mycoplasma genitalium
A detection method and a detection kit for rapidly and specifically diagnosing Mycoplasma pneumoniae and/or Mycoplasma genitalium infections are provided. The DnaK of Mycoplasma pneumoniae or Mycoplasma genitalium is used as an indicator. |
US08940492B2 |
Calibrator/control for simultaneous assay of proteins capable of complexing with one another
Disclosed herein are compositions and methods comprising two or more proteins in which at least one of the proteins has been altered to reduce their mutual recognition and binding. Such compositions are useful as reference, calibrators or controls in methods and assays for determining the amount of one or more of the proteins that may be present in a sample of interest or in confirming the presence of one or more of the proteins in the sample. More particularly, it relates to compositions and methods comprising altered placental growth factor-1 (PlGF-1) and soluble fms-like tyrosine kinase (sFlt-1) and methods for determining the amount or confirming the presence of sFlt-1 and/or PlGF-1 in a sample of interest. |
US08940490B2 |
Neoantibodies for diagnosing tissue injury
A method for diagnosing the development of a tissue injury in a subject comprising administering a sample of neoantibodies to the subject's tissue for the purpose of detecting the presence of neoepitopes bearing complement proteins. |
US08940484B2 |
Forensic identification
The invention provides allelic ladder mixtures and individual alleles suitable for use in such mixtures. The allelic ladder mixtures give improved identification and distinguishing capabilities, particularly suitable in forensic investigations. |
US08940480B2 |
MicroRNA based method for anti-colorectal cancer effects and prognosis of colorectal cancer
The present invention discloses a method of providing anti-oncogenic effects in a subject suffered from colorectal cancer. The present invention also discloses a method for screening an anti-colorectal cancer agent. The present invention further discloses a method of determining the prognosis of a subject with colorectal cancer. |
US08940478B2 |
Method and system for the analysis of high density cells samples
Methods for forming cell arrays of multiple cell samples arranged substantially in a monolayer on a single substrate particularly suited for diagnostic analysis are disclosed. The cell arrays are formed with a high-speed dispensing apparatus capable of dispensing small volumes in precise, complex patterns. Also disclosed are substrates upon which cell arrays may be formed, and methods for conducting diagnostic analyzes on the formed cell arrays. |
US08940473B2 |
Resist composition and method for producing resist pattern
A resist composition contains (A1) a resin having a structural unit represented by the formula (I), (A2) a resin being insoluble or poorly soluble in alkali aqueous solution, but becoming soluble in an alkali aqueous solution by the action of an acid, and (B) an acid generator represented by the formula (II). wherein R1 represents a hydrogen atom or a methyl group; A1 represents a C1 to C6 alkanediyl group; R2 represents a C1 to C10 hydrocarbon group having a fluorine atom; R3 and R4 independently represent a fluorine atom or a C1 to C6 perfluoroalkyl group; X1 represents an C1 to C17 divalent saturated hydrocarbon group; R5 represents a group having cyclic ether structure; and Z1+ represents an organic cation. |
US08940469B2 |
Liquid developer with an incompatible additive
A liquid developer for electrography, comprising toner particles dispersed in a liquid carrier, wherein the toner particles include a pigment, a thermoplastic resin, and an organic filler, which organic filler is reactive with groups of the thermoplastic resin and incompatible with the liquid carrier. |
US08940468B2 |
Decolorable toner and process for production thereof
Disclosed is a process for production of a decolorable toner, including: aggregating dispersed fine particles of a color material comprising at least a color-forming compound, a color-developing agent and a decoloring agent with dispersed fine particles comprising at least a binder resin comprising a polyester resin to form aggregates in an aqueous medium, adding a reactive polymer having an oxazoline group in to the aqueous medium, and fusing the aggregates in the aqueous medium. As a result, it becomes possible to produce a decolorable toner which suppresses the generation of fine powder due to the release of fine particles of an erasable color material from the toner. |
US08940464B2 |
Oxime ester photoinitiators
Compounds of the formula (I), (II), and wherein R1, R2, R′2 and R′″2 for example are C1-C20alkyl; R3, R4, and R5 for example independently of one another are hydrogen or a defined substituent provided that at least one of R3, R4 or R5 is other than hydrogen or C1-C20alkyl; R6, R7, R8, R′6, R′7, R′8, R″6, R″7, R′″6 and R′″7 for example independently of one another have one of the meanings as given for R3, R4, and R5; and R9 for example is C1-C20alkyl; exhibit an unexpectedly good performance in photopolymerization reactions. |
US08940462B2 |
Photomask blank, photomask, method of manufacturing the same, and method of manufacturing a semiconductor device
[Object] A photomask blank for use in producing a photomask for exposure with an ArF excimer laser. The photomask blank is intended to be applied to the 32-nm DRAM half-pitch (hp) and succeeding generations in the semiconductor design rule.[Solution] The photomask blank is for use in producing a photomask to which an exposure light having a wavelength not longer than 200 nm is applied. The photomask blank is characterized by comprising a transparent substrate, a light-shielding film formed on the transparent substrate and containing molybdenum and silicon, and an etching mask film formed directly on the light-shielding film and containing chromium. The photomask blank is further characterized in that the light-shielding film comprises a light-shielding layer and an antireflection layer which have been disposed in this order from the transparent substrate side, the light-shielding layer having a molybdenum content of 9-40 at %, and that the etching mask film has a chromium content of 45 at % or lower. |
US08940461B2 |
Method for membrane electrode assembly fabrication and membrane electrode assembly
A method of coating carbon based electrodes and thick electrodes without mud-cracking is described. The electrode ink is deposited on a decal substrate, and transferred to a hot press before the electrode ink is completely dried. The partially dried electrode ink is hot pressed to the membrane to form a membrane electrode assembly. A membrane electrode assembly including a polymer membrane; and a pair of crack-free electrode layers on opposite sides of the polymer membrane, each of the pair of electrode layers having a thickness of at least about 50 μm is also described. |
US08940460B2 |
Catalyst ink preparation for fuel cell electrode fabrication
Methods of fabricating gas diffusion electrodes and gas diffusion electrodes made from such methods are disclosed herein. One method of fabricating a gas diffusion electrode for a fuel cell comprises preparing a catalyst ink of a predetermined viscosity. Preparing the catalyst ink comprises mixing a catalyst solution comprising catalyst particles, an ionomer and a solvent at a first speed for a first period of time and homogenizing the catalyst solution at a second speed in a temperature controlled environment for a second period of time, wherein the second period of time is longer than the first period of time, the second period of time and the second speed selected to preserve a structure of the catalyst particles during homogenization. An active electrode layer is formed by spraying the catalyst ink directly on a gas diffusion layer in a single application and a uniform loading. |
US08940458B2 |
Fuel supply for a fuel cell
The present invention discloses a fuel supply for a fuel cell, the fuel cell including a liquid storage area that includes a liquid reactant, a reaction area that includes a solid reactant, wherein the liquid reactant is pumped into the reaction area such that the liquid reactant reacts with the solid reactant to produce reaction components, a product collection area that receives the reaction components, a barrier, and a container with an interior volume that substantially encloses the reaction area, liquid storage area, product collection area. The barrier separates and defines several of the aforementioned areas, and moves to simultaneously increase the product collector area and decrease the liquid storage area as the liquid reactant is pumped from the liquid storage area and the reaction components are transferred into the product collection area. |
US08940456B2 |
Fuel cell and manufacturing method of the same
A manufactured fuel cell includes: a unit cell including a first electrode layer, an electrolyte layer surrounding an outer circumference of the first electrode layer, and a second electrode layer surrounding the electrolyte layer while exposing an end of the electrolyte layer; a plating layer around an outer circumference of the exposed electrolyte layer; a cell coupling member including a passage pipe inserted into the unit cell and forming a continuous passage from the inside of the unit cell, a coupling pipe provided outside of the passage pipe to form a space accommodating an end of the unit cell from the passage pipe, and a connecting unit connecting the coupling pipe with the passage pipe and restricting an insertion depth of the electrolyte layer and the first electrode layer; and a welding portion fixing and sealing the plating layer and an inner circumference of the coupling pipe with each other. |
US08940455B2 |
Fuel cell
A fuel cell is provided that includes an anode, a cathode, a solid electrolyte layer, a barrier layer, and a buffer layer. The solid electrolyte layer includes zirconium and is provided between the anode and the cathode. The barrier layer includes cerium and is provided between the solid electrolyte layer and the cathode, with the barrier layer having pores. The buffer layer includes zirconium and cerium and is provided between the barrier layer and the solid electrolyte layer. The barrier layer has a first barrier layer provided near to the buffer layer with a first pore ratio and a second barrier layer provided between the first barrier layer and the cathode with a second pore ratio. The first pore ratio of the first barrier layer is larger than the second pore ratio of the second barrier layer. |
US08940454B2 |
Carbon-based fuel cell
A direct-electrochemical-oxidation fuel cell and method for generating electrical energy from a solid-state organic fuel. The fuel cell includes a cathode provided with an electrochemical-reduction catalyst that promotes formation of oxygen ions from an oxygen-containing source at the cathode, an anode provided with an electrochemical-oxidation catalyst that promotes direct electrochemical oxidation of the solid-state organic fuel in the presence of the oxygen ions to produce electrical energy, and a solid-oxide electrolyte disposed to transmit the oxygen ions from the cathode to the anode. The electrochemical oxidation catalyst can optionally include a sulfur resistant material. |
US08940452B2 |
Electrode catalyst substrate and method for producing the same, and polymer electrolyte fuel cell
A method for producing an electrode catalyst substrate is provided herein, which comprises a carbon film forming step of forming a porous carbon film on a base, a hydrophilization step of hydrophilizing the porous carbon film, an immersion step of immersing the base in a solution prepared by dissolving catalytic metal ions in a polar solvent, and a reduction step of adding a reducing agent to the solution and thus reducing the catalytic metal ions. An electrode catalyst substrate obtained by the method and a polymer electrolyte fuel cell in which the electrode catalyst obtained by the method is used for anodes and/or cathodes are also provided herein. In the electrode catalyst of the present invention, fine catalyst particles are loaded in a uniform and highly dispersed manner. |
US08940450B2 |
Membrane electrode assembly for fuel cell and fuel cell stack
A membrane electrode assembly for a fuel cell that secures a flow path of a separator while preventing generation of a pin-hole. The membrane electrode assembly includes an electrolyte membrane for a fuel cell, a microporous layer that is disposed at both surfaces of the electrolyte membrane, a backing layer that is disposed on the microporous layer, and a circumferential edge protective layer that is disposed at an circumferential edge of the electrolyte membrane. An end portion of the microporous layer is positioned further inside of the membrane electrode assembly than an end portion of the backing layer. The circumferential edge protective layer is inserted between the backing layer and the electrolyte membrane. |
US08940449B2 |
Fuel cell
A fuel cell including an electrolyte film, a catalyst layer, two diffusion layers, a fuel supply layer, an oxygen supply layer, a water-absorbing layer, and a collector. The fuel cell has an opening at least in a part of a side surface parallel to a proton conduction direction of the electrolyte film among side surfaces of the fuel cell. The water-absorbing layer is present between the oxygen supply layer and the collector. An end portion of the water-absorbing layer is present on one of a plane including the opening and an opposite side of the fuel cell with the plane including the opening being a reference. A fuel cell system having a fuel cell stack including the fuel cells. The fuel cell has a high water discharging ability and is capable of maintaining stable high generation efficiency and providing a high output even while being small-sized and light-weight. |
US08940444B2 |
Hybrid radical energy storage device and method of making
Hybrid radical energy storage devices, such as batteries or electrochemical devices, and methods of use and making are disclosed. Also described herein are electrodes and electrolytes useful in energy storage devices, for example, radical polymer cathode materials and electrolytes for use in organic radical batteries. |
US08940443B2 |
Polyvinylpyridine additives for nonaqueous electrolytes activating lithium rechargeable electrochemical cells
An electrolyte comprising an organic solvent, a lithium salt, and a polymer additive comprised of repeating vinyl units joined to one or more heterocyclic amine moieties is described. The heterocyclic amine contains five to ten ring atoms, inclusive. An electrochemical cell is also disclosed. The preferred cell comprises a negative electrode which intercalates with lithium, a positive electrode comprising an electrode active material which intercalates with lithium, and the electrolyte of the present invention activating the negative and the positive electrodes. |
US08940442B2 |
Porous film and secondary battery electrode
The present invention is intended for providing a porous film having excellent film uniformity, and is capable to contribute for improving cyclic and rate properties, which is provided on a surface of electrode used for a secondary battery and the like.The porous film of the present invention is characterized by including water soluble polymer having an average polymerization degree of 500 to 2500, an inorganic filler and water soluble particulate polymer. In the present invention particularly, it is preferable that said water soluble polymer is thickening polysaccharides, further said water-insoluble polymer is preferably selected from the group consisting of semisynthetic cellulose polymer, sodium salt and ammonium salt thereof. |
US08940441B2 |
Anode and battery
An anode capable of relaxing the stress due to expansion and shrinkage and a battery using the anode are provided. In the anode, an anode active material layer containing at least one of silicon and tin as an element is provided on both faces of a strip-shaped anode current collector. In the anode current collector and the anode active material layer, at least one penetrating portion that is cut out or slit to penetrate the anode current collector and the anode active material layer is formed to extend to include a longitudinal component of the anode current collector. |
US08940437B2 |
Method of fabricating structured particles composed of silicon or a silicon-based material and their use in lithium rechargeable batteries
Pillared particles of silicon or silicon-comprising material and a method of fabricating the same are disclosed. These particles may be used to create both a composite anode structure with a polymer binder, a conductive additive and a metal foil current collector, and an electrode structure. The structure of the particles overcomes the problems of charge/discharge capacity loss. |
US08940435B2 |
Tape
A tape for fixing an electrode assembly and a method of manufacturing a battery are provided. The tape for fixing an electrode assembly can effectively fix an electrode assembly in a can by realizing a 3D shape by means of an electrolyte. Thus, the tape can be useful in preventing the electrode assembly from moving and rotating inside a can by external vibration or impact and also preventing damage of welded regions of a tab or disconnection of inner circuits. |
US08940431B2 |
Battery and current collector
A negative current collector includes a base, which is fixed to a cover of a battery and is electrically connected to a negative external terminal, and a leg which projects from the base and is electrically connected to a negative electrode in a power generating element. There is provided a rib projecting in the same orientation as that of the leg along at least a part of the outer peripheral edge of the base. |
US08940427B2 |
Rechargeable battery pack
A rechargeable battery pack attachable to a power tool includes a display element, a remaining capacity detection device, a remaining capacity display control device, an abnormality detection device, and an abnormality display control device. The display element is provided such that a lighted state thereof can be confirmed from outside. The remaining capacity detection device detects a remaining capacity of a rechargeable battery. The remaining capacity display control device displays the remaining capacity detected by the remaining capacity detection device by controlling the lighted state of the display element. The abnormality detection device detects an abnormality of the rechargeable battery. The abnormality display control device displays the abnormality of the rechargeable battery detected by the abnormality detection device by controlling the lighted state of the display element to an abnormality display state, which is different from a remaining capacity display state controlled by the remaining capacity display control device. |
US08940425B2 |
Plastic liquid heat exchanger for battery cooling system
Plate assemblies for a heat exchanger suitable for use in a battery assembly are provided. A plate assembly can include a first substantially planar member having a first side, a second side, a first opening, and a second opening. A first conduit extends from the first opening on the first side and a second conduit extends from the second opening on the first side. A first spacer extends from the second side. Some plate assemblies include a second substantially planar member having a third side, a fourth side, a third opening, and a fourth opening. The third side faces the first side, the first conduit connects the first opening on the first side and the third opening on the third side, and the second conduit connects the second opening on the first side and the fourth opening on the third side. A second spacer extends from the fourth side. |
US08940415B2 |
Organic electroluminescent devices and metal complex compounds
An organic electroluminescent device, which has a pair of electrodes and at least one organic layer including a luminescent layer between the pair of electrodes, wherein at least one layer between the pair of electrodes comprises at least one metal complex having a tridentate- or higher polydentate-chain structure ligand. |
US08940413B2 |
Organic compound having acenaphtho[1,2-k]benzo[e]acephenanthrene derivative, light-emitting device, and image display apparatus
Provided is an acenaphtho[1,2-k]benzo[e]acephenanthrene derivative represented by general formula (1): wherein R1 to R16 are each independently selected from a hydrogen atom, a halogen atom, a substituted or unsubstituted alkyl group, a substituted or unsubstituted alkoxy group, a substituted or unsubstituted amino group, a substituted or unsubstituted aryl group, and a substituted or unsubstituted heterocyclic group; and at least one of R1 to R8 and R10 to R15 is selected from a halogen atom, a substituted or unsubstituted alkyl group, a substituted or unsubstituted alkoxy group, a substituted or unsubstituted amino group, a substituted or unsubstituted aryl group, and a substituted or unsubstituted heterocyclic group. |
US08940402B2 |
Multicolor dental blanks and related methods
A dental blank of the present invention has at least an inner zone (or layer) of a first color and an outer zone (or layer) of a second color wherein the inner and outer zones are concentric The inner zone can be surrounded in its entirety by the outer zone such that only the outer zone is visible on all surfaces of the blank and the inner zone is not visible on any surface of the blank Alternatively, the inner zone and the outer zone can extend to a same single surface of the blank, such that only the outer zone covers all remaining surfaces The dental blank may also have an intermediate zone between the inner and outer zones, wherein the intermediate zone is surrounded in its entirety by the outer zone and/or the intermediate zone surrounds the inner zone in its entirety. |
US08940401B2 |
Clear coatings acrylic coatings
The presently disclosed and claimed inventive concept(s) relates generally to liquid-based coatings for writable-erasable surfaces, products that include such coatings, and methods for making and using the same. |
US08940397B2 |
Weatherable and abrasion resistant coating systems for polymeric substrates
Disclosed herein is a primer composition comprising an inorganic UV absorbing agent and a polymer selected from (i) a copolycarbonate, and (ii) a polyurethane obtained by reaction of a polyisocyanate and a copolycarbonate diol. Also disclosed is a coated article comprising a polymeric substrate, a primer layer disposed on at least one surface of said substrate, and an abrasion-resistant layer disposed on said primer layer, where the primer layer is made from the primer composition of the invention. |
US08940393B2 |
Mannitol crystal powder having a low fine-particle content, and method for producing same
Disclosed is a powder composition of mannitol crystals, produced by: (i) the crystallization of mannitol in a solvent; followed by (ii) a step of separating the crystals from the resulting crystal suspension; (iii) a step of drying the crystals; and (iv) a selection step, the composition having a particle size distribution, as determined by laser particle sizing, of 72 to 99.9 vol % of particles having a particle size greater than 75 μm, of 0.1 to 60 vol % of particles larger than 250 μm, and a mean diameter of between 100 and 300 μm. Also described is a method for producing such a composition by a step of crystallizing a mannitol syrup followed by drying the mannitol crystals, a step of selecting particles, and a step of collecting a fraction of the powder composition including 72 to 99.9% of particles having a particle size greater than 75 μm. |
US08940391B2 |
Silicon carbide fibers and articles including same
Methods of producing silicon carbide fibers. The method comprises reacting a continuous carbon fiber material and a silicon-containing gas in a reaction chamber at a temperature ranging from approximately 1500° C. to approximately 2000° C. A partial pressure of oxygen in the reaction chamber is maintained at less than approximately 1.01×102 Pascal to produce continuous alpha silicon carbide fibers. Continuous alpha silicon carbide fibers and articles formed from the continuous alpha silicon carbide fibers are also disclosed. |
US08940389B2 |
Scratch- and abrasion-resistant coatings on polymeric surfaces
The present invention relates to a composition which contains a) at least one reaction product of a1) a silane of the general formula in which Y(1)=3-glycidyloxypropyl-, and R1, R2, R3=like or unlike alkyl groups having 1 to 6 carbon atoms, and a2) a silane of the general formula in which Y(2)=N-2-aminoethyl-3-aminopropyl- or NH2(CH2)2NH(CH2)2NH(CH)3, and R′1, R′2, R′3=like or unlike alkyl groups having 1 to 6 carbon atoms, and b) at least one inorganic filler, and c) a solvent having a boiling point at a temperature ≦85° C., and d) water, and e) a catalyst selected from organic and inorganic acids, to a method of producing a surface coating on a polymeric surface by applying the composition of the invention, and to articles having at least one polymeric surface which have the surface coating of the invention, and to their use. |
US08940388B2 |
Insulative elements
Methods of forming an insulative element are described, including forming a first metal oxide material having a first dielectric constant, forming a second metal oxide material having a second dielectric constant different from the first, and heating at least portions of the structure to crystallize at least a portion of at least one of the first dielectric material and the second dielectric material. Methods of forming a capacitor are described, including forming a first electrode, forming a dielectric material with a first oxide and a second oxide over the first electrode, and forming a second electrode over the dielectric material. Structures including dielectric materials are also described. |
US08940387B2 |
Applique to provide a design on a fabric
An appliqué of the invention comprises a disposable carrier film onto which a release layer and PU inks are printed using layering techniques. The ink layers can be multicoloured and each color is applied sequentially using a conventional screen-printing method. A back-up, a lacquer layer, and an adhesive layer are printed in sequence over the ink layers. The ink includes reflective particles providing the optical effect of a 3-dimensional appliqué. The artwork is created by overlapping design layers to controlled specification sequences. The ink, because of the additives, creates a desired color tone, and this may be enhanced by layering of the ink in an overlapping region. Thus, there are three main regions, namely a central region with reflective ink, a “shoulder” region with overlapping matt and reflective inks and an outer region with only matt ink. |
US08940386B2 |
Formed body with curved surface shape, method of producing the formed body, front cover for vehicle lighting device, and method of producing the front cover
A formed body having a curved surface, a method of producing the formed body, a front cover for a vehicle lighting device, and a method of producing the front cover. A front cover for a vehicle lighting device, mounted to a front opening in a vehicle lighting device having a lamp body and a light source which is provided in the lamp body, wherein a heat generating body is provided in a substantially rectangular region of that surface of the front cover which faces the light source. The heat generating body maintains the relationship of Ra =(2 R0), where R0 is the electric resistance value (initial value) of the heat generating body before the heat generating body is elongated and Ra is the electric resistance value of the heat generating body after the heat generating body is elongated 5%. |
US08940384B2 |
Colored web material comprising a plurality of discrete extended elements
A colored web material comprising a plurality of discrete extended elements. The colored web material comprises a colorant incorporated in the material itself or a colorant disposed on at least one surface of the web material. The discrete extended elements comprise thinned portions at the distal ends and/or along the sidewalls of the discrete extended elements. In one embodiment, the discrete extended elements have a diameter of less than about 500 microns. In one embodiment, the colored web material comprises at least about 95 discrete extended elements per square centimeter. In one embodiment, the discrete extended elements have an aspect ratio of at least about 0.2. |
US08940380B2 |
Coating liquid for forming insulation film, insulation film using the same, and method for producing compound used in the same
The present invention provides a coating liquid for forming an insulation film, which has a small shrinkage in the calcination step in water vapor and is not likely to cause cracking of a resulting silica coating film or detachment thereof from a semiconductor substrate; an insulation film using the same; and a method of producing a compound used in the same. The coating liquid of comprises an inorganic polysilazane whose ratio of a peak area at 4.5 to 5.3 ppm attributed to SiH1 group and SiH2 group with respect to a peak area at 4.3 to 4.5 ppm attributed to SiH3 group in 1H-NMR spectrum is 4.2 to 50; and an organic solvent. The insulation film is obtained using the coating liquid. |
US08940375B2 |
Liquid-crystal display
The present invention relates to a liquid-crystal (LC) display of the PS (polymer stabilized) or PSA (polymer sustained alignment) type, and to polymerizable compounds and LC media for use in PS (polymer stabilized) and PSA displays. |
US08940373B2 |
Liquid composition, ink jet recording method, ink jet recording apparatus and recorded image
The invention provides an aqueous liquid composition containing a water-soluble monomer, a photopolymerization initiator and an aqueous medium and further containing a polymer emulsion, wherein the water-soluble monomer is a monomer that has two or more ethylenically unsaturated bonds and is curable with an active energy ray. |
US08940372B2 |
Method for treating a surface of a substrate
A method for treating a surface of a substrate. A functional chemical is applied onto the surface of the substrate for improving the adhesion of silicone to the substrate. The functional chemical is applied in an amount of at least 5 mg/m2 onto the surface of the substrate by using a steam application beam to form a functional chemical layer on the substrate. The functional chemical includes double bonds, silane hydride, or vinyl silane reactive groups, or oligomeric or polymeric hydrocarbon or polysiloxane compounds. |
US08940360B1 |
Road surface repair compositions, processes and applicator apparatuses
An asphalt composition, process, and apparatus for repairing cracks and other distressed areas in road surfaces. The asphalt composition comprises an aggregate material and a cold pour asphalt emulsion, preferably a quickset cationic asphalt emulsion. The aggregate material will preferably be a graded aggregate material. The asphalt emulsion and the aggregate material will preferably be mixed together and then delivered into the distressed area in not more than 20 seconds. A small mixing assembly is preferably held in suspension over the road surface for continuously receiving and mixing the asphalt emulsion and aggregate components and delivering the mixture into the distress area. |
US08940359B2 |
Method of producing a microacoustic component
The microacoustic component has a substrate that has at least one layer (composed of a dielectric or piezoelectric material, and a metallic strip structure. The layer is composed of a dielectric or piezoelectric material and/or the metallic strip structure have/has been produced or can be produced by the atomic layer deposition method. |
US08940358B2 |
Maintaining a fixed distance by laser or sonar assisted positioning during coating of a medical device
System and method for coating an expandable member of a medical device comprising a support structure to support the expandable member and an applicator positioned with at least one outlet proximate a surface of an expandable member. A drive assembly establishes relative movement between the at least one outlet and the surface of the expandable member to apply fluid on the surface of the expandable member along a coating path. A positioning device is provided to determine the distance to the surface of the expandable member at a corresponding location and relays the information to a controller or the like to maintain a substantially fixed distance between the outlet of the applicator and the surface of the expandable member when in alignment with the corresponding location. |
US08940357B2 |
Marked precoated medical device and method of manufacturing same
A medical device, such as a medical wire, which includes a coating applied to the surface of the medical wire. The coating includes a base layer bonded to the surface of the medical wire and an at least partially transparent low-friction top coat applied to the base layer. The base layer includes heat activated pigments that change color when heated above a color shifting temperature. In one embodiment, the color of the pigment in one area contrasts with the color of the pigment in an adjacent area without otherwise affecting the low-friction surface of the coating. The areas of different color created in locations along the length of the low-friction coated medical wire form markings which, as an example, enable a surgeon to determine the length of the medical wire inserted into a body by observing the markings on the portion of the marked medical wire located exterior to the body. |
US08940355B2 |
Process for the preparation of an edible dispersion comprising oil and structuring agent
The invention relates to a process for the preparation of an edible dispersion comprising oil and structuring agent and one or more of an aqueous phase and/or a solid phase, in which the dispersion is formed by mixing oil, solid structuring agent particles and the aqueous phase and/or the solid phase, wherein the solid structuring agent particles have a microporous structure of submicron size particles. |
US08940353B2 |
Non-dairy beverage composition
In one embodiment, a method comprises adding ingredients to a mixing chamber, the ingredients comprising: one or more non-dairy first ingredients; one or more second ingredients operable to facilitate Maillard browning reactions; and one or more third ingredients selected from the group consisting of stabilizers, vitamins, minerals, flavors, functional ingredients, salts, antioxidants, sugar, and water. The method also comprises mixing to yield a mixture having the ingredients dispersed substantially evenly throughout. The method further comprises processing the mixture to yield a non-dairy beverage. |
US08940349B2 |
Process and apparatus for producing bakery products in the form of half-shells
In a process for producing half-shells (2) which are made from a dough for bakery products and are characterized by an annular orifice rim (6) with a finished surface, by producing a wafer sheet (1) comprising a plurality of half-shells (2) connected to one another by an interconnecting wall (4), by forming and baking said dough in a mold with the use of a mold formed by two complementary plates (12, 14) having respective front surfaces which, as a result of the fitting together of the two plates, can define a forming cavity having a shape generally corresponding to that of said wafer sheet (1), a mold is used wherein the front forming surface of at least one of said plates has shaped portions (26) which project towards the front surface of the other plate (12) and which can define, in the dough that is subjected to baking in the forming cavity, a notch (24) in the interconnecting wall (4) adjacent each half-shell (2), wherein the plates can be fitted together in an initial position in which the forming cavity has a volume smaller than the volume of the wafer sheet to be obtained, the dough is subjected to a first, partial baking step in the forming cavity with the molds fitted together in the initial position, while the volume of the forming cavity is kept constant until the dough is partially solidified, the dough is then subjected to finishing baking with an increase in the volume of the forming cavity, in order to obtain a wafer sheet (1) wherein the half-shells (2) are connected to the interconnecting wall (4) by an annular region (28) having a thickness which is substantially less than the thickness of the interconnecting wall (4); the half-shells can thus be separated from the wafer sheet by a slight pressure exerted in a direction perpendicular to the plane of the wafer sheet. |
US08940345B1 |
Antimicrobial ultraviolet device
Disclosed herein is an apparatus for treating food products, such as any species of meat (beef, pork or lamb) and ground beef, being transported in a fluid, such as carbonic acid liquid carbon dioxide, at a pressure sufficient to maintain the carbon dioxide as a liquid. |
US08940344B2 |
Capsule clusters for oral consumption
Provided are oral products that provide engaging and flavorful experiences to a user. The oral product includes a plurality of capsules, a powdered component, a viscous component and a binder that create a matrix that is molded into a shape. In a preferred embodiment, the capsules provide functional and flavorful ingredients. In an embodiment, the matrix is enclosed in a porous material that forms a pouch. |
US08940340B2 |
Systems and methods for maintaining the dominance of Nannochloropsis in an algae cultivation system
Systems and methods for maintaining the dominance of Nannochloropsis in an algae cultivation system are provided. Exemplary methods include applying an effective amount of a disinfectant to Nannochloropsis growing in an algae cultivation system. Another method for maintaining the dominance of Nannochloropsis in an algae cultivation system includes adjusting a salinity in the algae cultivation system to between approximately 0.5 PPT and 28 PPT. In a further method, the temperature of the algae cultivation system may be adjusted to between approximately 21 and 32 degrees Celsius (“° C.”). According to yet another method for maintaining the dominance of Nannochloropsis in an algae cultivation system, a salinity in the algae cultivation system may be adjusted to below that of seawater for a first predetermined period of time, and then the salinity in the algae cultivation system may be adjusted to a higher salinity for a second predetermined period of time. |
US08940338B2 |
Formulations for the treatment of mucositis induced by antitumor or immunosuppressive therapy
Formulations containing sanguinarine or chelerythrine or the salts thereof or extracts containing them in admixture with suitable carriers and/or excipients for the treatment and/or prevention of mucositis. |
US08940337B2 |
Transparent bacterial cellulose nanocomposite hydrogels
A transparent polymeric nanocomposite hydrogel is provided, wherein the polymeric nanocomposite hydrogel is made from a water insoluble polymer, i.e. poly(2-hydroxyethyl methacrylate) (PHEMA) or/and crosslinked PHEMA and a water insoluble nanofiber, i.e., bacterial cellulose (BC). Disclosed is a synthetic route for polymeric nanocomposites hydrogels. The preferred polymeric nanocompositions are produced through free radical polymerization of HEMA monomer in the presence of bacterial cellulose with an assistance of ultrasound to enhance the mixing of bacterial cellulose, initiator, and the monomers. The polymeric nanocomposite hydrogel is then formed by immersion of the dry polymeric nanocomposite in water. Disclosed is a high transmittance polymer nanocomposite hydrogel with a preferred BC loading less than 0.1%, water content of about 40% in weight, good mechanical integrity and strength. The disclosed polymer nanocomposite hydrogel and compositions pertain to hydrogel applications, particularly contact lenses and optic components for biosensor. |
US08940335B2 |
Process for making dry and stable hemostatic compositions
Described is a process for making a dry and stable hemostatic composition, said process comprising a) providing a dry granular preparation of a biocompatible polymer suitable for use in hemostasis, b) coating the granules in said dry granular preparation with a preparation of a coagulation inducing agent, thereby obtaining coagulation inducing agent coated polymer granules, c) filling said coagulation inducing agent coated polymer granules into a final container, d) finishing the final container to a storable pharmaceutical device containing said coagulation inducing agent coated polymer granules as a dry and stable hemostatic composition. |
US08940334B2 |
Pharmaceutical composition of an anthracycline
The present invention relates to pharmaceutical composition containing nemorubicin hydrochloride incorporated in microspheres. The compositions are useful for chemoembolization, particularly for loco regional treatment of tumors. |
US08940330B2 |
Abuse-resistant pharmaceutical composition for the treatment of opioid dependence
There is provided pharmaceutical compositions for the treatment of e.g. opioid dependency comprising microparticles of a pharmacologically-effective amount of buprenorphine, or a pharmaceutically-acceptable salt thereof, in associative admixture with particles comprising a weak acid, or particles comprising weakly-acidic buffer forming materials. The composition may further comprise a disintegrant and/or particles of a pharmacologically-effective amount of naloxone, or a pharmaceutically-acceptable salt thereof. The compositions are useful in the treatment of opioid dependency/addiction and/or pain. |
US08940321B2 |
Compositions for treatment of ear disorders and methods of use thereof
The present invention relates to compositions and methods useful for the treatment of ear disorders, administered to a treated ear in the form of a foam or a mousse. Administering a medicament in such forms will increase the residence time of the medicament in the ear canal, provide relatively uniform distribution of the composition, and can increase the penetration of the active pharmaceutical ingredient in the affected area, may release active substances slowly, enhance treatment effectiveness, increase compliance and is more convenient to use than currently available ear medications. The administration in the form of a foam or a mousse may preferably be provided as a metered dose, of a volume suitable to fill the ear canal. |
US08940320B2 |
Dental implant and production method for said implant
The invention relates to a dental implant, which comprises a coating at least in those surface areas that come into contact with hard and/or soft tissue when implanted. To ensure that the active ingredient contained in the coating (bisphosphonate) is released into the surrounding tissue or can act in the latter in a controlled manner at the correct speed, the coating is characterized in that it contains bisphosphonate, the respective pharmaceutically compatible salts or esters of the latter, in addition to at least one amphiphilic component, selected from the group containing branched or linear, substituted or unsubstituted, saturated or partially unsaturated C10-C30 alkyl-, alkenyl, alkylaryl-, aryl-, cycloalkyl-, alkylcycloalkyl-, alkylcycloaryl-carboxylates, -phosphates or -sulfates or mixtures thereof and/or a water-soluble ionic polymer component. The invention also relates to a method for producing a dental implant of this type and to a specific composition, which can be used to produce a coating of this type. |
US08940315B2 |
Benzodiazepine formulation in a polyorthoester carrier
Effective treatments of pain for extended periods of time are provided. The treatments include the administration of one or more drug depots intraspinally wherein the drug depots include an effective amount of a benzodiazepine, such as midazolam, formulated within a polyorthoester. By administration of one or more drug depots, one can relieve pain caused by diverse sources, including but not limited to chronic pelvic pain syndromes, spinal disc herniation (i.e. sciatica), spondilothesis, stenosis, discongenic back pain and joint pain, as well as pain that is incidental to surgery. In some embodiments, the relief can be for at least twenty-five days, at least fifty days, at least one hundred days or at least one hundred and thirty-five days. |
US08940303B2 |
CD127 binding proteins
Antigen binding proteins which bind to human IL-7 receptor (CD127) are provided. The antigen binding proteins are typically antibodies, and are useful in the treatment of diseases or disorders in humans, particularly autoimmune diseases such as multiple sclerosis. |
US08940301B2 |
Breast tumor treatment with anti-CXCR1 compositions
The present invention provides methods of treating cancer by administering an IL8-CXCR1 pathway inhibitor (e.g., an anti-CXCR1 antibody or Repertaxin) alone or in combination with an additional chemotherapeutic agent such that non-tumorigenic and tumorigenic cancer cells in a subject are killed. The present invention also provides compositions and methods for detecting the presence of and isolating solid tumor stem cells in a patient (e.g., based on the presence of CXCR1 or FBXO21). |
US08940298B2 |
High affinity anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting and detection
The present invention provides novel high affinity antibodies and fragments thereof that bind to the cancer antigen PSCA. The antibodies of the present invention may be used for cancer diagnosis, prognosis, treatment, visualization, and the like. The present invention also provides methods for the detection, visualization, and treatment of various cancers expressing PSCA. |
US08940297B2 |
Expression of thrombin variants
One aspect of the invention contemplates a mutant E-WE thrombin precursor that contains the SEQ ID NO:1 amino acid residue sequence. Another aspect contemplates a thrombin precursor that contains the amino acid residue sequence Asp/Glu-Gly-Arg at positions 325, 326 and 327 based on the preprothrombin sequence. A third aspect contemplates a thrombin precursor that contains the SEQ ID NO:1 amino acid residue sequence as well as the amino acid residue sequence Asp/Glu Gly Arg at positions 325, 326 and 327 based on the preprothrombin sequence. Also contemplated is a composition that contains an effective amount of mutant thrombin dissolved or dispersed in a pharmaceutically acceptable carrier. A method is also disclosed for enhancing treating and preventing thrombosis in a mammal in need using that composition. |
US08940291B2 |
Compositions and methods for enhancing virus efficacy
Provided are viral sensitizing compounds that enhance the efficacy of viruses by increasing spread of the virus in cells, increasing the titer of virus in cells, or increasing the cytotoxicity of virus to cells. Other uses, compositions and methods of using same are also provided. |
US08940286B2 |
Urate transporter, as well as method and kit for evaluating urate transport-related disease factor and inflammation-related disease factor, and test sample and drug
A method and evaluation kit are provided, in which a high-capacity urate transporter is identified to assist in the early treatment and prevention of urate transport-related disease and inflammation-related disease. The method can include a step for detecting variations in genes that encode ABCG2 protein. When a subject has an SNP of V12M, R113X, Q126X, Q141K, F208S, G268R, E334X, S441N, L447V, S486N, F506SfsX4, R575X, and/or C608X, it can be concluded that the subject has a factor that is capable of inducing urate transport failure, or a state or disease attributable to that failure. When a subject has an SNP of V12M, it can be concluded that, unlike the other SNPs, there is a possibility that the subject does not possess such a factor because, although this variation itself does not lead to a change in urate transport capability, said variation is related to linkage disequilibrium with other SNPs. |
US08940283B2 |
Cosmetic composition comprising at least one cationic poly(vinyllactam), at least one fatty alcohol, and at least one polyol, cosmetic process for treating keratin fibers and use of the composition
Disclosed herein a cosmetic composition for treating keratin fibers, for instance, human keratin fibers such as the hair, comprising, in a cosmetically acceptable medium, at least one cationic poly(vinyllactam) polymer, at least one fatty alcohol, and at least one polyol with a molecular weight of greater than 80. |
US08940282B2 |
Process for reducing hair damage upon treatment of hair by heat
A process for reducing hair damage upon treatment of hair by heat comprising the steps of providing a hair care composition comprising a heat-stable silicone material, applying said composition onto hair, providing a heat generating hair care appliance, and treating hair using said appliance; use and kit thereof. |
US08940281B2 |
Composition using cross-linked hyaluronic acid for topical cosmetic and therapeutic applications
Disclosed are compositions comprising crosslinked hyaluronic acid gels, preferably vinyl sulfone cross-linked hyaluronic acid known as hylan B gel, for use in topical cosmetic and dermatological formulations. The hylan B gel in these formulations provides prolonged delivery of incorporated substances to the surface of the skin, to provide a hydrated film on the surface of the skin, and to provide a substantive and compatible film on the skin. |
US08940275B2 |
Nanoparticles based on gadolinium coordination polymers as highly sensitive T1 MRI contrast agents
An agent for imaging of a biological system or delivering drugs to a biological system including one or more nanoparticles formed of at least one gadolinium coordination polymer. |
US08940274B2 |
Radioiodination method
The present invention provides a novel method of labelling biological targeting molecules (BTMs) of interest with radioiodine. Also provided are functionalised BTMs useful in the method, as well as methods of preparing such functionalised BTMs under mild conditions. |
US08940271B2 |
Transmucosal administration of drug compositions for treating and preventing disorders in animals
The invention includes compositions for transmucosal administration to an animal comprising at least one active agent and a pharmaceutically acceptable carrier. A preferred active agent is selected from the group consisting of meloxicam, carprofen, enrofloxacin, clemastine, diphenhydramine, digoxin, levothyroxine, cyclosporine, ondansetron, lysine, zolpidem, propofol, nitenpyram, ivermectin, milbemycin, and pharmaceutically acceptable salts, solvates and esters thereof. In another embodiment, the invention includes methods of treating or preventing a condition in an animal comprising transmucosally administering a composition comprising a therapeutically or prophylactically effective amount of an active agent and a pharmaceutically acceptable carrier. |
US08940270B2 |
Catalyst for decomposition of sulfur trioxide and hydrogen production process
To provide a sulfur trioxide decomposition catalyst, particularly, a sulfur trioxide decomposition catalyst capable of lowering the temperature required when producing hydrogen by an S—I cycle process.A sulfur trioxide decomposition catalyst comprising a composite oxide of vanadium and at least one metal selected from the group consisting of transition metal and rare earth elements is provided. Also, a sulfur dioxide production process comprising decomposing sulfur trioxide into sulfur dioxide and oxygen by using the sulfur trioxide decomposition catalyst above, is provided. Furthermore, a hydrogen production process, wherein the reaction of decomposing sulfur trioxide into sulfur dioxide and oxygen by an S—I cycle process is performed by the above-described sulfur dioxide production process, is provided. |
US08940269B2 |
Methods and materials for the thermochemical production of hydrogen from water
The present invention is directed to a method of thermochemical forming H2, O2, or a combination thereof from water, said method comprising the steps of contacting a composition comprising a spinel-type transition metal oxide of formula M3O4 with an alkali metal carbonate bicarbonate, or mixture thereof in the presence of H2O to form H2, CO2, and an alkali metal ion-transition metal oxide; hydrolytically extracting at least a portion of alkali metal ions from the alkali metal ion-transition metal oxide by the reaction with CO2 and liquid H2O; and thermochemically reducing the resulting oxidized-transition metal oxide. The thermochemical reduction of CO2 based on analogous methods is also disclosed. |
US08940265B2 |
Sustainable economic development through integrated production of renewable energy, materials resources, and nutrient regimes
The present disclosure is directed to a system and method of sustainable economic development, such as development through an integrated production of renewable energy, material resources, and nutrient regimes. In some embodiments, the system utilizes resources extracted from renewable energy sources to assist in the capture of energy from other renewable energy sources. In some embodiments, the system utilizes energy from renewable energy sources to extract resources from other renewable energy sources. |
US08940263B2 |
Removal of hydrogen and carbon monoxide impurities from gas streams
Hydrogen and carbon monoxide impurities are removed from a dry gas comprising the impurities, wherein the dry gas is at least substantially free of carbon dioxide, by passing the dry gas with sufficient residence time, e.g. at least 1.5 s, through a layer of catalyst comprising a mixture of manganese oxide and copper oxide. The use of expensive noble metal catalysts to remove hydrogen may thereby be avoided. In addition, regeneration of the catalyst using oxygen-containing regeneration gas does not reduce the effectiveness of the catalyst. |
US08940258B2 |
Regenerative recovery of contaminants from effluent gases
This invention relates to processes for the selective removal of contaminants from effluent gases. More particularly, various embodiments of the present invention relate to selective removal and recovery of sulfur dioxide from effluent gases in a regenerative sulfur dioxide absorption/desorption process that achieves favorable energy efficiency. Energy is recovered from a wet stripper overhead gas stream produced in the desorption cycle by indirect transfer of heat from the stripper gas to a cooling medium and used to generate steam for use in stripping contaminants from the absorption liquor. The absorption zone may optionally be cooled to enhance the capacity of the absorption medium for absorption of a contaminant gas, thereby lowering the volume of absorption medium and contaminant-enriched absorption liquor that must be pumped, handled, heated and cooled in the absorption/desorption cycle. |
US08940256B2 |
Method for recycling of rare earth and zirconium oxide materials
A method is presented for recovery, in reusable form, of rare earth minerals and zirconia from waste materials containing them. The method includes: mixing an ammonium sulfate powder and a powder containing the oxide waste material; heating the mixture to decompose the waste into a residue; dissolving the residue in water; separating rare earth constituents from the solution; and subsequently using the separated rare earth constituent (salt or solution) as a raw material. Moreover, the reactants used in the recovery may be recovered by appropriate precipitation and concentration operations. |
US08940255B2 |
Oxidation system with sidedraw secondary reactor
Disclosed are process and apparatus for vertical splitting of the oxygen supply to a post-oxidation reactor. Further disclosed are process and apparatus for supplying reaction medium to a post-oxidation reactor at a mid-level inlet. Such apparatus and process can assist in reducing oxygen pinch throughout the post-oxidation reactor. |
US08940250B2 |
Method of conveying liquids
The present invention relates to a method of continuously conveying a liquid which is used as starting material in a chemical reaction by means of a displacement pump having physically separate forward-transport valves and a liquid-filled bidirectional flow line between displacement pump and forward-transport valves, wherein an auxiliary liquid which is a product or a starting material of the chemical reaction and has a melting point which is below the melting point or below the saturation temperature of the liquid to be conveyed is present in the bidirectional flow line.The present invention additionally provides for the use of a product formed by hydrogenation of an aromatic compound as auxiliary liquid for conveying an aromatic compound and also the use of an alcohol or an ester derived from alcohol and carboxylic acid as auxiliary liquid for conveying carboxylic acids or carboxylic acid derivatives. |
US08940249B2 |
System for the analysis of liquid samples
A system for the automated analysis of liquid samples having one or more processing units for reaction between the samples and one or more reagents to thereby obtain reaction products is disclosed. Disclosed also are a sample unit for supplying the samples to the one or more processing units; a reagent unit equipped with plural reagent vessels containing one or more reagents for mixing with the samples; a distribution unit for distributing fluids including the one or more reagents provided with plural distribution lines, at least some of which are connected to the reagent vessels and the one or more processing units; and at least one analytical unit for analyzing the samples based on the reaction products, in which the analytical unit may include at least one detector for detecting the reaction products. |
US08940243B1 |
Reforming chamber with constant electric discharge to generate hydrogen
A circuit applies an electric field to a reforming chamber housing a hydrocarbon-water mixture to cause molecular breakdown and create a feed of hydrogen and carbon and dioxide that can be supplied to fuel cells. The circuit includes a DC-to-DC converter, a DC-to-AC inverter and a transformer to transform available input voltage to a control voltage that can be used to apply the electric field to the mixture in the reforming chamber. The signal supplied to the DC-to-AC inverter is monitored to determine whether enough voltage is supplied to create an electrical discharge in the reforming chamber. If an electrical discharge exists, the variables to the circuit is left alone or decreased until the signal indicates the electrical discharge is no longer present. If no electrical discharge exists, the variable input voltage is increased until an electrical discharge is detected. |
US08940241B2 |
Photostructured chemical devices and methods for making same
A photostructurable ceramic is processed using photostructuring process steps for embedding devices within a photostructurable ceramic volume, the devices may include one or more of chemical, mechanical, electronic, electromagnetic, optical, and acoustic devices, all made in part by creating device material within the ceramic or by disposing a device material through surface ports of the ceramic volume, with the devices being interconnected using internal connections and surface interfaces. |
US08940240B2 |
Apparatus and method for manufacturing composite nano particles
Disclosed are an apparatus and a method for manufacturing composite nanoparticles. The apparatus comprises: a first precursor supply unit vaporizing a first precursor and supplying it to a reaction unit; a second precursor supply unit vaporizing a second precursor and supplying it to the reaction unit; the reaction unit producing composite nanoparticles by reacting the vaporized first precursor with the vaporized second precursor; an oxygen supply line supplying an oxygen source to the reaction unit; and a collection unit collecting the composite nanoparticles produced by the reaction unit. Since gas phase synthesis occurs in different stages using the U-shaped reaction chamber, aggregation is prevented and composite nanoparticles of uniform size and high specific surface area can be produced easily. |
US08940237B2 |
Light guide test sensor
An optic light guide test sensor comprises a light guide, a reagent-coated membrane, and a mesh layer. The reagent-coated membrane and the mesh layer are attached to the light guide at an output end of the light guide. The light guide test sensor is adapted to be used to test the level of an analyte in a biological fluid sample when used with a readhead. A method of manufacturing the light guide test sensor involves providing a plurality of light guides, providing a strip of reagent-coated membrane, and providing a strip of mesh layer. The reagent-coated membrane and mesh layer are attached to the light guides by ultrasonic welding. The reagent-coated membrane and mesh layer may also be attached to the light guides by adhesive. |
US08940236B2 |
Device for inspecting a biological fluid
A device for inspecting a biological fluid, including a channel through which the fluid flows, a first inspection module arranged in a first region of the channel, and a second inspection module arranged in a second region of the channel, the device configured to provide a quantity that is representative of output of the second inspection module. The first inspection module is configured to measure at least one electrical property of the fluid passing through the first region. The second inspection module is configured to measure at least one optical property of the fluid passing through the second region. The inspection device also includes a controller connected to the first inspection module and to the second inspection module and configured to control the second inspection module according to the output of the first inspection module. |
US08940231B2 |
Measuring equipment and measuring method using cartridge container, and program recording medium
In the measuring equipment, a nozzle driving unit 10 equipped with a bar code reader decides whether the cartridge container being set is a special-purpose container, in which a predetermined reagent is injected separately in advance and to which a bar code is attached, or a general-purpose container that is prepared by separately injecting reagents by hand into an empty cartridge container, and when the cartridge container is a special-purpose container, a CPU 1 reads out measurement conditions from a measurement condition storage part for special-purpose reagents 3a based on the information included in the bar code, and when the cartridge container is a general-purpose container, the CPU1 reads out measurement conditions for items of a measurement object selected and input by a measurer from a measurement condition storage part for general-purpose reagents 3b to conduct a measurement. |
US08940230B2 |
Cell for conducting electrochemiluminescence measurements
A cell for conducting electrochemiluminescence measurements is disclosed. The cell in one embodiment provides a measurement cell housing having a cavity, a fluid inlet channel for inducing fluid into the cavity and a fluid outlet channel for discharging fluid from the cavity at axial ends. The cell also provides at least one working electrode and a counter electrode on or in the cavity, and an optical viewing element for observing electrochemiluminescence effects in the cavity, wherein the fluid inlet channel has an at least approximately continuous curved course in a transition area to the cavity so that the fluid inlet channel at its end which is joined to the cavity is shaped in such a manner as to constitute a continuous course of the transition between the fluid inlet channel and the cavity to generate a largely steady flow profile when inducing fluid into the measurement cell cavity. |
US08940227B2 |
Use of polyester polyamine and polyester polyquaternary ammonium compounds as corrosion inhibitors
The present invention relates to the use of a polyesteramine or a polyester polyquaternary ammonium compound as a corrosion inhibitor for metal surfaces, and to a method for protecting a metal surface from corrosion by contacting the metal surface with said corrosion inhibitor. |
US08940219B2 |
Ophthalmic device formed by additive fabrication and method thereof
An ophthalmic device is formed by additive fabrication, the optical device having an optical surface with a surface roughness on the order of less than 10 microns. A method is provided for making an ophthalmic device including an optical surface having a surface roughness of less than 10 microns by depositing on a stage in a first relative position a first lamina of particulates having a size less than 10 microns and in select configurations less than two microns and certain configurations less than one micron, and, synergistically stimulating the first lamina of particulates to form a first solidified layer. |
US08940218B1 |
De-focused laser etching of a light diffuser
Approaches for making a light-transmitting panel are disclosed. A panel is positioned on a support structure, and a stencil is positioned between a surface of the panel and a laser head. The stencil includes a plurality of openings. A defocused laser beam generated by the laser head is scanned over the openings in the stencil. The width of the defocused laser beam at a location at which the laser beam strikes the panel is at least as large as a size of the desired disruption, and the laser head is powered at a level and moved at a rate that creates a disruption in the surface of the panel at each opening. |
US08940215B2 |
Method for assembling window coaming on a fuselage, coaming to be used, and aircraft fuselage provided with such coaming
A reduction of the multiple costs of manufacture, assembly use, and upkeep connected with the assembly of window frames on aircraft fuselages. To this end, the invention provides a particular shape for the frames connected to the fuselage skin according to a specific assembly method. The shape enables, among other things, the window frames to be fitted onto the skin by means of adhesion and also frames to be dispensed with between the fuselage and the window. In one embodiment, composite material window frame has a wall totally in the shape of a crown that is connected, through co-adhesion, to the inner surface of the fuselage skin, also made of composite material. The skin is cut into a window-receiving opening, and the frame has a T-shaped cross section, wherein the bar of the “T” that forms the crown includes two portions having substantially equal lengths “T.” |
US08940212B2 |
Method for producing a moulded plastic product
There is disclosed a method for producing a molded plastic product having an outer skin and in inner core. The method is particularly suitable for making structural products such as panels or the like from recycled plastic material. The method comprises the steps of: providing a mold having a mold cavity; forming an outer skin from a first plastic material on at least two opposed surfaces inside the mold cavity; forming an inner core from a second plastic material inside the mold cavity; and at least partially curing the plastic materials to form a molding inside the mold cavity via the application of heat. The method is characterised by the subsequent steps of (optionally pre-cooling the molding and then) simultaneously cooling the molding and compressing the molding so as to reduce its size in at least one dimension to a desired dimension of the finished product. |
US08940209B2 |
Polyetherimide polymer for use as a high heat fiber material
Various embodiments of polymer fibers comprising a high heat polymer and process for making the polymer fibers are provided. In one embodiment, synthetic polymer fibers comprise polyetherimide polymer that is substantially free of foreign particulate matter greater than about 100 microns in size. A process for producing polymer fiber includes melting polymer comprising polyetherimide to a melt temperature that ranges from about 180-500° C. to form a molten polymer; passing the polyetherimide that is substantially free of foreign particulate matter above about 100 microns in size, through a spinneret comprising a plurality of hole openings to produce a fiber bundle; and cooling the fiber bundle with a cooling medium having a temperature that ranges from about 0° C. to about 80° C. |
US08940207B2 |
Pelletizing
A continuous length of material of non-circular cross-section is pelletized to form discrete bits, by feeding the material to a cutting wheel with shaped cutters that form non-planar bits having non-circular axial projections and that are aligned with the material. The material is fed so as to maintain a rotational orientation with respect to the cutters, and so as to avoid buckling. Multiple banks of strands of material are severed simultaneously, thereby producing high volumes of shaped bits that are useful as filling and as filter material, and as friction-enhancing additives. |
US08940206B2 |
Process for the anti-sticking treatment of polymer pellets
A process for the anti-sticking treatment of polymer pellets comprising:a) pelletizing the polymer in the presence of cooling water;b) drying the polymer pellets by means of a centrifugal drier,wherein in step b) an aqueous composition comprising an anti-sticking agents is metered inside said centrifugal drier. |
US08940205B2 |
Production of useful articles from waste material
Disclosed is a process of using waste material comprising absorbent material and a thermoplastic material, such as from the manufacture of disposable absorbent articles, to produce useful articles. The process includes shearing the waste material, chopping the waste material, pelleting the waste material, and extruding or injection molding the pelleted material to create a useful article. |
US08940203B2 |
Method for preparing composition comprising porous ceramic with thermo-response hydrogel
The present invention provides a method for preparing a composition comprising porous ceramic, comprising the following steps: (a) synthesizing poly(N-isopropylacrylamide-co-methacrylic acid) (p(NIPAAM-MAA)) or similar thermo-response compound thereof; (b) mixing a dispersant with hydroxyapatite or calcium phosphate salt; (c) mixing the p(NIPAAM-MAA) of the step (a) or similar thermo-response compound thereof with water to obtain a hydrogel solution; (d) mixing the hydrogel solution of the step (c) and product of the step (b) to produce a mixture; (e) adding macromolecular particles to the mixture of the step (d) and stirring to produce a slurry; (f) filling the slurry of the step (e) into a template slot; and disposing the template slot filling with the slurry of the step (f) on a crucible, then proceeding high temperature sinter in a furnace to form the composition comprising porous ceramic. |
US08940202B2 |
Closed loop control of auxiliary injection unit
A method and apparatus of controlling commencement of an injection of a melt stream of moldable material from an auxiliary injection unit. A sensor is placed in an injection molding system to sense a condition related to an injection of a first melt stream of a first moldable material provided by a primary injection unit. Commencement of a second melt stream of a second moldable material from the auxiliary injection unit is initiated upon the sensed condition related to the injection of the first melt stream being detected at a preselected value. The sensed condition may be a pressure, velocity or temperature of the first melt stream as provided by a direct sensor, a force or strain on a hot runner component as provided by an indirect sensor or the occurrence of a function of the injection molding system as provided by a functional sensor. |
US08940197B2 |
Processes for producing palladium nanoparticle inks
A process for preparing a palladium nanoparticle ink comprises reacting a reaction mixture comprising a palladium salt, a stabilizer, a reducing agent, and an optional solvent to directly form the palladium nanoparticle ink. During the formation of the palladium nanoparticle ink, the palladium nanoparticles are not isolated from the reaction mixture. |
US08940196B2 |
Silicon based shape memory alloy negative active material, negative active material composition including same, rechargeable lithium battery including same, and method of preparing same
A silicon-based shape memory alloy negative active material includes a silicon-based material precipitated on a Ni2Mn1-XZX shape memory alloy basic material. In the silicon-based shape memory alloy negative active material, X satisfies the relationship 0≦X≦1 and Z is one of Al, Ga, In, Sn, or Sb. |
US08940194B2 |
Electrodes with electrospun fibers
In accordance with various example embodiments, an apparatus includes two or more circuit nodes and a conductive material that is located between and configured to electrically couple the circuit nodes. The conductive material includes a network of elongated portions of at least one electrospun Cu-based nanostructure. Each elongated portion has an aspect ratio of at least 50,000 and a length that is greater than 100 microns, and at least one fused crossing point that joins with a fused crossing point of another of the elongated portions. The network of elongated portions is distributed and aligned in the conductive material to set a conductance level and a transparency level along the network, along at least one direction. |
US08940193B2 |
Electronic device for voltage switchable dielectric material having high aspect ratio particles
One or more embodiments provide for a device that utilizes voltage switchable dielectric material having semi-conductive or conductive materials that have a relatively high aspect ratio for purpose of enhancing mechanical and electrical characteristics of the VSD material on the device. |
US08940191B2 |
Electroconductive polymer solution, electroconductive polymer composition, and solid electrolytic capacitor therewith and method for producing same
The present invention provides an electroconductive polymer solution in which the good dispersibility is maintained and the pH is arbitrarily adjusted, and an electroconductive polymer composition having an excellent heat resistance. Further, the present invention provides a solid electrolytic capacitor having an excellent reliability.The present invention is an electroconductive polymer solution, containing an electroconductive polymer in which a dopant is doped, a first compound having an amino group and a hydroxyl group, a second compound having a carboxylic acid group, and a dispersing medium. |
US08940190B2 |
Composite for providing electromagnetic shielding
A composite for providing electromagnetic shielding including a plurality of nanotubes; and a plurality of elongate metallic nanostructures. |
US08940186B2 |
Insulating layer composition for substrate, and prepreg and substrate using the same
Disclosed herein are an insulating layer composition for a substrate, including a soluble type liquid crystal thermosetting oligomer, a metal alkoxide compound, and graphene oxide, and an insulating film and a substrate using the same.The insulating layer composition according to the present invention can effectively lower a coefficient of thermal expansion thereof, and thus, a dimensional change due to heat can be minimized when the insulating layer composition is used as an insulation material of the substrate, resulting in a substrate having improved thermal stability. |
US08940185B2 |
Liquid crystal compound, liquid crystal composition and liquid crystal display device
To provide a novel liquid crystal compound having general physical properties necessary for the compound, namely, stability to heat, light and so forth, a wide temperature range of a liquid crystal phase, a high clearing point, a good compatibility with other compounds, a large refractive index anisotropy, a large dielectric anisotropy and a small viscosity. The liquid crystal compound is provided as compound (1): wherein, for example, R1 is alkyl having 1 to 20 carbons; ring A1 and ring B1 are 1,4-cyclohexylene or 1,4-phenylene; Z1 and Z2 are a single bond, —CH2CH2—, —CH═CH— or —C≡C—; L1 is fluorine; L2, Y1 and Y2 are hydrogen, fluorine or chlorine; and X1 is halogen, —C≡N or alkyl having 1 to 10 carbons, and in the alkyl, arbitrary —CH2— may be replaced by —O— or —S—, and m is 1 and n is 0. |
US08940181B2 |
Emulsions of heat transfer fluids including nanodroplets to enhance thermal conductivities of the fluids
A heat transfer fluid emulsion includes a heat transfer fluid, and liquid droplets dispersed within the heat transfer fluid, where the liquid droplets are substantially immiscible with respect to the heat transfer fluid and have dimensions that are no greater than about 100 nanometers. In addition, the thermal conductivity of the heat transfer fluid emulsion is greater than the thermal conductivity of the heat transfer fluid. |
US08940180B2 |
Low GWP heat transfer compositions
The present invention relates, in part, to heat transfer and refrigerant compositions and methods that include HFC-32; HFO-1234ze and HFC-125. |
US08940178B2 |
Textured silicon substrate and method
A method of texturizing a silicon substrate comprising a) contacting the substrate with an etching solution comprising glycolic acid, b) etching a surface of the substrate thereby forming disruptions in said surface of the substrate, and c) removing the etching solution to yield a texturized substrate, said texturized substrate having a plurality of disruptions in at least one surface with a surface density of disruptions of a minimum of 60 disruptions in a 400 micron square area. |
US08940175B2 |
Method of mass transfer processes
Mass transfer sorption processes involve passage of a processed aqueous solution through a layer of granulated sorbent pre-filled with an organic liquid immiscible with either water or an aqueous solution under treatment. The apparatus for mass transfer of sorption processes is a vertical tank with inlet and outlet fittings loaded with a layer of sorbent disposed between the upper and the lower distribution and drainage systems. The industrial plant for separation of the components of aqueous solutions of inorganic substances includes the said apparatus and the apparatus for the separation of organic liquids from aqueous solutions. The latter has a casing with three chambers, the middle one of which is separated from the first outer one by a grid and from the other by a hydrophobic drainage layer. The emulsion to be separated is introduced into the middle chamber, and the separation results are derived from the outer chambers. |
US08940173B2 |
Membranes with functionalized carbon nanotube pores for selective transport
Provided herein composition and methods for nanoporous membranes comprising single walled, double walled, or multi-walled carbon nanotubes embedded in a matrix material. Average pore size of the carbon nanotube can be 6 nm or less. These membranes are a robust platform for the study of confined molecular transport, with applications in liquid and gas separations and chemical sensing including desalination, dialysis, and fabric formation. |
US08940169B2 |
Spiral wound membrane element and treatment of SAGD produced water or other high temperature alkaline fluids
A spiral wound module is suitable for use with high temperature water that is also very alkaline or has a high pH, for example SAGD produced water. The module uses a polyamide-based membrane with a polysulfone or polyethersulfone backing material. For other components, the module uses primarily one or more of, EPDM; polyamide; polyphenylene oxide; polyphenylene sulfide; polysulfone; polyethersulfone; polysulfonamide; polyvinylidene fluoride; mylar; fiberglass; and, epoxy. Polyester is not used. Polypropylene is not used for the feed spacer. For example, a module may use a PVDF feed spacer, a nylon permeate spacer and a polysulfone center tube. The center tube may be provided with 4 rows of 0.063″ diameter holes and be rolled under high tension. |
US08940165B2 |
Oil-filter device
An oil-filter device, in particular for a motor-vehicle internal combustion engine, includes a filter element and a cover region. An oil outlet, which is closed by a destructible single-use closure, is provided in the cover region of the oil-filter device. |
US08940161B2 |
Apparatus, system, and method for remediation of contamination
An apparatus, system and method for removing and treating contaminated materials on a bottom of a body of water and introducing growth packets to revitalize the treated bottom of the body of water. The structure may comprise a vessel with an open face. The vessel may be lowered down to the bottom of the body of water with the face facing down. As a result, the vessel and the bottom form an isolated space. The structure may comprise at least one agitating device(s) for stirring up the materials inside the vessel so as to form a mixture containing the sediment materials which in turn contain the contaminants. Multiple at least one pipe(s) may be coupled to the vessel for transporting the mixture out of the vessel for processing (filtering, treating with chemicals, etc.) so as to neutralize or eliminate the contaminants in the mixture. Then, the treated mixture can be returned to the inside of the vessel via the at least one pipe(s). |
US08940158B2 |
System and method for chlorine generation and distribution
A system and method is disclosed for chlorine generation and distribution for the treatment of a pool, spa, body of water, or other water system. |
US08940137B2 |
Continuous plating apparatus configured to control the power applied to individual work pieces within a plating tank
A continuous plating apparatus, when the number of the workpieces simultaneously transferred in the plating tank in a completely immersed state is N, (N+1) cathode relay members that extend in a workpiece transfer direction and (N+1) power supply units being provided outside the plating tank, anode terminals of the power supply units being connected to opposed anodes that are provided in the plating tank, cathode terminals of the power supply units being respectively connected to the cathode relay members so that power is supplied to each of the workpieces transferred in the plating tank from a corresponding power supply unit among the power supply units through a corresponding cathode relay member among the cathode relay members, and each of the power supply units being able to be controlled by constant current control when being transferred in the plating tank in a completely immersed state, by current gradual increase control when being carried into the plating tank in a partially immersed state, and by current gradual decrease control when being carried out from the plating tank in a partially immersed state. |
US08940135B2 |
Production of filled paper using biodegradable polyester fibers and/or polyalkylene carbonate fibers
The present invention relates to a process for producing filled paper, card and board comprising dewatering a paper stock with sheet formation and drying, wherein biodegradable polyester fibers and/or polyalkylene carbonate fibers are added to the paper stock. |
US08940131B2 |
Screw compression process for the conversion of lignocellulosic suspensions containing a high proportion of dry material
The invention describes a process for the conversion of aqueous suspensions of lignocellulosic solids comprising a solids content of between 1 and 20% of dry material, said process comprising a step a) for compression of said suspension so as to separate the liquid phase present in and between the solids from the compressed solid phase and a step b) for extraction of at least the liquid phase, said liquid phase then being homogenized by heat and/or chemical treatments and reinjected on to the compressed solid phase. |
US08940130B2 |
Method for separating lignin from black liquor
A method was developed for: a) improving the filterability of acid-precipitated lignin from kraft black liquors, b) increasing the dry solids content of the final lignin product, c) reducing the acid requirements and d) minimizing or eliminating TRS emissions during the acidification of black liquor to produce lignin and/or the subsequent suspension of the lignin in acid and/or the washing of the lignin with acid. No major difference in the chemical composition, MWD and main functional groups was found in the lignin of the present invention compared with lignins produced by conventional methods. |
US08940129B2 |
Process for reducing one or more insoluble solids in a black liquor
One exemplary embodiment can be a process for reducing one or more insoluble solids in a black liquor. The process may include hydrothermal processing the black liquor to a temperature of about 250-less than about 300° C. for an effective time to reduce the one or more insoluble solids by more than about 40%, by weight, based on a weight of the one or more insoluble solids prior to hydrothermal processing. |
US08940128B2 |
Plasma processing apparatus
The invention aims at suppressing the self bias generated at the surface of the inner wall of the vacuum processing chamber, to thereby suppress the chipping of the inner wall surface of the vacuum processing chamber or the consumption of the inner parts of the vacuum processing chamber. The present invention provides a plasma processing apparatus comprising a vacuum processing chamber, a vacuum processing chamber lid sealing an upper portion of the vacuum processing chamber, an induction antenna, a Faraday shield disposed between the induction antenna and the vacuum processing chamber lid, and a high frequency power supply for supplying high frequency power to the induction antenna, wherein the induction antenna is divided into two or more parts, the Faraday shield is divided into a division number corresponding to the division number of the induction antenna, and high frequency voltages are applied thereto via a matching box from the one high frequency power supply. |
US08940127B2 |
Resin composition for the manufacture high gloss laminated panels
A high gloss laminated panel is manufactured by applying a layer of a resin composition on a substrate layer and applying elevated pressure at elevated temperature for a time sufficient to at least partially cure the resin preferably without back-cooling. The resin composition includes a melamine formaldehyde resin in water and further includes one or more additives chosen from the group of thiourea, 1-amino-2-thiourea, stabilized guanidine, thio-acetamide, or an additive. |
US08940123B2 |
Prepreg tape slitting apparatus and method
A method and apparatus is provided for simultaneously producing wide and narrow slit tape from the same master roll. |
US08940117B2 |
Methods and systems for forming flexible multilayer structures
Techniques are described for fabricating multilayer structures having arrays of conducting elements or apertures in a conductive grid which can be used to form frequency selective surfaces (FSSs), antenna arrays and the like on flexible substrates. Fabrication techniques can include use of a polymer mask or direct dielectric molding. In embodiments utilizing a polymer mask, a temporary 3D polymeric relief pattern is formed on a substrate and used as a mask or stencil to form the desired pattern elements. In an additive process, the conductive material is deposited over the masked surface. Deposition can be followed by mask removal In the subtractive process, the conductive layer can be deposited prior to formation of the polymer mask, and the exposed parts of the underlying conductive layer can be etched. Other embodiments utilize dielectric molding in which the molded structure itself becomes an integral and permanent part of the FSS structure. |
US08940109B2 |
Method for manufacturing base material for wave gear
A method for manufacturing a base material for a wave gear which enables the effective suppression of man-hours and manufacturing cost while providing the required strength and elastic deformation characteristics for an external gear of a wave gear. In this manufacturing method, steel having a carbon content of 0.48% or less is subjected to primary molding by being cold worked into the shape of an external gear for a wave gear. The resulting primary molded article is heated to a temperature range in which the main phase of the metallographic structure thereof forms an austenitic structure. The main phase of the metallographic structure is formed into bainite by carrying out quenching to a predetermined temperature higher than the martensitic transformation starting temperature and maintaining the temperature for a predetermined time. The product is then cooled to normal temperature. |
US08940107B2 |
Dishwasher, and process for rinsing of wash items
A dishwasher (10) for the batch washing of wash items (20) comprises a wash chamber (24), which is arranged to accommodate wash items (20) and in which spray members ((34a-b)) for spraying out washing liquid and rinsing liquid are disposed; a wash tank (28), which is arranged to contain washing liquid which during a wash phase shall be supplied to the wash chamber (24) via the spray members ((34a-b)); a recirculating rinse tank (52), which is arranged to contain used rinsing liquid which during a rinse phase shall be supplied to the wash chamber (24) via the spray members ((34a-b)); members (62) for supplying final-rinse liquid which during a final-rinse phase shall be supplied to the wash chamber (24) via the spray members ((34a-b)); a collecting device (42, 46), which is arranged to collect liquid which has been sprayed out into the wash chamber (24) via the spray members ((34a-b)); and a pump (48), which is arranged to pump used rinsing liquid from the collecting device (42, 46) to the recirculating rinse tank (52). |
US08940105B2 |
Sulfonamide-doped undercoat for imaging device
A photoreceptor undercoat containing a sulfonamide facilitates removal of coatings from the substrate. |
US08940101B2 |
Apparatus for cleaning substrate
An apparatus for cleaning a substrate is disclosed. The apparatus includes a first chamber through which a substrate is conveyed, a second chamber where an oxide film formed on the substrate conveyed from the first chamber is removed; and a third chamber that discharges the substrate conveyed from the second chamber to the outside after rinsing the substrate, wherein the first chamber and the third chamber are disposed on top and on bottom. |
US08940100B2 |
Method for cleaning hot dip galvanized steel sheet and cleaning apparatus therefor
Cleaning of a hot dip galvanized steel sheet is conducted by bringing a strip-shaped steel sheet which was treated by surface oxidation in advance into contact with a cleaning liquid for 1 second or more, and then bringing the hot dip galvanized steel sheet into contact with pure water, while continuously transferring the hot dip galvanized steel sheet. The method allows efficiently and fully washing off the acidic solution adhered to the surfaces of the hot dip galvanized steel sheet treated by surface oxidation. The invention also provides an apparatus for cleaning the hot dip galvanized steel sheet to carry out the above cleaning method. |
US08940096B2 |
Vertical thermal processing apparatus and substrate supporter
A vertical thermal processing apparatus including: a substrate supporter; a transfer mechanism to transfer substrates between the substrate supporter and a container; and a thermal processing furnace to process substrates that have been loaded thereinto with the substrate supporter. The substrate supporter includes: support columns located at intervals therebetween to surround the substrates, supporting parts for substrate and supporting parts for annular plate provided at the support columns in a tier-like manner, for alternately supporting peripheral parts of the substrates and of annular plates at predetermined intervals therebetween, and annular plates to be supported by the supporting parts for annular plate, when seen from a direction in which the substrates are transferred. Each of the annular plates has an intermediate part having a thickness smaller than thicknesses of the peripheral parts thereof to be supported by the support columns. |
US08940092B1 |
Hybrid fibers, devices using hybrid fibers, and methods for making hybrid fibers
The present invention relates generally to nanocomposite materials. The present invention relates more particularly to hybrid fibers as well as devices including them and methods for making them. Accordingly, one aspect of the invention is a hybrid fiber including a plurality of nanowires, each nanowire having a length, a width, and a thickness, the length being at least 10 times the width and at least 10 times the thickness; and a plurality of binder elements, each binder element having a length, a width, and a thickness, each substantially smaller than the average length of the nanowires and at least one of which is less than about 10 nm in dimension, the binder elements being arranged to intercouple individual nanowires. In certain embodiments, the binder elements are carbon nanotubes, and the nanowires are formed from silicon carbide. |
US08940087B2 |
Coloring matter compound, ink, resist composition for color filter, and heat-sensitive transfer recording sheet
The coloring matter compound is represented by the following general formula (1): wherein R1 and R2 each independently represent an alkyl group or an acyl group, or R1 and R2 may be bonded to each other so as to form a cyclic organic functional group containing, as a hetero atom, a nitrogen atom to which R1 and R2 are bonded; R3 and R4 each independently represent an alkyl group; R5 and R6 each independently represent an alkyl group or an alkoxy group; R7 represents a hydrogen atom, an alkyl group or an alkoxy group; and R8 represents an alkyl group. |
US08940084B2 |
Gas adsorbing device and vacuum insulation panel provided with same
A gas adsorbing device (5a) according to the present invention includes a gas adsorbing material (9) that adsorbs at least nitrogen and a housing container (11) that has a long, thin, flat, tubular shape and is made of metal and in which both sides of a housing portion (10) configured to house the gas adsorbing material (9) under reduced pressure are sealed. A contact portion (13) where opposing inner surfaces of the housing container (11) are in close contact with each other is located between at least one of seal portions (12a and 12b) of the housing container (11) and the housing portion (10). |
US08940082B2 |
Filter element for an extractor hood and extractor hood
A filter element for an extractor hood includes an odor filter having depressions provided in an entry side of the filter element and extending at least over half of a height of the filter element. A frame holds the odor filter at its edges and has a height which is smaller at least on one side of the frame than a height of the odor filter. |
US08940081B2 |
Combustible gas enrichment apparatus
In order to provide a technique for enriching a combustible gas that allows enrichment of the combustible gas to a higher concentration in an efficient manner with minimization of loss of a source material, there are provided an adsorption tower charged with an adsorbent, a feeding/discharging means for feeding a source gas containing a combustible gas and air, a collecting means for desorbing the combustible gas adsorbed to the adsorbent and collecting the desorbed gas, a controlling means for sequentially effecting a combustible gas adsorption process and a combustible gas desorption process, a detecting means for detecting the concentration of the combustible gas in the source gas, and an operation condition setting section for varying an adsorption completion timing for the controlling means to complete the adsorption process, based on the combustible gas concentration detected by the detecting means. |
US08940079B2 |
Gas scrubber apparatus and method
A scrubber for removing contaminants from a gas stream, comprising a tank, a submerged head extending horizontally, wherein the submerged head comprises a plate having slots extending throughout, four solid joined vertical walls inset from the walls of the tank below the plate to form an open ended box under the plate, and openings along each edge of the plate between the walls of the tank and the vertical walls of the submerged head; a first baffle above the submerged head and means for spraying scrubbing fluid. The scrubber may comprise a flooded head extending horizontally above the first baffle and head having narrow slots extending throughout; and a second baffle extending horizontally between the four walls of the tank. |
US08940077B2 |
Indirect real-time monitoring and control of electrical resistively heated adsorbent system
A method for indirectly monitoring and controlling an electrically resistive adsorption system. Adsorption of a predetermined adsorbate is conducted while indirectly monitoring electrical resistance of a unified adsorbent element. Breakthrough is predicted based upon the indirectly monitored electrical resistance and a previously measured mass loading relationship between the resistance of the unified adsorbent element and the loading of the unified resistance element with the predetermined adsorbate. Adsorption, regeneration and cooling cycles are controlled by a controller without any direct measurement of temperature or resistance of the element and characterizations of mass loading and temperature. Systems of the invention can have no sensors that contact the element, are in an adsorption vessel, and/or are downstream adsorption vessel. |
US08940073B2 |
Filter material for cleaning air and gases
The invention relates to a filter material for cleaning air and gases, comprising a fiber layer (2) made of cellulose fibers bonded to each other in segments by pressing, thus compacting the cellulose fibers in the pressed areas (4). |
US08940072B2 |
Parallel passage fluid contactor structure
A parallel passage fluid contactor structure for chemical reaction processes has one or more segments, where each segment has a plurality of substantially parallel fluid flow passages oriented in an axial direction; cell walls between each adjacent fluid flow passages and each cell wall has at least two opposite cell wall surfaces. The structure also includes at least one active compound in the cell walls and multiple axially continuous conductive filaments either embedded within the cell walls or situated between the cell wall surfaces. The conductive filaments are at least one of thermally and electrically conductive, are oriented in axially, and are in direct contact with the active compound, and are operable to transfer thermal energy between the active material and the conductive filaments. Heating of the conductive filaments may be used to transfer heat to the active material in the cell walls. Methods of manufacturing the structure are discussed. |
US08940071B2 |
Filter element, in particular air filter element
A filter element may include a first end disc, a second end disc, a filter medium arranged between the first and second end discs, wherein the first and second end discs are spaced by a filter medium. A third end disc may connect the first and second end discs and be arranged obliquely to at least one of the first end disc and the second end disc. The third end disc may include at least one of an inlet and outlet. |
US08940070B2 |
Filter device
A filter device is disclosed, including an air filter for a fresh air system of a motor vehicle. The filter device further include a filter housing which contains a receiving space. An annular filter element is inserted into the receiving space. The device also includes a cover for closing the receiving space. The cover is detachably fastened to the filter housing by means of a bayonet catch, so that the cover can be inserted axially into a cover receptacle formed on the filter housing and, when inserted, can be rotated between an unlocking position and a locking position. |
US08940067B2 |
Swirl helical elements for a viscous impingement particle collection and hydraulic removal system
A system and methods for separating liquids, aerosols, and solids from a flowing gas stream whereby gas flows through a helical path formed in a separator element. Partially separated gas exits the bottom of the separator element at a generally conical cavity. Clean gas exits through an inner tube that is axially aligned beneath the helical path. Separated materials exit through an annular space between the inner tube and an outer tube. Separation occurs in the helical channels which include radially diverging walls to provide an aerodynamically efficient flow, in a region of high swirl created in a generally conical cavity beneath the separator element, and in a toroidal vortex ring created in the annular space. The area and geometry of the helical path, the conical cavity, and the inner and outer tubes is optimized to provide efficient separation at varying gas flow rates and at varying liquid loads. |
US08940064B2 |
Dust collector
A dust collector having a filter for catching dust in air flowing in an intake path is provided. A pair of the intake paths are formed so as to be combined together on an upstream side of an electric blower provided in a main body. A pair of communication paths allow a discharge passage to communicate with each of the intake paths. A first opening and closing member is provided so as to open and close the intake path, and in a normal state, is biased to open the intake path. A second opening and closing member is provided so as to open and close the communication path, and in the normal state, is biased to close the communication path, and opens the communication path in response to a closing operation of the intake path by the first opening and closing member. |
US08940061B2 |
Apparatus for generating hydrogen
An apparatus for generating hydrogen for fuel cells is provided. The apparatus includes a housing, a button, a first separating plate, a solid state reactant, and a separating membrane. The housing has an opening and a reservoir. The button connected to the housing covers the opening. The first separating plate disposed in the housing divides the reservoir into first and second sub-rooms. The opening communicates with the first sub-room and the first sub-room is suitable for storing a liquid reactant. The first separating plate has a through hole opposite to the button. The solid state reactant is disposed in the second sub-room. The separating membrane disposed on the through hole separates the first sub-room from the second sub-room. When the button is pushed, the button damages the separating membrane. Therefore, the liquid reactant flows to the second sub-room and reacts with the solid state reactant to generate hydrogen. |
US08940059B2 |
Azo compound and dye polarizing film containing the same
Disclosed is an azo compound represented by the formula (1) below, a salt thereof, or a copper complex salt compound thereof. (In the formula, R1 and R2 independently represent a hydrogen atom, a sulfonic acid group, a lower alkyl group or a lower alkoxyl group; R3-R6 independently represent a hydrogen atom, a lower alkyl group or a lower alkoxyl group; R7 represents a lower alkyl group or a lower alkoxyl group; and n represents 0 or 1.) |
US08940057B2 |
Casting liner, and method and kit for using the same
A tubular casting liner for forming a definitive prosthetic socket includes an outer layer defining first and second surfaces and at least one polymeric layer having first and second surfaces. The first outer layer surface continuously defines at least a portion of the exterior surface of the casting liner, and the at least one polymeric layer first surface is secured to the second surface of the outer layer. A ratio of thickness of the at least one polymeric layer at the distal end area relative to the proximal end area is at least 3:1. The casting liner has a substantially straight profile, wherein a diameter d1 of the liner whereat the distal end area begins to transition to close-ended form is the same or substantially the same as a diameter d2 at the proximal end area. A method and kit for forming a definitive prosthetic socket may use the casting liner. |
US08940055B2 |
Method and apparatus for wrist arthroplasty
A method of implanting a distal radial wrist implant relative to a host radius while salvaging at least portions of fractured radial bone can include, determining a size of a host radius. A distal radial component can be selected based on the determination. The distal radial component can have a body that includes a first connection portion. A stem portion can be selected based on the determination. The stem portion can have a second connection portion. Portions of the fractured radial bone can be located around the body. The portions of the fractured radial bone can be secured relative to the body. The first connection portion of the distal radial component can be coupled with the second connection portion of the stem portion. The distal radial implant can be implanted relative to the host radius. |
US08940051B2 |
Interbody device insertion systems and methods
Provided is a system for implanting an interbody device into a disc space located between a first and second vertebra includes a guide frame including a guide member having an opening. The system further includes an implant trial including an elongated body and a base plate coupled to the elongated body. The elongated body of the implant trial is releasably coupled to the guide member of the guide frame during use such that the opening guides longitudinal movement of the implant trial relative to the guide frame. The system still further includes a dilator operatively coupled to the elongated body during use for distracting the disc space. The system still further includes an insertion instrument including an elongated body and an insertion member coupled to the elongated body. The elongated body of the insertion instrument is releasably coupled to the guide member of the guide frame during use such that the opening guides longitudinal movement of the insertion instrument relative to the guide frame. The insertion member is releasably coupled to at least a portion of the interbody device during use. |
US08940050B2 |
Flexible vertebral spacer
A flexible implant system for positioning a flexible spacer between adjacent vertebrae including and interbody spacer and an insertion instrument. The interbody spacer including a central axis, a lateral axis, a top surface positioned generally parallel to the central axis and a plurality of hinge sections extending generally perpendicular to the central axis. A plurality of notches making up the plurality of hinge sections adjacent the top surface that permit the interbody spacer to flex. The interbody spacer further including a groove extending along a lateral side surface, generally parallel to the central axis. An insertion instrument includes a proximal end, a distal end and a tongue extending from the proximal end to the distal end along a non-linear path. The groove slidably engages the tongue to guide the interbody spacer from the proximal end to the distal end along the non-linear path. |
US08940049B1 |
Expandable intervertebral cage
An expandable intervertebral cage adapted to be implanted into an intervertebral disc space in a patient's body, the expandable intervertebral cage including first and second base plates having outer surfaces configured to interface with vertebra in the intervertebral disc space, a first, second and third arm assembly hingedly connected to first and second base plates, and first and second actuation members, wherein rotation of the first actuation member pulls the second arm assembly towards the first arm assembly and rotation of the second actuation member pulls the third arm assembly towards the second arm assembly, the first actuation member and the second actuation member capable of being actuated independently of each other. |
US08940048B2 |
Expandable spinal interbody and intravertebral body devices
A device for insertion into a spinal (intervertebral or intravertebral) space is expandable from a first circumference to a second circumference through axial compression of segments of the device, particularly once the device has been properly situated within a vertebral space. The interbody/intravertebral body device is characterized by a plurality of axially stacked, individual segments that are provided on a central insertion and deployment rod. Each segment includes a central plate or body to which are pivotally attached plate or leaf structures. Pivoting of the structures provides a collapsed or unexpanded position of the first circumference and an open or expanded position of the second circumference. |
US08940037B2 |
Stent having circumferentially deformable struts
Disclosed is a method of treating a bodily lumen with a stent, the method comprising: disposing a stent within a bodily lumen, the stent comprising a plurality of deformable struts that are substantially circumferentially aligned and are configured to selectively deform in a circumferential direction in localized regions in the struts upon application of an outward radial force; and expanding the stent by applying the outward radial force, wherein the outward radial force causes selective deformation of the deformable struts in a localized region in the struts. |
US08940031B2 |
Pedicle screw fixation system and method for use of same
A pedicle screw fixation system and method for use of the same are disclosed. In one embodiment, a tulip is provided for holding a head of a pedicle screw substantially along a longitudinal axis. The tulip includes opposing first and second U-shaped receiving slots aligned along a transverse axis. A rod is received by the opposing first and second U-shaped receiving slots. A coupling collar includes a plurality of resilient fingers circumferentially disposed therearound such that a snap fit engagement with the head of the pedicle screw formed. The coupling collar includes a first deformable face operable for contact with the rod. A set screw is for adapted for driving engagement through the tulip along the longitudinal axis such that a second deformable face is positioned for contact with the rod. The first and second deformable faces conform to the shape of the rod in response to forceful engagement therewith. |
US08940030B1 |
Spinal fixation system and related methods
The present invention relates generally to medical devices and methods for use in spinal surgery. In particular, the disclosed devices relate to a spinal fixation system and an intervertebral spinal implant assembly sized and dimensioned for the lumbar spine implantable via an anterior or anterolateral approach. The devices include an implant, bone screws, and an improved locking mechanism to prevent the back out of screws. |
US08940023B2 |
System and method for cervical midline fixation
Devices and methods for enhancing the effectiveness of spinal stabilization, and particularly that of cervical spinal stabilization, are provided herein. More specifically, methods and systems are disclosed for effectively positioning occipital plates and spinal fixation assemblies within target vertebrae, while also reducing any associated patient trauma (e.g., muscle stripping, tissue damage, etc.). The systems and methods can utilize trans-lamina delivery of the spinal fixation assemblies to allow for the positioning of the fixation elements along the midline of the patient's spine. |
US08940019B2 |
Bone tissue fixation device and method
Systems, methods, and kits incorporating a clamp for securing to bone tissue. The clamp includes gripping members to secure the clamp to the bone tissue without the use of screws. The clamp may be used to treat spinal conditions, and may be secured to the spinous process of vertebrae. Systems, methods and kits can incorporate a fusion member configured to fuse between adjacent spinous processes. |
US08940016B2 |
Mechanical method and apparatus for sequential tissue fastening
A mechanical system for rotatably, sequentially securing opposing sides of a tissue wound with a fastener. An applicator apparatus is capable of imparting rotatable motion to a falcate tissue penetrator that sequentially pierces and carries a fastener into a first side and a second side of the tissue wound. The first side and second side of tissue can be simultaneously captured and positioned with respect to a tissue definition member or alternatively, the first tissue side and second tissue side can be individually, sequentially captured and positioned relative to the tissue definition member. The applicator apparatus can comprise a single fastener for small tissue wounds or resections or alternatively, the applicator can comprise a plurality of staged fasteners for use in closing a larger wounds or wounds with increased tension. |
US08940013B2 |
Human skin treatment arrangement
A human skin treatment arrangement configured to treat surface conditions of human skin, especially the wrinkle, fine lines or scar appeared on the surface of human face, or for improving absorption efficiency of cosmetic or medical transdermal agent. In a treatment mode, the arrangement is configured for attaching to a portion of human skin such that the area of the human skin under treatment is maintained in a stretched position to enhance the treatment effect. In a further embodiment, the arrangement comprises a wrinkle relief agent, a scar relief agent or a cosmetic or medical transdermal agent to treat the surface of the skin. |
US08940012B2 |
Intravascular filter with biodegradable force-reducing element
An intravascular filter for a vessel includes a non-biodegradable apical hub and non-biodegradable struts extending generally distally from the hub. The struts extend radially outward from a longitudinal axis of the hub. The distal ends of the struts exert an expansile force against an interior of the vessel. One or more struts includes one or more time-degrading connectors along its length, which can be formed from a biodegradable element made from a fixation material. Prior to degradation, the fixation material rigidly connects a proximal section to a distal section of the respective strut. After degradation, the fixation material is dissolved or softened, and reveals a link that has a strong resistance to longitudinal movement of the distal section with respect to the proximal section and may have a weak resistance to rotational movement of the distal section with respect to the proximal section, such as a pair of interlocked loops. |
US08940010B2 |
Catheter with a polymide distal tip
A catheter having an elongated shaft which has a multilayered distal tip with a first layer formed of a polyimide first material and a second layer formed of a polymeric second material. In one embodiment the multilayered distal tip is a separate member, distal to the distal end of a proximal portion of the shaft. In another embodiment, the shaft has an outer tubular member, and a multilayered inner tubular member with a distal end which forms the multilayered distal tip of the shaft. In a presently preferred embodiment, the polyimide material is a thermoset polyimide. In one embodiment, the polymeric second material is a polyamide material. |
US08940006B2 |
Single-puncture lancing system
A lancing mechanism is adapted to move between resting, cocking and puncture positions and comprises a lancet holder, a shaft, at least one spring and a mass. The shaft is attached to the lancet holder and has an enlarged end opposite the lancet holder. The spring surrounds at least a portion of the shaft and has first and second portions. The second portion of the spring is attached to the lancet holder. The spring drives the lancing mechanism between the cocking and puncture positions. The mass is located along the spring with the first and second portions of the spring extending on opposite sides of the mass. The mass is distinct from the lancet holder. The first portion dampens the lancing mechanism when moving from the puncture position to the resting position. |
US08940005B2 |
Locking flexible surgical instruments
A flexible-shaft surgical instrument has a compression member that is distally movable to provide a compression force between the compression member and a distal compression bearing to compress a plurality of links and rigidly lock a semi-rigid tube formed by those links at any of a variety of user-selectable predetermined positions. The semi-rigid tube is configured to be bent and locked at the user-selectable predetermined position and, upon proximal movement of the compression member, returned to an unlocked state without significant plastic deformation of the semi-rigid tube. |
US08940001B2 |
Devices, systems and methods for retracting, lifting, compressing, supporting or repositioning tissues or anatomical structures
Devices, systems and methods for retracting, lifting, compressing, supporting or repositioning tissues, organs, anatomical structures, grafts or other structures within the body of human or animal subjects for the purpose of treating a diseases or disorders and/or for cosmetic or reconstructive purposes and/or for research and development purposes or other purposes. |
US08939995B2 |
Radiolucent reference for computer-assisted surgery
A radiolucent fastening device for fastening a reference device to a body for computer-assisted surgery, wherein a part of the fastening device is made from an unsubstituted carbon fiber reinforced polyether compound, a monosubstituted carbon fiber reinforced polyether compound or a multisubstituted carbon fiber reinforced polyether compound. |
US08939994B2 |
Suction fixing device
A suction fixing device to be fixed to an organic base includes at least one low-pressure casing, at least one attachment device operative to apply a low pressure to the surface of said organic base; and a holding device operative to secure the fixing device to the organic base. The holding device engages the organic base when low pressure is applied to the surface of the organic base. |
US08939993B1 |
Pre-curved electrode array loading tools
Exemplary systems for loading a pre-curved electrode array onto a stylet include a loading tool and a stylet retainer. The loading tool includes a docking assembly comprising a plurality of wing members that form a receptacle configured to receive a proximal portion of the stylet, a channel assembly comprising a channel configured to receive and allow passage therethrough of the pre-curved electrode array, the channel further configured to receive a distal portion of the stylet, and a connecting member configured to connect the channel assembly to the docking assembly. The stylet retainer is configured to couple to the loading tool to retain the stylet within the loading tool while the pre-curved electrode array is loaded onto the stylet. Corresponding methods are also described. |
US08939991B2 |
Apparatus and methods for removing obstructive material from body lumens
An apparatus is provided for removing material within a body lumen that includes a catheter including a proximal end, a distal end for introduction into a body lumen, and an aspiration lumen extending therebetween; a guide member extending from the distal end and terminating in a distal tip, the guide member comprising a track adjacent a track lumen extending from the distal tip into the aspiration lumen; and an obstruction clearing device deployable from the guide member and retractable along the track. In addition or alternatively, the apparatus includes a cutting head reciprocable within the aspiration lumen adjacent the distal end for macerating material being aspirated into the aspiration lumen. |
US08939989B2 |
Obstetric forceps
A pair of obstetric forceps is described. The forceps comprise a pair of blades for holding the head of a baby and a handle having at least one part by which a user can apply a pulling force on the head of the baby in use. A mechanically operated force indicator is connected to the at least one part of the handle and is operable to provide a visual indication of the amount of pulling force being applied to the head of the baby when a user applies a pulling force on the head of the baby in use. A mechanically operated disabling device is operable to at least partially disable the obstetric forceps when a maximum pulling force has been exceeded. The blades can each have a superior rim and inferior rim wherein the greatest separation between the superior rims is greater than the greatest separation between the inferior rims when the obstetric forceps are in a closed configuration so that the blades adopt the form of an at least partially bowl shape. |
US08939985B2 |
Biomaterial dispensing device
A device for dispensing biomaterial includes a handle configured to receive a syringe, the syringe including a biomaterial and a threaded plunger, and an engagement pin retained within the handle and slidable between a first position and a second position. The engagement pin is configured to engage the threaded plunger in the first position, the engagement pin is further configured to disengage from the threaded plunger in the second position. |
US08939984B2 |
Method of performing osteotomy
A method of performing an osteotomy including the steps of: providing a guide assembly; placing the guide assembly in operative relationship to a bone to be cut so that the guide assembly defines first and second guide edges that are in fixed relationship to each other to each guide movement of a cutting tool; guiding the cutting tool along each of the first and second guide edges to produce first and second cut lines in the bone to facilitate separation of a fragment of the bone from between first and second bone surfaces formed respectively at the first and second cut lines; separating the bone fragment so that a gap with a first width is formed between the first and second bone surfaces; and changing the width of the gap to be less than the first width. |
US08939975B2 |
Gap control via overmold teeth and hard stops
A forceps includes an end effector assembly having a stop and a plurality of overmold teeth within at least one jaw member. One (or both) of the jaw members is moveable relative to the other between a spaced-apart position and an approximated position for grasping tissue therebetween. One (or both) of the jaw members includes a stop molded within an insulative housing, and an insulator plate with the overmold teeth formed from plastic. The overmold teeth extend through openings within a sealing plate and protrude past the tissue sealing surface of the sealing plate. The stop primarily controls the gap distance between opposing jaw members by bearing most of an applied load and the overmold teeth assist in controlling the gap distance by bearing the remaining applied load. |
US08939974B2 |
Surgical instrument comprising first and second drive systems actuatable by a common trigger mechanism
A surgical instrument can comprise a first drive system for advancing a knife bar between a first position and a second position in order to close a jaw, or clamping, member of an end effector. The first drive system can comprise a toggle clamp which can generate and transmit an asymptotical clamping load to the jaw member. The surgical instrument can further comprise a second drive system for advancing the knife bar between the second position and a third position. The second drive system can comprise a rack and pinion system and the surgical instrument can comprise a single trigger for actuating both the first drive system and the second drive system on the same stroke. |
US08939964B2 |
Electrically switchable multi-spot laser probe
In certain embodiments, a system may include a housing, one or more lenses, and a scanning system. The housing has an interior region. A lens is disposed within the interior region and transmits a light beam. The scanning system is disposed within the interior region and comprises a number of scanning cells, where each scanning cell comprises an electro-optical (EO) material. The scanning system performs the following for a number of iterations to yield a spot pattern: receive one or more voltages and electrically steer the light beam with the EO material from a current direction to a next direction in response to the voltages. |
US08939962B2 |
System and method for urinary catheterization
The embodiments herein provide an atraumatic urinary catheter. The atraumatic urinary catheter has a first tubule, a second tubule and a third tubule. The first tubule is provided with a first channel and a second channel. The first channel is wide and extended from a proximal end to a distal end of the first tubule and the first channel is open in both ends. The second tubule comprises a third channel, which is connected to a bladder cavity. The third tubule placed on the first tubule and the second tubule as a cover, to form a catheter's balloon. In order to avoid balloon explosion, the sterile water in the balloon is drained by the self-retaining mechanism of the catheter to prevent an irritation and tissue traumatization. |
US08939956B2 |
Wearing article
A wearing article includes a chassis and an absorber main body. The wearing article has a central elastic member overlapping a non-skin surface of an absorber in the crotch region and extending along a longitudinal direction at an approximately center of a widthwise direction of the wearing article, and a back leg elastic member that curves within the crotch region from the end of a back waistline region in the widthwise direction and configures at least a part of an elastic stress line that crosses the absorber along the widthwise direction. In the elastic stress line, the elastic stress of the portion crossing the absorber is smaller than the elastic stress of the central elastic member. |
US08939954B2 |
Absorbent article having a multilayer visual signal
An absorbent article and method of making an absorbent article. The absorbent article has a first layer and a second layer in facing relationship with one another. The first layer has a first imparted colored region coincident with the longitudinal centerline. The second layer has a second imparted colored region laterally more extensive in a direction orthogonally away from the longitudinal centerline than the first imparted colored region. The second imparted colored region extends across the longitudinal centerline and has free ends. The absorbent article has a background region. The first imparted colored region and the second imparted colored region differ in color as compared to the background region. |
US08939952B2 |
Seal for a rectal or ostomy appliance
A rectal appliance with a tubular member defining a communication passage for body waste, and first and second inflatable chamber portions carried on the tubular member for forming internal and external seals with respect to the anus. One or both of the inflatable chamber portions have a partly flared shape. The second inflatable chamber portion has a low external profile, and a concave sealing surface. The inflatable chamber portions are defined at least partly by a common flexible membrane that is constrained near a middle region to define a narrow waist between the two inflatable chamber portions. |
US08939951B1 |
Fluid collection device
A fluid collection device for withdrawing a fluid from an object includes a chamber having a plurality of apertures and an opening for flow of the fluid. A tube is positioned in fluid communication with the opening of the chamber for withdrawing fluid out of the chamber. At least one of the apertures is positioned within a recess for substantially preventing clogging of the apertures during collection and removal of the fluid. The plurality of apertures may be interconnected by grooves for directing the flow and preventing clogging of the apertures. The tube has a plurality of holes that are positioned within the chamber and held in place with a retaining ring. The apertures may be positioned so that spaces are provided between the apertures for placement of the tube or other devices. Exposed edges of the chamber and recesses are radiused for reducing irritation to a person. |
US08939950B2 |
Supply chain method and apparatus for sealing and unsealing a vacuum draw path
This application teaches a disposal chain and a supply chain system for sealing and unsealing a vacuum draw path embodying a thrust handle capable of imparting assembly and disassembly thrust forces said system conferring the potential of reducing the amount solid waste mass contributed to the waste stream. |
US08939947B2 |
Systems and methods for radiographically identifying an access port
An access port for subcutaneous implantation is disclosed. Such an access port may comprise a body for capturing a septum for repeatedly inserting a needle therethrough into a cavity defined within the body. Further, the access port may include at least one feature structured and configured for identification of the access port subsequent to subcutaneous implantation. Methods of identifying a subcutaneously implanted access port are also disclosed. For example, a subcutaneously implanted access port may be provided and at least one feature of the subcutaneously implanted access port may be perceived. Further, the subcutaneously implanted access port may be identified in response to perceiving the at least one feature. In one embodiment, an identification feature is included on an insert that is incorporated into the access port so as to be visible after implantation via x-ray imaging technology. |
US08939946B2 |
Balloon trocar
A balloon trocar includes a cannula assembly including a cannula and an outer sleeve fitting over the cannula. The distal end of the outer sleeve is proximal to the distal end of the cannula. A balloon is coupled to a distal portion of the sleeve and a distal portion of the cannula. The outer surface of the cannula includes a plurality of longitudinal channels for transmitting gas or fluid to the balloon. A bolster having a gel pad at its distal portion is slidably mounted to the cannula assembly and may be locked in a desired position. In use, the trocar is inserted into an incision through a body wall and into a body cavity. The balloon is inflated and the cannula assembly pulled proximally against the incision while the bolster is slid distally to the body wall and locked in place to seal the incision with the compressed balloon. |
US08939944B2 |
Reservoir module comprising a piston rod
A product dispensing apparatus including a reservoir module, a dosing module and a dose setting member. The reservoir module includes a front casing section, a block, a first connector, a piston, and a piston rod moveable in a dispensing movement and against the dispensing movement, and including a return block engageable with the block, wherein engagement between the block and the return block prevents the piston rod from moving against the dispensing movement. The dosing module includes a rear casing section, including a second connector which is engageable with the first connector to form a detachable connection between the reservoir module and the dosing module, and a dosing and drive device. The dose setting member engages the piston rod such that it is moveable together with and in the same direction as the piston rod during the dispensing movement and is moveable relative to the piston rod against the dispensing movement. |
US08939940B2 |
Blow-molded syringe for use with injectors
A syringe for use in the pressurized injection of a fluid. The syringe includes a syringe barrel composed of a polymeric material having undergone expansion via blow molding, and an injection molded attachment mechanism which is integral with the syringe barrel and is located at the proximal end of the syringe barrel. The syringe barrel has a consistent wall thickness and is capable of withstanding pressures of at least 1200 psi. The syringe barrel includes a biaxial stretch sidewall as a result of the blow molding process while the attachment mechanism remains essentially unchanged by the blow molding process. The polymeric material can be, for example, polyethyleneterephthalate, cyclic olefin polymer, polypropylene, polystyrene, polyvinylidene chloride, polyethylene naphthalate and/or nylon. |
US08939939B2 |
Fistula catheter
A fistula catheter which allows a supply tube to be easily connected to a body-external fixing member positioned on the body surface side, and which is only slightly invasive for a patient is provided. The fistula catheter 10 includes a tube body 11 which is inserted into a fistula formed in the abdominal wall and the wall of the alimentary canal; a body-external fixing part 12 which is linked to one end of the tube body 11 and positioned on the abdominal wall surface side of the fistula; and a body-internal fixing part 13 which is linked to the other end of the tube body 11 and positioned inside the wall of the alimentary canal. The body-internal fixing part 13, and the fistula catheter has a flow path allowing fluid to flow through the body-external and body-internal fixing members. The body-external fixing part 12 includes a flexible tube 1 and is connected substantially at right-angles to the axial direction of the tube body 11. |
US08939937B2 |
Method for providing surgical access
One embodiment is directed to a method for advancing a needle into a tissue structure, comprising: advancing a distal end of a needle insertion assembly, the assembly comprising an insertion member coupled to a tissue interface indentor member and movably coupled to an elongate needle member, against a targeted tissue structure such that a distally protruding shape feature of the tissue interface indentor member engages one or more portions of the targeted tissue structure adjacent a distal tip of the elongate needle member at a position at which the elongate needle member distal tip is configured to be advanced through the insertion member and into the tissue structure, and locally changes an available angle of penetration between such portions and the distal tip of the elongate needle member; and inserting the elongate needle member relative to the insertion member and tissue interface indentor member. |
US08939935B2 |
Drive mechanism for drug delivery pumps with integrated status indication
A drive mechanism having integrated status indication includes a drive housing, a status switch interconnect, a drive biasing member, a piston, and a drug container having a cap, a pierceable seal, a barrel, and a plunger seal, wherein the drive biasing member is configured to bear upon an interface surface of the piston. Drive mechanism may include an incremental status stem having a stem interconnect, wherein the stem resides within the drive housing and the piston, and wherein the stem has an interconnect which engages one or more contacts on the piston to provide incremental feedback. A drug delivery pump with integrated status indication includes a housing and an assembly platform, upon which an activation mechanism, an insertion mechanism, a fluid pathway connection, a power and control system, and the drive mechanism having a drug container may be mounted. |
US08939934B2 |
Auto-injector
An auto-injector comprising a housing arranged to contain a slidably arranged syringe. The housing having a distal end and a proximal end with an orifice. Spring means is capable of, upon activation: pushing the needle into an advanced position and into an injection site, operating the syringe to inject a dose of medicament, and retracting the syringe. Activating means locks the spring means in a pressurized state prior to manual operation and capable of releasing the spring means for injection. The spring means is a compression spring grounded distally in the housing and proximally bearing against a thrust tube arranged to transmit load from the spring means via a plunger to the syringe and/or the stopper. A tubular syringe carrier is arranged for holding the syringe and supporting it at a proximal end, the syringe and the syringe carrier arranged for joint axial translation. |
US08939933B2 |
Manifolds, systems, and methods for administering reduced pressure to a subcutaneous tissue site
Systems, methods, and apparatuses are provided for delivering reduced pressure to a subcutaneous tissue site, such as a bone tissue site. In one instance, a manifold for providing reduced pressure to a subcutaneous tissue includes a longitudinal manifold body formed with at least one purging lumen and a reduced-pressure lumen. The manifold further includes a plurality of manifolding surface features or slits formed on the second, tissue-facing side of the longitudinal manifold body and a plurality of apertures formed in the longitudinal manifold body on the second, tissue-facing side. The plurality of apertures fluidly couple the reduced-pressure lumen and the manifolding surface features or slits. The manifold further includes an end cap fluidly coupling the reduced-pressure lumen and the at least one purging lumen. Other systems, apparatuses, and methods are presented. |
US08939929B2 |
Infusion control device
The present invention relates to an infusion control device designed to secure the infusion control device to a drip chamber attached to an infusion tube. The infusion control device comprises a light indicator and a microprocessor. The microprocessor determines the amount of fluid in an infusion bottle providing fluid to the transparent drip chamber, and provides instructions to the light indicator to illuminate the infusion bottle when the amount of fluid in the infusion bottle is less than a predetermined first limit. |
US08939925B2 |
Tightening system for an orthopedic article
A tightening system and method for operating the same in an article for a wearer includes first and second members arranged for being connected at first ends, and separated by a distance at second ends. A tension element connects the first and second members. A tensioning mechanism is mounted on the first member and coupled to the tension element. The tensioning mechanism includes a housing and a retractable and extendable line arranged to be extended from the housing and automatically retract to the housing upon release of the line to permit one-way incremental winding of the tension element to thereby draw the first and second members closer to one another by reducing the distance therebetween. |
US08939922B2 |
Standalone system for assisting in a life-saving situation
A system and a method is disclosed for monitoring parameters during cardiopulmonary resuscitation, including a compression measuring means, a ventilation measuring means and a processing means. If at least one of the measured values deviate from a respective reference range, the processing means provides an indication of the deviation. If more than one of the measured values deviate from a respective reference range, the deviations are prioritized with an indication being provided first to the deviation having a higher priority. The invention also regards a device for positioning on a patient's chest during cardiopulmonary resuscitation, which measures compression and which comprises a feedback module for providing a tactile output related to the measurements. |
US08939921B2 |
Apparatus and method for detecting the hand force of the hand pressure
An apparatus for detecting hand force or hand pressure includes a longitudinally extending hollow body having an upper fixed end part, a lower fixed end part and a longitudinally extending spacer element that keeps the upper end part and the lower end part mutually spaced apart. The hollow body includes a flexible outer cover which connects the upper end part to the lower end part such that a closed inner space is formed within which the spacer element is also arranged. The outer cover is can be at least partly surrounded by a hand, and the inner space of the hollow body contains a gel, elastic multicomponent or liquid material which acts as a pressure transmitter. A pressure measuring apparatus extends at least partly in the inner space in the longitudinal direction to transmit the pressure from the outer cover via the pressure transmitter to the pressure measuring apparatus. |
US08939919B2 |
Enhanced therapeutic stimulus system and methods of use
The present invention relates to a therapeutic system and methods of using the therapeutic system. In particular, the present invention relates to systems having hardware, software, and appliance components for assessing and entraining a neuromuscular pattern or behavior in a patient. The methods include configuring the hardware and software systems to receive data from an orofacial stimulation appliance and to generate a precise therapeutic pulse profile that is actuated as a tactile stimulus. In one embodiment, the system and methods also include collecting data using the orofacial stimulation appliance and delivering the tactile stimulus via the orofacial stimulation appliance to entrain an organized neuromuscular pattern or behavior. |
US08939918B2 |
Calibration and measurement system
Embodiments of the present invention include a calibration and measurement system designed primarily for use in the rapid evaluation and characterization of open or visible wounds in patients. The invention in a preferred embodiment comprises a set of colored concentric rings, typically constructed of paper or synthetic paper. The practitioner removes only as many rings, from the center outward, until the entire wound is visible within the open aperture at the center of the remaining rings. The area dimensions of the wound are then read out from the size of the inner remaining ring. Photography optionally records the wound appearance and size. A related system is developed for linear dimensioning of wounds. This embodiment is also designed to standardize the color scheme for accurate photography wound description. The color scheme is also applicable to a linear device to accurately describe wound size. Embodiments of the invention are also useful in forensic and accident investigations. |
US08939917B2 |
Methods and devices for quantitative analysis of bone and cartilage
A method for measuring cartilage defects within a subject includes surgically exposing a joint or cartilage surface. The exposed joint or cartilage surface having at least one defect, and the method may generating a cast of the at least one defect. The method may also include measuring a parameter of the cast, thereby estimating a characteristic of the defect. |
US08939911B2 |
Ultrasonic probe and apparatus for obtaining ultrasonic image
The ultrasonic probe comprises an ultrasonic transducer section in which a plural of ultrasonic transducers arranged in a row in the scanning direction, an acoustic lens and a low attenuation medium, and further comprises a probe shell housing the ultrasonic transducer section, acoustic lens, and low attenuation medium. In the probe shell, the low attenuation medium is located at the top end (contact surface with a subject to be examined) of the ultrasonic probe, and the low attenuation medium, acoustic lens, and ultrasonic transducer section are located in order. In this way, the ultrasonic waves transmitted from the ultrasonic transducer section are converged by the acoustic lens and transmitted outside the probe shell through the low attenuation medium. The reflection waves from the subject to be examined are received by the ultrasonic transducer section through the low attenuation medium. |
US08939910B2 |
Method for enhancing ultrasound visibility of hyperechoic materials
A hydrogel marker is placed under stress during its curing stage, in one embodiment, by application of an externally applied force. The stress may also be induced during or after the dehydration process. The direction of the externally applied force increases the length, width, depth, or radial extent of the marker. The elastic limit of the marker is exceeded when the external force is applied so that the marker substantially retains its stressed size and shape when the externally applied force is removed. When the stretched or otherwise deformed dehydrated marker is hydrated, it substantially returns to the configuration it had prior to its dehydration and prior to the application of the externally applied force. |
US08939908B2 |
Ultrasonic blood vessel inspecting apparatus
An ultrasonic blood vessel inspecting apparatus provided with a longitudinal cross sectional blood vessel image generating portion configured to generate a longitudinal cross sectional image of a blood vessel located below a skin of a live body, on the basis of reflected wave signals of an ultrasonic wave by using an ultrasonic probe placed on the skin of said live body, includes: an index value calculating portion configured to calculate an index value indicative of a degree of clarity of an image which represents an intima-media complex of said blood vessel and which exists within said longitudinal cross sectional image of the blood vessel. |
US08939899B2 |
Endoscope bending portion and manufacturing method of bending tube
Each of the first hinge portions includes a first central planar portion, and first both-sides planar portion, and each of second hinge portions includes a second central planar portion, and second both-sides planar portion which is arranged on the same plane as the first both-sides planar portion. At least one of each first hinge portion and each second hinge portion includes/include an axial step portion which is provided between the first central planar portion and the first both-sides planar portion and/or between the second central planar portion and the second both-sides planar portion over the entire length of the nodal ring in the longitudinal direction and allows/allow the first central planar portion to be arranged to an outer peripheral side than the second central planar portion by a distance corresponding to a wall thickness of the nodal ring. |
US08939898B2 |
Rotary self-advancing endoscope system, program, and method for driving rotary self-advancing endoscope system
A rotary self-advancing endoscope system which produces propulsion by rotating, with a motor, a rotating cylindrical body provided on an outer periphery side of an insertion portion main body and causes the insertion portion main body to move forward into an examinee's body, wherein the system is configured to periodically repeating a combination of a state in which the rotating cylindrical body forward-rotates at a predetermined RPM and a state in which the rotating cylindrical body is stopped from rotating and releases accumulated elastic energy and, when a drive current to the motor has reached a predetermined threshold value, reverse-rotate the motor. |
US08939896B2 |
Attachment for endoscope and endoscope system
Provided is an attachment for an endoscope, the attachment being attached to a leading end part of the endoscope having a leading end surface on which an observation window for observing an inside of a subject's body and a first opening for jetting a constant-pressure supplied gas are formed, the attachment including: a second opening provided at a position separate from the leading end surface; a pipe conduit that communicates the first opening and the second opening with each other so as to jet the constant-pressure supplied gas from the second opening; and a region separating member that separates a jetting region of the constant-pressure supplied gas jetted from the second opening from a region of view of the observation window. |
US08939892B2 |
Endoscopic image processing device, method and program
Endoscopic images and virtual endoscopic images are obtained. Then, an endoscopic image captured at a predetermined position of the anatomical structure is extracted from the obtained endoscopic images, and a comparative virtual endoscopic image virtually generated as if it is captured at a position corresponding to the predetermined position is extracted from the obtained virtual endoscopic images, and the extracted images are associated with each other. A three-dimensional position corresponding to each pixel forming the endoscopic image captured at the predetermined position is calculated based on a three-dimensional position of each pixel forming the comparative virtual endoscopic image. Then, volume data is generated from the endoscopic image captured at the predetermined position based on a pixel value of each pixel forming the endoscopic image and the three-dimensional position calculated for each pixel. |
US08939890B2 |
Implantable penile prosthesis
An implantable penile prosthesis is attachable to a pump and a reservoir and includes a distal part formed by a rear tip that is connected to a proximal part formed by a cylinder. The cylinder is oriented on a first longitudinal axis, and a distal portion of the rear tip forms a fluid chamber communicating with the cylinder. A tubing junction is integrally formed with the distal portion and communicates with the fluid chamber in the rear tip. A strain relief portion has a bore disposed on a second longitudinal axis, where the second longitudinal axis forms an acute angle relative to the first longitudinal axis, and the acute angle has a measurement that does not exceed 5 degrees. An exterior surface of the rear tip, between the tubing junction and the cylinder, provides the distal portion of the rear tip with a constant outer diameter. |
US08939888B2 |
Method and system for determining the pressure of a fluid in a syringe, an access port, a catheter, and a gastric band
A method and system for determining pressure in a syringe, and more specifically to a syringe pressure accessory which can be connected to a syringe to determine pressure in a syringe and a gastric band. The syringe pressure accessory can detect a pressure of a syringe and/or a gastric band and digitally display the pressure. The syringe pressure accessory can include a durable unit and a disposable unit. The disposable unit can be disposed of after a single use, while the durable unit can be reused with multiple disposable units. The syringe pressure accessory can also include a syringe attachment unit and one or more display units for a caretaker or a patient. The display unit can be wirelessly connected to the syringe attachment unit to display a pressure chart or the results of various analysis of the pressure data. Markers can be added to the pressure chart. |
US08939887B2 |
Composition for separating spermatozoa from a semen sample
Compositions and methods useful for processing animal semen for use in assisted reproduction. A composition, or colloid formulation, for separation of spermatozoa from a semen sample, the composition including at least one salt of an alkali metal and/or an alkaline earth metal, EDTA, a zwitterion buffer, silane-coated silica particles and water, the composition having a pH of 7.0-7.35 and an osmolarity of 300-345 mOsm. A method for preparing spermatozoa from a semen sample from a non-human animal by separating the spermatozoa from other semen constituents by centrifugation through a single layer of the composition, or colloid formulation. Also, a method for separating a sperm sub-population of interest from a semen sample from a non-human animal by providing a density gradient comprising at least two layers of the composition of the invention, each layer having a different density; separating the sperm sub-populations in the semen sample by centrifugation through the density gradient; and selecting the sperm sub-population of interest. Finally, spermatozoa prepared by these methods and the use of such spermatozoa in artificial insemination, in vitro fertilisation or intracytoplasmic sperm injection. |
US08939884B2 |
Sleep aid device and method, program and recording medium
Disclosed herein is a sleep aid device including: an electrode arranged on the surface of a pillow in such a manner as to come into contact with the scalp of a user; a brain wave signal acquisition section adapted to acquire a brain wave signal of the user via the electrode; an analysis section adapted to analyze the acquired brain wave signal; and a control section adapted to control the execution of a preset process according to the sleep stage representing the depth of sleep of the user identified by the analysis result. |
US08939882B2 |
Multi-lumen cannula
This document relates to methods and materials for providing blood flow for a blood pump recipient. For example, cannulae that can be connected to the circulatory system of a mammal and can be used in conjunction with a blood pump (e.g., an assist device) are provided. |
US08939874B2 |
Physical work-out device with adjustable elastic bands
A physical work-out apparatus comprised of a mechanism for shortening elastic bands, and one or more elastic bands that are integrated into the mechanism in such a way that enables a user to shorten or lengthen the elastic bands. The apparatus can be integrated and attached to a harness worn on the user's back and chest. The mechanism enables the user to shorten or lengthen, according to need, the elastic band or bands. |
US08939873B2 |
Disc holder dock
A disc holder dock includes a top cover having an opening for a driving wheel. The top cover has a cradle area for docking a gyroscopic wrist exerciser. The top cover further has a guide vane for directional guiding of the gyroscopic wrist exerciser. The top cover has a top cover sidewall. A middle frame mounted to the top cover. The driving wheel is mounted to the middle frame. The driving wheel is connected to the middle frame by a support. A lower plate is for holding a disc. The lower plate has a lower plate upper side and a lower plate lower side. The lower plate further includes a disk storage area. |
US08939871B2 |
Acceleration mechanism for exercise equipment
A rotary disk acceleration mechanism for exercise equipment includes a stationary axle; a first large rotary disk; at least one acceleration disk assembly; a first belt, which is coupled between the acceleration disk assembly and the first large rotary disk; a first bearing, which is mounted to the stationary axle; a second small rotary disk, which is rotatably mounted by the first bearing to the stationary axle and is coaxial with the first large rotary disk; and a second belt, which is coupled between the acceleration disk assembly and the second small rotary disk, so that the acceleration disk assembly drives, via the second belt, the second small rotary disk to rotate. |
US08939867B2 |
Automatic manual transmission for a hybrid car provided with an internal combustion engine and with an electrical machine
Examples include an automatic manual transmission for a hybrid car provided with an internal combustion engine and an electrical machine, the automatic manual transmission presents. Examples include a mechanical gearbox, a differential gear which receives the motion from a secondary shaft of the gearbox and transmits the motion to driving wheels, a clutch which is interposed between the secondary shaft of the gearbox and the differential gear, an auxiliary shaft along which the electrical machine is mounted, a first gear train which connects a first end of the auxiliary shaft arranged upstream of the electrical machine to a primary shaft of the gearbox, and a second gear train which connects a second end of the auxiliary shaft arranged downstream of the electrical machine to an output shaft of the clutch. |
US08939861B2 |
Transaxle
A transaxle comprises a transmission differential unit including a frictional transmission mechanism and a differential mechanism. The frictional transmission mechanism includes an input shaft, a drive disc provided on the input shaft, and a driven disc whose outer peripheral edge frictionally contacts a disc surface of the drive disc. The differential mechanism includes a pair of coaxial output shafts, and a differential casing differentially connecting the output shafts to each other. The driven disc is ring-shaped and is fitted at an inner peripheral portion thereof on an outer peripheral portion of the differential casing so as to be unrotatable relative to the differential casing and so as to be slidable on the outer peripheral portion of the differential casing in the axial direction of the output shafts. |
US08939860B2 |
Hydrodynamic coupling device, in particular a torque converter
A hydrodynamic coupling arrangement, particularly torque converter, comprises a housing arrangement (12) which is filled or fillable with fluid, an impeller (20), a turbine (28), a lockup clutch (54), a torsional vibration damping arrangement (42) with an input region (52) and an output region (82), wherein a first torque transmission path (46) and parallel thereto a second torque transmission path (48) and a coupling arrangement (50) for superposing the torques transmitted via the torque transmission paths (46,48) are provided between the input region (52) and the output region (82), wherein the torsional vibration damping arrangement (42) further includes at least in the first torque transmission path (46) a phase shifter arrangement (56) for generating a phase shift of rotational irregularities transmitted via the first torque transmission path (46) relative to rotational irregularities transmitted via the second torque transmission path. |
US08939853B1 |
Article of manufacture for the training of athletes in the skills, shooting, dribbling and throwing of ball sports
An article of manufacture for the training of athletes in the skills, shooting, dribbling and throwing of ball sports with an elastic material in the form of a pull-up sleeve, a sleeve that is pulled up and worn above and below the elbow with the restraining tubes on the top and bottom of the inside of the elbow joint, a sleeve that has 2 (two) flexible, semi-rigid restraining tubes above and below the elbow, the restraining mechanism will only allow the elbow joint to close to 90 degrees, a sleeve that remains in place during extensive use with the sleeve construction of and in elastic or stretchable material and foams, and the sleeve can be turned to the back of the elbow to protect the elbow joint. |
US08939850B2 |
Multi-layer core golf ball
Golf balls comprising a multi-layer core and a single-, dual-, or multi-layer cover are disclosed. The multi-layer core comprises a thermoplastic center and a thermoplastic outer core layer that are both soft relative to a hard, thermoset intermediate core layer. |
US08939846B2 |
Self-contained, resettable bowling pin release
A bowling pin release mechanism, which is used to release bowling pins onto the lane for the first ball, which is pin cell independent. As such, aside from the vertical, reciprocating motion of the frame structure on which it is mounted, does not require additional mechanical or electromechanical mechanisms or components for pin release and reset operations. The resettable pin support and release mechanisms are contained within the pin cell. |
US08939845B2 |
Tube yoke for a driveshaft assembly
A tube yoke for a driveshaft assembly includes a tube seat and a pair of lugs. The lugs outwardly project from the tube seat. The tube seat comprises a base, a wall, and a plurality of stiffening ribs. The stiffening ribs extend between an inner surface of the base and an end surface of the wall. A portion of the stiffening ribs between the inner surface of the base and the end surface of the wall gradually decreases in thickness. A method of reducing the radial deformation of the tube yoke of a driveshaft assembly is also provided. |
US08939844B2 |
Shell-type needle bearing and cross-type universal joint
Cross-type universal joint and a shell-type needle bearing that is used therein. The portions on the outer surface of the shell-type outer ring for which there is a possibility of coming in sliding contact with the tip end edges of at least two seal lips of a plurality of seal lips of a seal ring are selectively covered with a corrosion resistant coating. Preferably, the entire outer surface of the shell-type outer ring is covered by a chemically treated film having anti-corrosion properties. |
US08939843B2 |
Limiting torque clutch in an input damper
The present disclosure provides an input damper for coupling to a torque-generating mechanism. The damper includes an outer cover, a hub, and a carrier assembly coupled to the hub. The carrier assembly is movably disposed within the cover. A clutch assembly moves between an engaged position and a disengaged position and is biased towards the engaged position. The input damper further includes an angular displacement mechanism operably coupled to the clutch assembly for moving the clutch assembly between the engaged position and disengaged position. The outer cover is coupled to the carrier assembly in the engaged position. |
US08939839B2 |
Interactive vehicle gaming system and method
A computer implemented interactive vehicle gaming system and method includes a first interactive game device connected to a second interactive game device for communication therebetween. At least one game parameter is determined for the first and second game devices associated with driving behavior for at least one vehicle. User input is received on the first game device to initiate a virtual shot against the second game device. After receiving the user input, a shot game result is determined for the virtual shot based on the at least one game parameter. Then, at least one indication of the shot result is provided for at least one of first and second game devices. |
US08939837B2 |
Apparatus and method for managing user inputs in video games
A system that incorporates teachings of the present disclosure may include, for example, a computing device having a controller to obtain a user input that was inputted into a first accessory operably coupled with the computing device where the first accessory provides a user interface for user interaction with a video game, determine a language of an intended recipient of the user input based on an identity of the intended recipient, access a multi-lingual library comprising a plurality of words associated with the video game, match the user input to one or more words of the plurality of words of the multi-lingual library to generate a translated message in the determined language of the intended recipient, and provide the translated message to a second accessory for presentation to the intended recipient in real-time. Additional embodiments are disclosed. |
US08939832B2 |
Electronic gaming device with explosive scatters
Examples disclosed herein relate to systems and methods, which allow a player, the gaming device, and/or the gaming system to utilize exploding scatters. The electronic gaming device and/or method may utilize a plurality of reels. The plurality of reels may include one or more areas. The electronic gaming device and/or method may utilize a memory and a processor. The processor may generate one or more symbols to be located in the one or more areas. The one or more symbols may include a first expanding scatter symbol and a first dormant scatter symbol. The processor may modify the first dormant scatter symbol into an award value based on a first interaction determination. |
US08939829B2 |
Combine linear side-shake cleaning control system
A combine side-shaking control system includes a sieve for separating crop material from other materials and configured to move in a fore-aft direction. At least one side-shaking assembly includes a mounting device attached to a combine chassis, a lower plate configured to rotate about a lower plate axis and an upper plate configured to (i) have an upper plate rotational motion and rotate responsive to the rotation of the lower plate and (ii) have an upper plate substantially linear motion in a substantially linear direction. A fixed arm is rotatably coupled to the upper plate and attached to the sieve. An actuation device is configured to rotate the lower plate about the lower plate axis. Responsive to the rotation of the upper plate, the sieve is controlled to move diagonal to the fore-aft direction in the substantially linear direction of the upper plate substantially linear motion. |
US08939828B2 |
Biomass conveying and distributing system for a harvester
A biomass conveying and distributing system for separating and distributing lighter biomass residue from heavier or denser biomass, utilizing available air flow from the cleaning system of the harvester. The harvester will discharge a flow of heavier or denser biomass with an airborne flow of lighter biomass residue. The system includes a conveyor for receiving and conveying the heavier or denser biomass, and residue distributing apparatus disposed above the conveyor in a path of at least a portion of the airborne flow of lighter residue, including at least one deflector configured and operable for redirecting the airborne flow sidewardly away from the conveyor, above a passage through which the conveyor passes carrying the heavier biomass away from the harvester. |
US08939820B2 |
Paw cutter system and method
A paw cutting system for removing a poultry paw from a shackle conveyed along a shackle conveyor line and then cutting the leg of the paw to remove the knuckle is provided. The paw cutter has a guide bar substantially aligned with the shackle conveyor line that urges the paw to a central cavity of the shackle. The paw is discharged from the central cavity into a lateral notch formed in two opposed discs positioned adjacent to an end of the guide bar. The two opposed discs are rotatable and move the paw from the guide bar to a blade. As the paw is moved to the blade, the two discs stretch the paw so that the blade can cleanly cut the paw. The cut paw product can be placed onto a belt or other device in an ordered manner. |
US08939818B2 |
Polishing pad
An object of the invention is to provide a polishing pad which has a polishing layer with a phase-separated structure and can provide high polishing rate and high planarization property and with which scratching can be suppressed. The polishing pad comprises the polishing layer. The polishing layer comprises a product of curing reaction of a polyurethane-forming raw material composition containing: (A) an isocyanate-terminated prepolymer obtained by reaction of a prepolymer-forming raw material composition (a) containing an isocyanate component and a polyester-based polyol; (B) an isocyanate-terminated prepolymer obtained by reaction of a prepolymer-forming raw material composition (b) containing an isocyanate component and a polyether-based polyol; and a chain extender, wherein the product of curing reaction has a phase-separated structure. |
US08939813B2 |
Toys implementing inductively coupled power transfer systems
Electronic toys have now been around for years and are powered through mechanisms that require a toy to be tethered to a cable or utilize conventional batteries. Such toys are inconvenient because they consume a user's time to re-charge them, which in turn also limits the utility of these toys. Embodiments of this invention implement toys using an inductively coupled power transfer system, which is a wireless mechanism that is convenient to use and provides a faster way for the user to re-charge the toy. Some embodiments include an electronic device comprising an inductive charging plate, and a toy comprising an internal charge pad, a storage capacitor set to a predetermined voltage level, and a discharging device that discharges a function to implement the toy. |
US08939812B2 |
Two-sided toy vehicle
A slim, two-sided remote controlled toy vehicle with high speed, high maneuverability and high shock and crash resistance. A remote control scheme based on digital signals embedded in infrared beams allows improved control and high-speed terrestrial and aerial stunt capabilities. The toy intelligently implements infrared communication, on board micro-control units, flip sensors, sounds, lights and other pre-programmed actions. Various stunt accessories are also provided, to increase the play value of the toy. |
US08939811B2 |
Optical toy
An optical toy is disclosed. The optical toy includes a frame, at least one emitting part, at least one receiving part, a plurality of light guiding parts, and at least one power source. The frame includes a container and at least one containing structure. The emitting part is movably located on the containing structure. The emitting part includes at least one light source for emitting light. The receiving part is movably located on the containing structure. The receiving part includes a light sensor for sensing the light. The plurality of light guiding parts is located in the container for changing the direction of the light. The relative positions of the plurality of light guiding parts can be changed. The power source is located in the frame for providing power to the optical toy. |
US08939809B2 |
Organic light emitting device and method for manufacturing the same
A top emission OLED includes a driving TFT including a channel region and source and drain electrodes. A power supply, a ground line, and a light emitting diode are electrically coupled to the TFT and an auxiliary electrode is electrically coupled to the ground line and to the source electrode of the driver transistor. The auxiliary electrode resides between the light emitting diode and the channel region of the driver transistor and is configured to shield the channel region of the driver transistor from an electric field generated by the light emitting diode. |
US08939805B2 |
Air-propelled watercraft having an inflatable hull
A watercraft has a fan propeller, a motor coupled to the fan propeller, an inflatable hull including a first inflatable member and a second inflatable member, and a platform, which is positioned between the first and second inflatable members and coupled to a base of the fan propeller. The motor powers the fan propeller and thereby propels the inflatable hull in a forward direction. The watercraft is suitable for use in varying water environments including white water, open sea water, ice, snow, and shallow water. |
US08939800B2 |
Connection terminal
A connection terminal includes a bushar, wherein at least one insertion opening for accommodating a bridging device is formed on the bushar, wherein the insertion opening is designed in the form of a material passage having a hole collar, wherein the hole collar of the material passage encircles the insertion opening. The hole collar extends away from the surface of the bushar in the opposite direction to the insertion direction of the bridging device. |
US08939799B2 |
Connector
A connector includes a first connector housing having connecting protrusions and a second connector housing having lock pieces. The first connector housing and the second connector housing are locked in a fitted state by the engagement of the connecting protrusions and the lock pieces. When free ends of the lever members are displaced inwards in a widthwise direction of the second connector housing, the distal ends of the lock pieces are displaced outwards in the widthwise direction so that the connecting protrusions and the lock pieces are disengaged. The unlock member includes a pair of unlock parts which make the free ends of the lever members to be displaced inward in the widthwise direction by being moved in a second direction perpendicular to a first direction in which the lever members extend. |
US08939797B2 |
Connection system for establishing electrical connection between electrical device for automotive industry and at least one pair of cables
A connection system establishes an electrical connection between an electrical device and at least one pair of cables each of which ends with a cable terminal. The connection system comprises a fixed part including a support base adapted to be rigidly fitted to a wall of the electrical device and, for each cable, a connection screw protruding from the support base and electrically connectable to the electrical device. A mobile part includes a perimeter frame adapted to be mechanically fitted to the support base and having a passage wall defining, for each cable, a passage-through hole through which an end part of the cable passes so that the corresponding cable terminal is disposed inside the perimeter frame and aligned with the respective connection screw when the perimeter frame is mechanically fitted to the support base. |
US08939796B2 |
Surge protector components having a plurality of spark gap members between a central conductor and an outer housing
A coaxial connector includes a surge protection component including a plurality of elongated members, a body portion that is configured to receive the surge protection component such that the elongated members extend along an outer surface thereof, and a center conductor disposed inside the body portion and spaced apart from the surge protection component so as to create a gap therebetween. |
US08939788B2 |
Cable connector
A cable connector for receiving a cable and a connector block. The cable connector including a first shell element with a first strain relief holding feature, a first connector block receiving feature, and a recess; a second shell element with a second strain relief holding feature, a second connector block receiving feature, and a projection; and a strain relief element defining a cable aperture sized to receive the cable, a compression collar, and a wing portion. The projection is received within the recess. The first and second strain relief holding features cooperate to support and maintain the strain relief element. The first and second connector block receiving features cooperate to support and maintain the connector block. The wing portion of the strain relief element is arranged to increase a holding ability of the strain relief element when a twisting or axial force is applied to the cable. |
US08939786B2 |
Plug connector which can be cleaned easily
A plug connector having a plug body for holding the plug side of a socket body and having a resilient cage arranged on the plug body with resilient tongues which are axially slotted on the plug side, clasp the circumference of the socket body when it is mated with the plug body, and can be compressed radially by a locking sleeve which can be moved on the resilient cage. According to the invention, the resilient cage is itself arranged movably on the plug body and can be pushed back so far in the cable-side direction to a cleaning position that the plug-side end of the plug body is freely accessible. |
US08939780B2 |
Connector structure and electronic device having the same
In a connector structure, a moving element is pushed by a connector to move horizontally with respect to a first housing, while a linking element is moved accordingly by the moving element vertically with respect to the first housing. With such structural relation, the connector structure may be substantially reduced in its thickness before connection with the connector, saving room for the thickness of an electronic device where the connector structure is disposed. As the connector is inserted to the connector structure, the sinked linking element provides necessary structural support for withholding the connector, securing the contact between the connector and a connecting jack of the connector structure, and preventing the connector from detaching from the connector structure. |
US08939773B2 |
Connectors providing haptic feedback
A first connector may include a housing defining a first connector face to be positioned in a first position or a second position proximate to a second connector face of a second connector. A first extremely high frequency (EHF) communication unit may be disposed in the housing for communicating with a second EHF communication unit of the second connector when the first connector face is positioned in first or second position relative to the second connector face. A first magnet may be disposed in the housing. The first magnet may align with and repel a second magnet disposed relative to the second connector face when the first connector face is positioned in the second position. The first magnet may be configured not to align with and not to repel the second magnet when first connector face is positioned in the first position relative to the second connector face. |
US08939769B2 |
Multi-sensory manipulation
Aspects of the present invention relate to a multi-sensory manipulation system. The multi-sensory manipulation system is useable to train one or more senses through the manipulation of one or more sensory inputs as perceived by a user. The multi-sensory system may be used train a variety of senses, such as vision, hearing, olfactory, taste, touch, and the like. Consequently, the multi-sensory system may be comprised of a first sensory vitiation device that vitiates a sensory input for the first sense. The multi-sensory system may be comprised of a first sensory vitiation driver that generates vitiations instructions useable by the first sensory vitiation device. The multi-sensory system may also be comprised of a controller to coordinate one or more sensory drivers and/or one or more sensory vitiation devices to allow for the training of one or more senses through the manipulation of multiple sensory inputs. |
US08939766B2 |
Dental tools for photo-curing of dental fillings
A dental tool for use in photo-cured filling processes. The dental tool includes a tool tip formed from a material that allows the transmission of ultraviolet and visible light wavelengths through the tool tip without significant distortion or reflection. The material is also relatively high strength so not to shatter or break during use. The fill material will also not easily adhere to the tool. The material of a preferred embodiment is sapphire. The tool is able to continue to compact and shape the fill material while the composite polymer fill material is undergoing photo-curing. The light beam used for photo-curing is able to safely pass through the tool without the risk of damage to the surrounding tissue from reflection or distortion of the light beam. |
US08939763B2 |
Dental impression tray with absorbent barriers
A dental impression apparatus for obtaining a patient's dental impression is provided. The dental impression apparatus includes a support frame of a predefined shape, a partially permeable membrane mounted on the support frame, and absorbent barrier members. The support frame includes a distal member, a buccal edge member, and a lingual edge member. The absorbent barrier members mounted to the buccal edge member and the lingual edge member of the support frame define opposing troughs separated by the partially permeable membrane. The opposing troughs receive the patient's mandibular teeth and maxillary teeth. The opposing troughs are deposited with a first impression material and/or a second impression material for obtaining the dental impression of the patient. The absorbent barrier members confine a flow of the first impression material and the second impression material within the opposing troughs, when the patient applies a biting force within the opposing troughs. |
US08939760B2 |
Spike anneal residence time reduction in rapid thermal processing chambers
The present invention generally relates to methods of cooling a substrate during rapid thermal processing. The methods generally include positioning a substrate in a chamber and applying heat to the substrate. After the temperature of the substrate is increased to a desired temperature, the substrate is rapidly cooled. Rapid cooling of the substrate is facilitated by increasing a flow rate of a gas through the chamber. Rapid cooling of the substrate is further facilitated by positioning the substrate in close proximity to a cooling plate. The cooling plate removes heat from substrate via conduction facilitated by gas located therebetween. The distance between the cooling plate and the substrate can be adjusted to create a turbulent gas flow therebetween, which further facilitates removal of heat from the substrate. After the substrate is sufficiently cooled, the substrate is removed from the chamber. |
US08939758B2 |
Candles comprising wax-monoesters
Candle compositions are disclosed which include a high concentration of liquid oils, yet are solid due the incorporation of wax-monoesters; thereby enhancing the scope, quality and functionality of candles. The wax-monoesters may be obtained from natural plant based waxes, including rice bran wax. Candles based on the candle compositions and methods of making the compositions are also disclosed. |
US08939757B2 |
Liquid resin molding system
A liquid resin molding system has a stationary platen and a movable platen mounted for undergoing movement relative to the stationary platen. A mold has at least one cavity and includes a first mold member attached to the movable platen and a second mold member attached to the stationary platen. An injection nozzle is attached to the movable platen and is configured to receive a liquid resin and to inject the liquid resin into the mold cavity. A nozzle touch mechanism is attached to the movable platen for pressing the injection nozzle against the mold. |
US08939755B2 |
Method and device for the production of polyamide
The invention relates to a device for the implementation of a method for the production of pellets of polyamide 6 or copolyamides. The method can include production of a melt of polyamide 6 or copolyamides by means of polymerization, production of pellets from the melt by means of underwater pelletization into a process fluid, removal of the pellets from a site of underwater pelletization in the process fluid, supply of the pellets in the process fluid to an extraction stage, extraction of low-molecular components as extract, and drying of the pellets after extraction, wherein the underwater pelletization stage and the extraction stage take place using the same process fluid. |
US08939746B2 |
Quick-change system and operating method for a container processing machine
In a quick-change system for exchangeable machine elements, particularly in a container processing machine in which the machine element (E) can be brought into a target position and can be localized in a target position by a securing unit comprising at least one securing element, at least a second securing unit (P2) is provided with which a machine element that either has not been brought into the target position or that has moved out of the target position (X) can be localized in a securing position. The securing position is detected and evaluated as grounds for a corrective action before commencing an operation or during the operating sequence before a corrective action is initiated and executed. |
US08939744B2 |
Underwater pelletizer
An Underwater pelletizer for cutting extruded plastic into a flow of liquid. The pelletizer includes a cutter hub (90) carrying at least one cutter blade (96), a cutter shaft (60) for rotationally driving the cutter hub, and a flexible torque converter (80) for connecting a motor to the cutter hub. In one embodiment, the torque converter has a first set of bushings (82) that is fastened to a face (98) of the cutter hub and a second set of bushings that is fastened to a face (64) of the cutter shaft. A shaft extension (20) can be configured to engage a motor shaft, the shaft extension having an Outer diameter having formed thereon a splined portion (38) and first (26) and second (28) sealing surfaces. A motor adapter (40) has a seal surface (44). A water chamber plate (50) may also have a seal surface (52). |
US08939743B2 |
Device for supplying a fluid for explosion forming
With the invention, a device for fluid feed for explosive forming, which has a valve and an activating mechanism to activate the valve, is to be improved, so that the device permits both good filling of a die with fluid and good sealing during the explosive forming process in a technically simple design. This task is solved by a device for fluid feed for explosive forming that has a valve and an activating mechanism to activate the valve, in which the activating mechanism is arranged separate from the valve in an inactivated valve state. |
US08939740B2 |
Tube positioner
A tube-positioning system for loading tubing into a peristaltic pump includes a shell configured to slidably fit onto, and be releasably secured relative to, an exterior housing of a peristaltic pump. A pair of guides protrude from an upper portion of opposite side walls of the shell with each guide configured to releasably mount a first tube segment to extend between the guides. |
US08939737B2 |
Infusion device with a grooved piston channel wall
An apparatus for delivering a fluid includes a housing, an inlet in the housing for receiving the fluid, and an outlet in the housing for discharging the fluid. A piston channel is provided within the housing through which the fluid flows from the inlet to the outlet. An actuator is positioned within the housing and is moveable between a retracted position and a forward position, the actuator defining a piston chamber for storing fluid received through the inlet when the actuator is in the retracted position and for driving the fluid stored in the piston chamber toward the outlet when the actuator transitions from the retracted position to the forward position. The actuator includes an armature and a piston coupled to the armature and moveable within the piston channel. The piston channel wall is provided with a groove for conducting fluid from the inlet to the outlet. |
US08939732B2 |
Multi-stage compressor
Provided is a multi-stage compressor which includes: a first-stage compressing unit which includes a first compressing element with an impeller and a second compressing element with an impeller, the first and second compressing elements being connected to each other; and a rear-stage compressing unit which includes at least one rear compressing element with an impeller, wherein the rear-stage compressing unit receives a fluid compressed and output from the first-stage compressing unit. |
US08939728B2 |
Hybrid part made from monolithic ceramic skin and CMC core
A hybrid part for use in a gas turbine engine has a platform and an attachment feature. The platform and an exterior portion of the attachment feature are formed from a monolithic ceramic material. A ceramic matrix composite material is located adjacent interior portions of the platform and the attachment feature and is bonded to the monolithic ceramic material. |
US08939719B2 |
Centrifugal pump with outlet flow passage of increasing cross-section
A centrifugal pump includes a motor having an output shaft, a volute mounted at one side of the motor and an impeller which is located inside the volute and attached to the output shaft. The volute has an inlet arranged along the axial direction, an oulet arranged along the lateral direction and a flow channel arranged along the circumferential direction. The flow channel has a spiral shape. The cross-sectional area of the flow channel increases towards the outlet. |
US08939718B2 |
Turbocharger having an insertion plate
A turbocharger has a rotor housing. Said rotor housing has an insertion element. Said insertion element is configured such that the same forms an over-hanging spiral together with said rotor housing. |
US08939716B1 |
Turbine abradable layer with nested loop groove pattern
Turbine and compressor casing abradable component embodiments for turbine engines, with nested loop pattern abradable surface ridges and grooves. The nested loops comprise nested fully closed loops or a spiraling maze pattern loop. Some embodiments include distinct forward upstream and aft downstream composite multi orientation groove and vertically projecting ridges planform patterns, to reduce, redirect and/or block blade tip airflow leakage downstream into the grooves rather than from turbine blade airfoil high to low pressure sides. Ridge or rib embodiments have first lower and second upper wear zones. The lower zone optimizes engine airflow characteristics while the upper zone is optimized to minimize blade tip gap and wear by being more easily abradable than the lower zone. |
US08939712B2 |
External segmented shell capable of correcting for rotor misalignment in relation to the stator
The invention relates to a housing for covering the ends of a row of rotor blades of an axial turbomachine compressor, the housing being provided with a sealing device between the blade tips and the housing. It comprises a shell segmented along its circumference, each segment being fixed to the housing by a series of elastomeric elements in a recess in the shape of a channel cut into the inner surface of the housing. In this way, in the event of misalignment of the rotor relative to the stator, the rotor blades coming into contact with sections of the shell will be able to move to compensate for this misalignment while reducing the frictional forces generated by contact between the blades and the shell. In the event of alignment being re-established the segments of the shell will be able to resume their initial position because of the elastic behavior of the elements. |
US08939711B2 |
Outer rim seal assembly in a turbine engine
A seal assembly between a hot gas path and a disc cavity in a turbine engine includes a non-rotatable vane assembly including a row of vanes and an inner shroud, a rotatable blade assembly adjacent to the vane assembly and including a row of blades and a turbine disc that forms a part of a turbine rotor, and an annular wing member located radially between the hot gas path and the disc cavity. The wing member extends generally axially from the blade assembly toward the vane assembly and includes a plurality of circumferentially spaced apart flow passages extending therethrough from a radially inner surface thereof to a radially outer surface thereof. The flow passages effect a pumping of cooling fluid from the disc cavity toward the hot gas path during operation of the engine. |
US08939709B2 |
Clearance control for a turbine
A system for operating a turbine includes a rotating component and a non-rotating component separated from the rotating component by a clearance. A first actuator is connected to the non-rotating component, and the first actuator comprises a shape-memory alloy. A method for operating a turbine includes sensing a parameter reflective of a clearance between a non-rotating component and a rotating component and generating a parameter signal reflective of the clearance. The method further includes generating a control signal to at least one actuator based on the parameter signal and moving at least a portion of the non-rotating component relative to the rotating component to change the clearance. |
US08939705B1 |
Turbine abradable layer with progressive wear zone multi depth grooves
Turbine and compressor casing abradable component embodiments for turbine engines, with composite grooves and vertically projecting rows of first ridges in planform patterns, to reduce, redirect and/or block blade tip airflow leakage downstream into the grooves rather than from turbine blade airfoil high to low pressure sides. The abradable component embodiments have a multi-depth grooves formed in the abradable substrate surface between pairs of elongated continuous tip surface first ridges. These ridge and multi-depth groove embodiments have first lower and second upper wear zones. The lower zone, in the deeper grooves, optimizes engine airflow characteristics, while the upper zone, in the shallower grooves, is optimized to minimize blade tip gap and wear by being more easily abradable than the lower zone. |
US08939702B2 |
Sub-sea apparatus and operating method
Apparatus and method for handling a fluid-tight flange coupling between a first and a second conduit component while maintaining the fluid integrity of the coupling. The apparatus includes a gripping mechanism configured to straddle the flange coupling and grip both of the first and second conduit components. The gripping mechanism is mounted on a lifting frame able to bear the loadings upon the gripped components during a moving operation. The apparatus includes a base frame with a gripping mechanism to receive the flange coupling. The coupled components are gripped on each side of the flange coupling to maintain the fluid integrity of the flange coupling. |
US08939701B2 |
Fork with rollers
Machines are often used to collect and transport materials in a work environment. One of the more common methods of collecting and transporting materials is with a fork. The tines of a conventional fork may damage the materials being collected by the machine. Tines are also difficult to attach other work implements to. The disclosed apparatus facilitates collecting material with less resultant damage to the material. The disclosed apparatus also simplifies the connection of other work implements to the machine, in particular, a bucket, by not requiring that the fork first be removed from the machine to attach the bucket. The tine has a base member with a distal end; a roller rotatably coupled to the base member proximate to the distal end; and a part of the roller is elevated above the base member. |
US08939698B2 |
Ceiling traveling vehicle and method for preventing protrusion from ceiling traveling vehicle
A moving unit, an elevation device, or the like is prevented from laterally projecting from an overhead travelling vehicle and interfering with a stationary device or an overhead travelling vehicle in the neighborhood thereof. Projection from an overhead travelling vehicle is prevented, the vehicle including a travelling unit, an elevation device lifting and lowering articles, and a lateral movement mechanism including a base member supported by the travelling unit and a moving unit laterally moving while supporting the elevation device. The moving unit is moved between a state in which it laterally protrudes from the travelling unit and a state in which it is retracted to a position under the travelling unit. The moving unit or the elevation device is engaged with the base member or the travelling unit in the state in which the moving unit is retracted to the position under the travelling unit. |
US08939697B2 |
Selective orientation and ballast for a transportable container
A transportable container apparatus includes an elongated container with an outlet port, and a trailer releasably attachable to the container at first and second trailer attachment locations corresponding to first and second orientations of the outlet port with respect to the trailer. An actuator mounted to the trailer is operative, when the trailer is attached to the container, to selectively move the container between a transport position where the container is supported on the trailer in a substantially horizontal orientation, and a working position where the container is supported on the ground in a substantially vertical orientation. The trailer can be attached to an appropriate location to position the outlet port in a desired orientation at a work site. Ballast weight can be added to the lower portion of the container to increase stability, and the ballasted tank with a maximum allowable weight can be transported to a work site. |
US08939696B2 |
Automatic carrier transfer for transferring a substrate carrier in a semiconductor manufacturing post-process and method of transferring the substrate carrier using the same
A carrier transfer for automatically transferring a substrate carrier includes a gripper detachably coupled to the substrate carrier, the substrate carrier including a plurality of substrates and at least one open gate through which the plurality of substrates are loaded into or unloaded from the substrate carrier. The gripper includes a gate blocking unit secured to the gripper and configured to shift to a blocking position, the blocking position being a position of the gate blocking unit that partially blocks the gate to prevent the plurality of substrates from being separated from the substrate carrier during the automatic transferring of the substrate carrier. |
US08939692B2 |
Thread-forming screw and use thereof
A screw having a polygonal cross section exhibits a threaded section and a forming section adjoining the threaded section and extending as far as a front rounded end of the screw and, if necessary, being free of threads. The lateral line of the forming section, if necessary free of threads, runs smoothly and without interruption from the threaded section as far as the tip at a constant curvature. The screw serves for the attachment of an element to a sheet metal component, whereby said screw engages in an existing hole in the sheet metal component and forms the thread itself. Said screw is thereby also capable of enlarging the hole and forming a raised rim hole. |
US08939683B1 |
Inverse square tool form
A rotary cutting tool for forming a heat plate has a plurality of cutting blades arranged about a cutting tool body. The cutting edge profile of the rotary cutting tool has a lower radius portion and a middle convex portion. The lower radius portion has its center on the axis of the rotary cutting tool and the middle convex portion is defined by an inverse square curve of form Y=1/X2 with the vertical axis of the origin of the inverse square curve offset from the axis of the rotary cutting tool. X has values between 0.25 units and 4 units. |
US08939679B2 |
Mobile pipe lining apparatus
The present invention relates to a mobile pipe lining apparatus for installing strip lining material into a host pipe. The apparatus comprises a lining machine for receiving a feed of strip lining material and placing it in a host pipe to form a new pipe lining, a carriage attached to the lining machine such that the full weight of the lining machine is borne by the carriage, and adjusting means for adjusting a position of the lining machine relative to the carriage. |
US08939675B2 |
Barrier systems with interlocking flag
A barrier assembly includes a barrier having a chamber adapted to hold a ballast, an inlet being formed on the barrier in communication with the chamber. A flag assembly includes a post having a first end and an opposing second end with a flag disposed on the first end. A retainer is disposed on the post and includes a catch radially outwardly projecting from the post, the catch being movable between an outwardly extended position and an inwardly retracted position, the catch resiliently urging toward the extended position when in the retracted position, the first end of the post being received within the inlet on the barrier so that the catch is disposed within the chamber in the extended position, the catch being configured so that the first end of the post cannot be pulled out through the inlet without moving the catch to the retracted position. |
US08939673B2 |
Shelf carrier and shelf arrangement
A shelf carrier having an insertion pot with a T-shaped suspension opening on a side wall, the suspension opening being formed by a longitudinal slit extending parallel to the pot axis and by a transverse slit extending perpendicularly thereto. The longitudinal slit is open at an end facing away from the transverse slit. A slider is supported in the insertion pot so as to be displaceable transversely to the longitudinal slit. A longitudinal slit is formed on the slider, which extends parallel to the longitudinal slit of the insertion pot and is open at an end facing away from the insertion pot transverse slit, and forms a common insertion slit together with the insertion pot longitudinal slit in a center position of the slider. The slider is lockable with the insertion pot in the center position and/or in end positions transversely shifted to both sides of the center position. |
US08939668B2 |
Tire protectant applicator system
A system for applying chemical liquid protectant to tires which has an applicator with a foam pad for mating with the tire and a foam support structure for mating with the foam pad, where the foam pad has a quick connection to a source of pressurized chemical liquid protectant; the system having a nozzle for dispensing chemical liquid protectant into an area central to the foam pad. |
US08939667B2 |
Shaper
A shaper for defining a tip portion of a cosmetic unit that has become worn includes a shaping surface for smoothing a surface of the tip portion and a slot in the shaping surface. The shaping surface is user-selectably placed in contact with the tip portion. An edge disposed at the slot and is engageable for removing material of the tip portion when the shaping surface is in contact with tip portion. The removed material is passed through the slot. |
US08939663B2 |
Ribbon tension control system and method for a ribbon printing system
A ribbon tension control system for a printing system includes a ribbon tension control apparatus. The ribbon tension control apparatus is configured to engage a print ribbon that extends through the printing system for applying one or more inks in the print ribbon to one or more target objects as the print ribbon is pulled from an unwind spindle to a windup spindle in the printing system. The ribbon tension control apparatus also is configured to control tension in the ribbon in response to change in a torque applied to the windup spindle that is used to pull the ribbon through the printing system. |
US08939660B2 |
Optical fiber fusion splicer
An optical fiber fusion splicer includes positioning members and clamping members. Each clamping member clamps the bare fiber. A first guiding portion protrudes from the top surface of each positioning member and guides a distal end portion of the bare fiber toward the groove. A concave face of the first guiding portion has a V-shaped cross section. Each clamping member includes a second guiding portion, which guides a base portion of the bare fiber toward the groove of the corresponding positioning member, and a pressing member, which presses the bare fiber against the top surface of the fiber positioning member. A concave face of the second guiding portion has an inverted-V-shaped cross section. The fusion splicer can clamp bare fibers while the bare fibers are received by the groove. |
US08939657B2 |
Optical connector with sloped surface
An optical connector includes a printed circuit board (PCB), an optical-electric coupling element, and a jumper detachably attached to the optical-electric coupling element. The optical-electric coupling element is positioned on the PCB. The optical-electric coupling element includes at least two first coupling lenses and a sloped surface. The optical-electric coupling element defines a stepped receiving cavity in its sidewall. A bottom surface of the stepped receiving cavity forms at least two second coupling lenses. The jumper is detachably inserted into the stepped receiving cavity, and the jumper has at least two receiving holes receiving at least two optical fibers. Each optical fiber is optically aligned with a respective second coupling lens. Each second coupling lens is optically aligned with a respective first coupling lens via the sloped surface. |
US08939654B2 |
Ruggedized multi-fiber fiber optic connector with sealed dust cap
A fiber optic connector and fiber optic cable assembly is disclosed. The assembly includes a fiber optic cable having a plurality of optical fibers. The assembly also includes a connector body, a multi-fiber ferrule and a protective housing. The fiber optic cable is anchored to a proximal end of the connector body and the multi-fiber ferrule is mounted at a distal end of the connector body. The multi-fiber ferrule supports end portions of optical fibers of the optical fiber cable. The protective housing mounts over the connector body. A dimensionally recoverable sleeve prevents contaminants from entering the protective housing through a proximal end of the protective housing. A dust cap and sealing member prevent contaminants from entering the protective housing through a distal end of the protective housing. |
US08939652B2 |
Roller bearing apparatuses including compliant rolling elements, and related methods of manufacture
In an embodiment, a roller bearing apparatus may include a rotor having first superhard raceway elements distributed circumferentially about an axis. Each first superhard raceway element includes a raceway surface positioned/configured to form a first portion of a raceway. The apparatus includes a stator including second superhard raceway elements generally opposed to the first superhard raceway elements. Each second superhard raceway element includes a raceway surface positioned/configured to form a second portion of the raceway. The apparatus includes rolling elements interposed between the rotor and stator and positioned and configured to roll on the raceway. One or more of the rolling elements may be configured to elastically deform on the raceway during use. At least a portion of the raceway exhibits a first modulus of elasticity greater than a second modulus of elasticity of at least a portion of the one or more of the rolling elements. |
US08939650B2 |
Bearing, bearing assembly comprising such a bearing and turbocharger comprising such a bearing assembly
This bearing comprises a fixed outer ring and a rotatable inner ring, and at least one lubrication ring having at least one lubrication duct extending between an outer surface and an inner surface of the lubrication ring. The at least one lubrication duct is placed so that the scalar product of a vector collinear to the longitudinal axis of the lubrication duct, and a vector (VL1) collinear to the tangent line (L1) to an outer cylindrical surface of the inner ring, at the point where the longitudinal axis of the lubrication duct (270) intersects the outer cylindrical surface of the inner ring, and oriented in the same direction as the rotation direction (F) of the inner ring, is strictly superior to zero, said vectors being projected in a plane (P2) perpendicular to the rotation axis of the bearing. |
US08939649B2 |
Rolling bearing
A rolling includes an inner race and an outer race, which rotate relative to each other, balls, which are interposed between the inner and outer races, and a retainer, which is arranged between the inner and outer races, for retaining the balls equiangularly. The retainer includes two annular members facing each other in an axial direction and having opposing surfaces each including hemispherical pockets formed in a plurality of circumferential positions, for receiving the balls, the two annular members being coupled together so that the opposing surfaces are brought into abutment on each other. A flange portion extends radially and is provided on a radially inner or outer side of an axial end portion of each of the two annular members. |
US08939644B2 |
Swash plate and production method of the same
A swash plate 3 includes a substrate 11 made of an iron-based material, a hard first resin layer 12 provided to coat an end surface of the substrate 11, and a soft second resin layer 13 provided to coat the first resin layer 12. A spiral annular groove 12A is formed in a surface of the first resin layer 12, and the second resin layer 13 is provided to match the sectional shape of the first resin layer 12. With the soft second resin layer 13 on a sliding surface 3A of the swash plate 3, a swash plate 3 having a good fit in an initial stage of sliding can be provided. When the second resin layer 13 partially wears, a protrusion 12 of the first resin layer 12 of the hard resin is exposed to provide good wear resistance and good sliding properties. |
US08939636B2 |
Light source assembly formed of a plurality of light source modules detachably connected together
A light source assembly includes a plurality of light source modules detachably connected to one another. Each light source module includes a frame part, an electrical connection part, and at least one light emitting device. The frame part includes a female coupling disposed in one side surface thereof and a male coupling disposed on another side surface thereof and configured to be engaged with a female coupling of another light source module of the plurality. The electrical connection part is disposed on an upper surface of the frame part and extends onto the one side surface having the female coupling disposed therein and onto the other side surface having the female coupling disposed thereon. The at least one light emitting device is mounted on the electrical connection part and disposed on the upper surface of the frame part. |
US08939633B2 |
Area light source device
An area light source device has a light guide plate including a light incident end face, a light guide plate main body thinner than a thickness of the light incident end face, and a light introducing unit formed in continuation with the light guide plate main body and so that thickness gradually becomes thinner from the light incident end face side towards the light guide plate main body side, a light source arranged at a position facing the light incident end face, a diffuser plate and one or more prism sheets arranged on a surface on a light emission side of the light guide plate main body, and a light shielding sheet arranged on an upper side of the diffuser plate and the prism sheet in a region excluding a light emitting region of the light guide plate main body. |
US08939622B2 |
Signal light device for a motor vehicle
A device is for a lighting/signaling assembly of an automotive vehicle. The assembly includes a substantially transparent optical material and at least one light source of an “LED” type arranged for emitting light rays propagating within a thickness of the optical material. The device comprises a plate of substantially transparent optical material forming a screen and including at least one substantially bilateral elongated bulge defining a substantially circular overall substantially perpendicular cross-section and substantially mean longitudinal axis in a substantially mid-plane of the bulge and being adapted to form a light guide. At least one LED is disposed at at least one end of the light guide and defines a main axis of the LED that is substantially orthogonal to a substantially longitudinal axis of the light guide. |
US08939618B2 |
Light flux controlling member, light emitting apparatus, and illumination apparatus
Light flux controlling member (140) includes: light controlling emission surface (141) for controlling the distribution of light emitted from light emitting element (130); back surface (143) that is positioned on a side opposite light controlling emission surface (141); boss (145) that is formed on back surface (143) side; and annular concave part (146) that is formed in the vicinity of a base end of boss (145). Annular concave part (146) has inside surface (146a) that is smoothly connected to an outer peripheral surface of the base end of boss (145) and that has an arc-shaped cross-section in an axial direction of boss (145). |
US08939617B2 |
Lighting device
A lighting device may be provided that includes: a light emitting module; a heat sink disposed on the light emitting module; a heat radiating fan disposed on the heat sink; and a housing which receives the light emitting module, the heat sink and the heat radiating fan, and includes an air inlet port and an air outlet port which are separated from each other, and includes a partition separating the air inlet port from the air outlet port, wherein the air inlet port is connected to a space between the heat radiating fan and the housing, and wherein the air outlet port is connected to a space between the heat sink and the heat radiating fan. |
US08939616B1 |
Light fixture with privacy shroud
A light fixture including a housing having a wall extending from a bottom surface to a top surface and forming an opening, a socket proximate the bottom surface for receiving an illumination source, and a shroud removably secured to and extending away from the top surface. The shroud may include at least one protrusion extending from a rear surface and connectable to a housing top surface ridge. |
US08939615B2 |
Optically efficient notification device for use in life safety wall strobe applications
A wall notification device described herein can draw a lower current by providing a more efficient reflector configuration. The reflector is designed to be positioned on a wall and provide sufficient light output in each of the requisite directions, as required by the UL 1971 standard. The notification device has a reflector unit having a base having a curved portion centered on the vertical axis and a flat portion extending from the curved portion; a reflective flange extending from a location near a top side of the base; a first and second specular protrusion extending from the curved portion of the base; a third and fourth specular protrusion extending from the base; a fifth and sixth specular protrusion extending from the curved portion of the base; and a sixth and seventh specular protrusion extending form the flat portion of the base. |
US08939613B2 |
Light-emitting diode die packages and methods for producing
A LED die package includes an LED chip having a p-type electrode and an n-type electrode; an accommodating housing, for accommodating the LED chip, being made of transparent material and defining an accommodating space, an open end through which the accommodating space is accessible, a closed end opposite to the open end, and two through holes formed on a surface of the closed end, wherein the LED chip is mounted within the accommodating space, so that the p-type electrode and the n-type electrode of the LED chip are exposed via the trough holes; and a carrier having a conductor mounting surface and predetermined conductors formed on the conductor mounting surface, wherein the LED chip is mounted on the conductor mounting surface of the carrier, so that the respective electrodes thereof are electrically connected to predetermined conductors formed on the conductor mounting surface of the carrier via wires. |
US08939610B2 |
Energy efficient illumination apparatus and method for illuminating surfaces
A system for illuminating an object is provided, the system comprising a coherent or semi-coherent light source and a first diffuser positioned relative to the coherent or semi-coherent light source so as to receive said coherent or semi-coherent light. The first diffuser may diffuse the light to produce diffused light. An actuator having a moveable element, such as a moveable reflective surface, may be positioned to project the diffused light onto an object, and may be moved to project light onto different portions of the object. This movement may be performed with such rapidity that it is not perceived by a person viewing the object. Rather, the entire object would appear to be illuminated. Movement of the element may be controlled by a computer, and may be performed according to a predefined routine. |
US08939609B2 |
Method and apparatus for controlling multi-colored light strings
A rotary switch is provided for controlling an attached light string containing a plurality of light colors. By manipulation of the control dial, a specially designed rotary board is rotated to provide electrical connection to the light string according to one of several present color patterns preprogrammed into the rotary board. The discrete rotary switch positions provided by the rotary switch allow for different color signaling patters to be provided at the output leads from the rotary switch so as to power a multicolored light staring with different patterns and create different multicolored effects. One of the discrete rotary switch positions permits the input color patter from an input light string to be passed through the rotary switch so as to provide the same color pattern at the output leads and power a multicolored light string with the same color pattern provided by the input light string. |
US08939608B1 |
Heat management for a light fixture with an adjustable optical distribution
A light fixture includes a member having a substantially frusto-conical shape. A channel extends between a wide top end of the member and a narrower bottom end of the member. The member includes multiple surfaces (“facets”) disposed around its outer surface. Each facet is configured to receive one or more light emitting diodes (“LEDs”) in a linear or non-linear array. Each facet can be integral to the member or coupled to the member. The channel is configured to transfer heat generated by the LEDs through convection. Fins can be disposed within the channel, extending from the inner surface of the member to an inner channel. The fins are configured to transfer heat away from, and provide a greater surface area for convecting heat away from, the member. For example, one or both of the channels can transfer heat by a venturi effect. |
US08939606B2 |
Heatable lens for luminaires, and/or methods of making the same
Certain example embodiments of this invention relate to heatable glass substrates that may be used in connection with lighting applications, and/or methods of making the same. In certain example embodiments, a glass substrate supports an antireflective (AR) coating on a first major surface thereof, and a conductive coating on a second, opposite major surface thereof. Bus bars connect the conductive coating to a power source in certain example embodiments. The substrate may be heat treated (e.g., heat strengthened and/or thermally tempered), with one or both coatings thereon. The heatable glass substrate thus may help provide a chemical and/or environmental barrier for the luminaire or lighting system disposed behind it. In addition, or in the alternative, the heatable glass substrate may help reduce the amount of moisture (e.g., snow, rain, ice, fog, etc.) that otherwise could accumulate on the luminaire or lighting system. |
US08939603B2 |
LED lamp tube
A LED lamp tube includes a hollow transparent tube body, a heat-dissipating base disposed in the tube body, a light-emitting module, a control circuit module, an electrical-conductive element, and electrical-conductive caps covering the tube body. The light-emitting module and the control circuit module are provided on two opposite surfaces of the heat-dissipating base respectively. The electrical-conductive element penetrates the heat-dissipating base to be electrically connected to the light-emitting module and the control circuit module. By this structure, the LED lamp tube can be assembled more easily with reduced soldering steps. |
US08939602B2 |
Convertible work light
Disclosed is a work light with convertible configurations. First is a light head mounted upon a stand with an extendable neck. The second is a flashlight. A third is presented when the neck is extended in the flashlight mode. The stand is ideally a tripod with legs collapsible into a central body to form the flashlight handle, a movable stop being provided to support the legs when deployed. A double linkage hinge is also provided the head and neck. Magnets may be applied at both the head and the end of an extendable retainer cap such that the work light may be used as an extendable pick up tool with the magnet in the head and it may be mounted solely by the magnet in the cap, even against the pull of gravity. The extendible retainer cap may also be utilized as an extra center leg. |
US08939601B1 |
Collapsible camping lantern
A collapsible lantern includes a base, an inner telescopic portion, an outer telescopic portion and a switch. The inner telescopic portion is movable relative to the base between a first, collapsed position and a second, raised position. The inner telescopic portion includes a light source and a power source. The outer telescopic portion includes a cap and is movable relative to the inner telescopic portion and the base between a first, collapsed position where the light source is covered by the cap and a second, raised position where the cap is spaced above the light source. Moreover, the outer telescopic portion is movable together with the inner telescopic portion, relative to the base, from the second position to a third, uppermost position. The switch is electrically connected between the light source and the power source and arranged to be off until the outer telescopic portion reaches the third position. |
US08939593B2 |
Temporary and/or emergency lighting system with inflatable bearing structure
In order to provide a temporary lighting solution in extreme weather or lighting conditions, this application has been conceived. A set of blowers will continuously operate to inflate a long cylindrical tube in which a light has been placed to illuminate a designated area. Because the unit may be used outdoors a stabilizing rod has been placed in the event of a sudden loss of power to prevent the tube from deflating rapidly and descending rapidly to the ground level and causing possible injury to persons on the ground or the light itself. Because this device may be used in extremely windy conditions, a plurality of outriggers will attach to the frame and extend outward to stabilize the device, when needed. Because the blowers will operate continuously and thereby produce noise a plurality of noise abatement containers are placed around the blowers to help lessen the noise level. |
US08939591B1 |
Combined mirror and safety signal system
The present invention features a combined mirror and safety signal system for boats or other vehicles. The system features a housing having a housing anterior surface and a housing posterior surface. A magnet is located on the housing anterior surface and a mounting bracket is located on the housing posterior surface. The system has a removable mirror unit having a mirror unit anterior surface and a mirror unit posterior surface. A mirror is inset into a mirror unit anterior surface. A magnet is inset into a mirror unit posterior surface. A lanyard is located on the mirror unit. The housing is mounted on a boat or other vehicle via the mounting bracket. The mirror unit posterior surface magnetically connects to the housing anterior surface to hold the mirror unit in place on the housing. |
US08939589B2 |
Exterior mirror element with auxiliary reflector portion
A mirror reflector sub-assembly for a vehicular exterior rearview mirror assembly includes a mirror reflective element having a glass substrate. A principal reflector portion has a first radius of curvature and an auxiliary reflector portion includes a curved recess having a second radius of curvature smaller than the first radius of curvature. The curved recess is established at the second surface of the glass substrate by physical removal of glass from a portion of the substrate. The mirror reflective element is supported at a side of a mirror back plate and an opposing side of the mirror back plate is adapted for attaching the mirror back plate to a mirror actuator of an exterior rearview mirror assembly equipped with the mirror reflector sub-assembly. A heater pad is disposed at the second surface of the glass substrate between the mirror reflective element and the mirror back plate. |
US08939588B2 |
Device for protection of a multibeam optical instrument
A protection device for an optical instrument of a satellite including a body on which the optical instrument is mounted, the optical instrument including a central mirror and peripheral mirrors reflecting light towards the central mirror, said protection device having a folded position and a deployed position, includes a plurality of panels rigid in the deployed position, the device forming a cellular structure including a tube for each peripheral mirror, the section of the tubes being a polygon, the tubes being disposed in such a manner as to protect the peripheral mirrors against stray illumination, and said panels being held against the body of the satellite in the folded position. |
US08939587B2 |
Lens module comprising at least one exchangeable optical element
An optical system has a housing with a mount and an opening to a receiving region, the receiving region being located within the housing and including the mount. At least one optical element is inserted into and removed from the receiving region through the opening, and at least one gas supply device provides a flow of gas in the receiving region. Alternatively or in addition, the optical system has a gas lock that receives the optical element. The opening interconnects the gas lock and the receiving region of the housing, and accommodates passage of the optical element between the gas lock and the receiving region. |
US08939580B2 |
Characteristic image extraction method and ophthalmologic apparatus
Provided is an ophthalmologic apparatus for detecting an eye movement from movements of a plurality of characteristic points within a fundus image. It is determined whether or not the plurality of characteristic points are included in a new fundus image when a position of a fixation index is changed, based on a relationship between a displacement amount of the fixation index and positions of the characteristic points within a fundus plane. If it is determined that at least one of the plurality of characteristic points is not included in the new fundus image, new characteristic points are extracted from a limited range within a new fundus plane image. Accordingly, the characteristic points can be efficiently reacquired for eye movement detection performed when an imaging target region of an eye to be inspected is changed by the fixation index. |
US08939578B2 |
Progressive reading and intermediate distance lens defined by employment of a zernike expansion
There is provided a lens that includes a corridor having a width greater than or equal to about 6 millimeters. The lens has astigmatism less than or equal to about 0.5 diopter within the corridor. There is also provided an item of eyewear that includes such a lens, and a method for representing a surface of an ophthalmic lens. |
US08939567B2 |
Ink for inkjet recording apparatus, and image forming method
Water and a pigment, as well as a high penetrating agent, a penetrating agent and a moisturizing agent each having specific kind and amount are incorporated in an ink for an inkjet recording apparatus. The high penetrating agent is an alkyl-substituted 1,3-hexanediol or an alkyl-substituted 1,3-pentanediol each having 8 carbon atoms. The penetrating agent is a C1-C4 monoalkyl ether of a polyhydric alcohol, a C6-C8 monoalkyl ether of a polyhydric alcohol, or a polyhydric alcohol dibutyl ether. The moisturizing agent is glycerin and 1,3-propanediol. |
US08939565B2 |
Emulsified curable oligomer-based inks for indirect printing method
A method of printing an image to a substrate includes applying an aqueous inkjet ink onto an intermediate receiving member using an inkjet printhead, optionally spreading the ink onto the intermediate receiving member, inducing a property change of the ink, and transferring the ink to a substrate, wherein the ink includes a curable oligomer. A method of printing an image to a substrate includes applying an aqueous inkjet ink onto an intermediate receiving member using an inkjet printhead, optionally spreading the ink onto the intermediate receiving member, inducing a property change of the ink, and transferring the ink to a substrate, wherein making the ink includes forming an aqueous mixture by adding a mixture of oligomers and a surfactant to a reactor containing a mixture of a humectant and an aqueous vehicle, heating and stirring the aqueous mixture, and homogenizing the aqueous mixture, forming the ink. |
US08939562B2 |
Liquid discharging apparatus and control method thereof
When filling a printing head with ink, ink in a sub-tank is circulated through a forward path port, a forward path, the printing head, a return path, a return path port, and the sub-tank by pumping ink from the forward path port side to the printing head side by a circulation pump in a state where a plurality of nozzles is sealed by bringing a contact member of a capping device into contact with a nozzle formation surface. Thereafter, sealing of the plurality of nozzles by the capping device is released while pressurizing the sub-tank by a pressure adjusting device. |
US08939560B2 |
Liquid supplying apparatus and its control method
A liquid passage communicates a first reservoir of a main tank with a second reservoir storing a liquid supplied from the first reservoir, and has one end portion on the side communicating with the first reservoir, which joins with or detach from the main tank. To increase the liquid volume in the second reservoir up to a first predetermined volume, a controller feeds the liquid in the first reservoir to the second reservoir when the liquid volume in the second reservoir is less than a second predetermined volume. When the liquid volume in the second reservoir falls short of the first predetermined volume, the end portion of the liquid passage is detached from the main tank. Then, the controller determined whether the liquid volume in the second reservoir is equal to or more than the first predetermined volume. |
US08939558B2 |
Image forming apparatus including liquid ejection head
An image forming apparatus includes a liquid ejection head, a head tank, a liquid storage container, a liquid feed device, a supply valve, an exhaust passage, a float valve, an air release valve, and a suction device. The exhaust passage is disposed in the head tank and communicated with an ambient air. The float valve is disposed in the head tank to close the exhaust passage in response to an amount of liquid in the head tank. The air release valve opens and closes the exhaust passage of the head tank. When the suction device exhausts air from the exhaust passage with the air release valve open, the liquid feed device is driven to pressurize and feed the liquid. |
US08939557B2 |
Liquid discharge head
In a liquid discharge head including a surface plate having a plurality of discharge ports and a liquid discharge body having a discharge portion, the discharge portion and an opening are alternately arranged on the liquid discharge body and the liquid discharge body includes a bonding unit formed by combining two piezoelectric material plates. Each piezoelectric material plate is provided with a plurality of grooves on a first surface and has a first electrode on one side wall surface and the bottom of the groove of the piezoelectric material plate, a second electrode on the other side wall surface, and a third electrode on a second surface. Each piezoelectric material plate is polarized in a direction connecting the first electrode and the second electrode, and also in a direction connecting the first electrode and the third electrode, and the two piezoelectric material plates are bonded so that the first surfaces face each other to form the bonding unit. |
US08939556B2 |
Fluid ejection device
A fluid ejection device includes a flexible membrane, an adhesive layer, a piezoelectric material layer, and first and second electrically conductive layers. The adhesive layer and the piezoelectric material layer include edge regions and central regions. A surface of the edge region of the piezoelectric material layer is coplanar with a surface of the edge region of the adhesive layer. The first electrically conductive layer is between the piezoelectric material layer and the adhesive layer such that a surface of the first electrically conductive layer is coplanar with the surface of the edge region of the piezoelectric material layer and the surface of the edge region of the adhesive layer. The second electrically conductive layer is over the surface of the edge region of the piezoelectric material layer, the surface of the edge region of the adhesive layer, the surface of the first electrically conductive layer, and the flexible membrane. |
US08939554B2 |
Ink jet print head and fabrication method thereof
An ink jet print head includes a substrate in which a pressure chamber is formed, a vibration film configured to define the pressure chamber and deformed to change a volume of the pressure chamber, a lower electrode formed on the vibration film, a piezoelectric film formed on the lower electrode, and an upper electrode formed on the piezoelectric film and having a periphery receding inwardly relative to a periphery of the piezoelectric film. |
US08939552B2 |
Thermal fluid-ejection echanism having heating resistor on cavity sidewalls
A thermal fluid-ejection mechanism includes a substrate having a top surface. A cavity formed within the substrate has one or more sidewalls and a floor. The angle of the sidewalls from the floor is greater than or equal to nominally ninety degrees. The thermal fluid-ejection mechanism includes a patterned conductive layer on one or more of the substrate's top surface and the cavity's sidewalls. The thermal fluid-ejection mechanism includes a patterned resistive layer on the sidewalls of the cavity. The patterned resistive layer is located over the patterned conductive layer where the patterned conductive layer is formed on the sidewalls of the cavity. The patterned resistive layer is formed as a heating resistor of the thermal-fluid ejection mechanism. The conductive layer is formed as a conductor of the thermal-fluid ejection mechanism, to permit electrical activation of the heating resistor to cause fluid to be ejected from the thermal fluid-ejection mechanism. |
US08939551B2 |
Digital drop patterning device and method
A liquid dispensing system includes a liquid dispenser array structure that includes a functional liquid transfer region located between a liquid dispensing channel and a liquid return channel. A first liquid supply provides a carrier liquid that flows continuously through the dispensing channel, functional liquid transfer region, and return channel during a drop dispensing operation. Liquid dispensers, located on a common substrate, include a second liquid supply that provides a functional liquid, immiscible in the carrier liquid, to the dispensing channel. A drop formation device, associated with an interface of the supply channel and the dispensing channel, is selectively actuated to form discrete functional liquid drops in the flowing carrier liquid. A receiver conveyance mechanism and the functional liquid transfer region are positioned relative to each other such that functional liquid drops are applied to a receiver while the carrier liquid flows through the functional liquid transfer region. |
US08939549B2 |
Inkjet printing apparatuses, inkjet nozzles, and methods of forming inkjet nozzles
Provided is an inkjet printing apparatus. The inkjet printing apparatus includes a nozzle. The nozzle includes at least two nozzle parts. A first of the at least two nozzle parts has a first tapered shape, and a second of the at least two nozzle parts has a second tapered shape and extends from the first nozzle part. The first and second tapered shapes have a same taper direction. |
US08939547B2 |
Recording apparatus
A holder that holds a line recording head is displaced in a sheet width direction against the urging force of an elastic portion to bring an abutment portion of the holder into contact with one of a plurality of positioning surfaces provided at a reference portion of a sheet conveying mechanism. The holder is positioned and fixed to the reference portion, with the urging force exerted thereto. |
US08939544B2 |
Ink set for reducing printhead corrosion
An ink set for an inkjet printer. The ink set includes an aqueous first ink comprising a first colorant and absent any potassium ions; and an aqueous second ink comprising a second colorant and potassium ions. The second aqueous ink comprises an AI(III) additive in an amount greater than the first ink. |
US08939541B2 |
Optimization of drying for wet colorants in a printing system
Systems and methods are disclosed for determining an operational range of colorant densities and heating powers that result in successful drying for a print media that is based on a drying quality of test images printed by a printing system. One embodiment comprises a printing system that applies colorant onto a continuous-form medium and applies heat to the medium based on a heating power. The printing system prints a plurality of test images onto the medium, where one or more of a colorant density and a heating power vary for each of the printed test images. The printing system determines a drying quality for the printed test images, and calculates an operational range of colorant densities and heating powers for the medium based on the drying quality of the printed test images. |
US08939531B2 |
Fluid ejection assembly with circulation pump
A fluid ejection assembly includes a fluid slot, a recirculation channel, and a drop ejection element within the recirculation channel. A pump element is configured to pump fluid to and from the fluid slot through the recirculation channel. A first addressable drive circuit associated with the drop ejection element and a second addressable drive circuit associated with the pump element are capable of driving the drop ejection element and the pump element simultaneously. |
US08939528B2 |
Inkjet printing apparatus and inkjet printing method
An inkjet printing apparatus includes: a conveyance device which conveys paper; an inkjet head which ejecting droplets of colored ink onto the paper conveyed by the conveyance device so as to form an image on the paper; a transparent liquid deposition device which deposits a transparent liquid onto a blank background portion of the paper conveyed by the conveyance device; a transparent liquid deposition volume determination device which determines a deposition volume of the transparent liquid to be deposited onto the paper, according to printing information that is required for printing the image on the paper; and a transparent liquid deposition control device which controls the transparent liquid deposition device in such a manner that the transparent liquid with the deposition volume determined by the transparent liquid deposition volume determination device is deposited onto the blank background portion of the paper. |
US08939526B1 |
Adjustable face panel mounting assembly
A face panel mounting assembly provides for adjustable mounting of a drawer face panel to a drawer slide mechanism. The assembly includes a plate adapted to be vertically adjustably fixed to a back surface of a drawer face panel, an angled bracket secured to the drawer slide mechanism having a first leg and a second leg, and fasteners passing rearwardly through the plate and bracket to horizontally adjustably secure the drawer face panel to the drawer slide mechanism at a desired position. The assembly also includes anchor plate fixed to the front end of each movable drawer slide rail that includes an opening defining a pivot axis for tilting movement of the drawer face panel and an opening defining a range of movement of the drawer face panel about the pivot axis. |
US08939525B1 |
Self-closing buffer and automatic rebound mechanism for slide rail
A self-closing buffer and automatic rebound mechanism for a slide rail includes a buffer body, a buffer slide block, a buffer hook block, a buffer element, at least one pull-back spring, at least one push-out spring, a pressing toggle plate and a pressing block. The slide rail consists of an outer rail, a middle rail and an inner rail, and the inner and middle rails can be sequentially pulled and extended outward or pushed inwardly, overlapped and shortened. The slide rail is installed between a drawer and a cabinet for use. When the drawer is pushed inwardly to a certain degree, the drawer is pulled back automatically to a locked position, and the pushing force is damped to lower noises. After the drawer is pushed again, the drawer is rebounded automatically to a certain distance to facilitate operations that follow, so as to improve the convenience of use significantly. |
US08939521B2 |
Shelf gap spacer device for a merchandise display system
Aspects of the disclosure relate to a spacer device for use with a merchandise display. The merchandise display may include a first upright and a second upright opposite the first upright, a pegboard mounted between the two uprights, and at least one shelf mounted to the two uprights, wherein the configuration includes a gap between a back of the shelf and the pegboard. The spacer device may include two opposing ends. Each of the opposing ends may include a support arm that extends downward towards the gap, a mounting arm that extends downward towards the gap, and a tab that projects outward and away from the mounting arm. The spacer device may also include a gap filler portion extending between the two opposing ends wherein when the device is secured in the gap, the gap filler portion fills the gap. |
US08939520B2 |
Structural unit having a control unit housing and a hydraulic assembly housing
A structural unit having a control unit housing and a hydraulic assembly housing is proposed. The control unit housing and the hydraulic assembly housing form a receiving chamber with a covering for at least one electrical component. The at least one electrical component is arranged in the receiving chamber in a sealed manner at least in the region of contact faces between the component and the chamber. For each component, one seal is applied in a fluid process and is assigned individually to the relevant electrical component to be arranged. The seal is applied in the region of the contact faces between the component and the covering of the electrical component, the control unit housing, and the hydraulic assembly housing. |
US08939519B2 |
Vehicle brake device
A vehicle brake device includes a master cylinder having a master piston moved by servo pressure in a servo chamber and master pressure of a master chamber is changed by movement of the master piston. A mechanical servo pressure generating unit is connected to a high pressure source and the servo chamber, and generates a servo pressure within the servo chamber according to pilot pressure within a pilot chamber based on brake fluid pressure of the high pressure source. An electrical pilot pressure generating unit is connected to the pilot chamber and generates desired pilot pressure within the pilot chamber, and a master chamber-to-pilot chamber brake fluid line connects the master chamber with the pilot chamber so pilot pressure is generated by the pilot pressure generating unit during normal operation of a power supply system, and the master pressure is used as pilot pressure when the power supply system fails. |
US08939516B2 |
Rotary cutter drum for continuous mining machine
A rotary cutter drum for a continuous mining machine having a cutter drum, a bearing hub, an inner bearing, a sealing assembly and a shaft disposed in an inner portion of the cutter drum, the shaft having at least one flat passageway disposed along a longitudinal axis of the hub for allowing a lubricating fluid to move from an oil reservoir to a bearing surface. |
US08939512B2 |
Seat assembly and an adjustable head restraint assembly
A seat assembly having a headrest for supporting the head of a seat occupant. The seat assembly includes a seat back, a support post disposed on the seat back, and a headrest. The headrest has a front portion for supporting the head of a seat occupant. The front portion is configured to move between a first position and a second position. The headrest is rotatably disposed on the support post such that the headrest can rotate independent of movement of the front portion. |
US08939510B2 |
Seat assembly having a collapsible cushion support assembly
A seat assembly having a collapsible cushion support assembly disposed on a seat bottom frame and an adjustable support mechanism. The adjustable support mechanism supports a seat occupant and extends from a seat bottom frame to a seat back frame. |
US08939506B2 |
Carrier for infant car seat
A carrier for an infant car seat includes a lower support unit, two pairs of position adjusting units connected with the lower support unit, two pairs of angle adjusting units connected with the position adjusting units, and a pair of upper support bars connected with the angle adjusting units. An infant car seat is placed and supported between the upper support bars. Thus, the carrier is used to fix and support the infant car seat and can be placed indoors and outdoors. In addition, the carrier can be directly taken out of the car to support the infant car seat, so that the user can place and carry the infant car seat easily and conveniently. |
US08939504B2 |
Seat back of vehicle seat
A seat back of vehicle seat including: a seat back frame; a support wire element disposed in the seat back frame; a support plate attached to the support wire element such that an upper portion thereof projects upwardly from the support wire element; and a resilient reinforcing element provided to that upper portion of support wire element, thereby normally reinforcing such upper portion. The resilient reinforcing element has two upper end portions respectively slidably engaged with two brackets of the seat back frame and a main reinforcing portion which is resiliently extensible, while being resiliently deformable rearwardly of the seat back frame. Another resilient reinforcing element having a pair of reinforcing portions may be provided to a lower portion of the support wire element to normally reinforce such upper portion. Each of those two different reinforcing elements is resiliently deformable rearwardly by an excessive great load applied thereto. |
US08939501B2 |
Seat heater
A seat heater includes first heat-generating elements embedded in a seat so as to correspond to first sites of a seat occupant, second heat-generating elements embedded in the seat so as to correspond to second sites of the seat occupant, and a controller for executing a fluctuation control in which a first set temperature of the first heat-generating elements and a second set temperature of the second heat-generating elements are increased or decreased in each of a plurality of predetermined time periods. The controller sets the first set temperature to be higher than the second set temperature in one of the time periods and sets the second set temperature to be higher than the first set temperature in another of the time periods. |
US08939497B2 |
Dashboard crossbeam comprising at least two sections attached to each other by welding
The crossbeam according to the invention comprises at least two sections, each section comprising at least one wall and being assembled to the other section in a junction region so as to form said crossbeam. The walls of said sections are fastened to each other by a weld made by induction brazing. |
US08939494B2 |
Roll up pick-up truck box cover with lock down slats
A roll up cover for a box of a pick-up truck includes a plurality of substantially rigid slats connected by hinge joints. A flexible sheet of material is attached to the top surface of the slats. The hinge joints include a stop which allows pivoting of adjacent slats only in a direction moving the top surfaces of the slats towards each other, to allow the cover to be rolled up with flexible sheet facing inwardly, and with bottom surfaces of the slats facing outwardly, and not vice versa. Side rails are attached to the box of the pick-up truck. A roll rod in each side rail pivots into closed position when the cover is unrolled, with the roll rods engaging the end fittings on the slats, to hold the cover down onto the side rails. |
US08939492B2 |
Storage device and partition for use in such a storage device
A storage device for use in the passenger compartment of a vehicle is provided herein. The storage device has a partition that can divide a receptacle space of the storage device into partial receptacle spaces and an overload safety that prevents the partition from being destroyed or damaged under the influence of excessive force. |
US08939485B2 |
Container-lifting spreader with drive for the telescopic movement of spreader's beams protected against damage by collision
A container-lifting spreader includes at least two beams movably supported in a housing and provided a drive by which the beams can be driven in telescopic movements for adjusting the length of the spreader. The drive includes an electric motor and a pusher acting on the beams, the pusher interconnecting the beams for simultaneous telescopic movements in mutually opposite directions in the longitudinal direction of the spreader, and a power transmission operatively coupled between the motor and the pusher. The power transmission includes an input shaft carrying an external gear ring driven by the motor, and an output shaft likewise carrying an external gear ring that operates the pusher, the gear rings in mutual engagement forming an angle gear arranged with an irreversible mesh of teeth such that rotation of the input shaft causes rotation of the output shaft whereas the reverse is prohibited by the irreversible mesh of teeth. |