| Document | Document Title |
|---|---|
| US11988749B2 |
System and method for hybrid LiDAR segmentation with outlier detection
Devices, methods, and systems may obtain at least one point cloud, segment points in the at least one point cloud into a plurality of segments, train a neural network using known segments and a first loss function to generate a first trained neural network, train the first trained neural network using outlier segments and a second loss function to generate a second trained neural network, and train an extended isolation forest by applying an extended isolation algorithm to features of the known segments and features of the outlier segments to generate an anomaly score for each segment. |
| US11988743B2 |
Molded proximity sensor
A proximity sensor includes a printed circuit board substrate, a semiconductor die, electrical connectors, a lens, a light emitting assembly, and an encapsulating layer. The semiconductor die is positioned over the printed circuit board substrate with its upper surface facing away from the printed circuit board substrate. Each of the electrical connectors is in electrical communication with a contact pad of the semiconductor die and a respective contact pad of the printed circuit board substrate. The lens is positioned over a sensor area of the semiconductor die. The light emitting assembly includes a light emitting device having a light emitting area, a lens positioned over the light emitting area, and contact pads facing the printed circuit board substrate. The encapsulating layer is positioned on the printed circuit board substrate, at least one of the electrical connectors, the semiconductor die, the lens, and the light emitting assembly. |
| US11988736B2 |
Systems and methods for virtual aperture radar tracking
A system for virtual aperture array radar tracking includes a transmitter that transmits first and second probe signals; a receiver array including a first plurality of radar elements positioned along a first radar axis; and a signal processor that calculates a target range from first and second reflected probe signals, corresponds signal instances of the first reflected probe signal to physical receiver elements of the radar array, corresponds signal instances of the second reflected probe signal to virtual elements of the radar array, calculates a first target angle between a first reference vector and a first projected target vector from the first reflected probe signal, and calculates a position of the tracking target relative to the radar array from the target range and first target angle. |
| US11988730B2 |
Device, system and method for obtaining a magnetic measurement with permanent magnets
A magnetic field device, with a first magnet, a first ferromagnetic element positioned adjacent to the first magnet, a second magnet, a second ferromagnetic element positioned adjacent to the second magnet and relative to the first ferromagnetic element to create a gap between the first ferromagnetic element and the second ferromagnetic element, and a third magnet positioned between the first ferromagnetic element and the second ferromagnetic element and within the gap. |
| US11988728B2 |
Non-contact linear position sensor with flux collectors and a plurality of magnets for measuring a continuously increasing or decreasing magnetic field
Position sensors, including linear position sensors, that utilize magnetic field(s) are disclosed. Disclosed sensors include flux emitters and sensor assemblies. The sensor assemblies include flux collectors that interact with magnetic fields from flux emitters and with a magnetism sensing device. Flux emitters have arrangements of magnets that when combined with the sensor assembly can provide a constantly increasing or a constantly decreasing signal across a range of relative movement. |
| US11988723B2 |
Alternating-current detection circuit
An AC detection circuit, including a live wire input end and a neutral wire input end; a first diode and a second diode being both Zener diodes and with anodes connected to each other; a first resistor and a second resistor; a rectification module connected to the live wire input end and the neutral wire input end; a power supply for supplying power; a current mirror module with a current value at the first output end and a current value at the second output end having a fixed ratio; a unidirectional conduction module, configured to enable unidirectional conduction of the current from the current mirror module to the first diode; and a current comparison module, including an oscillator, a timer, a current comparator and a reference current source, and configured to compare the current value of the second output end of the current mirror module with a reference current value. |
| US11988722B2 |
Battery analysis system and method
A system or method for determining a battery state can include receiving a set of sensor measurements; determining the battery state using a state estimator collocated with the battery; and determining parameters used by the state estimator using a second state estimator operating on a processor remote from the battery. |
| US11988717B2 |
Measurement apparatus of power storage device and measurement method
A measurement apparatus of a power storage device supplies constant current to the power storage device, measures voltage of the power storage device, and computes an internal state of the power storage device on the basis of voltage change in the power storage device subjected to the measurement. |
| US11988716B2 |
Battery monitoring system
A battery health monitoring system that utilizes adaptive cathode and adaptive anode observers to estimate the ion concentrations at the respective cathode and anode of a battery. Subsequently, the estimated ion concentrations can be used in a battery model to estimate the state of heath and state of charge of the battery. Additionally, the model and ion concentrations can be updated real time as aging components of the battery are evaluated in the output data from the battery. |
| US11988713B2 |
Contact signal acquisition circuit for on-site on-line check of gas density relay
A contact signal acquisition circuit for online checking a gas density relay on site is provided, including a first connecting circuit, connecting a contact of a gas density relay to a contact signal control loop, and a second connecting circuit, connecting a contact of the gas density relay to a contact signal sampling interface of an online check device. In a non-checking state, the second connecting circuit is disconnected, and the first connecting circuit is closed; and in a checking state, the first connecting circuit is disconnected, and the second connecting circuit is connected, so as to connect the contact of the gas density relay to the contact signal sampling interface of the online check device, guaranteeing that no contact action signal is uploaded during checking and safe operation of a power grid is not affected. |
| US11988711B2 |
Test circuit and test method
A test circuit includes a scan chain and a wrapper chain. The wrapper chain shifts in a test pattern according a first clock. The scan chain is coupled to the wrapper chain via a logic combination of a circuit under test. The wrapper chain is configured to transmit the test pattern to the scan chain via the logic combination according to a second clock in a capture phase. The wrapper chain includes a first, a second wrapper cell, and an asynchronous register. The first wrapper cell sequentially shifts in two bits of the test pattern in the shift-in phase. The second wrapper cell shifts in the first bit of the test pattern in the shift-in phase. The asynchronous register conducts the first wrapper cell to the second wrapper cell in the shift-in phase, and latches the second wrapper cell in the capture phase. |
| US11988710B2 |
Test methods, tester, load board and test system
The present invention provides a test method, a tester, a load board and a test system. The test method includes: outputting, through a first input/output (I/O) port of a tester, a first test signal to a first channel of a load board, wherein the first test signal is used to generate a second test signal and a third test signal; receiving, through the first I/O port, a third feedback signal returned from the first channel, wherein the third feedback signal is generated based on a first feedback signal and a second feedback signal; and determining whether a first chip and a second chip are operating normally based on the third feedback signal. Solutions provided in the present invention are capable of increasing the number of chips that can be tested at a single time. |
| US11988709B2 |
System capable of detecting failure of component of system and method thereof
This disclosure proposes an inventive system capable of testing a component in the system during runtime. The system may comprise: a substrate; a plurality of functional components, of the plurality of functional components being mounted onto the substrate and including a circuitry; a system bus formed with electrically conductive pattern onto the substrate thereby allowing the plurality of functional components to communicate with each other; one or more wrappers, each of the one or more wrappers connected to one of the plurality of functional components; and an in-system component tester (ICT) configured to: select, as a component under test (CUT), at least one functional component, in an idle state, of the plurality of the functional components; and test, via the one or more test wrappers, the at least one functional component selected as the CUT. |
| US11988708B2 |
Exposure monitor device
The disclosed technology generally relates to integrated circuit devices with wear out monitoring capability. An integrated circuit device includes a wear-out monitor device configured to record an indication of wear-out of a core circuit separated from the wear-out monitor device, wherein the indication is associated with localized diffusion of a diffusant within the wear-out monitor device in response to a wear-out stress that causes the wear-out of the core circuit. |
| US11988707B2 |
Sensor status determination based on independent fundamental frequency measurements
Methods, computing systems, and computer-readable media for detecting sensor malfunctioning status. The method includes receiving sensor measurements of a first type from a first type of sensor, deriving a first value for a metric from the sensor measurements of the first type, receiving sensor measurements of a second type from a second type of sensor, wherein the second measurements of the second type include a second value for the metric, comparing the first value to the second value, determining whether the first type of sensor or the second type of sensor is malfunctioning based on the comparing, and storing or outputting information indicating whether first type of sensor and the second type of sensor are malfunctioning. |
| US11988706B2 |
Trace level voltage sensor for multi-layer printed circuit boards
A voltage sensor system for determining an abnormal circuit condition in a multi-layer printed circuit board is disclosed. The printed circuit board has a plurality of layers. One of the layers includes a trace network and a sensor circuit. The sensor circuit includes the trace network and a sensing point. The sensor circuit is coupled between a voltage supply and a ground. A controller is coupled to the sensing point. The controller is operable to determine a voltage of the sensing point and compare the voltage to a threshold value to determine an abnormal circuit condition in the printed circuit board. |
| US11988702B2 |
Method and system for inspection of defective MTJ cell in STT-MRAM
The present invention relates to a film quality inspection method and system for providing a stress evaluation scheme for inspection of film quality of a magnetic tunnel junction (MTJ) cell of spin-transfer torque magnetic random access memory (STT-MRAM), wherein a bipolar signal and a unipolar signal including a unipolar hole (positive polarity) and a unipolar electron (negative polarity) are simultaneously applied to the same MTJ cell, and then according to a result of a comparison of a cycling gap, the quality of a thin film having a thickness of about 1 nm may be inspected. |
| US11988701B2 |
Fault diagnosis method for three-phase power grid, apparatus, and computer device
In the fault diagnosis method, apparatus, and computer device, the method includes acquiring line voltage values in real time according to a voltage collector connected to phase lines (S100); according to the line voltage values and preset system parameters, obtaining a voltage peak balance degree and a phase angle offset of the three-phase power grid (S200); and obtaining a fault diagnosis result according to the voltage peak balance degree and the phase angle offset (S300). In such a way, a real-time diagnosis operation of whether a three-phase power grid is balanced can be implemented only by performing on-line calculation and analysis on line voltage values, which has simple analysis operation to reduce the system complexity; and only a voltage collector is added, and no other hardware costs are required, moreover high diagnosis reliability is obtained. |
| US11988697B2 |
Device for measuring a current through a choke and method for operating a device for measuring a current through a choke
The invention relates to a device (200) for measuring a current through a choke (130) of a voltage converter (100) comprising an integrator circuit (140), an amplifier circuit and an NTC resistor (160). The amplifier circuit comprises an inverting and a non-inverting amplifier input connection (152, 154) and an amplifier output connection (156). The non-inverting amplifier input connection (154) is supplied with an amplifier input signal according to an integrator output signal. A voltage signal characterising the current through the choke (130) is applied at the amplifier output connection (156) of the amplifier circuit. The NTC resistor (160) is arranged in the feedback path of the amplifier circuit between the inverting amplifier input connection (152) and the amplifier output connection (156). |
| US11988695B2 |
Arrangement for determining a current flowing through a busbar
An arrangement for determining a magnitude of an electrical current flowing through a busbar. The arrangement has a measurement conductor which is electrically connected at a first contact point to the busbar and which extends from the first contact point to a second contact point. A third contact point is located on the busbar at a spacing distance from the first contact point. A voltage measurement device is configured to measure a voltage between the second contact point and the third contact point. The arrangement also has a controlled current source which is configured to introduce a measurement current into the measurement conductor. |
| US11988687B2 |
Inspection jig and board inspection apparatus including the same
An inspection jig includes a first board, a probe unit including a probe, a second board located in parallel with the first board and electrically connected to the probe, an electrical connection portion electrically connecting the first board and the second board, and a board holding portion holding the second board in parallel with the first board in the thickness direction and holding the probe unit. The board holding portion includes a probe-side holding plate located on the probe unit side of the second board and a holding plate support portion that positions the probe-side holding plate at a position where the probe-side holding plate is in parallel with the first board in the thickness direction. The board holding portion holds the second board so that the first board and the second board are electrically connected via the electrical connection portion being sandwiched between the first board and second board. |
| US11988680B2 |
Analytical operation assisting device and non-transitory computer readable medium recording analytical operation assisting program
In a device (4) for assisting in analytical operations for correctly arranging samples in a plurality of sample-placement portions and implementing multiple protocols in the correct order, a storage section (41) holds sample information and analysis parameters for each protocol as well as the order of implementation. A protocol-selection-input receiver (42) receives an input of the selection of a protocol. A sample-position displayer (43) displays, on a display unit (6), sample information in the selected protocol along with the positions of the sample-placement portions. A protocol-implementation-information collector (45) collects information concerning the state of implementation of the protocols. A determiner (46) determines whether a protocol which must be implemented earlier was already implemented, based on the state of implementation and order of implementation of the protocols. A batch-file creator (47) creates a batch file when it is confirmed that the protocol which must be implemented earlier was already implemented. |
| US11988676B2 |
Protein biomarker indicators of neurological injury and/or disease and methods of use thereof
Methods, compositions and kits useful in the detection, assessment, diagnosis, prognosis and/or treatment of neurological injury or disease or brain injury, such as traumatic brain injury (TBI), are provided in which certain newly discovered protein biomarkers are detected in a biological sample of a subject undergoing testing or evaluation. The methods allow for detection of changes in levels, amounts, or concentrations of the protein biomarkers in a subject compared with those of controls. Detection of the protein biomarkers, and/or levels thereof, provides an indication of biological and biochemical events, e.g., at a cellular level, that are occurring in the subject who is undergoing testing or analysis for the neurological injury or brain injury. |
| US11988675B2 |
Methods for quantifying frataxin activity
The present disclosure provides methods, compositions and kits for measuring activity of a frataxin (FXN) protein, e.g., an FXN fusion protein. The present invention also provides methods for identifying compounds capable of modulating activity of an FXN protein, e.g., an FXN fusion protein. |
| US11988673B2 |
Multiplexed immunohistochemistry using recombinant antibodies with epitope tags
The present disclosure is directed to epitope-tagged antibodies, as well as methods of employing the epitope-tagged antibodies for detecting one or more targets in a biological sample, e.g. a tissue sample. |
| US11988672B2 |
CCL24 as a diagnostic and therapeutic target for breast cancer
Using expression of CC chemokine ligand (CCL24) to serve as an identification of a potential deriver of metastatic cancers and methods of detecting the presence of CCL24 to serve as a breast cancer diagnosis tool. |
| US11988671B2 |
Assays for detecting SARS-CoV-2
The present disclosure relates to methods of detecting a protein from the SARS-CoV-2 virus, or a fragment thereof, in a sample obtained from a subject using a first antibody or antigen-binding fragment thereof that binds to a protein from the SARS-CoV-2 virus, or a fragment thereof, and a second antibody or antigen-binding fragment thereof which binds to a protein from the SARS-CoV-2 virus, or a fragment thereof. |
| US11988670B2 |
Integrated sample processing system with multiple detection capability
An integrated sample processing system including an analyzer and a mass spectrometer is disclosed. The integrated sample processing system can perform multiple different types of detection, thereby providing improved flexibility and better accuracy in processing samples. The detection systems in the sample processing system may include an optical detection system and a mass spectrometer. |
| US11988668B2 |
Concentration-dependent self-interaction assay
Methods for producing high concentration protein formulations having high stability are provided. Assays for selecting proteins and formulation conditions that have high self-repulsive attributes are used as an early step in the manufacturing process. Specifically, a protein concentration-dependent self-interaction nanoparticle spectroscopy method is employed as a protein colloidal interaction assay. |
| US11988665B2 |
Systems and methods for determining viruses such as coronaviruses
Certain aspects of the present disclosure generally relate to systems and methods for determining viruses. For instance, some aspects are directed to systems and methods for determining viruses using a partitioning system. Within the partitioning system, the virus may partition into one or more phases. In some cases, a virus-binding moiety facilitates partitioning of the virus. The phases may be assayed to determine the virus based on, e.g., quantitative or qualitative assessments of the distribution of virus-binding and/or signaling moieties. The virus-binding moiety may be attached to particles that may form a complex around a virus. The complex may be detectable without a signaling moiety (e.g., as a color change) in some embodiments. In some cases, more than one virus may be determined. For example, a virus-binding moiety may substantially alter the partitioning behavior of one virus or complex, relative to another, by being selective for the first virus. |
| US11988658B2 |
Methods of assessing cellular breast samples and compositions for use in practicing the same
Methods are provided for assessing a cellular breast sample. Aspects of the methods include flow cytometrically obtaining sample data, cellular data, and combinations thereof, and then assessing the cellular breast sample based on the obtained data. In addition, compositions, e.g., kits, systems and programming, useful in practicing various embodiments of the methods are provided. |
| US11988657B2 |
Method for determining degree of sludge generation in oil
A method for determining the degree of sludge generation in oil includes: a deteriorated oil generating step ST1; a RPVOT testing step ST2; a sludge amount measuring step ST2B; and a determining step ST3. The step ST1 generates deteriorated oil oxidized by immersing and rotating a pressurized container in a thermostatic bath having a predetermined temperature. The pressurized container is pressurized until the oxygen partial pressure reaches a predetermined pressure higher than the value under atmospheric pressure by adding oil and a copper catalyst, substituting with oxygen, or injecting oxygen or air. The step ST2A measures an RPVOT residual ratio of a portion of generated deteriorated oil by the RPVOT test. The step ST2B measures the amount of sludge for a portion of generated deteriorated oil. The step ST3 determines the ease of sludge generation from the relationship between the measured RPVOT residual ratio and the amount of sludge. |
| US11988656B2 |
Remote monitoring of water distribution system
A liquid monitoring system includes a remote measurement device located at a location of the fire hydrant that is in contact with water provided by a water main. The remote measurement device has sensors that measure characteristics of the water and/or acoustic vibrations in the water and a communication interface that transmits measured information to a communication network device that may be located elsewhere on the fire hydrant. The communication network device communicates with a communication network. |
| US11988649B2 |
On-line suppressor
A device for ion chromatography comprises a tube with an inlet opening and an outlet opening and an inner diameter from about 40 microns to about 10 microns. There is an aperture through one side of the tube into a lumen of the tube. At least a portion of the inner surface of the tube has a first charge. An ion exchange barrier covers the aperture on an outside surface of the tube. The inner surface of the tube, from the inlet opening to the aperture, is coated with ion exchange particles having a diameter ranging from about 30 nm to about 200 nm. The ion exchange particles have a second charge opposite the first charge. The inner surface of the tube, from the outlet opening to the aperture, is not coated with ion exchange particles. |
| US11988645B2 |
Dynamic true triaxial electromagnetic Hopkinson bar system
The present disclosure provides a dynamic true triaxial electromagnetic Hopkinson bar system, including a central cubic box, a horizontal cruciform support platform, and a central support platform, wherein the central cubic box is disposed in the center of the upper surface of the central support platform; the central cubic box and the horizontal cruciform support platform form an orthogonal coordinate system for precisely positioning and centering the dynamic true triaxial electromagnetic Hopkinson bar system; the confining-pressure loading systems, electromagnetic pulse generators, circular bulges, square bars, and self-lubricating square bar fixation and support frames in the directions X, Y, and Z are respectively symmetrically arranged by taking the central cubic box as a symmetric center; and the systems in the directions X, Y, and Z together construct the dynamic true triaxial electromagnetic Hopkinson bar system. |
| US11988643B2 |
Characterization of a phase separation of a coating composition
A method for detecting a phase separation of a waterborne or solvent-borne or solvent-free coating composition includes providing the coating composition in a receptacle; providing a measurement instrument for receiving the receptacle, the measurement instrument including a measurement probe; controlling the measurement instrument to a) displace the measurement probe through the coating composition along a predefined measurement path with a predefined speed profile, the predefined measurement path extending along a length axis of the receptacle, b) acquire a force-displacement profile by measuring a force exercised on the measurement probe while the probe is being displaced along the predefined measurement path with the predefined speed profile; processing the force-displacement profile for detecting at least one phase separation of the coating composition; and outputting a detection result. |
| US11988639B2 |
Method and apparatus for inspecting marine risers
A method and device for inspecting marine risers is described. The marine riser is deployed from a floating unit and connected to a lower marine riser package (LMRP) and a blow-out prevention (BOP) stack, and the method comprises: performing a first riser inspection with an inspection tool where the marine riser is in an unconnected well configuration, wherein the inspection tool includes an ultrasonic transducer device, and the first riser inspection comprises: conveying the inspection tool in an internal diameter of the marine riser, detecting information on the marine riser with the inspection tool while conveying the inspection tool through the marine riser, and collecting data with the inspection tool corresponding to the information detected by the inspection tool. |
| US11988638B2 |
Measuring system for monitoring the material parameters and/or homogeneity of a suspension conveyed through a channel
A measuring system for monitoring the material parameters and/or homogeneity of a suspension which is conveyed through a channel, is electrically conductive or contains electrically conductive components with which an electrode of an electrical storage battery or electrical energy store is formed. A sensor system designed for ultrasonic inspection, which has at least one ultrasonic transducer, which is arranged on the outer wall of the channel in order to emit sound waves, and a sensor system designed for eddy current detection is provided, formed with at least one electrical transmitting coil and at least one electrical receiving coil or a giant magnetoresistive sensor (GMR), anisotropic magnetoresistive sensor (AMR), superconducting quantum interference sensor (SQUID) or Hall sensor and is arranged upstream or downstream of the sensor system. |
| US11988636B2 |
Method for particle analysis and method for particle production
The method for particle analysis includes a first magnetic susceptibility measurement step S4 of measuring a volume magnetic susceptibility of each of first particles p1; an encapsulation treatment step S5 of performing an encapsulation treatment so that the first particles p1 encapsulate an encapsulation target component pt smaller than the first particles p1; a second magnetic susceptibility measurement step S8 of measuring a volume magnetic susceptibility of each of second particles p2 as an analysis target that are the first particles p1 after the encapsulation treatment; and a step S9 of analyzing whether or not the encapsulation target component pt is encapsulated in the second particles p2 based on a result of measurement in the first magnetic susceptibility measurement step S4 and a result of measurement in the second magnetic susceptibility measurement step S8. |
| US11988632B1 |
Systems for continuous scanning monitoring and analysis based on discrete three-dimensional fluorescence technology
Embodiments of the present disclosure provide a system for continuous scanning monitoring and analysis based on a discrete three-dimensional fluorescence technology. The system comprises a high-pressure capillary gel electrophoresis mechanism configured to enable passages of different lengths of STR sequence fragments and nucleic acid gene fragments in an energized state; a sampling window unit configured to assemble a plurality of capillary tubes and a plurality of detection optical fibers shared by an excitation light and excited light; and a detection window unit configured to assemble the plurality of detection optical fibers and a fluorescence signal detection unit. The fluorescence signal detection unit is configured to output a plurality of single excitation light sources and obtain fluorescence signals. |
| US11988631B2 |
Laser doppler electrophoresis using a diffusion barrier
In one general aspect, an electrophoretic measurement method is disclosed that includes providing a vessel that holds a dispersant, providing a first electrode immersed in the dispersant, and providing a second electrode immersed in the dispersant. A sample is placed at a location within the dispersant between the first and second electrodes with the sample being separated from the electrodes, an alternating electric field is applied across the electrodes, and the sample is illuminated with temporally coherent light. A frequency shift is detected in light from the step of illuminating that has interacted with the sample during the step of applying an alternating electric field, and a property of the sample is derived based on results of the step of detecting. |
| US11988630B2 |
Method to use artificial intelligence to enhance visual inspection of oxygen sensors
A system configured to detect defects in a first oxygen sensor is disclosed. The system includes an X-ray imaging device configured to capture a production X-ray image of the first oxygen sensor and an electronic processor configured to use a trained oxygen sensor defect detection model to identify a defect of the first oxygen sensor by producing a pseudo X-ray image by simulating a projection of a fan beam through CT data of a second oxygen sensor. The electronic processor is also configured to measure, via the trained oxygen sensor defect detection model, a fan-beam distortion in the production X-ray image; select, via the trained oxygen sensor defect detection model, the pseudo X-ray image based on the fan-beam distortion; perform a comparison, via the trained oxygen sensor defect detection model, of the production X-ray image to the pseudo X-ray image; and, classify, based on the comparison, the production X-ray image as representing an improperly assembled oxygen sensor. |
| US11988628B2 |
Container including analyte sensing device
A container for storing one or more items is disclosed. The container may include a surface defining a volume of the container and a label printed on the container. In various implementations, the label includes a substrate, a plurality of carbon-based sensors printed on the substrate, and one or more electrodes printed on the substrate. The sensors may be collectively configured to detect a presence of one or more analytes within the container. Each sensor may be configured to react with a unique group of analytes in response to an electromagnetic signal received from an external device. The electrodes may be configured to provide one or more output signals indicating the presence or absence of the one or more analytes within the container. |
| US11988624B2 |
Method for detecting at least one gas quantity of at least one predetermined gas by a measurement sensor of a plurality of gases
A method for detecting a gas quantity of a predetermined gas by a sensor having a sensitive layer configured to measure a plurality of gases, having an impedance Zs and a heating layer, the method include a step of supplying the heating layer with a voltage ramp defining a linear change in the supply voltage between a low voltage value and a high voltage value to modify the temperature of the sensitive layer during a variation period, a step of measuring variations in the impedance of the sensitive layer at a plurality of temperatures of the sensitive layer during the variation period, so as to detect a plurality of gas quantities, and a step of comparing a variation of the impedance at a given temperature of the sensitive layer to associate the gas quantity measured with a predetermined gas. |
| US11988623B2 |
Quantitative analysis method for fiber compositions
The present invention relates a fiber analysis method for determining ratio of components in the fiber comprising hydrophobic fiber component and thermoplastic fiber component. |
| US11988618B2 |
Method and system to determine crystal structure
Molecular structure of a crystal may be solved based on at least two diffraction tilt series acquired from a sample. The two diffraction tilt series include multiple diffraction patterns of at least one crystal of the sample acquired at different electron doses. In some examples, the two diffraction tilt series are acquired at different magnifications. |
| US11988617B2 |
X-ray unit technology modules and automated application training
A scanner comprises an electromagnetic wave source; and a detector positioned to measure emissions from the electromagnetic wave source, wherein the electromagnetic wave source comprises a first technology, and the electromagnetic wave source is interchangeable with a second electromagnetic wave source comprising a second technology and/or wherein the detector comprises a first technology, and the detector is interchangeable with a second detector comprising a second technology. Training the scanner to inspect for contaminants includes generating electromagnetic wave emissions at a plurality of combinations of parameters; moving a conveyor belt to expose product having a plurality of contaminants of different sizes to the emissions generated at more than one combination of parameters; recording attenuated emissions that pass through the product at more than one combination of parameters; and selecting a combination of parameters to use when inspecting for the contaminant. |
| US11988611B2 |
Systems for parsing material properties from within SHG signals
Semiconductor metrology systems based on directing radiation on a wafer, detecting second harmonic generated (SHG) radiation from the wafer and correlating the second harmonic generated (SHG) signal to one or more electrical properties of the wafer are disclosed. The disclosure also includes parsing the SHG signal to remove contribution to the SHG signal from one or more material properties of the sample such as thickness. Systems and methods described herein include machine learning methodologies to automatically classify obtained SHG signal |
| US11988608B2 |
Method for determining the presence of an acidic sulfide species in a non-aqueous liquid using a metal complex dye
A method for determining the presence of an acidic sulfide species in a liquid sample of an industrial or environmental material. The method includes the step of contacting the sample or an extract thereof with a composition including a metal complex dye compound in which the electromagnetic absorption spectrum of the metal complex dye compound changes upon reaction with an acidic sulfide species. |
| US11988602B2 |
Surface plasmon resonance detection system
An example SPR detection system includes a first prism having a first surface adjacent to a first metal layer exposed to a sample gas, and a second prism having a second surface adjacent to a second metal layer exposed to a reference gas. At least one light source is configured to provide respective beams to the first and second surfaces, where each of the beams causes SPR of a respective one of the metal layers. At least one photodetector is configured to measure a reflection property of reflections of the respective beams from the metal layers during the SPR. A controller is configured to determine whether a target gas is present in the sample gas based on a known composition of the reference gas and at least one of an electrical property of the first and second metal layers during the SPR and the reflection property of the metal layers. |
| US11988600B2 |
Gas sensor MEMS structures and methods of fabrication thereof
A gas sensor, a method of manufacturing a gas sensor, a method for fabricating a micro electro-mechanical system (MEMS) die for a heater or thermopile, and a micro electro-mechanical system (MEMS) die for a heater or thermopile. The gas sensor comprises a first micro electro-mechanical system (MEMS) die comprising a light source; a second MEMS die comprising a light detector; a sample chamber disposes in an optical path between the light source and the light detector; and a holder substrate; wherein the first and second MEMS dies are disposed on the holder substrate in a vertical orientation relative to the holder. |
| US11988599B2 |
Miniature FT-MIR using a MEMS interferometer with a metasurface emitter and detector
A miniature Fourier transform mid-infrared (FT-MIR) spectrometer is provided. The FT-MIR includes a metasurface IR source to emit radiation when heated, a microelectromechanical (MEMS) interferometer, and a metasurface microbolometer to measure an interferogram from the MEMS interferometer, wherein the miniature FT-MIR spectrometer is less than about 20 mm in outer diameter. |
| US11988598B2 |
Optical cell cleaner
Systems, devices, and methods for an optical head enclosure of a sensor; one or more imbedded nozzles disposed on a surface of the optical head enclosure; an inlet of the one or more imbedded nozzles, where the inlet comprises a nozzle channel for receiving a cleaning solution; a flow channel internal to the optical head enclosure, where the nozzle channel is connected to the flow channel, and where the flow channel comprises an outlet for dispersing the cleaning solution received from the nozzle channel; wherein the inlet comprises a break to stop a nozzle of a cleaning device from reaching a mirror of the sensor; where the outlet directs the cleaning solution from the inlet onto the mirror. |
| US11988595B2 |
Method and device for the detection and monitoring of surface fouling
A method for the detection and monitoring of surface fouling from the nanoscale as a predictive or real-time monitoring tool is provided. Also provided are devices for carrying out the method, and to uses of the method, in particular for optimising cleaning procedures of devices or components thereof fouled by flows of foulant. |
| US11988591B2 |
Modular optical particle counter sensor and apparatus
A modular optical particle counter sensor and apparatus are described that consolidates counting functionality on a single main counter board and has expandable functionality through connections to plug-in system boards. The modular optical particle sensor may be directly connected to a manifold with an integrated venturi for better controlling the flow rate of the air stream passing through the apparatus for sampling. |
| US11988589B2 |
Parameters for use in particle discrimination
Aspects of the present disclosure include methods for characterizing particles of a sample in a flow stream. Methods according to certain embodiments include detecting light from a sample having cells in a flow stream, generating an image of an object in the flow stream in an interrogation region and determining whether the object in the flow stream is an aggregate based on the generated image. Systems having a processor with memory operably coupled to the processor having instructions stored thereon, which when executed by the processor, cause the processor to generate an image of an object in a flow stream and to determine whether the object is an aggregate are also described. Integrated circuit devices (e.g., field programmable gate arrays) having programming for practicing the subject methods are also provided. |
| US11988584B2 |
Disposable biopsy staining kit and related methods and systems
A disposable staining system is provided including an insertable module configured to receive a biological sample therein, the insertable module including a well in which the biological sample is positioned; and a staining cartridge configured to receive the insertable module including the biological sample therein, the insertable module being positioned in the staining cartridge. The insertable module has first and second inclined planes on opposing sides of an upper surface of the insertable module. A sled configured to receive the insertable module has corresponding first and second inclined planes on a bottom surface thereof. The first and second inclined planes of the insertable module and the first and second inclined planes of the sled are configured to transform horizontal movement of the insertable module into the staining cartridge into a vertical movement of the sled such that the sled is pushed upward. |
| US11988573B1 |
Method for determining a location to place a mass on a wheel assembly
A method is provided for determining a location to place a mass on a wheel assembly. A first set of acceleration data is collected from a plurality of inertial measurement units (IMU's) that are mounted to a removably attachable object that is attached to a wheel of the vehicle in a manner that inhibits the object from coming off of the vehicle when the vehicle is in motion. The first set of acceleration data is collected while operating the vehicle at a first speed. The first set of acceleration data is used to determine an offset between a center of the object and a bearing center of the wheel assembly. A second set of acceleration data is collected from the plurality of inertial measurement units (IMU's). The second set of acceleration data is collected while operating the vehicle at second speed that is greater than the first speed. The second set of acceleration data and the offset determined from the first set of acceleration data is used to determine the location to place the mass on a wheel assembly with respect to the bearing center of the wheel assembly. |
| US11988571B2 |
Arrangement and method for measuring a mechanical load on a test object, with the detection of changes in the magnetic field
The invention relates to an arrangement (100) for measuring a mechanical load on a test object, with the detection of changes in the magnetic field, said arrangement comprising a test object (14), which extends in a longitudinal direction L, and at least one sensor element (18) comprising a magnetic field generation device (20) for generating a magnetic field in the test object (14) and a magnetic field detection device (22) for measuring a change in the magnetic field in the test object (14). The sensor element (18) is arranged on a measurement surface (15) of the test object (14), at least one directional component of said measurement surface extending radially and/or transversely to the longitudinal direction L of the test object (14). A magnetic field is generated in the test object (14) and a change in the magnetic field in the test object (14) is measured on the measurement surface (15). The load measured is, in particular, a torque. |
| US11988568B2 |
Sensor based wearable fabric design for identifying distortion in movements and quantifying range of motion
This disclosure relates generally to a sensor based wearable fabric design for identifying distortion in movements and quantifying range of motion. Accurate quantification of multi-axial range of motion involved in complex movements of human body parts is challenging. The disclosure discloses a system and method providing a wearable fabric comprising a plurality of honey-comb structure with a plurality of adjacently placed hexagon structures. An optical sensor unit is placed on each side of each hexagon structure comprised in the plurality of honey-comb structures. A deformation of the plurality of sides of hexagon structure is determined to generate signatures of movement patterns of one or more body parts of a subject. Further, a comparison of generated signatures with stored signatures of the movement patterns is performed to determine an error indicative of a distortion in the movement patterns. The system and method accurately quantify range of motion with increased measurement accuracy. |
| US11988566B2 |
Pulling detection device and moving body system comprising same
A pulling detection device includes: a base in which, on a foundation portion, a first wall portion, a projection, and a second wall portion are provided; a movable rod including a switch operation body and a pulling rod, the switch operation body having a first wall portion opposed surface, a projection opposed surface, and a second wall portion opposed surface, the pulling rod extending from the second wall portion opposed surface, while movement of the movable rod toward one side is restricted by contact between the first wall portion and the first wall portion opposed surface and movement of the movable rod toward another side is restricted by contact between the projection and the projection opposed surface; an elastic body provided between the second wall portion opposed surface and the second wall portion; a first switch which operates by contact/separation; and a second switch which operates by contact/separation. |
| US11988565B2 |
Process-insensitive sensor circuit
A sensor system included in an integrated circuit includes multiple sensor circuits and a control circuit. Using characterization data, a model may be generated that defines a relationship between measurable parameters of the integrated circuit and an operating characteristic of the integrated circuit. The control circuit can combine, using a function included in the model, data from the multiple sensor circuits to determine a value of the operating characteristic that is more accurate than a sensor circuit configured to measure a single parameter of the integrated circuit that varies with the operating characteristic. |
| US11988562B2 |
Interferometer with at least one dispersive element
An interferometer for use in remote sensing systems includes a beam splitter that separates an input wave into a reflected wave, which travels along a first optical path within an upper interferometer arm, and a transmitted wave, which travels along a second optical path within a lower interferometer arm. The reflected and transmitted waves are subsequently recombined by the beam splitter for imaging onto a sensor. A highly dispersive element is incorporated into at least one of the pair of interferometer arms. Due to anomalous dispersion, a frequency shift in a wave transmitted through a dispersive element changes the optical path length within its corresponding arm. As a result, the recombined wave produces an interference pattern with a measurable phase change that can be utilized to calculate the original frequency shift in the input wave with great precision and potential sub-Hertz sensitivity. |
| US11988561B2 |
Method for producing a thermal infrared sensor array in a vacuum-filled wafer-level housing
A method for producing a thermal infrared sensor array in a vacuum-filled wafer-level housing with particularly small dimensions, consisting of at least two wafers, a cover wafer and a central wafer comprising multiple infrared-sensitive sensor pixels on a respective thin slotted membrane over a heat-insulating cavity is disclosed. A method for producing a high-resolution monolithic silicon micromechanical thermopile array sensor using wafer level packaging technology, wherein the sensor achieves a particularly high spatial resolution capability and a very high filling degree with very small housing dimensions, in particular a very low overall thickness, and can be inexpensively produced using standard CMOS processes. This is achieved in that the cover wafer is first rigidly mechanically connected to the provided central wafer comprising the sensor pixels with the infrared-sensitive pixels by means of wafer bonding, and the central wafer is then thinned out from the wafer rear face to a specified thickness. |
| US11988557B2 |
Electric field detection method and system
Methods and systems are described for use in determination of the presence, type (static or AC), direction, and/or strength of an electric field. Methods include examination of a gaseous sample to determine the presence of perturbation effects brought about by dielectrophoretic forces acting on components of the gaseous sample, and thereby, to identify the presence of an electric field. Examination of a gaseous sample can include Raman spectroscopy. A gaseous sample can be analyzed to determine the presence of molecular polarization due to an induced dipole on a polarizable molecule. |
| US11988554B2 |
Photon number resolving superconducting detector
A method of resolving a number of photons received by a photon detector includes optically coupling a waveguide to a superconducting wire having alternating narrow and wide portions; electrically coupling the superconducting wire to a current source; and electrically coupling an electrical contact in parallel with the superconducting wire. The electrical contact has a resistance less than a resistance of the superconducting wire while at least one narrow portion of the superconducting wire is in a non-superconducting state. The method includes providing to the superconducting wire, from the current source, a current configured to maintain the superconducting wire in a superconducting state in the absence of incident photons; receiving one or more photons via the waveguide; measuring an electrical property of the superconducting wire, proportional to a number of photons incident on the superconducting wire; and determining the number of received photons based on the electrical property. |
| US11988549B2 |
Apparatus, methodologies and software applications for determining a level of direct sunlight
A software application is provided to easily determine an indication of an amount of light available at a location at a given point in time. The software application may be used indoors or outdoors and is configured to be easy to use and highly accurate. |
| US11988534B2 |
Thermopile sensor
A thermopile sensor includes a thermopile. The thermopile is formed by connecting thermocouples, in series on an insulating film, in which a first PolySi interconnect and a metal interconnect including a metal portion in at least a part thereof are connected, each of the thermocouples connected in series is arranged side by side with a predetermined gap, the metal interconnect is arranged to overlap the first PolySi interconnect in each of the thermocouples, at a connection portion between a thermocouple and an adjacent thermocouple, the metal interconnect crosses the gap between the first PolySi interconnects, and a first width of a portion of the gap where the metal interconnect crosses the gap between the first PolySi interconnects is greater than a second width of a remaining portion of the gap between the first PolySi interconnects. |
| US11988530B2 |
Method for detecting an absolute angular position or an absolute angular movement path of a rotating member
A multi-pole annular encoder having 2N poles distributed irregularly is positioned facing a sensor that detects transitions between the poles. Times corresponding to the detected transitions are stored and the times that have elapsed between each transition and the previous transition of order 2N, which constitute durations for a complete revolution of a rotating member, are calculated. When the durations thus calculated are stable, a time that has elapsed between a tested transition and the previous transition is calculated, and a characteristic angle of the tested transition is deduced therefrom, this being proportional to a ratio between a time that has elapsed since the previous transition and a stabilized duration for a complete revolution. An index transition is identified and is used to ascertain absolute position of the encoder with respect to the sensor. |
| US11988527B2 |
Protection modules for on-board electronics and interconnection method
The present invention is used to compose the structure of a system that operates inside pipelines. It can be used in a robotic system in the form of a train to move tools inside small diameter tubes or ducts. It avoids the need for costly commercial connectors with limited variety of connections.The proposed solution is to partition/separate the electronic or hydraulic components into pressure vessel modules, thereby making it necessary to provide an adequate means of interconnection between said modules by means of an elastomeric conduit. Each module has a heat exchanger system (sink) to remove the heat generated by the electronic equipment installed inside thereof. The product of the invention has a sufficient degree of freedom to move in ducts and underwater pipes, where the hydrostatic pressure is extremely high. |
| US11988524B2 |
Polygon block shrinkage using push vectors
Techniques described herein may be used to adjust sets of bounded polygons in a predictable and automated manner. For example, a computer system may access a first set of polygons of a first type and a set of polylines of a second type. The computer system may group polygons from the first set of polygons into face groups. The computer system may determine that a first face group is anomalous based on a perimeter of the first polygon and first property of a first polyline of the set of polylines. The computer system may, for the first face group, compute a set of push vectors and apply the set of push vectors to the first face group. |
| US11988519B2 |
Navigation method, device, and system
Embodiments of the present application provide a navigation method, device and system. The method is applicable to a server and comprises: receiving current position characteristic information sent by a mobile terminal, and determining a position of an area matching the current position characteristic information based on the current position characteristic information and a locally stored database, and taking the determined position as an initial position; receiving target position characteristic information sent by the mobile terminal, determining a position of an area matching the target position characteristic information based on the target position characteristic information and the database, and taking the determined position as a target position; and determining a first route from the initial position to the target position and displaying the first route on an electronic map of the mobile terminal. Embodiments of the present application can provide users with accurate navigation information and improve user experience. |
| US11988518B2 |
Updating high definition maps based on lane closure and lane opening
A computer-implemented method may comprise: receiving sensor data from a sensor of an autonomous vehicle; determining a presence of a lane closure object located on a lane element; determining a change of the lane closure object, selected from the presence of the lane closure object or absence of the lane closure object on the lane element; generating a change candidate based on the change in the lane closure object; obtaining a plurality of the change candidates during a time period or the autonomous vehicle being on a preceding lane element on the route; analyzing the plurality of change candidates for the change being the presence of the lane closure object or the absence of the lane closure object on the lane element; generating a final change candidate based on the change; and providing the final change candidate for updating a high definition map of the route having the lane element. |
| US11988506B2 |
Error identification method for machine tool, non-transitory computer-readable storage medium, and machine tool
An error identification method includes: installing a calibrator including a sphere row A and a sphere row B in which a plurality of spheres are linearly aligned in a direction perpendicular to the sphere row A on a table such that the sphere row A and the sphere row B are approximately parallel to respective two of the translational axes and measuring positions of a plurality of spheres of the sphere row A and the sphere row B using a position measurement sensor tool; rotating the calibrator to a plurality of angles around a normal direction on the upper surface of the table to install on the table and measuring each position of the plurality of spheres of the sphere row A and the sphere row B; and identifying an error of the translational axis based on measured values in the installing and the rotating. |
| US11988505B2 |
Tape measure with light
A tool such as a tape measure, including a lighting system is shown. The lighting system includes a light source configured to direct light forward and strong enough to act as a flashlight. The tape measure further includes a housing designed to be compact and rugged enough to protect the internal components related to the lighting system from coming loose or suffering damage due to an impact or vibrations. |
| US11988504B2 |
Service tool
A service tool and method of using for calibrating a position of a cutting edge of a blade. The service tool may comprise an inward-side face disposed between a first face and a second face. The inward-side face may include a curved portion, a leg portion and a notch configured to receive the cutting edge. The first face includes a curved edge, a plurality of horizontal lines and a plurality of vertical lines. When the cutting edge is received in the notch, and the curved portion abuts the top face of a bolt, the plurality of horizontal lines is configured to measure a vertical distance from a center of the top face to the cutting edge, and the plurality of vertical lines is configured to measure a horizontal distance from the center of the top face to the cutting edge. |
| US11988497B2 |
Optical unit and film thickness measurement device
An optical unit includes an input portion configured to have measurement light having a wavelength extending from an ultraviolet region to a visible region input thereto, an optical system configured to condense the measurement light in a state where a chromatic aberration is caused to occur, and an opening portion configured not to image light having a wavelength in the visible region and to image light having a wavelength in the ultraviolet region of the measurement light having a chromatic aberration having occurred therein. |
| US11988493B2 |
Lanyard actuated percussion primer ignition mechanism for reserve battery activation
A striker mechanism including: a housing having a first surface; a slider movable in the housing, the slider having a projection or concavity, the slider having a second surface, the first and second surfaces defining an opening for a lanyard; a striker mass movably disposed relative to the housing, the striker mass having another of the projection and the concavity, the striker mass having a striker tip for engaging a primer; and a spring for biasing the striker tip relative to the housing. When the lanyard moves the slider within a first range of motion, the projection engages with the concavity to bias the striker mass towards the primer. When the lanyard moves the slider within a second range of motion, greater than the first range of motion, the projection disengages from the concavity allowing the striker mass to move towards the primer by a biasing force of the spring. |
| US11988488B2 |
Tracking projectile for target designation
A system and method for ordnance delivery that includes a projectile that, when embedded into a target, can transmit information such as location and position information to a computing device. The computing device can relay this information to a weapon system that can deliver ordnance to the target accurately. |
| US11988486B2 |
Counter-underwater vehicle apparatus and marker
A counter-underwater vehicle apparatus and marker. Moreover, a counter-underwater vehicle apparatus comprising a plurality of entanglement lines; a box configured to contain the plurality of entanglement lines; a suction cup coupled to the box configured to attach the box to a surface of an underwater vehicle; a release mechanism coupled to the box configured to detach the box from a bite plate and release the plurality of entanglement lines; and the bite plate selectively coupled to the release mechanism. Additionally a marker configured to highlight the location of an underwater vehicle, a box configured to contain and release the marker, a suction cup coupled to the box configured to attach to the box a surface of an underwater vehicle, a release mechanism coupled to the box configured to detach the box from a bite plate and release the marker, and the bite plate selectively coupled to the release mechanism. |
| US11988474B2 |
Weapon usage monitoring system having performance metrics and feedback recommendations based on discharge event detection
A system and method for recommending a corrective action based on a performance metric related to a discharge event of a firearm is provided. The method includes receiving, by a first event detection module associated with a first firearm, a plurality of first input signals over a sample window of time from a first inertial measurement unit configured on the first firearm; identifying, by the first event detection module, an occurrence of a first shot discharge of the first firearm at a shot time based on the plurality of first input signals; determining a first orientation of the first firearm at the shot time; determining a second orientation of the first firearm at a first time before the shot time; comparing the first and second orientations; determining a first performance metric related to pre-shot weapon orientation; and displaying a first recommended corrective action based on the first performance metric. |
| US11988473B1 |
Oxyhydrogen kinetic energy weapons system
A weapon has a barrel, a body connected to the barrel, a cylindrical part affixed to an internal cavity of the body, a magazine cooperative with the cylindrical part so as to dispense a projectile adjacent a front chamber of the cylindrical part, a receiver positioned in the front chamber of the cylindrical part, an actuator cooperative with the receiver, and a trigger cooperative at the front chamber of the cylindrical part so as to ignite oxyhydrogen gas in the front chamber in order to file the projectile through the barrel. The magazine has an oxyhydrogen tank in an interior thereof. The oxyhydrogen tank being in communication with the front chamber and the rear chamber of the cylindrical part. The receiver is adapted to receive a bullet therein. There actuator is adapted to move the receiver in order to chamber the projectile. |
| US11988469B2 |
Additively manufactured permeable barrier layer and method of manufacture
A vessel includes first and second portions that are non-permeable to a fluid and a third portion that is permeable to fluid. The first potion defines at least one exterior wall defining an exterior container. The second portion defines at least one interior wall defining an interior container encapsulated by the exterior container. The third portion is positioned between the at least one exterior wall and the at least one interior wall, is integrally formed with the first portion and the second portion, and has a porous structure with non-uniform connected porosity. |
| US11988466B2 |
Water heater bypass valves and devices thereto
The disclosed technology can include a bypass valve assembly having a partition that can fluidly separate an inlet and an outlet of a fluid heating system. A first bypass valve and a second bypass valve can be mounted to the partition and configured to permit a fluid to flow between the inlet and the outlet. The first bypass valve and the second bypass valve can be configured to transition between a closed state and an open state. The first bypass valve and the second bypass valves can each have a spring configured to transition the respective first and second bypass valve from the closed state in response to experiencing a pressure that is greater than or equal to a respective first or second predetermined pressure. The second predetermined pressure can be greater than the first predetermined pressure. |
| US11988463B2 |
Microchannel heat exchanger for appliance condenser
A heat exchanger that includes a microchannel tube having a plurality of straight sections interconnected by a plurality of bent sections; a plurality of accordion-style fins located between adjacent straight sections of the microchannel tube; and a plurality of brackets having a plurality of slots formed therein that are each configured for receipt of a respective straight section of the microchannel tube, wherein the plurality of brackets are configured to compress the accordion-style fins into direct engagement with the adjacent straight sections of microchannel tube, and wherein at least one of the accordion-style fins and the microchannel tube includes a mating feature that prevents lateral movement of the accordion-style fin relative to the adjacent straight sections of the microchannel tube. |
| US11988462B2 |
Heat exchanger and air conditioner using the heat exchanger
A heat exchanger is provided. The heat exchanger includes a configuration in which a heat transfer tube having a flat shape passes through a plurality of fins, and capable of securing drainage performance of condensed water retained on a surface of the heat transfer tube while improving a heat transfer rate, and further capable of suppressing an increase in ventilation resistance. The heat exchanger includes a heat transfer tube formed in a flat shape, and a plurality of fins, and a refrigerant flowing inside the heat transfer tube exchanges heat with air flowing between the plurality of fins. The fin includes a heat transfer expansion surface including a peak portion and a valley portion provided along an air flow direction, and a drain structure provided to overlap the heat transfer expansion surface. |
| US11988461B2 |
Additive airfoil heat exchanger
A heat exchanger includes a heat exchanger core. The heat exchanger core includes a first fin and a second fin. The second fin is spaced apart from the first fin. The heat exchanger core also includes a primary passage defined between the first fin and the second fin and extending through the heat exchanger core. The heat exchanger core also includes a plurality of airfoils extending through the first fin, the primary passage, and the second fin. At least one airfoil of the plurality of airfoils includes a secondary passage. The secondary passage extends through the heat exchanger core within the at least one airfoil transverse to the primary passage. |
| US11988457B2 |
Coaxial tube arrangement
A coaxial tube arrangement for a heat exchanger may include a coaxial tube and a closing cover. The coaxial tube may include an inner core channel and an outer annular channel. The closing cover may close the coaxial tube at a longitudinal end side. The closing cover may have a base region and a circumferential edge. The base region may be aligned transversely to a flow direction through the coaxial tube. The circumferential edge may be aligned with the flow direction and may face the coaxial tube. The circumferential edge may have a thickness, which is defined transversely to the flow direction, that is equal to or greater than a height of the annular channel, which is defined transversely to the flow direction. The circumferential edge may cover the annular channel transversely to the flow direction and may separate the annular channel from the core channel in a fluid-tight manner. |
| US11988454B2 |
Compact membrane-based thermochemical energy storage system
A thermochemical energy storage system. The system includes a membrane-based thermochemical reactor having a solution channel having an absorbent-containing solution flowing therethrough and a refrigerant channel having a refrigerant flowing therethrough along with first and second fluid channels. A porous membrane is positioned between the refrigerant channel and the solution channel; the porous membrane permits flow of vapor molecules therethrough while restricting flow of absorbent molecules. The system further includes a solution storage repository in fluid communication with the solution channel and a refrigerant repository in fluid communication with the refrigerant channel. The system can be used in high-density, high-efficiency, and low-temperature energy storage systems. The membrane-based reactor offers a large specific surface area and integrates solution/refrigerant flows, which enables formation of a highly compact reactor exhibiting strong heat/mass transfer. In some embodiments, direct diffusion of water molecules through the membrane makes it possible to lower the required charging temperatures. |
| US11988453B2 |
Thermal management planes
Some embodiments include a thermal management plane. The thermal management plane may include a top casing comprising a polymer material; a top encapsulation layer disposed on the top casing; a bottom casing comprising a polymer material; a bottom encapsulation layer disposed on the bottom casing; a hermetical seal coupling the bottom casing with the top casing; a wicking layer disposed between the bottom casing and the top casing; and a plurality of spacers disposed between the top casing and the bottom casing within the vacuum core, wherein each of the plurality of spacers have a low thermal conduction. In some embodiments, the thermal management plane has a thickness less than about 200 microns. |
| US11988451B2 |
Drift eliminator and method of making
A drift eliminator is provided that includes a plurality of blades interleaved by a plurality of spacers. Each spacer has a first leg, a second leg, and a support strip, each of the first and second legs including an upper edge and a lower edge, with the support strip extending laterally from the upper edge of the first leg to the upper edge of the second leg. Each blade includes at least one portion having a plurality of alignment slots formed therein, the plurality of alignment slots extending from an upper surface of the blade portion to a lower surface of the blade portion. Each spacer includes a plurality of alignment tabs extending from the first leg and the second leg, each of the plurality of alignment tabs interfiting with a corresponding one of the plurality of alignment slots in the at least one first blade portion. |
| US11988448B1 |
Mineral powder pellet drying device
The present disclosure relates to the technical field of mineral powder processing, and provides a mineral powder pellet drying device, the device includes a drying box body and a material preparation trough, and shunting buffer assemblies are configured to withstand the impact of falling mineral powder pellets in an elastically concave mode and guide the mineral powder pellets to two sides for dispersion. The device in the present disclosure has a simple structure, and is capable of buffering the impact strength of the falling mineral powder pellets, so that the breakage of the mineral powder pellets caused by a fast falling speed is avoided, therefore, the device in the present disclosure has a better drying effect and is highly applicable. |
| US11988444B2 |
Domestic appliance having a camera arranged in a door
A domestic appliance, which may be a cooling device, such as a refrigerator, includes: a treatment chamber that can be closed by a pivotable door; at least one camera arranged in the door for recording images from the treatment chamber when the door is open; and a door movement sensor for detecting values of at least one parameter of a door movement. The door movement sensor has at least one inertial sensor. At least one camera and the at least one inertial sensor are integrated in a camera/sensor module which is arranged in the door. The camera/sensor module has a communication device, at least for outputting image data from the camera of the camera/sensor module. The domestic appliance is configured to trigger at least one device function upon the detection of at least one trigger value. |
| US11988442B2 |
Refrigerator
A refrigerator includes a cabinet having a storage space and a door to open and close the storage space. The door includes a panel assembly including a front panel, a door frame connected to the panel assembly, a door liner connected to the panel assembly and the door frame and to define an insulating space, in which an insulator is disposed, together with the panel assembly and the door frame, and a sensor module installed on the door frame to sense a knock input applied to the front panel. The door frame includes a front wall that is in contact with the front panel and a rear wall spaced apart from the front wall and configured to define an accommodation space, in which the sensor module is accommodated, together with the front wall. |
| US11988441B2 |
Refrigerator management method, refrigerator management device, refrigerator management system, and temperature calculation method
A refrigerator management method according to one aspect of the present invention includes: obtaining log information including temperature information indicating an interior temperature of a refrigerator and opened and closed information indicating whether or not a door of the refrigerator has been opened and closed; calculating, based on the log information, a timewise change in the interior temperature for when the door is opened and closed in a predetermined period and for when the door is not opened and closed in the predetermined period; and outputting result information indicating a calculation result calculated in the calculating. |
| US11988440B2 |
Multi-chambered water tank for confined spaces in a refrigeration appliance
A system can include a fluid tank for a refrigeration appliance. The fluid tank can include a plurality of chambers. Each chamber of the plurality of chambers can include an inlet port and an outlet port. At least part of the outlet port can be on a horizontal plane that is offset in an upward direction with respect to the inlet port. At least two chambers of the plurality of chambers can be fluidly coupled in series. |
| US11988437B2 |
Refrigerator
A refrigerator including a sliding plate provided to be slidably moveable and couplable to a front surface of the door, a cover display provided to be rotatable and supported on the sliding plate, a display to which the cover display is couplable to be rotated together with the cover display, a plurality of rotation limitation parts provided to define a rotation range of the cover display, and a release screw provided to allow at least one of the plurality of rotation limitation parts to be adjusted to thereby release a rotation limitation of the defined rotation range of the cover display. As the cover display is being rotated beyond the defined rotation range as the rotation limitation of the cover display is released, the cover display is separated from the sliding plate together with the display and the cover display is no longer supported by the sliding plate. |
| US11988436B2 |
Refrigerator with a hidden display
A refrigerator includes a cabinet having a storage space, a door configured to open or close the storage space, a display assembly detachably coupled to the door, and a display window disposed on a front surface of the door and having a transmission part capable of transmitting light. The display assembly includes a first display disposed to correspond to the transmission part and a second display disposed not to correspond to the transmission part. |
| US11988434B2 |
Heat transfer system for warehoused goods
A high efficiency airflow management system can be used to reliably and consistently draw air through palletized product stacks with a minimum of energy expenditure. A racking system is provided with a grid of pallet bays separated from an air plenum/chamber by a wall having an airflow opening for each pallet bay. An air dam selectively permits or prevents airflow through portions of the airflow opening such that airflow may be allowed to flow through the entire opening, only a portion of the opening, or none of the opening. |
| US11988432B2 |
Refrigerator appliance having an air-cooled clear ice making assembly
A refrigerator appliance may include a cabinet, a liner, a thermodynamic assembly, an air conduit, a heat pipe, a conductive ice mold, and a water dispenser. The liner may define an icebox (IB) compartment. air conduit may be disposed within the IB compartment. The air conduit may define a conduit path between a conduit inlet and a conduit outlet downstream from the conduit inlet. The heat pipe may be mounted to the air conduit and extend therefrom outside of the conduit path. The conductive ice mold may be mounted to the heat pipe within the IB compartment. The conductive ice mold may define a mold cavity outside of the air conduit. The water dispenser may be positioned below the conductive ice mold to direct an ice-building spray of water to the mold cavity. |
| US11988430B2 |
Air conditioning unit for an accurate control of supply air temperature, and operation control method and operation control device for air conditioning unit
An air conditioning unit includes: a first refrigeration system including a first evaporator, a first compressor, a first condenser, a first one-way valve, and a first throttling element connected in sequence in a loop as well as a second one-way valve connected in parallel with the first compressor, and a first fluorine pump connected in parallel with the first one-way valve; and a second refrigeration system including a second evaporator, a second compressor, a second condenser, a third one-way valve, and a second throttling element connected in sequence in a loop as well as a fourth one-way valve connected in parallel with the second compressor, and a second fluorine pump connected in parallel with the third one-way valve, where the first evaporator and the second evaporator are arranged front and rear in sequence along a return air cooling duct. |
| US11988429B2 |
Control unit for a refrigerant compressor
A refrigerant compressor for refrigeration plants having a compressor unit driven by a drive unit. At least one of the compressor and drive units has a control unit which is controllable by delivery rate control system to control the refrigerant compressor at different delivery rates. An external delivery rate setpoint value is communicated to the delivery rate control system to prevent critical operating states. The delivery rate control system is configured to acquire, via a sensor, a compressor unit reference temperature. The delivery rate control system is configured to ascertain an operating state value group to acquire an operating state of the refrigerant compressor, and specify a delivery rate for operation of the refrigerant compressor outside of the critical operating states, if the value of the ascertained operating state value group based upon the compressor reference temperature permits a critical operating state of the refrigerant compressor. |
| US11988428B2 |
Low refrigerant charge detection in transport refrigeration system
A transport refrigeration system includes a compressor, a heat rejection heat exchanger, a flash tank, an expansion device and a heat absorption heat exchanger arranged in a serial refrigerant flow order to circulate a refrigerant; a controller configured to: determine a presence of at least one condition of the transport refrigeration system; and initiate a low refrigerant charge detection process in response to detecting the presence of the at least one condition of the transport refrigeration system. |
| US11988427B2 |
Refrigerant cold start system
A pumped refrigerant system can include a condenser, a pump coupled downstream of the condenser, an evaporator assembly coupled downstream of the pump, the condenser being coupled downstream of the evaporator assembly, and a refrigerant heating assembly coupled downstream of the pump, the condenser being coupled downstream of the refrigerant heating assembly. The refrigerant heating assembly can include a tank and a heating element coupled to the tank and configured to heat refrigerant within the tank. An input valve can be configured to selectively allow the pump to push refrigerant into the tank. An output valve can be configured to selectively inject heated refrigerant from the tank into plumbing upstream of the condenser. |
| US11988420B2 |
Refrigerant compressor having dedicated inlets for stator and rotor cooling lines
In some aspects, the techniques described herein relate to a refrigerant compressor, including: an impeller; a shaft; a motor configured to rotate the impeller via the shaft, wherein the motor includes a stator and a rotor; and a housing surrounding the motor, wherein the housing includes a first inlet configured to permit fluid to enter the housing and flow along a stator cooling line and a second inlet configured to permit fluid to enter the housing and flow a rotor cooling line, and wherein the first inlet is separate from the second inlet. |
| US11988419B2 |
Refrigeration cycle apparatus
A refrigerant circuit includes a compressor, a high-pressure side heat exchanger, a decompressor, and a low-pressure side heat exchanger, which are annularly interconnected by a refrigerant pipe, and is configured to circulate refrigerant. The refrigerant circuit performs an oil recovery operation based on an operation history of the compressor during a normal operation of the refrigerant circuit and an amount of oil in the compressor detected by an oil depletion sensor. |
| US11988414B2 |
System and method for control of electric water heater
System and methods of operating a water heater receiving power from an electrical grid. The water heater includes a heating element, a controller, and a first control circuit. The first control circuit including an energizing terminal and a microprocessor. The method includes connecting an energizing terminal of the first control circuit between a power output terminal of the controller and the heating element, receiving driving power from the controller based on a temperature signal. The method also includes receiving a control signal from the controller based on electrical grid information, and selectively energizing the heating element, by the microprocessor of the first control circuit and through the energizing terminal of the first control circuit based on the control signal. |
| US11988412B2 |
Methods and systems for modulating energy usage
The present disclosure relates to modulating energy consumption by a water provision system installed in a building, including one or more electrical heating elements operable to heat water, a heat pump configured to transfer thermal energy from outside the building to a thermal energy storage medium inside the building and a control module configured to control operation of the water provision system, the water provision system being configured to provide water heated by the one or more electrical heating elements and/or the thermal energy storage medium to one or more water outlets, This can include: determining a level of energy demands of a geographical region comprising the building; and upon determining that the level of energy demands is high, controlling the water provision system to switch from using the one or more electrical heating elements to the thermal energy storage medium for provision of heated water. |
| US11988407B2 |
Dehumidifier
A dehumidifier includes a machine body having a dehumidification function and a water tank including a receiving cavity. The receiving cavity includes a support boss on an inner side wall of the receiving cavity. The dehumidifier has a working state, in which a bottom of the machine body abuts against the support boss. |
| US11988406B2 |
Return air grille air purifier
A return air grille air purifier including an air filtration system including a media filter and a filter enhancement module. The filter enhancement module includes an ionization array configured to charge particles in an airstream passing through the filter enhancement module and towards the media filter. The return air grille air purifier also includes a first housing and a second housing configured to contain the air filtration system. The second housing contained within the first housing in a closed position and the second housing configured to move outward with the air filtration system at least partially out of the first housing in an open position. The media filter being removably accessible from the second housing in the open position. |
| US11988405B2 |
Air duct and an assembly for a fume extraction hood
An air duct which extends substantially in a longitudinal direction (X), having a duct wall which encloses a flow cross section and has, on its inner side, at least one fastening means for fastening at least one functional element, which can be accommodated in the air duct, in a variable position in the longitudinal direction (X) of the duct. |
| US11988403B2 |
Air conditioner and control method thereof
An air conditioner includes an outdoor unit having a compressor for compressing a refrigerant and an outdoor heat exchanger. A ventilator is connected to the outdoor unit by a plurality of refrigerant pipes. The ventilator includes a case having a supply passage, through which the outside air flows into the indoor space, a discharge passage through which the indoor air is discharged to the outside, a partition wall disposed in the case and separating the supply passage and the discharge passage, a main heat exchanger disposed in the supply passage, an outside air inlet damper, an indoor air outlet damper, a circulation hole damper, an outdoor temperature sensor, and a controller, configured to control operations of the dampers. |
| US11988402B2 |
Air conditioner, control method thereof and readable storage medium
A control method of an air conditioner includes obtaining a first operating frequency of a compressor of the air conditioner; in response to the first operating frequency being greater than or equal to a preset frequency, obtaining a current temperature of an evaporator of the air conditioner; and in response to the current temperature being less than a preset temperature, controlling the compressor to operate according to a second operating frequency greater than the first operating frequency. |
| US11988396B2 |
Multi-gas-source heater
A multi-gas-source heater is disclosed including a main shell, an ignition apparatus, a pipeline system arranged on the main shell, a temperature-sensing valve, a burner and a switching valve; the pipeline system has a first and second communication states; the temperature-sensing valve is connected to the pipeline system and can regulate flow of output gas; the burner includes a first and second nozzles both connected to the pipeline system; the ignition apparatus is connected to and can ignite the burner; the switching valve is connected to and can switch the pipeline system between the first and second communication states; when the switching valve switches the pipeline system to the first communication state, the first nozzle outputs the gas; when the switching valve switches the pipeline system to the second communication state, the second nozzle outputs the gas, or the first and second nozzles both output the gas. |
| US11988394B2 |
Operator control panel and domestic appliance
An operator control panel for a household appliance includes an operator control front, a panel carrier supporting the operator control front and having a recess, and a haptic actuator guided through the recess of the panel carrier for coupling to the operator control front so that during an operator control procedure of the operator control panel the haptic actuator outputs a haptic signal as feedback to a user in response to the operator control procedure via the operator control front. |
| US11988392B2 |
Removable heating element cover for an oven appliance and methods of detecting same
An oven appliance includes a chamber, a fan assembly operable to cause air to flow in the chamber, and a first heating element adjacent to a bottom wall of the oven appliance. The oven appliance further includes a removable heating element cover configured for defining a duct in fluid communication with the fan assembly and the first heating element for directing airflow in the chamber to the fan assembly and across the first heating element to heat a food item. The oven appliance also includes a sensing device for detecting a presence of the heating element cover and a controller having a processor configured to receive an indication from the sensing device confirming whether the heating element cover is engaged with the sensing device and control operation of the oven appliance based on the indication. |
| US11988391B2 |
Pan support, gas hob and method for producing a pan support
A pan support for a gas cooker includes a support structure for a container for food to be cooked. The support structure of the pan support has a contact surface for the container and a channel for a flammable combustion gas and air mixture, which channel leads to gas outlet openings. |
| US11988390B1 |
Body-mounted hinge assembly component
An appliance includes a hinge assembly for coupling a door to a housing or body of the appliance. The hinge assembly can include a body-mounted component, such as a body-mounted hinge or a body-mounted receiver. The body-mounted component is secured to a vertical support of the appliance. A mating component of the body-mounted hinge or body-mounted receiver is attached to the door. |
| US11988388B1 |
Wood-burning reduced smoke indoor-outdoor moveable fire pit
The invention describes a fire pit which includes at least three legs, a welded pipe cap base, a lower rail, a lower frame flange, a lower spark screen keeper, a reflector/spark screen, and upper spark screen keeper, an upper frame flange, an upper rail, a coil spring upper rail bumper, and a damper lid. The invention comprises an all-metal, wood-burning, reduced smoke, increased efficiency, essentially flame-contained, spark-suppressed, enhanced safety fire pit/fireplace with a metal screen enclosed vertical combustion column, dual safety rail barriers, manually moveable with incorporated two-wheel design, with grill surface, ash containment and ash removal apparatus, with various cooking implement attachment points, optionally configurable and fitted for either indoor or outdoor use, instantly extinguishable (by covering with the provided balanced handled steel safety barrel), and available with optional umbrella-picnic-table. |
| US11988384B2 |
Device for controlling the supply of a combustible gas to a burner of a heating apparatus
A device for controlling a combustible gas supply to a heating apparatus burner includes: a valve with a respective valve seat which is associated with a corresponding closure member provided with a respective control rod for opening the valve seat, a system for amplifying movement of the control rod which has a snap-fit spring which acts on the rod and a pushing element which in turn acts on the spring, a first end of a lever acts on the pushing element which is hinged at a fulcrum location which is positioned at an opposing second end of the lever, actuator which moves the lever, operationally associated with the lever in a position between the opposing lever ends to control the lever about the fulcrum location resulting in movement of the closure member away from and towards the valve seat, the actuator comprising a linear actuator element with converse piezoelectric effect. |
| US11988381B2 |
Catalytic thermal debind furnaces with feedback control
Apparatus and methods for debinding articles. The apparatus and methods may transform binder from furnace exhaust before the exhaust is discharged to the atmosphere. The apparatus may include a furnace retort and a reactor. The furnace retort may be configured to: exclude ambient air; and receive a carrier gas. The reactor may be configured to: receive from the retort (a) the carrier gas and (b) material removed in the retort from the article; and combust, at a temperature no greater than 750° C., the material. The material may be decomposed binder. The material may be hydrocarbon from binder that is pyrolyzed in the retort. The carrier gas may include gas that is nonflammable gas. |
| US11988379B2 |
Burner for a cooking appliance
Aspects and features of a burner for a cooking appliance include a first plate defining flame ports arranged in flow-sharing groups around a periphery of a combustion surface and a second plate coextensive with the first plate. Each plate is contoured so that the plates define an annular void within the burner. The annular void is fluidly coupled to the flame ports. In some aspects, each flow-sharing group includes clusters of flame ports, with each cluster including flame ports of two different diameters. The plates can each be made using the same tool such as a die, stamp, or mold, and the burner can be sized and installed in a cooking appliance so that it extends to cover a large portion of a wall of the cooking cavity of the appliance. |
| US11988375B2 |
Light source unit, light source module, and lighting device
A light source unit includes light-emitting elements, a light-shielding body, and a rod lens including a first end surface, a second end surface, and a side surface. The light-shielding body is separated from the side surface, covers the side surface, includes an opening exposing at least a portion of the second end surface, and includes a tip protruding further than the second end surface in a first direction from the first end surface toward the second end surface. A first plane crosses the first direction and is at the same first-direction position as the tip. A second plane crosses the first direction and is at the same position as the second end surface or between the tip and second end surface in the first direction. A first surface area of the opening at the first plane is greater than a second surface area of the opening at the second plane. |
| US11988370B2 |
Solid-state lighting fixtures with socket connections for accessories and accessories for use therewith
A solid-state lighting fixture assembly having a lighting fixture with a socket configured to receive a plug associated with one or more accessories to allow for easy in-field mounting of accessories, e.g., controls, onto installed lighting fixtures. The socket may be internally electrically connected to an auxiliary power output of a driver and/or to a battery power pack within the lighting fixture assembly, thereby providing direct-current voltage power for the accessory and, also, allowing for signal transmission to and from the accessory. Each accessory includes one or more sensors and communication components to provide the connected lighting fixture assembly with specific capabilities including, but not limited to, motion detection, ambient light level detection, ambient temperature measurement and wireless communications. The wireless communication can also be used to control one or a group of lighting fixtures and transmit sensor data associated with, for example, monitoring space utilization and asset tracking. |
| US11988367B2 |
Put wall light integration system, devices, and associated methods
A sorting system including a plurality of sorter light boxes, a hub, and a controller. The plurality of sorter light boxes may each be configured to be mounted to a respective shelf, and may each configured to be coupled to another one of the sorter light boxes to create a chain of sorter light boxes. The hub may be configured to be coupled to a first sorter light box in the chain of sorter light boxes. The hub may also be configured to operate as a concentrator of control signals and power for the sorter light boxes. The controller may be configured to be coupled to the hub and may be configured generate control signals for the sorter light boxes. |
| US11988365B1 |
Housing extension device and system
Systems, devices, and methods for a housing extension for lighting. A system embodiment may include: a primary housing, a first adjusting bracket attached to the primary housing, a second adjusting bracket, an adjustment screw inserted into both the first adjusting bracket and the second adjusting bracket, and an electrical component disposed within the primary housing. |
| US11988364B2 |
Device for increasing visibility of guy lines at night
Currently disclosed is a device for increasing visibility of a guy line at night. The device includes a housing, a light emitting source, a power source, and an on/off switch. The housing having an internal portion, external portion, and an attachment mechanism located on the external portion of the housing locking in place the housing to the guy line. The light emitting source is located within the housing and powered by the power source. The on/off switch is in contact with the power source providing readily activation of the light emitting source. The attachment mechanism may comprise at least one hook portion and a tensioning mechanism. The tensioning mechanism may comprise at least one offset portion. The tensioning mechanism prevents the device from sliding down the guy line. |
| US11988362B1 |
Flexible solar lamp
The flexible solar light may comprise a ground stake, a shock spring, a support post, a light housing, and a housing cap. The flexi-light solar may be an enclosure for a solar lighting system that may recover from a lateral impact by self-righting. Responsive to an impacting force applied to the flexi-light solar, the flexi-light solar may pivot away from the impacting force and then return to an upright position. |
| US11988357B2 |
Building egress lighting apparatus and system
One or more reduced, same form, light emitting apparatus(es) spaced apart and configured to be mounted at various heights and/or spacing employ the same power consuming light source input that is covered by a symmetrical or asymmetrical redirecting linear lens optics apparatus that is configured for use in a range of mounting heights to uniformly illuminate at least one legal path of egress below. |
| US11988355B2 |
Light module for a lighting device of a vehicle and method for reducing a color desaturation in a light module for a lighting device of a vehicle
A light module for a lighting device of a vehicle is disclosed having at least one illuminant and a light-guiding body which is suitable and destined for guiding radiation emanating from the illuminant and coupled into the light-guiding body to a light exit surface of the light-guiding body, and having at least one rear wall apparatus which is arranged at least in certain areas in the beam path of ambient radiation incident from externally through the light exit surface of the light-guiding body into the light-guiding body. The rear wall apparatus has at least one first rear wall region and at least one second rear wall region, wherein the at least one first rear wall region and the at least one second rear wall region differ from one another in terms of reflection and/or absorption properties, for example with regard to the ambient radiation. |
| US11988349B2 |
Lamp for vehicle and vehicle including the same
Disclosed is a lamp for a vehicle including a light source that outputs light, a light guide provided on a front side of the light source, and an inner lens provided on a front side of the light guide, the light guide includes an input area, into which the light is input from the light source, a reflection area connected to the input area, extending in one direction, and that totally reflects the light input from the input area, and an output area formed in an opposite direction to the input area with respect to the reflection area, connected to the reflection area, and in which the light reflected by the reflection area travels in a direction that faces the inner lens. |
| US11988348B2 |
Lamp for vehicle and vehicle including the same
A lamp for a vehicle includes a light source configured to emit light; a light guide provided in front of the light source and into which the light is incident; and a heat dissipation unit provided in close contact with one side of the light guide. The light guide includes a first recessed region formed on a bottom surface of the light guide and having an upward recessed shape, and the heat dissipation unit is provided in close contact with the first recessed region. |
| US11988347B2 |
Integrated strobe module
A strobe module can include a Fresnel lens that defines an external surface of the strobe module and a sidewall at least partially defining an internal volume and defining an external channel. A gasket can be disposed in the external channel. A substrate can be coupled to the sidewall to further define the internal volume and a light source can be disposed on the substrate in the internal volume. |
| US11988342B1 |
LED circuit board
An LED circuit board that includes an insulation board provided with connecting holes and a holding column, and at least two circuit boards; a first circuit board has a through hole, and a second circuit board has connecting columns; the connecting columns are detachably inserted in the connecting holes; the holding column is detachably inserted in the through hole; the insulation board is made of fire-retardant and fire-resistant plastic material. |
| US11988339B2 |
Apparatus for fixing pressure vessel
The present disclosure relates to an apparatus for fixing a pressure vessel, the apparatus including: a frame part disposed to be separable from the subject and configured to support the pressure vessel; and a foothold disposed on the frame part, thereby obtaining an advantageous effect of simplifying a structure and improving a degree of design freedom and spatial utilization. |
| US11988337B2 |
Gas control system and gas control method
A gas control system includes a high pressure tank, a temperature sensor, a pressure sensor, an injector, and a gas control ECU. The high pressure tank includes a liner, a reinforcing layer, and a discharge hole for discharging hydrogen gas from the liner. The temperature sensor detects the temperature of the reinforcing layer or the temperature around the outside of the high pressure tank. In the implementation of the gas control method, the gas control ECU, based on temperature information detected by the temperature sensor and pressure information detected by the pressure sensor, changes the timing of starting limiting control for limiting the discharge of hydrogen gas. |
| US11988336B2 |
Scalable greenhouse gas capture systems and methods
Scalable greenhouse gas capture systems and methods to allow a user to off-load exhaust captured in an on-board vehicle exhaust capture device and to allow for a delivery vehicle or other transportation mechanism to obtain and transport the exhaust. The systems and methods may involve one or more exhaust pumps, each with a multi-function nozzle assembly including an exhaust nozzle corresponding to a vehicle exhaust port and a fuel nozzle for supplying fuel to a vehicle fuel tank. Upon engagement with the vehicle exhaust port, the exhaust nozzle may create an air-tight seal between the exhaust nozzle and the vehicle exhaust port. An exhaust conduit may be configured to transport captured exhaust therethrough from the exhaust nozzle to an exhaust holding tank connected to and in fluid communication with the exhaust conduit. |
| US11988333B2 |
Bladder-type pressure tank and preparation method thereof
A bladder-type pressure tank includes an outer shell, a bladder, a nozzle, and an elbow pipe. The outer shell includes a liner and a glass-fiber layer covering the outer surface of the liner. The liner includes polyethylene (PE). The liner further includes a chamber, a first opening, and a second opening. The bladder is disposed in the chamber. In an inflated state of the bladder, a gap is formed between the inflated bladder and the inner surface of the liner. The bladder includes polyurethane (PU). The nozzle is integrated with the bladder, and is disposed in the first opening and seals the first opening. The elbow pipe includes a first end and a second end. The first end of the elbow pipe is disposed in the second opening and communicates with the chamber; and the second end of the elbow pipe is configured to connect to a pipeline. |
| US11988327B2 |
Ceiling mounted plastic storage bin holder
A plurality of brackets and hooks form a kit of ceiling mounted devices configured for removably storing plastic storage/container bins. Each bracket has a channel disposed below a top plane where the bracket is configured to abut against an underside of a ceiling. Each hook has an axle configured to be pivotably captured by the channel, where at least one prong extends from and is connected to the hook. The at least one prong extends upwards when the hook is pivotably hanging from the bracket when the bracket is attached to the underside of the ceiling. A portion of the bracket is configured to pass through an aperture of the hook, wherein the axle of the hook is configured to be disposed within the channel of the bracket. The at least one prong is configured to removably capture a rim of the plastic storage/container bin. |
| US11988322B2 |
Tripod design and manufacture
A tripod may be provided herein with nesting flip locks on inside faces of the tripod legs. The tripod may comprise a hub and a plurality of telescoping legs. Each of the telescoping legs may be coupled, at a proximal end of each of the plurality of legs, to the hub. Each of the plurality of legs may comprise a plurality of hollow leg sections and at least one nesting flip lock. The nesting flip lock may be coupled to an inward-facing side of one hollow leg section of the plurality of hollow leg sections. The nesting flip lock may comprise a collar coupled to a distal end of the one hollow leg section and a lever coupled to the collar, wherein the lever may comprise a cam mechanism to manage an engagement and disengagement of the nesting flip lock. |
| US11988321B2 |
Height-adjustable standing post
A height-adjustable standing post belongs to the technical field of height-adjustable devices. The height-adjustable standing post includes: a driving tube, an outer tube, a first fastener and a second fastener. The driving tube is supported on the ground. The outer tube is sleeved outside the driving tube, and the outer tube is allowed to rise and fall. The first fastener is provided between the driving tube and the outer tube, and the first fastener is fixed relative to a position of the driving tube. The second fastener is provided between the driving tube and the outer tube, and the second fastener is fixed relative to a position of the outer tube. The second fastener is provided with an auxiliary locking member, and the auxiliary locking member is used to manually lock the outer tube. The height-adjustable standing post has a wide height adjustment range, and is stable. |
| US11988317B2 |
Adaptive sealing devices for pipeline porous leakage
An adaptive sealing device for pipeline porous leakage. The device includes a pressure protection device and an encircling sealing rubber cover. The pressure protection device is used to pressurize and seal the pipeline by the encircling sealing rubber cover. The device further includes a control mechanism connected with the pressure protection device for adjusting the sealing pressure of the pressure protection device on the pipeline. The device further includes an anti-retraction mechanism connected with the pressure protection device and the control mechanism for limiting the pressure protection device and/or the control mechanism. |
| US11988313B2 |
Coupler for fire extinguisher nozzle accessory
A push-to-connect and quick-release coupler can be provided. In an example, the coupler can be used with or coupled to a fire extinguisher nozzle. The coupler can include a socket body and an automatic locking assembly. In an example, the locking assembly can include a collar movably coupled with the socket body, and a movable locking element. In a locked configuration, a fire extinguisher nozzle can be retained in the socket body, and the collar can be disposed in a first position, and the locking element can be biased by the collar toward the plug portion of the fire extinguisher nozzle. In a released or unlocked configuration, the nozzle can be removable from the socket body, the collar can be disposed in a second position, and the locking element can be unbiased by the collar. |
| US11988310B2 |
Apparatus for managing lines that need to be organized, sorted, and returned for storage
An apparatus for organizing, untangling, and storing multiple lines. The apparatus prevents tangling of lines and decreases wasted time in organizing, detangling, using, and storing lines. The apparatus includes a stop groove for preventing movement of the apparatus long the multiple lines being managed. The apparatus may also include an indicator for identification of the position of the stop groove. |
| US11988308B2 |
Electrostatic discharge mitigation device
This disclosure provides electrostatic discharge (ESD) mitigation devices. In one or more embodiments, the electrostatic discharge (ESD) mitigation device is a tubing connector to connect two or more conductive tubing segments in a fluid circuit, the tubing connector including an electrically conductive connector body with two or more attachment portions, two or more attachment fittings, and a conductive bracket configured to attach and interface with the connector body to electrically connect the connector body to ground. |
| US11988306B2 |
Joining structure, pipe joint, and method for forming joining structure
A joining structure airtightly or liquid-tightly joins an outer peripheral surface of the pipe member and an inner peripheral surface of a cylindrical member to be mounted on the pipe member, and the pipe member and the cylindrical member are made inseparable by an annular protrusion formed on the inner peripheral surface of the cylindrical member. |
| US11988304B2 |
Tubular elements with adhesive joint, method of joining tubular elements thereof
Apparatus and method for joining two tubular elements (14, 22) at a joint using an adhesive that is non-flowable at ambient temperatures but flowable at an elevated temperature. A ring (12) of uncured, non-flowable adhesive is placed around the male end of a male (14)/female (22) pipe interface. Upon exposure to elevated temperatures, the ring (12) melts and flows down into the interface, and cures. |
| US11988302B2 |
Fluid control device, abnormality detection method of fluid control device, abnormality detection device, and abnormality detection system
A fluid control device, capable of detecting leaks even if the leaks is slight, is provided. Further, a fluid leak abnormality is identified as a change accompanying an operation of the fluid control device and the fluid leaks is detected with high accuracy. A fluid control device, having a flow path and a closed space isolated from the flow path by a diaphragm and capable of detecting an abnormality, includes a pressure sensor detecting a pressure inside of the closed space, a processing module executing a predetermined information process, and an operation detecting mechanism detecting an operation of the fluid control device. The processing module executes a discriminating process discriminating abnormality of the fluid control device by comparing a detected value detected by the pressure sensor with a predetermined threshold value, and a correcting process correcting the predetermined threshold value in accordance with the operation of the fluid control device. |
| US11988300B2 |
Pneumatic actuation valve assembly
This system is a pneumatic actuation valve assembly that can include a frame; a timing spool housing; a timing spool carriage; a timing spool; a magnet configured to bias the timing spool in a forward position; a main spool and configured to travel toward a frame forward portion when a fluid is received into a mid-main spool pressure area wherein the main spool actuates a bolt carried by the frame and is configured to receive a projectile in an open position and chamber the projectile in a closed position; and, a bore defined in the timing spool configured to allow pressure in a rear main spool pressure area to escape through the bore releasing rearward pressure on the timing spool allowing the timing spool to travel from the rearward position to the forward position according to an attraction of the magnet. |
| US11988297B2 |
Multi-position valve
Improved valve assemblies (e.g., multi-position valve assemblies) are provided. More particularly, the present disclosure provides for high efficiency multi-position rotary backwash valve assemblies. In exemplary embodiments, the present disclosure provides for a four-position rotary high efficiency valve assembly for a swimming pool or spa filter. The present disclosure provides multi-position valve assemblies having infrequent maintenance and allowing for user-friendly service. The present disclosure provides for improved multi-position valve assemblies and related features, systems and methods of use. Improved, convenient and effective systems and methods for utilizing improved multi-position valve assemblies (e.g., high efficiency multi-position rotary backwash valve assemblies) are provided. The valve assembly can be utilized in fluid systems as a flow control assembly (e.g., as a backwash valve associated with a pool or spa filter). |
| US11988296B2 |
Capacity control valve
A capacity control valve includes a valve housing provided with a suction port through which a suction fluid of suction pressure passes, and a control port through which a control fluid of control pressure passes, a valve element configured to be driven by a solenoid, a spring that biases the valve element in the direction opposite to the driving direction by the solenoid, and a CS valve formed by a CS valve seat and the valve element and configured for opening and closing a communication between the control port and the suction port by movement of the valve element. The capacity control valve further includes a pressure receiving portion to which force in accordance with discharge pressure is applied in the axial direction of the valve element. |
| US11988295B1 |
Controllable variable flow valve having pivoting foot with abutting heel
A novel fluid valve system includes a housing defining a fluid path between first and second ports. The housing preferably includes an interior cylindrically-arcuate surface that defines a center of curvature, with the fluid flow path passing through an opening in the interior cylindrically-arcuate surface. The fluid valve may include a foot having a bottom and a heel, with the bottom facing the interior cylindrically-arcuate surface, and with the heel disposed transverse to the bottom. The foot may extend in a radial direction away from the center of curvature, with the foot pivoting within an operational angular range about the center of curvature. The bottom of the foot may be configured to translate over the opening in the interior cylindrically-arcuate surface, and the heel may be configured to abut the second port with the foot pivoted to a closed position of the operational angular range. |
| US11988293B2 |
Valve and package provided with the same
A valve for forming a passage through an inside and an outside of a packaging container constituted by resin molded articles or films are in communication with each other includes a breakable valve that's arranged to block the passage and splits open when internal pressure of the packaging container increases due to gas generated inside the packaging container, a check valve that's arranged on a secondary side located on an outer side to the breakable valve in the passage and through which the gas is discharged from the inside of the packaging container to the outside thereof according to internal pressure of the packaging container after the breakable valve has split open, and an attachment portion that delimits at least a portion of the passage and is fixed to the packaging container in a state of being sandwiched between the resin molded articles or the films constituting the packaging container. |
| US11988291B2 |
Valve unit
A valve unit includes an actuator, a first valve and a second valve. The first/second valve includes a first/second valve housing and a first/second valve body. The first/second valve body is rotatably arranged in the first/second valve housing. The two valves are arranged coaxially to one another and rotatable about a common adjusting axis. The actuator is non-releasably coupled to the first valve body and releasably coupled to the second valve body via the first valve body. The first valve body is rotatable in a first and second direction of rotation with the actuator. The second valve body in the coupled state is co-rotatable with the first valve body in the first/second direction of rotation and in the decoupled state is not co-rotatable with the first valve body at least in the second direction of rotation. In addition, a method for adjusting the valve unit is provided. |
| US11988290B2 |
Coolant flow control valve
A multi-level rotor for a coolant flow control valve assembly, which accommodates an increased number of inlet ports, outlet ports, and flow channels using a single rotor located in a housing, enabling a larger number of flow configurations. The housing includes nine ports which may function as an inlet or an outlet, which facilitates different flow configurations. For a thermal management system, reduced cost and less space utilization is achieved by a reduced number of valves, where the multi-level rotor is able to fluidically connect multiple inlets/outlets. This enables different flow configurations, depending on the degree of rotation. The channels at different levels are sealed from each other within the housing. The flow channels are manufactured into a single entity, therefore always having the same positional accuracy relative to each other when the rotor is repositioned. |
| US11988289B2 |
Bypass valve and water purifier
The present invention discloses a bypass valve and a water purifier comprising the bypass valve. The bypass valve comprises a valve housing and a valve core disposed in an inner space of the valve housing and capable of rotating in the inner space around an axial direction. The valve core comprises a first inlet and a first outlet disposed at intervals in an axial direction, a first annular seal fitted on an outer side surface of the valve core between the first inlet and the first outlet, and a first channel disposed within the valve core and communicating with the first inlet and the first outlet. The valve housing comprises a first opening and a second opening disposed at intervals in an axial direction, the inner space communicating with the first opening and the second opening, and a bypass opening provided on a side wall of the valve housing between the first opening and the second opening and communicating with the inner space and an outer space outside the valve housing. The bypass opening and the first circular seal are configured in such a manner that, when the valve core rotates, the first annular seal is capable of partitioning the bypass opening into two parts, and an axial position of a part of the first annular seal in contact with the bypass opening varies with the rotation of the valve core. |
| US11988284B1 |
Locomotive diesel engine power assembly cylinder head-to-cylinder liner gasket grommet
A method, system and device for gasketing and sealing of locomotive diesel engine power assembly's internal combustion cooling medium process. The method, system and device comprise a single metal gasket having a plurality of individual elastomeric grommets specifically constructed for sealing the internal power assembly cooling fluid movement through the muting surfaces of the two-piece assembly consisting of the cylinder liner and the cylinder head. The grommets pre-assembled into the gasket at a plurality of internal fluid passage locations are selectively configured to withstand the critical assembly clamping pressure condition and the extreme temperature fluctuations experienced during the combustion process itself. The grommet material composition includes a percentage of carbon black, and eliminates any elastomeric yellow coloration additive. |
| US11988283B2 |
Non-metallic engine case inlet compression seal for a gas turbine engine
A non-metallic engine case inlet compression seal for a gas turbine engine includes a non-metallic longitudinal leg section that extends from the non-metallic arcuate interface section and a non-metallic mount flange section that extends from the longitudinal leg section. |
| US11988282B2 |
Chain tensioner
A fixed-side support arm (17) of a torsion coil spring (10) is provided with a locking portion (17a) and a pressing portion (17c). The locking portion (17a) is housed in a recessed spring housing portion (22) provided in a lever (9), and an engaging portion (22a) abuts against the locking portion (17a) to lock a biasing force of the spring. A pressing force (F) is applied to the pressing portion (17c) to remove the locking portion (17a) from the spring housing portion (22), thereby releasing the locking by the engaging portion (22a). |
| US11988280B2 |
Blocking mechanism
A blocking mechanism including a transmission casing and a movable pawl having a locking finger. The movable pawl is pivotably mounted in a plane about a pivot axis on the transmission casing between a locking position in which the locking finger is engaged in the locking recess and a release position in which the locking finger is disengaged from the locking recess. The movable pawl includes a cam surface. A linear actuator moves a movable carriage guided by a guide rail, in which the movable carriage includes a cam follower capable of moving on the cam surface, and a housing formed in the transmission casing, in which the guide rail is fitted in the housing. |
| US11988278B2 |
Dual clutch transmission for a motor vehicle, in particular for an automobile, method for operating a dual clutch transmission of this type and motor vehicle
A dual clutch transmission for a motor vehicle, with a first sub-transmission, with a second sub-transmission, with a first clutch associated with the first sub-transmission, and with a second clutch associated with the second sub-transmission. The dual clutch transmission is designed to be shifted into a parking lock state, in which two gears of one of the sub-transmissions are simultaneously engaged, and in the lock state, the two gears of the one first sub-transmission are simultaneously engaged. A first gear wheel of a first of the gears, which is designed as loose wheel and rotatably arranged on a first shaft of the dual clutch transmission, is connected in a torque-proof manner to the first shaft, by a first switching element. |
| US11988277B2 |
Hydraulic system for a transmission of a motor vehicle
A hydraulic system (1) for a transmission (2) of a motor vehicle (3) includes a pump system (5) with a first pressure outlet (6) and a second pressure outlet (7), a primary circuit (11), a secondary circuit (12), and a system pressure valve (8) that has a system pressure valve slide (9). A secondary pump pressure (PPsek) output from the second pressure outlet (7) of the pump system (5) is fed to a radial pressure surface (26) of the system pressure valve slide (9), and therefore an axial load based on the secondary pump pressure (PPsek) acts upon the radial pressure surface (26) of the system pressure valve slide (9) such that the system pressure valve slide (9) tends to move counter to a mechanical preload force out of a first switching position into a second switching position. |
| US11988274B2 |
Passive gearbox lubrication system with a secondary sump
A passive lubrication system for lubricating components of a gearbox is provided. The passive lubrication system includes a first sump, formed in a housing of the gearbox, for holding a lubricant fluid for lubricating components of the gearbox and a second sump formed in the housing of the gearbox, the second sump for capturing lubricant fluid displaced, by rotation of the gear wheel, from the first sump, the second sump having one or more openings for directing lubricant fluid captured in the second sump to the one or more components of the single speed drive system to provide lubrication to the one or more components of the single speed drive system. The passive lubrication system also includes a channel formed in the housing of the gearbox, the channel for channeling lubricant fluid, displaced by rotation of the gear wheel, from the first sump to the second sump. |
| US11988272B2 |
Transmission device with a floating bushing for supply media between components of a planetary transmission
A planetary transmission includes a transfer device for transferring a supply medium. First and second transmission parts rotate relative to one another, with the transfer device having an annular groove on a surface of the first transmission part or of the second transmission part. The transfer device has bores distributed over a periphery. The first transmission part includes a separate bush which points towards the second transmission part and has a sealing groove with a sealing ring axially on both sides of the annular groove. The bush is arranged rotationally fixed on a rest of the first transmission part and designed to float in an axial direction with sufficient play in order to tilt out of a coaxial relative position with respect to the first transmission part and/or to the second transmission part to the extent of a relative movability of the respective sealing ring within the associated sealing groove. |
| US11988264B2 |
Hydraulic damper with a baffle
A baffle press-fit against an inner portion of an outer tube defining an interior of a hydraulic damper. The baffle comprising a first wall, a second wall, opposite the first wall, a circumferential third wall, and a channel formed between at least a portion of the circumferential third wall and the inner portion of the outer tube. The channel comprising an inlet formed along at least a portion of the first wall, an outlet formed along at least a portion of the second wall, and a groove formed along at least a portion of the circumferential third wall and fluidly coupling the inlet to the outlet. |
| US11988262B2 |
Damping stopper
A damping stopper is interposed between two members axially displaced relative to each other and is provided with an elastic body which, when the interval between the two members decreases, is axially compressed by the two members and expands radially outward. In the elastic body, a second member suppressing the expansion is located in one axial region and attached to the outer periphery. When axially compressed by the two members, the elastic body expands while receiving resistance by the second member. The expanding elastic body contacts the side wall of one of the two members. |
| US11988260B2 |
Torque limiting mechanism for solar tracking systems
Torque limiters prevent the transmission of excessive torque between moving components of one or more gears in a tracker drive assembly. When an amount of torque between these moving components exceeds a threshold, the torque limiter may slip, thus allowing the components to move relative to each other. Embodiments disclosed herein may include a drive motor configured to rotate a drive shaft, at least one gear configured to translate rotation of the drive shaft into rotation of a PV module mounting structure, and a torque limiter interposed between an interior surface of a first component of the at least one gear and an exterior surface of a second component of the at least one gear to allow the first component to slip relative to the second component when an amount of torque between the first and second components exceeds a threshold. |
| US11988258B2 |
Brake assembly for an electric motor
A brake assembly for an electric motor includes: a brake pad plate, a driver, and a shaft. The driver includes an inner driver part and an outer driver part, which are connected to one another by an intermediate layer, the brake pad plate having an inner tooth system, which meshes with an outer tooth system of the outer driver part so that the brake pad plate is connected to the driver in a torsionally fixed but axially displaceable manner, the inner driver part being connected to the shaft in a torsionally fixed manner. |
| US11988257B2 |
Disk brake
The present disk brake includes a carrier fixed to a non-rotatable portion of a vehicle, a caliper attached to this carrier and including a piston configured to press an inner brake pad, a slide pin fixed to any of the carrier and the caliper and configured to allow the caliper to slidably move relative to the carrier in an axial direction of a wheel, and a driving mechanism including an electric motor and a speed reduction mechanism and configured to transmit a driving force of the electric motor to the piston via the speed reduction mechanism. At least a part of the driving mechanism is disposed on an extension of an axis of the slide pin. This configuration can prevent an increase in the size of the present disk brake, thereby improving the mountability thereof onto a vehicle. |
| US11988254B2 |
Dog clutch assembly, powertrain, and motor vehicle
A dog clutch arrangement for a motor vehicle having a clutch body. The clutch body has first teeth in a first toothing and an axially movable sliding sleeve arrangement with second teeth in a second toothing. The sliding sleeve arrangement has a shift ring and a sleeve with the second toothing. The shift ring and the sleeve at least partially overlap in axial direction and are arranged to be axially displaceable relative to one another. The shift ring and the sleeve enclose an intermediate space, a pneumatic damping which damps the movement of the sleeve and the shift ring relative to one another being formed with the intermediate space. |
| US11988249B2 |
Joint
The invention relates to a joint, in particular for use in a parallel kinematic positioning device, which has at least three rotational degrees of freedom, and which has a rigid carrier element and at least two elastically deformable joint devices arranged overlapping one another at least in sections on the carrier element, wherein each of the joint devices comprises two joint elements, and each of the joint elements has an elongated connecting section and a securing section arranged at one end of the connecting section for securing the joint device to a higher level unit, and the two connecting sections of each joint device extend in a direction pointing away from the carrier element in such a way that they cross over one another. |
| US11988244B2 |
Electronically-releasable suction cup assembly secured to an appliance
An electronically-releasable suction cup assembly is designed to releasably secure an object to a surface. The suction cup assembly includes a suction cup secured to the object. The suction cup has a cavity and is configured to be releasably secured to the surface. The suction cup assembly further includes a gas generating cell coupled to the suction cup. The gas generating cell is configured to selectively eject fluid into the cavity of the suction cup to release the suction cup from the surface. |
| US11988240B2 |
Locking tab-washer
A locking tab washer for rotatably locking a bolt fastened to a component in an aircraft engine has a body with an opening and at least four locking tabs positioned about the opening and circumferentially spaced apart from one another at integer multiples of a common angle relative to the center of the opening. The locking tabs are bendable towards to rotatably lock the bolt. The locking tab washer also has a retaining feature positioned about the opening and operable to rotatably retain the locking tab washer to the component. |
| US11988233B2 |
Working cylinder
A cylinder includes a cylinder tube, a first closure part, a second closure part, and a piston unit. The cylinder tube has a first tube end and a second tube end. The tube and end closure parts define a cylinder interior. The piston unit defines at least one working space in the cylinder interior. The first closure part is connected to the tube by a first peripheral laser ring weld and the second closure part is connected to the tube by a second peripheral laser ring weld. The laser ring welds each define a fluid-tight sealing plane. A peripheral sealing ring is located between each closure part and a tube inner wall at an axial distance from the associated laser ring weld seam. The peripheral sealing ring defines a pressure-separated ring section between the peripheral sealing ring and the associated laser ring weld seam. |
| US11988232B2 |
Actuator rotational alignment device
An e.g. fluid powered linear actuator is provided with a helical orientation surface in a fixed angular position relative to a first component; and a follower in a fixed angular position relative to a second component. When the first and second components are moved towards one another as the actuator is retracted, the follower engages and moves along the helical orientation surface to rotate the first and second components to a predetermined relative angular position. |
| US11988229B2 |
Diffuser pipe alignment tool
A method of positioning exits of diffuser pipes of a centrifugal compressor in an aircraft engine includes aligning an alignment tool with a structure supporting the diffuser pipes, and rotating each diffuser pipe about an inlet axis thereof to close a gap between a surface of the diffuser pipe and part of the alignment tool until the diffuser pipe abuts the part of the alignment tool. The alignment tool includes for example a body defining a center axis and having at least one tool datum configured for abutting against the casing, and a plurality of alignment members that are fixed to the body and extend radially from the body relative to the center axis. |
| US11988228B2 |
Air compressor for vehicle
Air compressor for a vehicle having improved internal cooling efficiency by ensuring a circulation flow of compressed air for internal cooling and allowing the compressed air to sufficiently flow. The air compressor comprises: a housing with a compression unit for introducing and compressing air from outside; a motor unit which includes a rotor and a stator, and drives the compression unit to rotate according to the rotation of the rotor; a bearing unit supporting the rotor to be rotatable; a cooling circulation flow path formed inside the housing for moving, in an axial direction, some of the air compressed in the compression unit and circulating the air to the compression unit; and a bypass flow path which receives some of the air passing through the cooling circulation flow path and bypasses a partial region of the bearing unit to join the cooling circulation flow path. |
| US11988226B2 |
Centrifugal blower
A centrifugal blower includes a box, a filter, an impeller, a scroll casing, a bell mouth, a partition wall, and a separation tube. The scroll casing defines an air passage gradually increasing from a nose portion in a circumferential direction. The partition wall divides the air passage into an upper passage and a lower passage. The separation tube includes an air introducing plate to partially cover the impeller and defining an air inlet portion and a tubular portion that extends from the air inlet portion through the impeller. On a virtual plane parallel to a rotational axis of the impeller, an outer edge of the air introducing plate extends and a passage between the filter and the upper passage is divided by the separation tube into a first passage cross-section closer to the nose portion and a second passage cross-section that is smaller than the first passage cross-section. |
| US11988222B2 |
Flexible guide vane structure of mixed flow pump with adjustable flow area, mixed flow pump and adjustment method
A flexible guide vane structure of a mixed flow pump with adjustable flow area, a mixed flow pump and an adjustment method are provided. The flexible guide vane structure includes a flexible guide vane and a flexible guide vane adjusting device. The flexible guide vane adjusting device includes a support rib, a support rib base and a base driving mechanism. As the skeleton of the flexible guide vane, the support rib realizes the shape change of the flexible vane through the base driving mechanism and the support rib base. In the mixed flow pump, the flexible guide vane adjusting device is installed inside the blade hub. Through the flow section feedback regulation system, the angle of the support rib is adjusted based on the real-time working condition of the mixed flow pump to adjust the flow area of the blade and achieve the best working condition. |
| US11988221B2 |
Refrigerant compressor with impeller having blades with wavy contour
This disclosure relates to a refrigerant compressor including an impeller. The impeller has a blade with a wavy contour. The wavy contour reduces flow separation relative to smooth, non-wavy blades. In particular, the disclosed wavy contour creates smaller trailing edge vortexes adjacent the blades. In turn, the wavy contour of the blades improves overall compressor efficiency. |
| US11988220B2 |
Volute assembly and induced draft fan comprising the same
A volute assembly includes a volute body, a cover plate, and a seal. The volute body includes a top plate, a side plate protruding axially from an edge of the top plate, a cavity formed by the top plate and the side plate, and an exhaust duct disposed on the side plate and communicating with the cavity. The side plate includes a first bottom edge and a plurality of clamping blocks disposed at intervals on the first bottom edge. The cover plate includes a bottom plate and an annular sleeve surrounding the bottom plate. The annular sleeve includes a second bottom edge and a flange protruding from the second bottom edge. The flange includes a plurality of buckles disposed at intervals. The seal is disposed around the annular sleeve and is supported by the flange. The side plate is matched with the annular sleeve in shape. |
| US11988218B2 |
Electric coolant pump with expansion compensating seal
An electric coolant pump system is presented including a housing having a main body and an end cap. The main body having a hollow interior and an open end. The end cap is operably connected to the main body and closes the open end of the main body. The system includes a rotor shaft operably connected to the housing. The system includes a rotor operably connected to the rotor shaft and positioned within the hollow interior. The system includes an impeller operably connected to the rotor. The system includes a stator configured to generate a rotating electromagnetic field during operation. The rotor is configured to rotate the impeller in response to the rotating electromagnetic field. The impeller is configured to pump a coolant when rotated. One or more components of the electric coolant pump system thermally expand and contract as the coolant is heated and cooled. |
| US11988217B2 |
Oil feed type air compressor
Provided is an oil feed type air compressor which can increase the determination accuracy regarding a deterioration state of oil. An oil feed type air compressor 1 includes a compressor main body 3, a separator 6 that separates oil from compressed air discharged from the compressor main body 3, and an oil feeding system 8 that feeds the oil separated by the separator 6 into a compression chamber of the compressor main body 3. The oil feeding system 8 includes a temperature control valve 20 that adjusts a diversion ratio for an oil cooler 18 and a diversion ratio for a bypass pipe 19 according to a temperature of the oil. The oil feed type air compressor 1 includes pressure sensors 22A and 22B located in the oil feeding system 8, a discharge temperature sensor 11 located on the discharge side of the compressor main body 3, and a controller 9 that computes, when it is estimated that the diversion ratio for the oil cooler 18 is 100% from the temperature sensed by the discharge temperature sensor 11 exceeding a predetermined value Td1, a difference ΔP between the pressure sensed by the pressure sensor 22A and the pressure sensed by the pressure sensor 22B and determines a deterioration state of the oil in reference to the difference ΔP. |
| US11988213B2 |
Multistage pump and subsea pumping arrangement
A multistage pump for installation on a sea ground includes a common housing, a pump unit arranged in the common housing, a drive unit arranged in the common housing, and a coupling. The common housing includes a pump inlet and a pump outlet, the pump unit including a plurality of impellers to convey a compressible fluid from the pump inlet to the pump outlet, and a pump shaft, on which each impeller is mounted, each impeller being a radial or semi-axial impeller. The drive unit includes a drive shaft to drive the pump shaft, and an electric motor configured to rotate the drive shaft about an axial direction. The coupling couples the drive shaft to the pump shaft. The pump unit conveys the fluid in a dense phase at the pump outlet, and at least two impellers of the plurality of impellers have a different specific speed. |
| US11988208B2 |
Sealing in helical trochoidal rotary machines
Sealing in rotary positive displacement machines based on trochoidal geometry that comprise a helical rotor that undergoes planetary motion within a helical stator is described. Seals can be mounted on the rotor, the stator, or both. The rotor can have a hypotrochoidal cross-section, with the corresponding stator cavity profile being the outer envelope of the rotor as it undergoes planetary motion, or the stator cavity can have an epitrochoidal cross-section with the corresponding rotor profile being the inner envelope of the trochoid as it undergoes planetary motion. In some embodiments, the geometry is offset in a manner that provides advantages with respect to sealing in the rotary machine. In multi-stage embodiments, the rotor-stator geometry remains substantially constant or varies along the axis of the rotary machine. |
| US11988203B2 |
Modular metering pump system
A metering pump system for supplying an aqueous chemical to a destination stock includes a first metering pump and a second metering pump connected to a common suction line and a common discharge line and operable to supply a desired chemical feed rate, an electronic flowrate sensor in communication with one of the common suction line and the common discharge line to measure an actual flowrate of the metering pump system, a controller in communication with the first metering pump, the second metering pump, and the electronic flowrate sensor, a control loop in use implemented by the controller to operate one or more of the first metering pump and the second metering pump to correct a deviation between the desired chemical feed rate and the actual flowrate measured by the electronic flowrate sensor. |
| US11988201B2 |
Electrochemical compressor
An anode current collector of an electrochemical compressor includes a plurality of first portions and a plurality of second portions that are alternately arranged from the first end portion toward an inner side in a plane direction of the anode current collector. In the first portion, a first porous body, a second porous body, and a third porous body are sequentially stacked. In the second portion, the first portion, the third porous body, and the second porous body are sequentially stacked. The porosity of the second porous body is larger than the porosity of the first porous body and the porosity of the third porous body is larger than the porosity of the second porous body. |
| US11988197B1 |
Wind turbine
A wind turbine assembly include a housing, a turbine disposed in the housing and configured to rotate about an axis, the turbine including a rotor and a plurality of blades which protrude from an outer surface of the rotor, and a funnel configured to collect fluid stream energy through a fluid inlet opening and to direct at least a portion of the collected fluid stream energy into the housing and in a first direction toward the turbine, and the funnel and the housing are configured to rotate together about an axis independently of the turbine blades. |
| US11988191B2 |
Inflatable wind turbine blade and attachment mechanism
Among other things, the present disclosure relates to a wind turbine rotor blade that can be assembled at the site of its wind turbine. The blade includes an internal structure which may be pre-fabricated with connections to the shell skin prior to being transported to the site of its wind turbine. A filler material may be injected into the layers of fabric making up the shell skin at the wind turbine site and allowed to harden at approximately atmospheric conditions. |
| US11988190B2 |
Method for producing a wind turbine blade and wind turbine blade
Disclosed is a wind turbine blade and a method for its manufacture. A lower shell part and an upper shell part are provided, each shell part having a leading edge end and a trailing edge end. A flatback profile component and web for connecting an inner surface of the lower side shell part with an inner surface of the upper side shell part are connected. The assembly which comprises the flatback profile component and the at least one web are placed on the lower shell part and the upper shell part is mounted. The wind turbine blade comprises a flatback profile component being arranged at the trailing edge, wherein the flatback profile component is coupled by at least one distance holder with at least one web, wherein the web couples the interior surface of the upwind side shell part with the interior surface of the downwind side shell part. |
| US11988187B1 |
Wind turbine blade with self-adaptive tip-sweep
A blade for a rotor of a wind turbine, the blade comprising: an inboard portion; an outboard portion connected to the inboard portion, wherein the outboard portion is deflectable by a variable sweep angle in an edgewise direction of the blade; and a passive mechanism configured to adjust the sweep angle in response to an amount of flapwise moment acting on the blade, such that the magnitude of the sweep angle increases in response to an increased flapwise moment, and decreases in response to a decreased flapwise moment. |
| US11988186B2 |
Airflow guiding device for the sound- and pressure-optimized supply of an airflow to an inlet nozzle of a fan, fan device, generator, and wind power installation
An airflow guiding device for the sound- and pressure-optimized supply of an airflow to an inlet nozzle of a fan, in particular a radial fan, wherein the inlet nozzle has a nozzle input opening with an incident flow angle, the airflow guiding device having: a frame device which extends along a longitudinal axis in an axial direction with a height between an inlet opening, through which the airflow flows into the frame device in an operating state, and an outlet opening, through which the airflow flows out of the frame device in the operating state, wherein the inlet opening has an inlet cross section with a minimum inlet cross-sectional width, and the outlet opening has an outlet cross section with a minimum outlet cross-sectional width which corresponds to the minimum inlet cross-sectional width or which is smaller than the minimum inlet cross-sectional width, and the frame device comprises a flow duct which connects the inlet opening and the outlet opening in terms of flow, wherein the outlet opening is configured to be connected in terms of flow to the inlet nozzle of the fan in the operating state, characterized in that the height of the frame device according to the following formula h≥(D−d)/(2·tan(β)) corresponds to a ratio of a difference of the minimum inlet cross-sectional width and a diameter of the inlet nozzle and double the value of the tangent of the incident flow angle or is greater than the ratio, and a grid element, which is arranged on the inlet opening. |
| US11988185B2 |
Valve with an integrated turbine for energy harvesting
An example valve includes: a seat member; a spool configured to be seated on the seat member to block fluid flow from a first port to a second port when the valve is in a closed state, wherein fluid at the first port applies a fluid force on the spool; a spring applying a biasing force on the spool toward the seat member, wherein as the fluid force overcomes the biasing force, the spool moves in the proximal direction off the seat member, thereby allowing fluid flow from the first port to the second port through a flow area formed between the spool and the seat member; a turbine configured to rotate as fluid flowing through the flow area flows downstream across the turbine; and an electric generator coupled to the turbine, such that rotation of the turbine causes the electric generator to generate electric power. |
| US11988184B2 |
Engine ignition system with multiple ignition events
In at least some implementations, a method of controlling spark events in a combustion engine, includes determining change in voltage at an input of a sensor during an engine revolution, and providing at least two spark event signals to attempt to provide at least two spark events in the engine during the engine revolution. In at least some implementations, the engine revolution is within a first threshold number of engine revolutions from attempted starting of the engine. In at least some implementations, the first threshold may include the first and up to ten engine revolutions from attempted starting of the engine. |
| US11988182B2 |
Integrated vehicular remote starting interrupter
A system and method of remotely enabling and disabling the starting of one or more vehicles using hardware components installed within a case and a data processing device (DPD), such as a smart phone, in logical communication with one of the vehicle and the case via a WAN, wherein an ignition request is relayed via the WAN to server which parses the ignition request into one or more encrypted ignition instructions, each encrypted ignition instruction sent to a separate vehicle exclusively associated with the encrypted ignition instruction. |
| US11988166B2 |
Rotary heat pump
There is provided a rotary heat pump capable of realizing further miniaturization, compared with a current status. As means of solution, a rotary heat pump includes: a rotary drive section including: a rotary shaft; a stationary gear; a rotor that has a rotor gear engaged with the stationary gear and that makes an eccentric rotation; a rotary housing along a peritrochoid curve defined by the eccentric rotation of the rotor; and a first side housing and a second side housing that cover one end side and the other end side of the rotary housing and that fix the stationary gear; a heat exchange fin provided in each of a compression region that is demarcated by the rotor and the rotary housing and that has a smallest planar area and an expansion region that has the largest planar area; and a heat insulation portion formed in a boundary portion between the compression region and the expansion region. |
| US11988164B2 |
Start control apparatus of internal combustion engine
A start control apparatus of an internal combustion engine includes: a gas sensor configured to detect a gas concentration of the liquefied gas fuel in a gasified state at a position near a combustion chamber; a scavenging pump configured to perform scavenging from a position upstream of the combustion chamber to a position downstream of the combustion chamber; and a control unit configured to prohibit a start of the internal combustion engine and operate the scavenging pump when the gas concentration detected by the gas sensor before the start of the internal combustion engine is equal to or greater than a predetermined threshold value. |
| US11988162B2 |
Engine intake system control device and control method thereof
An engine intake system control device configured to control an intake system of an engine, having a map function that inputs at least a fuel injection pressure of the engine, a fresh air flow, and a compressor outlet temperature of a supercharger, and outputs a control gain; and a control unit that inputs the control gain and a deviation between a controlled variable of the intake system of the engine and a target value thereof, and controls a manipulated variable of the intake system of the engine. |
| US11988156B2 |
Engine assembly and method of operation
A power plant assembly, including—a turbine for driving at least one rotor shaft; —a combustion chamber for generating drive energy for the turbine; —at least one electric machine which is coupled to the rotor shaft and can be operated both in a generator mode and in a motor mode; —and at least one energy storage system which is connected to the electric machine and can store energy generated by the electric machine when the electric machine is in generator mode. A set of control electronics of the power plant assembly is configured to operate the combustion chamber using a lean fuel-air mixture and, for this purpose, to selectively operate the at least one electric machine in generator mode or in motor mode, depending on the power to be applied by the power plant assembly. |
| US11988147B2 |
Heat exchanger for a hydrogen fuel delivery system
A heat exchanger for a hydrogen fuel delivery system includes a tube bank including an inner-tube where a first portion of the inner-tube extends through an inlet region of the tube bank, a second portion of the inner-tube extends through a mid-region of the tube bank, and a third portion of the inner-tube extends through an outlet region of the tube bank. A thermal buffer at least partially surrounds the inner-tube. A first portion of the thermal buffer extends along the first portion of the inner-tube, a second portion of the thermal buffer extends along the second portion of the inner-tube, and a third portion of the thermal buffer extends along the third portion of the inner-tube. A plurality of fins is disposed along the inner-tube and extends radially outwardly from an outer surface of the thermal buffer. |
| US11988146B2 |
Thermal management of a gas turbine engine shaft
A gas turbine engine includes a fan rotor, a compressor section, a combustor section, and a turbine section. The turbine section is positioned downstream of the combustor section. A fan drive turbine in the turbine section, and a shaft connects the fan drive turbine to the fan rotor. An inlet duct is connected to a cooling air source and connected to a cooling compressor downstream of the fan drive turbine. The cooling compressor is connected to an air source, and connected to a turning duct for passing compressed air in an upstream direction through the shaft. A method is also disclosed. |
| US11988145B2 |
Apparatus and method for mitigating airflow separation around engine combustor
According to one embodiment, a gas turbine engine component assembly is provided. The gas turbine engine component assembly comprising: a first component having a first surface and a second surface opposite the first surface, the first component including a cooling hole extending from the second surface to the first surface through the first component, wherein the second surface of the first component is oriented relative to a first airflow path such that airflow in the first airflow path separates from the second surface of the first component; and a first fairing secured to the first component proximate the second surface of the first component, the first fairing being configured to redirect airflow in the first airflow path such that the airflow exits the first fairing oriented parallel with the second surface of the first component. |
| US11988142B2 |
Inlet filter housing having components including portions of filter system that collectively form housing
An inlet filter housing includes a plurality of components that collectively form a complete filtering and conditioning system for filtering and conditioning a fluid along a housing flow path. Each component is fitted within an external structure of an International Organization of Standards (ISO) shipping container, which provides a rectangular cuboid enclosure. Each component includes operative structure of at least one of: a) only a portion of an axial extent of the filtering and conditioning system, and b) only a portion of a lateral cross-sectional area of the housing flow path. |
| US11988140B2 |
Gas turbine engine inlet wall design
A blended wing aircraft including a blended wing fuselage and at least one embedded gas turbine engine in the fuselage. The gas turbine engine includes an inlet duct formed with a generally elliptical shape that includes a first set of ellipse sections along an upper portion of the inlet duct and a second set of ellipse sections along a lower portion of the inlet duct. The inlet duct includes a vertical centerline. The first set of ellipse sections at a throat of the inlet duct is larger in area than an area of an upstream most end of the second set of ellipse sections. The area of the second set of ellipse sections increases toward a downstream end of the inlet duct. A fan section has an axis of rotation that is spaced from the vertical centerline and is disposed within an inlet duct orifice. The inlet duct is upstream of the fan section. |
| US11988139B2 |
Unit cell structures including stiffening patterns
Methods, apparatus, systems and articles of manufacture are disclosed for a structure of an engine component, including a first plurality of unit cells offset from a neutral plane in a first direction, a second plurality of unit cells offset from the neutral plane in a second direction, a plurality of nodes joining ones of the first plurality of unit cells and ones of the second plurality of unit cells, wherein the first plurality of unit cells and the second plurality of unit cells are arranged in pairs such that ones of the first plurality of unit cells are laterally adjacent to and interconnected with ones of the second plurality of unit cells, and wherein the structure is a stiffened structure. |
| US11988138B2 |
Hybrid propulsion system with integrated air-cooling system
The present disclosure provides air cooling systems and methods for propulsion systems (e.g., aviation or aerospace propulsion systems). More particularly, the present disclosure provides integrated air cooling systems and methods utilizing air cycle machine cooling for hybrid-electric aircraft or aerospace propulsion systems or the like. The present disclosure provides integrated air cycle machine cooling into the hybrid propulsion system (e.g., into the wing-mounted hybrid propulsion system). As such, the air cooling systems and methods of the present disclosure can minimize weight while improving electric motor/generator cooling. |
| US11988136B2 |
Turbomachine having a contrarotating turbine for an aircraft
A turbomachine having a contrarotating turbine for an aircraft, the turbomachine including a contrarotating turbine of which a first rotor is configured to rotate in a first direction of rotation and is connected to a first turbine shaft, and a second rotor configured to rotate in an opposite direction of rotation and connected to a second turbine shaft. The first rotor includes turbine wheels interleaved between turbine wheels of the second rotor, the turbomachine further including a planetary-type epicyclic mechanical reduction gear which has a sun gear driven in rotation by the second shaft, a ring gear driven in rotation by the first shaft, and a planet carrier attached to a first stator casing of the turbomachine located upstream of the contrarotating turbine with respect to a direction of flow of gas in the turbomachine. The turbomachine includes bearings for guiding the first and second shafts. |
| US11988134B2 |
Switching rack for a variable compression ratio connecting rod and a vehicle comprising such a switching rack
A combustion engine comprising a switching rack and a plurality of connecting rods, where the switching rack comprises a longitudinal body having a face side and a rear side, where the face side comprises a plurality of switching arrangements where each switching arrangement comprises a first cam and a second cam, where each switching arrangement is adapted to interact with a switch on a connecting rod, and where the switching rack is arranged in a gliding manner in a groove between a cylinder block and an engine bedplate of the combustion engine. The advantage of the invention is that a means for switching a variable compression switch in a connecting rod in a combustion engine can be mounted in a simple and reliable manner. |
| US11988129B2 |
Method for operating a fuel-operated burner
A method for operating a fuel-operated burner (3) downstream of an engine (1) and upstream of a catalytic converter (4), comprising an actuation of an ignition apparatus (12) of the burner (3) during a pre-definable preheating phase, without delivering fuel (11) to the burner (3) during the preheating phase, and, after the end of the preheating phase, a timely delivery of fuel (11) to the burner (3) and combustion of the delivered fuel (11) in the burner (3). Further, a computing unit and a computer program product for carrying out such a method are proposed. |
| US11988126B2 |
Exhaust manifold having turbine connector with turbine foot
A turbine connector (40) in an engine exhaust manifold (30) includes a turbine foot (54) attached to incoming exhaust conduits (42,46). The turbine foot (54) has an outer perimetric edge (72) defining a trapezoidal shape, and inner perimetric edges (86,90) forming exhaust outlets (88,92) from the incoming exhaust conduits (42,46). The inner perimetric edges (86,90) have varied perimetric curvatures largest in finite curvature size upon a web (94) extending between the exhaust outlets (88,92), and together forming an hourglass web profile in a turbine-mounting plane defined by the turbine foot (54). |
| US11988125B2 |
Method for automatically detecting clogging of a sensor pipe extending between a pressure sensor and an exhaust manifold of an internal combustion engine
The invention relates to a method for automatically detecting clogging of a sensor pipe extending between a pressure sensor and an exhaust manifold of an internal combustion engine, wherein the pressure sensor enables to record a signal representative of the relative pressure over time. The method includes at least one of the following steps: a) determining, while the engine runs in a steady operation state, an average amplitude of oscillations of the signal over a first period of time, the sensor pipe being considered clogged when said average amplitude is lower than a first threshold; b) monitoring, from the time the engine has been turned off, the signal over a second period of time, the sensor pipe being considered clogged when the integral of the signal is greater than a second threshold. |
| US11988122B2 |
Exhaust sound bypass
A vehicle comprising: an internal combustion engine having a cylinder and an exhaust manifold for collecting exhaust gases expelled from the cylinder; an exhaust system configured to channel exhaust gases along a flow path from the exhaust manifold to an exhaust outlet, the exhaust system comprising an exhaust component configured to cause an alteration to engine-generated sound pulses passing through the exhaust component; and a sound bypass device comprising a sound inlet port at a first location on the exhaust system before a first exhaust component along the flow path and a sound outlet port at a second location on the exhaust system after the first exhaust component along the flow path, the sound bypass device being configured to transmit engine-generated sound pulses from the sound inlet port to the sound outlet port whilst preventing flow of exhaust gases from the sound inlet port to the sound outlet port. |
| US11988120B2 |
Blow-by gas filtration assembly with threaded filter portion
A blow-by gas filtration assembly fluidically connects to a crankcase ventilation circuit of an internal combustion engine. The filtration assembly has an axis and includes a filter group having a hollow cylindrical shape with a central chamber radially traversable by the blow-by gases, preferably from the outside to the inside. In addition, the filtration assembly includes a support and control member engageable to the filter group for supporting it in an axial position along the axis and for controlling it in rotation around the axis to perform the filtration operations. The member and the filter group include, respectively, a threaded member portion and a threaded filter portion engageable by reciprocal screwing. The member and the filter group also include, respectively, a member abutment and a filter abutment axially engageable along the axis to prevent further screwing of the threaded member portion and a threaded filter portion. |
| US11988117B2 |
Engine lubrication oil consumption and condition monitoring
The present invention pertains to a method of determining a lubrication oil condition of a stationary gas engine comprising the steps of retrieving a lubrication oil temperature information and retrieving a lubrication oil level information from a lubrication oil level sensor, wherein the lubrication oil level sensor is a capacitance sensor, and a step of normalizing a lubrication oil level information over the lubrication oil temperature information. |
| US11988116B2 |
Combined valve actuating devices with specialized actuating cams for hydraulic lash self-adjustment
Embodiments provide combined valve actuating device with specialized actuating cams for hydraulic lash self-adjustment, including an actuator fixedly mounted on a rocker arm shaft and a rocker arm mounted with a hydraulic lash adjuster. The actuator is provided with a primary piston and an actuating piston. An actuating oil line is disposed between the primary piston hole and the actuating piston hole. The actuating oil line is connected to an oil supply line through a positioning and pressure control unit. A hydraulic linkage is formed between the primary piston and the secondary piston and an actuating valve is opened when oil is supplied to the actuating oil line. |
| US11988114B2 |
H2 boiler for steam system
A power plant comprises supplies of hydrogen fuel, oxygen fuel and water, a boiler comprising a burner for combusting hydrogen and oxygen to produce heat, combustion products and low/intermediate-pressure steam and a first heat exchanger configured to heat water to generate high-pressure steam, and a steam turbine comprising a first turbine configured to be driven only with the high-pressure steam to provide input to a first electrical generator and a second turbine configured to be driven by low/intermediate-pressure steam from the boiler. A method of operating a steam plant comprises combusting hydrogen fuel in a boiler to produce combustion products and LP/IP steam, turning a turbine with the combustion products, condensing water from the combustion products in a condenser, heating water from the condenser in a heat exchanger within the boiler to produce HP steam and turning a turbine with the steam from the first heat exchanger. |
| US11988111B2 |
Method for refitting blade shrouds of a rotor wheel in an aircraft turbomachine
A method for refitting blade shrouds of a rotor wheel in an aircraft turbomachine is described. The rotor wheel has a disc bearing blades that each have an airfoil extending between a root and a shroud, the shroud of each blade having lateral edges including shapes complementary to the lateral edges of the shrouds of the adjacent blades. The lateral edges of the shrouds are interlocked in engagement with one another such that anti-wear coatings of these edges are in contact with one another in a desired interlocking engagement position, and at least one of the lateral edges of at least one of the shrouds being able to be disengaged from the lateral edge of an adjacent shroud in an undesired disengagement position. The method includes, when an undesired disengagement position is detected, a step of inserting a re-engagement device into the turbomachine. |
| US11988109B2 |
Component with cooling passage for a turbine engine
An apparatus and method for an engine component for a turbine engine. The engine component having an outer wall defining an interior and extending between a root and a tip to define a radial direction, a tip wall spanning the first side and second sides to close the interior at the tip. A tip rail extending from the tip wall and having an inner tip rail surface, an outer tip rail surface extending from at least one of the first or the second side, and radially terminating in an upper tip rail surface connecting the inner tip rail surface and the outer tip rail surface. A tip rim formed in at least one of the outer surface or the inner tip rail surface and spaced from the upper tip rail surface in the radial direction, and multiple cooling passages formed in the outer wall and fluidly coupling the at least one cooling conduit to the tip rim at corresponding passage outlets. |
| US11988108B2 |
Turbine vane including a cooling-air intake portion including a helical element for swirling the cooling air
A turbine vane of a turbine engine such as a turboprop or a turbojet, the vane comprising a root supporting a blade, the vane including at least one air-circulation duct for cooling the air during operation, the duct including, at the vane root, an inlet portion for collecting the cooling air, the inlet portion extending away from a lower surface of the vane root opposite the blade. At least one inlet portion is provided with a helical element for rotating the cooling air in order to improve the cooling efficiency thereof. |
| US11988102B2 |
Method of cleaning blade of rotary device
A method of cleaning a blade of a rotary device includes: a first application step of applying a water-soluble cleaning liquid containing a surfactant to the blade; a setting-aside step of setting the blade to which the cleaning liquid has been applied aside; a first wiping step of wiping the blade after the setting-aside step; a second application step of applying water or a dilute cleaning liquid having a lower concentration of the surfactant than that in the cleaning liquid applied in the first application step to the blade after the first wiping step; and a second wiping step of wiping the blade after the second application step. |
| US11988099B2 |
Unducted thrust producing system architecture
An unducted thrust producing system, includes a rotating element, a stationary element. An inlet may be located forward or aft of the rotating element and the stationary element. An exhaust may be located forward, aft, or between the rotating element and the stationary element. |
| US11988098B2 |
Increasing surge margin and compression efficiency via shaft power transfer
In a gas turbine engine of the type having a high-pressure (HP) spool and a low-pressure (LP) spool, methods of increasing surge margin and compression efficiency at a given thrust are provided. One method increases compression efficiency and includes transferring mechanical power from the HP spool to the LP spool to reduce a corrected speed of a HP compressor therein and raise a working line of a LP compressor therein. Another method increases surge margin and includes transferring mechanical power from the LP spool to the HP spool to increase a corrected speed of a HP compressor therein and lower a working line of a LP compressor therein. |
| US11988095B2 |
Seals for managing thermal distortion in a turbomachine and methods for building the same
A seal assembly for a component of a turbomachine and method of assembly thereof is provided. The seal assembly includes at least one mating face positioned adjacent to the component and a seal coupled to the mating face. The seal includes an outer shell defining an interior space; an inner matrix filling the interior space comprising a plurality of unit cells comprising one or more metamaterials, wherein at least a portion of the plurality of unit cells are identical, and wherein the plurality of unit cells are repeated throughout the inner matrix; and one or more support struts extending throughout the inner matrix. The method of building the seal assembly may include selecting a first material for the outer shell and selecting the one or more metamaterials for the inner matrix based on the first material. |
| US11988089B2 |
Systems and methods for downhole communication
A downhole communication system includes a mud pulse generator that generates a set of pressure pulses in a pattern, the pattern including encoded data. A roll stabilized platform includes a turbine that is rotatable in response to the pressure pulses. The rotational rate of the turbine is correlated with a pressure value. A processor on the roll stabilized platform demodulates the pressure pulse pattern, and then decodes the encoded data. |
| US11988088B2 |
Downhole flowmeter
An intelligent completion module includes a flowmeter that uses one or more electromagnetic acoustic transducer (EMAT) sensors and a flow control valve. The flow rate and the speed of sound in the production fluid from a production zone is measured and used to make reservoir management decisions. The flowmeter includes at least two EMAT rings, including one or more EMAT sensors in a circular distribution which can be used in propagation or pulse-echo modes. In a segregated flow regime, a single EMAT sensor in pulse-echo mode is used to measure holdups of fluid components. |
| US11988084B2 |
Electronics enclosure with glass portion for use in a wellbore
A sealed enclosure can include a glass portion that can be positioned with respect to an electromagnetic component that is in an area defined by the sealed enclosure. The enclosure can prevent fluid from a wellbore environment from contacting the electromagnetic component and to allow the electromagnetic component to wirelessly communicate with a component external to the sealed enclosure. A second portion interfaces with the glass portion for preventing the fluid from the wellbore environment from contacting the electromagnetic component. |
| US11988083B2 |
Apparatus and methods for determining information from a well
A system for drilling a well may be adapted to process signals received from a fiber optic cable located in the casing of a previously drilled well or wells. The fiber optic cable may act as a distributed sensor receiving acoustic signals generated during the drilling of the well, and the system may be programmed to process the signals from the fiber optic cable to locate the borehole of the well being drilled, including its location relative to the previously drilled well or well. The system may be used to automatically update a well plan for the well being drilled responsive to information about the location of the borehole and also may be used to automatically adjust one or more drilling parameters or drilling operations responsive to the location of the second well borehole. |
| US11988079B2 |
Pressure bulkhead
A perforation tool, and a bulkhead member for a perforation tool, are disclosed. The perforation tool has a loading tube, an initiator module, and a bulkhead member connected between the loading tube and the initiator module. The bulkhead member has a hollow body member with a central transverse plate having a central bore through the transverse plate along a longitudinal axis of the body member and an electrical conductor disposed in the central bore, the electrical conductor having a pin connection at a first end thereof and a box connection at a second end thereof. |
| US11988074B2 |
Suction cylinder exploitation device and method for marine natural gas hydrates
The invention discloses a suction cylinder exploitation device and method for marine natural gas hydrates. The exploitation device comprises an exploitation cylinder, a water pump, a sand control device, a liquid-gas filling system and the like. Through the specially-designed exploitation cylinder and mating devices thereof, the exploitation cylinder can sink below a seabed surface to exploit natural gas hydrates deep below the seabed surface and can be withdrawn. A series of problems such as high well drilling and completion cost of traditional deep-sea drilling exploitation methods, and damage, collapses and sand generation of plain concrete wellbores under the effect of formation pressure are solved, and the limitations that traditional capping depressurization methods can only exploit submarine superficial hydrates and are low in exploitation efficiency are overcome. The invention can greatly reduce the exploitation cost of natural gas hydrates deep below the seabed surface and is of great significance for commercial exploitation of marine natural gas hydrates. |
| US11988072B1 |
Projectile drilling system
Systems for drilling or tunneling include an assembly for accelerating a projectile through a first conduit into a region of geologic material, which generates debris. The debris may be reduced in size by moving the debris to a crushing device located in a second conduit using a conveying device, such as an auger. The reduced-size debris is then moved toward the surface using fluid movement. A third conduit may be used to provide and remove material from the bottom of the first conduit to control pressure at the end of the conduit to prevent ingress of material into the first conduit. Water jets or other types of devices may be used to cut or deform a perimeter of a region of geologic material before the projectile is accelerated to control the shape of the borehole and the manner in which debris is broken from the geologic material. |
| US11988068B1 |
Staged multi-cluster fracturing sliding sleeve system based on smart key label
The invention relates to the technical field of oil and gas field development, in particular to a staged multi-cluster fracturing sliding sleeve system and method based on smart key label. The system includes at least one multi-cluster sliding correspondingly placed in each fracturing stage, an end sliding sleeve, and a smart key label. The method includes: step S1, performing fracturing stage by stage from a first stage to a last stage, placing the smart key label through a wellhead and pumping the smart key label to the target fracturing stage; step S2, opening the multi-cluster sliding sleeves of the current fracturing stage one by one through the smart key label, and finally blocking the smart key label in the end sliding sleeve when the multi-cluster sliding sleeve and the end sliding sleeve of the current fracturing stage are opened; and step S3, repeating the steps S1 and S2 until the fracturing operations of all the stages are completed. |
| US11988064B2 |
Managed pressure drilling control system with continuously variable transmission
An apparatus can include a choke with a flow restrictor having at least two positions, a flow coefficient Cv of the choke with the flow restrictor in one position being less than with the flow restrictor in the other position, and an operational device that displaces the flow restrictor at a variable actuation rate, the actuation rate with the flow restrictor in one position being less than with the flow restrictor in the other position. A method can include displacing a flow restrictor, thereby decreasing a flow coefficient Cv of a choke, and decreasing a rate of change of the flow coefficient Cv in response to decreasing the flow coefficient Cv. A drilling system can include a choke with a flow restrictor, and a continuously variable transmission which causes an actuation rate to vary based on a position of the flow restrictor. |
| US11988061B2 |
Hydraulic control line filters for subsea high-pressure application
Fluid containing contaminants may be filtered using a hydraulic control line filter for subsea high-pressure application comprising a housing, an end cap disposed at a first end of the housing where the end cap defines a filter fluid connector which comprises a fluid inlet and a filtered fluid outlet, a first centralizer disposed within the housing, a sump tube disposed within the housing and centralized within the first centralizer where an outside diameter of the sump tube and an inside diameter of the housing define a sump volume annulus there-between, a filter centralizer, and a fluid filter disposed in the housing and centralized within the sump tube by the filter centralizer. |
| US11988060B2 |
Systems and methods in which polyacrylamide gel is used to resist corrosion of a wellhead component in a well cellar
Systems and methods use polyacrylamide gel to resist corrosion of one or more wellhead components in a well cellar. Examples of such wellhead components include a surface casing and a landing base. The well cellar is part of a well, such as an oil well, a gas well or a water well. |
| US11988059B2 |
Dual activity top drive
A dual activity top drive may include a mechanized system configured for suspension from a traveling block of a drill rig and for engaging and rotating a drill string from the top of the drill string. The dual activity top drive may also include a primary pipe handling system suspended from the mechanized system and configured for handling a pipe string and an auxiliary pipe handling system suspended from the mechanized system and configured for handling a segment of pipe to be added or removed from the pipe string. |
| US11988055B2 |
Controllable downhole drilling and completion tool separating device and their method of use
A controllable downhole drilling and completion tool separating device and their method of use are provided. The device includes an upper mandrel connector, an outer sleeve, a claw clamp sleeve, a claw clamp locking ring, a mandrel sleeve, a lower connector, a piston ring and a pressure bearing ball. The upper end of the lower connector is on the outer side of the upper connector in a sleeving mode. A first annular cavity is between the lower connector and the upper connector. The piston ring is on the outer side of the upper connector in a sleeving mode and located in the first annular cavity. The claw clamp sleeve and the outer sleeve are sequentially arranged on the outer side of the upper connector in a sleeving mode. A second annular cavity is communicated with the first annular cavity and formed between the claw clamp sleeve and the upper connector. |
| US11988052B2 |
Methods and apparatus for deployment of large lost circulation material objects
A method, and related apparatus, involves providing one or more drill pipe segments and disposing a quantity of lost circulation material objects within the one or more drill pipe segments. A retention element is provided to retain the lost circulation material objects within the one or more drill pipe segments. The one or more drill pipe segments are connected to a drill string at a wellbore, and drilling fluid is flowed through the drill string. The flowing of drilling fluid through the drill string causes the retention element to release the lost circulation material objects to propagate further. |
| US11988040B2 |
System and method for reducing friction in a counterbalancing spring of a roller shade
A roller shade comprising a shade drive unit having a counterbalancing spring connected to and extending between a stationary spring carrier and a rotating spring carrier over an output mandrel, wherein the output mandrel comprises a length that maintains the spring in a stretched state such that the plurality of coils at the active portion of the spring do not contact each other when the shade material is at the rolled down position to reduce friction in the counterbalancing spring. |
| US11988030B2 |
Hinge assembly
A hinge assembly includes a mounting body to be secured on a furniture carcass, a furniture hinge which has two fitting parts interconnected via at least one joint axle, and a locking device, by which one of the fitting parts of the furniture hinge can be locked to the mounting body. The fitting part of the furniture hinge that is to be locked on the mounting body has three plates which are arranged one above the other and are interconnected at least by at least one common, pin-like retaining part. |
| US11988028B2 |
Door hinge
A door hinge has a first leaf assembly, a second leaf assembly, and a link assembly connected to the leaf assemblies for pivoting of the second assembly on the first assembly. An adjuster in the first leaf assembly can displace the link assembly relative to the first leaf assembly and thereby adjust a position of the door in the frame. The adjuster has an adjusting element projecting from the first leaf assembly in the closed position. The second leaf assembly is formed with a recess in which the projecting adjuster engages in the closed position. |
| US11988023B2 |
Intelligent electronic lock
The disclosure is an intelligent electronic lock. The intelligent electronic lock includes: an electronic lock shell, a wireless communication module, an instruction input device, the instruction input device is arranged on the electronic lock shell for instruction input, a processor, the processor is connected to the wireless communication module and the instruction input device is connected to receive and send signals, and the electronic rope. |
| US11988019B2 |
Drawer lock device
An anti-lock picking lock device is provided. The lock device features a locking cylinder having an opening configured to receive a drawer. The drawer having a keyway slot on its top surface and is configured to receive a similar shaped key. The drawer is enabled to slide within the clocking cylinder during use. In one position, the keyway slot is not exposed and occluded from any type of tampering. In another positon, the drawer is extended, either manually or via an electronic device, making the keyway slot accessible for operation. |
| US11988018B2 |
Rekeyable lock cylinder with enhanced torque resistance
A rekeyable lock cylinder with a cylinder body and a plug assembly. The lock cylinder includes a plurality of key followers and a corresponding plurality of racks disposed in the plug assembly. The lock cylinder includes, for example, a locking bar for blocking rotation of the plug assembly with respect to the cylinder body to prevent unlocking of the rekeyable lock cylinder with an unauthorized object. In some embodiments, the locking bar is configured such that torqueing the plug assembly with an unauthorized object applies force to the locking bar without translating such force to the plurality of racks. This type of arrangement enhances torque resistance of the lock cylinder against attempted forced entry. |
| US11988017B2 |
Key blank and key for actuating a disk cylinder and method of manufacturing such a key blank and key
A key blank for manufacturing a key for a disk cylinder having rotatable disk tumblers has a key shaft that extends along a longitudinal axis. The key shaft further has a plurality of notches that extend transversely to the longitudinal axis, that extend at equal spacings from one another, and that have the same depth. In a key, these notches may form chamfers of drive slopes for driving the disk tumblers. |
| US11988014B2 |
Inflatable surface-covering device
A device for covering a rectangular surface is provided that includes a cover (10) rotatably mounted on a drum (2), the device being capable of winding and unwinding the cover between an uncovered position and a covering position, rails (6) attached along the longitudinal sides of the surface, each of the rails includes an opening (6o) allowing the longitudinal edges (10L) of the cover to be locked in an air-tight manner, a blower system (51) suitable for blowing air (51a) into a volume under the cover and a flap (41) having an end (41s) which is sealed over a whole length of the second transverse side of the surface, a free end (41L) opposing the sealed end, such that the free end of the flap is in contact with the surface, the flap forming an air-tight seal between the cover and the surface along the second transverse side thereof. |
| US11988012B2 |
Wave generator system and method for free-form bodies of water
A wave park includes a body of water, and a track positioned in or proximate the body of water. The wave park further includes at least one foil coupled to move along the track and be at least partially submerged in the body of water. The at least one foil has a curvilinear cross-sectional geometry that includes a leading surface that is concave about a vertical axis to provide drag to generate a primary wave laterally in water of the body of water that contacts the leading surface of the foil, and a trailing surface that narrows from a maximum width of the foil adjacent the leading surface to a point at an end of the foil, the trailing surface to decrease the drag of the foil and to minimize oscillatory waves that trail the primary wave from the water moving past the leading surface of the foil. |
| US11988010B2 |
Fence brace system adapted to secure a fence rail to a fence post
The present invention comprises a brace adapted to secure one or more fence rails to a fence post. The present invention brace may optionally be installed onto an existing fence or on a new fence. The invention includes a fence post brace member adapted to connect to one or more sides of a fence post and a fence rail brace member adapted to connect to two or more sides of a fence rail. The fence post brace member may form a vertical picket fastener slot for use in affixing a picket to the fence post. The fence post brace system may be adapted to secure a fence rail to a fence post such as those having a fence rail positioned on one or more sides of the fence post and those defining a channel for receiving a fence rail. |
| US11988009B2 |
Fence brace system adapted for use with corner post arrangements
The present invention comprises a brace adapted to secure one or more fence rails to a fence post. The present invention brace may optionally be installed onto an existing fence or on a new fence. The invention includes a fence post brace member adapted to connect to one or more sides of a fence post and a fence rail brace member adapted to connect to two or more sides of a fence rail. The fence post brace member may form a vertical picket fastener slot for use in affixing a picket to the fence post. The fence post brace system may be adapted for use with corner fence post arrangements such as those having a fence rail positioned above and supported by the fence post and those defining a channel for receiving a fence rail. |
| US11988008B2 |
Connecting assembly for canopies
A connection assembly for an overhanging canopy comprises a support column and a connection adjustment mechanism. The connection adjustment mechanism is arranged on the support column. The connection adjustment mechanism includes a fixed block and a movable block. The fixed block is arranged on the top of the support column, and the rear side of the top of the fixed block is arranged with a mounting block, the inner wall of the mounting block is arranged with a connecting rod, the right side of the connecting rod penetrates the mounting block and extends to the outside of the mounting block, a limit frame is arranged on the front of the mounting block. |
| US11988000B2 |
Tilt-form bracket for concrete wall construction
A tilt-form bracket for tilt up concrete wall construction includes a triangle brace piece that is mated atop a shoe plate piece for thinner wall construction. An optional height extension piece may be mounted atop the triangle brace piece for thicker wall construction. The triangle brace piece may include a pair of spaced apart triangle braces separated by a vertical wall that defines a form connection through hole. |
| US11987999B2 |
Support head with quick release for formwork system
A support head mountable on a support post for supporting a beam in a formwork system is provided. The support head includes a top member for contacting and supporting the beam, a base member mountable on top of the support post, and a pin. Each of the top and base members has a tube with opposing pin holes. The tubes are configured to form vertically extending telescopic tubes, with the pin holes aligned along a horizontal axis. The pin is insertable into the pin holes, and has spaced apart depressions thereon. The pin is slidably moveable in the pin holes from a first position to a second position. In the first position, the depressions are offset from the pin holes. In the second position the depressions are aligned with the respective pin holes thus lowering the first tube and the top member in height. |
| US11987998B2 |
Climbing device having a climbing rail
A climbing device is proposed having at least one climbing rail for adjusting and/or climbing a scaffolding and/or a formwork and/or a platform, at least one climbing shoe being arranged on the climbing rail, at least one hydraulic cylinder comprising at least one drive piston, arranged in a cylinder housing, and having a hydraulic fluid being provided for raising the climbing shoe and/or the climbing rail and/or the scaffolding and/or the formwork and/or the platform, which at least partially avoids or at least reduces the disadvantages of the prior art. According to the invention this is achieved in that the hydraulic cylinder is embodied as a hydraulic unit, the hydraulic unit comprising at least one hydraulic tank for storing hydraulic fluid, an electric motor and a hydraulic pump driven by the electric motor for pressurizing the hydraulic fluid. |
| US11987994B2 |
Floor panel and method for manufacturing a floor panel
Floor panel, which includes a substrate and a top layer provided above, and preferably directly above, the substrate, where the top layer includes a décor layer, a thermoplastic wear layer, and a lacquer layer provided above, and preferably directly above, the wear layer, and where the floor panel has an upper surface showing a relief, where the relief has a maximum relief depth which is larger than 100 microns, and where the wear layer and the lacquer layer are embossed in order to form the relief. |
| US11987992B2 |
Building panel with a mechanical locking system
A set of panels each including a main surface, a first edge, an opposite second edge, a third edge which is adjacent to the first edge and a fourth edge which is opposite to the third edge. The set includes a mechanical locking device which is configured to lock the first edge to the second edge. The locking device includes a flexible tongue. The flexible tongue includes a central part configured to cooperate with a tongue groove for locking. A first edge part and the tongue groove are configured such that when in the locked position a force P′ is applied adjacent the first edge and the third edge of the first panel and another force P is applied adjacent the second edge and the third edge of the second panel, the first edge part is pushed towards a bottom surface of an insertion groove which allows a disassembling. |
| US11987983B2 |
Roofing system and associated roofing shingle
Roofing shingles are disclosed that are capable of self-adhering to a roof deck or underlayment and/or other roofing shingles and that require few or no mechanical fasteners to remain attached to the roof. By appropriate positioning of sealant lines on the shingle, direct adhesion between the shingle and the roof deck or underlayment and/or other roofing shingles can be achieved. If the shingle is laminated, the layers may be mechanically attached with indentations in the common bond area. The nail zone of the shingle may be visually indicated with fines and/or one or more paint lines. A roofing system comprising a plurality of courses of the shingles is also disclosed. |
| US11987982B2 |
Structural support system for rockwork with mechanical fastening of adjacent chip assemblies
Rebar-based support assemblies that can be fabricated without the need for on-site welding. The assemblies include a number of differing sized and shaped crimps used in place of welds to provide rebar assembly-to-rebar assembly connections. Each crimp mechanically couples two or three pieces of rebar together, such as a border bar of one rebar assembly to a border bar of an adjacent rebar assembly. Each crimp includes a body with two or more arcuate recessed surfaces each for receiving a piece of rebar. In a first configuration of the crimp, a pair of spaced-apart arms (or extending members) extend from the body and define an opening through which the rebar is passed and set into the recessed surfaces. A deformation force is applied upon the two arms to deform the body into a second configuration with the arms in abutting contact or nearly so at an outer tip or end. |
| US11987981B2 |
Structural element reinforcement systems and methods
Systems for reinforcement of structural elements such as piles, posts, pillars, and pipes are disclosed. The present invention features reinforced structural elements. The reinforced structural elements may include a sleeve structure positioned around a length of the structural element such that there is a chamber between the structural element and the sleeve structure. This chamber may be filled with concrete or another core filler material so as to reinforce the structural element. The sleeve structures of the present invention may be formed by the assembly of multiple staggered segmented layers of coupled reinforcing shells such as rigid, semi-rigid, or flexible fiber-reinforced shells. |
| US11987980B2 |
Anchor bolt assembly and ceiling finishing panel fixing apparatus comprising same
An anchor bolt assembly according to an embodiment of the present disclosure includes an anchor body provided with a plurality of pointed protrusions on an upper surface thereof, an anchor shell provided with open upper and lower sides thereof, extrapolated to a lower side of the anchor body, provided with a first incised part having a “Y” shape at an equal interval along a circumference of the anchor shell, and provided with a second incised part having a “v” shape at an equal interval along a longitudinal direction of the first incised part, a tightening member screwed to the anchor body through a screw thread provided on an inner circumferential surface of the tightening member, and provided with a processing part for increasing frictional force along an upper circumference of the tightening member. |
| US11987979B2 |
Prefabricated wall module leveling assembly
A leveling stud includes a threaded body extending between a top end and a bottom end thereof. The bottom end has a flat bottom surface and a dig protrusion extending from a portion of the flat bottom surface. The dig protrusion is configured to dig into a channel surface of a base track of a prefabricated wall system when the leveling stud is threaded into a positioning nut of the base track. The flat bottom surface is also configured to abut the channel surface when the leveling stud is threaded into the positioning nut. |
| US11987971B2 |
Systems and methods for underground storage of storm and other water sources
In various embodiments, the disclosure relates to a system for locating storm and/or waste water to a subsurface region. The system can be sized to replace, in some instances, retention ponds and to increase developable square footage on a region of land. The system can include a conduit for directing a volume of storm and/or waste water to a subsurface region located at least as deep as the aquifer layer. The system can be sized to handle a volume of water generated during a 100 year storm. In certain embodiments, the subsurface region is located directly below a land structure (e.g., a building structure). |
| US11987968B2 |
Flush toilet device
The present invention provides a flush toilet device (1) including: a flush toilet (2); a flush water tank (10); a discharge valve (12) that discharges the flush water stored in the flush water tank; a branching portion (33) that splits flush water supplied from a water supply source into first and second branched flow paths; a first on-off valve (19) provided in the first branched flow path and switches between spout and stop of the flush water from the upper spout port; a second on-off valve (17) provided in the second branched flow path and switches between supply and stop of the flush water into the flush water tank; and a controller (28) that controls the first and second on-off valve so that water is spouted from the upper spout port and is supplied into the flush water tank at a time by opening the first and second on-off valves. |
| US11987967B1 |
High efficiency toilet
A high efficiency toilet configuration including a water tank. The tank includes a supply line, a mechanical valve controlling a flow of water from the line into the tank, and walls and a base. The tank includes a through-hole in the base channeling water out of the water tank and a tank outlet hole including a housing extending through the through-hole. The tank includes an outlet valve configured for selectively prohibiting water from flowing through the tank outlet hole and permitting water through the tank outlet hole during a flush event. The tank includes a water column vessel disposed around the outlet hole and configured for separating water in the water tank between water outside of the vessel and a channel of water contained over the outlet hole. The configuration includes a toilet base including a bowl and a plenum for channeling the water to the bowl. |
| US11987966B2 |
Portable pipe dredging machine and dredging method
A portable drain cleaning machine includes a flexible shaft advancing and retreating device, a casing device, a motor device, a drum device, a flexible shaft, protection tubes, and a joint. The flexible shaft advancing and retreating device is connected with the protection tube. The protection tubes are connected with the casing device. Both the motor device and the drum device are arranged in the casing device. The motor device cooperates with the drum device. The flexible shaft includes one end connected with the drum device and the other end arranged in a funnel-shaped structure. The flexible shaft penetrates the flexible shaft advancing and retreating device and the protection tube. Any adjacent two of the protection tubes are connected by the joint. The drum device includes a drum body, a flexible shaft disc, and a motor connecting plate. The flexible shaft disc is arranged on the drum body. |
| US11987963B2 |
Shower assembly and method of attaching such a shower assembly
A shower assembly includes a telescoping rod assembly for placement between opposing walls. The rod assembly includes an outer rod having opposite open ends and a spring-biased inner rod mounted inside the outer rod for axial movement in relation to the outer rod such as to allow adjustment of an axial length of the rod assembly. A control valve can be attached to a water-supply line for controlling discharge of water from the one. A tubular member having one end connected to the valve and another end enters a valve-proximate one of the open ends of the outer rod. A primary shower head is connected to the other end of the tubular member at a location distal to the valve-proximate one of the open ends. |
| US11987961B2 |
Virtual field-based track protection for a mining machine
Embodiments described herein provide systems and methods for preventing and mitigating collisions between components of an industrial machine. The industrial machine includes an electronic controller, having an electronic processor and a memory, that is configured to receive dipper position data indicative of a position of the dipper and determine a distance between the dipper and tracks of the industrial machine based on the dipper position data. The electronic controller is further configured to set a motion command limit for a dipper motion based on the distance, the dipper motion being selected from a group of a swing motion, a crowd motion, and a hoist motion and control the dipper motion according to a dipper motion command limited by the motion command limit. |
| US11987957B2 |
Shovel
A shovel includes a lower traveling structure, an upper swing structure swingably mounted on the lower traveling structure, an attachment, and processing circuitry. The attachment includes a boom attached to the upper swing structure, an arm attached to the distal end of the boom, and an end attachment attached to the distal end of the arm. The processing circuitry is configured to automatically move the attachment in such a manner as to relatively reduce the movement of the attachment. |
| US11987956B2 |
Work vehicle, control device for work vehicle, and control method for work vehicle
A work vehicle controls an engine output based on an accelerator operation amount and a work equipment operation amount. A control device for the work vehicle includes an acceleration correction unit, a target vehicle speed determination unit, and a deceleration correction unit. The acceleration correction unit obtains a corrected accelerator operation amount by correcting the accelerator operation amount based on an inching operation amount. The target vehicle speed determination unit determines a target vehicle speed based on the corrected accelerator operation amount and a signal based on an operation of a shift operation member. The deceleration correction unit corrects the target vehicle speed based on the inching operation amount. |
| US11987954B2 |
Shovel
A shovel includes a lower traveling body, an upper traveling body turnably mounted on the lower traveling body, a hydraulic actuator, an operating apparatus configured to be operated to operate the hydraulic actuator, an object detector configured to detect an object within a predetermined area around the shovel, a gate lock lever configured to switch the operating apparatus between an enabled state and a disabled state, and a control device. The control device is configured to switch the operating apparatus between the enabled state and the disabled state separately from the gate lock lever, and to disable the operating apparatus in response to determining that the object is present within the predetermined area based on the output of the object detector while the operating apparatus is switched to the enabled state by the gate lock lever, during the standby state of the shovel. |
| US11987951B2 |
Land leveller
A land leveller includes a vehicle frame and a swing frame. The swing frame include a supporting beam assembly and connecting parts, the supporting beam assembly include multiple beam members, and the multiple beam members are connected sequentially at end parts, such that the multiple beam members form a closed shape. The connecting part is arranged at the connecting end part between two adjacent beam members. At least one connecting part is rotatably connected with the vehicle frame, and at least another connecting part is rotatably connected with a driving part. |
| US11987950B2 |
Method and apparatus to form rip lines across a sloping surface
A method and apparatus of forming two or more waving rip lines across a sloping surface, wherein the rip lines are formed at substantially right angles to the downward direction of the sloping surface and have a plurality of peaks and troughs. The troughs form catchment areas for water and the peaks separate the troughs limiting the amount of water stored in the catchment areas. Each of the rip lines can be substantially parallel with each other or offset relative to an adjacent rip line. The plurality of waving rip lines contribute to the stability of the landform, long term conservation and maintenance of the landform, and thereby encourage establishment and growth of vegetation in the remediation process. |
| US11987947B2 |
Method and apparatus for a fender system
In general, embodiments of this invention relate to methods, apparatuses, and systems for providing boat or ship protection from damages associated with vessel contact, allision, or other physical contact or with objects. Therefore, the preferred embodiment of the invention is represented by a Fender apparatus Comprising: A first and second crossbar; and At least one fender rotationally connected to the first crossbar at one end of the fender and rotationally connected to the second crossbar opposite the first crossbar, wherein there are three fenders rotationally connected to the first and second crossbars. |
| US11987944B2 |
Mat washer
A mat washer includes: a body adapted for highway transport; a loading platform adapted to receive a stacked pair of mats from, for example, a forklift, and adapted to pivot the pair of mats to an upright position; a splitter adapted to receive the mats from the loading platform and to separate the mats from one another; a transporter adapted to transport each of the mats longitudinally relative to the body from the splitter; a uniter adapted to receive the mats from the transporter and urge them together; an unloading platform adapted to receive the pair of mats from the uniter and pivot them downwardly for retrieval by, for example, the forklift; and a washing facility disposed between the loading and the unloading platform and adapted to wash the mats. |
| US11987943B1 |
Traffic marker illumination device
A traffic marker illumination device for improving the visibility of a traffic marker to provide warnings for constructions sites and roadways. The traffic marker illumination device is designed to removably attach to an interior portion of a traffic marker. The traffic marker illumination device generates a light to illuminate the traffic marker based on the geographic position of the traffic marker and surrounding environmental elements. |
| US11987938B2 |
Drainage device and methods for constructing and use
The present invention is manufactured to prevent the difficulties that may arise when installing a drainage system into a trench that has been cut into a sidewall of a building containing a network of structural members. The present invention is developed to produce a secure and effective connection between the structural member(s) of a drainage system and the structural members in the sidewall of a building in order to increase the stability of the drainage system within the sidewall. |
| US11987931B2 |
Cleansing substrate with synchronized printed and expanded texture
The current disclosure provides for a woven or nonwoven textured substrate that is stable in water based solutions. The textured substrate is generated by a controlled placement of ink on to portions of the surface and/or between layers of the textured substrate which is then followed by heat activation which expands the ink to puff out where the ink was applied to the textured substrate. |
| US11987929B2 |
Textile materials containing dyed polyphenylene sulfide fibers and methods for producing the same
A textile material comprises a plurality of yarns, wherein the yarns contain an intimate blend of dyed polyphenylene sulfide fibers and cellulosic fibers. The dyed polyphenylene sulfide fibers comprise a disperse dye that is distributed substantially evenly across the cross-sectional area of the fibers. A method for dyeing textile materials containing polyphenylene sulfide fibers comprises the steps of (a) providing a textile material comprising yarns which contain an intimate blend of polyphenylene sulfide fibers and cellulosic fibers, (b) providing a dye liquor comprising a liquid medium and a disperse dye, (c) applying the dye liquor to the textile material, (d) heating the textile material under ambient atmosphere to a temperature sufficient to evaporate substantially all of the liquid medium from the textile material, and (e) heating the textile material under ambient atmosphere to a temperature of about 180° C. or more to fix the disperse dye to the polyphenylene sulfide fibers. |
| US11987918B2 |
Cutting system and cutting device
A cutting system includes a sewing machine and a cutting device. The sewing machine includes a sewing portion, a sewing communication portion, a sewing processor, and a sewing memory. The sewing machine acquires an embroidery data stored in the sewing memory. The sewing machine sends, via a network line, the acquired embroidery data. The cutting device includes a cutting portion, a cutter communication portion, a cutter processor, and a cutter memory. The cutting device receives, via the network line, the embroidery data sent by the sewing machine. The cutting device generates a cutting data based on the received embroidery data. The cutting device drives the cutting portion based on the generated cutting data, and cuts the object to be cut. |
| US11987917B2 |
Shaped nonwoven
A through-air thermally bonded nonwoven fabric is provided. The nonwoven fabric can include a first surface and a second surface and a visually discernible pattern of three-dimensional features on one of the first or second surface. Each of the three-dimensional features can define a microzone comprising a first region and a second region. The first and second regions can have a difference in values for an intensive property, wherein at least one of the surfaces has a TS7 value of less than about 15 dB V2 rms, and wherein the first surface has a TS7 value that is higher than the second surface TS7 value. |
| US11987914B2 |
Activated porous fibers and products including same
A composition including inorganic fibers having a surface area of at least 5 m2/g and an active agent incorporated into the inorganic fibers and/or applied onto at least a portion of the inorganic fibers. Products including the composition may include fiber aggregates, composite materials, filter elements, catalytic elements, exhaust gas treatment devices and other exhaust system components, and papers. |
| US11987903B2 |
N-type GaN crystal, GaN wafer, and GaN crystal, GaN wafer and nitride semiconductor device production method
Provided is an n-type GaN crystal, in which a donor impurity contained at the highest concentration is Ge, and which has a room-temperature resistivity of lower than 0.03 Ω·cm and a (004) XRD rocking curve FWHM of less than 20 arcsec. The n-type GaN crystal has two main surfaces, each having an area of 2 cm2 or larger. One of the two main surfaces can have a Ga polarity and can be inclined at an angle of 0° to 10° with respect to a (0001) crystal plane. Further, the n-type GaN crystal can have a diameter of 20 mm or larger. |
| US11987901B2 |
Methods for forming a silicon substrate with reduced grown-in nuclei for epitaxial defects and methods for forming an epitaxial wafer
Methods for preparing single crystal silicon substrates for epitaxial growth are disclosed. The methods may involve control of the (i) a growth velocity, v, and/or (ii) an axial temperature gradient, G, during the growth of an ingot segment such that v/G is less than a critical v/G and/or is less than a value of v/G that depends on the boron concentration of the ingot. Methods for preparing epitaxial wafers are also disclosed. |
| US11987898B2 |
Molybdenum-silicon-boron with noble metal barrier layer
An article includes a substrate formed of a molybdenum-based alloy. A barrier layer is disposed on the substrate. The barrier layer is formed of at least one noble metal. |
| US11987897B2 |
Systems and methods for shielding features of a workpiece during electrochemical deposition
In one embodiment, an electroplating cell for depositing a metal onto a surface of a substrate includes an electroplating chamber configured to receive an electrolyte containing metal ions and a substrate having a surface disposed to contact the electrolyte, wherein the surface of the substrate is configured to serve as a cathode and wherein the surface of the substrate includes an anomaly region at or near the outer perimeter of the surface of the substrate, an anode disposed in the electrolyte chamber, a shielding device disposed between the cathode and the anode to shield the anomaly section, an oscillator configured to impart a relative oscillation between the cathode and the shielding device, and a power source to cause an electric field between the anode and the cathode. |
| US11987895B2 |
Modification method of anode for hydrogen production via electrolysis, anode for hydrogen production via electrolysis and use
A modification method of an anode for hydrogen production via electrolysis, the anode for hydrogen production via electrolysis and use thereof are provided. The modification method of the anode for hydrogen production via electrolysis includes providing an anode substrate which can be used for hydrogen production via catalytic electrolysis; and depositing a plurality of silver nano particles on the active surface of the anode substrate to form a silver nano layer, wherein gaps are present between the silver nano particles, and a part of the active surface is exposed from the gaps. In the modification method provided by the present application, the silver nano layer covers on the surface of the anode substrate, and chlorine ions are adsorbed onto the surface of silver in the process of hydrogen production via electrolysis to form a chlorine removal layer. |
| US11987893B2 |
System and method for extracting oxygen from powdered metal oxides
A system for extracting oxygen from powdered metal oxides, the system comprising a container comprising an electrolyte in the form of meltable or molten salt, at least one cathode, at least one anode, a power supply, and a conducting structure, wherein the cathode is shaped as a receptacle having a porous shell, which has an upper opening, the cathode being arranged in the electrolyte with the opening protruding over the electrolyte, wherein the conducting structure comprises a plurality of conducting elements and gaps between the conducting elements, wherein the power supply is connectable to the at least one cathode and the at least one anode to selectively apply an electric potential across the cathode and the anode, wherein the conducting structure is insertable into the cathode, such that the conducting elements reach into an inner space of the cathode, wherein the conducting structure is electrically connectable to the cathode, and wherein the system is adapted for reducing at least one respective metallic species of at least one metal oxide of feedstock inside the shell of the cathode with inserted conducting structure by applying the electric potential, wherein the potential is greater than the dissociation potential of the at least one metal oxide. |
| US11987892B2 |
Metal cleaning compositions comprising furoate esters and uses therefor
Disclosed are metal cleaning formulations and methods of use. A formulation of the present teachings comprises one or more furoate esters such as ethyl 5-methyl-2-furoate and methyl 5-methyl-2-furoate. The formulations further comprise a base oil, which can be, for example, a naphthenic oil, a synthetic oil or a combination thereof. In some embodiments, a formulation can further comprise a metal protection additive and a lubrication additive. A variety of base oils, metal protection additives, and lubrication additives are suitable for use in the present teachings. Formulations of the present teachings are especially useful for the cleaning of metal products such as firearms. The cleaning power of a formulation of the instant teachings can exceed that required for US Military Specifications. |
| US11987878B2 |
Chemical vapor deposition processes using ruthenium precursor and reducing gas
Chemical vapor deposition (CVD) processes which use a ruthenium precursor of formula R1R2Ru(0), wherein R1 is an aryl group-containing ligand, and R2 is a diene group-containing ligand and a reducing gas a described. The CVD can include oxygen after an initial deposition period using the ruthenium precursor and reducing gas. The method can provide selective Ru deposition on conductive materials while minimizing deposition on non-conductive or less conductive materials. Further, the subsequent use of oxygen can significantly improve deposition rate while minimizing or eliminating oxidative damage of the substrate material. The method can be used to form Ru-containing layers on integrated circuits and other microelectronic devices. |
| US11987869B2 |
Method for manufacturing alloys of precious metals and alloys of precious metals thus obtained
A method for manufacturing an alloy formed from a boride of a precious metal, may involve reacting a source of the precious metal with a source of boron in a salt or a mixture of salts in the molten state. An alloy formed from a boride of a precious metal may include crystalline nanoparticles of MxBy with M being a precious metal, distributed in an amorphous matrix of B or in an amorphous matrix of B and of MzBa. |
| US11987862B2 |
Method for liquefying niobium and tantalum, and method for producing niobium solution and tantalum solution
A method for liquefying niobium and tantalum and a method for producing a niobium solution and a tantalum solution, which can liquefy niobium and tantalum or produce a niobium solution and a tantalum solution safely and efficiently from a smelting raw material containing niobium and tantalum. Ammonium hydrogen sulfate is mixed as a reaction agent into a powdered substance containing at least one element of niobium or tantalum, and the mixture is melted under predetermined conditions to form a molten substance. A suspension formed by dissolving the molten substance having been solidified in an aqueous solution is subjected to solid-liquid separation to recover a precipitate. The precipitate is composed of niobium and/or tantalum with few impurities, and the precipitate is dissolved in one type of acid solution selected from hydrochloric acid, sulfuric acid, or nitric acid, whereby 90% or more of niobium and/or tantalum can be leached out. |
| US11987857B2 |
Cold rolled and annealed steel sheet, method of production thereof and use of such steel to produce vehicle parts
A cold rolled and annealed steel sheet including by weight: 0.6 |
| US11987855B2 |
Method and system for determining converter tapping quantity
The invention relates to a method and a system for determining the steel-tapping quantity of a converter, which consider that the working environment of the steel-making process of the converter is severe, the measurement is difficult and the interference of other factors is large, and provide a data-driven prediction model based on data, combine a Principal Component Analysis (PCA) with a RBF neural network, find the relation and the internal relation among variables by carrying out mathematical analysis on the related internal structure of the original variables, can quickly and accurately realize the prediction of the steel-tapping quantity of the converter, improve the component hit rate and the product stability in the steel-making process of the converter, are beneficial to realizing the control of narrow regions of steel-making components, save the alloying cost and have good application prospects in the field of ferrous metallurgy. |
| US11987853B2 |
Method for chromatographic purification of viscous loads
The invention relates to a method for purifying a mixture to be separated, in a multicolumn chromatography system, the method comprising successively and cyclically: a step of collecting a raffinate, a step of injecting the mixture to be separated, a step of collecting an extract and an eluent injection step, at an operating temperature; wherein the mixture to be separated has a viscosity at 20° C. greater than or equal to 3 mPa·s; and wherein the dry matter mass concentration of the mixture to be separated is equal, within 5%, to a threshold concentration, said threshold concentration is such that: the viscosity of the mixture to be treated at a dry matter mass concentration equal to the threshold concentration and at the operating temperature, is equal to twice the viscosity of the mixture to be treated, at a dry matter mass concentration equal to 85% of the threshold concentration and at the operating temperature. |
| US11987849B2 |
Composition for detecting leptospirosis and method of diagnosing leptospirosis using same
This application relates to a composition for diagnosis of leptospirosis and a method for diagnosis of leptospirosis by real-time PCR. For example, the application relates to a pair of primers of SEQ ID NOS: 1 and 2 and a probe of SEQ ID NO: 3, a kit for diagnosis of leptospirosis, comprising the diagnostic composition, and a method for providing information for diagnosis of leptospirosis are provided. The composition and the method can specifically detect L. interrogans IS 1500 gene and exhibit excellent accuracy and sensitivity, compared to conventional well-known detection methods. Thus, the simple method through real-time PCR using the composition allows the quick and accurate diagnosis of leptospirosis. |
| US11987846B2 |
Biomarker pairs for predicting preterm birth
The disclosure provides a pair of isolated biomarkers selected from the group consisting of IBP4/SHBG, IBP4/PSG3, IBP4/LYAM1, IBP4/IGF2, CLUS/IBP3, CLUS/IGF2, CLUS/LYAM1, INHBC/PSG3, INHBC/IGF2, PSG2/LYAM1, PSG2/IGF2, PSG2/LYAM1, PEDF/PSG3, PEDF/SHBG, PEDF/LYAM1, CD14/LYAM1, and APOC3/LYAM1, wherein the pair of biomarkers exhibits a change in reversal value between pregnant females at risk for pre-term birth and term controls. Also provided is a method of determining probability for preterm birth in a pregnant female, the method comprising measuring in a biological sample obtained from the pregnant female a reversal value for at least one pair of biomarkers selected from the group consisting of IBP4/SHBG, IBP4/PSG3, IBP4/LYAM1, IBP4/IGF2, CLUS/IBP3, CLUS/IGF2, CLUS/LYAM1, INHBC/PSG3, INHBC/IGF2, PSG2/LYAM1, PSG2/IGF2, PSG2/LYAM1, PEDF/PSG3, PEDF/SHBG, PEDF/LYAM1, CD14/LYAM1, and APOC3/LYAM1 to determine the probability for preterm birth in the pregnant female. |
| US11987844B2 |
Use of CFDNA fragments as biomarkers in patients after organ transplantation
The present invention provides methods for detecting donor cell-free DNA in the circulation of an organ transplant recipient for the early identification of transplant rejection. |
| US11987842B2 |
Sequencing device
A method of preparing reagents includes inserting a cartridge into an instrument. The cartridge includes a plurality of reagent enclosures disposed in a cavity of the cartridge and exposing a port to an exterior of the cartridge. Each reagent enclosure includes a reagent container including a reagent and an internal cavity defining a compressible volume, an opening defined through the reagent container to the internal cavity. The method further includes connecting a plurality of fluid ports to the openings of the plurality of reagent enclosures; applying a solution through the fluid ports to at least partially fill the plurality of reagent enclosures; and cycling a pressure of the cavity, whereby for each of the reagent enclosures, during increasing pressure, the solution enters the internal cavity of the reagent container, combines with the reagent, and compresses the compressible volume, and during decreasing pressure, the compressible volume decreases and the reagent is ejected through the opening. |
| US11987840B2 |
Systems and methods for assessing of biological samples
A system for determining the number of target nucleotide molecules in a sample includes a sample holder, an excitation optical system, an optical sensor, and an emission optical system. The sample holder is configured to receive an article comprising at least 20,000 separate reaction sites. The excitation optical system comprises a light source configured to simultaneously illuminate the at least 20,000 separate reaction sites. The optical sensor comprises a predetermined number of pixels, the predetermined number of pixels being at least 20 times the number of separate reaction sites. The emission optical system comprises a system working distance from the sample holder, wherein the working distance is less than or equal to 60 millimeters. |
| US11987838B2 |
Methods and kits for labeling cellular molecules
Methods of uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are provided. Kits for uniquely labeling or barcoding molecules within a cell, a plurality of cells, and/or a tissue are also provided. The molecules to be labeled may include, but are not limited to, RNAs, cDNAs, DNAs, proteins, peptides, and/or antigens. |
| US11987837B2 |
Nucleic acid sequence enrichment by defined nucleic acid-directed endonuclease digestion
A method of sample analysis is described comprising providing a sample comprising a plurality of endblocked polynucleotides, digesting the sample with one or more defined nucleic acid-directed endonuclease that targets a sequence of interest to produce a digested sample of polynucleotide fragments, wherein one or more of the fragments in the digested sample comprises: a sequence of interest and at least one ligatable end that has been generated by endonuclease cleavage; (c) enriching for fragments that contain the sequence of interest, wherein the one or more sequences of interest are enriched greater than 55 times, or greater than 750 times, their relative abundance in the sample; and (d) analyzing the enriched sample. |
| US11987835B2 |
Amino acid-sensing diguanylate cyclase and methods of use
Provided are SpdE polypeptides and variants and nucleic acids encoding the SpdE polypeptides and variants. Also provided are vectors including one or more nucleic acids encoding a SpdE polypeptide or variant and cells including a nucleic acid encoding the SpdE polypeptide or variant, as well as cells expressing a SpdE polypeptide or variant and compositions including such cells and a pharmaceutically acceptable carrier. Finally, methods of detecting presence and/or amount of one or more amino acids in a sample are provided. The methods include contacting the sample with a SpdE protein, measuring diguanylate cyclase activity of the SpdE protein; and comparing the diguanylate cyclase activity of the SpdE protein to a control. The methods can utilize isolated SpdE protein or a cell expressing a SpdE protein. |
| US11987833B2 |
Method for producing multi-hydroxy derivatives of polyunsaturated fatty acids
The present invention relates to a novel enzyme capable of producing multi-hydroxy derivatives from polyunsaturated fatty acids and a method for producing multi-hydroxy derivatives of polyunsaturated fatty acids using the same. |
| US11987831B2 |
Processes for producing a fermentation product
The present invention relates to processes for producing fermentation products from starch-containing material, wherein an alpha-amylase and optionally a thermostable protease, pullulanase and/or glucoamylase are present and/or added during liquefaction, wherein a cellulolytic composition is present and/or added during fermentation or simultaneous saccharification and fermentation. The invention also relates to a composition suitable for use in a process of the invention. |
| US11987830B2 |
Cell-free protein synthesis systems
Provided herein are cell free protein synthesis (CFPS) systems comprising a plurality of ribosomes attached to or encapsulated within a structure, or a plurality of structures, and, optionally, a solid support. Also provided are related kits and uses of the CFPS systems. Methods of producing a protein and methods of treating a disease are provided herein. |
| US11987829B2 |
Method for the biosynthesis of diosmin and/or hesperidin in a microorganism
The present invention relates to a recombinant microorganism which is modified to be capable of producing diosmin and hesperidin and to the use thereof for producing diosmin and/or hesperidin. |
| US11987824B2 |
Additional endoglucanase variants and methods
The invention is directed to novel variant endoglucanases and their use thereof. |
| US11987823B2 |
Engineered lipase variants
The present invention provides engineered lipase polypeptides and compositions thereof. The engineered lipase polypeptides have been optimized to provide improved thermostability, protease stability, and stability under a range of pH conditions, including acidic (pH<7) and basic (pH>7) conditions. The invention also relates to the use of the compositions comprising the engineered lipase polypeptides for therapeutic and/or nutritional purposes. The present invention also provides polynucleotides encoding the engineered lipase polypeptides, as well as methods for making the engineered polynucleotides and lipase polypeptides. |
| US11987819B2 |
Method of increasing omega-3 polyunsaturated fatty acids production in microalgae
The subject disclosure features, in one aspect, a method for producing lipids enriched for EPA, comprising modifying a microalga to increase expression of PFA1, and/or PFA3, and culturing the modified microalga under conditions which allow the expression of PFA1, and/or PFA3, wherein lipids enriched for EPA are produced. Also featured is a recombinant microalga in which PFA1, and/or PFA3, is overexpressed. Such recombinant microalgae have been demonstrated herein to produce very favorable fatty acid lipid profiles (e.g., increased levels of EPA, increased ratio of EPA:DHA, decreased levels of DPA n-6, etc.). |
| US11987816B2 |
Composition for inducing dedifferentiation from somatic cells to induced pluripotent stem cells and method of inducing dedifferentiation using same
The present invention relates to a composition for inducing dedifferentiation form somatic cells to induced pluripotent stem cells (iPSs) and method of inducing dedifferentiation using same, wherein the composition for inducing dedifferentiation and the method of inducing dedifferentiation increases the efficiency of dedifferentiation from somatic cells to iPSs by stimulating CXC chemokine receptor 2 (CXCR2), which is a receptor on human somatic cells, and thus may be effectively used for inducing the dedifferentiation to iPSs. |
| US11987815B2 |
Methods for reprogramming somatic cells
The invention provides methods for reprogramming somatic cells to generate multipotent or pluripotent cells. Such methods are useful for a variety of purposes, including treating or preventing a medical condition in an individual. The invention further provides methods for identifying an agent that reprograms somatic cells to a less differentiated state. |
| US11987811B2 |
Method for producing CD4-positive T cells from pluripotent stem cells
An object of the present invention is induction of CD4-positive T cells from pluripotent stem cells. This object is achieved by production of CD4-positive T cells by introducing a CD4 gene or a gene product thereof into T cells induced from pluripotent stem cells. |
| US11987808B2 |
Method of human periferic sensory neurons differenciation from human stem cells and uses thereof
The present invention relates to the field of stem cell biology, in particular the linage specific differentiation of pluripotent or multipotent stem cells. Specifically described are methods to direct the lineage specific differentiation of hiPSC to sensitive neurons or neuronal fibers innervating the human skin, such as neural crest stem cells (NCPCs) and here called peripheral sensory neurons (PSNs) using novel culture conditions. It is also described a method for screening a biological agent in vitro. The PSNs obtained using the methods of the present invention are further contemplated for various uses including, but limited to, use in in vitro tests or disease modelling, such as drug discovery assays, cell therapy on a higher scale, detecting a range of skin irritants and other compounds of interest, for studying skin aging mechanism, and for producing a dermocosmetic product. Also, it is contemplated the use of ligands in vitro for checking the differentiation and/or activation of the PSN cells, produced by the method of the invention, and the PSN cells, produced by the method of the invention. |
| US11987806B2 |
Biocompatible conditioned cell medium compositions and uses thereof
The present invention is drawn, in part, to biocompatible compositions comprising a biocompatible polymer matrix and conditioned cell medium comprising i) a cell culture medium and ii) one or more agents synthesized by and secreted from one or more cells cultured in the cell culture medium, as well as therapeutic uses thereof, particularly in modulating bone and/or gum tissue growth. |
| US11987803B2 |
Efficient delivery of large cargos into cells on a porous substrate
In various embodiments, method and devices for delivering large cargos (e.g., organelles, chromosomes, bacteria, and the like) into cells are provided. In certain embodiments method of delivering a large cargo into eukaryotic cells, are provided that involve providing eukaryotic cells disposed on one side of a porous membrane; providing the cargo to be delivered in a solution disposed in a reservoir chamber on the opposite side of the porous membrane; and applying pressure to the reservoir chamber sufficient to pass the cargo through pores comprising said porous membrane wherein said cargo passes through cell membranes and into the cells. |
| US11987798B2 |
Transgenic maize event MON 87419 and methods of use thereof
The invention provides recombinant DNA molecules that are unique to the maize MON 87419 event and transgenic maize plants, plant parts, seeds, cells, and agricultural products containing the MON 87419 event as well as methods of using and detecting the maize MON 87419 event. Transgenic maize plants containing the MON 87419 event exhibit tolerance to dicamba and glufosinate herbicides. |
| US11987795B2 |
Methods of modulating SLC7A11 pre-mRNA transcripts for diseases and conditions associated with expression of SLC7A11
Described are methods for enhancing exon skipping in a pre-mRNA of interest, comprising contacting the pre-mRNA with interfering oligonucleotides such as antisense, siRNA, and miRNA. The exon skipping methods are associated with methods of treating a variety of diseases and conditions, including cancer. |
| US11987794B2 |
Products and compositions
The present invention relates to products and compositions and their uses. In particular the invention relates to nucleic acid products that interfere with target gene expression or inhibit target gene expression and therapeutic uses of such products. |
| US11987793B2 |
Compositions and methods for prevention of bladder fibrosis
A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2′-O-methylation modification to increase stability. Cholesterol is conjugated to the 3′-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule. |
| US11987790B2 |
Methods for high-resolution genome-wide functional dissection of transcriptional regulatory regions
Embodiments disclosed herein provide a general, scalable, high-throughput, and high-resolution approach for experimental dissection of regulatory regions and driver nucleotides in the context of human biology and disease. Applicants present HiDRA, a novel high-resolution global screen for transcriptional regulatory activity in accessible chromatin regions, enabling high-efficiency, high-throughput, and high-resolution inference of regulatory activity. |
| US11987786B2 |
Device for reducing size of biological tissue
A device for reducing the size of biological tissue according to an embodiment includes a plate, and a thru-hole which penetrates the front and the rear of the plate and is defined by a plurality of edges of the plate, wherein each of the plurality of edges includes a protruding part protruding toward a center part of the thru-hole, and biological tissue may be reduced in size by being scratched and torn by the protruding parts while passing through the thru-hole. |
| US11987784B2 |
Sampling system and method of using the same
The present application is directed to a sampling system for sampling a fluid from a vessel, where the sampling system includes a sterile dispenser assembly operatively connected to the vessel, the sterile dispenser assembly including a valve operatively connected to the vessel, a membrane, and a needle, and a detachable sterile sampling container assembly operatively connected to the sterile dispenser assembly, the detachable sterile sampling container assembly including a sampling container, a membrane attached to the sampling container, and a sampling container housing enclosing the sampling container, where the sampling container housing includes a compressible portion having a deflated configuration and an expanded configuration. |
| US11987783B2 |
System and method for wirelessly powering a sensor in a bio-processing environment
A bio-processing system (100) for wirelessly powering one or more sensors (116-128, 400) is presented. The system (100) includes bio-processing units (106-110), process supporting devices (112-114), energy sources (146-148), and sensors (116-128, 400) including an energy harvesting unit (402) and an energy storage unit (404). The system (100) includes a power management subsystem (104, 200) wirelessly coupled to the sensors (116-128, 400) and including a processor (202) configured to wirelessly monitor energy consumption of the sensors (116-128, 400) and a level of energy stored in corresponding energy storage units (404), select at least one sensor (116-128, 400) based on the energy consumption of the sensors (116-128, 400) and corresponding levels of energy stored in the energy storage units (404), and identify at least one active energy source (146-148) as a power source, where the identified power source is configured to wirelessly transfer power to the selected sensor (116-128, 400). |
| US11987770B2 |
Liquid hand dishwashing cleaning composition with reduced viscosensitivity
The need for a hand-dishwashing composition which is highly effective at removing grease, providing long-lasting suds under soiled conditions, while having a Newtonian viscosity which is less sensitive to changes on surfactant and solvent levels, is met by formulating the liquid hand dishwashing cleaning composition to comprise a surfactant system having a combination of alkyl sulphate anionic surfactant having little or no alkoxylation and an alkyl polyglucoside surfactant. |
| US11987760B2 |
Processes for utilisation of purified coal to upgrade refinery process components in the manufacture of petroleum coke
Processes for the production of coke, and one or more volatile products comprise the steps of: (i) providing a purified coal product (PCP), wherein the PCP is in particulate form, and wherein at least about 90% v of the particles are no greater than about 100 μm in diameter; wherein the PCP has an ash content of less than about 10% m and a water content of less than around 5% m; (ii) combining the PCP with a liquid residue oil to create a combined solid-liquid blend, wherein the solid-liquid blend comprises at least around 0.1% m and at most around 30% m PCP; (iii) subjecting the solid-liquid blend to a temperature in excess of 375° C. for a time period sufficient to induce cracking of at least 1% of the PCP particles to generate the one or more volatile products, and (iv) producing coke from the product of step (iii). |
| US11987759B2 |
Solvolysis process
The present disclosure relates to the thermal liquefaction of lignin, and more particularly to lignin solvolysis of a lignin feedstock chosen based on its molecular weight. The process comprises subjecting a feed mixture (30) of lignin feedstock (10) and solvent (20) to a thermal liquefaction step by heating (110) the feed mixture (30) at a temperature between 360 and 420° C., separating (120) a liquid product mix (50) from a product mix (40); and recirculating at least part of said liquid product mix (50) as an oil fraction of said solvent (20). |
| US11987758B2 |
Integrated operation method in the use of catalyst in conventional and residue FCC units
The present invention refers to an integrated operation method of conventional and residue FCC units that applies a model developed for predicting the catalytic performance of residue FCC units with any content and quality of flushing for the correct prediction and optimization of process simulators for residue FCC units and refining production planning models. The application can be for individual studies in process simulators or in digital twins to mitigate the unreliability in the prediction of the original simulator for studies with wide alteration in the content and quality of the flushing. The other application consists of modifying the refining production planning models based on the simulation result obtained in the modified process simulators to predict the performance of the waste units operating for any variation in the content and quality of the flushing catalyst used. The refining production planning model allows: 1. Indicative of potential profitability gain; 2. Optimum replacement of virgin and flushing catalysts in the conventional and residue FCC units; 3. Better distribution of the flushing content and flushing quality for FCC consumer units of the flushing system; 4. Quantifies the marginal value of flushing generated in the FCCs units that produce flushing; 5. Defines the best virgin catalyst budget and predicts the logistical costs of transporting flushing between the FCC units producing flushing and consuming flushing, considering all viable routes. |
| US11987756B2 |
Process for PVC-containing mixed plastic waste pyrolysis in a reactor handling three phases of products
A process for pyrolysis of a mixed plastic stream that contains polyvinyl chloride (PVC) is provided in which the chloride from PVC is removed from an initial melting reactor that melts the mixed plastic stream. Chloride is removed in a vapor stream from the initial melting reactor with additional chloride removed from addition of sorbents to the pyrolysis reactor and in adsorbent beds downstream of the pyrolysis reactor. The pyrolysis reactor has a configuration comprising two cylindrical ring structures, an inner cylindrical ring structure within an outer cylindrical ring structure wherein a circulation liquid supply stream enters said pyrolysis reactor tangentially relative to a ring edge of said two cylindrical ring structures and wherein solid particles move in a downward direction to a bottom of the pyrolysis reactor. |
| US11987754B2 |
Solvolysis process for combined feedstock
The present disclosure relates to a process for converting a combined feedstock to renewable liquid product(s), wherein the ash content of the combined feedstock of lignin feedstock and a second renewable feedstock is low. The combined feedstock is mixed with solvent, followed by solvolysis to obtain a product mix. At least part of the product mix is recirculated as the oil fraction of said solvent. The present disclosure further concerns the use of the product mix as a renewable product or use of hydroprocessed oil obtained by the process. |
| US11987753B2 |
Treatment of well stimulation proppants with depression additive based on predicted storage temperature
Apparatus for treating a wetted proppant including a device to estimate fraction of water in a wetted proppant feed of a frac proppant processing plant; a system for determining an environmental temperature at which the wetted proppant will be exposed to in the frac proppant processing plant or in storage holding an output from the frac proppant processing plant; and an additive system to apply a freezing point suppression additive to the wetted proppant in proportion to the fraction of water such that a mixture of the wetted proppant plus the freezing point suppression additive does not solidify at the environmental temperature. Also, a method for treating a wetted proppant. |
| US11987752B2 |
Downhole acid stimulation method with corrosion inhibition
A method of inhibiting corrosion of metal during acid stimulation of an oil and gas well that involves treating the oil and gas well with an acidic treatment fluid that includes 10 to 28 wt. % of an acid, based on a total weight of the acidic treatment fluid, and a corrosion inhibitor composition containing gelatin, wherein the gelatin is present in the acidic treatment fluid in a concentration of 0.1 to 10% by weight per total volume of the acidic treatment fluid. |
| US11987750B2 |
Water mixture for fracturing application
A method for using produced water (PW), for example, for use in a fracturing fluid. The method includes performing ultrafiltration on the PW to form filtered PW, filtering seawater (SW) to form filtered SW, and blending the filtered PW with the filtered SW to form an aqueous blend. |
| US11987749B2 |
Polymers and nanoparticles for flooding
A method and compounds for enhanced oil recovery (EOR) including flooding of a mixture of water and one or more of the compounds in a geological formation. The compounds have a fluoroalkyl group. |
| US11987743B2 |
Compositions and methods for well cementing
The effectiveness of expansive cement systems may be diluted when, during a well cementing operation, commingling takes place between the cement slurry and a spacer fluid, a drilling fluid, or both. Incorporating expansive agents in the spacer fluid or drilling fluid may reduce or negate the loss of expansion at the cement slurry/spacer interface or the cement slurry/drilling fluid interface, thereby promoting zonal isolation throughout the cemented interval. |
| US11987740B2 |
Silicon nitride film etching composition and etching method using the same
Provided are a silicon nitride film etching composition, a method of etching a silicon nitride film using the same, and a manufacturing method of a semiconductor device. Specifically, a silicon nitride film may be highly selectively etched as compared with a silicon oxide film, and when the composition is applied to an etching process at a high temperature and a semiconductor manufacturing process, not only no precipitate occurs but also anomalous growth in which the thickness of the silicon oxide film is rather increased does not occur, thereby minimizing defects and reliability reduction. |
| US11987738B2 |
C2-C3-alkenyl-substituted rylene imide dyes and curing product of curable silicon resin composition and C2-C3-alkenyl-substituted rylene imide dyes
The present invention relates to a curable resin composition comprising a curable resin mixture and at least one C2-C3-alkenyl-substituted compound of formula (I) wherein m is 1, 2 or 3; Rm1, Rm2, Rm3 and Rm4 are hydrogen or C6-C14-aryloxy, which is substituted by one or more radicals selected from C1-C24-alkyl and C6-C14-aryl-C1-C10-alkylene; R5, R6, are hydrogen or optionally substituted C6-C14-aryl, or R5 and R6 together are a diradical of the formula A; A is a diradical of the formulae A.1 or A.2 wherein R7 is C2-C3-alkenyl; R8, n are as defined in the claims and in the description. The present invention also relates to a polymer comprising in copolymerized form at least one compound of formula (I) and an organopolysiloxane and to novel compounds of formula (I). |
| US11987733B2 |
Acrylic adhesive composition, polarizing plate, and display device
An acrylic adhesive composition including an acrylic copolymer formed by polymerizing a monomer mixture is provided. The monomer mixture includes a monomer represented by [Formula 1], a (meth)acrylic monomer having a crosslinkable functional group, and an alkyl (meth)acrylate-based monomer. The acrylic copolymer has a branched polymer structure. The acrylic composition also includes a polyfunctional acrylate having two or more radically polymerizable functional groups, a first photoinitiator, and a second photoinitiator, wherein the first photoinitiator is an acetophenone-based photoinitiator, and the second photoinitiator is a phosphine oxide-based photoinitiator. |
| US11987730B2 |
Waterbased one coat adhesive composition
Disclosed is an aqueous adhesive composition which comprises an admixture of: (a) a first aqueous composition comprising, (i) one or more film forming polymers, (ii) one or more lower crystallinity polynitroso compounds, (iii) one or more higher crystallinity polynitroso compounds, and (iv) one or more bismaleimide-containing monomers; and (b) a second aqueous composition comprising (i) an aqueous dispersion of at least one phenolic resin which is a condensation product of a phenol and formaldehyde, wherein the aqueous dispersion is stabilized by at least one polyacrylate; (b) one or more latices formed from one or more halogenated polyolefins; and (c) one or more metal oxides. |
| US11987723B2 |
Fluorinated coating agent composition, surface treatment agent, and article
This surface treatment agent can form a water repellent/oil repellent layer having particularly excellent wear durability, weather resistance, and alkali resistance, and contains a fluorinated coating agent composition containing: (A) one or more selected from hydroxy group- or hydrolyzable group-containing silanes and siloxanes modified with a fluorooxyalkylene group-containing polymer, and partial (hydrolyzed) condensates thereof, and (B) a fluorooxyalkylene group-containing polymer-modified polysilazane formed of silazane units modified with a fluorooxyalkylene group-containing polymer, wherein the number-average molecular weight of fluorooxyalkylene group-containing polymer residues in the component (A) is 1,500-10,000, the number-average molecular weight of fluorooxyalkylene group-containing polymer residues in the silazane units modified with the fluorooxyalkylene group-containing polymer in the component (B) is 500-6,000, and the mixed mass ratio between the component (A) and the component (B) is 10:90 to 90:10. |
| US11987722B2 |
Film, liquid composition, optical element, and imaging apparatus
A film (1) includes hollow particles (10) and a binder (20). The hollow particles are made of a material having a refractive index of 1.15 to 2.70. The binder (20) is formed of at least a polysilsesquioxane and binds the hollow particles (10). The film (1) satisfies at least one of requirements Ib/Ia≥0.7 and Ib/Ic≥0.3. Ia is an absorbance derived from a hydrocarbon group not directly bonded to a silicon atom, the absorbance being determined by attenuated total reflection using a Fourier transform infrared spectrophotometer. Ib is an absorbance derived from a bond between a silicon atom and a non-reactive functional group. Ic is an absorbance derived from a bond between a silicon atom and a hydroxy group. |
| US11987721B2 |
Heat-shielding member
A heat shielding member includes a base, and a heat shielding membrane on the base.The heat shielding membrane includes a porous layer including at least a closed pore. The porous layer includes resin and carbon-based filler. The heat shielding member has both of low thermal conductivity and low heat capacity and improves the fuel economy performance. |
| US11987720B2 |
Metal-particle dispersion composition and aqueous coating composition
Provided is a metal-particle dispersion composition as a composition containing dispersed metal particles and being suitable for use in aqueous coating compositions, etc., the metal-particle dispersion composition comprising 10-80 mass % metal particles, 0.01-10 mass % organic titanate compound in a chelate form, 1-40 mass % water, and 2-30 mass % organic solvent having a higher boiling point than water, the amounts being based on the whole composition, wherein the organic titanate compound is an organic compound represented by Ti(OR)4 (the OR groups include at least one chelatable substituent based on triethanolamine) and the organic solvent having a higher boiling point than water is a C7 or lower alcohol compound. |
| US11987719B2 |
Aqueous dispersion of inorganic fibers and method for formulating aqueous coating composition therefrom
The present disclosure is directed to an aqueous dispersion of inorganic fibers and a method for formulating an aqueous coating composition therefrom. The aqueous dispersion of inorganic fibers comprises water, inorganic fibers, a dispersing agent, an anti-settling agent and optionally additional additives, wherein the inorganic fibers have an average fiber diameter of from 1 micron to 100 microns and have a number average aspect ratio of from 1.1:1 to 10:1; and wherein the aqueous dispersion does not contain a film-forming amount of a polymeric resin. |
| US11987716B2 |
High impact strength 3D printing materials derived from polycycloolefin monomers and crosslinkers
Embodiments in accordance with the present invention encompass a composition containing a latent catalyst and a compound capable of generating a Bronsted acid with a counterion capable of coordinating and activating the latent catalyst along with one or more monomers which undergo ring open metathesis polymerization (ROMP) and one or more multi-functional crosslinkable molecules when said composition is exposed to a suitable radiation forms a three-dimensional (3D) object. The catalyst system employed therein can be sensitive to oxygen and thus inhibits polymerization in ambient atmospheric conditions. The three-dimensional objects made by this process exhibits improved mechanical properties, particularly, high distortion temperature, impact strength, elongation to break, among others. Accordingly, compositions of this invention are useful as 3D inkjet materials for forming high impact strength objects of various sizes with microscale features lower than 100 microns, among various other uses. |
| US11987715B2 |
Radiation curable ink jet composition and ink jet method
A radiation curable ink jet composition includes polymerizable compounds and a photopolymerization initiator, the polymerizable compounds include a monofunctional monomer, a content of the monofunctional monomer with respect to a total mass of the polymerizable compounds is 90 percent by mass or more, and the photopolymerization initiator includes ethyl (2,4,6-trimethylbenzoyl)phenylphosphinate. |
| US11987706B2 |
Elastomer composition
An elastomer composition including (a) an elastomer blend component; (b) at least one first odor-reducing component; and (c) at least one second odor-reducing component; the elastomer component (a) including a hydrogenated block copolymer, a propylene polymer, a maleic anhydride grafted polymer, a mineral oil, and a filler, and/or a nucleating agent. The elastomer composition can be particularly suitable for fabricating injection molded non-carpet vehicle flooring with a reduced amount of undesirable odor. |
| US11987704B2 |
Method for preparing biodegradable latex composition for dip forming
Provided is a method for preparing a latex composition for dip forming, the method including: (a) preparing a monomer mixture including a conjugated diene-based monomer, an ethylenically unsaturated nitrile monomer and an ethylenically unsaturated acid monomer; (b) introducing starch, an emulsifier and an inorganic solvent into the monomer mixture; and (c) preparing a copolymer latex by introducing a polymerization initiator, wherein the copolymer includes the starch in a main chain thereof. |
| US11987703B2 |
Rubber composition and tire
The present invention aims to provide rubber compositions and tires which provide improved overall performance in terms of wet grip performance and dry grip performance. The present invention relates to a rubber composition having a hardness that reversibly changes with water and satisfying the following relationship (1): Hardness when dry−Hardness when water-wet≥10 (1) wherein each hardness represents the JIS-A hardness at 25° C. of the rubber composition. |
| US11987702B2 |
Thermoplastic resin composition comprising a core-shell resin and a molded resin article composed of the thermoplastic resin composition
A thermoplastic resin composition comprising 80 to 99.9 parts by mass of a thermoplastic resin (I), and 0.1 to 20 parts by mass of a silicone-acryl core-shell resin (II), a total mass of the thermoplastic resin (I) and the silicone-acryl core-shell resin (II) being 100 parts by mass, wherein a core particle of the silicone-acryl core-shell resin (II) is composed of an organopolysiloxane (A), and a shell layer of the silicone-acryl core-shell resin (II) is composed of a poly (meth) acrylate ester (B), a mass ratio of the organopolysiloxane (A) to the poly (meth) acrylate ester (B) is in a range of 40:60 to 90:10, and a length (β) of the part of a circumference occupied by the poly (meth) acrylate ester in the silicone-acryl core-shell resin (II) accounts for at least 90% of a whole circumferential length (α) of the silicone-acryl core-shell resin (II). |
| US11987700B2 |
Barrier polymer compositions
The present application relates to polymer compositions that provide barrier properties to oxygen, water vapor and/or hydrocarbons, to polymer film or sheet comprising the polymer composition and to their use in the manufacture or preparation of plastic material and/or plastic packaging. The present application also relates to a method of reducing oxygen water vapor and/or hydrocarbons permeability in plastic material and/or plastic packaging. |
| US11987696B2 |
Biobased polyester blends with enhanced performance properties
The invention relates to a biodegradable and compostable blend of polylactic acid, a compostable polyester with or without carbon based biocontent, polyethylene glycol, and optionally an inorganic talc filler that have greatly increased elongation, flexibility, and tensile toughness as measured by tensile test ASTM D638-10. These blends of PLA with 5-30% of said polyester, about 10% PEG, and about 5% of an inorganic talc filler unexpectedly increased the elongation to 750+ % for molded test bars. Additionally, 4 mil films showed a max tear strength of about 1200 gms (in MD) and 900 gms (in TD) measured by ASTM D1922-09 while maintaining other preferable properties. |
| US11987692B2 |
Thermoplastic resin compositions, adhesive coating materials, and laminates using the same
Provided is a thermoplastic resin composition or an adhesive coating material capable of adhering a cyclic polyolefin-based polymer with a metal or metal compound such as aluminum foil or an ethylene-vinyl alcohol copolymer with sufficient strength. The thermoplastic resin composition contains (A) 100 parts by mass of thermoplastic resin; (B) 0.05 to 5 parts by mass of one or more kinds selected from the group consisting of an unsaturated carboxylic acid and an unsaturated carboxylic acid derivative; and (C) 0.01 to 3 parts by mass of organic peroxide; which component (A) contains (a1) 10 to 90% by mass cyclic polyolefin-based polymer; and (a2) 90 to 10% by mass a hydrogenated product of a block copolymer comprising a polymer block composed mainly of an aromatic vinyl compound and a random copolymer block of a conjugated diene compound and an aromatic vinyl compound (with the proviso that the total of the component (a1) and the component (a2) is 100% by mass). |
| US11987691B2 |
Resin molded article and manufacturing method thereof
A resin molded article including an ethylene vinyl acetate copolymer resin and carbon black as primary components. After the resin molded article is heated from 25 degrees Celsius to 100 degrees Celsius and then cooled to 25 degrees Celsius, the shrinkage factor of the resin molded article at 25 degrees Celsius cooled after heated to 100 degrees Celsius relative to the resin molded article at 25 degrees Celsius before heated is less than or equal to 2.0%. |
| US11987680B2 |
Composite ion exchange membrane and method of making same
An anion exchange membrane is made by mixing 2 trifluoromethyl ketone [nominal] (1.12 g, 4.53 mmol), 1 BiPhenyl (0.70 g, 4.53 mmol), methylene chloride (3.0 mL), trifluoromethanesulfonic acid (TFSA) (3.0 mL) to produce a pre-polymer. The pre-polymer is then functionalized to produce an anion exchange polymer. The pre-polymer may be functionalized with trimethylamamine in solution with water. The pre-polymer may be imbibed into a porous scaffold material, such as expanded polytetrafluoroethylene to produce a composite anion exchange membrane. |
| US11987678B2 |
Polyester composition film and hot melt adhesive laminate comprising the same
Provided is a polyester composite film, comprising a first thermoplastic polyether ester elastomer (TPEE) film and a second TPEE film. The melting point of a second TPEE resin of the second TPEE film is higher than that of a first TPEE resin of the first TPEE film, and the absolute difference in enthalpy of fusion between the first and second TPEE films is 5 J/g to 15 J/g. By adopting the first and second TPEE films having specific absolute difference of the enthalpy of fusion and controlling the melting points of the first and second TPEE resins, the polyester composite film can be well attached onto the fabric by hot pressing to obtain sufficient peel strength, and thereby the attached fabric can have excellent waterproof performance. Besides, a hot melt adhesive laminate comprising the polyester composite film also exhibits the above beneficial effects when attached to the fabric. |
| US11987667B1 |
High-viscosity biodegradable aliphatic-aromatic polyester copolymer having excellent hydrolysis resistance and method of preparing the same
Provided are a biodegradable aliphatic-aromatic polyester copolymer having excellent hydrolysis resistance and high viscosity which has a carboxyl end group (CEG) content of 15 mg KOH/g or less, a ratio (Mz/Mn) of a z-average molecular weight (Mz) to a number average molecular weight (Mn) of 3 to 15, and a melt index (MI) of 5 g/10 min or less as measured under conditions of a temperature of 190° C. and a load of 2.16 kg in accordance with ASTM D 1238. A method of preparing a biodegradable aliphatic-aromatic polyester copolymer is provided, including adding a chain extender and an anti-hydrolysis agent to an aliphatic-aromatic polyester pre-copolymer over time, whereby a significant viscosity rise and improvement of hydrolysis resistance may be implemented simultaneously. |
| US11987666B2 |
Thermoplastic resin composition and molded product using same
Disclosed are a thermoplastic resin composition and a molded product including the same, and based on 100 parts by weight of a base resin including (A) 70 wt % to 90 wt % of a polybutylene terephthalate resin and (B) 10 wt % to 30 wt % of an acrylate-based graft copolymer, the thermoplastic resin composition includes: (C) 1 part by weight to 5 parts by weight of an epoxy group-containing methacrylate-aromatic vinyl-unsaturated nitrile copolymer; (D) 15 parts by weight to 20 parts by weight of a carbon fiber; (E) 1 part by weight to 5 parts by weight of carbon nanotubes; and (F) 18 parts by weight to 20 parts by weight of aluminum diethyl phosphinate (ADEP). |
| US11987665B2 |
Polymer and organic light emitting device comprising same
The present invention provides a novel polymer comprising repeating unit represented by the following Chemical Formula 1, and an organic light emitting device including the same: Wherein L1, L2, Ar1, Ar2, Ar3, R1 to R8, o, p and n are described herein. |
| US11987661B2 |
Modified polymer polyols
The present invention relates to new modified polymer polyols comprising at least one polyol and a stable dispersion of polymeric particles in the at least one polyol. The dispersed polymeric particles having a high content of P and N. There are also disclosed processes for the preparation of the herein described modified polymer polyols, and processes for preparing polyurethane materials containing them. |
| US11987660B2 |
Catalytic system and use thereof, and preparation method of syndiotactic 1,2-polybutadiene (s-PB)
The present disclosure relates to the technical field of preparation of syndiotactic 1,2-polybutadiene (s-PB), in particular to a catalytic system and use thereof, and a preparation method of s-PB. In the present disclosure, the catalytic system includes an iron-containing organic compound, an azodicyano compound, an organoaluminum compound, and a free radical scavenger; where an iron element in the iron-containing organic compound, the azodicyano compound, the organoaluminum compound, and the free radical scavenger have a molar ratio of 1:(0.5-10):(5-100):(1-1000); and the free radical scavenger is selected from the group consisting of a sterically hindered phenol, a sterically hindered amine, and a phosphorus-containing antioxidant. The catalytic system can prepare the s-PB with a high activity at a high temperature, and the s-PB has a melting point of 60° C. to 130° C. with an extremely low gel content or even no gelation. |
| US11987659B2 |
Hydrogenation reaction catalyst and preparation method therefor
Provided are a hydrogenation reaction catalyst and a preparation method therefor, and more particularly, to a hydrogenation reaction catalyst including sulfur as a promoter, thereby selectively hydrogenating an olefin by changing a relative hydrogenation rate of the olefin and an aromatic group during a hydrogenation reaction of an unsaturated hydrocarbon compound containing an aromatic group, and a preparation method therefor. |
| US11987658B2 |
Curable resin composition and method of manufacturing article
A curable resin composition that is capable of forming a cured product having impact resistance and a high elastic modulus, and has a low viscosity, thereby being suitable for three-dimensional shaping. The curable resin composition contains: (A) an α-(unsaturated alkoxyalkyl)acrylic acid or an ester thereof; (B) a bifunctional radically polymerizable oligomer; optionally (C) a radically polymerizable compound other than the component (A) and the component (B); (D) rubber particles; and (E) a radical polymerization initiator, wherein the component (A) is represented by the following formula (1). |
| US11987652B2 |
Light as catalytic switch: metal-organic insertion/light initiated radical (MILRad) polymerization
A method of polymerizing a first, and a second class of monomers to form product polymer. The first class of monomers polymerize via a radical pathway in the presence of light, and the second class of monomers polymerize via an insertion pathway in the absence of light. |
| US11987651B2 |
Catalyst composition and method for preparing hydrocarbon resin using the same
A catalyst composition and a method for preparing a hydrocarbon resin using the same are disclosed herein. In some embodiments, a catalyst composition includes an oxonium ion-based catalyst and an additive. In some embodiments, a method includes polymerizing a monomer mixture in the presence of a catalyst composition, wherein the monomer mixture comprises a C5 unsaturated hydrocarbon monomer, a C9 unsaturated hydrocarbon monomer, or a mixture thereof, wherein the catalyst composition comprising a catalyst represented by the following Formula 1 and an additive represented by the following Formula 2. |
| US11987650B2 |
Activated pectin-containing biomass compositions and products
Methods for producing an activated pectin-containing biomass composition are provided. The method includes (A) mixing a starting pectin-containing biomass material including an insoluble fiber component and an insoluble protopectin component with an aqueous solution of an alcohol to form a mixture; (B) activating the starting pectin-containing biomass material to form an activated pectin-containing biomass material comprising the insoluble fiber component and a soluble pectin component by subjecting the starting pectin-containing biomass material to (i) an activating solution formed by adding acid to the mixture to adjust the pH of the mixture within the range from at or about 0.5 to at or about 2.5 and (ii) heat to a temperature greater than at or about 40 degrees Celsius; and (C) applying mechanical energy either (i) to the mixture of step A), (ii) during the activating of step B), or (iii) to the mixture of step A) and during the activating of step B); and (D) separating the activated pectin-containing biomass material from the mixture; wherein during the method the alcohol present in the mixture is at or greater than about 40 weight percent based on the total weight of the mixture. Activated pectin-containing biomass compositions are also provided. |
| US11987649B2 |
Wet milling process
The present invention provides process for treating crop kernels, comprising the steps of a) soaking kernels in water to produce soaked kernels; b) grinding the soaked kernels; c) treating the soaked kernels in the presence of an effective amount of GH62 polypeptide having arabinofuranosidase activity or a GH43 polypeptide having arabinofuranosidase activity, wherein step c) is performed before, during or after step b). |
| US11987646B2 |
Immunomodulatory peptides
This disclosure provides peptides which can therefore be used for various therapeutic purposes, such as inhibiting the progression of a hyperproliferative disorder, including cancer; treating infectious diseases; enhancing a response to vaccination; treating sepsis; and promoting hair re-pigmentation or lightening of pigmented skin lesions. |
| US11987645B2 |
Peptide for treating rheumatoid arthritis and use thereof
A peptide for treating rheumatoid arthritis and use thereof are provided, and a peptide consisting of an amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 5 or a polynucleotide encoding the same, and a pharmaceutical composition for treating rheumatoid arthritis or a health functional food composition for improving rheumatoid arthritis, each including the peptide, are provided. |
| US11987644B2 |
Method of manufacturing bispecific antibodies, bispecific antibodies and therapeutic use of such antibodies
The invention relates to bivalent bispecific monoclonal antibodies (bbmAb) or variants thereof, and methods of manufacturing such antibodies by co-expressing modified Fc-mutated derivatives of two different monoclonal antibodies in mammalian cell lines. |
| US11987641B2 |
Anti-PSMA antibodies and uses thereof
Disclosed herein are antibodies or antigen binding fragments thereof that bind prostate specific membrane antigen (PSMA), polynucleotides, vectors, host cells, radioconjugates, antibody drug conjugates and methods of treating cancer using the same. |
| US11987640B2 |
Anti-mesothelin antigen-binding molecules and uses thereof
Mesothelin (MSLN) is expressed on pancreatic cancers, ovarian cancers and mesotheliomas. The present disclosure provides antigen-binding molecules, including anti-MSLN antibodies, and bispecific antigen-binding molecules that bind to both MSLN and a T cell antigen (e.g., CD3) and activate T cells in the presence of MSLN-expressing tumor cells. The antigen-binding molecules of this disclosure are useful for the treatment of diseases and disorders in which a MSLN-targeted immune response is desired and/or therapeutically beneficial. For example, the antigen-binding molecules of the present disclosure are useful for the treatment of various cancers, including pancreatic cancer, ovarian cancer and mesotheliomas. |
| US11987638B1 |
Prevention of disulfide bond reduction during recombinant production of polypeptides
The invention concerns methods for preventing the reduction of disulfide bonds during the recombinant production of disulfide-containing polypeptides. In particular, the invention concerns the prevention of disulfide bond reduction during harvesting of disulfide-containing polypeptides, including antibodies, from recombinant host cell cultures. |
| US11987632B2 |
Antibodies binding to HLA-A2/MAGE-A4
The present invention generally relates to antibodies that bind to HLA-A2/MAGE-A4, including multispecific antibodies e.g. for activating T cells. In addition, the present invention relates to polynucleotides encoding such antibodies, and vectors and host cells comprising such polynucleotides. The invention further relates to methods for producing the antibodies, and to methods of using them in the treatment of disease. |
| US11987630B2 |
Anti-vista antibodies and fragments, uses thereof, and methods of identifying same
The present invention relates to antibodies and fragments that bind to a V-domain Ig Suppressor of T cell Activation (VISTA), and methods of eliciting certain biological responses using the antibodies. Methods of identifying anti-VISTA antibodies capable of eliciting certain biological responses are also included. |
| US11987628B2 |
Methods and compositions for modulating CAR-T activity
Disclosed herein are engineered cells and/or hypoimmunogenic cells including engineered and/or hypoimmunogenic stem cells, engineered and/or hypoimmunogenic cells differentiated therefrom, engineered and/or hypoimmunogenic CAR-T cells (primary or differentiated from engineered and/or hypoimmunogenic stem cells) and related methods of their use and generation. Provided herein are engineered and/or hypoimmunogenic cells exhibiting reduced expression of MHC class I and/or MHC class II human leukocyte antigens and T-cell receptors. In some embodiments, such cells also exogenously express one or more tolerogenic factors such as CD47 and one or more chimeric antigen receptors (CAR)s. |
| US11987624B2 |
Human monocarboxylate transporter 1 antibodies and uses thereof
The present invention relates to antibodies that specifically bind human monocarboxylate transporter 1 (MCT1) (“anti-human MCT1 antibodies”), compositions comprising such anti-human MCT1 antibodies, and methods of using such anti-human MCT1 antibodies. |
| US11987622B2 |
Drug-conjugates with a targeting molecule and two different drugs
There is disclosed an improved ADC (antibody drug conjugate) type composition having at least two different drug payloads conjugated to a single targeting protein. More specifically, the present disclosure attaches a first drug conjugate to a dual Cysteine residue on a targeting protein and a second drug conjugate with a different drug to a Lys residue on the targeting protein. |
| US11987619B2 |
Single-chain chimeric polypeptides and uses thereof
Provided herein are single-chain chimeric polypeptides that include: (i) a first target-binding domain; (ii) a soluble tissue factor domain; and (iii) a second target-binding domain. Also provided here are methods of using these single-chain chimeric polypeptides and nucleic acids encoding these single-chain chimeric polypeptides. |
| US11987618B2 |
Camelidae single-domain antibodies against Yersinia pestis and methods of use
Single-domain antibodies (SAbs) against three Yersinia pestis surface proteins (LcrV, YscF, and F1), nucleic acid sequences encoding the SAbs, and polypeptides comprising two or more SAbs capable of recognizing two or more epitopes and/or antigens. The present invention further includes methods for preventing or treating Y. pestis infections in a patient; methods for detecting and/or diagnosing Y. pestis infections; and devices and methods for identifying and/or detecting Y. pestis on a surface and/or in an environment. |
| US11987616B2 |
Antigen binding molecules targeting SARS-CoV-2
The invention provides, in various embodiments, polypeptides (e.g., camelid antibodies and antigen binding fragments thereof) that specifically bind to Spike glycoprotein of severe acute respiratory syndrome coronavirus (e.g., SARS-CoV-2-Spike). The invention also provides, in various embodiments, fusion proteins comprising one or more of the polypeptides, polynucleotides encoding the polypeptides, vectors and host cells suitable for expressing the polypeptides, and methods for treating viral infections (e.g., COVID-19). |
| US11987613B2 |
Isolated T cell receptors and methods of use therefor
Provided are isolated TCRs, TCR-like molecules, and portions thereof that bind to phosphopeptide-HLA-A2 complexes. The isolated TCRs, TCR-like molecules, or portions are optionally soluble TCRs, TCR-like molecules, or portions. Also provided are isolated nucleic acids encoding the disclosed TCRs, TCR-like molecules, or portions; host cells that contain the disclosed TCRs, TCR-like molecules, or portions; pharmaceutical compositions that include the disclosed TCRs, TCR-like molecules, portions, nucleic acids, and/or T cells; kits; and methods of using the same. |
| US11987611B2 |
Polypeptide and method of producing IMP using the same
The present disclosure relates to a novel polypeptide having an activity of exporting 5′-inosine monophosphate, a microorganism comprising the same, a method for preparing 5′-inosine monophosphate using the same, and a method for increasing export of 5′-inosine monophosphate. |
| US11987607B2 |
Antimicrobial peptides with alpha-core helices
Computational systems and methods are described for identifying new α-helical antimicrobial peptides using a systemic consensus formula. Newly identified α-helical antimicrobial peptides are tested experimentally and show potent microbiocidal activities. |
| US11987603B2 |
Chimeric insecticidal proteins toxic or inhibitory to lepidopteran pests
Nucleotide sequences are disclosed that encode novel chimeric insecticidal proteins exhibiting Lepidopteran inhibitory activity. Particular embodiments provide compositions and transformed plants, plant parts, and seeds containing the recombinant nucleic acid molecules encoding one or more of the chimeric insecticidal proteins. |
| US11987602B2 |
Malonate transporters
The methods and systems disclose enzymes that function to import malonic acid or malonates into a cell. The enzymes increase the output of precursor molecules by enriching certain pathways in the cell. The precursor molecules can be converted to cannabinoids. The enzymes are a family of proteins which have a majority of common alignments. |
| US11987601B2 |
Norovirus fusion proteins and VLPs comprising norovirus fusion proteins
Nucleic acids encoding norovirus VP1 fusion proteins and VLPs comprising the norovirus VP1 fusion proteins are provided. Methods for norovirus VP1 fusion protein and norovirus VLP production in plants are also described. The VP1 fusion protein comprises, a first sequence encoding an S domain derived from a first norovirus strain, and a second sequence encoding a P domain derived from a second norovirus strain. |
| US11987600B2 |
Contraceptive use of triterpenoids
Disclosed are systemic and intravaginal non-hormonal contraceptives comprising a spermicidal triterpenoid. The contraceptive may be in the form of a foam, cream or gel, or in unit form of a pill, vaginal contraceptive film (VCF), suppository, sponge, transdermal or hypodermal patches or a slow release intravaginal device or intrauterine device such as a drug-impregnated silicone elastomer vaginal ring or polymeric IUD. |
| US11987599B2 |
Solid support for synthesizing nucleic acid sequences and methods for making and using
Disclosed herein are embodiments of a solid support suitable for synthesizing nucleic acid sequences. The solid support may have a structure according to Formula I, where CPG is controlled pore glass, and m, n, x, y, R1 and R2 are as defined herein. Also disclosed are methods for making and using the solid support, kits including solid support, and a universal linker phosphoramidite suitable for use in the solid support. |
| US11987596B1 |
Polyelectrochromism of electronically weakly coupled 4,4′-divinylazoarylene-bridged two Ru(CO)Cl(PiPr3)2 entities
A 4,4′-divinylazoarylene-bridged diruthenium complex bearing two Ru(CO)Cl(PiPr3)2 entities, its synthesis, and its use as an catalyst in inorganic processes. |
| US11987595B2 |
Fluorogenic probe using a Mislow-Evans rearrangement for real-time imaging of hydrogen peroxide
Provided herein is a fluorogenic probe that selectively undergoes a [2,3]-sigmatropic rearrangement (seleno-Mislow-Evans rearrangement) with H2O2, followed by an acetal hydrolysis, to produce a green fluorescent molecule in seconds. Also provided herein is a method of identifying or visualizing the presence of H2O2 in a cell, tissue, organ, or organism that includes contacting the cell, tissue, organ, or organism with the fluorogenic probe. Also provided herein is a method of identifying or quantifying the presence of H2O2 in a sample that includes adding to or mixing in the sample the fluorogenic probe. |
| US11987591B2 |
Salts, crystal forms, and production methods thereof
Provided are salts of (S)-(4,5-dihydro-7H-thieno[2,3-c]pyran-7-yl)-N-methylmethanamine and various of crystal forms thereof, and compositions, medicaments, pharmaceutically acceptable formulations thereof, and methods of making same. In addition, provided are compounds comprising specific particle size distributions of crystalline (S)-(4,5-dihydro-7H-thieno[2,3-c]pyran-7-yl)-N-methylmethanamine HCl and methods of making and modulating the particle size distributions. |
| US11987589B2 |
Heterocyclic flavone derivatives, compositions, and methods related thereto
In certain embodiments, the disclosure relates to heterocyclic flavone derivatives, such as those described by formula provided herein, pharmaceutical compositions, and methods related thereto. In certain embodiments, the disclosure relates to methods of treating or preventing diseases or conditions related to BDNF and TrkB activity, such as depression, stroke, Rett syndrome, Parkinson's disease, and Alzheimer's disease by administering effective amounts of pharmaceutical compositions comprising compounds disclosed herein to a subject in need thereof. |
| US11987583B2 |
Fused triazolo-pyrimidine compounds having useful pharmaceutical application
A compound and/or a pharmaceutically acceptable salt thereof has the following formula A: These compounds can be PIKfyve kinase inhibitors. |
| US11987578B1 |
7-(4-((5-(2-chlorobenzylideneamino)-2-thioxo-1,3,4-thiadiazol-3(2H)-yl)methyl)piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid as an anti-inflammatory compound
A 7-(4-((5-(2-chlorobenzylideneamino)-2-thioxo-1,3,4-thiadiazol-3(2H)-yl)methyl)piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid compound, its synthesis, and its use as an anticancer and/or anti-inflammatory agent. |
| US11987577B2 |
Therapeutic compounds and methods
The disclosure provides a compound of formula I: or a salt thereof, wherein R1, R2, R4, L1, L2, and A have any of the values described in the specification, as well as compositions comprising a compound of formula (I). The compounds are useful as TRPV4 antagonists. |
| US11987572B2 |
Therapeutic compounds and methods of use thereof
The invention provides a compound of formula I: or a salt thereof, wherein R1, R2, R3, A, B, D, E, F and G have any of the values described in the specification, as well as compositions comprising a compound of formula I. The compounds are useful as bromodomain inhibitors. |
| US11987568B2 |
Allosteric inhibitor of WEE1 kinase
Disclosed is a method for selecting a cancer therapeutic for a patient that involves assaying a tumor biopsy sample from the subject to detect PAXIP1 expression, and selecting a WEE1 inhibitor as the cancer therapeutic if PAXIP1 is detected in the tumor biopsy sample. |
| US11987563B1 |
3-cyano 4,5-diphenyl furan-2-carboxamides as antitubercular agents
Compounds for treating a microbial infection and/or tuberculosis and, particularly, antimicrobial and/or antitubercular compounds that are 3-cyano 4,5-diphenyl furan-2-carboxamides and their use as antimicrobial and/or antitubercular agents are provided. |
| US11987562B2 |
Production of hydroxyethylpiperazine
Embodiments relate to a continuous process for the production of hydroxyethylpiperazine that includes feeding neat piperazine, recycled piperazine, and ethylene oxide to a reactor to form crude hydroxyethylpiperazine, in which the reactor is a continuous stirred tank reactor or a plug flow reactor. The process further includes continuously feeding the crude hydroxyethylpiperazine from the reactor to a distillation system that includes at least one distillation column, the distillation system produces at least a recycled piperazine stream and a hydroxyethylpiperazine stream, the recycled piperazine stream includes the recycled piperazine that is fed to the reactor to form the crude hydroxyethylpiperazine, and the hydroxyethylpiperazine stream includes at least 60 wt % of hydroxyethylpiperazine based on a total weight of the hydroxyethylpiperazine stream. |
| US11987559B1 |
1-(4-bromobenzylideneamino)-5-phenylimidazolidine-2,4-dione as an antimicrobial compound
A 1-(4-bromobenzylideneamino)-5-phenylimidazolidine-2,4-dione compound, its synthesis, and its use as an antimicrobial agent. |
| US11987553B2 |
Methods for removal of sulfur dioxide (SO2) from trifluoroacetyl chloride (TFAC)
Impurities such as sulfur dioxide (SO2) are removed from trifluoroacetyl chloride (TFAC) through distillation, adsorption, or a combination thereof, and/or including the formation of an azeotrope or azeotrope-like composition including effective amounts of sulfur dioxide (SO2) and trifluoroacetyl chloride (TFAC). The trifluoroacetyl chloride (TFAC) thus purified may then be used in the manufacture of trifluoroiodomethane (CF3I). Also disclosed are azeotropes and azeotrope like compositions of sulfur dioxide (SO2) and trifluoroacetyl chloride (TFAC). |
| US11987552B2 |
Polymeric phenolic antioxidants
A phenol compound comprises a phenyl group, a hydroxy group directly bonded to the phenyl group, and at least one polymeric substituent bound to the phenyl group. The polymeric substituent comprises three or more monomers units. A method for producing a polyurethane polymer comprises the steps of (a) providing a polyol; (b) providing a polyisocyanate compound; (c) providing the phenol compound described above; (d) combining the polyol, the polyisocyanate compound, and the phenol compound to produce a reaction mixture; and (e) allowing the polyol and the polyisocyanate compound to react to produce a polyurethane polymer. |
| US11987549B2 |
Preparation method of rhodium octanoate dimer
A preparation method of a rhodium octanoate dimer includes the following steps: (1) mixing RhCl3 with an alkali metal octanoate uniformly to get a first solution; (2) adding a reductant into the first solution obtained from step (1), and heating for reflux reaction to get a second solution; (3) adding the second solution obtained from step (2) into deionized water while hot, continuing to stir, and performing a suction filtration to get a crude product; and (4) performing a primary washing, a secondary washing, a filtration, and a drying on the crude product obtained from step (3) to get a rhodium octanoate dimer as a green solid. |
| US11987547B2 |
Methods for forming light olefins that include use of cooled product as a recycled quench stream
According to one or more embodiments, a method for forming light olefins may comprise introducing a hydrocarbon feed stream into a reactor, reacting the hydrocarbon feed stream with a dehydrogenation catalyst in the reactor to form a high temperature dehydrogenated product, separating at least a portion of the dehydrogenation catalyst from the high temperature dehydrogenated product in a primary separation device, combining the high temperature dehydrogenation product with a quench stream to cool the high temperature dehydrogenation product and form an intermediate temperature dehydrogenation product, and cooling the intermediate temperature dehydrogenation product to form a cooled dehydrogenation product. |
| US11987546B2 |
Polycyclic carbogenic molecules and uses thereof as anti-cancer agents
Disclosed are new polycyclic carbogenic molecules and their methods of synthesis. The new polycyclic carbogenic molecules may be utilized in anti-cancer therapies. In particular, the polycyclic carbogenic molecules may be formulated as pharmaceutical compositions that comprise the small molecules, which compositions may be administered in methods of treating and/or preventing cell proliferative diseases and disorders such as cancer. The new polycyclic carbogenic molecules may be prepared from vinyl- or allyl-substituted cyclohexenone precursors via preparation of a silyl bis-enol ether intermediate. |
| US11987544B2 |
Device and method for extraction of pure compounds
Described is an extraction device for extracting compounds from plant material and a method for using such an extraction device. The extraction device comprises an extraction tank receiving plant material and dissolving soluble compounds inside the plant material into a solvent to form a micelle. A series of fluidly connected separation chambers separate purified compounds from the micelle, resulting in purified compounds in each of the separation chambers and solvent. A heat exchanger and a chilled reservoir are used for cooling and storing the solvent. A pump is used for pumping and circulating the solvent into the extraction device. Finally, a control system automatically controls temperature and flow in the extraction device. |
| US11987543B1 |
8-(4-bromobenzylideneamino)naphthalene-1,3-disulfonic acid as an antioxidant compound
An 8-(4-bromobenzylideneamino)naphthalene-1,3-disulfonic acid compound, its synthesis, and its use as an antioxidant agent. |
| US11987542B2 |
Co-crystal of sorafenib derivatives and process for preparation thereof
The present disclosure provides compounds for the inhibition of soluble epoxide hydrolase and associate disease conditions, as well as a method of treating or preventing disorders in a subject by inhibition of soluble epoxide hydrolase. |
| US11987539B2 |
Dicarboxylic acid diesters
The present invention relates to novel dicarboxylic diesters as well as the use thereof as for inhibiting the methane production in ruminants. |
| US11987538B2 |
Method for producing cyclic olefin compound
Provided is a method for producing a cyclic olefin compound, including a step of producing a cyclic olefin compound by acting a divalent nickel complex represented by General Formula (1) to decarbonylate and decarboxylate an alicyclic dicarboxylic acid anhydride, in which the divalent nickel complex includes at least one specific anionic ligand Y: Ni(Y)m(L)n (1) wherein Ni is divalent nickel, Y is an anionic monodentate or polydentate ligand and has at least one Ni-E covalent bond, E is a heteroatom or a n-bonding group, m is 1 or 2, L is a neutral ligand, and n is a real number of 0 to 6. |
| US11987531B2 |
Ultra-high dielectric constant garnet
Disclosed are embodiments of synthetic garnet materials for use in radiofrequency applications. In some embodiments, increased amounts of bismuth can be added into specific sites in the crystal structure of the synthetic garnet in order to boost certain properties, such as the dielectric constant and magnetization. Accordingly, embodiments of the disclosed materials can be used in high frequency applications, such as in base station antennas. |
| US11987529B2 |
Light shielding member
The light shielding member of the present disclosure includes an aluminum oxide ceramics including an oxide of titanium whose composition formula is shown as TiO2-x (1≤x<2), and a total content of Fe, Ni, Co, Mn and Cr is 260 mass ppm or less. |
| US11987528B2 |
Process for hydrophobizing shaped insulation-material bodies based on silica at ambient pressure
The present invention relates to a process for producing a hydrophobized shaped thermal-insulation body, comprising pressing or compacting a thermal-insulation mixture containing a silica, an IR opacifier, an organosilicon compound A and an organosilicon compound B, wherein organosilicon compound A is hexamethyldisilazane (HMDS) and organosilicon compound B corresponds to a substance of the formula RnSiX4-n, where R=hydrocarbyl radical having 1 to 18 carbon atoms, n=0, 1 or 2, X=Cl, Br or alkoxy group —OR1 where R1=hydrocarbyl radical having 1 to 8 carbon atoms, or organosilicon compound B corresponds to a silanol of the formula HO[—Si(CH3)2O—]mH, where m=2-100. |
| US11987527B1 |
High-performance green concrete kit with four components
A green concrete comprising: a binder component comprising Portland cement (C), volcanic ash (VA), microsilica (MS) and colloidal nano-silica (CNS); an aggregate component comprising fine aggregates (FA) and coarse aggregates (CA); water (W); and a super plasticizer. |
| US11987526B2 |
Multilayer insulating construction system for a building—method for its manufacture—dry composition for use in such manufacture
The aim of the invention is to provide a novel construction system for buildings, having the properties of being multilayer, insulating, ductile, and lightweight.To this end, the invention relates to a multilayer insulating construction system for a building, characterized in that (a) this system comprises at least one wall associated with at least one hardened insulation layer, (b) the maximum thickness of the hardened insulation layer is between 1 and 60 cm, (c) the hardened insulation has a bulk density (BD) in kg/m3 that is less than or equal to 450; 300; 250; 200; 150; 100; and more preferably between 50 and 300; 150 and 250; (d) this hardened insulation layer is prepared by mixing, with water, a dry composition (d) comprising: -A at least one binder including: -A1- at least one hydraulic or air binder; -A2- possibly at least one water retention agent -A3- possibly at least one surfactant; -B- at least one bio-sourced aggregate based on sunflower stalk and/or corn stalk and/or rape stalk, having a Bulk Density(BD) in kg/m3 that is less than 110; preferably between 10 and 80; (e) this composition having a ratio of A/B [mass of dry binder -A- in kg]/[mass of dry filler -B- in kg] comprised between 1 and 10. Another object of the invention is the dry composition which, after mixing with water, enables manufacturing the hardened insulation layer of this construction system. The invention also includes the method for manufacturing the construction system. |
| US11987525B2 |
Mortar containing polyurethane dispersion with ethylene oxide units
A composition including: at least one waterbased polyurethane dispersion containing ethylene oxide units; at least one cement; and at least one mineral filler. The composition can be mixed and applied without coagulation of the polyurethane dispersion. Upon curing, it has a high strength and good adhesion properties, with surprisingly low shrinkage and most surprisingly good water impermeability properties. It is particularly suitable for the use as repair mortar, waterproofing mortar or screed mortar. |
| US11987522B2 |
Ion exchangeable glass containing boron and phosphorous
Ion exchangeable glasses containing SiO2, Al2O3, Na2O, MgO, B2O3, and P2O5 are provided. The compressive stresses of these ion exchanged glasses are greater than 900 megapascals (MPa) at a depth of 45 or 50 microns (μm) with some glasses exhibiting a compressive stress of at least 1 gigaPascals (GPa). The ion exchange rates of these glasses are much faster than those of other alkali aluminosilicate glasses and the ion exchanged glass is resistant damage to impact damage. A method of ion exchanging the glass is also provided. |
| US11987513B2 |
Method for synergistic degradation treatment of polysaccharide-containing polymer wastewater by controllable—OH radical
The present disclosure relates to the technical field of wastewater treatment in oil and gas field operations, in particular to a method for synergistic degradation treatment of polysaccharide-containing polymer wastewater by controllable —OH radical. In this method, a ferrous ion solution, an alkaline solution, and an oxidant solution are mixed and heated to generate —OH radicals, —O radicals and polymeric iron ions, etc., which then is mixed with polysaccharide-containing polymer wastewater. The generated highly oxidative —OH radicals and —O radicals react with polysaccharide polymers so that they are degraded. The generated polymeric iron ions form flocs that purify the suspended solids in the wastewater. The purified polysaccharide-containing polymer wastewater can be re-injected or reused as an oilfield working fluid. In the present disclosure, the polysaccharide-containing polymer wastewater can be treated in a quick and efficient manner, and the treated wastewater can be recycled. |
| US11987510B2 |
Production of H2S for efficient metal removal from effluents
Method and apparatus pertaining to the production of hydrogen sulfide using sodium salts recycle. Sodium sulfate is reacted with a carbon containing stream to produce sodium sulfide and carbon dioxide. The sodium sulfide is blended with elemental sulfur and water. The blend is subjected to elevated temperatures and pressures to result in the production of hydrogen sulfide and sodium sulfate. A mixing apparatus, such as a bubble column reactor, has been found to be especially useful. The hydrogen sulfide can be used for removing metal from effluents. |
| US11987506B2 |
Salt recovery solution and processes of use thereof
The present invention relates to a salt recovery solution and to a process for separating a salt from an aqueous solution. The present disclosure also relates to a salt recovery solution and to its use to concentrate a salt or brine solution by recovering water therefrom. The salt recovery solution suitable for recovering a salt from an aqueous solution comprises at least one tertiary amine containing compound; and at least one enolisable carbonyl. |
| US11987505B2 |
Enhanced foam removal of total suspended solids and multiply charged cations from aqueous or aqueous/oil mixed phase via increased viscoelasticity
The present invention provides improved methods for purifying and/or removing multiply charged cations and suspended solids from water. In particular the process relates to an additive composition that has the appropriate surfactant characteristics for effectively removing multiply charged cations and suspended solids from an aqueous or oil/aqueous mixed phase via foam fractionation. According to the invention, a hydrophobically modified polymer that acts as an associative thickener is used in the presence of a source of alkalinity or anionic reactant as well as surfactant in appropriate ratios to facilitate multiply charged cation and suspended solids removal for water purification in any of a number of commercial, environmental and industrial applications. |
| US11987500B2 |
Nanomaterial, method of preparing the nanomaterial and application thereof
A nanomaterial and a method of preparing the nanomaterial are provided. The nanomaterial is a product formed by a reaction of functionalized carbon nanotube comprising first and second aminoalkyl groups covalently bonded to a surface of the carbon nanotube and a porphyrin ring of formula (I). A method of removing a pollutant from an aqueous solution by contacting the aqueous solution having an initial concentration of the pollutant with the nanomaterial is also provided. |
| US11987496B2 |
Method for producing bis(fluorosulfonyl)imide lithium salt (LiFSI) with reduced fluorine anion content by using alkoxy trialkyl silane
A method for producing a bis(fluorosulfonyl)imide lithium salt is disclosed. The method includes the steps of: (a) reacting bis(chlorosulfonyl)imide with NH4F(HF)n (n=0-10) to prepare ammonium bis(fluorosulfonyl)imide; and (b) reacting the ammonium bis(fluorosulfonyl)imide with a lithium base, wherein in at least one of steps (a) and (b), after the reaction, a process of adding an alkoxy trialkyl silane to the reaction solution to remove a fluorine anion is performed. |
| US11987494B2 |
Wire-bond damper for shock absorption
Various embodiments of the present disclosure are directed towards a microelectromechanical systems (MEMS) package comprising a wire-bond damper. A housing structure overlies a support substrate, and a MEMS structure is between the support substrate and the housing structure. The MEMS structure comprises an anchor, a spring, and a movable mass. The spring extends from the anchor to the movable mass to suspend and allow movement of the movable mass in a cavity between the support substrate and the housing structure. The wire-bond damper is on the movable mass or structure surrounding the movable mass. For example, the wire-bond damper may be on a top surface of the movable mass. As another example, the wire-bond damper may be on the support substrate, laterally between the anchor and the movable mass. Further, the wire-bond damper comprises a wire formed by wire bonding and configured to dampen shock to the movable mass. |
| US11987491B2 |
MEMS actuator element and MEMS actuator array with a plurality of MEMS actuator elements
A MEMS (micro-electromechanical system) actuator element includes a substrate, a stationary first electrode structure with an edge structure, a second electrode structure with an edge structure, wherein the second electrode structure is deflectably coupled to the substrate by means of a spring structure and electrostatically deflectable by means of the first electrode structure to move the edge structure of the second electrode structure into an intermediate position between a minimum and maximum vertical deflection position, wherein the minimum and maximum deflection position specify a maximum deflection path, wherein the edge structures of the first and second electrode structures are to each other and are vertically spaced apart in the minimum deflection position and wherein, in the maximum deflection position, the vertical immersion path of the edge structure of the second electrode structure into the edge structure of the first electrode structure is up to 0.5 times the maximum deflection path zS. |
| US11987486B2 |
System for processing containers
One embodiment of the present invention provides a system for processing containers. The system may include an apparatus for processing sealed plastic containers having a first headspace pressure. The apparatus may include: an open entry port or tunnel for continuously receiving containers; a sanitizer configured to sanitize outside surfaces of the received containers; a perforator configured to perforate or open a cap or seal of the containers within the apparatus; a sealer configured to seal the perforation or opening formed in the cap or seal of the containers; an open exit port or tunnel for continuously exiting the processed containers; and a conveyor system configured to transport or convey the containers. The system may further include a production line including a filler for filling empty blow-moulded containers with a heated liquid to pasteurize inside surfaces of the containers and a capper for sealing the filled blow moulded containers. |
| US11987483B2 |
Operator control system for a materials handling vehicle
An operator control system is provided for a materials handling vehicle, the materials handling vehicle including an operator station having a support structure. The operator control system includes an operator control assembly having a housing mounted to or integral with the support structure, and at least one control element for controlling a function of the vehicle. One or both of the housing and/or the control element is positionable in a plurality of positions. |
| US11987482B2 |
Aircraft cargo handling system with distributed antenna system and mobile cargo controller
A cargo handling system that utilizes a distributed antenna system for a cargo bay or compartment is disclosed. A cargo deck within the cargo bay may incorporate a plurality of power drive units. A mobile cargo controller may wirelessly communicate with the distributed antenna system to control movement of a ULD into/out of/within the cargo bay. A base station may be operatively interconnected with both the distributed antenna system and the plurality of power drive units (e.g., directly or indirectly via a control system, such as a control panel). |
| US11987480B2 |
Cable guide device
A cable guide device, including a cable with one end attached to an unwinding/rewinding device, another end having structure for accepting applied force, with cable therebetween guided by a cable guide, wherein as force is applied to the cable, the cable guide causes redirection of the applied force eliminating cable binding as cable is rewound. One embodiment is a trunnion-sheave winch-apparatus for object recovery, including: a trunnion-sheave of a pair of sheaves with cable inserted therebetween, one cable end attached to a winch drum with a hook attached to its other end for connection to an object being recovered, wherein as the object is recovered the force applied to the cable is redirected by the trunnion-sheave causing said cable to be maintained at a minimum of 90° contact with the pair of sheaves regardless of the angle of force being applied to the cable causing elimination of cable binding. |
| US11987479B2 |
Cable tensioning capstan assembly with independently rotatable flange
A cable tensioning capstan assembly comprises a capstan drum and at least a first traction flange. The capstan drum may be configured to support a cable (e.g., a cable is configured to wrap around the capstan drum), and the capstan drum may be configured to rotate about an output axis. The first traction flange may be disposed adjacent the first axial end of the capstan drum and configured to rotate about the output axis. In various embodiments, the first traction flange is independently rotatable relative to the capstan drum. A clutch assembly between an input shaft and the first traction flange may facilitate the independent rotatability of the first traction flange. |
| US11987478B2 |
Guide display device and crane provided with same
Provided is a guide display device with which incorrect recognition of a place having small features as a ground surface having no features can be suppressed in generating and updating a three-dimensional map. A data processing unit (70): detects an edge (Eg) of a feature (E) on the basis of a result of subjecting image data captured by a camera (61) to image processing, and recognizes the feature (E) on the basis of the edge (Eg); and accumulates, from a predetermined number of frames from before the time at which the image data was captured, point group data (P) of a nearby range (Ma) of the edge (Eg) of the feature (E) that was recognized as a ground surface (F), and generates, on the basis of the accumulated point group data (P), a three-dimensional map (M) of the feature (E) the edge (Eg) of which has been recognized. |
| US11987477B2 |
System and method for controlling mobile hoisting apparatus, server and mobile hoisting apparatus
The present disclosure provides a system for controlling a mobile hoisting apparatus, a method for controlling a mobile hoisting apparatus, a server, and a mobile hoisting apparatus, capable of improving efficiency and reducing cost of hoisting operations. The system for controlling a mobile hoisting apparatus includes: an environment sensing module configured to detect environment information, and transmit the environment information to a server; a positioning module configured to determine a location of the mobile hoisting apparatus to obtain location information of the mobile hoisting apparatus, and transmit the location information to the server; and the server configured to plan a travel route from a current location of the mobile hoisting apparatus to a hoisting operation location of the mobile hoisting apparatus, determine a perception result based on the environment information, determine travel decision information based on the perception result and the travel route, control the mobile hoisting apparatus to move to the hoisting operation location along the travel route based on the travel decision information, and control, at the hoisting operation location, a hoisting arm of the mobile hoisting apparatus to place goods to be transported to a corresponding target location. |
| US11987473B2 |
Escalator device
An escalator device includes a plurality of steps, wherein both sides of each step are provided with mounting portions and step wheels rotatably mounted to the mounting portions; step wheel guide rails fixedly arranged on both sides of the escalator device for guiding the step wheels of each step, during the operation of the escalator device, the step wheels of each step move along the step wheel guide rails on both sides respectively; and anti-detachment guide rails arranged on both sides of the escalator device, during the movement of the step wheels of each step along the step wheel guide rails on both sides respectively, the anti-detachment guide rails are located above and spaced apart from anti-detachment portions of each step, a piezoelectric sensor is provided on the surface of the anti-detachment guide rail facing the anti-detachment portion. |
| US11987471B2 |
Image forming apparatus
An image forming apparatus, including a main chassis having a discharge tray and a switchback tray in an upper position with respect to the discharge tray; an image forming unit; a discharge roller to discharge a recording sheet conveyed through the image forming unit onto the discharge tray; a duplex conveyer to invert the sheet and convey the inverted sheet to return to the image forming unit; and a switchback roller being rotatable in a normal direction to convey the sheet toward the switchback tray and a reverse direction to convey the sheet to the duplex conveyer; is provided. The main chassis includes a pair of walls, each of which extends in a vertical direction and in a conveying direction of the sheet and is arranged in adjacent to the switchback tray such that the switchback tray is interposed between the pair of walls. |
| US11987463B2 |
Medium storage device and method of controlling the medium storage device
A medium storage device includes a safe having at a front portion a first entrance for replenishment and recovery to which a first transit cassette is selectively connected and at a rear portion a second entrance for replenishment and recovery to which a second transit cassette is selectively connected; an identification unit serving to identify whether the medium is a normal medium or a rejection medium; a recycle cassette configured to accommodate the medium recognized as the normal medium; a conveyance path configured to convey the medium between the first entrance, the second entrance, the identification unit, and the recycle cassette; and a control unit is configured to control the conveyance path such that the medium accommodated in the first transit cassette is conveyed to the identification unit, and the medium identified as the normal medium in the identification unit is conveyed to the recycle cassette. |
| US11987462B2 |
Switch assembly for devices for handling value documents
The invention relates to a switch assembly for a device for handling value documents, comprising a shaft (110) which is rotationally fixed to a switch body (120), said switch body (120) being rotatable about the longitudinal axis of the shaft (110) between a first switch body position (P1) and a second switch body position (P2). The switch assembly additionally comprises a switch lever (130, 131), said shaft (110) being rotatable about its longitudinal axis by means of the switch lever (130, 131), and a solenoid (200) which comprises an armature (210). The solenoid (200) can be actuated such that the armature (210) can be moved between a first armature position (A1) and a second armature position (A2). The switch lever (130, 131) is in engagement with the armature (210) such that the switch lever (130, 131) rotates about the longitudinal axis of the shaft (110) by means of the movement of the armature. |
| US11987459B2 |
Gravity-driven flow rack assemblies
A method of transporting a vehicle engine wire harness from a component preparation location to a component pick location is provided. The method includes placing the vehicle engine wire harness on a hook of a component hanger. The component hanger with vehicle engine wire harness is directed along a supply track assembly through a heated enclosure to the component pick location at a vehicle assembly line. |
| US11987458B2 |
Curtain assemblies or seals for dock levelers
A dock leveler apparatus includes a curtain assembly that includes an upper curtain section and a lower curtain section. The curtain assembly is movable between a folded configuration and a pendant configuration. The curtain assembly extends a greater distance in the pendant configuration than in the folded configuration. A connector couples to the upper curtain section to a deck pivotally coupled to a base frame of a dock leveler. A releasable coupling is provided between the upper curtain section and the lower curtain section. The releasable coupling is to removably couple the lower curtain section and the upper curtain section. |
| US11987457B2 |
Coordinated braking systems and methods for rail cars
A system and method include a train including a plurality of rail cars configured to travel along a track having rails. Each of the plurality of rail cars includes brakes. A braking control unit is in communication with the brakes of the plurality of rail cars. The braking control unit is configured to control the brakes of a subset of the plurality of rail cars in accordance with braking data. |
| US11987452B2 |
Palletizing system and palletizing method
A plurality of workpieces include a plurality of first workpieces of a first workpiece group to be loaded onto a first loaded member according to a first loading sequence and a plurality of second workpieces of a second workpiece group to be loaded onto a second loaded member according to a second loading sequence. On a conveying device, workpieces are arranged at ransom with respect to respective arrangement sequences of the first workpiece group and the second workpiece group and the classifications of the first workpiece group and the second workpiece group. On a conveying device, workpieces of the first workpiece group are sequentially arranged based on the first loading sequence and workpieces of the second workpiece group are sequentially arranged based on the second loading sequence. At the same time, the workpieces of the first workpiece group and the second workpiece group are arranged together. |
| US11987445B2 |
Lid opening-and-closing device
A lid opening-and-closing device that opens and closes an upper lid of a container, the container including: a container body; the upper lid; a locking mechanism that locks the upper lid onto the container body when the upper lid is mounted on the container body; and a strip provided to the upper lid, the device including: a placement platform on which the container is placed; a guide provided on both sides above the placement platform and comes into contact with a lower face of the strip to rotate the strip upward to an extent exceeding the predetermined value with respect to the container body when the container is inserted in the horizontal direction to a specified position of the placement platform; and a raising/lowering mechanism that moves the container body and the upper lid for which locking by the locking mechanism has been released, relatively in an up-and-down direction. |
| US11987443B2 |
Subsea fluid storage unit
A modular subsea fluid storage unit comprises a variable-volume inner tank having a rigid top panel and a peripheral wall that is flexible by virtue of concertina formations. The peripheral wall is extensible and retractable vertically while the horizontal width of the tank remains substantially unchanged. A side wall of a lower housing part surrounds and is spaced horizontally from the peripheral wall of the inner tank to define a floodable gap between the peripheral wall and the side wall that surrounds the tank. An upper housing part extends over and is vertically spaced from the top panel of the inner tank and overlaps the side wall to enclose the inner tank. The floodable gap and the upper housing part enhance thermal insulation and trap any fluids that may leak from the inner tank. |
| US11987437B1 |
Attachable beverage insulator
A beverage insulator includes a first portion adapted to insulate a first surface of beverage container, and an attachment point arranged to attach the beverage insulator to an apparatus when the beverage insulator is not in use. The attachment point may include a slit that is adapted to stretch over the handle of a cooler, thereby attaching the beverage insulator to the cooler. The beverage insulator may be adapted to remain substantially flat when attached to the cooler, thereby providing an area for branding or other display. |
| US11987436B2 |
Package and method for color retention of fresh meat
The package includes a plurality of food packages (16) continuing fresh meat food products (17). Each food package is vacuum packaged in a case ready package with a permeable film. The case ready package being sealed within a master pouch (12) having a modified atmosphere. The modified atmosphere having an elevated concentration of carbon monoxide. The fresh meat (17) being in the case ready package and not in direct contact with the modified atmosphere. The fresh meat (17) retaining acceptable color within the case ready package after being removed from the master pouch. |
| US11987432B2 |
Device for containing a liquid or semi-liquid cosmetic or pharmaceutical product
The invention provides a device (900) for containing a liquid or semi-liquid cosmetic or pharmaceutical product, the device comprising: a closure (902) comprising a product withdrawing conduit; a rigid container (901) having a first means for engaging with the closure, thereby closing the container; and a cartridge (905) enclosed within the rigid container, the cartridge having a second means for engaging with the closure, thereby forming a substantially airtight seal between the cartridge and the closure; wherein the cartridge comprises a biodegradable or recyclable rigid outer (906) enclosing a collapsible liner (907), the collapsible liner defining a cavity for containing the product, wherein the product withdrawing conduit extends inside the cavity. Also related methods, products and kits. |
| US11987426B2 |
Lid-spout assembly for a package and package having a lid-spout assembly
A lid-spout assembly for a package having a main body including a designated pour opening and being filled with a pourable product. The lid-spout assembly comprises at least a spout having a pouring outlet, a lid configured to selectively close and open the pouring outlet and a tethering element tethering the lid to the spout. The spout includes at least a base frame configured to couple the spout to the main body about the designated pour opening and a collar carrying the pouring outlet and protruding from the base frame. The tethering element includes a first end fixed to the lid and a second end fixed to the collar. |
| US11987425B2 |
Flip top closure and container
A closure (10) of the flip-top type, and a closure combined with a bottle or other container The closure comprises a cap base (12) which can be releasably fastened to a package (74), the cap base including an opening. A closing flap (16) is movably attached to the cap base and is suitable, when it is in a closed position, for preventing egress of a liquid from the package through the cap base opening. The closing flap has a locking flap extending therefrom, and movably attached to the closing flap. A locking flap fastener (70) is provided for releasably securing the locking flap to the cap base or to the package to prevent inadvertent opening of the closure during transport and use by the consumer. The locking flap (38) may be tucked within the closing flap during normal use and used to lock the closing flap during transport. The locking flap may be disposed in a recess (20) in the cap base. |
| US11987424B2 |
Container lid having oxygen shielding properties
An oxygen-shielding container lid according to the present invention comprises a high density polyethylene cap shell 1 having a skirt section 7 and a top plate section 5 provided with an inner ring 9 for intimate contact with an inner surface of a container mouth; and an in-shell molded body 3 provided in a portion of an inner surface of the top plate section which is surrounded with the inner ring 9. The in-shell molded body 3 is composed of a primary molded body 3a which has been formed by in-shell molding on the inner surface of the top plate section and which has an oxygen shielding function; and a secondary molded body 3b which has been formed on the primary molded body 3a by in-shell molding so as to cover the primary molded body 3a and to be fused and fixed to the inner surface of the top plate section at the peripheral edge of the primary molded body. A resin composition used for formation of the secondary molded body 3b contains linear low density polyethylene, and has a melt flow rate at 190° C. of 1 to 10 g/10 minutes, a density of 0.900 to 0.920 g/cm3, and a nominal tensile strain at break, as defined by JIS K-6922-2, of 400% or more. |
| US11987420B2 |
Skid assembly for an appliance
A packaging assembly for a home appliance includes a base frame including a first plank and a second plank provided parallel to the first plank, and a pair of spring clips attached to the base frame. The pair of spring clips includes a right spring clip attached to a top surface of the first plank, and a left spring clip attached to a top surface of the second plank, wherein an axial extension direction of the right spring clip is parallel to an axial extension direction of the left spring clip, and wherein the pair of springs are configured to selectively accept a base rail of the home appliance therein. |
| US11987416B2 |
Plastic container
Plastic container (1) being composed of a neck (3), a shoulder (5), a body (4) and a base section (2), where the base section (2) comprises at least two tie members (6a) extending from a central area (8) to the side wall of the base (2). According to the invention, the tie members (6b, 6c) and/or the function of the tie members (6b, 6c) of the base (2) at least in certain areas extend into the body section (4) or into the body (4) and the shoulder section (5) of the plastic container (1). |
| US11987415B2 |
Method and apparatus for filling and/or emptying flexible containers
A filling and/or emptying apparatus (I) for filling and/or emptying flexible containers (5) having a filling and/or emptying neck (2) with an open end portion and at least one deformable disposable fastening ring (9), wherein the ring (9) is designed in relation to the internal diameter of the neck (2) such that once a container edge (7) is folded over around the ring, it is possible to insert the ring (9) in an end portion of the neck (2) so that the ring (9) is arranged substantially concentrically with the neck (2), and a radially outer fold-over portion (8) of the container edge (7) is arranged and/or clamped between an inner surface of the neck (2) and a radially outer surface. It is possible to press the ring (9) into a sealing portion (15) of the neck (2), which is arranged after the end portion in the axial direction (A) and has a smaller internal diameter than the end portion. The ring (9) undergoes deformation in the radial direction, so that the insertion and/or pressing into the interior of the neck (2) leads to a radial deformation and a counterposed pressure force which presses the outer fold-over portion (8) of the container edge (7) against the inner surface of the neck (2), thereby sealing the container (5) against the neck (2). |
| US11987412B2 |
Spirofeed brush box for a blister machine
The present disclosure relates to a brush box that includes a housing, a gear system (100) configured inside the housing. The gear system (100) includes a first gear (102) having first teeth configured on an inner side of the first gear (102). Second gear (104) configured inside the first gear (102), the second gear (104) includes second teeth that engages with the first teeth such that the first gear (102) configured to rotate about its axis when the at least one second gear (104) moves on the inner side of the first gear (102). Distributing means (106) operatively coupled to the second gear (104). The movement of the second gear (104) circumferentially on the inner side of the first gear (102) enables spirographic movement of the distributing means (106) around a centre of the first gear (102). |
| US11987409B2 |
Packaged viscoelastic polymer substance
Packaged viscoelastic polymer substances and methods for the production of the packaged viscoelastic polymer substances are provided. The packaged viscoelastic polymer substances are further processable under the influence of heat and shear. |
| US11987407B2 |
Robotic strapping machine and method
A strapping system and method for automatically applying strapping to at least one associated object, such as a roll of coiled material having a void. The system includes a first end effector and second end effector, each end effector mountable to a robotic arm and including at least a portion of a chute, the end effectors movable relative to each other when mounted to a robotic arm such that the chute portions of each end effector can be selectively brought together in a plurality of orientations to define a generally continuous chute loop through which a strapping material can be advanced to surround the at least one associated object located at least partially within the chute loop. |
| US11987395B2 |
Thrusting rails for launch vehicles, and associated systems and methods
The present technology is directed to thrusting rails for launch vehicles, and associated systems and methods. Certain embodiments of the thrusting rails can include a first rail housing portion having a cavity and a second rail housing portion having a projection positioned at least partially within the cavity. The rails can include a bellows positioned within the cavity and an elongated tube positioned within the bellows. The elongated tube can include a vent opening in a lateral wall of the elongated tube. A shield can be positioned between the vent opening at the bellows and a sleeve can be positioned within the elongated tube. The sleeve can be constructed from a fibrous material and positioned to retain an ordnance within the elongated tube. |
| US11987389B2 |
Method and apparatus for forming a composite fuselage structure
A method and apparatus for forming a composite structure. An inner tooling, a stackup, and an outer tooling are held in place together using a load constraint. A bladder and a plurality of stringer bladders in the stackup are pressurized to cause expansion of the bladder and the plurality of stringer bladders, thereby pushing together an overbraided thermoplastic skin and a plurality of overbraided thermoplastic members in the stackup. The overbraided thermoplastic skin and the plurality of overbraided thermoplastic members are co-consolidated while the bladder and the plurality of stringer bladders are pressurized to form the composite structure. |
| US11987386B2 |
Method and system for depositing and checking of baggage into airline flights
A baggage drop system is disclosed for depositing and checking of baggage into airline flights. The baggage drop system can include a substantially horizontal frame member. The frame member can be mounted above a first conveyor equipped with a static or dynamic weighting scale. The frame member can also be mounted away from an end of the first conveyor at a distance from an upper surface of the first conveyor substantially equal to a maximum allowable height of baggage thereby forming a physical barrier for oversized baggage. A computer can be configured to compare an output of the weighing scale with allowable baggage weights. |
| US11987385B2 |
Aerial vehicle image capturing systems
A method, system, apparatus, and/or device for capturing images is disclosed. An example embodiment comprises a first image capturing device mounted to a mounting structure; a second image capturing device mounted to the mounting structure; and a third image capturing device mounted to the mounting structure, wherein the first image capturing device, the second image capturing device, and the third image capturing device are arranged in an octahedral array for capturing a 360 degree image, wherein the first image capturing device, the second image capturing device, and the third image capturing device face outward from a center of an octahedral shape that defines the octahedral array, and wherein image data captured by the first image capturing device, the second image capturing device, and the third image capturing device are combined to generate the 360 degree image. |
| US11987384B2 |
Timing apparatus
The present application provides a timing apparatus mounted in an unmanned aerial vehicle (UAV). The timing apparatus includes: a timing unit configured to generate a current reference time and to send the current reference time to at least one system in the UAV; and a power supply unit connected to the timing unit and configured to supply power to the timing unit. According to the timing apparatus provided in the present application, the current reference time is generated through the timing unit in the technical apparatus, and is provided to the system in the UAV, thereby synchronizing a system time of the UAV with the current reference time. |
| US11987383B2 |
Lighting apparatus for remote controlled device
There is a remote control device or drone, which has software and a combination of lights or LED on an lighting ring or apparatus that can move independently of the drone; the drone can be programmed or be reactive to sound or other stimulus to create the effect of writing shapes or words in the air and typically at nighttime against a dark sky. |
| US11987377B2 |
Turbo expanders for turbine engines having hydrogen fuel systems
Aircraft propulsion systems include aircraft systems having at least one hydrogen tank and an aircraft-systems heat exchanger and engine systems having at least a main engine core, a high pressure pump, a hydrogen-air heat exchanger, and a turbo expander. The main engine core includes a compressor section, a combustor section having a burner, and a turbine section. Hydrogen is supplied from the at least one hydrogen tank through a hydrogen flow path, passing through the aircraft-systems heat exchanger, the high pressure pump, the hydrogen-air heat exchanger, and the turbo expander, prior to being injected into the burner for combustion. The turbo expander includes a rotor separated into a first expander portion and a second expander portion arranged about an output shaft and the output shaft is operably connected to a generator configured to generate electrical power. |
| US11987375B2 |
System and method for operating engines of an aircraft in an asymmetric operating regime
Methods and systems for operating an aircraft having two or more engines are described. The method comprises receiving an engine availability confirmation when a set of engine parameters meet engine operating conditions for an asymmetric operating regime, receiving an aircraft availability confirmation when a set of aircraft parameters meet aircraft operating conditions for the asymmetric operating regime, outputting an availability message to a cockpit of the aircraft in response to receiving the engine availability confirmation and the aircraft availability confirmation, receiving a pilot-initiated request to operate the engine in the asymmetric operating regime, and commanding the engines to operate in the asymmetric operating regime in response to the pilot-initiated request. |
| US11987374B2 |
Systems and methods for driving fan blades of an engine
A system and a method for driving a fan of an engine of an aircraft, including an electric motor operatively coupled to a drive axle of the fan, and a control unit in communication with the electric motor. The control unit is configured to operate the electric motor to rotate the fan. |
| US11987369B2 |
Turbomachine with unducted dual propellers
A turbomachine of an aircraft comprising an outer casing delimiting with an inner hub, a flow path of a gas stream in which is disposed a low-pressure turbine configured to rotationally drive a low-pressure shaft; said turbomachine comprising, in the direction of flow of the gas stream, a first propeller; and a second propeller downstream of the first propeller, the first propeller being rotationally driven by said low-pressure shaft and the second propeller being rotationally driven by an electric motor, the second propeller being further disposed at a distance between 1.5 and 4 cord lengths from the first propeller defined between the respective axes of shimming of each of the first and second propellers. |
| US11987368B2 |
Aircraft operation during steep approach
Systems and methods to facilitate a steep final approach phase of flight of an aircraft are disclosed. In one embodiment, a method for operating an aircraft during a steep approach phase of flight of the aircraft comprises operating an engine of the aircraft at an idle speed associated with the steep approach type that is lower than an idle speed associated with a non-steep approach type capable of being executed by the aircraft. The method also comprises operating an ice protection system of the aircraft during the steep approach phase of flight of the aircraft. |
| US11987364B2 |
Seat rail assembly for fastening a seat assembly in a vehicle, use of a seat rail assembly of this type in an aircraft, and method for producing a seat rail assembly
A seat rail assembly for fastening a seat assembly in a vehicle and a method for making such a seat rail assembly are described. The seat rail assembly includes a seat rail configured to fasten the seat assembly, the seat rail including a metal material. A fastening profile element of the seat rail assembly is configured to receive the seat rail, the fastening profile element being formed of a plastic material. The fastening profile element forms a receiving region, which is configured to receive the seat rail, and the seat rail includes a seat rail crown which is arranged in the receiving region of the fastening profile element such that a wall portion of the fastening profile element at least partly extends around the seat rail crown. The seat rail assembly may be used in an aircraft. |
| US11987358B2 |
Towplate units for aerial cargo delivery and assemblies including the same
Towplate units and assemblies are disclosed for airborne extraction of a cargo load. The towplate unit includes an extraction and jettison links having a pair of spaced-apart parallel extraction and jettison link arms and an extraction and jettison cross-connector extending between and rigidly joining the extraction and jettison link arms, respectively. A locking system removably locks the jettison link to the extraction link to thereby allow the jettison link to be removed from the extraction link when unlocked. A towplate assembly is also provided which includes a towplate unit removably assembled with a deck plate and an actuator control assembly operatively interconnected to the towplate unit so as to cause the towplate unit to separate from the deck plate during a normal cargo deployment condition or to cause the jettison link to separate from the extraction link of the towplate unit during an aborted cargo deployment condition. |
| US11987353B2 |
Thermoplastic skin panels, torque box and method
Stiffened skin panels comprise alternating truss core portions and solid laminate portions sandwiched between inner and outer facesheets, all formed from a fiber reinforced thermoplastic. The components of the panels are co-consolidated using induction heating. The panels are stiffened with spars fastened to the solid laminate portions. |
| US11987350B2 |
Winged tiltrotor aircraft
A tandem tiltrotor aircraft in which the tiltrotor assemblies are operably coupled at the forward and aft ends of the fuselage of the aircraft is disclosed. The tiltrotor assemblies are capable of rotating between a vertical lift position and a horizontal flight position. The in-line location of the tiltrotor assemblies allow the aircraft to have the vertical take-off and landing capabilities, and, in combination with the at least one wing, can be used in horizontal flight. The aft rotor assembly can assume a horizontal flight position that places the rotor blades forward of a vertical fin of the aircraft. In another embodiment, a winged triple tiltrotor aircraft is disclosed. In another embodiment, a winged quad tiltrotor aircraft is disclosed. |
| US11987340B2 |
Hull behavior control system and marine vessel
A hull behavior control system for controlling behavior of a hull of a marine vessel includes a memory and at least one controller coupled to the memory. The at least one controller is configured or programmed to control a steering that changes the traveling direction of the marine vessel, obtain a water surface shape around the marine vessel, estimate movement of a wave based on the water surface shape, and when it is determined that the hull rides the wave whose movement has been estimated, control the steering so as to reduce an influence of the wave on the hull. |
| US11987336B2 |
Exhaust pipe coupling
An oceangoing vessel exhaust pipe coupling used to temporarily couple to an oceangoing vessel exhaust pipe. Installation and removal of the coupling only requires a simple mechanism with three translational degrees of freedom and one rotational degree of freedom, thereby enabling remote coupling. The coupling adapts to a wide array of exhaust pipe shapes and sizes. This is accomplished by a unique shape that allows stable and balanced resting position on top of an exhaust pipe as well as a two-chamber configuration, wherein the two chambers are separated by a permeable partition. Furthermore, the unique shapes of the chambers deflect the exhaust gas stream towards the outlet of the coupling, regardless of exhaust pipe style, thereby increasing capture efficiency and extending the life of an attached fabric flexible hose. |
| US11987334B2 |
Outboard motor support device
An outboard motor support device includes a transom connection mechanism, a pivot joint, and a motor support. The transom connection mechanism engages directly with a transom bracket to maximize stability and is configured to provide a consistently correct angular orientation of the motor support relative to the motor during use. In particular, the pivot joint adjustably aligns to the motor is a desired orientation during assembly to ensure a firm and “nested” engagement with the lower unit of the motor in the motor support. The motor support can be designed to fit specific motors, allowing for maximum stability and maximum surface area contact when properly aligned and engaged with the motor. The present outboard motor support device is formed as a single unit that provides vertical support as well as horizontal stabilization to the motor during transit, thereby also preserving the transom brackets and tilt/trim mechanism of the motor. |
| US11987326B2 |
Container for launching sonar buoys
A container for housing and launching sonar buoys of class G (sonobuoy) including a casing partitioned into two portions and automatic and simplified valve means to sequentially eject the buoys from the container. |
| US11987322B2 |
Bicycle sprocket
A bicycle sprocket comprises sprocket teeth. The sprocket teeth include at least one first tooth and at least one second tooth. The at least one first tooth has a first radial-tooth height. The at least one first tooth has a first chain-engaging axial width which is smaller than a first distance defined between opposed outer link plates of a bicycle chain and which is larger than a second distance defined between opposed inner link plates of the bicycle chain. The first radial-tooth height is greater than the first chain-engaging axial width. The at least one second tooth has a second radial-tooth height. The at least one second tooth has a second chain-engaging axial width which is smaller than the second distance. The second radial-tooth height is greater than the second chain-engaging axial width. The first radial-tooth height is greater than the second radial-tooth height. |
| US11987320B2 |
Power assisted electric bicycle, transmission device and control method
The present disclosure provides a power assisted electric bicycle, a transmission device and a control method. The power assisted electric bicycle includes a body, a wheel, a torque sensor, a motor and a controller. The torque sensor is configured to output a plurality of torque signals corresponding to a pedal force. The controller is configured to: receive the torque signals from the torque sensor; compute and determine a first period according to a speed of the power assisted electric bicycle at a first time point; obtain a first maximum value of the torque signals in the first period that ends at the first time point; and, set a first torque output of the motor according to the first maximum value corresponding to the torque signal. |
| US11987318B2 |
Leaning-type vehicle
A leaning vehicle includes a vehicle body, a left front wheel, a right front wheel, a lean mechanism, a lean brake mechanism, a steering handle, a left grip, a throttle grip, a lean brake manipulator. The lean mechanism causes the left front wheel and the right front wheel to lean about a front-rear direction as a rotation center when the vehicle body leans about the front-rear direction as a rotation center. The lean brake mechanism brakes the leaning operation by the lean mechanism while the leaning vehicle is traveling. The lean brake manipulator is positioned at a first side in the vehicle width direction, changes a position integrally with the left grip, and for performing an operation of actuating the lean brake mechanism to brake. |
| US11987315B2 |
Methods and apparatus for selective stiffness of vehicle suspension
A method and apparatus for an adjustable suspension system for a vehicle comprises at least one strut. In one embodiment, the stanchion (or slider) is non-uniform with a major and minor circumferential stiffness and is adjustable relative to a fore and aft axis of the vehicle in order to provide a differing amount of stiffness relative thereto. In another embodiment, a portion of the stanchion is circular and a reinforcement is annularly disposed therearound with axial retention formations, The reinforcement has a non-uniform circumferential characteristic and is rotatable relative to the fore/aft axis of the vehicle |
| US11987314B2 |
Removable bass speaker enclosure for motorcycle saddlebags
A sealed speaker enclosure for a bass speaker that is hand-insertable and removable from a hard-side motorcycle saddlebag. The body of the enclosure complements the interior space of the saddlebag making sealing contact with the interior walls of the saddlebag. The bass speaker faces the motorcycle side of the saddlebag within the shock absorber tower indentation overlapping and opening. A speaker grill overlays the opening in the shock absorber tower indentation of the saddlebag. |
| US11987311B2 |
Lock system
A lock system for securing a battery of a vehicle operable by muscle power and/or motor power, in particular an electric bicycle. The lock system includes: a deadbolt which is pivotable about a bolt axis, a lock cylinder which is configured to actuate the deadbolt, and a lifting element which is coupled to the lock cylinder, the lock cylinder being movable into a holding position and into a release position, the lock cylinder in the holding position preventing a removal of the battery in a removal direction, and in the release position allowing the removal of the battery. The lifting element is configured to move the battery in the removal direction when the deadbolt is moved from the holding position into the release position. |
| US11987310B2 |
Swinging locking mechanism for bicycle rack and bicycle rack having the same
A swinging locking mechanism for a bicycle rack is provided, configured to be assembled with a base of a hanging member, including a first rod member, a first connecting rod, a second rod member, a second connecting rod and an operating member. The first connecting rod is movably disposed on the first rod member and includes at least one second engaging portion releasably engaged with the at least one first engaging portion. The second rod member is non-swingably sleeved with the first rod member. The second connecting rod is movably disposed on the second rod member and detachably assembled with the first connecting rod. The operating member is connected with the second connecting rod. The bicycle rack including the swinging locking mechanism is further provided, further including: a carrying frame, connected with the swinging locking mechanism and configured to carry at least one bicycle. |
| US11987305B2 |
Bogie axle assembly for a vehicle
A bogie axle assembly for a vehicle, in particular for an off-highway vehicle such as a forestry machine, the bogie axle assembly comprising: a rigid link arm; a first joint disposed on the link arm for pivotally coupling the link arm to a vehicle frame; a second joint disposed on the link arm, at a distance from the first joint; a bogie pivotally coupled to the link arm via the second joint; and a ground engaging structure comprising one or more wheels rotatably mounted on the bogie. The present disclosure further relates to a vehicle comprising said bogie axle assembly. |
| US11987304B2 |
Generating steering wheel torques as tactile feedback in vehicle steering systems
Generating a steering wheel torque (ML) on a steering wheel in a vehicle steering system as a tactile feedback. A value for a rack force (FZ) may be obtained, and at least a component (MZ) of an actuator-generated target steering wheel torque (MS) utilizing a characteristic curve (K1) that defines the steering wheel torque (MS) as a function of the rack force (FZ). A steering wheel torque (ML) is generated on the basis of the target steering wheel torque (MS) using an actuator mechanically connected to the steering wheel. A steering system for a vehicle, and a control unit for such a steering system may be configured to perform the functions disclosed herein. |
| US11987302B2 |
Rim for a track roller
A rim includes a wall, a first annular projection, and a second annular projection. The wall has a first end and a second end. The first end includes a first opening, and the second end includes a second opening that communicates with the first opening to define a bore for a shaft of a track roller. The first annular projection and the second annular projection, which are configured to engage a track, extend radially from the wall. The first annular projection includes a first flange that is configured to constrain movement of the track in a first axial direction. The first flange includes a plurality of notches. The second annular projection includes a second flange that is configured to constrain movement of the track in a second axial direction that is opposite to the first axial direction. |
| US11987297B2 |
Motor-driven power steering system and control method thereof
Provided is a motor-driven power steering system including: a motor driver; and a controller, wherein the controller is configured to: receive a first rotation angle obtained by a steering wheel angle sensor according to steering and a second rotation angle obtained by a motor position sensor, when a steered position of the steering wheel is in an auxiliary steering limit section and a difference value between the first rotation angle and the second rotation angle is different from a predetermined reference value, change a rotation position of the steering wheel angle sensor and a rotation position of the motor position sensor to an initial original position, when changed to the initial original position, receive the first rotation angle and the second rotation angle again, and control the motor driver to perform auxiliary steering based on the first rotation angle and the second rotation angle received again. |
| US11987295B2 |
Modular vehicle mounted rack system
A vehicle rack system includes elongate structural members coupled together to form a rack for use on or within a vehicle's cargo area. At least one of the elongate structural members has an elongate pressure tight lumen for holding a fluid therein, and a nozzle allows the fluid to enter and exit the lumen. A vehicle having a rack system includes a vehicle and a plurality of elongate structural members removably coupled together to form a rack removably coupled to the vehicle. A first of the members has a longitudinal slot between and behind a pair of flanges. An anchor is positioned in the slot, and the anchor is irremovable from the slot while the system is at an assembled configuration. The anchor is removable from the slot while the system is at unassembled configuration. The anchor is used to secure the first member to a second of the members. |
| US11987292B2 |
Vehicle
A vehicle includes a body including a front compartment and a subframe configured to support an installed part disposed in the front compartment. The body includes a first counterface that inclines downward in a rearward direction of the vehicle. The subframe is attached to the body from below. The subframe includes a second counterface facing the first counterface of the body. The second counterface is inclined downward in the rearward direction of the vehicle. At least one of the first counterface and the second counterface includes a portion inclined rearward toward an inner side in a right-left direction of the vehicle. |
| US11987290B2 |
Suspension connection weldment
A suspension connection weldment may include a cross member having a first end and a second end and a pair of substantially parallel flank walls spaced apart from one another and arranged at respective first and second ends of the cross member. The flank walls may extend upward and forward from the respective first and second ends of the cross member and generally orthogonal to the cross member. The flank walls may include a plurality of vertically extending rib elements spaced horizontally along respective flank walls from a rear side of the flank wall to a front side of the flank wall. Each rib element may include an upper bore in an upper end and a lower bore in a lower end. The upper and lower bores may be configured to receive a suspension connecting pin. |
| US11987286B2 |
Vehicle automatic parking control device
This vehicle control device is provided with: an environment recognition unit for recognizing the surrounding environment of a vehicle; a parking route generation unit for generating a travel route to a parking position which is determined on the basis of the recognized surrounding environment; a signal input unit to which a parking command signal is input; and a travel control unit for causing the vehicle to travel along the travel route to the parking position on the basis of the input parking command signal. The vehicle control device drives the vehicle to travel to the parking position for automatic parking while behaving differently depending on whether the parking command signal input to the signal input unit is a first parking command signal or a second parking command signal. |
| US11987285B2 |
Sensing apparatus for use in power steering system of a vehicle
An embodiment provides a sensing apparatus comprising: a first rotation part; a second rotation part in which the first rotation part is disposed; a housing in which the second rotation part is disposed; and a first metal member disposed between the housing and the second rotation part, wherein the second rotation part includes a first holder and a second holder combined with the first holder, and the first metal member includes a body disposed between the first holder and the housing and a first flange portion extending radially outward from the body. |
| US11987280B2 |
Pulley assemblies for use in modular utility systems
A counterbalanced vertical track assembly which may be configured with three types of pulley support assemblies are herein disclosed. The first type of pulley support assembly has a pair of opposed pulley modules having an elongate structural element interposed the two pulley modules which are attached to end plates at both ends of the elongate structural element. The second type of pulley support assembly has a pair of opposed pulley modules which include male end connectors for demountable engagement of the pulley modules with another module of the system with female ends. The third type of pulley support assembly has a pair of opposed pulley modules wherein the modules' pulley brackets are repositionable to varying angular orientations by alternating screw mount positions selected on mount components at opposite ends of an elongate structural element. |
| US11987277B2 |
Electric rail vehicle
A Rail Drone can include: a payload interface, a drivetrain, and a rail platform 515. The Rail Drone can additionally or alternatively include any other suitable set of components. The Rail Drone can integrate a standardized payload interface and an autonomous electric road vehicle platform into a rolling stock architecture. The Rail Drone can be a stand-alone, payload-agnostic, motive element which can be independently or cooperatively capable of carrying heavy loads across long distances at various cruising speeds. |
| US11987276B2 |
Monitoring system for axles of a vehicle
A monitoring system is provided that may include a sensor configured to detect at least one characteristic related to at least one axle of a first vehicle. The monitoring system may also include a controller having one or more processors in communication with the sensor. The one or more processors may be configured to restrict movement of the first vehicle based at least in part on the at least one characteristic related to the at least one vehicle axle, and vary movement of a second vehicle based at least in part on the at least one characteristic related to the at least one vehicle axle. |
| US11987274B2 |
In-vehicle communication system
Purpose is to enable communication with a vehicle installation installed in a vehicle in a manner that facilitates implementation of a security measure and with high sensitivity and at low cost. An in-vehicle communication system includes an interior light with communication function, a seat and a display device, the interior light with communication function including a LED configured to transmit information to the seat and the display device via visible light communication, and the seat and the display device including light receiving units configured to receive information transmitted from the interior light with communication function and control units configured to control themselves based on the information received by the light receiving units. |
| US11987273B2 |
Overhead monorail driving unit group realizing mechanical fast power distribution
The present invention relates to the field of coal mine underground auxiliary transportation equipment, and particularly relates to an overhead monorail driving unit group realizing mechanical fast power distribution. The overhead monorail driving unit group realizing mechanical fast power distribution includes a rail, wherein the rail is connected with driving portions, carrying trolleys and a hoisting beam, the hoisting beam is disposed in a middle position of the driving portions and the carrying trolleys, and the driving portions, the carrying trolleys and the hoisting beam are connected through driving portion short pull rods, frame-shaped pull rods and driving portion long pull rods. Overhead monorail driving portions have four paths for transmitting a driving force to the hoisting beam, the frame-shaped pull rods directly transmit the driving force of the driving portions in positions far away from the hoisting beam to the hoisting beam, the objective is to reduce an accumulated peak value of the driving force of the driving portion in a mode of serial-parallel arrangement of the overhead monorail driving portions, the problem of horizontal direction bending failure of the rail caused by the driving portions in an operation process of an overhead monorail is solved, and the reliability and adaptability of overhead monorail transportation equipment are improved. |
| US11987270B2 |
Vehicle dispatch management device and vehicle dispatch management method
In a vehicle dispatch management system which manages a plurality of shared vehicles (2) and dispatches the shared vehicles in response to a dispatch request from a user, the vehicle dispatch management system includes: an individual cruising distance calculation device (22) configured to calculate a cruising distance of each of the shared vehicles; a total cruising distance calculation device (17) configured to calculate a total cruising distance of all of the shared vehicles; an energy supply determination device (18) configured to determine a necessity of traveling energy supply of the shared vehicle when the total cruising distance is equal to or less than a first predetermined value; and a supply instruction device (19) configured to instruct a supply instruction to the shared vehicle determined to be supplied on the basis of determining the necessity of traveling energy supply of the shared vehicle. |
| US11987265B1 |
Agent trajectory prediction using target locations
A system obtains scene context data characterizing the environment. The scene context data includes data that characterizes a trajectory of an agent in a vicinity of a vehicle up to a current time point. The system identifies a plurality of initial target locations, and generates, for each of a plurality of target locations that each corresponds to one of the initial target locations, a respective predicted likelihood score that represents a likelihood that the target location will be an intended final location for a future trajectory of the agent. For each target location in a first subset of the target locations, the system generates a predicted future trajectory for the agent given that the target location is the intended final location for the future trajectory. The system further selects, as likely future trajectories of the agent, one or more of the predicted future trajectories. |
| US11987262B2 |
Method and device for the automated driving of a vehicle
A method for automated driving of a vehicle, comprising: provide function modules, wherein the function modules each comprise at least one subfunction for automated driving, and wherein the function modules are each assigned at least one module validity attribute that defines the context of the surroundings in which the particular function module is valid, provide at least one system configuration, wherein the at least one system configuration comprises at least one of the function modules, and wherein the at least one system configuration is assigned at least one configuration validity attribute that defines the context of the surroundings in which the at least one system configuration is valid, select one of the at least one system configurations, wherein the selection depends on a context of the surroundings and the at least one associated configuration validity attribute, control the vehicle, wherein controlling is based on the selected system configuration. |
| US11987261B2 |
Detecting a road structure change by a lead autonomous vehicle (AV) and updating routing plans for the lead AV and following AVs
A lead autonomous vehicle (AV) includes a sensor configured to observe a field of view in front of the lead AV. Following AVs are on the same road behind the lead AV. A processor of the lead AV is configured to detect a road structural change on the particular road. The processor updates driving instructions of the lead AV to navigate through the structural change using driving instructions related to the structural change. The processor sends a first message to the operation server indicating that the structural change is detected. The operation server updates the first portion of the map data, reflecting the structural change. The operation server sends the updated map data to the one or more following AVs. |
| US11987254B2 |
Ground load estimation device, control device, and ground load estimation method
The present invention achieves a technique that makes it possible to estimate a ground contact load of a vehicle with sufficiently high accuracy. A ground contact load estimation device (100) acquires a wheel angular speed, a steady load, and an inertia load of a vehicle, uses the steady load and the inertia load to cause a first gain calculation section (122) to calculate a first gain, multiplies a variation in wheel angular speed by a second gain so as to cause a tire effective radius variation calculation section (121) to calculate a tire effective radius variation, and multiplies the tire effective radius variation by the first gain so as to estimate a road surface load. |
| US11987253B2 |
Apparatus and method for testing automated vehicles
A processor, responsive to a set of location or motion data describing one or more objects relative to a first, local frame of reference, generates a transformed set of location or motion data describing the one or more objects relative to a second, local frame of reference different than the first local frame of reference, such that the set of location or motion data and the transformed set of location or motion data relative to a global frame of reference are same. The processor also outputs the transformed set of location or motion data to a vehicle such that the vehicle performs control operations responsive thereto. |
| US11987248B2 |
Vehicle control device
A vehicle control device is configured to: execute vehicle speed maintaining control for causing the vehicle speed to coincide with a set vehicle speed; start first control, for causing the acceleration to coincide with target acceleration for keeping maintaining acceleration no higher than limit acceleration, or second control, for controlling the acceleration such that the vehicle speed is kept no higher than a limit vehicle speed lower than the set vehicle speed, as limit control when a traffic signal correlated distance correlated with a traffic signal distance to a stop instructing traffic signal is determined to become a first threshold or less during execution of the vehicle speed maintaining control; and suspend the vehicle speed maintaining control and the limit control when a driver operates a deceleration operator during execution of the limit control. |
| US11987240B2 |
System for avoiding blind spot of vehicle and method thereof
A method and apparatus for avoiding a blind spot of a vehicle, where the apparatus for avoiding the blind spot of the vehicle includes an image sensor configured to provide image information by acquiring a surrounding image of a host vehicle, and a vehicle controller configured to sense a large vehicle traveling adjacent to the host vehicle based on the image information, determine a blind spot range of the large vehicle, determine a dangerous level of the blind spot range, and generate a path for the host vehicle to deviate from the blind spot or to avoids the blind spot, based on a traveling situation of the host vehicle. |