| Document | Document Title |
|---|---|
| US11886407B2 |
Method of performing transactional and analytical data processing using a data structure
Disclosed herein is a computer-implemented method of processing a query using a columnstore comprising a plurality of segments, the method comprising: receiving a query comprising a parameter; determining a key corresponding to the parameter; identifying a mapping structure, from a plurality of mapping structures, relating to said key, wherein each mapping structure corresponds to a respective segment of the columnstore; interrogating the identified mapping structure to determine a value corresponding to the key, wherein the value identifies an entry of an index table of a plurality of index tables that corresponds to the respective segment, wherein the entry of the index table identifies a row of the respective segment of the columnstore relating to the parameter; and retrieving data relating to the parameter from a data source based on data stored in the entry of the index table. |
| US11886405B2 |
System and method for extracting and cataloging specified file activity data
A system for use in restoring data processing capabilities in the event of an interruption. System including a user catalog program that when executed by a processor configures the system to store indexes of data utilized by the system, a system management facility (SMF) program that when executed by the processor configures the system to create SMF audit records that track the catalog activity as SMF data, and a virtual catalog program that when executed by the processor configures the system to intercept portions of the SMF data over a timeline. The portions correspond to the creation, deletion and modification of the data files, and catalog the intercepted portions of SMF data over the timeline. |
| US11886402B2 |
Systems, methods, and media for dynamically generating informational content
Systems, methods, and media for generating analytical data from actions performed on one or more publishing servers. Methods may include capturing one or more audit trails by determining actions performed on the one or more publishing servers via one or more client devices, the one or more publishing servers adapted to publish informational content; generating analytical data from the one or more audit trails; and storing the generated analytical data in a database. |
| US11886399B2 |
Generating rules for data processing values of data fields from semantic labels of the data fields
Methods and systems are configured to determine a semantic meaning for data and generate data processing rules based on the semantic meaning of the data. The semantic meaning includes syntactical or contextual meaning for the data that is determined, for example, by profiling, by the data processing system, values stored in a field included in data records of one or more datasets; applying, by the data processing system, one or more classifiers to the profiled values; identifying, based on applying the one or more classifiers, one or more attributes indicative of a logical or syntactical characteristic for the values of the field, with each of the one or more attributes having a respective confidence level that is based on an output of each of the one or more classifiers. The attributes are associated with the fields and are used for generating data processing rules and processing the data. |
| US11886396B2 |
System and method for learning-based synthesis of data transformation rules
Data migration of an application from source to target information system is a critical step for a successful modernization project. There are few commercial tools available to address the data migration challenge, creation of a data transformation specification is largely a manual, knowledge intensive, and expert driven process. A system and method for learning based synthesis of data transformation rules have been provided. The system is focused on automating important aspects of automatic inference of the transformation specification. The key principles behind the system and method are derived from the observations on how experts use domain, system, and historical mapping knowledge while creating data transformation specifications. The system contains two major components, schema matching and transformation rule program generation. The system uses machine learning, knowledge representation for schema matching and developed rule generator using a deductive synthesizer. |
| US11886390B2 |
Data file partition and replication
The present disclosure provides a method, system, and device for file replication. To illustrate, based on target replication information corresponding to a version of a file at a target device, a source device may determine one or more portions of a different version of the file at the source device to be provided to the target device. One or more other aspects of the present disclosure further provide sending, to the target device, the one or more portions and replication information corresponding to the version of the file at the source device. Based on the version of the file at the target device, the one or more portions, and the replication information corresponding to the version of the file at the source device, the target device may assemble and store a file that corresponds to the version of the file at the source device. |
| US11886379B2 |
System and method of partial compilation with variational algorithms for quantum computers
A computing system includes a quantum processor with qubits, a classical memory including a quantum program defining a plurality of instructions in a source language, and a classical processor configured to: (i) receive a circuit of gates representing a quantum program for a variational algorithm in which computation is interleaved with compilation; (ii) identify a plurality of blocks, each block includes a subcircuit of gates, leaving one or more remainder subcircuits of the circuit of gates outside of the plurality of blocks; (iii) pre-compile each block of the plurality of blocks with a pulse generation program to generate a plurality of pre-compiled blocks including control pulses configured to perform the associated block on the quantum processor; and (iv) iteratively execute the quantum program using the pre-compiled blocks as static during runtime and recompiling the one or more remainder subcircuits on the classical processor at each iteration of execution. |
| US11886375B2 |
Interface with variable data rate
A device includes a transmitter coupled to a node, where the node is to couple to a wired link. The transmitter has a plurality of modes of operation including a calibration mode in which a range of communication data rates over the wired link is determined in accordance with a voltage margin corresponding to the wired link at a predetermined error rate. The range of communication data rates includes a maximum data rate, which can be a non-integer multiple of an initial data rate. |
| US11886373B2 |
Authentication and information system for reusable surgical instruments
An authentication and information system for use in a surgical stapling system includes a microprocessor configured to demultiplex data from a plurality of components in the surgical system. The authentication and information system can include one wire chips and a coupling assembly with a communication connection. |
| US11886367B2 |
Arbitration allocating requests during backpressure
An arbitration system receives requests to access a destination during an arbitration window that spans multiple processor clock cycles. During each clock cycle, the destination is monitored to determine whether the destination is suffering from backpressure by receiving more requests than the destination is able to accommodate during the clock cycle. In response to detecting backpressure, a masking index value assigned to a requesting source is incremented, which limits an amount of requests from the source that will be granted destination access during a subsequent arbitration window. Alternatively, in response to detecting an absence of backpressure during an arbitration window, the masking index value is decremented, which increases the amount of requests from the source that will be granted destination access during a subsequent arbitration window. This arbitration process continues for successive arbitration windows, oscillating between incrementing and decrementing the masking index value during the successive arbitration windows. |
| US11886365B2 |
DMA control circuit with quality of service indications
Techniques for improving the handling of peripherals in a computer system, including through the use of a DMA control circuit that helps manage the flow of data between memory and the peripherals via an intermediate storage buffer. The DMA control circuit is configured to control timing of DMA transfers between sample buffers in the memory and the intermediate storage buffer. The DMA control circuit may output a priority value of the DMA control circuit for accesses to memory, where the priority value based on stored quality of service (QoS) information and current channel data buffer levels for different DMA channels. The DMA control circuit may separately arbitrate between multiple active transmit and receive channels. Still further, the DMA control circuit may store, for a given data transfer over a particular DMA channel, timestamp information indicative of completion of the DMA and peripheral-side operations. |
| US11886360B2 |
Memory module with programmable command buffer
A memory module includes a plurality of memory integrated circuit (IC) packages to store data and a command buffer IC to buffer one or more memory commands destined for the memory IC packages. The command buffer IC includes a first interface circuit and one or more second interface circuits. The first interface circuit receives the one or more memory commands. The one or more second interface circuits output a pre-programmed command sequence to one or more devices separate from the command buffer IC, the pre-programmed command sequence output in response to the one or more memory commands matching a pre-programmed reference command pattern. |
| US11886359B2 |
AI accelerator apparatus using in-memory compute chiplet devices for transformer workloads
An AI accelerator apparatus using in-memory compute chiplet devices. The apparatus includes one or more chiplets, each of which includes a plurality of tiles. Each tile includes a plurality of slices, a central processing unit (CPU), and a hardware dispatch device. Each slice can include a digital in-memory compute (DIMC) device configured to perform high throughput computations. In particular, the DIMC device can be configured to accelerate the computations of attention functions for transformer-based models (a.k.a. transformers) applied to machine learning applications. A single input multiple data (SIMD) device configured to further process the DIMC output and compute softmax functions for the attention functions. The chiplet can also include die-to-die (D2D) interconnects, a peripheral component interconnect express (PCIe) bus, a dynamic random access memory (DRAM) interface, and a global CPU interface to facilitate communication between the chiplets, memory and a server or host system. |
| US11886357B2 |
Memory for reducing cost and power consumption
A memory includes: a control chip; and a plurality of storage chips, in which the plurality of storage chips are electrically connected with the control chip via a common communication channel, the plurality of storage chips include a first storage chip set and a second storage chip set, the storage chips in the first storage chip set are configured to perform information interaction with the control chip by adopting a first clock signal, the storage chips in the second storage chip set are configured to perform information interaction with the control chip by adopting a second clock signal, and phase of the first clock signal is different from phase of the second clock signal. |
| US11886356B2 |
Local instantiation of remote peripheral devices
Enhanced apparatuses, systems, and techniques for coupling network-linked peripheral devices into host computing devices is presented. A method includes, over a network interface of a host device, obtaining an indication of a peripheral device available for associating with the host device. Based on the indication, the method includes initiating instantiation of the peripheral device into a Peripheral Component Interconnect Express (PCIe) subsystem of the host device by at least emulating behavior of the peripheral device over the network interface as a PCIe peripheral device coupled locally to the host system. |
| US11886352B2 |
Access friendly memory architecture of graph neural network sampling
This specification describes methods and systems for accelerating attribute data access for graph neural network (GNN) processing. An example method includes: receiving a root node identifier corresponding to a node in a graph for GNN processing; determining one or more candidate node identifiers according to the root node identifier, wherein attribute data corresponding to the one or more candidate node identifiers are sequentially stored in a memory; and sampling one or more graph node identifiers at least from the one or more candidate node identifiers for the GNN processing. |
| US11886351B2 |
Memory efficient virtual address management for system calls
Systems and methods for managing host virtual addresses in a system call are disclosed. In one implementation, a processing device may receive, by a supervisor managing a first application), a system call initiated by the first application, wherein a first parameter of the system call specifies a memory buffer virtual address of the first application and a second parameter of the system call specifies the memory buffer virtual address of the second application. The processing device may also translate the memory buffer virtual address of the first application to a first physical address and may translate the memory buffer virtual address of the second application to a second physical address. The processing device may further compare the first physical address to the second physical address and responsive to determining that the first physical address matches the second physical address, the processing device may execute the system call using the memory buffer virtual address of the second application. |
| US11886348B2 |
Interleaved cache prefetching
A method includes receiving, at a direct memory access (DMA) controller of a memory device, a first command from a first cache controller coupled to the memory device to prefetch first data from the memory device and sending the prefetched first data, in response to receiving the first command, to a second cache controller coupled to the memory device. The method can further include receiving a second command from a second cache controller coupled to the memory device to prefetch second data from the memory device, and sending the prefetched second data, in response to receiving the second command, to a third cache controller coupled to the memory device. |
| US11886343B2 |
Lock-free ring buffer
According to at least one embodiment, a method for writing, by a computing thread, data to a ring buffer is disclosed. The method includes determining whether the ring buffer is full. If the ring buffer is not full, the method further includes: reserving an element of the ring buffer for writing the data, wherein reserving the element includes incrementing a size variable corresponding to a number of stored elements in the ring buffer; reserving a portion of the ring buffer at which the data is to be written; and determining whether a state of the portion of the ring buffer is in change by at least one other computing thread. If the state is not in change, the method further includes: marking the state of the portion of the ring buffer as being in change by the computing thread; and writing the data to the portion of the ring buffer. |
| US11886334B2 |
Optimizing spool and memory space management
A storage system has NVRAM (non-volatile random-access memory), solid-state storage memory, and a processor to perform a method. The method includes allocating virtual units of NVRAM with mapping of the virtual units to physical memory. The method includes writing data having various sizes into allocated first virtual units of memory and into allocated second virtual units of memory. The first virtual units of memory each include a first contiguous physical addressed amount of NVRAM having a first size. The second virtual units of memory each include an amount of NVRAM having a second size. The method includes relocating at least some of the data such that a portion of the allocated second virtual units of memory become available for the allocating. |
| US11886333B2 |
Memory block reclamation method and apparatus
A memory block reclamation method includes, after receiving an unmap command sent by a memory controller, a medium controller reclaims one or more memory blocks in a non-volatile memory connected to the medium controller based on memory logical address information in the unmap command. The one or more reclaimed memory blocks are available memory blocks. |
| US11886331B2 |
Memory sub-system codeword addressing
A method includes writing a first codeword to a first set of contiguous partitions in a first memory die of a memory device. The method further includes writing a first portion of a second codeword to a second set of contiguous partitions in the first memory die of the memory device and writing a second portion of the second codeword to a first set of contiguous partitions in a second memory die of the memory device. The method also includes writing a third codewords to a second set of contiguous partitions in the second memory die of the memory device. |
| US11886330B1 |
System, method, and computer program for generating a context visualization during test automation
As described herein, a system, method, and computer program are provided for generating a context visualization during test automation. In use, during automated testing of a user interface application, an inspection of an element within a user interface of the user interface application is detected. Additionally, in response to detecting the inspection of the element, a visualization of the element within the user interface is generated. Further, the visualization of the element within the user interface is presented with information associated with the inspection of the element. |
| US11886329B2 |
Automated machine learning test system
A computing device selects new test configurations for testing software. (A) First test configurations are generated using a random seed value. (B) Software under test is executed with the first test configurations to generate a test result for each. (C) Second test configurations are generated from the first test configurations and the test results generated for each. (D) The software under test is executed with the second test configurations to generate the test result for each. (E) When a restart is triggered based on a distance metric value computed between the second test configurations, a next random seed value is selected as the random seed value and (A) through (E) are repeated. (F) When the restart is not triggered, (C) through (F) are repeated until a stop criterion is satisfied. (G) When the stop criterion is satisfied, the test result is output for each test configuration. |
| US11886324B2 |
Relay and metering test instrument
A relay and metering test instrument includes an application processor circuitry to control functional operation of the relay and metering test instrument. The application processor circuitry may receive a user selected source code state program, and operational parameters input by the user. The application processor circuitry may compile the source code state program and the operational parameters into a test routine for storage in a memory circuitry with other test routines. The relay and metering instrument may also include a real time processor circuitry and an input/output processor circuitry. The real time processor circuitry may selectively and independently execute the test routine or one of the other test routines to perform one or more respective testing stages. The input/output processor circuitry may cooperatively operate with the real time processor circuitry to output test signals and monitor for receipt of input test signals according to execution of the test routine. |
| US11886320B2 |
Diagnosing application problems by learning from fault injections
Identifying a likely cause of a problem in an application can include: injecting a series of a set of predetermined faults into the application; sampling a subset of a set of training features from the application during each predetermined fault injected into the application and labeling each subset with an identifier of the corresponding predetermined fault; and training a classifier to identify the likely cause by associating a set of real-time features sampled from the application that pertain to the problem to one or more of the predetermined faults in response to the training features. |
| US11886317B2 |
Inappropriate use control system and inappropriate use control program
When a current situation corresponds to at least one of action determination conditions as conditions for determining a curbing action as an action for curbing inappropriate use of an electronic device carried and used by a user, the electronic device determines the curbing action according to the action determination condition to which the current situation corresponds, and executes the determined curbing action. |
| US11886316B2 |
Platform measurement collection mechanism
An apparatus to collect firmware measurement data at a computing system is disclosed. The apparatus includes a plurality of agents, each including a non-volatile memory storing firmware executed to perform a function associated with the agent, verification logic to generate measurement data by verifying the integrity of the firmware and a register to store the measurement data, and a processor to execute an instruction to collect firmware measurement data from each of the plurality of agents. |
| US11886315B2 |
Managing computing capacity in radio-based networks
Disclosed are various embodiments for managing computing capacity in radio-based networks and associated core networks. In one embodiment, it is determined that a set of computing hardware implementing a radio-based network for a customer has an excess capacity. At least one action is implemented to reallocate the excess capacity of the computing hardware. |
| US11886313B2 |
Temperature assisted NAND flash management
Systems, apparatus and methods are provided for temperature assisted non-volatile storage device management in a non-volatile storage system. In one embodiment, a non-volatile storage system may comprise a temperature sensor, a non-volatile storage device and a processor. The processor may be configured to obtain a read-out from the temperature sensor, generate a predicted real-time on-die temperature for the non-volatile storage device based on the read-out, generate an estimated threshold voltage for reading data stored in the non-volatile storage device based on the predicted real-time on-die temperature and conduct a local sweep of a reference voltage using the estimated threshold voltage as a starting point to obtain a final read reference voltage with a minimum read bit error rate. |
| US11886311B2 |
Intra-class adaptation fault diagnosis method for bearing under variable working conditions
The invention relates to a fault diagnosis method for a rolling bearing under variable working conditions. Based on a convolutional neural network, a transfer learning algorithm is combined to handle the problem of the reduced universality of deep learning models. Data acquired under different working conditions is segmented to obtain samples. The samples are preprocessed by using FFT. Low-level features of the samples are extracted by using improved ResNet-50, and a multi-scale feature extractor analyzes the low-level features to obtain high-level features as inputs of a classifier. In a training process, high-level features of training samples and test samples are extracted, and a conditional distribution distance between them is calculated as a part of a target function for backpropagation to implement intra-class adaptation, thereby reducing the impact of domain shift, to enable a deep learning model to better carry out fault diagnosis tasks. |
| US11886310B2 |
System for cloud infrastructure validation for suitability substantiation
Systems, computer program products, and methods are described herein for implementing an intelligent validation protocol within a cloud infrastructure. The present invention is configured to receive a request to invoke the intelligent validation protocol on one or more cloud service component clusters; determine one or more operating systems associated with the one or more cloud service component clusters; determine one or more validation requirements for the one or more operating systems; dynamically invoke, using the intelligent validation protocol, a multi-checkpoint validation subroutine on the one or more operating systems; determine whether the one or more operating systems meet the one or more validation requirements; initiate a dashboard script configured to generate an analysis interface indicating whether the one or more operating systems meet the one or more validation requirements; and transmit control signals configured to cause the computing device of the user to display the analysis interface. |
| US11886306B2 |
Systems and methods for leveraging backup metadata to provide granular options for discovery of deleted items and recovery after data backup
A method for performing a backup includes: receiving, by a computing device, a native view request for a graphical user interface (GUI) of a local file system; intercepting, by a backup services agent executing on the computing device, the native view request before the GUI is generated; obtaining, by the backup services agent and in response to intercepting the native view request, a file system backup metadata associated with the local file system from a backup storage device and a local file system metadata associated with the local file system from a local storage of the computing device; generating a combined file system content list using the file system backup metadata and the local file system metadata; generating the GUI using the combined file system content list; and displaying, on a display of the computing device and to a user, the GUI. |
| US11886303B2 |
Streamlined secondary copy operations for data stored on shared file storage
The present inventors devised techniques and technologies that streamline the protection of data stored on shared file storage e.g., on file servers, network-attached storage (NAS), share drives, network shares, etc., in a data storage management system. Some embodiments feature a proxy-less backup configuration in which backup services hosts are assigned to perform a secondary copy job, at job runtime, based on host attributes relative to the data source. Some embodiments are configured to, at job runtime, automatically resolve data paths to the source data, and automatically mount the data paths, rather than requiring data paths to be expressly pre-administered on all possible candidate backup machines. Some embodiments automatically protect data from shared file storage that was not expressly given a backup plan (“undefined” data) by applying default preferences for protecting undefined data. |
| US11886302B1 |
System and method for execution of applications in a container
Disclosed are systems and methods for execution of applications in a container. An exemplary method comprises receiving, by at least one computing device, a request to an application, wherein the application includes a set of instructions for processing the request, determining whether a state snapshot is available for the computing device, restoring state of the process from the state snapshot in a container on the computing device and processing the request based on the set of instructions by the process when the state snapshot is available, preparing at least one new process in the container on the computing device for processing the request, creating a new state snapshot for the application and processing the request based on the set of instructions by the new process when the state snapshot is not available, wherein creating the new state snapshot is performed after preparing the new process and before processing the request. |
| US11886301B2 |
Encryption key management
Disclosed herein are system, method, and computer program product embodiments for encryption key management. An embodiment operates by executing an initial non-backup instance of an application and generates a primary key using a cryptographic algorithm. The embodiment requests a customer to create a passphrase configured to encrypt and decrypt the primary key. The embodiment generates a derived key using a cryptographic algorithm and the customer passphrase as input. The embodiment then encrypts the primary key using the generated derived key and stores the encrypted primary key in a catalog. |
| US11886288B2 |
Optimize data protection layouts based on distributed flash wear leveling
A method for storing data in a storage system having solid-state memory is provided. The method includes determining portions of the solid-state memory that have a faster access rate and portions of the solid-state memory that have a slower access rate, relative to each other or to a threshold. The method includes writing data bits of erasure coded data to the portions of the solid-state memory having the faster access rate, and writing one or more parity bits of the erasure coded data to the portions of the solid-state memory having the slower access rate. A storage system is also provided. |
| US11886285B2 |
Cross-correlation of metrics for anomaly root cause identification
Technologies are disclosed herein for cross-correlating metrics for anomaly root cause detection. Primary and secondary metrics associated with an anomaly are cross-correlated by first using the derivative of an interpolant of data points of the primary metric to identify a time window for analysis. Impact scores for the secondary metrics can be then be generated by computing the standard deviation of a derivative of data points of the secondary metrics during the identified time window. The impact scores can be utilized to collect data relating to the secondary metrics most likely to have caused the anomaly. Remedial action can then be taken based upon the collected data in order to address the root cause of the anomaly. |
| US11886284B2 |
System and method for data redistribution in a database
A method for data redistribution of a job data in a first datanode (DN) to at least one additional DN in a Massively Parallel Processing (MPP) Database (DB) is provided. The method includes recording a snapshot of the job data, creating a first data portion in the first DN and a redistribution data portion in the first DN, collecting changes to a job data copy stored in a temporary table, and initiating transfer of the redistribution data portion to the at least one additional DN. |
| US11886282B2 |
Recovery method for terminal device startup failure and terminal device
Embodiments of this application provide a recovery method for a terminal device startup failure and a terminal device. The method includes: determining that a failure indication event occurs in a startup process, where the failure indication event is used to indicate a startup failure; determining at least one recovery policy based on a type of the failure indication event and/or a cause of the failure indication event; and performing startup recovery based on the at least one recovery policy. |
| US11886280B2 |
Return and replacement protocol (RRP)
Systems and methods provide for managing faulting network devices. A first network device can receive an error. The first network device can generate one or more frames including data indicative of the error. The first network device can broadcast the one or more frames to one or more neighboring network devices. It may be determined that the first network device is inaccessible. The first data can be retrieved and presented from a second network device among the one or more neighboring network devices. In some embodiments, a network management system can utilize the first data to generate a machine learning model that classifies whether network devices are instances of network devices designated for a Return Merchandise Authorization (RMA) process. In some embodiments, the network management system can apply the first data to a machine learning classifier to determine whether to initiate the RMA process for the first network device. |
| US11886278B2 |
Computing systems and methods for creating and executing user-defined anomaly detection rules and generating notifications for detected anomalies
A computing platform may be installed with software technology for creating and executing user-defined anomaly detection rules that configures the computing platform to: (1) receive, from a client device, data defining a given anomaly detection rule that has been created by a user, wherein the given anomaly detection rule comprises at least one anomaly condition that is to be applied to at least one streaming event queue, (2) store a data representation of the given anomaly detection rule in a data store, (3) convert the data representation of the given anomaly detection rule to a streaming query statement, (4) iteratively apply the streaming query statement to the at least one streaming event queue, and (5) while iteratively applying the streaming query statement, make at least one determination that the at least one anomaly condition is satisfied and then cause at least one anomaly notification to be issued to the user. |
| US11886275B2 |
Efficient system on chip power delivery with adaptive voltage headroom control
Systems and methods related to efficient system on chip (SoC) power delivery with adaptive voltage headroom control are described. A method for adaptively controlling voltage headroom for a system includes, in response to either a detection of a headroom violation by a per core voltage regulator headroom monitor or a detection of a voltage droop by a per core droop detector, independently throttle operating frequency of a respective core clock signal. The method further includes, in response to meeting a predetermined criterion: (1) lowering the operating frequency of the respective core clock signal, (2) monitoring headroom violation events and droop events at the lowered operating frequency, and (3) if monitored headroom violation events or monitored droop events continue to meet the predetermined criterion, changing the voltage set point associated with the motherboard voltage regulator to a second voltage set point corresponding to a higher voltage. |
| US11886273B2 |
Power source devices for power delivery contract selections
An example power source device includes a universal serial bus interface to couple to a power sink device, a power supply interface to couple to a power supply, a power measurement controller to measure a total power consumption of the power sink device and the power source device, a power contract manager to select a power delivery contract for the power sink device based on the total power consumption, a power supply rating of the power supply and a previous power delivery contract, and a power delivery controller to deliver power to the power sink device according to the selected power delivery contract. |
| US11886269B2 |
Control network system for power allocation
Apparatus, methods and systems are disclosed related to negotiation mechanism among control devices (200, 200a, 200b, 200c, 200d) each having a dedicated hierarchy level configured to obtain DC current from the control network (100) with at least a power source (300, 300′) on the network (100). The control device (200, 200a) with a higher dedicated hierarchy level may request another control device (200b, 200c, 200d) with a lower dedicated hierarchy level to release current for its use, when the available current at the power source (300, 300′) is not sufficient. |
| US11886265B2 |
Source device and power control method of source device
A source device includes a first control unit to perform a negotiation with the sink device based on power standard and perform control of supplying power to a sink device based on first power information determined by the negotiation. The source device includes a power detection unit to detect power required by the sink device and includes a second control unit to receive the first power information including voltage and current values of power determined by the negotiation and of second power information including voltage and current values of power detected. The second control unit generates third power information, including voltage and current values based on the inputs of the first power information and the second power information and on the predetermined power standard. The second control unit instructs the first control unit to perform negotiation again on the basis of the third power information generated. |
| US11886259B2 |
Thermal management for extended reality ecosystem
A method by a computing system associated with a set of disjoint devices that includes at least one wearable device includes receiving a request to perform a task. The method further includes determining, based on sensor data associated with the set of disjoint devices, a thermal-constraint differential for each device of the set of disjoint devices. The method further includes determining a plurality of workload assignments needed to be performed to accomplish the task. The method further includes distributing, based on the thermal-constraint differentials of the set of disjoint devices, the plurality of workload assignments to one or more devices of the set of disjoint devices to satisfy one or more power or thermal constraints associated with each device of the set of disjoint devices. The method further includes performing the task by causing the one or more devices to execute the distributed plurality of work assignments. |
| US11886258B2 |
Hybrid heat sink for electronics cooling
Embodiments are disclosed of a hybrid heat sink. The hybrid heat sink includes a dry base and a wet base spaced apart from the dry base. The wet base including a fluid inlet and a fluid outlet. A plurality of air channels is formed between the dry base and the wet base; and a plurality of liquid channels are formed between the dry base and the wet base. The plurality of liquid channels are coupled to the fluid inlet and the fluid outlet, and the plurality of liquid channels are thermally coupled to the plurality of air channels. Other embodiments are disclosed and claimed. |
| US11886257B2 |
Hinge structure and electronic device including the same
An electronic device is provided. The electronic device includes a first housing, a second housing, a hinge structure configured to connect the first housing and the second housing, and a foldable display module. The hinge structure includes a rotating shaft, a first idle gear, a second idle gear, a first gear, a second gear, a first pressing member configured to move the first gear toward the second gear, and a first interconnecting structure formed between the first gear and the second gear to enable the first gear to engage with the second gear, the first interconnecting structure being formed between the first gear and the second gear such that, as first pressing member moves the first gear toward the second gear, the first gear and the second gear receive with rotational forces in opposite directions. |
| US11886254B2 |
Hinge structure and foldale electronic device including the same
Disclosed is a foldable electronic device including a flexible display, a first housing and a second housing, a hinge housing, and a hinge structure. The hinge structure includes a first rotary member coupled to the first housing, a second rotary member coupled to the second housing, a first arm part coupled to the first rotary member and including a first rotary cam, a second arm part coupled to the second rotary member and including a second rotary cam, a fixed cam part including a first fixed cam engaged with the first rotary cam, a second fixed cam engaged with the second rotary cam, and a cam body connecting the first fixed cam and the second fixed cam, a stopper that restricts rotational angles of the arm parts, and an additional structure disposed between the stopper and the fixed cam part. |
| US11886249B2 |
Dynamic information tag
A dynamic information tag is disclosed for performing a dynamic information tag operation. The dynamic information tag includes a tag housing, the tag housing being sized to fit within a recess of an information handling system configured for receipt of a static information tag; a control and connection portion; and, a display coupled to the control and connection portion, the display being controlled via the control and connection portion to present information handling system information. |
| US11886246B2 |
Electronic devices with shape-transforming displays
An electronic device may have a housing with a display. The display may be overlapped by an image transport layer such as a coherent fiber bundle or layer of Anderson localization material. The image transport layer may have an input surface that receives an image from the display and a corresponding output surface to which the image is transported. The input surface and output surface may have different shapes. A wristwatch device may, as an example, have a rectangular or hexagonal input surface and may have an output surface such as a rectangular output surface with rounded corners or a circular output surface. A region of the output surface may have compound curvature. A portion of the image transport layer may protrude laterally over an inactive portion of the display. |
| US11886244B2 |
Wearable electronic belt device
A belt wearable by a human subject includes a variety of sensors that collect information about the wearer, the wearer's environment, and the wearer's movements. A communication interface on the belt allows sensor data collected by the belt to be transferred to a storage server. In some examples, the communication interface is a Wi-Fi interface, a cellular interface, or a removable memory interface. The data is processed to identify activities performed by the wearer such as walking, driving, and working at heights. In some examples, events such as aggressive driving events, slips and falls, and unsafe lifting are detected. In some examples, this information is used to generate reports that allow an employer to manage the productivity and safety of a workforce. |
| US11886235B2 |
Electronic device with a thermal and EMI shield
An electronic device is disclosed. The electronic device includes a shield that provides thermal and electromagnetic interference (“EMI”) shielding benefits. The shield is secured with fan assemblies by airtight seals to prevent air leakage and promote a pressured volume when the fan assemblies are running. Further, the shield can direct airflow from the fan assemblies to one or more thermally conductive components, where the airflow can convectively cool the thermally conductive components and exit the electronic device. The shield is made from a metal, and when the shield covers a circuit board, the shield protects an EMI barrier for integrated circuits located on the circuit board. Moreover, the shield can provide a single-piece, monolithic body that provides advantages over multiple shields, such as eliminating gaps in the shield for air leakage and EMI intrusion, increasing air circulation efficiency, and decreasing costs. |
| US11886234B2 |
Adaptive voltage converter
An adaptive voltage converter adapted to compensate for the exponential sensitivities of sub-threshold and near-threshold circuits. The converter can change its power/performance characteristics between different energy modes. The converter may comprise two or more voltage converters/regulators. A multiplexing circuit selects between the outputs of the several converters/regulators depending on the state of a control signal generated by a control facility. The converter is specially adapted to change the output of each converter/regulator based on a number of variables, including, for example, process corner, temperature and input voltage. |
| US11886232B2 |
Providing a mobile communications device with access to a provider service conditioned upon a device security level determination
Methods and systems are provided for providing a mobile communications device with access to a provider with a plurality of security levels. The security state of the device varies according to severity levels of device security events. The mobile communications device generates data regarding security events and provides the data to the provider, which compares that security state to a policy associated with the provider. The mobile communications device is allowed to access to a provider service where the device's current security state meets or exceeds the security state required for the provider service. |
| US11886226B2 |
Consolidating snapshots using partitioned patch files
A method of consolidating snapshots includes receiving a request to consolidate a first snapshot with a second snapshot into a third snapshot, the first and second snapshots stored in separate backup files, each backup file organized as a directory where data parts of the first and second snapshots can be hard linked to locations outside of the backup file, comparing the data parts of the first and second snapshots to determine if any second snapshot data part fully overlaps with any first snapshot data part, responsive to determining that a second snapshot data part fully overlaps with a first snapshot data part, hard linking the determined second snapshot data part into the third snapshot, and storing the third snapshot in the backup file. |
| US11886225B2 |
Message processing method and apparatus in distributed system
In a message processing method, a message stream platform receives a plurality of log messages from a production platform, and the plurality of log messages are used to record information about a first service executed by the production platform. The message stream platform stores the plurality of log messages in a log file based on time segments. Then, the message stream platform may send messages in a same time segment in the plurality of log files to a consumption platform based on the time segment mark. According to the message processing method, the messages in the same time segment in the plurality of log files may be sent to the consumption platform to ensure that the consumption platform obtains the log messages generated in the same time segment. |
| US11886224B2 |
Core selection based on usage policy and core constraints
A processing unit of a processing system compiles a priority queue listing of a plurality of processor cores to run a workload based on a cost of running the workload on each of the processor cores. The cost is based on at least one of a system usage policy, characteristics of the workload, and one or more physical constraints of each processor core. The processing unit selects a processor core based on the cost to run the workload and communicates an identifier of the selected processor core to an operating system of the processing system. |
| US11886221B2 |
Image system
An image system is provided by the present disclosure. The image system includes a display device displaying at least one floating image layer on a top surface of the display device and a frame disposed on the display device and partially exposing the top surface of the display device, wherein the frame has a height with reference to the top surface of the display device. The at least one floating image layer is aligned with a top surface of the frame in a direction parallel to a height direction of the frame. |
| US11886220B2 |
Dynamic power-down management in a computing device
In a computing device it may be determined whether to power down a subsystem based on how long the subsystem has been idle and based on one or more measurements of subsystem current consumption, subsystem bandwidth usage, and subsystem efficiency. An idle power-down count value may be determined based on the measurements, using predetermined relations among subsystem current consumption, subsystem bandwidth usage, and subsystem efficiency. The subsystem may be powered down based on a determination of whether the subsystem has been idle for an interval not less than the idle power-down count value. |
| US11886219B2 |
Flexible display module and electronic device including the same
An electronic device is provided. The electronic device includes a housing, a display, a middle plate, an adhesive layer, a support layer, and a coating layer. The housing includes a front plate facing a direction, a rear plate facing an opposite direction, and a lateral member surrounding a space between the front and rear plate. The display is configured to be seen through the front plate, and includes a first and second surface. The middle plate is disposed between the display and the rear plate, and includes a surface facing the display, and a recess. The adhesive layer is attached to the display, and the support layer is disposed between the adhesive layer and the middle plate. The coating layer is disposed between the support layer and the adhesive layer and is disposed in a first portion overlapped with the recess when viewed from the display. |
| US11886218B2 |
One-handed joystick for cranes
A one-handed joystick for cranes allows an operator to make all necessary motions with a single hand and arm for manipulating various components of a crane. The one-handed joystick includes a rotatable cylinder bar, a rotatable ring, an industrial joystick base, a rocker switch and at least two push button switches. Motions of the rotatable cylinder bar, the rotatable ring, the industrial base and the rocker switch are used to raise and lower the auxiliary hoist; raise and lower the telescopic boom for luffing a hoist; raise and lower the main hoist; slew the boom base in a clockwise or counterclockwise direction; and extend or retract the telescoping boom. The speed of main and auxiliary hosts may be changed with the two push button switches. A Deadman's switch may be installed on a back side of the rotatable cylinder bar. |
| US11886216B2 |
Voltage regulator circuit and method for regulating a voltage
A voltage regulator is provided. The voltage regulator includes a shunt transistor and a feedback circuit. The shunt transistor has a first current electrode coupled to a first voltage source terminal, a second current electrode coupled to a second voltage source terminal, a control electrode coupled to receive a reference voltage, and a body electrode. The feedback circuit has an input terminal coupled to the body electrode of the shunt transistor, and an output terminal coupled to the control electrode of the shunt transistor. The voltage regulator is suitable for use in a passive RFID device to protect the device from over-voltage damage. In another embodiment, a method for regulating a voltage is provided. |
| US11886214B2 |
Low-dropout voltage regulation device having compensation circuit to compensate for voltage overshoots and undershoots when changing between activity mode and standby mode
A low-dropout regulator includes a power stage having an output terminal coupled to a load circuit operable in different operating modes in which it receives different output currents. An error amplifier has a first input coupled to a reference voltage and an output coupled to an input terminal of the power stage. A compensation circuit includes a first stage with an RC filter coupled to the input terminal of the power stage, and generating an initial compensation voltage. A second stage includes a first transistor coupled between a supply voltage and a second node, and controlled by a complementary control signal, a high-side capacitor coupled between the second node and ground, and a third transistor coupled between the initial compensation voltage and the second node, and controlled by a control signal representative of the current operating mode of the load circuit. |
| US11886210B2 |
Method and system for providing a centralized appliance hub
An appliance hub for use in an upper portion of an enclosure can include a substrate configured to be positioned in an upper portion of an enclosure. The appliance hub can include a climate control apparatus mounted on the substrate and the climate control apparatus can be configured to regulate a temperature within the enclosure. The appliance hub can include one or more lighting elements configured to provide light within the enclosure, a plurality of fluid lines connected to the substrate and configured to provide fluid service and return to the climate control apparatus, and/or a plurality of electrical connections connected to the substrate and configured to provide electrical power and/or data to at least one of the climate control apparatus and the one or more lighting elements. |
| US11886206B2 |
Pressure regulator for fluid hammer reduction
A pressure regulator for a BOP stack includes a housing having an input port, an output port, and a pilot port and a regulator piston axially movable through the housing between an open position and a closed position. The regulator piston has an internal passage formed through its first axial end. When the regulator piston is in the open position, the internal passage is in fluid communication with the input and output ports. When the regulator piston is in the closed position, the internal passage is in fluid communication with the output port and fluidly isolated from the input port. A space with regulator fluid is also provided within the housing adjacent a second axial end of the regulator piston, opposite the first axial end, wherein the space is fluidly isolated from the input port and the output port in both the open position and the closed position. |
| US11886203B2 |
Flight control method and apparatus, and control device
A flight control method includes displaying a user interface configured to receive an operation instruction including coordinates of waypoints, generating route data of a route based on the coordinates of the waypoints, sending the route data to an aircraft to instruct the aircraft to execute the route, recording an interruption point during execution of the route by the aircraft, displaying a plurality of candidate starting points including at least one of the interruption point, a last waypoint of the route before the interruption point, a next waypoint of the route after the interruption point, or a user-designated waypoint, in response to a selection instruction, selecting a target starting point from the plurality of candidate starting points, and controlling the aircraft in an interrupted state to fly to the target starting point and resume the execution of the route from the target starting point. |
| US11886199B2 |
Multi-scale driving environment prediction with hierarchical spatial temporal attention
In accordance with one embodiment of the present disclosure, method includes obtaining multi-level environment data corresponding to a plurality of driving environment levels, encoding the multi-level environment data at each level, extracting features from the multi-level environment data at each encoded level, fusing the extracted features from each encoded level with a spatial-temporal attention framework to generate a fused information embedding, and decoding the fused information embedding to predict driving environment information at one or more driving environment levels. |
| US11886197B2 |
Electronic device for preventing spilling of liquid during movement
An electronic device and a method of driving the same are provided. The electronic device includes a container; a sensor; a driving unit; and a processor configured to: based on sensing data received through the sensor, measure, at a predetermined time interval, external forces exerted on the electronic apparatus from a ground on which the electronic apparatus is located, identify, based on frequency characteristics of the external forces and a natural vibration frequency of a liquid contained in the container, a frequency having frequency characteristics corresponding to the natural vibration frequency among frequencies of the external forces, and input a driving signal to the driving unit, based on a size of the identified frequency, the driving signal controlling a velocity of the electronic apparatus according to a natural vibration period of the liquid. |
| US11886196B2 |
Controlling machine operating in uncertain environment discoverable by sensing
A controller of a machine determines jointly a sequence of control inputs defining a state trajectory of the machine and a desired knowledge of the environment by solving a multivariable constrained optimization of a model of dynamics of the machine relating the state trajectory with the sequence of control inputs subject to a constraint on admissible values of the states and the control inputs defined based on the desired knowledge of the surrounding environment represented by the state of the environment and the uncertainty of the state of the environment determined from the measurements of the environment. In such a manner, the controller performs joint but imbalance optimization of the control inputs and the sensing instructions to the sensor for learning the environment. |
| US11886195B2 |
Active learning and validation system for vehicles
A method includes generating a parameter of a trajectory associated with a scenario using a path planner. The parameter is generated based on a training dataset. The method includes comparing the parameter of the trajectory against a validation parameter associated with a validation dataset. The validation parameter is based on human-based vehicle driving trajectory data associated with scenarios that satisfy a level of similarity with the scenario. The method further includes determining a level of similarity between the parameter associated with the scenario and the validation parameter associated with the scenarios, and, subsequent to determining that the level of similarity fails to satisfy a similarity threshold, the method concludes with providing training data associated with the scenario to the training dataset so that a subsequent parameter of a subsequent trajectory generated by the path planner and associated with the scenario satisfies the level of similarity against the validation parameter. |
| US11886192B2 |
Mobile body, information processor, mobile body system, information processing method, and information processing program
An information processing method of an information processor includes: obtaining information received from a mobile body through a wireless communication, the mobile body including a movement mechanism and an imaging unit configured to capture image data, the information received from the mobile body including captured image data obtained by the imaging unit, with the captured image data being updated periodically; and generating route guidance information for use in moving the mobile body by the movement mechanism. The captured image data is stored together with data update time information. The route guidance information includes at least two selectable routes. The route guidance information is generated based on the captured image data, position information of the mobile body, and the data update time information. |
| US11886191B2 |
Scheduling method and system for fully autonomous waterborne inter terminal transportation
The present application discloses is a scheduling method and system for fully autonomous waterborne inter terminal transportation, and belongs to the field of transportation. The method includes: establishing a dynamic scheduling model for waterborne Autonomous guided vessels (wAGVs); quickly inserting the dynamically arriving transportation tasks into all the existing wAGV paths, calculating the insertion cost and selecting the path and position with the lowest insertion cost to obtain updated initial paths; improving the initial path using a heuristic algorithm based on tabu search to obtain quasi-optimal wAGV paths; executing the scheduling wAGV paths. |
| US11886185B2 |
Vehicle remote control method and vehicle remote control device
The relative position between a vehicle and an extension unit located outside the vehicle is detected, and a command touch operation for operating the vehicle with a remote operation device is set in accordance with the detected relative position. The touch operation of an operator is detected by a touch panel of the remote operation device, and a determination is made as to whether or not the detected touch operation is the command touch operation. When the touch operation is the command touch operation, the vehicle is controlled to execute autonomous travel control. The vehicle has an autonomous travel control function. |
| US11886184B2 |
Navigating an autonomous vehicle based upon an image from a mobile computing device
An autonomous vehicle receives geographic location data defined via a mobile computing device operated by a user. The geographic location data is indicative of a device position of the mobile computing device. The autonomous vehicle also receives image data generated by the mobile computing device. The image data is indicative of a surrounding position nearby the device position. The surrounding position is selected from an image captured by a camera of the mobile computing device. A requested vehicle position (e.g., a pick-up or drop-off location) is set for a trip of the user in the autonomous vehicle based on the geographic location data and the image data. A route from a current vehicle position of the autonomous vehicle to the requested vehicle position for the trip of the user in the autonomous vehicle is generated. Moreover, the autonomous vehicle can follow the route to the requested vehicle position. |
| US11886183B2 |
System and method for autonomous vehicle control to minimize energy cost
A system and method for autonomous vehicle control to minimize energy cost are disclosed. A particular embodiment includes: generating a plurality of potential routings and related vehicle motion control operations for an autonomous vehicle to cause the autonomous vehicle to transit from a current position to a desired destination; generating predicted energy consumption rates for each of the potential routings and related vehicle motion control operations using a vehicle energy consumption model; scoring each of the plurality of potential routings and related vehicle motion control operations based on the corresponding predicted energy consumption rates; selecting one of the plurality of potential routings and related vehicle motion control operations having a score within an acceptable range; and outputting a vehicle motion control output representing the selected one of the plurality of potential routings and related vehicle motion control operations. |
| US11886182B2 |
Systems and methods of detecting intent of spatial control
Systems and methods of manipulating/controlling robots. In many scenarios, data collected by a sensor (connected to a robot) may not have very high precision (e.g., a regular commercial/inexpensive sensor) or may be subjected to dynamic environmental changes. Thus, the data collected by the sensor may not indicate the parameter captured by the sensor with high accuracy. The present robotic control system is directed at such scenarios. In some embodiments, the disclosed embodiments can be used for computing a sliding velocity limit boundary for a spatial controller. In some embodiments, the disclosed embodiments can be used for teleoperation of a vehicle located in the field of view of a camera. |
| US11886176B2 |
Bioreactor control system and method of use
A process and/or a bioreactor control system for controlling a bioreactor. The bioreactor control system includes a bioreactor, a sensor, an electronic card, and a bioreactor controller. The sensor is proximate to the bioreactor and configured to generate a signal indicative of an operating condition of the bioreactor. The signal is then transmitted to the electronic card. Receiving the signal, the electronic card processes the signal to generate a converted signal. The converted signal is then transmitted to the bioreactor controller. The bioreactor controller, in turn, processes the converted signal and generates a control signal to modify the operating condition of the bioreactor. |
| US11886175B2 |
Systems of industrial internet of things (IoT) for automated guided vehicle (AGV) control, methods, and media thereof
The present disclosure provides a system of an industrial Internet of Things (IoT) for an automated guided vehicle (AGV) control, a method, and a medium. The method includes: obtaining an AGV circuit layout and forming an AGV operation model; obtaining a feeding time, each AGV being fed for at least once within a preset period; the material end point being a node for receiving material in the AGV operation model; calculating an operation track of each AGV of the AGV operation model within the preset period based on the operation speed and the feeding time; adjusting the operation speed to recalculate the operation tracks until the operation process is qualified; and sending the operation track of the qualified operation process to a user platform through the service platform to display to a user. |
| US11886172B2 |
Operating a factory
It is proposed a method for factory operation. The method includes providing manufacturing tasks each represented by a law describing a manufacturing of a product by one or more manageable machines. The method includes obtaining one or more manufacturing constraints and one or more manufacturing events. The method includes determining an operating mode of the factory based on the one or more manufacturing constraints and on one or more product constraints. The determining includes one or more iterations. Each iteration computes a respective propensity of each manufacturing task representing a frequency with which the task is chosen for manufacturing the product given the constraints and/or a previous event(s) occurrence. The iteration ranks the tasks according to a propensity descending order. The iteration visits the tasks according to the ranking and affecting to each task one or more manageable machines and resources. The iteration executes the tasks until an event(s). |
| US11886166B2 |
Method and system of reducing charged particle beam write time
A method for exposing a pattern in an area on a surface using a charged particle beam lithography is disclosed and includes inputting an original set of exposure information for the area. The area comprises a plurality of pixels, and the original set of exposure information comprises dosages for the plurality of pixels in the area. A backscatter is calculated for a sub area of the area based on the original set of exposure information including the dosages for the plurality of pixels in the area. An increase in dosage for at least one pixel in a plurality of pixels in the sub area is determined, in a location where the backscatter of the sub area is below a pre-determined threshold, thereby increasing the backscatter of the sub area. |
| US11886163B2 |
Method for operating a machine control system, and machine control system
A method for operating a machine control system and a corresponding machine control system uses a portable hand-held terminal for functionally influencing at least one machine controller. The terminal includes at least one emergency stop actuation element for terminating potentially dangerous machine operations. The controller and/or the terminal is adapted for indicating a representation of the control system on the terminal display. The controller and/or the hand-held terminal is adapted for indicating the operational range(s) of the at least one emergency stop actuation element by the terminal display. The controller and/or the hand-held terminal are further adapted for simultaneously representing the operational range(s) of the at least one emergency stop actuation element by selective, fail-safe controlling of at least one lighting device at the hand-held terminal and/or at least one discrete lighting device in or at the at least one emergency stop actuation element at the hand-held terminal. |
| US11886161B2 |
Configuring and building an automation system to perform rule-based transformations on complex technical systems
System and methods for configuring a technical system based on generated rules and building the technical system. The technical system and the generated rules are given in graph representations including the following steps: defining rules by a user and representing the rules in a graphical interface, converting the rules from the graphical interface into a programming language and/or a natural language, validating the rules for the technical system, checking the compatibility of the rules, serializing the rules for storage in a file system or a database, using the serialized rules to configure the technical system, and building the configured technical system. |
| US11886152B2 |
Automated monitoring and control using augmented streaming decision tree
A non-transitory computer-readable medium comprising computer-executable instructions that, when executed, are configured to cause a processor to perform operations that include receiving operational parameters for one or more automation devices, wherein the one or more automation devices are configured to implement control logic generated based on a decision tree. The operations also include receiving an output by the decision tree based on the operational parameters. Further, the operations include determining the output is an anomalous output based on a constraint associated with the decision tree. Further still, the operations include generating an updated decision tree based on the anomalous output. Even further, the operations include generating updated control logic for the one or more automation devices based on the updated decision tree. Even further, the operations include sending the updated control logic to the one or more automation devices. |
| US11886150B2 |
Push button system and timepiece comprising the same
A push button system for activating an actuation member, the system including a button head, a pusher actuator integral with the button head, a first hollow guide member, the pusher actuator being mounted to slide inside the first hollow guide member, the first hollow guide member being intended to be secured to a fixed element relative to the button head and to the pusher actuator, a second hollow guide member arranged in the button head, and a pin mounted to slide inside the second hollow member, and intended to be secured to the fixed element. The pusher actuator has an upper portion provided on the periphery thereof with a collar intended to cooperate with an internal face of the first hollow guide member to guide the pusher inside the member. |
| US11886148B2 |
Timepiece bezel
A timepiece component (1) for a watch case, notably a bezel, comprising an axis (A), a first ring (10), a second ring (11) and a connecting element (12) for connecting the first and second rings, the connecting element being elastic and positioned between the first and second rings, the first ring and/or the second ring comprising an element (31) for retention on the rest of a watch case (200), particularly on a watch middle (4). |
| US11886145B2 |
Electrostatic charge image developing toner and manufacturing method of same, image forming method, image forming system and output product using same
Provided is an electrostatic charge image developing toner including toner matrix particles containing at least a binder resin, wherein a photosensitizer having a singlet oxygen generating ability is contained inside the toner matrix particles or in an external additive attached to the toner matrix particles. |
| US11886139B2 |
Image forming apparatus that reduces uncessary touch from user
An image forming apparatus includes a placing portion onto which a recording medium having an image formed is to be placed, and an opening-closing member that covers an opening provided at least at one side face of the placing portion and automatically opens the opening with a predetermined timing. |
| US11886131B2 |
Image forming apparatus
An image forming apparatus includes a rotatable image bearing member, a rotatable transfer member, a first driving source to drive the image bearing member, a second driving source to drive the transfer member, and a control portion. Based on a toner amount per unit area of the toner image transferred to each of a plurality of first divided regions on a plane of a recording material in a feeding direction, the control portion controls a driving speed of the transfer member while each of the plurality of the first divided regions passes through a transfer portion. The control portion acquires an index value correlating with a toner amount of the toner image transferred to each of a plurality of second divided regions of each first divided region in a widthwise direction, and controls the driving speed based on the index value while the first divided region passes through the transfer portion. |
| US11886126B2 |
Apparatus and method for removing a single particulate from a substrate
The present application relates to an apparatus and to a method for removing at least a single particulate from a substrate, especially an optical element for extreme ultraviolet (EUV) photolithography, wherein the apparatus comprises: (a) an analysis unit designed to determine at least one constituent of a material composition of the at least one single particulate; and (b) at least one gas injection system designed to provide a gas matched to the particular constituent in an environment of the at least one single particulate; (c) wherein the matched gas contributes to removing the at least one single particulate from the substrate. |
| US11886124B2 |
Flows of optimization for patterning processes
A method to improve a lithographic process for imaging a portion of a patterning device pattern onto a substrate using a lithographic projection having an illumination system and projection optics, the method including: (1) obtaining a simulation model that models projection of radiation by the projection optics, wherein the simulation model models an effect of an obscuration in the projection optics, and configuring, based on the model, the portion of the patterning device pattern, and/or (2) obtaining a simulation model that models projection of radiation by the projection optics, wherein the simulation model models an anamorphic demagnification of radiation by the projection optics, and configuring, based on the model, the portion of the patterning device pattern taking into account an anamorphic manufacturing rule or anamorphic manufacturing rule ratio. |
| US11886119B2 |
Material for forming underlayer film, resist underlayer film, method of producing resist underlayer film, and laminate
A material for forming an underlayer film according to the present invention is a material for forming an underlayer film which is used to form a resist underlayer film used in a multi-layer resist process, the material including a cyclic olefin polymer which has a repeating structural unit [A] represented by Formula (1) and a repeating structural unit [B] represented by Formula (2), in which a molar ratio [A]/[B] of the structural unit [A] to the structural unit [B] in the cyclic olefin polymer is greater than or equal to 5/95 and less than or equal to 95/5. |
| US11886111B2 |
Freeform optical substrates in waveguide displays
Embodiments of the present disclosure generally relate to methods of forming a substrate having a target thickness distribution at one or more eyepiece areas across a substrate. The substrate includes eyepiece areas corresponding to areas where optical device eyepieces are to be formed on the substrate. Each eyepiece area includes a target thickness distribution. A base substrate thickness distribution of a base substrate is measured such that a target thickness change can be determined. The methods described herein are utilized along with the target thickness change to form a substrate with the target thickness distribution. |
| US11886105B2 |
Base assembly of voice coil motor and voice coil motor
The present disclosure provides a base assembly of voice coil motor and a voice coil motor. The base assembly includes a base body having a first elastic piece connecting area, a lower elastic piece disposed on the first elastic piece connecting area, and a first terminal disposed in the base body. The first terminal has: a first conductive part disposed in the base body; a first terminal connecting part disposed on one side of the first conductive part and extending toward a direction away from the first conductive part, wherein a part of the first terminal connecting part protrudes from the first elastic piece connecting area and is connected with the lower elastic piece; and an engaging part disposed on one side of the first terminal connecting part and extending toward a direction away from the first terminal connecting part. |
| US11886102B2 |
Illumination system and projection device
An illumination system, configured to provide an illumination beam, is provided. The illumination system includes a first excitation light source, a wavelength conversion element, and a controller. The first excitation light source is configured to provide a first excitation beam. The wavelength conversion element is located on a transmission path of the first excitation beam. The wavelength conversion element includes multiple wavelength conversion regions and multiple non-wavelength conversion regions. The controller controls whether the first excitation light source emits light. During a first time interval, the controller turns off the first excitation light source. During a second time interval, the controller controls the first excitation light source to emit light. The first excitation beam is transmitted to one of the wavelength conversion regions to form a converted beam. The illumination beam includes the converted beam. Another illumination system and multiple projection devices are also provided. |
| US11886101B2 |
Display device, and method of controlling display device
A projector is provided with a CPU, a first memory which is a volatile memory to be reset when the projector makes the transition to a standby state, and a second memory which is a volatile memory capable of keeping data in the standby state of the projector. The CPU stores OSD data in the second memory when the projector makes the transition to the standby state. |
| US11886098B1 |
Modular camera housing kit
A kit for constructing a camera housing comprises a main housing unit, a first end cover, and a base stand. The main housing unit contains a camera compartment, and each end of the main housing unit is at least partially open to a recessed slot that has a width at an outer portion of the slot that is less than the width of an interior portion of the slot. The first end cover includes a locking piece having a shape that is complementary to the shape of one of the recessed slots. The base stand comprises a base having a top surface and a protrusion extending from the top surface, wherein the protrusion has a shape that is complementary to the shape of one of the recessed slots. Preferably, the shape of the vertical cross section of the two recessed slots is approximately the same. |
| US11886096B2 |
Assembly including a non-linear element and a method of use thereof
An assembly including a non-linear element configured for generating broadband radiation from input radiation coupled into the non-linear element. The assembly further includes an optical element positioned downstream of the non-linear element configured to reflect a fraction of the broadband radiation back into the non-linear element. The non-linear element can be a nonlinear fiber, such as a hollow-core photonic crystal fiber (HC-PCF). |
| US11886090B2 |
Edible electrodes and uses in electrophoretic displays
Flowable electrode materials and articles constructed therefrom that can be used to make edible electrical connections. The flowable electrode material may comprise a liquid and a salt, wherein the liquid and the salt are edible. The flowable electrode material can be used to create electrodes, and those electrodes may be incorporated into an electro-optic display comprising a first electrode, a second electrode, and an electro-optic material located between the first electrode and the second electrode. In some embodiments, the first electrode, the second electrode, and the electro-optic material can be edible. |
| US11886087B2 |
Lighting device and vehicle lamp having same
The lighting device disclosed in the embodiment includes a substrate, a light emitting device disposed on a lower surface of the substrate, a reflective layer disposed to face a light emitting surface of the light emitting device, a first resin layer disposed between the substrate and the reflective layer, and a light-transmission control layer disposed on an upper surface of the substrate, wherein the light-transmission control layer may include a liquid crystal layer including a cholesteric liquid crystal, and light emitted through the light emitting surface of the light emitting device may be reflected by the reflective layer and be provided to the light-transmission control layer through the substrate. |
| US11886086B2 |
Light control sheet
A light control sheet including a first transparent electrode layer, a second transparent electrode layer, a light control layer including a resin layer formed between the first transparent electrode layer and the second transparent electrode layer, the resin layer including voids dispersed therein and filled with a liquid crystal composition including liquid crystal molecules, and a first orientation layer formed between the first transparent electrode layer and the light control layer such that a haze of the light control layer is increased by applying a voltage to the first transparent electrode layer. The light control layer has a first surface in contact with the first orientation layer, and an area ratio of the voids at the first surface is 49% or more where the area ratio is a percentage of a total area of all the voids to an area of the first surface. |
| US11886081B2 |
Liquid crystal device comprising a plurality of first spacers disposed inside a sealant and a plurality of first and second strip electrodes
According to one embodiment, a liquid crystal device includes a first liquid crystal cell and a second liquid crystal cell bonded to the first liquid crystal cell. Each of the first liquid crystal cell and the second liquid crystal cell includes a first substrate, a second substrate, a liquid crystal layer, a sealant bonding the first substrate and the second substrate together, one or more first spacers disposed inside the sealant and holding the gap, and a plurality of second spacers disposed in an effective area surrounded by the sealant and holding the gap. |
| US11886073B2 |
Nanostructure based display devices
Embodiments of a display device are described. A display device includes a backlight unit having a light source and a liquid crystal display (LCD) module. The light source is configured to emit a primary light having a first peak wavelength. The LCD module includes a first sub-pixel having a phosphor film and a second sub-pixel having a non-phosphor film. The phosphor film is configured to receive a first portion of the primary light and to convert the first portion of the primary light to emit a secondary light having a second peak wavelength that is different from the first peak wavelength. The non-phosphor film is configured to receive a second portion of the primary light and to optically modify the second portion of the primary light to emit an optically modified primary light having a third peak wavelength that is different from the first and second peak wavelengths. |
| US11886072B2 |
Color filter substrate, array substrate, and display panel
The present application provides a color filter substrate, an array substrate and a display panel. A first dielectric grating layer in the color filter substrate is stacked with a first dielectric layer, and ridges and grooves are arranged at intervals periodically on one side of the first dielectric grating layer away from the first dielectric layer; a first polarizing layer in the color filter substrate is located in the grooves of the first dielectric grating layer; a second polarizing layer in the color filter substrate is located on the ridges of the first dielectric grating layer. |
| US11886071B2 |
Light guide element comprising a diffraction element having a cholesteric liquid crystal layer with a pitch gradient
A light guide element includes: a light guide plate; and a diffraction element that is disposed on a main surface of the light guide plate, in which the diffraction element includes a liquid crystal layer that is formed of a liquid crystal composition including a liquid crystal compound and has a liquid crystal alignment pattern in which a direction of an optical axis derived from the liquid crystal compound changes while continuously rotating in at least one in-plane direction, a refractive index of the light guide plate is 1.70 or higher, and in a case where the refractive index of the light guide plate is represented by nd and a refractive index of the liquid crystal layer is represented by nk, nk−nd≥0 is satisfied. |
| US11886069B1 |
Display device and position input system including the same
A display device includes: a display panel; and a stacked structure on the display panel, wherein the stacked structure includes: a first coupling member on the display panel; a reflective layer on the first coupling member; a second coupling member on the reflective layer; a code pattern part on the second coupling member; and a light blocking layer on the code pattern part and including an ultraviolet absorber, and a thickness between a lower surface of the reflective layer and an upper surface of the light blocking layer is 100 μm or less. |
| US11886063B2 |
Display panel motherboard, cutting method and manufacturing method thereof, display panel, and display device
A display panel motherboard, a cutting method and a manufacturing method thereof, a display panel, and a display device are provided. The display panel motherboard includes at least three mother substrates, at least one display panel unit, and a cutting region. The at least three mother substrates are stacked with each other, at least a portion of the at least one display panel unit is surrounded by the cutting region, and an organic film layer is not disposed in at least two of the at least three mother substrates in the cutting region. |
| US11886062B2 |
Optical device and method for manufacturing optical device
Provided is a method for manufacturing an optical device capable of surely curing a photocurable resin composition. The method for manufacturing an optical device 1 in which an optical member 2 and a transparent panel 4 are bonded together via a cured resin layer 3 includes: a step of forming, on one of the optical member 2 and the transparent panel 4, a wall 12 surrounding a forming region for the cured resin layer 3 and having at least one opening 13; a step of laminating the optical member 2 and the transparent panel 4 to form a laminated body 10 in which a resin filling space 14 surrounded by the wall 12 is formed between the optical member 2 and the transparent panel 4; a step of filling the resin filling space 14 of the laminated body 10 with a photocurable resin composition 30; and a step of curing the photocurable resin composition 30 to form the cured resin layer 3. |
| US11886059B1 |
Display apparatus, control circuit, and anti-peeping display method
A display apparatus, a control circuit, and an anti-peeping display method are provided. The display apparatus includes a display panel and a backlight module. The anti-peeping display method includes: determining an anti-peeping area; controlling the dimming diaphragm to be alternately switched between a transparent mode and a diffusion mode; in response to the dimming diaphragm being switched to the transparent mode, disabling a part of first light-emitting units rotating into the anti-peeping area from emitting light and enabling a part of second light-emitting units rotating into the anti-peeping area to emit light; and in response to the dimming diaphragm being switched to the diffusion mode, disabling the part of the first light-emitting units rotating into the anti-peeping area to emit light and the part of the second light-emitting units rotating into the anti-peeping area from emitting light. |
| US11886057B2 |
Advanced optoelectronic system architectures and associated methods using spatial light modulation
An optoelectronic system includes a concentration layer, a modulation layer including an array of light modulators, an exit layer that receives the modulation layer output having a modulation layer output spatial distribution and remaps the modulation layer output spatial distribution to a modified spatial distribution. A collector layer receives the modified spatial distribution to produce a collector layer output. A detector receives the collector layer output. A processor controls the modulation layer and receives the detector output to generate an image. The collector layer can receive the modified spatial distribution at a plurality of collector layer inputs and combine the plurality of collector layer inputs at a collector layer output. Modulators can be configured to direct couple modulated light to a collector layer, without using an exit layer. Configurations with spatial light modulator modules and sub-modules are described. |
| US11886054B2 |
Light transmissive element
A light transmissive element includes a light transmissive area. The element includes transparent substrates including respective transparent conductive films on respective surfaces thereof. The element has a structure in which the transparent substrates are disposed so as to face each other across a gap with the transparent conductive films facing each other and the gap is filled with an electrolyte. The electrolyte contains a metal ion and is prepared so as to allow the metal ion to be reversibly deposited on a surface of a transparent conductive film via electrodeposition according to a state of applied voltage between the transparent conductive film and the transparent conductive film. In the light transmissive area, a dividing line is formed in the transparent conductive film. The transparent conductive film includes divisional areas in the light transmissive area, the divisional areas being electrically insulated from each other by the dividing line. |
| US11886051B2 |
Display device
A display device includes: an optical waveguide comprising an optical waveguide body and a light outputting section disposed on the optical waveguide body; M lens assemblies disposed adjacent to an end of the optical waveguide body, wherein at least two lens assemblies of the M lens assemblies have different focal lengths, and M is a natural number greater than one; and M display screens corresponding to the M lens assemblies in one-to-one correspondence, each of the M display screens configured to emit light with image information through a corresponding lens assembly to the optical waveguide body for transmission; wherein the light outputting section is configured to output the light from the M display screens out of the optical waveguide body for imaging, the light from the M display screens form M images, respectively, and at least two images of the M images have different image distances. |
| US11886045B2 |
Method for making photochromic contact lenses
Described herein is a method for producing photochromic contact lenses, in particular, photochromic silicone hydrogel contact lenses. The method comprises a step of cast molding of a lens-forming composition including an iniferter to form an unprocessed contact lens having iniferter moieties covalently incorporated into its polymer matrix and a step of iniferter-induced graft-polymerization of a photochromic vinylic monomer to the polymer matrix only in its central region which is circular and concentric with the central axis of the unprocessed contact lens. The obtained photochromic contact lens has a central pupillary region that only can undergo a reversible color change upon exposure to UV/HEVL-radiation. |
| US11886043B2 |
Wearable optical devices
A modular wearable optics device including: at least one wearable support element; one or more active optical elements adapted in use to display an image to a user; one of a plurality of bridging elements selected to position or orientate the one or more active optical elements in a predetermined location based on one or more anthropometric characteristics of the user. |
| US11886041B2 |
Camera optical lens
The present disclosure relates to the field of optical lenses, and discloses a camera optical lens. The camera optical lens includes eight lenses, and the eight lenses includes successively from an object side to an image side: a first lens having negative refractive power, a second lens having positive refractive power, a third lens, a fourth lens, a fifth lens, a sixth lens, a seventh lens, and an eighth lens. An object side surface of the eighth lens is a convex surface at a paraxial position, an image side surface thereof is a concave surface at a paraxial position, and at least one of the first lens to the eighth lens includes a free-form surface. The camera optical lens of the present disclosure has good optical performance while meeting design requirements of a large aperture, ultra-thinness, and a wide angle while. |
| US11886039B2 |
Optical imaging lens group
The present disclosure discloses an optical imaging lens group including, sequentially from an object side to an image side along an optical axis, a first lens, a second lens, a third lens, a fourth lens, a fifth lens and a sixth lens, each of which has refractive power. An object-side surface of the first lens is a convex surface, and an image-side surface of the first lens is a concave surface; an image-side surface of the second lens is a concave surface; and an object-side surface of sixth lens is a concave surface. A distance TTL along the optical axis from an object-side surface of the first lens to an imaging plane of the optical imaging lens group and half of a diagonal length ImgH of an effective pixel area on the imaging plane of the optical imaging lens group satisfy TTL/ImgH≤1.23. |
| US11886038B2 |
Imaging optical lens assembly, image capturing apparatus and electronic device
The present disclosure provides an imaging optical lens assembly, including, in order from an object side to an image side: a first lens element with negative refractive power having an object-side surface being concave in a paraxial region, a second lens element with positive refractive power, a third lens element with negative refractive power, a fourth lens element with positive refractive power, and a fifth lens element with negative refractive power having an image-side surface being concave in a paraxial region and at least one convex shape in an off-axial region on the image-side surface, wherein the imaging optical lens assembly has a total of five lens elements. |
| US11886035B2 |
Optical mechanism and lens module thereof
A lens module is provided, including a holder, a barrel, and an optical element. The optical element is affixed in the barrel, and the holder has a first material. Additionally, the barrel is affixed in the holder and has a second material, wherein the hardness of the first material is greater than the hardness of the second material. |
| US11886033B2 |
Imaging lens module and electronic device
An imaging lens module includes a plastic lens barrel, a first optical element assembly and a second optical element assembly, wherein both of the first optical element assembly and the second optical element assembly are disposed in the plastic lens barrel. The plastic lens barrel includes a first inner annular surface and a second inner annular surface. The first inner annular surface forms a first receiving space. The second inner annular surface forms a second receiving space. The first optical element assembly is disposed in the first receiving space and includes a plurality of optical lens elements and a first retainer. The second optical element assembly is disposed in the second receiving space and includes a first light blocking sheet and a second retainer. |
| US11886029B2 |
Systems and methods of managing cables in telecommunication systems
Cable managers are provided. A cable manager includes a body configured to be selectively engaged with a loose end of a first cable, wherein the body defines an effective unbiased length, as measured in an unbiased state, and an effective biased length, as measured in a biased state, and wherein the effective biased length is greater than the effective unbiased length. |
| US11886028B1 |
Rollable ribbon separator
A rollable ribbon separator tool for separating fibers in a rollable ribbon, the rollable ribbon separator including a chassis having a length and a guide surface along the chassis length for receiving a first portion of a rollable ribbon in a flattened position, the guide surface for positioning the first portion of the rollable ribbon having a first node with selected fibers to be separated, the selected fibers being positioned flat on the guide surface. The rollable ribbon separator includes a blade securable to the chassis, the blade having a cutting edge positioned toward the guide surface at an acute angle to the guide surface. The angle of the blade cutting edge with respect to the guide surface allows the cutting edge to urge the first portion of the flattened ribbon fibers against the guide surface when the fibers are drawn through the chassis along the guide surface. |
| US11886017B2 |
Multiports and other devices having connection ports with securing features and methods of making the same
Devices such as multiports comprising connection ports with associated securing features and methods for making the same are disclosed. In one embodiment, the device comprises a shell, at least one connection port, at least one securing feature passageway, and at least one securing feature. The at least one connection port is disposed on the multiport with the at least one connection port comprising an optical connector opening extending from an outer surface of the multiport to a cavity of the multiport and defining a connection port passageway. The at least one securing feature is associated with the connection port passageway, and the at least one securing feature is disposed within a portion of the at least one securing feature passageway. |
| US11886014B2 |
Two-stage expanded beam optical coupling
A silicon-based photonic chip is provided that includes an interface for optically coupling the photonic chip to an optical fiber or an optical fiber assembly. The interface includes: a single-mode waveguide configured to guide light and to provide a first light beam; a first optical element configured to expand the light beam in a first direction in-plane of the photonic chip, thereby providing an expanded light beam; and a second optical element configured to deflect and to further expand the expanded light beam in a second direction, thereby providing an output light beam from the photonic chip. Also provided are methods for fabricating such a photonic chip. |
| US11886012B2 |
Optical fiber lateral input/output device
An object of the present invention is to provide a versatile optical fiber lateral output device that can deal with various types of optical fiber core wires. An optical fiber input-output device according to the present invention includes: a first jig 11 including a recess portion 22 and an optical input-output means 51; a second jig 12 including a projection portion 23 and a guide groove 24; and a pressing unit 14 configured to apply a pressing force in a direction in which the recess portion 22 of the first jig 11 and the projection portion 23 of the second jig 12 approach each other so as to bend an optical fiber core wire 100. Letting R1 be a curvature radius of the recess portion 22 of the first jig 11, θ1 be a central angle of the recess portion 22, R2 be a curvature radius of the projection portion 23 of the second jig 12, and θ2 be a central angle of the projection portion 23, R2≤R1 and θ2≤θ1 are satisfied. |
| US11886011B2 |
Optical microstructure for fiber optical tweezers
An optical microstructure is configured to work with an optical fiber or a different substrate and the optical microstructure includes a beam converter including a tapered optical guide configured to transform a gaussian optical beam into a first annular optical beam; an inverted cone having first and second reflection surfaces, each configured to reflect the first annular optical beam, having a radius R1, so that a resulting second annular optical beam has a radius R2 larger than the radius R1; and a prism having a reflection surface configured to reflect the second annular optical beam to form a third converging annular optical beam. The third converging annular optical beam includes plural single optical beams that intersect at a given crossing point, outside the optical microstructure. The plural single optical beams form an optical trap. |
| US11886008B2 |
Methods of fabrication of compound light-guide optical elements having embedded coupling-in reflectors
A stack has first and second faces and multiple LOEs that each has two parallel major surfaces and a first plurality of parallel internal facets oblique to the major surfaces. A first block has third and fourth faces and a second plurality of parallel internal facets. The first block and the stack are bonded such that the second face joins the third face and the first and second facets are non-parallel, forming a second block. The second block is cut at a plane passing through the first face, forming a first structure having an interfacing surface. A third block has fifth and sixth faces and a plurality of parallel internal reflectors. The third block and the first structure are bonded such that fifth face joins the interfacing surface and the internal reflectors are non-parallel to all the facets, forming a second structure. Compound LOEs are sliced-out from the second structure. |
| US11886004B2 |
Planer lightwave circuit
Provided is a planar lightwave circuit in which stress on a substrate is reduced to decrease the curve of the substrate. The planar lightwave circuit is formed by layering a glass film on the substrate. When the optical axis direction from an input waveguide toward an output waveguide is in the longitudinal direction of the substrate, a plurality of grooves are formed in a line in the transverse direction of the substrate. |
| US11885999B2 |
Optical construction and display system
An optical construction includes a reflective polarizer and an optically diffusive film disposed on the reflective polarizer. The reflective polarizer includes an outer layer including a plurality of first particles partially protruding from a first major surface thereof to form a structured major surface. A first optically diffusive layer is conformably disposed on the structured major surface. The optically diffusive film includes a second optically diffusive layer including a plurality of nanoparticles dispersed therein, and a structured layer including a structured major surface. For a substantially normally incident light and a visible wavelength range from about 450 nm to about 650 nm and an infrared wavelength range from about 930 nm to about 970 nm, the second optically diffusive layer has an average specular transmittance Vs in the visible wavelength range and an average specular transmittance Is in the infrared wavelength range, where Is/Vs≥2.5. |
| US11885986B2 |
Plasma dispersion effect for metasurface tuning
An active metasurface that provides low-loss and high-bandwidth modulation control of light includes a number of cells arranged on a substrate. A controller dynamically alters a voltage differential supplied to the electrodes of each of the cells is adapted to alter refractive index of each of the high-index dielectric blocks in order to controllably steer light exiting the cell. |
| US11885982B1 |
Multilayer optical barrier
A liquid lens architecture includes a transparent substrate, a multilayer thermoplastic polyurethane (TPU)-based membrane overlying at least a portion of the transparent substrate, and a liquid layer disposed between and abutting the transparent substrate and the multilayer thermoplastic polyurethane-based membrane. The TPU-based membrane may exhibit a reversible elastic response to imposed strains of up to approximately 2% and is configured to limit the transpiration of fluid to less than approximately 10−2 g/m2/day. |
| US11885975B2 |
Optical switch for single and multiple projectors
A projection system and method therefor comprises a first light source configured to emit a first-eye light, wherein the first-eye light includes a first set of wavelengths; a second light source configured to emit a second-eye light, wherein the second-eye light includes a second set of wavelengths; a first projector including first projection optics configured to receive a first input light; and an optical switch configured to be switched between an a first mode and a second mode, wherein the optical switch is configured to, in the first mode, combine the first-eye light and the second-eye light into a combined light and direct the combined light to the first projection optics as the first input light. |
| US11885974B2 |
Near-eye display (NED) system and method using flexible reflector
A device is provided. The device includes a waveguide configured to output a first light having a first polarization to a first side of the waveguide and a second light having the first polarization to a second side of the waveguide. The device also includes an optical element assembly disposed at the first side of the waveguide and configured to convert the first light having the first polarization into a third light having a second polarization, and output the third light toward the waveguide. The device further includes a polarizer disposed at the second side of the waveguide and configured to transmit the third light having the second polarization, and block the second light having the first polarization. |
| US11885969B2 |
Flat spectral response gratings using high index materials
An example head-mounted display device includes a plurality of optical elements in optical communication. The optical elements are configured to project an image in a field of view of a user wearing the head-mounted display device. A first optical element is configured to receive light from a second optical element. The first optical element defines a grating at along a periphery of the first optical element. The grating includes a plurality of protrusions extending from a base portion of the first optical element. The protrusions include a first material having a first optical dispersion profile for visible wavelengths of light. The grating also includes a second material disposed between at least some of the plurality of protrusions along the base portion of the first optical element. The second material has a second optical dispersion profile for visible wavelengths of light. |
| US11885964B2 |
Electronic device
Disclosed is an electronic device. An electronic device according to the present disclosure may include: an optical system generating light for implementing an image; and a display emitting the light provided from the optical system to an exit location set according to an incident location and an incident angle, in which the optical receiver may include a light source, and a reflector has a shape bent at a different angle with respect to the display while reflecting the light generated by the light source to the display. The electronic device according to the present disclosure may be associated with an artificial intelligence module, a robot, an augmented reality (AR) device, a virtual reality (VR) device, a device related to a 5G service, and the like. |
| US11885957B2 |
Optical deflector
An optical deflector capable of making a swing angle of a reflective plate larger is provided. In drive elements, since a size in the Y direction at first positions separated by a first distance from the reflective plate is larger than a size in the Y direction at second positions separated by a second distance from the reflective plate, the second distance being greater than the first distance, it is possible to increase displacement of tips of beam portions at the first positions and to make a swing angle of the reflective plate large by increasing a generated force of the entire beam portions. |
| US11885955B2 |
Circuit board, circuit board jointed panel, periscope camera module, and application thereof
A circuit board includes a flexible circuit board layer, a rigid circuit board layer, a chip connection portion, and a bending portion. The chip connection portion includes at least part of the flexible circuit board layer and at least part of the rigid circuit board layer overlapping the flexible circuit board layer. The bending portion includes at least part of the flexible circuit board layer and at least part of the rigid circuit board layer overlapping the flexible circuit board layer. The bending portion is connected to the chip connection portion in an invertible manner, after the bending portion is inverted to the rear side of the chip connection portion, a part of the flexible circuit board layer of the bending portion and a part of the flexible circuit board layer of the chip connection portion are arranged face-to-face. |
| US11885951B1 |
High-efficiency oblique illumination module for fluorescence excitation and detection
Disclosed is a module for efficiently exciting and detecting fluorescence. In a disclosed preferred embodiment, excitation lamp modules with multiple solid-state light sources shone at different oblique angles, such that multiple-beams converge in a single plane, are combined with appropriate emission filters that block the excitation light wavelengths while passing the emission wavelengths. A multitude of such modules can be combined on a slider with precise registration via a mating structure, and can be accurately positioned in front of an observation point, such as a microscope's objective lens, external to the microscope, via a novel magnetic detent system, allowing for the rapid switching between the analysis of different fluorophores. |
| US11885949B1 |
Acousto-optic laser microscopy system
A laser scanning microscopy system includes a laser whose beam is modified by an acousto-optic deflector that includes an optical element having a surface with one or more steps formed thereon; a conductive layer formed on the surface with the steps; one or more crystals secured to each step; and electrodes positioned on each surface of each crystal. |
| US11885935B2 |
Camera optical lens
The present disclosure provides a camera optical lens including, from an object side to an image side in sequence: eight lenses which are, from an object side to an image side in sequence: a first lens having a positive refractive power, a second having a positive refractive power, a third lens having a negative refractive power, a fourth lens, a fifth lens having a positive refractive power, a sixth lens having a positive refractive power, a seventh lens having a negative refractive power, and an eighth lens having a positive refractive power; and the camera optical lens satisfies conditions of: 0.95≤f/TTL; 2.00≤f2/f≤5.00; and 2.50≤(R15+R16)/(R15−R16)≤15.00. The camera optical lens can achieve good optical performance while meeting the design requirements for ultra-thinness and long focal length. |
| US11885934B2 |
Camera optical lens
A camera optical lens is provided. The camera optical lens includes, from an object side to an image side, a first lens, a second lens having positive refractive power, a third lens, a fourth lens, a fifth lens, a sixth lens, a seventh lens, an eighth lens, and a ninth lens. The camera optical lens satisfies following conditions: 1.60≤f1/f≤3.00, and 2.00≤d15/d16≤10.00, where f denotes a focal length of the camera optical lens, f1 denotes a focal length of the first lens, d15 denotes an on-axis thickness of the eighth lens, and d16 denotes an on-axis distance from an image side surface of the eighth lens to an object side surface of the ninth lens. The camera optical lens according to the present invention has better optical performance while satisfying design requirements for ultra-thin, wide-angle lenses having large apertures. |
| US11885930B2 |
Optical lens assembly and photographing module
An optical lens assembly includes, in order from the object side to the image side: a stop, a first lens, a second lens, a third lens, and an IR band-pass filter, wherein half of a maximum view angle (field of view) of the optical lens assembly is HFOV, a radius of curvature of an image-side surface of the third lens is R6, a focal length of the optical lens assembly is f, and following condition is satisfied: −6.83 |
| US11885929B2 |
Hierarchical photonic crystals and methods of making the same
The present disclosure provides a composition comprising a hierarchical opal that exhibits structural color when exposed to incident electromagnetic radiation. The hierarchical opal comprises nanoscale periodic cavities separated by a lattice constant, and includes a surface having grooves. The grooves may form a diffractive optical element on the surface of the hierarchical opal, such as a diffuser, a diffraction grating, a beamsplitter, a beam displacement opic, a Fresnel lens, and a micro lens, among others. |
| US11885927B2 |
Image quality test article
A test article containing test objects for assessing and evaluating an image producing x-ray computed tomography system, includes: an exterior shell assembly surrounding an inner volume; a base assembly comprising a flat base portion; a support structure comprising one or more partitions configured to support the test objects, a pair of component supports configured to support an angled bar test object, and one or more brackets configured to attach to at least one of: a partition and the flat base portion; an object length test object connected to the one or more partitions; an angled bar test object connected to the pair of component supports; an NEQ test object comprising a support extension with a threaded attachment configured to connect to a threaded attachment on another test object; and an acetal cylinder test object comprising two threaded mounting extensions and configured to support at least one metal annular device. |
| US11885926B2 |
Electronic device and method for detecting whether a cover is attached thereto
An electronic device includes: a housing including a first surface facing a first direction; and a second surface facing a second direction opposite to the first direction, wherein an inner space is formed between the first surface and the second surface; a board disposed in the inner space; a geomagnetic sensor disposed on the board; and a processor. The geomagnetic sensor is configured to detect a first magnetic force, when a first cover part of the cover, including a first magnetic member, is disposed to cover the first surface from the first direction of the electronic device, and detect a second magnetic force, when a second cover part of the cover, including a second magnetic member, is disposed to cover the second surface from the second direction of the electronic device in a state where the first cover part is disposed to cover the first surface from the first direction of the electronic device. |
| US11885924B2 |
Locating collars on well casings
A method and system may include disposing an electromagnetic (EM) logging tool in a wellbore. The EM logging tool may include a transmitter disposed on the EM logging tool and a receiver disposed on the EM logging tool. The method may further include transmitting an electromagnetic field from the transmitter into one or more, measuring the eddy current in the one or more tubulars with the receiver, and forming an EM log from the plurality of measurements. Additionally, the method may include identifying a representative signature of a collar from the EM log, locating a plurality of signatures that are similar to the representative signature, iteratively locating a collar signature based at least in part on the representative signature, the plurality of signatures that are similar to the representative signature, and a joint length; and displaying a depth for each of the one or more collars. |
| US11885922B2 |
Adaptive tracking of geological objects
A computer-implemented method for detecting at least one natural contour of a geologic object in 3D seismic data may comprise: (a) receiving at least one first predetermined data set from said 3D seismic data comprising a plurality of phase events; (b) selecting at least one first seed phase event having a first phase characteristic from said plurality of phase events; (c) determine a characterizing score between said selected at least one first seed phase event and each one of a predetermined number of candidate phase events of said at least one first predetermined data set; (d) assigning said characterizing score to each one of said predetermined number of candidate phase events; (e) adjusting said characterizing score of at least one of said predetermined number of candidate phase events in accordance with at least one first boundary condition; (f) determining at least one natural contour between said at least one first seed phase event and at least a second phase event, utilizing an optimization algorithm; (g) generating a visual representation of said at least one natural contour within said at least one first predetermined data set. |
| US11885919B2 |
Calorimetric detector for measuring the energy of electrons and photons
A calorimetric detector (1) for measuring energy of electrons and photons comprises a light energy absorber and scintillating fibers (2). The absorber is formed of a tungsten matrix (3), comprising a first assembly (4) and a second assembly (5) of parallel tungsten plates. The first assembly (4) is perpendicular to the second assembly (5) forming a grid, while each plate is in one half formed by alternating teeth (6) and gaps (7). The first assembly's (4) plates fit detachably with their teeth (6) into the gaps (7) of the second assembly (5) and vice versa. Spaces between the plates of the first assembly (4) and the second assembly (5) form longitudinal sections (8) with inner cross-section size of one pixel. The scintillating fibers (2) are longitudinally arranged, made of a single crystal material. The tungsten matrix (3) is in a protective metal frame (9) having tungsten inner walls (10). |
| US11885918B2 |
Sonar system with dynamic power steering
A sonar array system comprises a plurality of sonar arrays and a sonar signal processor. Each sonar array is configured to receive transmit electronic signals and transmit corresponding sonar beams in a forward direction and a downward direction. Each sonar array includes a plurality of groups of sonar transducer elements, with each group including at least a first sonar transducer element and a second sonar transducer element. The sonar signal processor is configured to communicate a plurality of transmit electronic signals to the sonar arrays. The transmit electronic signals include a first transmit electronic signal including a periodic waveform having a first phase and a second transmit electronic signal including a periodic waveform having a second phase. A distribution of power between the sonar beams transmitted in the forward direction and in the downward direction varies according to a difference in the first phase and the second phase. |
| US11885913B2 |
LiDAR and automobile
The present application discloses a LiDAR, which includes a base including a bearing surface, an adjusting structure located on the bearing surface, and a laser transceiving module including a plurality of laser transceiving devices. A galvanometer module of the LiDAR is fixed on the bearing surface. Each laser transceiving device is fixed on the adjusting structure, respectively. Each laser transceiving device is able to generate an outgoing laser emitted to the galvanometer module, respectively. The adjusting structure is configured so that each of the laser transceiving devices has a corresponding distance from the bearing surface, and therefore, the outgoing lasers generated by each of the laser transceiving devices form a preset laser detection field of view outside the LiDAR. |
| US11885908B2 |
Apparatus and method of selecting sources of illumination to be jammed for passive radar jamming
This application relates to a method for selecting sources of illumination to jam, performed by an apparatus of selecting sources of illumination to jam for passive radar jamming. The method may include, predicting sources of illumination used by a virtual passive radar of interest disposed within a jamming range with respect to the location of a passive radar jammer. The method may also include selecting sources of illumination as candidates for jamming if the signal strength of a target reflection signal received by the virtual passive radar of interest from the sources of illumination is equal to or greater than an acceptable received signal strength. The method may further include picking out which sources of illumination to jam from the sources of illumination selected as candidates for jamming, based on how frequently the virtual passive radar of interest uses each of the selected candidates for jamming. |
| US11885900B2 |
Method and system for tracking a mobile device
A computer-implemented method for tracking a mobile device based on a series of motion measurements of said device comprises retrieving a topological map providing a graph of topological paths, wherein each topological path is associated with a corresponding path direction; statistically generating, on a virtual map, a plurality of particles around an estimated initial position of the mobile device, representing an initial uncertainty of said estimated initial position of the mobile device; determining, from said series of motion measurements, a measured displacement vector of the mobile device representing an estimated displacement direction and an estimated displacement distance of the mobile device; displacing each of said particles on the virtual map according to a randomized particle displacement vector which is derived from said measured displacement vector based on an uncertainty of the measured displacement vector and recording said particle displacement vector for each displaced particle; determining a weight of each particle based on a comparison of the respective particle displacement vector with the path direction of an adjacent topological path and/or based on a distance of the particle to the adjacent topological path; selecting a subset of said displaced particles for resampling based on a particle-weight dependent selection criterion; and regenerating said selected subset of displaced particles within a particle regeneration area around a current mean location of the plurality of particles according to a probability distribution. |
| US11885890B2 |
Method and apparatus of single epoch position bound
A method for determining a protection level of a position estimate using a single epoch of GNSS measurements, the method includes: specifying a prior probability density P(x) of a state x; specifying a system model h(x) that relates the state x to observables z of the measurements; quantifying quality metrics q associated with the measurements; specifying a non-Gaussian residual error probability density model ƒ(r|θ, q) and fitting model parameters θ using a set of experimental data; and defining a posterior probability density P(x|z, q, θ); estimating the state x; and computing the protection level by integrating the posterior probability density P(x|z, q, θ) over the state x. |
| US11885888B2 |
System for distributed verification of satellite position
A satellite for implementing a protocol associated with a distributed satellite position verification system is provided. The satellite, on implementing the protocol, verifies records of positions of one or more other satellites in the distributed satellite position verification system. According to the protocol, the satellite performs, at different time instances, a first operation, a second operation, or a third operation to act as a first satellite, a second satellite, or a third satellite, respectively in the distributed satellite position verification system. When the first satellites performs the first operation, the first satellite verifies at least some positions in the records of positions of the second satellite such that the first satellite: determines a verified position of the second satellite; calculates a deviation between the verified position and a prior estimated position of the second satellite; and records the verified position into the records, based on the calculated deviation. |
| US11885885B2 |
Distributed LIDAR systems and methods thereof
A LIDAR system, comprising: (a) a plurality of anchored LIDAR sensing units, each anchored LIDAR sensing unit comprising at least: (i) a housing; (ii) at least one detector, mounted in the housing, configured to detect light signals arriving from objects in a field of view of the anchored LIDAR sensing unit; and (iii) a communication unit, configured to output detection information which is based on outputs of the at least one detector and which is indicative of existence of the objects; and (b) at least one integratory processing unit, configured to receive the detection information from two or more of the plurality of anchored LIDAR sensing units, and to process the received detection information to provide a three dimensional model of a scene which is larger than any of the field of views of the independent anchored LIDAR sensing units. |
| US11885884B2 |
Camera module
An embodiment of the present invention discloses a camera module including a light output unit configured to output an optical signal to an object; an optical unit configured to pass the optical signal reflected from the object; a sensor configured to receive the optical signal passed by the optical unit; and a control unit configured to acquire depth information of the object using the optical signal received by the sensor, wherein the sensor includes an effective area in which a light receiving element is disposed and an ineffective area other than the effective area and includes a first row region, in which the effective area and the ineffective area are alternately disposed in a row direction, and a second row region, in which the effective area and the ineffective area are alternately disposed in the row direction and the effective area is disposed at a position not overlapping the effective area of the first row region in a column direction, light that reaches the effective area of the first row region is controlled by first shifting control to reach the ineffective area of the first row region or the ineffective area of the second row region, and light that reaches the effective area of the second row region is controlled by the first shifting control to reach the ineffective area of the second row region or the ineffective area of the first row region. |
| US11885882B1 |
Triangulation sensor system
An inventory management system includes an inventory holder and sensors. The sensors measure distances to locations on the inventory holder. The measurements are used to determine pitch, roll, and yaw of the inventory holder. The pitch, roll, and yaw are used to determine a location of an inventory cubicle in the inventory holder. |
| US11885881B2 |
Sensor system for a road finishing machine
A sensor system for a construction machine, in particular a road finishing machine, includes a laser scanner and an evaluation unit. The laser scanner can be arranged on the construction machine or the road finishing machine itself and is configured to search a specified angular range for objects and to determine angles of the specified angular range according to distance values describing the distance to the one or several objects together with corresponding intensity values describing an intensity of a reflection resulting at the one or several objects. The evaluation unit is configured to detect an object as a reference together with corresponding angles based on a known pattern including the distance values and the intensity values across the angles. Further, the evaluation unit is configured to determine a distance to the reference and/or an angle with respect to the reference. |
| US11885879B2 |
Measurement apparatus and measurement method
A measurement apparatus includes a laser apparatus, a branch that branches a frequency-modulated laser beam into a reference light and a measurement light, a beat signal generator that generates a beat signal by mixing the reference light and a reflected light that is the measurement light radiated onto an object to be measured, a first analyzer that analyses a first signal component corresponding to a difference in a propagation distance between the reference light and the measurement light on the basis of the beat signal, a second analyzer that analyses a second signal component corresponding to a cavity frequency of an optical cavity on the basis of the beat signal, and calculation circuitry that calculates the difference in the propagation distance between the reference light and the measurement light. |
| US11885877B2 |
Systems and methods of sparse orthogonal diverging wave ultrasound imaging
Encoded transmit signals are provided to an ultrasound array such diverging ultrasound waves are sequentially transmitted. Each diverging ultrasound wave is generated by a respective set of encoded transmit signals, where each set of encoded transmit signals is encoded by a respective row of an N×N invertible orthogonal matrix. Only a selected subset of M rows, with N |
| US11885875B2 |
Methods and system to assist search and interception of lost objects
Devices and methods for aiding a large area search for objects. A searcher transmits interrogation signals of long range relative to the return range to be received by a device at the target object. The target device responds with a ping signal modified to be more easily found by means of information contained in the interrogation signal. The information may be in the nature of the received signal or data encoded and embedded. The target device may use a microprocessor to do complex operations using the information from the interrogation signal and other information. Detection of a weak ping is facilitated by such means as being beamed in the direction of the interrogation, arriving at a predictable time, or having parameters adapted to values requested by the searcher. The object is then intercepted with help of the ping or other signals from the device. |
| US11885874B2 |
Acoustic distance measuring circuit and method for low frequency modulated (LFM) chirp signals
In one form, an acoustic distance measuring circuit includes a frequency generator, a transmitter amplifier, an acoustic transducer, and a sensing circuit. The sensing circuit includes an input adapted to be coupled to the acoustic transducer, for receiving an input signal. The sensing circuit provides an in-phase portion and a quadrature portion of the input signal to a filter. The sensing circuit filters the in-phase portion and the quadrature portion and calculates a phase of the input signal in response to the filtered in-phase and quadrature portions. The sensing circuit determines a frequency slope of the input signal in response to calculating the phase and provides the frequency slope of the input signal to an output. |
| US11885873B2 |
Agricultural system
A system including a beamforming-sensor configured to acquire sensor-data representative of a swath in an agricultural field; and a controller configured to determine swath-property-data based on the sensor-data. |
| US11885869B2 |
Smart automatic frequency control apparatus based on digital control
The present disclosure provides a smart automatic frequency control (AFC) apparatus, including: a phase shift module, connected to a first signal input terminal and configured to: receive an incident wave from the first signal input terminal, perform a phase shift on the incident wave according to a phase shift parameter so as to generate a phase-shifted signal, and output the phase-shifted signal to a phase detection module; and the phase detection module, connected to the phase shift module and a second signal input terminal and configured to: receive a reflected wave from the second signal input terminal, perform a phase detection on the phase-shifted signal and the reflected wave so as to generate a phase difference signal, and output the phase difference signal via a control interface. |
| US11885866B2 |
Auto-calibration for coreless current sensors
Auto-calibrating current sensor integrated circuits (ICs) are configured for mounting at a position relative to a conductor. The auto-calibrating current sensor ICs can include a plurality of magnetic field sensing elements disposed at different locations within the integrated circuit, respectively, and can be configured to measure a magnetic field produced by a current carried by the conductor. The auto-calibrating sensors can include an electromagnetic model of the IC and the conductor. The model can be operative to determine a magnetic field at points in space due to a given current in the conductor at a known location of the conductor from the IC, and also the inverse situation of determining an unknown current and/or location of the conductor based on measurements of a magnetic field at known locations in space due to an unknown current in the conductor. Related auto-calibration methods are also described. |
| US11885865B2 |
Quality control phantom and evaluation method for magnetic resonance arterial spin labeling perfusion imaging
A quality control phantom and an evaluation method for magnetic resonance arterial spin labeling perfusion imaging includes: a phantom main body; a container, a circulating liquid being provided in the container; a tube, comprising a first tube and a second tube, one end of the first tube being in communication with the container, the other end being in communication with a liquid inlet of the phantom main body, one end of the second tube being in communication with the container, the other end being in communication with a liquid outlet of the phantom main body, and the first tube, the phantom main body, the second tube and the container jointly forming a closed loop; a pump, provided on the first tube and used to drive the circulating liquid to circulate along the closed loop to generate a perfusion signal in the phantom main body. |
| US11885864B2 |
Magnetic resonance imaging apparatus and method of controlling the same
Generation of artifacts caused by the FID signal is suppressed even when the parallel imaging is applied to the imaging using a spin echo type pulse sequence. In performing a pulse sequence of a spin echo type using an excitation RF pulse for exciting nuclear spin and an inversion RF pulse for inverting excited nuclear spin as a high-frequency magnetic field pulse, a high-frequency transmitter of a MRI apparatus changes the phase of the inversion RF pulse according to the phase encoding and the phase encoding number imparted for each echo signal. Specifically, the phase of the inversion RF pulse is controlled to be a quadratic function of the phase encode of the echo signal. |
| US11885862B2 |
Deep learning based magnetic resonance imaging (MRI) examination acceleration
Systems and methods for deep learning based magnetic resonance imaging (MRI) examination acceleration are provided. The method of deep learning (DL) based magnetic resonance imaging (MRI) examination acceleration comprises acquiring at least one fully sampled reference k-space data of a subject and acquiring a plurality of partial k-space of the subject. The method further comprises grafting the plurality of partial k-space with the at least one fully sampled reference k-space data to generate a grafted k-space for accelerated examination. The method further comprises training a deep learning (DL) module using the fully sampled reference k-space data and the grafted k-space to remove the grafting artifacts. |
| US11885859B2 |
Passive shim tray for magnetic resonance examination system
A shim tray (10) for a main magnet system of a magnetic resonance examination system comprises a plurality of shim pockets (11), of which an individual shim pocket has side walls (21, 42) forming an open channel (11). Two opposite lateral side walls (21) have insertion profiles (22) to receive an end shim-element (13) at least one open channel's end. Essentially the entire volume of the channel of the shim pocket is available to hold passive shim elements. |
| US11885856B2 |
Head coil device and magnetic resonance imaging apparatus using the same
Provided is a coil device capable of improving operability or durability thereof, being attached to a subject in a close contact state regardless of the size of a head of the subject, and obtaining a high-quality MRI image. The coil device includes at least one coil unit which has a coil element and a coil support portion which has a mechanism for attaching the coil unit to a head of a subject. The coil support portion includes a base portion, a support body which is connected to the base portion and has an elastic member, and a holder which connects the support body to the at least one coil unit and the holder has at least three contact points which are formed directly or indirectly with respect to the base portion. |
| US11885854B2 |
Testers, testing systems and methods of testing electrical components
A tester for testing an electrical component. The tester includes a database of testing specifications for electrical components, a tester connector for physically and electrically connecting to different electrical components, and an output device. The tester identifies an electrical component connected to the tester connector and provide corresponding identification data, retrieves a testing specification from the database using the identification data, commands a test of the electrical component according to the testing specification, and outputs an indication of a result of the test through the output device. |
| US11885851B2 |
Jig for battery charging and discharging test
A jig for a battery charging and discharging test includes a first frame and a second frame which are disposed in parallel to each other so as to be spaced apart from each other. Two mounting rails are installed to protrude forward to connect the first and second frames, and have slit grooves open in directions facing each other. Each have an open side, such that the battery pack is mounted on the mounting rails through a rail-type structure. An anode unit and a cathode unit are arranged on either side of the mounting rails, and brought into contact with a first terminal and a second terminal of the battery pack coupled to the mounting rails, respectively. The jig can fix a battery at various angles to flexibly cope with various test environments, in order to perform a battery charging and discharging test. |
| US11885849B2 |
Method for monitoring a machine on the basis of electric current signals and device for implementing such a method
A method can be used for supervising the operation of a machine powered with electric current. The method includes operating the machine in a normal operation mode, repeatedly performing a learning phase for learning the normal operation machine of the machine to create a knowledge base, autonomously switching from the learning phase into a supervision phase when the knowledge base is considered to have been created, and repeatedly performing the supervision phase. |
| US11885847B2 |
Automatically testable short circuit breaker
Proposed is an automatically testable short circuit breaker that includes: a pseudo short circuit signal driving circuit unit connected to opposite ends of a test button in a short circuit breaker; a pseudo short circuit signal recognition circuit unit which recognizes a short circuit detection signal and outputs a diagnosis signal; and a pseudo short circuit signal shut-off circuit unit which induces the short circuit detection signal to grounding so that the short circuit detection signal does not flow into the driving unit. |
| US11885841B2 |
Electric field sensor
An electric field sensor which measures an electric field generated by a target utilizing an electro-optic effect, the electric field sensor including a light source, an electro-optic crystal on which light in a predetermined polarization state emitted from the light source is incident and which is subjected to the electric field generated by the target, a reference electric field applicator configured to apply an electric field based on a reference signal with a known signal level to the electro-optic crystal, a light receiver configured to receive light emitted from the electro-optic crystal and to convert the received light into an electric signal, and a separation corrector configured to separate the electric signal into a measurement signal based on the electric field generated by the target and the reference signal and to correct a signal level of the measurement signal on the basis of the signal level of the separated reference signal. |
| US11885840B2 |
Method of measuring temperature change and SAR of artificial hip joint implant using magnetic resonance imaging equipment
A method of measuring a specific absorption rate (SAR) of a hip joint implant using magnetic resonance imaging (MRI), includes: arranging the hip joint implant in a human lower body-shaped phantom; arranging an electric field sensor around the hip joint implant; providing radio frequency (RF) energy according to an MRI sequence to the human phantom; and calculating the SAR of the hip joint implant from strength of an electric field measured by the electric field sensor. |
| US11885834B2 |
Magnetic current sensing
In a described example, a circuit includes a sensor circuit including multiple magnetic field sensors having respective sensor outputs. The magnetic field sensors are configured to provide magnetic field sensor signals at the respective sensor outputs representative of a measure of current flow through a conductive structure. A combiner interface has combiner inputs and a combiner output. The combiner inputs are coupled to the respective sensor outputs. The combiner interface is configured to provide an aggregate sensor measurement at the combiner output responsive to the magnetic field sensor signals, in which the aggregate sensor measurement is decoupled from magnetic fields generated responsive to the current flow through the conductive structure. |
| US11885832B2 |
Signal analyzer
The invention relates to a signal analyzer, comprising a signal receiving unit configured to receive a signal, in particular a radio frequency (RF) signal, a digitizing unit configured to digitize the received signal, and a trigger detection unit configured to detect a trigger event in the digitized signal. The signal analyzer further comprises an acquisition unit configured to store a segment of the digitized signal in a memory of the signal analyzer if the trigger detection unit detects the trigger event in the digitized signal, and an anomaly search unit configured to analyze the stored segment of the digitized signal in order to detect signal anomalies, in particular glitches, in the stored segment of the digitized signal. |
| US11885830B2 |
Probe tip assembly for testing optical components
In some implementations, a probe tip assembly includes a driver printed circuit board assembly (PCBA) and a probe tip subassembly. The probe tip subassembly includes a plurality of probe tips, wherein a probe tip, of the plurality of probe tips, extends beyond an end of the PCBA, and the PCBA and the probe tip are configured to transmit an electric signal to test an optical component. The probe tip may include a material comprising at least one of copper (Cu), a beryllium copper (BeCu) alloy, tungsten (W), Paliney, Neyoro, and/or another conductive material. |
| US11885826B2 |
Biochemical analysis apparatus and biochemical analysis method
A biochemical analysis apparatus includes a piercer for piercing a cover member, a nozzle that passes through the piercer which has pierced the cover member and suctions a specimen, a liquid surface sensor that detects contact of the nozzle with the specimen, and a controller that drives the nozzle and the piercer, in which the controller provides an error notification upon detection of contact of the nozzle with the accommodation object inside the piercer, and upon detection of a collision of the nozzle with the cover member. |
| US11885817B2 |
Biomarkers and methods for detection of seizures and epilepsy
Epileptic seizures are difficult to diagnose and are often difficult to distinguish from several conditions with similar presentations, and therefore, diagnosis of seizures is often a long, expensive, and unreliable process. This invention provides biomarkers for identifying seizures and epilepsy, assays for measuring and assessing biomarker concentration, predictive models based on biomarkers and computational systems for detecting, assessing and diagnosing phasic and tonic changes associated with seizures and epilepsy in all clinical and healthcare settings. Diagnostic and treatment methods, systems, kits, and predictive models provided herein, provide quantitative and/or qualitative assessment in order to allow patients to proceed immediately to diagnostic and/or treatment protocols, and assess therapeutic treatment effectiveness. |
| US11885814B2 |
High efficiency targeted in situ genome-wide profiling
A method for detecting the binding of a chromatin-associated factor of interest to a sequence of chromatin DNA in a cell, including: contacting a permeabilized cell or nucleus with a specific binding agent that specifically recognizes the chromatin-associated factor of interest, wherein the specific binding agent is linked to a nuclease that is inactive or an activatable transposome; activating the nuclease or transposase, thereby excising the sequence of chromatin DNA bound to the chromatin-associated factor of interest; isolating the excised DNA; and determining the sequence of the excised DNA, thereby detecting binding of a chromatin-associated factor of interest to a sequence of chromatin DNA in the cell. |
| US11885813B2 |
Methods of diagnosing and predicting renal disease
This disclosure relates to methods of diagnosing and predicting renal disease, using one, two, or more biomarkers, including sTN-FR1, sTNFR2, sFAS, TNF, and IL-6. |
| US11885807B2 |
Method for depleting malignant T-cells
The present invention relates to a chimeric antigen receptor (CAR) which comprises an antigen-binding domain which selectively binds TOR beta constant region 1 (TRBC1) or TRBC2; cells; such a T cells comprising such a CAR; and the use of such cells for the treatment of a T-cell lymphoma or leukaemia in a subject. |
| US11885804B2 |
Application of ERH gene in the preparation of bladder cancer diagnosis and treatment products
The invention relates to the application of the ERH gene in the preparation of bladder cancer diagnosis and treatment products. The ERH gene is found to have a good correlation with bladder cancer. In addition, an RNA interference vector is constructed to perform cell function experiments to study the effect of ERH gene on the proliferation and clonality of bladder cancer cells. The present invention provides a research basis for clinical diagnosis and treatment of bladder cancer and has a good application prospect. |
| US11885798B2 |
Centrifuge and method for loading and centrifuging a reaction vessel unit
A centrifuge for cleaning a reaction vessel unit, having a rotor for holding at least one reaction vessel unit with its opening(s) directed outwardly, a motor for rotating the rotor around a rotation axis, and a loading mechanism with a beam for loading and unloading the centrifuge with the at least one reaction vessel unit. |
| US11885796B2 |
Assay to identify anti-cancer agents
An in vitro method for identifying an anti-cancer agent, the therapeutic efficacy of which is enhanced upon administration with a second agent that increases the expression of OPRK1 and/or BAD, comprising the steps of: a. co-incubating a population of cells with a target anti-cancer agent and said second agent and b. measuring the cytotoxicity and/or cytostasis in the population of cells; wherein the therapeutic efficacy of the target anti-cancer agent is enhanced if the cytotoxicity and/or cytostasis of the target anti-cancer agent is increased compared to a control. |
| US11885788B2 |
Apparatus and method for multimode analytical sensing of items such as food
A multimode biological sample inspection apparatus and method is provided. The apparatus includes an illumination hardware arrangement comprising transmission and sensing hardware configured to inspect a biological sample using at least two modes from a group comprising a fluorescence imaging mode, a reflectance imaging mode, a scattering imaging mode, and a Raman imaging mode, and processing hardware configured to operate the illumination hardware arrangement according to a protocol comprising inspection settings of the at least two modes. The processing hardware receives scan results from the illumination hardware arrangement and identifies attributes of the biological sample by constructing a multidimensional dataset comprising at least one spatial dimension and at least one spectral dimension from the scan results and analyzing the multidimensional dataset. The processing hardware is configured to employ the attributes of at least one biological sample and alter the protocol. |
| US11885778B2 |
Open port sampling interface
A system for sampling a sample material includes a probe which can have an outer probe housing with an open end. A liquid supply conduit within the housing has an outlet positioned to deliver liquid to the open end of the housing. The liquid supply conduit can be connectable to a liquid supply for delivering liquid at a first volumetric flow rate to the open end of the housing. A liquid exhaust conduit within the housing is provided for removing liquid from the open end of the housing. A liquid exhaust system can be provided for removing liquid from the liquid exhaust conduit at a second volumetric flow rate. A droplet dispenser can dispense drops of a sample or a sample-containing solvent into the open end of the housing. A sensor and a processor can be provided to monitor and maintain a liquid dome present at the open end. |
| US11885776B2 |
Chromatography analysis system
A chromatography analysis system includes a liquid delivery pump (2), an autosampler (4), a separation column (12), a column oven (6), a detector (8). The chromatography analysis system further comprising a shutdown execution part (22) configured to start shutdown to finally stop driving of the liquid delivery pump (2) and temperature control operation of the column oven (6) at a time when a predetermined situation occurs, by controlling operation of the liquid delivery pump (2) and the column oven (6), and a column protection temperature setter (24) configured to set a column protection temperature for preventing deterioration of the separation column (12) due to overheating. The shutdown execution part (22) is configured to stop driving of the heater (14) in a state where the liquid delivery pump (2) is driven when the shutdown is started, and then, stop driving of the liquid delivery pump (2) after a temperature of the internal space detected by the temperature sensor (18) becomes equal to or less than the column protection temperature. |
| US11885772B2 |
Material testing systems having three phase switched-mode power supply units
Disclosed example material testing systems include: a material testing apparatus configured to receive an electrical supply, wherein the material testing apparatus comprises: guide means; sample holding means configured for holding a sample; force means configured for applying force to the sample; and a crosshead arranged to support at least a portion of one or both of the sample holding means and the force means, wherein the crosshead is moveable about the guide means; a three phase switched-mode power supply unit arranged to provide the electrical supply to the material testing apparatus; and one or more blocking means connected with a power output of the three phase switched-mode power supply unit, wherein the blocking means is arranged to prevent an electrical current at the power output of the three phase switched-mode power supply unit from flowing in a predetermined direction. |
| US11885768B2 |
Semi-automatic scanner for ultrasonic inspection of branch pipe weld
The present invention relates to a semi-automatic scanner for ultrasonic inspection of a branch pipe weld that has a small size and is able to perform an inspection while moving in a state of being attached to a test object by a magnetic force, thereby being applied to fittings having various shapes, such as a branch pipe and an elbow. The semi-automatic scanner for ultrasonic inspection according to the present invention includes a probe configured to inspect a weld by irradiating ultrasonic waves onto a surface of a test object, a probe holder configured to couple the probe by applying an elastic force so as to be pressed against the surface of the test object, an installation bracket having a rod shape, to which the probe holder is coupled so as to be laterally movable, four wheel units installed on both front and rear side surfaces of the installation bracket so as to be vertically slidable, and four magnet parts, each of which is installed on one of the four wheel units and presses the one of the wheel units against the test object with a magnetic force. |
| US11885766B2 |
Photoionization detector and method of operating same
An electrode stack assembly includes an electrically insulative substrate having a cavity therethrough extending, a first counter electrode on a top surface thereof and extending through the substrate, a second sensing electrode on a bottom surface thereof and extending through the substrate, and a third electrode having a top body portion on a top of the substrate, a bottom body portion on a bottom of the substrate, and a coupling pin passing through the substrate and electrically coupling the top and bottom body portions. The third electrode electrically separates the pin of the sensing electrode from the counter electrode. |
| US11885764B2 |
Gas sensor
A gas sensor according to the present application includes a detecting device that detects a specific gas concentration of a measurement-object gas based on an electromotive force generated between a reference electrode and a measurement electrode; and a reference gas regulating device that flows an oxygen pumping current between the reference electrode and a measurement-object gas side electrode and pumps oxygen from around the measurement-object gas side electrode to around the reference electrode, wherein when the average value of the oxygen pumping current is P and the limiting current value of a reference gas introduction layer when oxygen is pumped from around the reference electrode to around the measurement-object gas side electrode is Q, the ratio Q/P is from 0.8 to 10. |
| US11885761B2 |
Electronic device including flexible display module and method for detecting damage to the display module
An electronic device include: a first housing; a second housing; a display module including a flexible substrate, a TFT layer on the flexible substrate, a protection layer on the TFT layer, and a deformation region which deforms as a relative position between the first housing and the second housing changes; a bending portion including a first layer integral with the flexible substrate and bent, and a second layer integral with the TFT layer, bent and laminated on the first layer; a display driver IC (DDI) in the bending portion; a touch wire on the protection layer to be connected to a touch circuit; and a detection wire on the protection layer in the deformation region and having an electrical value changeable by physical damage to the protection layer. The detection wire extends from the protection layer to the second layer so as to be electrically connected to the DDI. |
| US11885759B2 |
Solar panel inspection using unmanned aerial vehicles
Methods, systems, and program products of inspecting solar panels using unmanned aerial vehicles (UAVs) are disclosed. A UAV can obtain a position of the Sun in a reference frame, a location of a solar panel in the reference frame, and an orientation of the solar panel in the reference frame. The UAV can determine a viewing position of the UAV in the reference frame based on at least one of the position of the Sun, the location of the solar panel, and the orientation of the solar panel. The UAV can maneuver to the viewing position and point a thermal sensor onboard the UAV at the solar panel. The UAV can capture, by the thermal sensor, a thermal image of at least a portion of the solar panel. A server onboard the UAV or connected to the UAV can detect panel failures based on the thermal image. |
| US11885758B2 |
Sensor apparatus systems, devices and methods
A sensor apparatus and sensor apparatus system for use in conjunction with a cassette, including a disposable or replaceable cassette. In some embodiments, the cassette includes a thermal well for permitting the sensing of various properties of a subject media. The thermal well includes a hollow housing of a thermally conductive material. In other embodiments, the cassette includes sensor leads for sensing of various properties of a subject media. The thermal well has an inner surface shaped so as to form a mating relationship with a sensing probe. The mating thermally couples the inner surface with a sensing probe. In some embodiments, the thermal well is located on a disposable portion and the sensing probe on a reusable portion. |
| US11885752B2 |
Calibration method and device therefor
A method of determining at least one x-ray scanning system geometric property includes the steps of positioning a calibration device inside a scanning chamber of the scanning device, the chamber being intersected by at least one fan beam of x-rays during a scanning operation, measuring a distance between the calibration device and at least one inner wall of the chamber, scanning the calibration device to produce an image of the calibration device, identifying pixels representing the a geometric feature of the calibration device in the image, determining a position and orientation of the pixels representing the geometric feature in the image and, determining a scanning system property based on the position and orientation of the pixels representing the geometric feature in the image. The position and orientation of the feature in the scanning chamber and the x-ray scanning system property may be determined simultaneously. |
| US11885751B2 |
Testing device and testing method
A testing device for detecting defects of transparent test specimens, in particular of ophthalmological lenses, has an illumination device for transilluminating test specimens to be examined and with an image acquisition device for imaging the test specimen transilluminated by the illumination device. The illumination device includes a plurality of linearly adjustable light sources for generating a stripe pattern. To capture the stripe pattern, the acquisition duration of the image acquisition device can be adjusted in such a way that the light emitted by each of the light sources is detected as a light stripe. Further, the disclosure relates to a testing method for detecting a defect of a transparent specimen. |
| US11885750B2 |
Integrated wafer bow measurements
In some examples, a wafer bow measurement system comprises a measurement unit including: a wafer support assembly to impart rotational movement to a measured wafer supported in the measurement unit; an optical sensor; a calibration standard to calibrate the optical sensor; a linear stage actuator to impart linear direction of movement to the optical sensor; a wafer centering sensor to determine a centering of the measured wafer supported in the measurement unit; and a wafer alignment sensor to determine an alignment of the measured wafer supported in the measurement unit. |
| US11885746B2 |
Downhole laser system with an improved laser output production and data collection
One or more embodiments relates to a method of growing ultrasmooth and high quantum efficiency CsTe photocathodes. The method includes exposing a substrate of Cs using an alkali source such as an effusion cell; and controlling co-evaporating growth and co-deposition forming a CsTe growth. The method further includes monitoring a stoichiometry of the CsTe growth. |
| US11885744B2 |
Sensor for lifetime plus spectral characterization
Some aspects relate to integrated devices for obtaining timing and/or spectral information from incident light. In some embodiments, a pixel may include one or more charge storage regions configured to receive charge carriers generated responsive to incident photons from a light source, with charge carriers stored in the charge storage region(s) indicative of spectral and timing information. In some embodiments, a pixel may include regions having different depths, each configured to generate charge carriers responsive to incident photons. In some embodiments, a pixel may include multiple charge storage regions having different depths, and one or more of the charge storage regions may be configured to receive the incident photons and generate charge carriers therein. In some embodiments, a pixel may include an optical sorting element configured to direct at least some incident photons to one charge storage region and other incident photons to another charge storage region. |
| US11885743B2 |
Fluorescence and scatter and absorption spectroscopic apparatus with a sapphire tube and method for analyzing inline low level hydrocarbon in a flow medium
An apparatus and method of inline measurement of low-concentration hydrocarbons overlaps fluorescence, scatter and absorption spectroscopy devices so as to measure scatter and absorption of fluorescing oil and the excited fluorescence itself. The apparatus includes a fitting, an input port, an output port, and a sapphire tube having a hollow interior in fluid connection with the input port and the output port. Flow medium passes through the input port, the sapphire tube, and the output port. The apparatus also includes a light emitter, a first detector, and a second detector. The light emitter can include a lens, an absorption and scatter wavelength emitter, and a fluorescence wavelength emitter. An incident absorption and scatter beam and an incident fluorescence beam from the light emitter and parallel so as to determine free hydrocarbon, dissolved hydrocarbons, and solids in a sample within the sapphire tube. |
| US11885739B2 |
Methods and assemblies for determining and using standardized spectral responses for calibration of spectroscopic analyzers
Methods and assemblies may be used for determining and using standardized spectral responses for calibration of spectroscopic analyzers. The methods and assemblies may be used to calibrate or recalibrate a spectroscopic analyzer when the spectroscopic analyzer changes from a first state to a second state, the second state being defined as a period of time after a change to the spectroscopic analyzer causing a need to calibrate or recalibrate the spectroscopic analyzer. The calibration or recalibration may result in the spectroscopic analyzer outputting a standardized spectrum, such that the spectroscopic analyzer outputs a corrected material spectrum for an analyzed material, and defining the standardized spectrum. The corrected material spectrum may include signals indicative of material properties of an analyzed material, the material properties of the material being substantially consistent with material properties of the material output by the spectroscopic analyzer in the first state. |
| US11885737B2 |
Method and system for optical characterization of patterned samples
A method and system are presented for use in measuring on patterned samples, aimed at determining asymmetry in the pattern. A set of at least first and second measurements on a patterned region of a sample is performed, where each of the measurements comprises: directing illuminating light onto the patterned region along an illumination channel and collecting light reflected from the illuminated region propagating along a collection channel to be detected, such that detected light from the same patterned region has different polarization states which are different from polarization of the illuminating light, and generating a measured data piece indicative of the light detected in the measurement. Thus, at least first and second measured data pieces are generated for the at least first and second measurements on the same patterned region. The at least first and second measured data pieces are analyzed and output data is generated being indicative of a condition of asymmetry in the patterned region. |
| US11885735B2 |
Ex vivo and in vivo systems for evaluating hemostatic patches, sealants, adhesives on solid organs
The present is directed to systems for ex vivo testing performance of a hemostatic or sealing product attached to an animal organ and fully covering a cored channel in said organ, comprising: a pressure sensor positioned proximate to said hemostatic or sealing product in said cored channel; a monitoring or recording device configured to receive pressure readings from said pressure sensor; and a pressurized fluid source connected to said cored channel and configured to supply said pressurized fluid into said cored channel under constant or variable pressure. The present invention is also directed to methods of use for such systems. |
| US11885734B2 |
Optical plastic film, and optical laminate, polarization plate, and image
The present disclosure addresses the problem of providing an optical plastic film such that rainbow unevenness when viewed with naked eyes and blackout when viewed with polarized sunglasses can be suppressed without any axis alignment or increase in the in-plane phase difference. Disclosed is an optical plastic film satisfying the following conditions 1 and 2: |
| US11885733B2 |
White blood cell population dynamics
Systems and methods for modeling and detecting white blood cell population dynamic for diagnosis and treatment, e.g., of acute coronary syndrome or leukocytosis. |
| US11885732B2 |
Morphometric genotyping of cells in liquid biopsy using optical tomography
A classification training method for training classifiers adapted to identify specific mutations associated with different cancer including identifying driver mutations. First cells from mutation cell lines derived from conditions having the number of driver mutations are acquired and 3D image feature data from the number of first cells is identified. 3D cell imaging data from the number of first cells and from other malignant cells is generated, where cell imaging data includes a number of first individual cell images. A second set of 3D cell imaging data is generated from a set of normal cells where the number of driver mutations are expected to occur, where the second set of cell imaging data includes second individual cell images. Supervised learning is conducted based on cell line status as ground truth to generate a classifier. |
| US11885726B2 |
Particulate matter sensor
A particulate matter sensor module includes a light source and a light detector mounted on a substrate. A housing is attached to the substrate and includes first and second sections attached to one another in a stack over the substrate such that the first section is disposed between the substrate and the second section. The first and second sections, in combination, define a light reflection chamber, a fluid flow conduit, a particle-light interaction chamber, and a light trap chamber. The first section has a first aperture through which light emitted by the light source can pass to a reflective surface within the light reflection chamber. The reflective surface is configured to reflect the light toward the particle-light interaction chamber where the light can interact with particles in a fluid flowing in the fluid flow conduit. The first section has a second aperture through which light scattered in the particle-light interaction chamber as a result of interaction with one or more of the particles can pass for sensing by the detector. The fluid flow conduit includes a fluid inlet portion having an end coupled directly to the particle-light interaction chamber. |
| US11885725B2 |
Surface analysis tools for process control of laser treatment of composites
Aspects of the present disclosure are directed methods and systems pertaining to the use of at least one methodology or technique for the purpose of at least one of either: 1) determining that a desired and predetermined level or “degree” of surface treatment of a composite substrate surface has or has not been conducted (e.g., laser treatment of a composite substrate surface); and 2) that a composite substrate surface has been laser treated. |
| US11885719B2 |
Measurement data recording apparatus, generating apparatus, system, apparatus, method, and computer readable medium
Provided is a measurement data recording apparatus including: an acquisition portion configured to acquire time-series measurement data obtained by measuring a state of a target; a recording portion configured to record the acquired measurement data; a measurement data transmission portion configured to transmit the measurement data recorded in the recording portion to a generation apparatus configured to generate a determination model for determining a quality of the state of the target; a model reception portion configured to receive the determination model generated by the generation apparatus; and a determination portion configured to determine the quality of the state of the target from newly acquired measurement data using the received determination model. |
| US11885717B2 |
Method and apparatus for hermeticity test
An apparatus includes an enclosure designed to house electronics and a ventilation plug fastened to an exterior of the enclosure, the ventilation plug being adapted for field testing hermeticity. |
| US11885716B2 |
Test method of a semiconductor device and manufacturing method of a semiconductor device
A test method for a semiconductor device comprising a substrate wafer (1), in which an element is formed and a material through which an infrared ray can be transmitted, and a package having an airtight space (7) between a cap wafer (3), which is provided opposite to the substrate wafer (1); and which includes a water applying process in which the semiconductor device is exposed to a high moisture atmosphere and a leak discrimination process in which an infrared ray from the semiconductor device is detected and a leak of the package is discriminated based on absorption of the infrared ray by water molecules. |
| US11885715B2 |
Method for checking tyres configured for overturning tyres perpendicular to a tyre rotation axis
A method for checking tyres, includes: arranging a tyre in a station for checking tyres; moving a sensor within the tyre; performing first checks on an inner surface of the tyre with the at least one sensor; engaging a radially outer portion of the tyre with grip elements of an overturning device; extracting the sensor from the tyre and spacing the sensor from the tyre; overturning the tyre by 180° by rotation of the grip elements; moving again the sensor within the tyre; performing second checks on the inner surface of the tyre with the sensor; extracting again the sensor from the tyre and spacing the sensor from the tyre; and transporting the tyre outside the station for checking tyres. |
| US11885705B2 |
Fully differential capacitive pressure sensor including stacked sensor and reference capacitors
Pressure sensors include stacking of sensor capacitors on top of reference capacitors. A pressure cavity may be extended below a bottom electrode. The pressure sensors may include a mechanical link of a top membrane with the bottom electrode in order to form a dual membrane, or a mechanical link of the top membrane, the bottom electrode and an intermediate electrode within a cavity. A pressure sensor includes a first and second pressure sensing portions, each including a first and second rigid electrodes, and a deflectable membrane structure. The second rigid electrode is between the first rigid electrode and the deflectable membrane structure arranged in a vertical configuration. The first and second rigid electrodes of the first and second pressure sensing portions form respective reference capacitors, and the second rigid electrodes and the deflectable membrane structures form respective sensing capacitors. |
| US11885704B2 |
Flexible two-dimensional sheet array of electronic sensor devices
A flexible electronic sensor array apparatus comprising: a continuous flexible sheet having a length defining a first axis, a width defining a second axis and a thickness comprising a third axis; wherein the flexible sheet comprises multiple flexible sheet layers formed of one or more flexible materials stacked along the third axis; a plurality of electronic sensors disposed within the flexible sheet, each respective sensor comprising at least two conductive pattern layers, the two conductive pattern layers of the respective sensor spaced apart from one another along the third axis by one of the flexible sheet layers interposed between the conductive pattern layers; and wherein each respective sensor of the plurality of sensors is disposed at a different respective position along the first axis or the second axis of the flexible sheet from the remaining sensors, thereby forming an array of sensors spaced along the first and second axes. |
| US11885700B2 |
Stretchable strain sensor, combination sensor, and display panel and device
A stretchable strain sensor includes a light-emitting element, an optical structure, and a photo-detective element. The stretchable strain sensor is located in a path of light emitted from the light-emitting element. The optical structure is configured to have optical properties that change in response to stretching of at least a portion of the stretchable strain sensor. The photo-detective element is configured to detect light transmitted through the optical structure or reflected through the optical structure. |
| US11885696B2 |
Vibrating wire sensor and vibrating wire for a vibrating wire sensor
The invention relates to a vibrating wire sensor (20, 30, 40 and 50) having a vibrating wire (21, 31, 41 and 51), which is tensioned accordingly differently under measurement conditions of a current factor to be detected, and having an exciter arrangement for exciting the vibrating wire (21, 31, 41 and 51) in the range of the respective natural frequency thereof, wherein the exciter arrangement has at least one exciter layer (22, 32, 42 and 52) provided on a longitudinal portion of the vibrating wire (21, 31, 41 and 51), having a piezoelectric activation layer (33, 46 and 54), which has a different length depending on the activation state, and thus creates a correspondingly different vibration position of the vibrating wire (21, 31, 41 and 51). A vibrating wire sensor can thus be designed to be more robust, wherein the power consumption is additionally considerably less. The invention further relates to a vibrating wire having an exciter layer (22, 32, 42 and 52), which has a piezoelectric activation layer. |
| US11885694B2 |
Temperature sensor element
There is provided a temperature sensor element including a pair of electrodes and a temperature-sensitive film disposed in contact with the pair of electrodes, in which the temperature-sensitive film includes a matrix resin and a plurality of conductive domains contained in the matrix resin, the conductive domains include a conjugated polymer and a dopant, and the number of structural units constituting the conjugated polymer is 65 or less. |
| US11885690B2 |
High-precision non-contact temperature measurement device
A high-precision non-contact temperature measurement device includes: a thermal insulation box made of a thermal insulation material and having therein a receiving space; a dynamic constant-temperature feedback control module for controlling temperature of the receiving space; and a non-temperature-sensing thermal imager disposed in the receiving space. The device achieves system thermal insulation within a non-contact temperature measurement gauge, maintains the overall closed system dynamically at constant temperature, compensates for effects of internal chip self-heating effect and visual field background temperature variation, and finally calculates average temperature of surfaces of a target precisely with an imaging, non-contact temperature measurement gauge and a temperature calibration algorithm widely used in thermal-imaging non-contact temperature measurement. |
| US11885687B2 |
Vehicle elevated body temperature identification
A non-contact body temperature detection system of a vehicle includes: a thermography camera configured to generate an image of a user within a passenger cabin of the vehicle; a head detection module configured to determine a first area of the image including a head of the user; an eye detection module configured to determine a second area of the first area of the image including an eye of the user; a tear duct detection module configured to determine a third area of the second area of the image including a tear duct of the user; a temperature module configured to determine a body temperature of the user based on pixels of the third area of the image; and an indicator module configured to indicate whether the user has an elevated body temperature when the body temperature of the user is greater than a temperature threshold. |
| US11885684B2 |
Systems and methods for Raman spectroscopy
A method of performing Raman spectroscopy can include guiding a Raman pump beam with an optical fiber, where the Raman pump beam inducing fluorescence in the optical fiber. The beam and the fluorescence are coupled to a photonic integrated circuit (PIC) via the fiber. The beam is used to excite a sample in optical communication with the PIC via evanescent coupling and induces Raman scattering in the sample. The Raman scattering is collected via the PIC, and the Raman pump beam as well as the fluorescence is filtered out from the Raman scattering via the PIC. |
| US11885683B2 |
Method for estimating chlorophyll content of a leaf
A method of estimating chlorophyll content of a leaf including providing a device wherein the device includes a mobile computing device with a digital camera; and a peripheral removably attached to the mobile computing device, the peripheral including a light source aligned with the digital camera, wherein the peripheral provides for a space between the light source and the digital camera; capturing by the digital camera a first image of the light source turned on without the leaf interposed between the digital camera and the light source; retrieving exposure data of the first image; capturing by the digital camera a second image with the leaf interposed between the digital camera and the turned on light source; retrieving exposure data of the second image; and using a processor, estimating the chlorophyll content of the leaf based on the retrieved exposure data of the first and second images. |
| US11885681B2 |
Methods and devices for standoff differential Raman spectroscopy with increased eye safety and decreased risk of explosion
A compact, portable Raman spectrometer makes fast, sensitive standoff measurements at little to no risk of eye injury or igniting the materials being probed. This spectrometer uses differential Raman spectroscopy and ambient light measurements to measure point-and-shoot Raman signatures of dark or highly fluorescent materials at distances of 1 cm to 10 m or more. It scans the Raman pump beam(s) across the sample to reduce the risk of unduly heating or igniting the sample. Beam scanning also transforms the spectrometer into an instrument with a lower effective safety classification, reducing the risk of eye injury. The spectrometer's long standoff range automatic focusing make it easier to identify chemicals through clear and translucent obstacles, such as flow tubes, windows, and containers. And the spectrometer's components are light and small enough to be packaged in a handheld housing or housing suitable for a small robot to carry. |
| US11885679B2 |
Mobile devices for chemical analysis and related methods
The present disclosure relates to mobile devices for analyzing a chemical composition, and related methods of analyzing a chemical composition. A benefit of embodiments disclosed herein can include portable and economical devices providing for simple and rapid analysis of luminescent chemical sensor arrays. A benefit of methods disclosed herein can include the use of embodied devices to provide highly accurate qualitative and quantitative analyses of the components of a broad range of chemical compositions. A benefit of the methods disclosed herein can include the rapid, simple, and accurate analysis of trace chemicals present in chemical compositions. |
| US11885677B2 |
High-performance on-chip spectrometers and spectrum analyzers
We disclose an on-chip photonic spectroscopy system capable of dramatically improving the signal-to-noise ratio (SNR), dynamic range, and reconstruction quality of Fourier transform spectrometers. Secondly, we disclose a system of components that makes up a complete on-chip RF spectrum analyzer with low-cost and high-performance. |
| US11885670B2 |
Smart stadium applications using fiber optic sensing
Aspects of the present disclosure describe distributed fiber optic sensing (DFOS) systems, methods, and structures that advantageously are employed in smart stadium or other venue applications, such applications including: parking lot security and management; intrusion detection; social sensing; air quality monitoring and early fire detection—among others. |
| US11885663B2 |
Flowmeter calibration system and method
A calibration system and methods for flow metering technologies integrates a known primary reference standard (e.g., a gravimetric scale), configured to determine a mass of calibration fluid, in parallel with surrogate secondary masters (e.g., Coriolis effect flowmeters) connected via an adjustable flowpath having a closed loop mode, including a meter bank, a pump and a measuring section, and an open loop mode, including a reservoir, the meter bank, the pump, the measuring section and the primary reference standard, which enables calibration duality and redundant meter under test confirmation of calibration factors. The disclosed systems and methods enable life cycle assurance of the primary reference standard and the secondary masters' standard reliability and reproducibility over time and, as a redundant system, enable calibration of multiple flow metering technologies, such as, for example, volumetric, mass, density, viscosity and Reynolds number-reliant technologies, in one homogenous system. |
| US11885659B2 |
Method for compensating the influence of the Reynolds number on the measurement of a Coriolis mass flow meter, and corresponding device
A method for compensating the influence of at least one of the parameters from the group consisting of flow rate, viscosity, density and Reynolds number of a fluid to be measured on the measured flow rate and/or density of this fluid in a Coriolis mass flow meter with the aid of an equation using the parameters of the current Reynolds number of the fluid to be measured in the Coriolis mass flow meter, the maximum compensation value for Reynolds numbers approaching zero, the Reynolds number at which the curve of the compensation value has the largest slope, and the slope of the curve of the compensation value at the point Rec. Moreover, the invention relates to a Coriolis mass flow meter with a control device for carrying out the method. |
| US11885658B2 |
Converting a directly measured mass flow rate to account for buoyancy
A method of converting a directly measured mass flow rate to account for buoyancy is provided. The method includes directly measuring a mass flow rate of a material, measuring a density of the material, and using the measured density of the material to convert the directly measured mass flow rate into a mass value including a buoyancy of a fluid. |
| US11885656B2 |
Flow-rate measuring apparatus capable of accurately measuring flow rate of fluid with reflecting viscosity of fluid
A flow-rate measuring apparatus transmits a first measurement signal having at least one first frequency by a first transducer, and receives the first measurement signal by a second transducer through a fluid inside a pipe. The flow-rate measuring apparatus determines a second frequency based on the first measurement signal. The flow-rate measuring apparatus transmits a second measurement signal having the second frequency by a third transducer toward an interface between the pipe and the fluid, and receives the second measurement signal reflected at the interface by a fourth transducer. The flow-rate measuring apparatus calculates a flow rate of the fluid inside the pipe so as to reflect a viscosity of the fluid based on the first and second measurement signals. |
| US11885654B2 |
Ultrasonic flowmeter, use of an ultrasonic flowmeter in a shut-off device and shut-off device
An ultrasonic flowmeter includes a measuring tube, a first transducer pair including first and second ultrasonic transducers, and a second transducer pair including third and fourth ultrasonic transducers. Each ultrasonic transducer is an ultrasonic transmitter and/or an ultrasonic receiver. The first transducer pair is on the measuring tube offset such that the respective transmitter transmits an ultrasonic signal in or against the direction of flow, and the receiver receives the ultrasonic signal. A course of the ultrasonic signal between the first and second ultrasonic transducers defines a first signal path. The second transducer pair is on the measuring tube offset such that the respective transmitter transmits an ultrasonic signal in or against the direction of flow. The receiver receives the ultrasonic signal transmitted by the transmitter. A course of the ultrasonic signal between the third and fourth ultrasonic transducers defines a second signal path. |
| US11885643B2 |
Level with metal frame supporting protective outer body
A tool, such as a level, including one or more polymer/plastic body segment, protective cover and/or seal is provided. The covers discussed herein may limit or prevent dirt or construction materials, such as concrete, from entering into the level body. The cover may also be a non-stick material, such as a polymer outer sleeve, that limits the ability of dirt and construction material to adhere to the level. The level may also include scratch resistant vial windows. |
| US11885640B2 |
Map generation device and map generation method
A map generation device according to one embodiment includes a reception unit that receives probe data transmitted from at least one vehicle and indicating a feature detected in vehicle surroundings by an environment monitoring sensor incorporated in the vehicle, and the device creates or updates map data based on the probe data received by the reception unit. The map generation device includes: a characteristic determination unit that determines whether the probe data includes sufficient characteristic information usable for alignment with other probe data or map data; and a combining unit that joins a target probe data set including an insufficient amount of characteristic information to the probe data previous or subsequent to the target probe data set in consecutive probe data sets acquired from the same travel of the same vehicle. |
| US11885636B2 |
Method, apparatus, and system for automatically coding and verifying human settlement cartographic features
An approach is provided for automatically coding cartographic feature(s), e.g., human settlement(s). The approach involves receiving data point(s) associated with point location(s) and indicative of a cartographic feature. The approach also involves retrieving or generating a cartographic feature polygon corresponding to the cartographic feature based on the data point(s). The approach further involves generating a plurality of polygon data points that replicate the cartographic feature polygon, and/or a spider web model that represents the point location(s). The approach further involves retrieving imagery data depicting the cartographic feature based on the plurality of polygon data points and/or the spider web model. The approach further involves merging the data point(s), the plurality of polygon data points, and/or the imagery data to generate new or updated polygon structure data point(s) to represent the cartographic feature. The approach further involves storing the new or updated polygon structure data point(s) in a map database. |
| US11885635B2 |
Displaying charging options for an electric vehicle
Examples are provided for identifying charging options for charging an electric vehicle. In one method, the charging options may be identified by receiving a charging station query including one or more parameters, accessing a charging station database, the charging station database storing connector codes identifying a connector type and a connector power level for charging connectors provided at a plurality of charging stations, and comparing parameters of the charging station query to the connector codes of the charging station database to identify a first subset of the plurality of charging stations that fit the parameters of the charging station query. The method may also include transmitting mapping data for the first subset of the plurality of charging stations to a client device. |
| US11885633B1 |
Intelligently restricting transportation changes based on transportation signals in a transportation matching system
The present disclosure relates to systems, non-transitory computer-readable media, and methods for intelligently restricting transportation changes based on signals in a dynamic transportation matching system. For example, the disclosed systems can analyze signals associated with transportation of a requestor by a vehicle of a provider to determine whether a transportation-change request is indicated. In response to determining that a transportation-change request is indicated, the disclosed systems can prevent a transportation change to a destination, route, or waypoint and generate a restriction notification. The disclosed system can also provide the restriction notification to at least a provider client device in response to determining that it is safe to do so. |
| US11885631B2 |
Navigation and routing based on sensor data
A computing system can receive sensor data from one or more computing devices co-located with a vehicle, where the sensor data indicates a seating arrangement of one or more current passengers of the vehicle. The system can receive location data from the one or more computing devices co-located with the vehicle, and using the sensor data and the location data, the system determines a first route for the vehicle to travel to a start location of a requesting user such that a curbside seat of the vehicle is available for the requesting user. The system then transmits navigation instructions to the one or more computing devices co-located with the vehicle to provide routing directions corresponding to the first route. |
| US11885630B2 |
System and method for simulation of outcomes for use in navigating procedures for resource acquisition
Embodiments of the present invention provide a system for simulating outcomes for use in navigating procedures for resource acquisition. The system is configured for identifying initiation of at least one event by a user via an entity application, wherein the at least one event is associated with acquisition of a first resource, in response to identifying initiation of the at least one event, extracting user data associated with the user, identifying one or more procedures associated with the acquisition of the first resource, compiling the user data and the one or more procedures to generate one or more navigational recommendations associated with the acquisition of the first resource, transmitting the one or more navigational recommendations to a user device of the user, and transmitting a set of control signals to display the one or more navigational recommendations on a graphical user interface of the user device, via the entity application. |
| US11885628B2 |
Route coordination and navigation based on user proximity to points of interest
A system receives sensor data from computing devices of passengers riding in an autonomous vehicle (AV). Based on the sensor data, the system can determine a position of each of the passengers within the AV. The system determines a next passenger to be picked up by the AV. Based at least in part on the position of each of the passengers within the AV, the system can (i) select a pickup location for the next passenger, and (ii) determine a route for the AV based on the pickup location such that an open seat within the AV is adjacent to the next passenger when the AV arrives at the pickup location for the next passenger. The system can transmit data corresponding to the route to enable the AV to update a current route in order to facilitate a rendezvous with the passenger at the pickup location. |
| US11885626B2 |
Systems and methods for updating pickup and dropoff locations for a vehicle
An example method includes setting an initial pickup location. The method includes causing an autonomous vehicle to navigate towards the initial pickup location. The method includes periodically generating a plurality of candidate updated pickup locations. The method includes selecting a suggested pickup location from the plurality of candidate pickup locations that achieves a benchmark for reducing one or more of a time and a distance associated with the initial pickup location for one or more of the autonomous vehicle and the client device. The method includes determining that the suggested pickup location satisfies a set of pre-update checks for limiting a number of pickup location updates. The method includes responsive to (i) selecting the suggested pickup location, and (ii) determining that the suggested pickup location satisfies the set of pre-update checks, causing the autonomous vehicle to navigate to the suggested pickup location. |
| US11885623B1 |
System and method for mapping a position on a non-linear navigational chart
A system and method for mapping a mobile device position on segments that lie between waypoints on a non-linear map by converting real world geographic coordinates of a mobile device to image X, Y coordinates using an image X, Y length or scale of a respective segment as a basis for the conversion. The mobile device position may be mapped in real time and presented to a user via a mobile device. The coordinate may be mapped in real-time to a specific X, Y location on the map and may be presented to a user on a screen, stored in a database, or used in any appropriate way. |
| US11885622B2 |
Interferometer with a looped or straight optical fiber
A fiber-optic interferometer is designed to receive and propagate a first single-mode wave along a first optical path and, respectively, a second single-mode wave along a second optical path, the second optical path being the reverse of the first optical path, and to form a first output wave and, respectively, a second output wave, having a modulated phase difference Δϕm(t). According to the invention, the modulated phase difference Δϕm(t) is equal to sum of a first periodic phase difference Δϕπ(t) having a level equal to ±π, a second periodic phase difference Δϕalpha(t) having a level equal to ±alpha and a third periodic phase difference Δϕbeta(t) having a variable level between −beta and +beta, said modulated phase difference Δϕm(t) comprising per modulation period T at least eight modulation levels among twelve modulation levels and said modulated phase difference between such that: Δϕm(t+T/2)=−Δϕm(t). |
| US11885621B2 |
Sensor device
A sensor device includes a sensor element, a substrate, and a bonding wire. Over the substrate, provided is the sensor element. The bonding wire forms at least part of a connection path that electrically connects the sensor element and the substrate together. The bonding wire is provided to connect two connection surfaces that intersect with each other. |
| US11885620B2 |
Inertia detection device
An inertia detection device includes one set of gyro sensors for detecting an angular velocity of a detection target object along a same direction, the gyro sensors arranged in a same physical quantity range, in which sensor movement is detectable as a same physical quantity. When an abnormality affecting an output signal of one of the gyro sensors is caused, based on an observation that a difference of magnitudes of the output signals from normal and abnormal gyro sensors is different from a difference of magnitudes of the output signals from two normal gyro sensors, such an abnormality of one of the gyro sensors is determinable by a comparison between the output signals, without using an estimated value thereof. |
| US11885616B2 |
Apparatus, methods, and computer programs for obtaining an image of a sample
An apparatus comprising means for: causing illumination of different areas of a sample with an optical frequency imaging beam at different positions at different times, wherein adjacent positions are configured to cause the corresponding areas to at least partially overlap; receiving signals indicative of back-scattering of the optical frequency imaging beam from the sample at the different times; and processing the received signals to obtain an image of the sample, wherein processing the received signals compensates for phase variations between the different positions at the different times using a matched filter derived from a scattering model of the sample. |
| US11885615B2 |
Method for thickness measurements of a work item in a rolling mill
A method for determining a present thickness of a work item while being processed in a rolling mill, the method including: acquiring a data signal reflecting a time dependence of an eddy current decay in the work item caused by an applied pulsed magnetic field, determining a thickness parameter value based on the acquired signal, the thickness parameter value being determined from samples in the data signal, the thickness parameter value being dependent on a ratio between a thickness of the work item and a resistivity of the work item, computing a ratio between a reference thickness value of the work item and the thickness parameter value to thereby provide an instantaneous resistivity value, determining a mean resistivity value based on the instantaneous resistivity value, and providing an output signal based on the mean resistivity of the work item and the thickness parameter value, the output signal being indicative of the determined present thickness of the work item. |
| US11885613B2 |
Depth data measuring head, measurement device and measuring method
A depth data measuring head (300), a measurement device (1400) and a measurement method. The measuring head (300) comprises: a projection device (310, 1410) used to project and scan line coded structured light across a region to be photographed; first and second image sensors (310_1, 310_2, 1410_1, 1410_2) disposed at preset relative positions and used to photograph said region so as to respectively obtain first and second two-dimensional image frames under irradiation of the structured light; and a synchronization device (330, 1430) used to synchronously activate, on the basis of a scan position of the projection device, pixel columns of the first and second image sensors (310_1, 310_2, 1410_1, 1410_2) in a line direction corresponding to the current scan position to perform imaging. |
| US11885610B2 |
Method and system for measuring coating thickness
A method for determining the thickness of a plurality of coating layers. The method comprises the steps of performing a calibration analysis on calibration data to determine initial values and search limits of optical parameters of the plurality of coating layers, irradiating the plurality of layers with a pulse of THz radiation in the range from 0.01 THz to 10 THz, detecting the reflected radiation to produce a sample response derived from the reflected radiation, producing a synthesized waveform using the optical parameters and predetermined initial thicknesses of the layers, varying the thicknesses and the optical parameters within the search limits to minimize the error measured between the sample response and the synthesized waveform, and outputting the thicknesses of the layers. |
| US11885609B2 |
Wafer thickness, topography, and layer thickness metrology system
The invention describes a metrology system allowing for the reduction of the errors caused by vibration of the production floor and allowing for measurements of the thickness of wafers in motion. This is accomplished by performing simultaneous measurements of spectra containing interference signals containing distance information using a plurality of probes positioned on both sides of the measured wafer on the same detector at the same time or by means of plurality of synchronized detectors. System is also able to measure thickness of the individual optically accessible layers present in the sample. |
| US11885604B1 |
Firearm cartridge
A firearms cartridge is provided which is equipped with a signal receiver. The signal receiver is operable to disable the firearm when it received a predetermined signal, such as a signal on the electromagnetic spectrum, acoustic signal, and the like. When the signal is not present, the firearm cartridge works like a traditional unrestricted firearm cartridge allowing a firing of the weapon. |
| US11885599B2 |
Shooting target thrower
A shooting target thrower for throwing a shooting target includes a throwing arm rotatable about a throwing axis to throw the shooting target. A throwing spring is operatively coupled to the throwing arm and rotates the throwing arm to throw the shooting target. A drive train is operatively coupled to the throwing arm and includes a charge pedal and a fire pedal. The charge pedal rotates the throwing arm toward a cocked position. The fire pedal releases the throwing arm to rotate, under a force of the throwing spring, from the cocked position to throw the shooting target. |
| US11885598B2 |
Shooting target
A modular target having a support pole and a head. The head is preferably removable. The head is configured for removable attachment of a target. The head has a rail onto which a sleeve of a target is attached. The rail is preferably cylindrical. The target is configured with a sleeve that slides over the rail. Preferably a shooting face extends from the sleeve. Further, the shooting face is configured such that a moment arm allows the shooting face to hang at a 5-20 degree angle from vertical, with the preferred angle being 10 degrees. In a preferred embodiment the modular target utilizes a removably head configured with a neck that attaches to a vertical support pole. The vertical support pole preferably has a slide hammer attached that allows for easier placement of the target in the ground. Preferably the support pole has a fin that serves to resist rotation of the support pole when the target is hit by a projectile fired by a firearm. |
| US11885596B2 |
Hybrid-layered cell and bulletproof structure having the same
A hybrid-layered cell for a bulletproof structure includes a viscous absorber layer, a first elastic metal layer, a viscous-elastic foundation layer and a second elastic metal layer, orderly arranged in a lamination manner. The viscous absorber layer contains a semi-liquid viscous material. The first elastic metal layer, laminated fixedly to the viscous absorber layer, has a first predetermined toughness. The viscous-elastic foundation layer, laminated fixedly to the first elastic metal layer by opposing the viscous absorber layer, has predetermined elasticity and compressibility. The second elastic metal layer, laminated fixedly to the viscous-elastic foundation layer by opposing the first elastic metal layer, has a second predetermined toughness. In addition, the first predetermined toughness is higher than the second predetermined toughness. |
| US11885593B2 |
Mounting rail for firearm
A mounting rail for a firearm is described, wherein the rail includes at least one catch arranged on a flat upper surface of the rail. The at least one catch serves as a means of fixation for at least one accessory. The rail also includes a housing that extends longitudinally, and the housing is suited to receive a printed circuit board allowing for an electrical connection with the accessory. The housing is partially defined by at least one recess, each recess being arranged between two opposite flanks of the corresponding catch. A top of the corresponding catch extends transversely on either side of a median plane of the rail above the housing. |
| US11885587B2 |
Reset mechanism for a bow
A bow may have a string latch that holds a bowstring and that can be moved into three distinct positions. One activator may be used to prevent the string latch from being moved into its second position. A second activator may be used to prevent the string latch from being moved into its third position. A third activator may be used to move the first and second activators to prevent the string latch from being moved into its second or third positions. |
| US11885580B2 |
Weapon with cartridge-case ejection
Firearms with cartridge-case ejection, including a barrel with a movable bolt carrier with a bolt, with a breech face, with a movable ejector and with a firearm-fixed functional edge which pushes the ejector into its ejection position when the bolt carrier moves back after a shot has been fired. In order to create an ejection that is always evenly performed, an ejector lever is arranged on the bolt carrier so that it can be rotated about a pivot axis running normal to the firearm's central plane, which abuts against the functional edge when the bolt carrier moves backwards and thereby twisted so that it abuts an impact surface of the ejector and forces it to the eject position. |
| US11885579B2 |
Additively manufactured heat transfer device
An additively manufactured heat transfer device is disclosed, including an enclosure portion with outer walls. The outer walls contain an inner channel configured to direct a flow of coolant fluid. The heat transfer device further includes a fluid intake port and a fluid outtake port, each connected to the first inner channel. The fluid intake port is configured to direct a flow of coolant fluid through an outer wall of the enclosure portion into the inner channel, and the fluid outtake port is configured to direct a flow of coolant fluid through an outer wall of the enclosure portion out of the inner channel. The inner channel is defined by internal walls, and the enclosure portion and the internal walls form a single additively manufactured unit. |
| US11885577B2 |
Heat exchanger array system and method for an air thermal conditioner
An air thermal conditioning system, for at least one of heating air and cooling air, which includes a cross-flow heat exchanger array. The cross-flow heat exchanger array includes a plurality of planar membrane heat exchangers disposed in parallel with a space separating adjacent planar membrane heat exchangers. Each of the planar membrane heat exchangers include a first sheet; a second sheet coupled to the first sheet; and at least one fluid chamber defined by the first and second sheets, with the at least one fluid chamber extending between first and second ends of the planar membrane heat exchangers and opening to a first and second port at the first and second ends respectively. |
| US11885576B2 |
Structures for radiative cooling
Various aspects as described herein are directed to a radiative cooling device and method for cooling an object. As consistent with one or more embodiments, a radiative cooling device includes a solar spectrum reflecting structure configured and arranged to suppress light modes, and a thermally-emissive structure configured and arranged to facilitate thermally-generated electromagnetic emissions from the object and in mid-infrared (IR) wavelengths. |
| US11885573B2 |
Aircraft heat exchanger panel attachment
A heat exchanger for providing thermal energy transfer between a first flow along a first flowpath and a second flow along a second flowpath has at least one plate bank having a plurality of plates, each plate having: a first face and a second face opposite the first face; a leading edge along the second flowpath and a trailing edge along the second flowpath; a proximal edge having at least one inlet port along the first flowpath and at least one outlet port along the first flowpath; and at least one passageway along the first flowpath. An inlet manifold has a first face to which the plurality of plates are mounted along their respective proximal edges. An inlet plenum has at least one inlet port and at least one outlet port. An outlet plenum has at least one outlet port and at least one inlet port. The first flowpath passes from the at least one inlet port of the inlet plenum, through the at least one passageway of each of the plurality of plates, and through the at least one outlet port of the outlet plenum. For each plate, the manifold first face has a respective associated slot capturing a portion of the plate along the proximal edge thereof to prevent extraction of the plate normal to the manifold first face. |
| US11885571B2 |
Pulsating vapor chamber
A pulsating vapor chamber has an inner board, a first outer board, a second outer board, an asymmetric loop, and a working fluid. The inner board has a first surface and a second surface. The first and second outer boards are mounted on the first surface and the second surface of the inner board respectively. The asymmetric loop is located between the first and second outer boards and has multiple channels communicating with each other in sequence. A part of the channels are formed between the first outer board and the inner board, and the remaining channels are formed between the second outer board and the inner board. With the asymmetric loop, even if the vapor chamber is disposed horizontally, pressure may be changed by different amount in the channels so that the working fluid is still able to oscillate or circulate. |
| US11885570B2 |
Cooling system
An apparatus includes first and second microchannel heat exchangers and first and second pipes. The first heat exchanger includes a first inlet, a second inlet, a first tube, a second tube, a first outlet, and a second outlet. Refrigerant at the first inlet is directed through the first tube to the first outlet and the first pipe. Refrigerant at the second inlet is directed through the second tube to the second outlet and the second pipe. The second heat exchanger includes a third inlet, a fourth inlet, a third tube, a fourth tube, a third outlet, and a fourth outlet. The third inlet directs refrigerant from the first pipe through the third tube towards the third outlet. The fourth inlet directs the refrigerant from the second pipe through the fourth tube towards the fourth outlet. The first pipe overlaps the second pipe between the two heat exchangers. |
| US11885569B2 |
Heat exchanger
A heat exchanger including a first header tank and a second header tank that are disposed to be spaced apart a predetermined distance in a height direction and a core part that is disposed between the first header tank and the second header tank and includes a plurality of tubes and fins, the first header tank including a first header plate, a first tank, and a first partition wall that divides a space formed by a combination of the first header plate and the first tank to form a plurality of flow paths, a manifold including an inflow passage and an outflow passage being connected to an outer side of the first header tank, and the inflow passage and the outflow passage having different sizes to each other, the outflow passage having a larger cross-sectional area than that of the inflow passage. |
| US11885568B2 |
Systems and methods for periodic nodal surface based reactors, distributors, contactors and heat exchangers
The present disclosure relates to a transport mechanism apparatus for transporting at least one of a gas or a fluid. The transport mechanism may have an inlet, an outlet and an engineered cellular structure forming a periodic nodal surface, which may include a triply periodic minimal surface (TPMS) structure. The structure is formed in a layer-by-layer three dimensional (3D) printing operation to include cells propagating in three dimensions, where the cells include non-intersecting, continuously curving wall portions having openings, and where the opening in the cells form a plurality of flow paths throughout the transport mechanism from the inlet to the outlet, and where portions of the cells form the inlet and the outlet. |
| US11885567B2 |
Method of recording images within a furnace using a thermal imaging camera comprising a borescope
A method of recording images within a furnace using a thermal imaging camera comprising a bore scope connected to a digital camera unit is described, comprising the steps of: (a) inserting the borescope into the interior of the furnace, (b) collecting one of more images of the interior of the furnace using the thermal imaging camera with the borescope at a first position, and (c) moving the borescope from the first position to a second position and collecting one or more images of the interior of the furnace as the borescope is moved from the first position to the second position, wherein the borescope movement is guided by means of a guide device comprising a movable borescope mounting, mounted externally on the furnace. |
| US11885564B2 |
Apparatus and method for developing freeze drying protocols using small batches of product
A method and apparatus for eliminating or minimizing the non-uniformity of edge vials compared to center vials during freezing or primary drying of product therein in a freeze dryer. A temperature controlled surface is positioned in close proximity to or in contact with the edge vials to control the temperature thereof. The method and apparatus may be used to simulate in a development freeze dryer the conditions of the center and edge vials in a larger batch target freeze dryer. |
| US11885559B2 |
Refrigerator
A refrigerator may include a storage compartment, an inner door which comprises an opening having a size corresponding to a size of the storage compartment, a plurality of door guards, and an outer door which open and close the storage compartment, wherein the inner door comprises a control unit may control an internal environment of the storage compartment. |
| US11885558B2 |
Sealing assembly for refrigerator
A refrigerator including a body, a door, configured to pivot about the body, a female sealing member, and a male sealing member. The body is provided with a first refrigerated compartment. The door may be configured to pivot between an open position, in which the refrigerated compartment is open, and closed position, in which the refrigerated compartment is closed. The female sealing member extends along portions of the body or portions of the door. The male sealing member extends along the other of the portions of the body or the door. When the door is in the closed position, the female sealing member receives the male sealing member. |
| US11885552B2 |
Method for creating ice structures
A method for building an ice structure includes making a plurality of ice logs or ice beams and attaching the ice logs together to form a support structure. The support structure may be two or more stories high and may be constructed by freezing the ice logs or ice beams together. |
| US11885551B2 |
Defroster for a direct cool icemaker
An icemaker assembly includes a mold body defining a plurality of cavities. A working fluid line is directly attached to the mold body, and a drain duct is disposed below the mold body. A defrost heating element is positioned below the mold body and within the drain duct. The defrost heating element is spaced from the mold body, and the defrost heating element is operable to melt frost on the mold body with radiant heat from the defrost heating element. A related appliance is also provided. |
| US11885547B2 |
Refrigerator having a cold air supply means and control method therefore
A control method for a refrigerator includes sensing a temperature of a storage room; operating a cool air supply at a cooling power when the sensed temperature of the storage room is equal to or above a first reference temperature; operating the cool air supply at a delay power, which is less than the cooling power, when the sensed temperature of the storage room is equal to or below a second reference temperature, which is less than the first reference temperature while the cool air supply is operating at the cooling power; and adjusting the cooling power or the delay power of the cool air supply according to the temperature of the storage room while the cool air supply is operating at the delay power, and operating the cool air supply at the determined adjusted cooling power or delay power. |
| US11885546B1 |
Control process for climate control system based on outdoor humidity conditions
Examples of the present disclosure relate to climate control systems and outdoor units that use humidity measurements associated with the outdoor environment to improve the operation of one or more components. In some examples, an outdoor unit of a climate control system includes a housing, a compressor located within the housing that circulate a refrigerant fluid, and a humidity sensor that detects a humidity condition of an outdoor environment. The outdoor unit may further include control circuitry that controls the compressor by establishing a target parameter, where the target parameter is associated with a property of a refrigerant fluid. The control circuitry may further receive measurements associated with the humidity condition of the outdoor environment, adjust the target parameter based on the measurement, monitor the property of the refrigerant fluid, compare the monitored property to the adjusted target parameter, and adjust operation of the compressor based on the comparison. |
| US11885544B2 |
Adjustable cooling system
A refrigeration system comprises a variable speed compressor and a first evaporator. A second evaporator is operably coupled in series with the first evaporator. A first valve is coupled to the variable speed compressor and the first evaporator. A second valve is fluidly coupled to the second evaporator, and a pressure regulator is coupled to the second valve. |
| US11885534B2 |
Cooling device and vehicle including the same
Disclosed are a cooling device and a vehicle including the same. The cooling device according to one aspect of the present disclosure includes a housing part having a first hole formed at one side thereof and a second hole formed at the other side thereof, a heat exchange part accommodated in an internal space of the housing part and having one side communicating with the first hole and the other side communicating with the second hole, a thermoelectric element part provided above the heat exchange part, and a radiational cooling part provided above the thermoelectric element part and at least partially exposed to the outside. |
| US11885531B2 |
Fluid heating system with combustion trim learning
A fluid heating system including a burner unit is operated based on feedback control loops. The fluid heating system comprises a burner unit configured to heat a fluid, a sensor configured to sense a characteristic of the appliance, and a controller coupled to the burner unit and the sensor. The controller includes an electronic processor and a memory. The controller is configured to receive a first signal corresponding to the characteristic from the sensor, determine, based on the first signal, a first feedback loop control, control combustion of the burner unit based on the first feedback loop control, determine, based on the first feedback loop control, a second feedback loop control, and control combustion of the burner unit based on the second feedback loop control. |
| US11885527B2 |
Air purification device
The present invention relates to an air purification device. The housing includes a main passage section through which air is introduced from a room through a main inlet port and is discharged to an outside through a main outlet port, and a bypass passage section partitioned from the main passage section, through which air is introduced from the room through a bypass inlet port and is discharged to an outside through a bypass outlet port. The main inlet port damper opens and closes the main inlet port. The main outlet port damper opens and closes the main outlet port. The bypass damper opens and closes the bypass passage section. The controller is configured to control the bypass damper so as to open the bypass passage section when the main passage section is closed due to a malfunction of the main inlet port damper or the main outlet port damper. |
| US11885526B2 |
High-performance housings for backward-curved blowers
In an embodiment, a blower for a heating, ventilation, and air conditioning system includes a blower wheel and a housing. The blower wheel includes backward-curved blades configured to rotate in a rotational plane. The housing forms an at least hexagonal cross- section around at least a portion of the rotational plane, where the blower wheel is positioned within the housing such that there exists a first distance and a second distance. The first distance is measured radially outward from a center of the blower wheel to a first side of the at least hexagonal cross-section. The second distance is measured radially outward from the center of the blower wheel to a second side of the at least hexagonal cross-section. The second distance forms a an acute angle with the first distance. The first distance and the second distance are unequal and less than a diameter of the blower wheel. |
| US11885523B2 |
Airflow appliance for mitigating spread of infectious disease
An airflow appliance for mitigating spread of infectious disease. The appliance may include an elongated body configured for being disposed across the top surface of a table, first and second side surfaces of the body respectively facing first and second sides of the table; at least one air intake disposed along at least one of top or side surfaces of the body; at least one air exhaust disposed along at least one of bottom or end surfaces of the body; at least one fan disposed in the body, the at least one fan drawing air from the at least one air intake and expelling air from the at least one air exhaust; wherein the at least one air intake is configured to draw air from at least one of the first and second sides of the table; and wherein the at least one air exhaust is configured to blow air away from at least one of the first and second sides of the table. |
| US11885520B2 |
Machine learning apparatus for determining operation condition of precooling operation or preheating operation of air conditioner
A machine learning apparatus determines an operation condition of a precooling operation or preheating operation of an air conditioner. The machine learning apparatus includes an acquisition unit and a learning unit. The acquisition unit acquires, as state variables, room temperature data at a time of the precooling operation or preheating operation, set temperature data, and outside air temperature data. The learning unit learns the operation condition of the precooling operation or preheating operation based on the state variables, a room temperature after start of the precooling operation or preheating operation, and a set temperature. |
| US11885519B2 |
Dynamic retrofit control of ductless mini-split systems
A retrofit control of a ductless mini-split system (DMSS) for use in relation to temperature monitoring within a property. Data indicating a command is transmitted to a controller associated with a ductless mini-split system. The command causes the controller to configure an operation to be performed by the ductless mini-split system. Power output associated with the ductless mini-split system is monitored based on transmitting the data indicating the command. A determination that the operation has been performed by the ductless mini-split system is made based on monitoring the power output. Data indicating that the operation has been performed by the ductless mini-split system is provided for output. |
| US11885515B2 |
Air conditioning system to calculate indoor air quality index to control air ventilation
An air conditioning system includes: a sensor; an obtainer that obtains information indicating air quality in an indoor space, which is output by the sensor; and a controller that calculates an air quality index based on the information obtained, and controls a ventilator, based on the air quality index calculated. The air quality index is expressed by f(Xn)×g(T, H), where f(Xn) denotes a function with respect to Xn that indicates at least one of a CO2 concentration, a concentration of total volatile organic compounds (TVOC), a concentration of particulate matter (PM), an NOX concentration, an SOX concentration, an O3 concentration, a mold count, or a dust count, and g(T, H) denotes a function with respect to T denoting temperature and H denoting humidity in the indoor space. |
| US11885512B2 |
Heat exchanger and refrigeration cycle device
A heat exchanger has first and second heat exchange units disposed one above the other. In a case where the heat exchanger functions as a condenser, refrigerant flows through the second heat exchange unit after having flowed through the first heat exchange unit. An intermediate header unit through which the first heat exchange unit and the second heat exchange unit communicate with each other causes at least a portion of refrigerant having flowed through a first heat transfer pipe group on the windward side of the first heat exchange unit to flow to a fourth heat transfer pipe group. Further, the intermediate header unit causes at least a portion of refrigerant having flowed through a second heat transfer pipe group on the leeward side of the first heat exchange unit to flow into a third heat transfer pipe group or the fourth heat transfer pipe group. |
| US11885511B2 |
Modular bulkhead system
A structural support system for a fan array system. The system allows for a modular bulkhead wall to be customized and installed within a cabinet of an air handling unit. The modular bulkhead wall comprises one or more intermediate bulkhead stiffening elements that enable the modular bulkhead wall to support the fan array system. |
| US11885506B2 |
Air convection smart diffusion system
A cooking appliance may include an oven cavity having a cavity top, a cavity back, and cavity side walls, an interior side wall extending parallel to each of the cavity side walls defining a passage therebetween, and a plurality of side rails extending along the interior side walls, the rails being rotatable between a rest position in which no oven rack is installed and airflow is blocked, and an active position in which the oven rack is installed and airflow is provided. |
| US11885505B2 |
Filter device and fume extraction device comprising filter device
A filter device for a fume extraction device includes at least two filter elements arranged at an angle relative to one another, and a holding frame for holding the at least two filter elements. An edge of one of the at least two filter elements lies adjacent to an edge of the other one of the at least two filter element. Each of the at least two filter elements has a surface with a variable distance between opposite outer faces of the filter element. |
| US11885503B2 |
Pre-fabricated grease duct system
The present double walled grease duct includes a tubular outer shell surrounding a tubular inner liner, wherein a spacer is positioned perpendicular to the walls of the outer shell and the inner liner. The spacer can include a plurality of vertical metal strips extend from a top edge of the spacer to the bottom edge of the spacer, wherein the top edge of the spacer contacts the walls of the outer shell and wherein the bottom edge of the spacer contacts the walls of the inner liner. The metal strips resist the different rates of thermal expansion between the outer shell and inner liner ultimately preventing the collapse of the inner liner under pressure from thermal expansion. |
| US11885502B2 |
Door for a cooking device comprising a separate frame with a recessed grip, and cooking device comprising a door
A door for a cooking appliance includes a front pane, a further pane arranged in spaced-apart relation to the front pane, a recessed grip embodied in an upper region of the door and configured for gripping from above, and a separate functional frame arranged in an intermediate space between the front pane and the further pane when viewed in a depth direction of the door. The functional frame includes an upper frame part having a delimiting web which protrudes upward on the upper frame part such that the recessed grip is embodied in the upper frame part. |
| US11885498B2 |
Turbine engine with fuel system including a catalytic reformer
A gas turbine engine with a compressor section, a turbine section, and a combustion section located downstream from the compressor section and upstream from the turbine section, the combustion section including a dome inlet, a combustor outlet fluidly coupled to the turbine section, a liner and a dome assembly together at least partially defining a combustion chamber extending between the dome inlet and the combustor outlet, a fuel system fluidly coupled to the combustion section, the fuel system comprising a fuel supply, a primary fuel line fluidly coupling the fuel supply to the combustion section, and a reformer fluidly coupled to the fuel supply. |
| US11885494B2 |
Smart fuel burning system and method of operating same
A system configured to generate heat when supplied with a first fuel or a second fuel can include a fuel supply line operatively connected to a fuel source. A valve assembly can be operatively connected to the fuel supply line. A main burner can be operatively connected to the valve assembly. A thermoelectric generating system can be configured to transform heat to electricity. A first pilot burner can include at least one of a first thermocouple and a first Fe-ion sensor. A second pilot burner can include at least one of a second thermocouple and a second Fe-ion sensor. A printed circuit board (PCB) can be operatively connected to the valve assembly and the first and second pilot burners. The PCB can be configured to control operation of the valve assembly based on information received from at least one of the first and second pilot burners. |
| US11885481B2 |
LED lighting device
The present invention provides an LED illumination device, including: a light source carrier including a base, an accommodating space formed on the base; a light emitting unit including a light emitter and a lamp board fixed to the light source carrier; and an optical member covering or at least partially covering the light emitting unit. The light emitting unit and the optical member are both disposed in the accommodating space. The optical member includes a first light distribution unit and a second light distribution unit. At least 70% of a luminous flux generated by the light emitter in operation is directly emitted from the LED illumination device through the second light distribution unit. |
| US11885480B1 |
Mounting plate for recessed lighting
A mounting plate mounting plate for a recessed light fixture comprising a body which is flat and which extends in a plane, the body being pierced with an opening which is substantially circular; a portion of material forming a central target at a center of the opening; and at least one branch which bridges the central target to the body. The central target is to be illuminated by a laser light for proper placement (alignment). The at least one branch can be bent upwardly and away from the center of the opening to retain an electrical wire of a transformer on the mounting plate, immediately aside a dedicated opening for easy retrieval, making the installation faster and avoiding spilling mineral wool from the roof by manual searching of such an electrical wire. |
| US11885477B2 |
Multi-colored retrofit light fixture
Provided is a light fixture retrofit kit comprising: a) a body with a first LED light source of a first color and a second LED light source of a second color; b) a switch for controlling one or more of wattage of the light sources and the color; c) a bracket for attaching the body to a pre-existing housing resting on a T-bar; wherein the fixture is placed in the pre-existing housing and pivotally attached to the T-bar with the bracket, wherein the user selects to power the first light source only, the second light source only, or both the first and the second light source to produce a blended color that is different than the first and the second color, and selects to power the light sources with different levels of power (watts). |
| US11885466B2 |
Expandable solar-powered light
An inflatable solar-powered light is provided. The solar-powered light includes a bladder and a solar-powered light assembly disposed entirely within the bladder. The solar-powered light assembly includes a solar panel, a rechargeable battery in electrical communication with the solar panel, and at least one light-emitting diode in electrical communication with the rechargeable battery. The bladder is substantially transparent, flexible, inflatable, and collapsible. |
| US11885462B2 |
Atomizer unit
Embodiments relate to an atomizer unit that has a chamber assembly with an injection chamber and an atomizer chamber. The injection chamber is connected to the atomizer chamber by a nozzle, and the atomizer unit has a first feed channel for feeding a first compressed air flow into the injection chamber, a second feed channel for feeding a second compressed air flow into the atomizer chamber, and an injection valve for injecting a coolant and/or lubricant into the first compressed air flow in the injection region of the injection chamber. The first compressed air flow flows from the injection chamber into the atomizer chamber through the nozzle, is atomized in the atomizer chamber by the nozzle, is combined with the second compressed air flow in the atomizer chamber in order to form a transport flow for transporting the injected coolant and/or lubricant, and can be conducted to the machining location. |
| US11885460B1 |
System and method for hanging decorative lighting
A system and method for securing a cable with decorative lights to an existing cable is disclosed. An outdoor lighting clip which comprises a curve and annular portion for securing two cables in proximity to each other. In use, the annular portion has a slot which may be secured over a first cable such that the clip hangs from the first cable. A second cable may then be hung on the curve of the clip, such that the first cable and second cable remain in proximity to each other. This allows the second cable to have lighting decorations hanging without sagging in the middle of cable and without the cable needing to be in tension between two anchor points. Many lighting decorations include a loop on their cable for hanging from hooks, and this clip is compatible with allowing the second cable to hang from the clip by the loop. |
| US11885450B2 |
Quick connect coupler
A quick connect coupler includes a female connector having a central bore and a plurality of recesses, and a male connector having a post insertable into the central bore. The male connector has a first tab row with a plurality of first tabs and a second tab row with a plurality of second tabs axially spaced from the plurality of first tabs. The first and second tabs are shaped corresponding to the recesses in the female connector. The first and second tab rows are circumferentially offset to effect a two- or multi-step connection between the female connector and the male connector. |
| US11885448B2 |
Press fitting device, components and method
A press fitting device, components and method provide one or more indicators to provide a visual indication that the fitting has been properly pressed around a tube and that the correct amount of pressure has been provided to create a permanent seal. In embodiments, a sealing ring and a latching band are retained within a main body component of the fitting and the latching band can be formed with a radially inwardly extending latch that extends through an opening in the sealing ring. |
| US11885446B2 |
Arrangement
An arrangement for equalizing an offset between two pipe flanges, includes an arrangement for equalizing an offset between two pipe flanges, having adjustment rings, each having a recess which extends along an axis and about which a ring material extends in a circumferential direction, wherein at least two of the adjustment rings have two contact surfaces, the contact surfaces having flat, substantially circular contact surfaces at least along circular tracks concentric to the axis. A cross section of the ring material has a varying axial ring material thickness in the circumferential direction such that at least two of the adjustment rings have a wedge shape having an angular offset of the two contact surfaces relative to each other. The arrangement has at least three adjustment rings to flexibly compensate for different offset phenomena. |
| US11885442B2 |
Mechanical joining of nitinol tubes
The present invention relates to mechanical joining of Nickel Titanium tubes, also known as Nitinol, to other tubular components. Such mechanical joining may be achieved by interpenetration of lobe features between the respective tubes by translating the tubes together on a longitudinal axis, a transverse axis, by a combination of translation and rotational motion or by a hinging motion. The Nitinol superelasticity is used to accommodate the lobe deformation required for assembly and to snap the lobe back into its original shape to complete the mechanical joint. |
| US11885439B2 |
Microvalve, and a multi-directional valve apparatus
A microvalve comprising a hard base 14, a clamping plate 12, an inlet port 96, 98, an outlet port 96, 98, a membrane 16, a ball bearing 18 and a drive head 20; wherein the hard base comprises a recess over which the membrane is clamped by the clamping plate, the recess defining a cup with a generally spherical cap shaped surface and a perimeter, both of the inlet and outlet ports being in the recess, and at least one of them being in the generally spherical cap shaped surface; wherein the membrane extends across the recess and is clamped thereover, and it is flexible for enabling the unclamped part of it to be flexed into the recess by the ball bearing in the clamping plate on the other side of the membrane to the recess upon actuation by the drive head behind the ball bearing for selective driving of the ball bearing against the membrane to flex the membrane into the recess as the membrane flexes around part of the ball bearing to move the membrane from a condition in which both ports are open to a port closing condition, the port closing condition being where the membrane has been flexed to extend over either one of, or alternatively both of, the input port and the output port, and clamped thereagainst by the ball bearing. |
| US11885437B2 |
Stem seal cartridge for valve
A stem sealing device for a valve can include a device body defining an annular shape; a stem seal defining an annular shape and configured to seal a gap between a valve stem of the valve and a valve body of the valve and positioned within the device body, the stem sealing device installable in and removable from the valve as an assembly without prior or subsequent removal of the stem seal; and a fastener configured to secure the device body to the valve body. |
| US11885435B2 |
Pressure relief valve and method of relief valve opening detection
Systems and methods described herein provide for pressure relief valve detection and monitoring. A valve assembly includes a striker and an indicator assembly separated by a diaphragm. The diaphragm may be elastically or permanently deformable. The striker may be connected to a relieve valve disk that releases in response to high fluid pressure at the valve. Movement of the striker may be detected by contact with the diaphragm or by sensors near the diaphragm, which may trigger the indicator assembly to provide an external indication of a valve opening. |
| US11885434B2 |
Handle connection systems and methods
A process includes placing a nut around a valve cartridge, the valve cartridge comprising a valve stem. The process also includes aligning the valve stem with an engagement crown of a handle. The process also includes pressing the handle towards the nut after placing the nut around the valve cartridge and aligning the valve stem with the engagement crown, such that the valve stem is rotatably coupled to the handle through the engagement crown. |
| US11885421B2 |
Rotary-type valve device
A rotary-type valve device includes: a tubular valve having an inner passage and opening parts opened in an outer circumferential wall from the inner passage toward an outward side in a radial direction; a housing accommodating the valve and turnably supports the valve; a tubular passage member assembled in the housing such that the passage member abuts on the outer circumferential wall of the valve and defining a radial-direction passage; and a biasing spring biasing the passage member toward the outer circumferential wall The passage member includes an abutting member abutting on the outer circumferential wall, and an intervening member having an annular pressing part intervening between the abutting member and the biasing spring and partially pressurizing the abutting member. The abutting member includes an annular sealing surface aligned with the annular pressing part in a biasing direction of the biasing spring. |
| US11885419B1 |
Pressure regulating valve
A pressure regulating valve including a seal seat that defines an opening. A seat stem is moveable between a closed position in which the seat stem engages the seal seat and prevents fluid flow through the opening, and an open position in which the seat stem is spaced from the seal seat and permits fluid flow through the opening. A biasing element biases the seat stem in the closed position. A housing defines a passage that extends between an inlet and an outlet. The seal seat, seat stem and biasing element are positioned in the passage such that movement of the seat stem between the closed and open positions controls flow of the fluid between the inlet and outlet. The housing has an outer wall including a coupling mechanism for fixing the housing inside a channel of a primary regulator body. |
| US11885418B2 |
Mechanical seal and rotary union having a mechanical seal
The disclosure relates to a mechanical seal for sealing at least one fluid-carrying channel and/or space extending in a stationary component and/or a rotating component from the environment, having a seal ring which is supported in a sealing manner in the axial direction against a mating ring and, to compensate for wear on its end sealing surface or on a mating face, is supported against the mating ring elastically and movably in the axial direction with this sealing surface; having a housing which movably accommodates the mechanical seal ring in the axial direction and encloses the mechanical seal ring with a circumferential part in the circumferential direction. The mechanical seal according to the disclosure, characterized in that the housing has a flange which adjoins the circumferential part in the axial direction and which is integrally formed with the circumferential part or is connected to the circumferential part by a material bond, wherein the flange forms at least one radially inwardly facing projection and the mechanical seal ring has a stop face opposite the radially inwardly facing projection in the axial direction, with which the mechanical seal ring strikes against the projection during a maximum permissible movement in the axial direction, and the flange forms at least one radially outwardly facing projection with which it can be connected or is connected non-rotatably to one of the two components holding the housing. |
| US11885416B2 |
Dynamic shaft seal
The invention relates to a dynamic shaft seal which comprises (a) elastomer material and (b) graphene without a chemically modified surface in an amount of from 0.1 to 2 phr, in relation to 100 parts by weight of the elastomer material, as the sole constituent of the dynamic shaft seal made of elemental carbon. |
| US11885415B2 |
CVT automatic variator transmission for a bicycle
A CVT variator transmission box for using on a bicycle is provided. The CVT variator transmission box increases or decreases a speed of a rotation of pedals or hands when a form of a motion transmission is provided; and the CVT variator transmission box introduces a new variator gearbox with a CVT variator transmission mechanism capable of transmitting to a front wheel or a rear wheel by increasing or decreasing the speed from the pedals or the hands when the form of the motion transmission is provided. The CVT variator transmission box is positioned on any part of the front wheel, the rear wheel or on a frame of the bicycle. |
| US11885414B2 |
Parking apparatus for vehicle with rack and pinion structure and transmission for vehicle including the same
A parking apparatus for a vehicle and a transmission for a vehicle are provided. The parking apparatus for the vehicle includes an actuator, a pinion gear mounted in an end portion of the actuator and rotating in a same direction as the actuator rotates, a rack gear engaged with one side of the pinion gear and linearly moving in a tangential direction to the pinion gear as the pinion gear rotates, a push assembly including a push shaft extending from an end portion of the rack gear and a push head provided on one side of the push shaft, a parking sprag rotating according to an operation of the push assembly, and a parking gear mounted in a driver and selectively engaged with the parking sprag as the parking sprag rotates. |
| US11885413B2 |
Direct drive unit for a transmission system
A torque convertor and direct drive unit arrangement and operating methods are provided herein. In one example, a prime mover may be configured to be coupled to a transmission via one of a torque convertor and a direct drive unit, the direct drive unit including a higher range clutch and a lower range clutch. |
| US11885411B2 |
Transmission control systems to adjust clutch pressure and torque based on grade
Transmissions, control systems for transmissions, and methods of operating transmissions are disclosed. A transmission includes an input shaft, an output shaft, one or more clutches, and a control system. The input shaft is configured to receive rotational power supplied by a drive unit. The output shaft is coupled to the input shaft and configured to provide rotational power supplied to the input shaft to a load. The one or more clutches are coupled between the input shaft and the output shaft to selectively transmit rotational power between the input shaft and the output shaft in one or more operating modes of the transmission. Each of the one or more clutches is selectively engageable in response to one or more fluid pressures applied thereto. The control system is configured to control operation of the one or more clutches to select the one or more operating modes of the transmission. |
| US11885406B2 |
Transmission having a fan assembly
A transmission includes a fan assembly, including a fan wheel, a hood, and a guard. The fan wheel is connected to the driving shaft of the transmission for conjoint rotation, and the hood is attached to a, e.g., multi-piece retaining frame fastened to the housing of the transmission. The guard is formed of two guard parts, and the first parting line thereof is a straight segment or formed of two straight segments in alignment with each other. The hood is formed from two hood parts, and the second parting line thereof is a flat curve including straight line segments. |
| US11885399B2 |
Power transmission device
A power transmission device is provided with: a rotary body arranged to receive the torque to rotate about an axis; a clutch including a clutch member engaging with the rotary body and axially movable and clutch teeth connectable with the clutch member to transmit the torque; a solenoid configured to generate a magnetic flux in response to input of electric power; a stator coupled with the solenoid as to conduct the magnetic flux and prevented from rotation about the axis; a rotor arranged to receive the magnetic flux from the stator and, when driven by the received magnetic flux, to create a rotational motion about the axis; and a conversion mechanism drivingly connected with the rotor to convert the rotational motion into a linear motion in a direction along the axis, the conversion mechanism including a thrust member transmitting the linear motion to the clutch member. |
| US11885396B2 |
Transmission arrangement and drive device for an electrically driven vehicle
A transmission arrangement for an at least partially electrically driven vehicle includes a first electric machine defining a first central longitudinal axis and having a first gear stage and a second gear stage. The arrangement further includes a second electric machine defining a second longitudinal axis and having a first gear stage and a second gear stage. Further, the arrangement includes a transmission housing, with the first and second electric machines being arranged in the transmission housing. Additionally, the arrangement includes a differential drivingly connected to the second gear stages of the first and second electric machines. The first and second central longitudinal axes are axially parallel to each other on a circular path, the circular path being perpendicular to an output axis. |
| US11885393B2 |
Cord lock
A cord-lock assembly for slidably adjusting a length of cord is provided. The assembly may include various components such as a cord, a cord lock, and an article layer into which the cord lock and cord may be at least partially integrated. The cord lock may include one or more components that releasably clamp onto the cord and engage the cord through resistance provided by a biasing element. The cord-lock assembly may be configured such that a force applied to the cord lock in axial alignment with an aperture in which the cord lock is positioned allows adjustment of a length of cord extending through the cord lock and/or through the aperture layer. |
| US11885392B2 |
Toothed belt made of rubber, and rubber composition
A rubber toothed belt includes a belt main body including a plurality of tooth portions provided at predetermined intervals along a longitudinal direction of the belt and including a first rubber composition, in which the first rubber composition includes a composite polymer including a hydrogenated nitrile rubber and an unsaturated carboxylic acid metal salt in a mass ratio of the former/the later=100/80 to 100/180, and includes, with respect to 100 parts by mass of the composite polymer, 3 parts by mass to 50 parts by mass of a zinc oxide, 3 parts by mass to 50 parts by mass of a non-reinforcing filler, 10 parts by mass or less of a reinforcing filler, 5 parts by mass or less of short fibers, and 1 part by mass to 5 parts by mass of an organic peroxide. |
| US11885390B2 |
Internal combustion engine having concentric camshaft and balance shaft
An internal combustion engine, including a piston, a cylinder, and an output shaft, wherein the piston is arranged for reciprocating motion within the cylinder, driven by combustion, and the piston is coupled to the output shaft by a coupling such that said reciprocating motion of the piston drives rotation of the output shaft, wherein the coupling includes a connecting rod coupled to the piston, a slider bearing located for reciprocating movement relative to the connecting rod, the coupling further including a crankshaft rotatably mounted within a slider bearing, the engine having a camshaft and a balance shaft wherein the balance shaft is housed in a hollow of the camshaft such that the camshaft and the balance shaft rotate about a common axis. |
| US11885389B2 |
Bracket
A bracket with an excellent reinforcing effect is provided. A bracket (1) with an opening (A) includes a body (10) and a reinforcement portion (20). The body (10) is made of resin. The body (10) includes a pair of column portions (11) and a pair of connecting portions (12, 13). The body (10) includes a plate portion (15) on at least one of the column portions (11). The plate portion (15) is provided with ribs (16 to 18) that extend from the side of the opening (A) to the bracket outer peripheral side and protrude in the opening penetration direction. The reinforcement portion (20) includes a reinforcement portion (21). The reinforcement portion (21) forms an outer peripheral face (f1) of the bracket (1). The reinforcement portion (21) is arranged so as to overlap the ribs (16 to 18) when viewed in the opening penetration direction. |
| US11885387B2 |
Friction material and preparation method therefor, and friction part
A friction material, a preparation method therefor, and a friction part. The friction material contains the following components by weight percentage: 24%-31% of a nitrile rubber, 0.35%-1% of a vulcanizing agent, 0.35%-0.6% of a vulcanization activator, 0.4%-0.8% of a promoter, 0.06%-0.11% of a scorch inhibitor, 1.5%-2.4% of ZnO, 24%-31% of a thermoplastic phenolic resin, 1.5%-2.2% of a plasticizer and 15%-25% of white carbon black, and optionally: 0%-25% of a filler, 0-0.8% of an anti-aging agent, and 0-2.4% of MgO. |
| US11885386B2 |
Vehicle brake pad and a production process thereof
Various systems, devices, and methods for a vehicle smart brake pad comprising a sensor such as a force sensing device, and a production process thereof. For example, a production process of a vehicle brake pad can include the following steps in time sequence: applying an electrical circuit a support plate; screen printing on the electrical circuit of at least a first electrode; screen printing on the at least first electrode of a sheet of piezoelectric material; screen printing on the sheet of at least a second electrode; applying a friction pad on the support plate; and bulk polarizing the sheet of piezoelectric material by a supply of power to the at least first and second electrodes. |
| US11885384B2 |
Pot-shaped composite brake rotor for motor vehicles
A pot-shaped composite brake rotor for motor vehicles, which combines at least one securing component as a hub interface with at least one friction ring component (as a friction partner for at least one friction lining. Distinction is made between a torque transmission function a fixing function between the paired components by the provision of a heat-conductive joint interface between the components on one side. The components are assembled coaxially with one another and joined rotationally fixedly in the axial direction so that the securing component serves as a heat sink for the friction ring component. At least one fixing element between the components is provided separately, and this fixing element substantially exclusively (nominal load) performs a fixing function by mutual form fit by a radially directed engagement behind at least one undercut. A press-fit connection s present for torque transmission between the securing component and the friction ring component. |
| US11885383B2 |
Disc brake pad
A disc brake pad which is supported by a pair of pins to a pad support member so that the disc brake pad is movable in an axial direction, include a lining and a back plate supporting a back surface of the lining. The back plate includes a clip insertion portion where part of a pad clip is inserted in the axial direction, at an intermediate portion of a radially outer side portion in a circumferential direction, includes pin insertion portions where the pins are respectively inserted in the axial direction, at both sides of the radially outer side portion in the circumferential direction with the clip insertion portion located therebetween. The clip insertion portion includes, on a radially outer side portion of an inner peripheral surface thereof, a pressed surface where a pressing force directed radially outward is applied from the pad clip. |
| US11885377B2 |
Snap ring mounted conductive assembly for bearings
An electrically conductive assembly for preventing current flow through the raceways of a bearing includes a mounting ring disposeable within a retention groove of an outer member or a bearing outer ring and is formed of an electrically conductive elastic material. The mounting ring has two circumferential ends spaced apart and is deflectable inwardly such that the two circumferential ends displace generally toward each other to reduce the outside diameter of the ring for installation into the retention groove. An arcuate conductor has an outer radial end attached to the mounting ring, an inner radial end engageable with the shaft or the bearing inner ring and two circumferential ends spaced apart to define an arcuate gap when the conductor is installed about a shaft or a bearing inner ring. An electrically conductive path extends between the shaft and the outer member through the arcuate conductor and the mounting ring. |
| US11885375B2 |
Tubular body used for power transmission shaft and power transmission shaft
A tubular body of a power transmission shaft made of fiber-reinforced plastic is provided with a cylindrical main body portion, and a second connection portion continuous with an end portion of the main body portion and to which a stab shaft is joined. The main body portion is formed with a weak portion which fails when a load input in the direction of an axial line exceeds a predetermined value. A linear rupture portion is formed on an outer peripheral surface of the weak portion. In the present configuration, cost reduction and weight reduction of the tubular body are made possible, and the tubular body fails infallibly when a predetermined load is input to the tubular body in the direction of the axial line. |
| US11885372B2 |
Friction-less low-profile hinge system and method
The present disclosure relates to a reduced friction torsion component system that makes use of a first frame portion adapted to be coupled to, or integrally formed with, a first object, and forming a first bore, and a second frame portion adapted to be coupled to, or integrally formed with, a second object, and forming a second bore. The two bores are axially aligned and receive at least one elongated hinge component. The elongated hinge component operates to both couple the first and second frame portions together for pivoting movement relative to one another, and also provides a torsional biasing force to enable pivotal deployment from a first position to a second position of one of the first or second frame portions. |
| US11885371B2 |
Connection system
A connection system for removably connecting first and second pieces one to another. The connection system comprises: a tapering recess formed in, or connected to, the first piece. The tapering recess has an opening which is shaped and dimensioned to receive a wedge formed in, or connected to, the second piece. The wedge has a dovetail profile which is adapted to engage with walls of the recess. The wedge is shaped and dimensioned to slide in a first direction and thereby wedge into the tapered recess. Each piece has at least one aperture which receives a lock piece. The first and second pieces when connected and which when oriented in a user preferred direction, cause the lock piece to fall from a first aperture into a second aperture, thereby locking the wedge in the tapering recess and preventing movement in an opposite sliding direction. |
| US11885370B1 |
Rapid coupling apparatus
A coupling apparatus configured to provide a quick and efficient technique to operably connect bamboo poles or similar structural members. The present invention includes a first portion and a second portion that are operably integrated to provide coupling of structural members. The first portion includes a first section and a second section wherein the first section is insertable into the second section and is configured to be releasably secured therein. The first section includes grooves that are configured to operable coupled with a locking member located in the second section. Within the scope of the present invention alternate embodiments of the grooves and first section are contemplated. The second portion includes two embodiments wherein the two embodiments are configured to provide alternate orientations of coupling of bamboo poles. The second portion is configured to provide both an end-to-end connection as well as an angular orientation of bamboo poles. |
| US11885362B2 |
Quick-release connection device
A quick-release connection device includes a main load-bearing structural rod, a safety pin, a cam handle, a spring piece and a clamping piece. A free end of the structural rod is provided with a pin hole for insertion of the pin. The cam handle is connected to an end opposite to the free end. One end of the spring piece is connected to the cam handle, and the other end is provided with an insertion hole such that it can be sleeved on the free end, and limited by the pin to form locking connection with the structural rod. One end of the clamping piece is connected to the cam handle or spring piece, and the other end is provided with an opening such that it can be sleeved on the free end, and can be limited by the spring piece to form locking connection with the structural rod. |
| US11885358B2 |
Blind fastener and method of installation thereof
The present disclosure relates to a blind fastener and a method of installation thereof. The blind fastener comprises a sleeve and a mandrel. The sleeve comprises a first sleeve end, a second sleeve end, and a cavity extending from the first sleeve end to the second sleeve end. The mandrel is configured to be at least partially received by the cavity of the sleeve. The mandrel comprises a first mandrel end disposed adjacent to the first sleeve end and comprising an enlarged portion having a diameter greater than a diameter of the cavity, a second mandrel end comprising a pull region, and a shank region extending intermediate the first mandrel end and the second mandrel end. The pull region comprises an axial length no greater than four times a diameter of the shank region and is configured to be engaged by an installation tool. |
| US11885356B2 |
Connecting means and method for connecting two components
In order to provide a connecting device for connecting two components, which is simple to manufacture and enables a stable and reliable connection of the two components, it is proposed that the connecting device comprises a main body which comprises a receiving channel extending through the main body for accommodating a fixing element, wherein the receiving channel is preferably accessible at one end by way of an insertion opening of the main body and/or preferably at a (further) end by way of a fixing opening of the main body, wherein the main body preferably further comprises an actuating opening that is different from the insertion opening and/or the fixing opening, by way of which in particular the fixing element arranged in the receiving channel is preferably accessible for the actuation thereof. |
| US11885347B2 |
Centrifugal compressor
A centrifugal compressor includes a shaft member and an impeller. The shaft member extends in an axial direction and is rotatable. The impeller includes a hub that is disposed on an end portion of the shaft member, and a plurality of blades disposed on an outer peripheral surface of the hub. The impeller has a shape that tapers outward in the axial direction. A cover member is disposed at least at an end portion of the impeller outside in the axial direction. The cover member is joined to outer peripheries of the plurality of blades in a radial direction and covers at least a part of the plurality of blades from outside in the radial direction. A first bearing is disposed outside in the radial direction of the cover member, the first rotatably supporting the impeller. |
| US11885345B2 |
Pump
A pump housing comprises a circumferential wall forming an outer wall of the pump housing; a pump casing which connects to the circumferential wall on a first outer side to form a first chamber, the pump casing comprising a central opening to form an axial supply of the pump housing for material to be pumped; and pressurizing means to pressurize the first chamber. |
| US11885344B1 |
Adjustable mount for securing fan accessory
A mount is for attaching an accessory to a fan including a downtube. The mount includes a receiver adapted for connecting to the downtube. A retainer is adapted to receive the accessory. The retainer is adapted to support and rotate about the receiver so as to position the accessory in a desired orientation. Related methods of attaching an accessory to a fan are also disclosed. |
| US11885341B2 |
Rotor support and vacuum pump with such a rotor support
A rotor support configured to rotatably mount a rotor shaft in a vacuum pump is disclosed. The rotor support comprises: a rolling bearing for rotatably supporting the shaft; an insert and at least one resilient damping member, the insert and the at least one resilient damping member surrounding the rolling bearing. The insert comprises inner and outer annular portions connected by a plurality of flexible members, the plurality of flexible members being configured to flex in a radial plane and resist movement in an axial plane, thereby absorbing radial movement of the shaft. The at least one resilient damping member is formed of an elastomeric material configured to flex in both a radial and axial direction. |
| US11885340B2 |
Compressor rotor structure
Compressor rotor structure for turbomachinery, such as a compressor, is provided. Disclosed embodiments can benefit from sealing sleeves that may be arranged to inhibit passage onto respective hirth couplings of process fluid being processed by the compressor. The sealing sleeves may be affixed to adjoining structures (e.g., adjoining impeller bodies) by way of a slip fit connection to one of the adjoining structures and an interference fit connection with respect to the other adjoining structure, which is conducive to a user-friendly assembly of the sealing sleeves with the adjoining structures. |
| US11885326B2 |
Flexible impeller pump
A mounting hub operable to connect a flexible impeller to a drive shaft. The mounting hub is detachable from the impeller, and is adapted to permit the impeller to be decoupled rotationally from the impeller drive shaft during installation, and then recoupled rotationally once the flexible impeller is in position. |
| US11885324B2 |
Systems and methods of controlling an electric motor that operates a pump jack
Systems and methods of controlling the performance of client nodes served by an electric power utility are provided. In one exemplary embodiment, a method performed by a first network node that is operable to control via a client node an electric motor configured to operate a pump jack comprises sending, to the client node, an indication to change an amount of electric power consumed by the motor to operate the pump jack based on at least one of a value of a first parameter associated with operation of the motor and a value of a second parameter associated with operation of the pump jack so as to reduce an average amount of electric power consumed during a certain time period by the motor in operating the pump jack. |
| US11885322B2 |
Heat-driven pumping system
According to examples of the disclosure there is provided a heat-driven pumping system and a method of pumping. The heat-driven pumping system comprises a closed circuit for a first liquid. The closed circuit comprises a vaporization portion. The vaporization portion is configured to receive heat from an external source. The vaporization portion is configured to cause vaporization of first liquid within the vaporization portion. Vaporization of first liquid within the vaporization portion thereby increases an amount of gas in the closed circuit. The closed circuit is sealed such that the increase in the amount of gas increases a pressure exerted on the first liquid. The heat-driven pumping system comprises a transfer means. The transfer means is configured to convert the pressure exerted on the first liquid into a pumping force. The pumping force is transferred to a pumping vessel for pumping a second liquid. |
| US11885320B2 |
Apparatus and method of operating a gas pump
A nano gas pump for generating gas flow, gas compression and gas rarefication which provides up to several orders of magnitude pressure difference, operates over a wide range of pressure from several millitorr to several atmospheres, and with pumping speeds from several nano liters to several liters per minute. The nano gas pump does not require any moving parts and generate gas flow using steep temperature gradients of more than 100 milli Kelvin over a mean free path of the local gas in the direction of the gas flow. Temperature gradients are created and restricted mostly to the gas doing the work, through an arrangement of PNP, NPN, PP, NN thermoelectric segments together with conductive interconnects. Contact resistance which drastically reduces the efficiency of a nanoscale thermoelectric heat pump is mitigated by overlapping thermoelectric segments and electric connections. |
| US11885319B2 |
Swash plate-type compressor
A swash plate compressor including rotor arms protruding from a rotor toward a swash plate and having rotor arm holes; swash plate arms protruding from the swash plate toward the rotor and having swash plate arm holes; and a link arm hingedly coupled to the rotor arms and the swash plate arms by link pins, in which the swash plate arms include a first swash plate arm positioned at a side in rotation direction of the shaft based on the link arm; and a second swash plate arm positioned at a side in a direction opposite to the rotation direction of the shaft based on the link arm, and in which the first swash plate arm has higher wear resistance than the second swash plate arm. |
| US11885315B2 |
Radio-frequency plasma generating system and method for adjusting the same
Disclosed is a radio-frequency plasma generating system including a radio-frequency generator and a plasma source, the radio-frequency generator being inductively or capacitively coupled to the plasma source through a resonant electric circuit, the radio-frequency generator being adapted to receive direct current power from a direct current power supply and for generating radio-frequency power at a frequency f, the radio-frequency power including a reactive radio-frequency power oscillating in the resonant electric circuit and an active radio-frequency power absorbed by the plasma. The radio-frequency plasma generating system includes a unit for measuring an efficiency of conversion E of direct-current power to active radio-frequency power absorbed by the plasma and a unit for adjusting the frequency f as a function of the measured efficiency of conversion E to maintain the efficiency of conversion E in a predetermined range within a RF plasma operational range. |
| US11885311B2 |
Lubrication system
A lubrication system for a wind turbine is provided, the lubrication system including a lubricant consumer to which fresh lubricant is supplied and out of which used lubricant is extracted, a pump for pumping fresh lubricant to the lubricant consumer, a waste lubricant collector where used lubricant can flow after being extracted from the lubricant consumer, and a plurality of containers delivering fresh lubricant to the lubrication system. |
| US11885310B2 |
Cooling system and wind power generator set
A cooling system and a wind power generating set. The cooling system comprises two cooling sub-systems thermally coupled to each other. Each cooling sub-system comprises: a first cooling circuit for cooling a first heat-generating component, a second cooling circuit for cooling a second heat-generating component, a third cooling circuit for cooling a third heat-generating component, a fourth cooling circuit for cooling a fourth heat-generating component, a pump station unit and a heat dissipation unit. The first cooling circuit and the fourth cooling circuit are connected in parallel to form a first branch, the second cooling circuit and the third cooling circuit are connected in parallel to form a second branch, and the first branch and the second branch are connected in parallel, and are connected to the pump station unit and the heat dissipation unit. The cooling system may achieve the fault-tolerant operation of two cooling sub-systems. |
| US11885305B2 |
Method of determining the wind speed in the rotor plane of a wind turbine
The present invention relates to a method of determining the wind speed in the plane of a rotor (PR) of a wind turbine (1), by measuring (MES2) the rotational speed of the rotor, the angle of the blades and the generated power. The method according to the invention uses a wind turbine model (MOD) constructed from wind speed measurements (LID), and by use of measurement clustering (GRO) and regressions (REG). |
| US11885304B2 |
Wind turbine system, wind turbine control device, driving method, and tangible computer-readable storage medium storing program
A wind turbine system includes: a ring gear; a yaw drive unit including a pinion gear meshing with the ring gear, the yaw drive unit being configured to rotate the pinion gear; a yaw brake unit configured to generate a braking force for inhibiting rotation of the ring gear; a load information acquiring unit configured to acquire an external load applied to the ring gear; and a control unit configured to release the braking force of the yaw brake unit when a rotational torque generated on the ring gear by the yaw drive unit has been larger than the external load acquired by the load information acquiring unit, in switching the ring gear from a stationary state to a rotating state. |
| US11885302B2 |
Efficient wind energy convertor without gearbox or multi-pole generator
A vertical axis turbine having a first rotor and at least one second rotor, the first rotor being configured to rotate around a first rotation axis that is vertical or more vertical than horizontal. The first rotor may be configured to be driven and/or rotated by wind or water flow. The at least one second rotor is provided on or coupled to the first rotor such that the first rotor is operable to move the second rotor upon rotation of the first rotor. The second rotor is operable to drive a power take off system. Each second rotor rotates around a respective second rotation axis that may be angled or perpendicular to the first rotation axis of the first rotor. The first and second rotors are configured so that the power take-off system can be driven without the need for a gearbox. |
| US11885294B2 |
Wind turbine, wind turbine rotor blade, and blade bearing for a wind turbine
The disclosure concerns a wind turbine, comprising: a hub with a hollow cylindrical region with a mean circumference UN; at least one rotor blade mounted rotatably on the hub, with a blade laminate which extends in the longitudinal direction of the rotor blade and at least in portions forms a hollow cylinder with a mean circumference UR; and at least one blade bearing for mounting the rotor blade on the hub, with a first bearing ring which is arranged on the hub side and connected by means of a first flange connection to a rotor hub flange formed on a rotor-blade side end portion of the hub, wherein the first flange connection has at least one hub longitudinal bolt which is arranged on a circumference UNB coaxially to the blade bearing; and a second bearing ring which is arranged on the rotor blade side and connected by means of a second flange connection to a rotor blade flange formed on a hub-side end portion of the rotor blade, wherein the second flange connection has at least one rotor blade longitudinal bolt which is arranged on a circumference URB coaxially to the blade bearing. The disclosure achieves the fundamental object in that a first radial offset V1 is formed between the circumference UN and the circumference UNB, and/or a second radial offset V2 is formed between the circumference URB and the circumference UR. In a further aspect, the disclosure achieves the fundamental object with a wind turbine rotor blade and a rotor blade bearing. |
| US11885291B2 |
Low pressure fuel injection system for a combustion engine
In at least some implementations, a charge forming device includes multiple throttle bores, an inlet chamber in which fuel is received, at least one fuel passage communicating the inlet chamber with the throttle bores, and a valve having an inlet in communication with the inlet chamber, an outlet and a valve head that is movable and allows flow from the inlet chamber through the outlet when the pressure in the inlet chamber is greater than a threshold pressure. |
| US11885290B2 |
Fuel injector and nozzle assembly having dual concentric check assembly and ducted spray orifices
A fuel injector includes a nozzle assembly having a nozzle case, and a concentric check assembly within the nozzle case. Transfer passages are formed in an outer check of the check assembly, and spray orifices are formed in the nozzle case. A fuel volume is formed between the outer check and an inner check, and the inner check is movable to fluidly connect the transfer passages to the fuel volume. The outer check is rotatable between a first angular orientation and a second angular orientation to fluidly connect separate sets of the transfer passages to separate sets of the spray orifices. Spray ducts are in spray path alignment with at least one of the sets of spray orifices. |
| US11885286B2 |
Separator plate for cooling tubes
In some implementations, an exhaust gas recirculation cooler may include a shell defining an internal chamber; a first tube support plate defining a first wall of the internal chamber; a second tube support plate defining a second wall of the internal chamber; a plurality of cooling tubes extending through the internal chamber from the first tube support plate to the second tube support plate, the plurality of cooling tubes being flexible tubes; and at least one separator plate, extending within the internal chamber between the first tube support plate and the second tube support plate, that partitions the internal chamber such that a first set of the plurality of cooling tubes are to a first side of the at least one separator plate and a second set of the plurality of cooling tubes are to a second side of the at least one separator plate. |
| US11885281B2 |
Thrust reverser with flaps controlled by a mechanism equipped with aeronautical bellcranks
An aeronautical thrust reverser including a sliding cowl, shutter flaps and deflection cascades. The reverser includes, for each flap, a return member hinged to the sliding cowl, to a driving connecting rod itself hinged to a front frame of the reverser, and to a return connecting rod itself hinged to the flap, the latter being moreover hinged by its rear end to the sliding cowl. The return member, the driving connecting rod and the return connecting rod form an actuation system capable of opening the secondary flow duct in a direct thrust configuration. |
| US11885280B2 |
Thrust reverser cascade including acoustic treatment
A cascade type thrust reverser device for a turbomachine of an aircraft, comprising a thrust reverser cascade and a casing, the cascade including first cavities, and the casing comprising an opening defining a housing wherein said cascade can be inserted in a first direction, and the casing and said cascade being in relative translation with respect to one another in the first direction between a first position of the device in which the cascade is entirely positioned in the housing and a second position of the device in which said cascade is at least partially outside said housing. The casing comprises an acoustic treatment panel including second cavities extending in a second plane parallel to the first plane, each first cavity facing a second cavity when the device is in the first position to form an acoustic treatment cell. |
| US11885279B2 |
Monolithic heat-exchanger bodies
A monolithic heat exchanger body for inputting heat to a closed-cycle engine includes heating walls and heat sink, such as heat transfer regions. The heating walls are configured and arranged in an array of spirals or spiral arcs relative to a longitudinal axis of an inlet plenum. Adjacent portions of the heating walls respectively define corresponding heating fluid pathways fluidly communicating with the inlet plenum. At least a portion of the heat sink is disposed about at least a portion of the monolithic heat exchanger body. The heat sink includes working-fluid bodies including working-fluid pathways that have a heat transfer relationship with the heating fluid pathways. Respective ones of the heat transfer regions have a heat transfer relationship with a corresponding semiannular portion of the heating fluid pathways. Respective ones of the heat transfer regions include working-fluid pathways fluidly communicating between a heat input region and a heat extraction region. |
| US11885278B2 |
Cylinder head gasket
A cylinder head gasket is disclosed having a carrier layer, in which at least one through-opening for a combustion chamber is located, and a combustion chamber sealing element, which is inserted in the through-opening and extends in an intrinsically closed manner. In some examples, at least one gap is formed at least in some sections between the carrier layer and the combustion chamber sealing element, the gap extending around the combustion chamber sealing element at least in some sections. Further, in some example, the carrier layer has at least one slot-like or groove-like channel, which extends from the at least one gap between the carrier layer and the combustion chamber sealing element to the outer edge of the carrier layer. |
| US11885274B2 |
Controller for internal combustion engine, control method for internal combustion engine, and memory medium
Control circuitry executes an increase correction control for fuel when an internal combustion engine is started. A determination process determines whether warm-up in a cylinder is completed. A direct injection mode injects fuel only from a direct injection valve when it is determined that the warm-up in the cylinder is completed. A reduction process sets an increase correction amount of fuel obtained through the increase correction control when executing the direct injection mode to be less than an increase correction amount obtained prior to the execution of the direct injection mode. |
| US11885271B2 |
Systems and methods for detonation control in spark ignition engines using analog neuromorphic computing hardware
An apparatus is provided for detonation control in spark ignition engines. The apparatus includes an analog neurocomputing hardware device, a knock sensor coupled to a spark ignition engine, an ignition coil for the spark ignition engine, and an Electronic Control Unit (ECU) for the spark ignition engine. The analog neuromorphic hardware device is configured to receive knock signals from the knock sensor, receive ignition coil data from the ignition coil, determine a knock level and ignition quality measure based on the received knock sensor signals and the received ignition coil data, and transmit the knock level and ignition quality measure to the ECU. |
| US11885268B2 |
Assembly for a turbine engine
An assembly for a turbine engine extending along an axis, includes a stator, a low-pressure compressor shaft, a low-pressure compressor comprising a rotor comprising a drum rotatably coupled to the shaft of the low-pressure compressor, and a fan comprising a disk rotatably coupled to the shaft of the low-pressure compressor. The drum has a radially internal part rotatably coupled to the shaft of the low-pressure compressor and a radially external part fixed to the radially internal part by means of detachable fixing means. A first axial retention means is configured to axially and detachably retain the disk of the fan relative to the shaft of the low-pressure compressor. A second axial retention means is configured to axially and detachably retain the radially internal part of the drum relative to the shaft of the low-pressure compressor. |
| US11885261B2 |
Ice accumulation and shedding mitigation for sensor probe
Ice accumulation and shedding mitigation devices associated with sensor probes extending into a stream of air entering an aircraft engine are provided. An exemplary device comprises a wedge-shaped blade configured to be exposed to the stream of air and disposed upstream of the sensor probe. The wedge-shaped blade has two faces meeting at a leading edge oriented to face the stream of air. |
| US11885260B2 |
Gas turbine engines having cryogenic fuel systems
Turbine engine systems are described. The turbine engine systems include a combustor arranged along a core flow path of the turbine engine, a cryogenic fuel tank configured to supply a fuel to the combustor, a fuel supply line having a first flow supply line and a second flow supply line, the first flow supply line fluidly connecting the cryogenic fuel tank to the combustor through a first core flow path heat exchanger, and the second flow supply line fluidly connecting the cryogenic fuel tank to the combustor through a second core flow path heat exchanger, and a flow controller arranged along the fuel supply line and configured to respectively control a flow of fuel into the first flow supply line and the second flow supply line. |
| US11885257B2 |
Piston, internal combustion engine, and vehicle
A piston for an internal combustion engine is disclosed. The piston is configured to reciprocate along a centre axis of the piston during operation in an engine. The piston comprises a number of fuel directing surfaces arranged at a distance from a top surface of the piston measured along the centre axis. Each fuel directing surface is configured to direct a fuel spray sprayed onto the fuel directing surface. The fuel directing surfaces are arranged with gaps between two adjacent fuel directing surfaces. The present disclosure further relates to an engine comprising a piston and a vehicle comprising an internal combustion engine. |
| US11885252B2 |
Planetary gear system arrangement with auxiliary oil system
In an embodiment of the present disclosure, a gas turbine engine includes a fan, a first compressor stage and a second compressor stage, a first turbine stage and a second turbine stage, and wherein said first turbine stage drives said second compressor stage as a high spool, and wherein said second turbine stage drives said first compressor stage as part of a low spool, and a gear train driving said fan with said low spool, and such that said fan and said first compressor stage rotate in the same direction, and wherein said high spool operates at higher pressures than said low spool. |
| US11885250B1 |
Vehicle systems and methods for aftertreatment preheating
Vehicle systems and methods are provided for preheating an aftertreatment system prior to engine ignition. A method involves obtaining a first measurement indicative of a current temperature associated with the aftertreatment system, obtaining a second measurement indicative of a current state of an energy source coupled to a heating element integrated with the aftertreatment system, determining an amount of electrical energy to be applied to the heating element based at least in part on a difference between the current temperature associated with the aftertreatment system and a target temperature for the aftertreatment system, and automatically enabling current flow from the energy source to the heating element prior to ignition of the engine for a duration of time in a manner that is influenced by the amount of electrical energy to be applied to the heating element and the current state of the energy source. |
| US11885249B2 |
Catalyst for exhaust gas purification
Provided is a catalyst for exhaust gas purification, the catalyst comprising: a noble metal; an alumina support particle; and a ZrO2 semiconductor support particle deposited on a surface of the alumina support particle. |
| US11885245B2 |
Oil pressure actuated phaser with a lock pin shutoff
An oil pressure actuated or torsion assisted phaser with a lock pin that has a position which shuts off communication between the advance and retard chambers and the front cam bearing and/or oil control valve, effectively acting as a shutoff valve and preventing leakage of oil from the advance and retard chambers. The prevention of leakage maintains oil in the phaser after engine shutdown. Additionally, by shutting off communication between the advance and retard chambers and the oil supply, the side load on the lock pin from the oil pressure torque on the rotor vanes during unlocking of the lock pin can be reduced or eliminated. |
| US11885244B2 |
Pumped heat energy storage system with electric heating integration
A method including: (i) operating a pumped-heat energy storage system (“PHES system”) in a charge mode to convert electricity into stored thermal energy in a hot thermal storage medium (“HTS medium”) by transferring heat from a working fluid to a warm HTS medium, resulting in a hot HTS medium, wherein the PHES system is further operable in a generation mode to convert at least a portion of the stored thermal energy into electricity; and (ii) heating the hot HTS medium with an electric heater above a temperature achievable by transferring heat from the working fluid to the warm HTS medium. |
| US11885243B2 |
Multi-functional fecal waste and garbage processor and associated methods
At least one aspect of the technology provides a self-contained processing facility configured to convert organic, high water-content waste, such as fecal sludge and garbage, into electricity while also generating and collecting potable water. |
| US11885236B2 |
Airfoil tip rail and method of cooling
An airfoil for a turbine engine includes an outer wall bounding an interior and defining a pressure side and a suction side, the outer wall extending axially between a leading edge and a trailing edge to define a chord-wise direction, and also extending radially between a root and a tip to define a span-wise direction. At least one cooling conduit can be formed in the interior of the airfoil, and a tip rail can project from the tip in the span-wise direction. |
| US11885232B2 |
Gas turbine system and movable body including the same
A gas turbine system includes: a compressor configured to compress external air to generate compressed air; a combustor configured to burn the compressed air together with fuel to generate a combustion gas; a turbine configured to be driven by the combustion gas; an exhaust unit configured to guide the combustion gas, which has passed through the turbine, to outside; a shell having a cylindrical shape and extending along an axis line about which the turbine is configured to rotate and being arranged so as to cover the compressor, the combustor, the turbine, and the exhaust unit; and an exit unit configured to guide the combustion gas, which has passed through the turbine, to a discharge port in the surface of the shell. |
| US11885229B2 |
Electric motor having an integrated cooling system and methods of cooling an electric motor
The present disclosure pertains to electric machines such as electric propulsion systems for aircraft that integrated cooling systems, and methods of cooling such an electric machine. Exemplary electric machines include an electric motor that has a stator, a rotor, and a drive shaft operably coupled to the rotor. Exemplary electric machines further include a motor cooling conduit that defines a pathway for conveying a cooling fluid through or around at least a portion of the electric motor, a casing assembly that circumferentially surrounds at least a portion of the electric motor, a casing assembly conduit integrally formed within at least a portion of the casing assembly which defines a pathway for conveying the cooling fluid through the at least a portion of the casing assembly, and a pump or compressor operably coupled to the drive shaft and configured to circulate the cooling fluid through the motor cooling conduit and the casing assembly conduit. |
| US11885228B2 |
System and method for inspecting fan blade tip clearance relative to an abradable fan case
A system and method for inspecting fan blade clearances in a fan stator module are presented. The method includes rotating a fan rotor assembly that includes an attached bracket situated between adjacent fan blades connected to the fan rotor assembly. The bracket includes a laser module and an inclinometer configured to measure a circumferential position of the laser module. The method further includes projecting a laser beam from the laser module to the fan case to determine a distance measurement between the laser module and the fan case at multiple circumferential points around the fan case. The distance measurement and circumferential position data is processed by a computing device to determine a clearance distance between a fan blade and the fan case. |
| US11885223B2 |
Method to prevent dual rod drill string drag
An apparatus and method for preventing drill string drag. Rotation encoders are provided for tracking the rotation of an inner and outer member of a dual-member drill string. Based upon the drilling conditions, the readings of the encoder can detect when the inner member is dragging on the outer member. When such a drag condition is detected, a processor can trigger remedial measures, which may include increasing a rotation rate of the inner member, sending a warning signal, stopping operation, or a combination of these. |
| US11885222B2 |
Inclination-based levelling system
A drilling machine includes an inclination-based levelling system. The drilling machine includes a frame with front and rear portions, and a plurality of support jacks including a pair of rear jacks proximate the rear portion of the frame and a front jack proximate the front portion of the frame. Each jack is extendable and retractable. The drilling machine also includes a sensor configured to monitor and transmit sensor data, the sensor data including at least one of a roll of the drilling machine and a pressure. A controller operatively associated with the sensor, is configured to calculate a volume of debris to be produced during an operation of the drilling machine, to select a machine height setting based on the calculated volume of debris, and to extend and retract the plurality of support jacks according to the selected machine height setting. |
| US11885219B2 |
Chemical injection system for a resource extraction system
A chemical injection system for a resource extraction system includes a controller having a memory and a processor. The memory stores instructions that cause the processor to receive a first pressure from a first pressure sensor of the resource extraction system, receive a second pressure from a second pressure sensor of the resource extraction system, determine a flowrate of a produced fluid of the resource extraction system based on the first pressure and the second pressure, determine an ion concentration of the produced fluid, and adjust an injection rate of a chemical into the resource extraction system based on the flowrate of the produced fluid, the ion concentration of the produced fluid, or both. |
| US11885217B2 |
Apparatus for and method of monitoring a drilling installation
An assembly includes two tubular elements, a primary and a secondary seal arranged between the two tubular elements, a seal cavity formed between the two tubular elements and the primary and the secondary seal, and a seal monitoring apparatus having a housing and a position sensor. The housing has a chamber enclosing a separator which divides the chamber into a first and a second sub-chamber. The first sub-chamber is fluidly connected to the seal cavity and is filled with a hydraulic fluid. The separator is movable in a first direction relative to the housing to increase a volume of the first sub-chamber and decrease a volume of the second sub-chamber, and in a second direction to decrease the volume of the first sub-chamber and increase the volume of the second sub-chamber. The position sensor generates an electrical signal which represents a position of the separator relative to the housing. |
| US11885215B2 |
Downhole pressure/temperature monitoring of ESP intake pressure and discharge temperature
Provided is a gauge mandrel, a sensing system, and a well system. The gauge mandrel, in one aspect, includes a tubular having a length (Lt), an internal diameter (Di) and a width (W), the internal diameter (Di) and the width (W) defining a sidewall thickness (t), the tubular defining a primary fluid passageway. The gauge mandrel, in accordance with this aspect, further includes a gauge cavity extending along at least a portion of the length (Lt) of the tubular and located entirely within the sidewall thickness (t), the gauge cavity having an insertion end configured to accept a gauge sensor. |
| US11885208B2 |
Automated precise constant pressure fracturing with electric pumps
A method of controlling a pumping stage of a fracturing fleet at a wellsite with a set of electric frac pumps to deliver fracturing fluids into a target formation at a steady pressure value. An global control process on a computer system communicatively connected to the plurality of pumping units can communicate a unit setpoint to each pumping unit, monitor the sensor measurements, compare the periodic datasets to a target pressure, and modify the fluid output of the pump units to achieve the target pressure during the pumping operation. The global control process can direct at least one pumping unit to deliver a fracturing treatment at a pressure higher or lower than the target pressure in response to changing wellbore environment pressures. |
| US11885202B2 |
Electric/hydraulic safety valve
Provided is an electro/hydraulic valve for use in a hydrocarbon production well, an electrically surface-controlled subsurface safety valve, and a method of operating an electrically surface-controlled subsurface safety valve. The electro/hydraulic valve for use in a hydrocarbon production well, in one aspect, includes a fluid chamber and an electro/mechanical pump having a fluid inlet and a fluid outlet, and further wherein an inlet check valve is positioned in fluid communication between the fluid chamber and the fluid inlet and an outlet check valve is positioned in fluid communication between the fluid outlet and a hydraulically controlled actuation member. |
| US11885200B2 |
Low power consumption electro-hydraulic system with multiple solenoids
An electro-hydraulic control system for actuating a control valve includes a control module. The control module is coupled to the surface via at least one hydraulic line and two electrical power lines. The control module uses one of the hydraulic lines as a “supply” line and the other line as a “return” line if included. Each hydraulic line of the at least one hydraulic lines can be used as an “open” line or a “close” line to open or close the control valve. The control module includes two normally closed (NC) solenoid valves (SOVs) that are coupled to the electrical power lines and can be controlled from the surface to open or close. The opening or closing of the NC SOVs in cooperation with hydraulic pressure on a “supply” line of the hydraulic lines operates (i.e., closes or opens) the control valve. |
| US11885199B2 |
Actuated sand dump system and methods
An apparatus, system and related methods for controlling a pressurized flow from a high or low pressure system. An actuated sand dump system and related methods include a first valve positioned downstream of a high or low pressure system, a second valve positioned downstream of the first valve, a choke positioned between in the first and second valves, a plurality of pressure gauges, and a control unit operable to automatically open and close the first and second valves and the choke in a predetermined sequence, upon initiating the predetermined sequence, and in response to pressure measurements from the plurality of pressure gauges. |
| US11885198B2 |
Choke system with capacity for passage of large debris
Embodiments include a choke system that passes enlarged debris despite having a relatively small diameter for an input port of the choke system. Embodiments also include systems to prevent dislodging of a choke seat when backpressure is supplied to the choke system. Embodiments also include sealing systems to prevent fluid leaks around the choke seat of the choke system. |
| US11885194B2 |
Rotating indexing coupling (RIC) assembly for installation and orientation of a subsea production tree
One illustrative apparatus (100) disclosed herein includes a stab body (37), at least one inlet/outlet (61) and a coupler body (35) positioned around the stab body (37), wherein the coupler body (35) is adapted to rotate relative to the stab body (37). Also included is at least one hydraulic coupling element (70) positioned on the coupler body (35) and at least one coiled tube (52) positioned around the stab body (37), the at least one coiled tube (52) being in fluid communication with the at least one first hydraulic coupling element (70) and the at least one inlet/outlet (61). |
| US11885192B1 |
Wireline jarring tool and methods of use
A wireline jarring tool includes an elongate body having opposing upper and lower ends, a longitudinal channel defined in the elongate body and extending between the upper and lower ends and sized to loosely receive a wireline, and a jarring assembly housed within the elongate body and operable to generate a jarring force transmittable to a bottom hole assembly (BHA) once the wireline jarring tool is secured to the BHA within a wellbore. The wireline jarring tool is conveyable into the wellbore by translating longitudinally along the wireline, and actuating the jarring assembly is configured to release the BHA from a stuck position within a wellbore. |
| US11885191B2 |
Patch for joining downhole ends of pipes
A downhole tool for joining a string of pipe to a tubular already downhole with a seal element made of metal or metal alloy with a melting point lower than the melting point of the tool and tubular but higher than the temperature of expected downhole operating conditions. |
| US11885190B2 |
Apparatus and method to longitudinally and circumferentially cut and remove a section of a wellbore tubular
An apparatus for cutting sections of a wellbore tubular includes a housing shaped to enable movement along an interior of the tubular. The housing has an upper end arranged to connect to a conveyance and a lower end comprising a guide. Cutting materials are disposed in the housing and arranged to cut the wellbore tubular in two, longitudinally spaced apart circumferential cuts and at least one longitudinal cut extending between the circumferential cuts. The cutting materials are arranged to create the circumferential cuts simultaneously or with a time delay chosen to optimize energy created when cutting. A method for cutting wellbore tubulars includes positioning the apparatus at a selected position in the wellbore and actuating the cutting materials. |
| US11885187B2 |
Control line activated tubing disconnect latch system
A method and apparatus are disclosed that use a control line to expand a piston that shears pins to disconnect a latching system for wellbore operations. |
| US11885186B2 |
High-temperature and high-pressure drilling fluid inhibition evaluation device and usage method thereof
A drilling fluid inhibition evaluation device includes a main test member, a temperature control pressurization system, a gas source, a circulation heating system, a confining pressure pump, a central control system, a computer, an ultrasonic detector and a safety valve electrically connected through pipelines, respectively, the main test member and the temperature control pressurization system sequentially connected with the gas source; the present disclosure can pre-pressurize experimental fluid and then inject the fluid into a dilatometer, so as to prevent the fluid from generating obvious changes of phase states, eliminate pressure setting errors caused by a saturated vapor pressure of the fluid, improve accuracy of evaluation results, inspect a real expansion state of the sample and simultaneously monitor structural change characteristics of a rock sample in real time through reflection conditions of sound waves. |
| US11885183B2 |
Downhole inductive coupler with ingot
An inductive coupler and method for a downhole tool such as a drill pipe comprising an electrically conductive ingot cast into a magnetically conducting electrically insulating (MCEI) annular mold. The MCEI mold may comprise an annular channel comprising a first perforation and one or more second perforations. The ingot may comprise first and seconds with sockets proximate the respective ends. The first perforation may comprise an electrical connection to a ground pin in the downhole tool. The one or more second perforations may comprise electrical connections to a similarly configured ingot within the downhole tool and to electrical equipment within the drill pipe. The ingot may further comprise cleats and flutes. The ingot may comprise an annular passageway around the interior of the ingot. The ingot may be sealed within the channel and each of the perforation may comprise a seal insolating the electrical connections from the downhole environment. |
| US11885180B2 |
Modular ladder system
A modular ladder system includes a first ladder module comprising a first plurality of ladder steps; a second ladder module comprising a second plurality of ladder steps; and a ladder base, the modular ladder system is configurable in an unassembled configuration and an assembled configuration; wherein: in the unassembled configuration, the first ladder module is detached from the second ladder module and the first and second ladder modules are stacked on the ladder base; and in the assembled configuration, the first ladder module is coupled to the ladder base and the second ladder module is attached to the first ladder module opposite the ladder base to define a ladder extending upward from the ladder base. |
| US11885175B2 |
Method, system and apparatus for controlling excessive gaps of a door
A method and system configured to correct a non-compliant, excessive gap condition between a door and a frame, correct a non-compliant, excessive gap condition between a pair of doors at the meeting edge, correct a non-compliant, excessive gap condition at least using a formed metal edge and mechanical fasteners, and correct a non-compliant, excessive gap condition at least using a formed metal edge and mechanical fasteners, whereby the formed metal edge may vary in dimensions to accommodate uneven gaps. |
| US11885174B2 |
Solar control coatings with quadruple metallic layers
A coated article includes a substrate, a first dielectric layer, a first metallic layer, a second dielectric layer, a second metallic layer, a third dielectric layer, a third metallic layer, a fourth dielectric layer, a fourth metallic layer and a fifth dielectric layer. At least one of the metallic layers is a discontinuous metallic layer having discontinuous metallic regions. An optional primer is positioned over any one of the metallic layers. Optionally a protective layer is provided as the outer most layer over the fifth dielectric layer. |
| US11885171B2 |
Vehicle interior component
A vehicle interior component is disclosed. The component may comprise a base comprising a bin; a cover moveable from a closed to an open position through an unlatched position; and a mechanism moveable to an extended position to prevent the cover from opening when subjected to an inertial force. The mechanism may hold the cover in a blocked position partially uncovering the bin. The mechanism may be re-set by opening the cover. The mechanism may comprise a blocker to prevent the cover from moving from the unlatched position to the open position. The cover may comprise a cam surface configured to move the blocker to re-set the mechanism and allow the cover to open. The cover may comprise an interface/bottom surface accessible when the cover is blocked by the mechanism. The component may comprise a console; storage compartment; instrument panel; floor console; or center console. |
| US11885168B2 |
Sliding barrier tracking system
Disclosed herein is a sliding door system including a motor, a driveshaft coupled to the motor, and a coupling mechanism fastened to the sliding door. The coupling mechanism is configured to convert rotation of the driveshaft into linear motion of the sliding door, such that movement of the coupling mechanism is directly correlated to movement of the sliding door. The sliding door system also includes a rotary encoder, a belt mechanically coupled to the coupling mechanism. The belt, as moved by the coupling mechanism, is configured to turn the rotary encoder as the sliding door moves, such that movement of the rotary encoder is directly correlated to movement of the sliding door and not directly correlated to movement of the motor and driveshaft. |
| US11885165B2 |
Furniture board having a hinge, and furniture item having such a furniture board
A furniture board includes an integrated or inserted hinge for guiding a movable furniture part. The furniture board has two side faces, an end face, and an end-face recess for receiving a hinge. The hinge includes a basic element, a linear guide and a pivot guide hinged thereto. The linear guide has forcibly guided movable elements, to which the pivot guide is hinged at a distance from the basic element. Two side faces of the furniture board lie one in a first and one in a second plane. The linear guide and the hinged connection of the pivot guide to the linear guide lie between the first and the second plane, at least in a closed state of the hinge. |
| US11885164B2 |
Coupling device and terminal equipment
A terminal device with a folding screen includes a coupling device with a middle frame fixing member, a first transmission assembly, a second transmission assembly and a third transmission assembly. A first transmission assembly is rotatable relative to the middle frame fixing member during rotation of the middle frame fixing member. The second transmission assembly has a first end hinged to the first transmission assembly and a second end slidably coupled to the first transmission assembly, and the second transmission assembly converts a rotation action of the first transmission assembly into a moving action along a second direction. A third end of the third transmission assembly pushes the middle frame fixing member to move towards a first side facing away from the first transmission assembly or a second side towards the first transmission assembly during the rotation of the middle frame fixing member. |
| US11885162B2 |
Counter balance device for a sash window
A counter balance device for a sash window includes a spiral balance having a hand-wound spiral rod connected to wind a torsion spring to generate an initial spring force that counter balances the window's weight for keeping the sash up when raised. The lower end of the spiral rod is connected to a rotation shaft rotatably disposed on a slide block. When a large repulsion force produced by the torsion spring is applied to the spiral rod, the rotation shaft is urged in a direction reverse to the rotation direction of the spiral rod by a buffer spring having a spring force which is larger than the initial spring force so that the rotation of the rotation shaft is tolerated. |
| US11885158B2 |
Deployable handle system using remote actuator
A vehicular door actuation system for a door of a vehicle includes a handle assembly, a latch and an actuator. The handle assembly includes a handle portion and a base portion. The base portion is disposed at the door of the vehicle and the handle portion is movable between a recessed position, where the handle portion nests at least partially in the base portion, and a ready position, where the handle portion extends from the base portion. The actuator is disposed at the door of the vehicle separate and remote from the handle assembly. A handle linkage operatively couples operation of the actuator to the handle portion to move the handle portion from the recessed position to the ready position. The latch mechanism latches the door in a closed state, and unlatches the door responsive to a user pulling the handle portion from the ready position to open the door. |
| US11885157B2 |
Latch assembly
An appliance door closure assembly is provided and comprises an inner door selectively coupled with an outer door. An anchor is in connection with the inner door and defines a retention space. A latch assembly is in connection with the outer door. The latch assembly includes a first cam having a first contact surface and pivotally coupled to a base. A second cam has a second contact surface engaged with the first contact surface of the first cam. The latch assembly is movable between a first position and a second position. |
| US11885156B2 |
Locking device for an electrical switchboard
A locking device includes: a housing intended to be mounted on an electrical switchboard between a first switching apparatus and a second switching apparatus, each of the switching apparatuses having a control lever able to move between a lower position, corresponding to an open state, and an upper position, corresponding to a closed state, a locking member able to move in rotation between: a first locking position, in which the locking member blocks the control lever of the first switching apparatus in the open position, and a second locking position, in which the locking member blocks the control lever of the second switching apparatus in the open position. |
| US11885155B2 |
Cabinet lock for use with programmable electronic key
A cabinet lock for protecting merchandise within a merchandise display cabinet having an inner door and an outer door. The cabinet lock includes a strike plate affixed to the inner door and a lock housing affixed to the outer door such that the cabinet is in a locked configuration that prevents access to the merchandise when the lock housing is operably engaged to the strike plate. A programmable electronic key communicates a security code with the cabinet lock and transfers electrical power to the cabinet lock to operate a lock mechanism between the locked configuration and an unlocked configuration. An indicator is provided for indicating whether the cabinet lock is in the locked configuration or the unlocked configuration. The indicator includes a first segment and a second segment that can be energized to visually indicate the status of the cabinet lock. |
| US11885150B2 |
Disc tumbler cylinder lock and key combination
A combination of a disc tumbler cylinder lock and a key. The disc tumbler cylinder lock includes rotation limiting device for the key and a guiding element. The key includes grooves for the guiding element, which has two rails making up some of said rotation limiting device, and both of the rails include at least one limiter protrusion arranged to facing inward in the disc tumbler cylinder lock. The key includes at least one recess for the limiter protrusions. The rotation limiting device further includes a front guide having the rails in association therewith. The front guide and the rails are arranged to allow the key, which is in a basic position in the disc tumbler cylinder lock, to be turned for releasing the locking of the disc tumbler cylinder lock. |
| US11885147B2 |
Large format theater design
Theater designs including social media, and theater entrances configured to draw patrons into a main area of the theater including an entrance having a curved wall and curved walkway having a horizon drop-off for display of content related to a motion picture or other feature to be shown in the theater. The content may be interactive or otherwise linked to patrons passing a hallway including the curved wall. Spatialized sound corresponding to the video “moves” with objects in the video and with patrons as they traverse walkway. |
| US11885142B2 |
Stair and walkway system and method
Disclosed is an arrangement including a staircase as well as walkway systems. The staircase includes a transitional member, and the walkways incorporate grate supports in order to facilitate the connection to adjacent structures. The arrangement also utilizes angled members which are configured with a reinforced flange existing in a dimension that has higher load requirements than the other flange. A novel step configuration is also disclosed. |
| US11885140B2 |
Prefabricated tile strip
A prefabricated tile strip includes a backing board, a tile region having plural tiles and grout. The grout can be composed of a resin/polymer-based grout that allows for superior water resistance, stain resistance, crack resistance and is transportable without breaking. The strip includes an edge region or flange on either side of the tiles to allow for simple screw in and glue on assembly, not even a wall is necessary, the strip can be attached directly to the studs. A step over/under water resistant edges can go directly onto a bathtub or shower ledge or onto the wet area of a tile floor (not separate ledge), allowing it to go straight down to the bottom of a shower floor, or It can step right over a thin plastic flange on a tub or shower base. |
| US11885139B2 |
Mounting device for building surfaces having elongated mounting slot
A mounting device or bracket for paneled building surfaces is disclosed. The mounting bracket includes an upper wall in the form of a flat surface for supporting various types of attachments. An elongated mounting slot extends through the upper wall, and the mounting bracket includes an elongated nut receptacle that is positioned below this elongated mounting slot. With an attachment being positioned on the upper wall, an attachment fastener may be directed through the attachment, then through the elongated mounting slot, and then may be threadably engaged with a nut that is positioned within and movable along the nut receptacle in its elongated dimension. The elongated configuration of the mounting slot and nut receptacle provides adjustability for the position of the attachment fastener relative to the mounting bracket, including after the mounting bracket has already been installed on the building surface. |
| US11885136B2 |
Handrail, kit, and method for installation of same
A handrail kit that includes a cover, a first endcap, a second endcap, and a support member is provided. The support member includes a longitudinal axis, a first end along the longitudinal axis, a second end along the longitudinal axis, a first lateral side, a second lateral side, a first longitudinal side, and a second longitudinal side. The first lateral side of the support member is configured to be secured directly against a mounting surface. The first endcap is configured to mate with the first end of the support member and the second endcap is configured to mate with the second end of the support member. The cover is configured to be placed over the second lateral side of the support member and to engage the first longitudinal side and the second longitudinal side of the support member. |
| US11885133B2 |
Soffit vent
An exterior elevated assembly with a walking surface is described which has features for facilitating inspection of the interior support frame of the assembly. The assembly includes a support frame for the walking surface, which defines an interior space and a soffit covering an underside of the support frame. The soffit provided with an opening. A vent panel is provided for covering the opening and a vent panel retention mechanism is provided for reversibly holding the vent panel in place over the opening. Methods and kits for installing a vent panel in a soffit of an exterior elevated assembly with a walking surface are also described. |
| US11885132B2 |
Non-combustible, net-zero energy building systems
Methods, systems, and apparatus for constructing a wall panel and building are disclosed. The wall panel can include: fiber-reinforced concrete layers including concrete with interwoven fibrous materials; an insulation layer; and a connector. The insulation layer is sandwiched between the fiber-reinforced concrete layers, and the connector extends through the insulation layer and concrete layers to create composite action between the insulation layer and the concrete layers. |
| US11885130B2 |
Ceiling grid lighting assembly with configured alignment
A ceiling grid lighting assembly for use in suspended ceiling systems is provided with multiple linear lighting modules in parallel arrangement. End plates are used to connect, support, and enclose longitudinal ends of the elongate body of each linear lighting modules while simultaneously functioning as reflective faces for optical cavities. A configured gap spacing between individual linear lighting modules can be used to house and support components such as additional light sources, acoustic or decorative panels, HVAC components, or power systems, controls or sensors. The end plate can also be configured to allow a T-bar to be placed in the configured gap spacing thereby enabling the mounting of the assembly in-line upon the longitudinal axis of a ceiling grid T-bar. Embodiments of linear lighting modules are presented comprising LED light sources, light guides and diffusers housed within the elongate body. The light guides may be edgelit from one or two sides and aligned horizontally or tilted relative to the ceiling grid plane. |
| US11885124B2 |
Prefabricated construction wall assembly
A prefabricated construction wall assembly comprising: a frame structure having a first thermal expansion coefficient; and a panel configured for covering at least a majority of the a face of the frame structure, said panel having a second thermal expansion coefficient different from the first thermal expansion coefficient, and a solid-surface exterior face exposed to an exterior of the wall assembly and an interior face connected to the face of the frame structure so as to withstand the thermal structural differences between the frame structure and the exterior face. |
| US11885121B2 |
System and method for protecting structures
Systems and methods are disclosed for protecting structures. In example embodiments, one or more waterproof barrier panels are sealed to one or more exterior walls of the structure. In other example embodiments, the barrier system comprises a plurality of sealing elements, protective panels and, optionally, tracks comprising shackles or hooks for suspending the protective panels. The barrier panel optionally comprises a thermoplastic olefin, and further optionally comprises a fire-resistant material. |
| US11885117B2 |
Structure having edge reinforcement on profiled rail
A profiled rail assembly for casting into concrete. The profiled rail assembly includes a profiled rail including a rail body having a rail slot extending in the direction of a longitudinal axis of the profiled rail, and a reinforcing body including a head element and at least one tension element protruding from the head element, the head element opposite the at least one tension element having a head element major face defining a contact surface for a formwork element. The at least one tension element is connected to the profiled rail. |
| US11885113B2 |
Drain system for use with a tile floor
A drain system includes a drain cover positionable over a drain opening in a floor. The drain cover has a sidewall extending about a periphery of the drain cover and a release surface on the sidewall tapering or sloping inwardly toward a bottom of the drain cover. The release surface is arranged to interface with a support frame configured to support and position the drain cover over the drain opening and reduce frictional and shear forces between the drain cover and the support frame during removal of the drain cover from the support frame. |
| US11885109B2 |
Washdown flush toilet
In a washdown flush toilet, a water discharge trap conduit includes: an inlet pipe part connected to a bowl part receiving waste; a trap ascending pipe part connected to the inlet pipe part and forming an ascending flow channel; and a trap descending pipe part connected to the trap ascending pipe part and forming a descending flow channel. With regard to a cross section perpendicular to a flow direction of the ascending flow channel, a portion on a downstream side of the ascending flow channel is provided with an enlarged part having a cross section area larger than that on an upstream side of the ascending flow channel. A downstream end of the ascending flow channel and/or an upstream side of the descending flow channel is provided with a shrunk part having a cross section area smaller than that on the upstream side of the ascending flow channel. |
| US11885108B2 |
Work machine and periphery monitoring system
In a hydraulic excavator including a machine body and a front work device, when an object is detected by sensors for detecting an object around the machine body when operation limiting control for limiting the operation of at least one of the machine body and the front work device is enabled, or when an operation device is operated, the detection of the object is notified to an operator by a first state warning, and when the operation limiting control is enabled and when the operation device is not operated, the detection of the object is notified to the operator by a second state warning that is weaker in warning intensity than the first state warning. Accordingly, the botheration for the operator can be suppressed while securing the effectiveness of an alarm in periphery monitoring, and the safety performance can be enhanced. |
| US11885107B2 |
Hose support structure, link for work vehicle, and work vehicle
A hose support structure includes a first round bar and a second round bar provided on a mounting surface of a first plate and extending in a first direction. A first restraint and a second restraint face the mounting surface in a second direction and are provided between the first round bar and the second round bar in a third direction. The first restraint extends from a first proximal end toward a first distal end in a fourth direction, and the second restraint extends in a fifth direction opposite to the fourth direction from a second proximal end connected to the first proximal end. A third restraint is provided opposite to the second restraint with respect to the first restraint in the first direction. At least a part of the second restraint is separated from the mounting surface by a second distance shorter than the first distance in the second direction. |
| US11885106B2 |
Working machine
A working machine includes: a support bracket provided on a machine body and including a boom pivotal support portion and a cylinder pivotal support portion; a boom pivotally supported by the boom pivotal support portion; a boom cylinder pivotally supported at the cylinder pivotal support portion and the boom, and causing the boom to swing upward and downward; a hydraulic hose extended through the support bracket from the rear of the support bracket to the front of the support bracket and connected to the boom cylinder; a first clamp to retain the hydraulic hose on the support bracket; and a second clamp to retain the hydraulic hose on the boom cylinder. The support bracket includes a through hole through which the hydraulic hose is passed in a fore-and-aft direction. The first clamp is disposed rearward of the through hole and forward of the rear end of the boom shaft. |
| US11885101B2 |
Remote operation system and remote operation server
Provided is a system which can avoid instability of an operating state of a working machine, when switching a remote operation actor of the working machine. In a case where a state of one or both of a working machine 40 or a first operator is a specified state when the working machine 40 is remotely operated through a first remote operation apparatus 10, a first notification corresponding to the specified state is transmitted to a remote operation server 30. In the remote operation server 30, a second remote operation apparatus 20 which is appropriate in view of content of the first notification is selected as the remote operation actor of the working machine 40. |
| US11885100B2 |
Quad track skid-steer loader
Disclosed embodiments are directed to quad track skid-steer loaders and power machines having a frame, a cab, and a lift arm assembly pivotally coupled to the frame rearward of at least a portion of the cab and extending forward of the frame. A first axle assembly and a second axle assembly on a first side of the frame mount first and second track assemblies. A third axle assembly and a fourth axle assembly on a second side of the frame mount third and fourth track assemblies. A first drive motor rotates the first and second axles to drive the first and second track assemblies and a second drive motor rotates the third and fourth axles to drive the third and fourth track assemblies. |
| US11885098B2 |
Serrated blade assembly using differently configured components
A wear member comprises a shank portion defining a longitudinal axis, a free end and a perimeter, at least one flat surface on the perimeter extending to the free end and a cross-hole defining a cross-hole axis along which the cross-hole extends through the at least one flat surface perpendicularly, and a wear portion extending downwardly axially from the shank portion, the wear portion including a polygonal configuration. |
| US11885095B1 |
Loader with improved arm path
A compact utility loader compact utility loader comprising a frame, a first track and a second track positioned on either side of the frame, and a pair of loader arms. The loader arms are configured to couple with an attachment via a hitch plate and a hitch pin. The compact utility loader is configured such that as the loader arms are raised and lowered, the hitch pin follows a path approximately defined by a curve ƒ(x)=4.641e0.34x The value “x” represents a horizontal direction and the function f(x) represents a vertical direction. |
| US11885094B2 |
Product and method for sealing and lubricating sewer manhole assemblies
A sewer manhole cover includes a frame having an access aperture and a cover for covering the access aperture. A primary seal is generated when the cover is placed on the frame either by way of contact between the frame and cover or by way of a gasket received within a groove formed into one of the frame or cover, wherein the gasket is compressed between the frame and cover. A method is provided for generating a secondary seal between the frame and cover by applying an amount of a viscous compound to a circumferential surface of the frame or cover, wherein the secondary seal is formed when the cover compresses the compound when the cover is received within the frame. |
| US11885093B2 |
Method of installing a hybrid foundation for offshore wind turbines
A method of installing a hybrid foundation for an offshore wind turbine, the method includes providing a monopile, friction wheel, and suction bucket; installing the friction wheel and suction bucket in the sea floor; and inserting the monopile through the opening into the sea floor. |
| US11885090B2 |
Frame rail assemblies and interlocking frame rail systems
A frame rail assembly for a boat dock structure includes a frame rail member and a removable resilient rub-rail member. The frame rail member includes a first side configured for securing the frame rail member to a side of the boat dock structure; a second side opposing the first side; a first channel extending along a length of the frame rail member; and a second channel below the first channel, the second channel extending along the length of the frame rail member. An interlocking frame rail system for boat dock structures includes a first frame rail member, a second frame rail member, and an upper connector member extending along at least a portion of a length of the first frame rail member and at least a portion of the length of a second frame rail member. |
| US11885082B2 |
Deck system
A deck system is disclosed having a mounting plate with a planar support surface and at least one locating rod extending from the support surface. The locating rod extends in a direction that is substantially perpendicular to the support surface. A beam having a first end and a second end is positioned on the support surface of the mounting plate. The first and second ends of the beam have a slot and the slot is disposed for receiving the locating rod. At least one tread is disposed to extend between the two spaced apart parallel oriented beams. The tread has opposed shoulders on the side of the tread that engages the spaced apart beams. The opposed shoulders are disposed for engaging a side of the spaced apart beams that are in adjacent relationship. |
| US11885076B2 |
Roadway infrastructure for autonomous vehicles
An elevated roadway for autonomous vehicles may include a pylon extending vertically from a ground anchor and comprising a metal tube defining a central cavity and a concrete column within the central cavity. The elevated roadway further includes a bracket coupled to the pylon and comprising a mounting plate secured to the pylon and a cantilevered road support member extending from the mounting plate. The elevated roadway may further include a cantilevered road section coupled to the pylon via the cantilevered road support member and comprising a joist structure structurally coupled to the cantilevered road support member, a road member above the joist structure and supported by the joist structure, and first and second side barriers along first and second sides of the road member, respectively. The road member may be adapted to receive a four-wheeled roadway vehicle. |
| US11885074B2 |
Tie plate dispenser and method therefore
Present embodiments relate to a tie plate dispenser which selectively changes the orientation of the tie plates being ejected, if needed. An actuator is used to flip the tie plate as it falls from an ejection location of the dispenser. |
| US11885073B2 |
Durable and dispersible creped mutli-ply tissue
Disclosed are multi-ply tissue products comprising a non-crosslinked binder that are durable and dispersible. The products generally have a Slosh time less than 2 minutes, such as less than about 60 seconds, such as less than about 45 seconds. Surprisingly, the foregoing Slosh times are achieved despite the tissue products having relatively high cross-machine direction (CD) wet tensile strength, such as greater than about 100 g/3″. Typically, increasing wet tensile strength, particularly wet CD tensile strength, negatively effects dispersability and increases Slosh time. Despite this trend, the present invention surprisingly provides a tissue product having a relatively high degree of wet strength and good dispersability. |
| US11885071B2 |
Aramid-mica composite insulating nanopaper and preparation method thereof
An aramid-mica composite insulating nanopaper and a preparation method thereof are disclosed. A mixture of mica and urea is subjected to a solid-phase ball milling, to obtain nano mica modified with amino groups on the surface, which is then assembled with the aramid nanofiber by stepwise suction filtration according to the present disclosure, to form an ordered nanopaper, thereby obtaining an aramid-mica composite insulating nanopaper with ultra-high insulation performances. |
| US11885069B2 |
Processes, methods, and systems for chemo-mechanical cellular explosion and solid and liquid products made by the same
Disclosed herein is a process, comprising combining one or more additives with a feedstock to obtain a first mixture, the feedstock comprising a fibrous material and water, the fibrous material comprising lignin, cellulose, and hemicellulose; and conditioning the first mixture to obtain a liquid product and a dry pulp product. Also disclosed herein are condition processes and machines for use with the same. Also disclosed herein are liquid products, dry pulp products, and fibrous pellets made by the disclosed processes, and methods of using the same. |
| US11885067B2 |
Warp transferring machine
A warp transferring machine includes a color transferring unit, a colored paper unit and a yarn arranging unit. The color transferring unit includes a heating roller, a driving shaft, a separable shaft, a supporting shaft that are rotatable about their respective axes and a pressing belt that is looped therearound to circulate continuously. The colored paper unit and the yarn arranging unit respectively guide a colored paper and a yarn toward the heating roller such that the pressing belt presses thereagainst so as to transfer colors of the colored paper onto the yarn. |
| US11885064B2 |
Apparatus for drying laundry or other items using ultraviolet radiation
An apparatus for drying laundry with ultraviolet radiation is provided. One or more ultraviolet light sources emit ultraviolet radiation, which, in various embodiments, is transmitted through a UV-radiation permeable transparent drum containing the wet laundry and other wet articles to be dried. Also provided is a dryer having ultraviolet light sources centrally situated with respect to the drum, wherein the ultraviolet light sources emit ultraviolet radiation directed at laundry in the drum. |
| US11885061B2 |
Washing machine appliance spacer assembly
A washing machine appliance is provided, including a cabinet having a rear panel, a wash tub located within the cabinet, and a shipping spacer assembly. The shipping spacer assembly is removably attached to the wash tub for fixing a distance between the wash tub and the cabinet in an installed position. The shipping spacer assembly includes a bolt, a spacer, and a locking mechanism. The bolt includes a shaft extending along an axial direction, and a head located at one end of the shaft. The bolt defines a lock-receiving feature along the shaft. The spacer defines a bolt cavity extending along the axial direction and removably receives the shaft. The locking mechanism removably engages the bolt at the lock-receiving feature to secure the spacer to the bolt. |
| US11885059B2 |
Suspension system
A laundry appliance includes a cabinet frame that defines a receiving aperture. A tub is disposed within the cabinet frame. A suspension support includes an engagement portion. The engagement portion includes an ejection surface sloping in a first direction and an assembling surface sloping in a second opposing direction to a retaining notch. A suspension rod extends between the tub and the suspension support and has a hook for selectively engaging the assembling surface in an installed position and selectively engaging the ejection surface in a misaligned position. |
| US11885058B2 |
Laundry treating appliance and method of operation
A laundry treating appliance for treating laundry items according to a cycle of operation includes a chassis defining an interior. A rotatable treating chamber is located within the interior. An antenna is configured to receive RFID data from RFID tags on the laundry items and outputs a signal indicative of the RFID data. A controller receives the signal from the antenna and is configured to process the signal and to suggest, alter, or implement the cycle of operation based on the signal. |
| US11885052B2 |
Braiding machines and carriers for braiding machines
A carrier for supporting a yarn to be used by a braiding machine, has: a spool carrying the yarn; a motor drivingly engaged to the spool; at least one sensor for producing data about a condition of the yarn in the spool; and a controller operatively connected to the motor and to the at least one sensor, the controller having a processor and a computer-readable medium operatively connected to the processor and having instructions stored thereon executable by the processor for: receiving said data from the at least one sensor; determining operation parameters of the motor based on the received data; and operating the motor per the determined operation parameters to create the desired tension in the yarn. |
| US11885049B2 |
Mesh belt used in apparatus for producing water absorbing body
A mesh belt used in a process for producing a water absorbing body which is formed by warps and wefts being woven with each other. One or more yarns which constitute(s) the warps or the wefts emerging on at least a transporting surface side of the mesh belt is made of an electrically conductive material. |
| US11885046B2 |
Web stretching device disposed between a carding device and a cross-lapper
Apparatus for forming a fibre mat, in particular a non-woven mat, comprising a fibre web-forming device, for example a card, a cross-tapper and a device for drafting the fibre web(s) disposed between the web forming device and the cross-lapper in order to draft the fibre web(s), in particular in a time-varying, specifically periodic manner, to thereby adjust a predetermined desired profile of the fibre mat leaving the cross-lapper, the web-forming device comprising at least one output belt (1, 2) for at least one web (5, 6), and preferably two output belts (1, 2) for two webs (5, 6), an upper and lower web respectively; wherein the cross-hipper has an input belt (7) for receiving the web(s) from the output belt(s) of the web forming device, characterised in that the arrangement is such that the path of the web, or of the at least one web, and preferably of the two, upper and lower, webs, between the output belt(s) of the web-forming device, in particular the card, and the input belt of the cross-lapper includes at least one inflection point (11, 12). |
| US11885044B2 |
Method for producing polypropylene nonwoven fabric
The polypropylene nonwoven fabric produced by the method for producing a polypropylene nonwoven fabric according to the present invention has features that it has excellent stretchability and excellent water pressure resistance. |
| US11885042B2 |
Spinneret assembly for spinning polymeric fibers
A spinneret assembly for spinning polymeric fibers, including: (a) a cap provided with an inlet port and a flared lower surface that flares outwardly from the inlet port in the direction of flow; (b) a spinneret having numerous spinning flow channels through its thickness; (c) a filter freely resting on the spinneret; and (d) a flow guide with a tapered geometry mounted in a cavity defined by the cap and the spinneret. The flow guide has an apex facing the inlet port, a base facing the filter, and one or more side surfaces tapering up to the apex. A diverging flow passage is defined by the tapering side surface(s) of the flow guide and the cap's flared lower surface. The base of the flow guide is spaced apart from an upper surface of the spinneret, creating a space that is in fluid communication with the divergent flow passage. |
| US11885035B2 |
Formation of lining layers in the cathode shells of aluminium electrolytic reduction cells
This disclosure relates to non-ferrous metallurgy and electrolytic production of Aluminium for lining a cathode assembly of an electrolytic cell. The present method includes laying materials while simultaneously distributing same over the surface of a base and levelling them at a height measured from the plane of the top edge of the shell of the cathode assembly of the electrolytic cell by gradually moving a device for installing unformed lining materials along a longitudinal axis of the cathode of the Aluminium electrolytic cell. Said device is configured in the form of a bridge equipped with a mechanical drive for movement. The bridge has guides on which a frame is mounted for vertical movement, said frame having cassettes provided with gates with a mechanical drive. The technical result is reduced labor costs, healthier working conditions for operatives, and better quality installation of the base of an electrolytic cell. |
| US11885034B2 |
Electrical power generation systems and methods regarding same
A solid or liquid fuel to plasma to electricity power source that provides at least one of electrical and thermal power comprising (i) at least one reaction cell for the catalysis of atomic hydrogen to form hydrinos, (ii) a chemical fuel mixture comprising at least two components chosen from: a source of H2O catalyst or H2O catalyst; a source of atomic hydrogen or atomic hydrogen; reactants to form the source of H2O catalyst or H2O catalyst and a source of atomic hydrogen or atomic hydrogen; one or more reactants to initiate the catalysis of atomic hydrogen; and a material to cause the fuel to be highly conductive, (iii) a fuel injection system such as a railgun shot injector, (iv) at least one set of electrodes that confine the fuel and an electrical power source that provides repetitive short bursts of low-voltage, high-current electrical energy to initiate rapid kinetics of the hydrino reaction and an energy gain due to forming hydrinos to form a brilliant-light emitting plasma, (v) a product recovery system such as at least one of an augmented plasma railgun recovery system and a gravity recovery system, (vi) a fuel pelletizer or shot maker comprising a smelter, a source or hydrogen and a source of H2O, a dripper and a water bath to form fuel pellets or shot, and an agitator to feed shot into the injector, and (vii) a power converter capable of converting the high-power light output of the cell into electricity such as a concentrated solar power device comprising a plurality of ultraviolet (UV) photoelectric cells or a plurality of photoelectric cells, and a UV window. |
| US11885033B2 |
Electrode structure for electrolyzer
Disclosed are an electrode structure including: an electrode plate; and a flow path guide disposed on one side of the electrode plate along the circumference of the electrode plate, and an electrolyzer including the electrode structure. |
| US11885031B2 |
Modular electrocatalytic processing for simultaneous conversion of carbon dioxide and wet shale gas
An apparatus for converting carbon dioxide and natural gas liquids into other chemicals and/or fuels, comprising at least one electrochemical cell, wherein the electrochemical cell reduces the endothermic load associated with electrochemical CO2 reduction, and a method for converting carbon dioxide and natural gas liquids into carbon monoxide and other chemicals and/or fuels, comprising converting CO2 into CO and converting C2H6 into C2H4 at a temperature in the range of 650° C.-750° C. |
| US11885028B2 |
Method of selectively interrupting a passive cathodic protection unit from a metallic structure
A method for changing an activation state of an interruption module for selectively interrupting at least one passive cathodic protection unit from a metallic structure. The method includes enabling a global positioning system (GPS) receiver in data communication with a controller of the interruption module, receiving GPS time via the GPS receiver from at least one global positioning system satellite in data communication therewith, synchronizing a real-time clock time of a real-time clock in data communication with the controller to GPS time, disabling the GPS receiver and changing the activation state of the interruption module if a predetermined activation state change time of the interruption module is between the local real-time clock time and the GPS time. |
| US11885025B2 |
High-strength steel sheet having excellent moldability and impact resistance, and method for manufacturing high-strength steel sheet having excellent moldability and impact resistance
A high-strength steel sheet includes a chemical composition including: by mass %, C: 0.080 to 0.500%, Si: 2.50% or less, Mn: 0.50 to 5.00%, P: 0.100% or less, S: 0.0100% or less, Al: 0.001 to 2.500%, N: 0.0150% or less, O: 0.0050% or less, and the balance: Fe and inevitable impurities. The high-strength steel sheet satisfying a predetermined formula has a microstructure in a region from ⅛t to ⅜t from a steel sheet surface. The microstructure includes: by volume %, 20% or more of acicular ferrite, 20% or more of an island-shaped hard structure including residual austenite, 2% to 25% of residual austenite, and 20% or less of aggregated ferrite. |
| US11885024B2 |
Gas introduction structure and processing apparatus
A gas introduction structure extends in a longitudinal direction of a processing container having a substantially cylindrical shape to supply gas into the processing container. The gas introduction structure includes an introduction section that partitions an introduction chamber, an ejection section that partitions a plurality of ejection chambers each including a plurality of gas holes through which the gas is ejected into the processing container, and a branch section that partitions a branch chamber connected to the introduction chamber. The branch chamber is branched to correspond to the number of ejection chambers in a tournament manner and connected to the ejection chambers. |
| US11885023B2 |
Substrate retaining apparatus, system including the apparatus, and method of using same
A substrate retaining apparatus, a load lock assembly comprising the substrate retaining apparatus, and a system including the substrate retaining apparatus are disclosed. The substrate retaining apparatus can include at least one sidewall and one or more heat shields. One or more of the at least one sidewall can include a cooling fluid conduit to facilitate cooling of substrates retained by the substrate retaining apparatus. Additionally or alternatively, one or more of the at least one sidewall can include a gas conduit to provide gas to a surface of a retained substrate. |
| US11885021B2 |
Gas supply member with baffle
A gas supply member includes a first side opposite a second side and an inner surface defining a first opening extending between the first and second sides. The gas supply member includes a third side orthogonal to the first side, the third side includes a first extension that has a face partially defining the second side, and the first extension includes a first plurality of holes extending through the first extension to the face. The gas supply member includes a fourth side opposite the third side, the fourth side includes a protrusion that has a face partially defining the second side. The gas supply member also includes a baffle disposed adjacent to the inner surface, the baffle includes a first portion extending from the inner surface and a second portion attached to the first portion, and the second portion orthogonal to the first portion and parallel to the third side. |
| US11885008B2 |
Film forming apparatus and method for reducing arcing
Embodiments of the present disclosure provide a substrate processing system. In one embodiment, the system includes a chamber, a target disposed within the chamber, a magnetron disposed proximate the target, a pedestal disposed within the chamber, and a first gas injector disposed at a sidewall of the chamber. The first gas injector includes a first gas channel extending through a body of the first gas injector, the first gas channel has a first gas outlet. The first gas injector also includes a second gas channel extending through the body of the first gas injector, wherein the second gas channel has a second gas outlet. The second gas channel includes a first portion, and a second portion branching off from an end of the first portion, wherein the second portion is disposed at an angle with respect to the first portion, and the first gas injector is operable to rotate about a longitudinal center axis of the body of the first gas injector. |
| US11884998B2 |
Surface treated steel sheet
Provided is a surface treated steel sheet which includes a base metal, and a plated layer formed on a surface of the base metal, wherein an average composition of the plated layer contains, in mass %, Mg: 0.5 to 2.0%, and [60.0≤Zn+Al≤98.0], [0.4≤Zn/Al≤1.5], and [Zn/Al×Mg≤1.6] are satisfied. |
| US11884997B2 |
Hot rolled plate or forging of an austenitic steel
A hot rolled plate or forging of an austenitic steel not susceptible to relaxation cracking is provided. The hot rolled plate or austenitic steel includes a composition having in percentages by weight: 0.019%≤C≤0.030%, 0.5%≤Mn≤2%, 0.1%≤Si≤0.75%, Al≤0.25%, 18%≤Cr≤25%, 14%≤Ni≤17%, 1.5%≤Mo≤3%, 0.001%≤B≤0.008%, 0.25%≤V≤0.35%, 0.23%≤N≤0.27%, the balance being iron and unavoidable impurities, Ni(eq.)≥1.11 Cr(eq.)−8.24, Cr(eq)=Cr+Mo+1.5Si+5V+3Al+0.02, Ni(eq)=Ni+30C+x(N−0.045)+0.87; x=30 for N≤0.2, x=22 for 0.2 |
| US11884993B2 |
Process for leaching metal sulfides with reagents having thiocarbonyl functional groups
This application pertains to methods of recovering metals from metal sulfides that involve contacting the metal sulfide with an acidic sulfate solution containing ferric sulfate and a reagent that has a thiocarbonyl functional group, wherein the concentration of reagent in the acidic sulfate solution is sufficient to increase the rate of metal ion extraction relative to an acidic sulfate solution that does not contain the reagent, to produce a pregnant solution containing the metal ions. |
| US11884990B2 |
High strength hot rolled or cold rolled and annealed steel and method of producing it
A steel strip or sheet having a complex phase microstructure including one or more of ferrite, carbide free bainite, martensite and/or retained austenite in its microstructure including: 0.16-0.25 wt. % C; 2.3-4.00 wt. % Mn; 5-50 ppm B; 5-100 ppm N; 0.001-1.10 wt. % Al tot; 0.05-1.10 wt. % Si; 0-0.04 wt. % Ti; 0-0.10 wt. % Cu; 0-0.10 wt. % Mo; 0-0.10 wt. % Ni; 0-0.20 wt. % V; 0-0.05 wt. % P; 0-0.05 wt. % S; 0-0.10 wt. % Sn; 0-0.025 wt. % Nb 0-0.025 wt% Ca; remainder iron and inevitable impurities. |
| US11884987B2 |
Galvannealed steel sheet
A method for the manufacture of a galvannealed steel sheet including the provision of a specific steel sheet, a recrystallization annealing with specific heating, soaking and cooling sub-steps using an inert gas, a hot-dip galvanizing and an alloying treatment; the galvannealed steel sheet and the use of the galvannealed steel sheet. |
| US11884980B2 |
Method for detection of traumatic brain injury
The present disclosure describes significant methylation changes in multiple genes and multiple metabolites in body fluid in response to TBI. Gene pathways affected included several known to be involved in neurological and brain function. A large number of good to excellent biomarkers for the detection of TBI was identified. The combination of epigenomic, clinical and metabolomic markers in different combinations overall were highly accurate for the detection of pediatric concussion using Artificial Intelligence-based techniques. |
| US11884978B2 |
Pathogen biomarkers and uses therefor
Disclosed are compositions, methods and apparatus for diagnosing and/or monitoring a virus-associated systemic inflammation by measurement of a host immune response. The invention can be used for diagnosis including early diagnosis, monitoring, making treatment decisions, or management of subjects suspected of having systemic inflammation associated with an infection. More particularly, the present disclosure relates to peripheral blood RNA and protein biomarkers that are useful for specifically distinguishing between the host systemic immune response to viruses as compared to the host immune response to other causes of systemic inflammation. |
| US11884977B2 |
Nanoarrays and methods of use thereof
Disclosed herein, inter alia, are nanoarrays and methods of use thereof. |
| US11884975B2 |
Sequencing methods and compositions for prenatal diagnoses
The invention provides methods for determining aneuploidy and/or fetal fraction in maternal samples comprising fetal and maternal cfDNA by massively parallel sequencing. The method comprises a novel protocol for preparing sequencing libraries that unexpectedly improves the quality of library DNA while expediting the process of analysis of samples for prenatal diagnoses. |
| US11884974B2 |
TIM-3 nanobody, a preparation method thereof, and use thereof
The application belongs to the technical field of animal or human antibodies, and discloses a TIM-3 nanobody, a preparation method thereof and use thereof. The nanobody is a TIM-3 nanobody with sequence of SEQ ID NO:1. TIM-3 antigen is a transient transfection expression by mammalian cells. TIM-3 antigen is used to screen the nanobody library repeatedly, specific phage of nanobody is obtained, and the target fragment is conducted sequencing. The application uses the HEK293 cell line to express antigen. Using the mammalian expression system to express human protein may maximumly guarantee the original structure of the protein, guarantee the protein to have a post-translational modification and specific modifications of eukaryotic proteins such as glycosylation, which makes the obtained protein have high activity. This method maximizes the original structure and activity of the protein; the nanobodies screened by the application can efficiently and specifically bind to the target. <110> Shihezi University <120> TIM-3 nanobody, a preparation method thereof, and use thereof <160> 3 <210> 1 <211> 1049 <212> DNA <213> Artificial Sequence <400> 1 GGTGGGCGGA CATTTCACAA GCTTAAGGAG ACAGTACATA TGAAATACCT ATTGCCTACG GCAGCCGCTG GATTGTTATT ACTCGCGGCC CAGCCGGCCA TGGCCCAGGT GCAGCTGCAG GAGTCTGGAG GAGGCTTGGT GCAGCCTGGG GGGTCTCTGA GACTCTCCTG TGCAGCCTCT GGGTTCACCT TCCGTAGATC TATTCTGAAA TGGCTCCGAC AGGCTCCAGG GAAGGAACTG GAGTGGGTGT CCACTATAGA TACATACTCT AATAACACAT ACTATGAAGA CTCCTTGAAG GGCCGATTCA CCATCTCCGC AGACAACGCC AAGAACACGC TGTATCTGCA AATGGACAGC CTGAAACCTG AGGACACGGC CGTGTATTAC TGTGCAAAGG GTGGAGGTGG TATCTACTCC CGCACGTATG ACTACCGGGG CCAGGGGACC CAGGTCACCG TCTCCTCAGC GGCCGCATAC CCGTACGACG TTCCGGACTA CGGTTCCCAC CACCATCACC ATCACTAGAC TGTTGAAAGT TGTTTAGCAA AACCTCATAC AGAAAATTCA TTTACTAACG TCTGGAAAGA CGACAAAACT TTAGATCGTT ACGCTAACTA TGAGGGCTGT CTGTGGAATG CTACAGGCGT TGTCGTTTGT ACTGGTGACG AAACTCAGTG TTACGGTACA TGGGTTCCTA TTGGGCTTGC TATCCCTGAA AATGAGGGTG GTGGCTCTGA GGGTGGCGGT TCTGAGGGTG GCGGTTCTGA GGGTGGCGGT ACTAAACCTC CTGAGTACGG TGATACACCT ATTCCGGGCT ATACTTATAT CAACCCTCTC GACGGCACTT ATCCGCCTGG TACTGAGCAA AACCCCGCTA ATCCTAATCC CTTCTCTTGA GGAGTCTCAG CCTCTTATAC TTTCATGTTT CAGATATAGG TTCCGAAATA GGCAGGTGCA TTAACTGTTA TACGGGCACT GTACTCATGC ACTGACCCCG TTAAACTTAT TACCAGTACA CTCCTGTATC ATCAAAAGCC ATGTATGA <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 GACACGAATTCGCCACCATGTTCAGCCACC <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <400> 3 GTGTCAAGCTTTCACTTGTCATCATCATCCTTGTA <210> 4 <211> 4541 <212> DNA <213> Unknown <400> 4 GAGCGCCCAA TACGCAAACC GCCTCTCCCC GCGCGTTGGC CGATTCATTA ATGCAGCTGG CACGACAGGT TTCCCGACTG GAAAGCGGGC AGTGAGCGCA ACGCAATTAA TGTGAGTTAG CTCACTCATT AGGCACCCCA GGCTTTACAC TTTATGCTTC CGGCTCGTAT GTTGTGTGGA ATTGTGAGCG GATAACAATT TCACACAGGA AACAGCTATG ACCATGATTA CGCCAAGCTT GCATGCAAAT TCTATTTCAA GGAGACAGTC ATAATGAAAT ACCTATTGCC TACGGCAGCC GCTGGATTGT TATTACTCGC GGCCCAGCCG GCCATGGCCC AGGTGCAGCT GCAGGAGTCT AGAGGGGACC CAGGTCACCG TCTCCTCAGC GGCCGCATAC CCGTACGACG TTCCGGACTA CGGTTCCCAC CACCATCACC ATCACTAGAC TGTTGAAAGT TGTTTAGCAA AACCTCATAC AGAAAATTCA TTTACTAACG TCTGGAAAGA CGACAAAACT TTAGATCGTT ACGCTAACTA TGAGGGCTGT CTGTGGAATG CTACAGGCGT TGTGGTTTGT ACTGGTGACG AAACTCAGTG TTACGGTACA TGGGTTCCTA TTGGGCTTGC TATCCCTGAA AATGAGGGTG GTGGCTCTGA GGTGGCGGT TCTGAGGGTG GCGGTTCTGA GGGTGGCGGT ACTAAACCTC CTGAGTACGG TGATACACCT ATTCCGGGCT ATACTTATAT CAACCCTCTC GACGGCACTT ATCCGCCTGG TACTGAGCAA AACCCCGCTA ATCCTAATCC TTCTCTTGAG GAGTCTCAGC CTCTTAATAC TTTCATGTTT CAGAATAATA GGTTCCGAAA TAGGCAGGGT GCATTAACTG TTTATACGGG CACTGTTACT CAAGGCACTG ACCCCGTTAA AACTTATTAC CAGTACACTC CTGTATCATC AAAAGCCATG TATGACGCTT ACTGGAACGG TAAATTCAGA GACTGCGCTT TCCATTCTGG CTTTAATGAG GACCCATTCG TTTGTGAATA TCAAGGCCAA TCGTCTGACC TGCCTCAACC TCCTGTCAAT GCTGGCGGCG GCTCTGGTGG TGGTTCTGGT GGCGGCTCTG AGGGTGGCGG CTCTGAGGGT GGCGGTTCTG AGGGTGGCGG CTCTGAGGGT GGCGGTTCCG GTGGCGGCTC CGGTTCCGGT GATTTTGATT ATGAAAAAAT GGCAAACGCT AATAAGGGGG CTATGACCGA AAATGCCGAT GAAAACGCGC TACAGTCTGA CGCTAAAGGC AAACTTGATT CTGTCGCTAC TGATTACGGT GCTGCTATCG ATGGTTTCAT TGGTGACGTT TCCGGCCTTG CTAATGGTAA TGGTGCTACT GGTGATTTTG CTGGCTCTAA TTCCCAAATG GCTCAAGTCG GTGACGGTGA TAATTCACCT TTAATGAATA ATTTCCGTCA ATATTTACCT TCTTTGCCTC AGTCGGTTGA ATGTCGCCCT TATGTCTTTG GCGCTGGTAA ACCATATGAA TTTTCTATTG ATTGTGACAA AATAAACTTA TTCCGTGGTG TCTTTGCGTT TCTTTTATAT GTTGCCACCT TTATGTATGT ATTTTCGACG TTTGCTAACA TACTGCGTAA TAAGGAGTCT TAATAAGAAT TCACTGGCCG TCGTTTTACA ACGTCGTGAC TGGGAAAACC CTGGCGTTAC CCAACTTAAT CGCCTTGCAG CACATCCCCC TTTCGCCAGC TGGCGTAATA GCGAAGAGGC CCGCACCGAT CGCCCTTCCC AACAGTTGCG CAGCCTGAAT GGCGAATGGC GCCTGATGCG GTATTTTCTC CTTACGCATC TGTGCGGTAT TTCACACCGC ATATAAATTG TAAACGTTAA TATTTTGTTA AAATTCGCGT TAAATTTTTG TTAAATCAGC TCATTTTTTA ACCAATAGGC CGAAATCGGC AAAATCCCTT ATAAATCAAA AGAATAGCCC GAGATAGGGT TGAGTGTTGT TCCAGTTTGG AACAAGAGTC CACTATTAAA GAACGTGGAC TCCAACGTCA AAGGGCGAAA AACCGTCTAT CAGGGCGATG GCCCACTACG TGAACCATCA CCCAAATCAA GTTTTTTGGG GTCGAGGTGC CGTAAAGCAC TAAATCGGAA CCCTAAAGGG AGCCCCCGAT TTAGAGCTTG ACGGGGAAAG CCGGCGAACG TGGCGAGAAA GGAAGGGAAG AAAGCGAAAG GAGCGGGCGC TAGGGCGCTG GCAAGTGTAG CGGTCACGCT GCGCGTAACC ACCACACCCG CCGCGCTTAA TGCGCCGCTA CAGGGCGCGT ACTATGGTTG CTTTGACGGG TGCACTCTCA GTACAATCTG CTCTGATGCC GCATAGTTAA GCCAGCCCCG ACACCCGCCA ACACCCGCTG ACGCGCCCTG ACGGGCTTGT CTGCTCCCGG CATCCGCTTA CAGACAAGCT GTGACCGTCT CCGGGAGCTG CATGTGTCAG AGGTTTTCAC CGTCATCACC GAAACGCGCG AGACGAAAGG GCCTCGTGAT ACGCCTATTT TTATAGGTTA ATGTCATGAT AATAATGGTT TCTTAGACGT CAGGTGGCAC TTTTCGGGGA AATGTGCGCG GAACCCCTAT TTGTTTATTT TTCTAAATAC ATTCAAATAT GTATCCGCTC ATGAGACAAT AACCCTGATA AATGCTTCAA TAATATTGAA AAAGGAAGAG TATGAGTATT CAACATTTCC GTGTCGCCCT TATTCCCTTT TTTGCGGCAT TTTGCCTTCC TGTTTTTGCT CACCCAGAAA CGCTGGTGAA AGTAAAAGAT GCTGAAGATC AGTTGGGTGC ACGAGTGGGT TACATCGAAC TGGATCTCAA CAGCGGTAAG ATCCTTGAGA GTTTTCGCCC CGAAGAACGT TTTCCAATGA TGAGCACTTT TAAAGTTCTG CTATGTGGCG CGGTATTATC CCGTATTGAC GCCGGGCAAG AGCAACTCGG TCGCCGCATA CACTATTCTC AGAATGACTT GGTTGAGTAC TCACCAGTCA CAGAAAAGCA TCTTACGGAT GGCATGACAG TAAGAGAATT ATGCAGTGCT GCCATAACCA TGAGTGATAA CACTGCGGCC AACTTACTTC TGACAACGAT CGGAGGACCG AAGGAGCTAA CCGCTTTTTT GCACAACATG GGGGATCATG TAACTCGCCT TGATCGTTGG GAACCGGAGC TGAATGAAGC CATACCAAAC GACGAGCGTG ACACCACGAT GCCTGTAGCA ATGGCAACAA CGTTGCGCAA ACTATTAACT GGCGAACTAC TTACTCTAGC TTCCCGGCAA CAATTAATAG ACTGGATGGA GGCGGATAAA GTTGCAGGAC CACTTCTGCG CTCGGCCCTT CCGGCTGGCT GGTTTATTGC TGATAAATCT GGAGCCGGTG AGCGTGGGTC TCGCGGTATC ATTGCAGCAC TGGGGCCAGA TGGTAAGCCC TCCCGTATCG TAGTTATCTA CACGACGGGG AGTCAGGCAA CTATGGATGA ACGAAATAGA CAGATCGCTG AGATAGGTGC CTCACTGATT AAGCATTGGT AACTGTCAGA CCAAGTTTAC TCATATATAC TTTAGATTGA TTTAAAACTT CATTTTTAAT TTAAAAGGAT CTAGGTGAAG ATCCTTTTTG ATAATCTCAT GACCAAAATC CCTTAACGTG AGTTTTCGTT CCACTGAGCG TCAGACCCCG TAGAAAAGAT CAAAGGATCT TCTTGAGATC CTTTTTTTCT GCGCGTAATC TGCTGCTTGC AAACAAAAAA ACCACCGCTA CCAGCGGTGG TTTGTTTGCC GGATCAAGAG CTACCAACTC TTTTTCCGAA GGTAACTGGC TTCAGCAGAG CGCAGATACC AAATACTGTC CTTCTAGTGT AGCCGTAGTT AGGCCACCAC TTCAAGAACT CTGTAGCACC GCCTACATAC CTCGCTCTGC TAATCCTGTT ACCAGTGGCT GCTGCCAGTG GCGATAAGTC GTGTCTTACC GGGTTGGACT CAAGACGATA GTTACCGGAT AAGGCGCAGC GGTCGGGCTG AACGGGGGGT TCGTGCACAC AGCCCAGCTT GGAGCGAACG ACCTACACCG AACTGAGATA CCTACAGCGT GAGCATTGAG AAAGCGCCAC GCTTCCCGAA GGGAGAAAGG CGGACAGGTA TCCGGTAAGC GGCAGGGTCG GAACAGGAGA GCGCACGAGG GAGCTTCCAG GGGGAAACGC CTGGTATCTT TATAGTCCTG TCGGGTTTCG CCACCTCTGA CTTGAGCGTC GATTTTTGTG ATGCTCGTCA GGGGGGCGGA GCCTATGGAA AAACGCCAGC AACGCGGCCT TTTTACGGTT CCTGGCCTTT TGCTGGCCTT TTGCTCACAT GTTCTTTCCT GCGTTATCCC CTGATTCTGT GGATAACCGT ATTACCGCCT TTGAGTGAGC TGATACCGCT CGCCGCAGCC GAACGACCGA GCGCAGCGAG TCAGTGAGCG AGGAAGCGGAA |
| US11884973B2 |
PCR measuring method and measurement device
The present invention is directed to provide new PCR measuring method and device. As one embodiment of the present invention, a DNA detection method for detecting DNA in a droplet being present in oil, the droplet containing the DNA and a fluorescent labeled probe, the fluorescent labeled probe being hybridized to the DNA, the method including: a first step of amplifying the DNA in the droplet by a nucleic acid amplification reaction; and a second step of measuring a melting temperature of the fluorescent labeled probe and the DNA in the droplet is provided. |
| US11884966B2 |
Tissue-specific methylation marker
Provided herein are compositions comprising tissue-specific markers for identifying a tissue of origin of a cell-free nucleic acid, e.g., a cell-free DNA molecule. Also provided herein are methods, compositions, and systems for identifying a tissue of origin of a cell-free nucleic acid by determining an absolute amount of cell-free nucleic acids comprising the tissue-specific marker. Also provided herein are methods, compositions, and systems for detecting a cancer in a tissue of an organism by analyzing tissue-specific markers. |
| US11884965B2 |
Chimeric primers with hairpin conformations and methods of using same
Methods and compositions for nucleic acid amplification, detection, and genotyping techniques are disclosed. In one embodiment, a nucleic acid molecule having a target-specific primer sequence; an anti-tag sequence 5′ of the target-specific primer sequence; a tag sequence 5′ of the anti-tag sequence; and a blocker between the anti-tag sequence and the tag sequence is disclosed. Compositions containing such a nucleic acid molecule and methods of using such a nucleic acid molecule are also disclosed. |
| US11884962B2 |
Functionalized gel beads
The present disclosure provides methods of generating supports (e.g., beads) comprising barcode molecules coupled thereto. A barcode molecule coupled to a support may comprise a barcode sequence and a functional sequence. A barcode molecule may be generated using two or more ligation reactions in a combinatorial fashion. A support comprising two or more different barcode molecules may be useful for analyzing or processing one or more analytes such as nucleic acid molecules, proteins, and/or perturbation agents. |
| US11884954B2 |
Protein complex based on DNA enzymes of E family of Escherichia coli and application thereof in artificial protein scaffolds
A protein complex based on DNA enzymes of an E family of Escherichia coli and an application thereof in artificial protein scaffolds are provided. The protein complex includes one or more of interaction pairs formed by a CL2 protein and an Im2 protein, a CL7 protein and an Im7 protein, a CL8 protein and an Im8 protein, or a CL9 protein and an Im9 protein. By protein engineering of a carboxyl terminus DNase domain of the DNA enzymes CE2, CE7, CE8 and CE9, mutants that lose DNA enzyme activity but still retain the ultra-high affinity with the corresponding Im protein are obtained, and protein interaction pairs CL2/Im2, CL7/Im7, CL8/Im8 and CL9/Im9 are constructed. These protein interaction pairs have properties of heat resistance, high affinity, high specificity, small molecular weight, fast assembly speed, etc. Based on this, an artificial protein scaffold is constructed for the construction of artificial multienzyme complexes. |
| US11884953B2 |
Method for preparing protein peptide based on connective tissue and prepared protein peptide and use thereof
A novel method for preparing an active protein peptide from connective tissue which includes steps of: connective tissue acquisition, segmenting, washing, pulverization, pH adjustment, enzymolysis, filteration, ultrafiltration, nanofiltration concentration, sterilization, freeze-drying, etc. The connective tissue protein peptide obtained by the method of the invention has features of high peptide content, high activity, etc., and the prepared active protein peptide of the connective tissue is easily absorbed by the human body, and has functions of preventing and/or alleviating and/or treating related diseases. Further, the method includes operation steps that are simple and easy to perform, which has low energy consumption, appropriate and effective utilization of animal natural resources, as well as environmental friendly, non pollution of environment, and low production costs, which is suitable for large-scale industrial production, and the purpose of efficiently preparing an protein active peptide from connective tissue can be achieved. |
| US11884952B2 |
Daptomycin-producing Streptomyces strain and use thereof
The present invention provides a novel daptomycin-producing Streptomyces strain and use thereof, the strain is a subspecies of streptomyces griseus, named Streptomyces griseus L340, and the preservation number is CGMCC17921. The genetic character and fermentation unit of the strain provided by the present invention are relatively stable, the culture and fermentation conditions are suitable for industrial production of daptomycin, and the interference of pigment in later separation and purification is eliminated. The secondary metabolite daptomycin is obtained through fermentation of the Streptomyces provided by the present invention, which has the advantages of no interference of pigment accumulation, cleaner metabolic spectrum and thus is obviously superior in later separation and purification. |
| US11884949B2 |
Methods of producing morphinan alkaloids and derivatives
A method of producing promorphinan, morphinan, nal-opioid, and nor-opioid alkaloid products through the increased conversion of a promorphinan alkaloid to a morphinan alkaloid. The method comprises contacting the promorphinan alkaloid with at least one enzyme. Contacting the promorphinan alkaloid with the at least one enzyme converts the promorphinan alkaloid to a morphinan alkaloid. |
| US11884942B2 |
Compositions and methods comprising the use of Exiguobacterium acetylicum and Bacillus coagluans α-glucanotransferase enzymes
An isolated and/or purified α-glucanotransferase from Exiguobacterium acetylicum, recombinantly engineered variants thereof, active fragments thereof, synthetic nucleic acids encoding the α-glucanotransferase and variants thereof, host cells comprising the synthetic nucleic acids, and compositions comprising the α-glucanotransferase are provided. Methods of using the compositions include the manufacture of oligosaccharides. |
| US11884938B2 |
Cell culture system
The embodiments of the invention described herein relate to systems and methods for culturing and/or maintaining intestinal cells, tissues and/or organoids in vitro. The cells, tissues and/or organoids cultured according to the methods and systems described herein can mimic or reproduce natural intestinal epithelial structures and behavior as well as support co-culture of intestinal microflora. |
| US11884937B2 |
Activation of innate immunity for enhanced nuclear reprogramming of somatic cells with mRNA
The nuclear reprogramming of somatic cells with mRNA encoding reprogramming factors is shown to be greatly accelerated by activation of innate immune responses in the somatic cell. Methods of activating innate immunity include activation of PKR, of toll-like receptors, e.g. TLR3, etc. In some embodiments the mRNA provides the activator of innate immunity. |
| US11884931B2 |
Oncolytic virus for colorectal cancer treatment using colorectal cancer cell-specific infectious newcastle disease virus and composition for colorectal cancer treatment using same
Provided is an M2-LVP-K1 virus including a colorectal cancer cell-specific mutant sialic acid binding domain and a composition for treating colorectal cancer including the same. The mutant sialic acid binding domain is constructed using directed evolution technology, and is a recombinant Newcastle disease virus constructed by substituting a normal sialic acid binding domain for a HN protein, a cell-binding receptor, to improve the specific infectivity to HCT116 cells. It was identified that M2-LVP-K1 recombinant Newcastle disease virus with improved colorectal cancer cell-specific infectivity has improved HCT116 cell death effect compared to the conventional normal recombinant Newcastle disease virus, and produces an excellent effect in inhibiting cancer tissue growth through in vivo experiments. The mutant recombinant Newcastle disease virus presented in this study relates to a therapeutic viral agent capable of inducing clinical symptom reduction, partial remission, or complete remission through colorectal cancer cell death or colorectal cancer tissue shrinkage. |
| US11884925B2 |
Synthetic immunomodulation with a CRISPR super-repressor in vivo
Provided herein are CRISPR-based synthetic repression systems as well as methods and compositions using the synthetic repression systems to treat septicemia, an adverse immune response in a subject and Waldenström macroglobulinemia. |
| US11884922B1 |
Tuning cascade assay kinetics via molecular design
The present disclosure relates to compositions of matter and assay methods used to detect one or more target nucleic acids of interest in a sample. The compositions and methods allow one to control reaction kinetics of the cascade assay by two orders of magnitude via molecular design of one of the reaction components; further, varying molecular design also allows for quantification of target nucleic acids of interest over a large range of concentrations or discriminating between extremely low copy numbers of target nucleic acids of interest. |
| US11884918B2 |
Systems and methods for modulating CRISPR activity
Provided herein are polynucleotides comprising sequence configured to bind to a CRISPR effector protein. Modulation of one or more modifications of the polynucleotides can be used to tune the activity of CRISPR effector proteins complexed with the polynucleotides. |
| US11884912B2 |
Cell culture device and method thereof
A cell culture device includes a culture unit, a gas supply unit, a first pressure unit, at least one inspecting unit and a control unit. The culture unit contains a cell culture liquid. The gas supply unit, connected with the culture unit, is used for transmitting a culture gas into the culture unit. The first pressure unit, connected with the culture unit, is used for applying a pressure to the cell culture liquid in the culture unit. The at least one inspecting unit, connected with the culture unit, is used for receiving the cell culture liquid for inspection. The control unit, electrically coupled with the culture unit, the first pressure unit, the gas supply unit and the at least one inspecting unit, is used for monitoring corresponding condition parameters to determine respective operations. In addition, a cell culture method for the cell culture device is also provided. |
| US11884909B2 |
Cluster airlift bioreactor
A bioreactor includes a plurality of spargers and a plurality of vertical circulation loops. A first vertical circulation loop of the plurality of vertical circulation loops includes a first sparging region and a first return region. The first vertical circulation loop is in liquid communication with one or more other loops of the plurality of vertical circulation loops. The first vertical circulation loop is characterized by an individual loop mass transfer coefficient. A controller is coupled to the plurality of spargers and configured to control the plurality of spargers together such that a cumulative mass transfer coefficient of the plurality of vertical circulation loops is within a threshold of the individual loop mass transfer coefficient associated with the first vertical circulation loop. |
| US11884904B2 |
Gas fermentation using multiple-pass trickle bed reactors
The subject matter of this application is using novel biological reactors for the fermentation of gases into liquid products. More specifically, the subject matter relates to the use of a Multiple-Pass Trickle Bed Reactor (MP-TBR) for the anaerobic or aerobic and biological fermentation of gases generated from industrial processes and/or from the gasification of biomass and other organic carbon sources. The products may include, but are not limited to, ethanol and other valuable chemicals. |
| US11884902B2 |
Systems and methods of forming and analyzing dissolvable articles
Systems and methods of forming and analyzing a dissolvable article are provided herein. In an embodiment, a method of analyzing a dissolvable article includes providing a dissolvable article comprising a water-soluble block copolymer and a fragrance, capturing a plurality of images of a surface of the dissolvable article using a three dimensional imaging device, wherein the plurality of images have different spatial properties and wherein the plurality of images are of a substantially similar viewing area of the three-dimensional imaging device, and determining a measurement of pore density and surface roughness of the surface of the dissolvable article. |
| US11884900B2 |
Cleaning compositions and methods of use thereof
The present disclosure relates to cleaning compositions that are used to clean semiconductor substrates. These cleaning compositions can remove the defects/contaminants arising from previous processing on the semiconductor substrates and thereby make the substrates appropriate for further processing. The cleaning compositions described herein primarily contain at least one pH adjusting agent and at least one biosurfactant. |
| US11884897B2 |
Hard surface cleaners including fluorosurfactants
Hard surface, in particular glass, cleaners having an ease in wipe-out while providing good cleaning with a streak-free, glossy shine are described. The cleaner includes at least one fluorosurfactant including a fluorinated functional group with 2 to 6 carbon atoms, and a hydrophilic moiety; at least one non-fluorinated surfactant; a combination of solvents; a combination of cleaning agents; and water. |
| US11884896B2 |
Sanitizing soap preparation comprising a benzalkonium chloride/alkyl trimonium cationic surfactant combination
Anti-microbial compositions for cleaning and sanitizing skin are disclosed. The anti-microbial compositions preferably comprises at least one quaternary ammonium chloride active and results in low irritation cleansing and sanitizing products that allow more frequent application. |
| US11884893B1 |
Antiwear system for improved copper corrosion
An oil-soluble ashless antiwear additive and a lubricating composition including the ashless antiwear additive having improved copper corrosion performance obtained by reacting an organic hydroxy compound with phosphorus pentasulfide to form a reaction product, distilling the reaction product and recovering a condensate, and reacting the condensate with an unsaturated carboxylic acid to form an oil-soluble phosphorus antiwear additive. |
| US11884886B2 |
Low pressure hydrocracking process for the production of a high yield of middle distillates from a high boiling hydrocarbon feedstock
The present invention provides for a low pressure, low temperature process for the production of middle distillate products, including aviation fuel and diesel, from the hydrocracking of a hydrocarbon feedstock consisting of a mixture of hydrocarbons, wherein a significant fraction of said mixture is C25+ hydrocarbons including hydrocarbons selected from Fischer-Tropsch wax, long chain paraffin and/or olefin, wherein the feedstock may include a water component. |
| US11884885B2 |
Co-processing of waste plastic pyrolysis oils and biorenewable feedstocks
A process is provided for producing a liquid hydrocarbon material suitable for use as a fuel or as a blending component in a fuel. The process includes co-processing a pyrolysis oil derived from a waste plastic raw material and a biorenewable feedstock comprising triglycerides in a catalytic cracking process in a presence of a solid catalyst at catalytic cracking conditions to provide a cracking product. The cracking product may be fractionated to provide at least one of a gasoline fraction and a middle distillate fraction. |
| US11884882B2 |
Electrochromic device
According to one embodiment, provided is an electrochromic device including an electrochromic layer, which contains a tungsten oxide material. The tungsten oxide material includes potassium-containing tungsten oxide particles having an average particle size of 100 nm or less. The potassium-containing tungsten oxide particles contain potassium within a range of 1 mol % to 50 mol %, and include a central section and a peripheral section adjacent to the central section. A periodicity of a crystal varies between the central section and the peripheral section. |
| US11884868B2 |
Latent heat storage material, and cold storage tool, logistic packaging container, transportation method, human body refrigeration tool and cold storage tool for beverages each using same
Provided are a latent heat storage material having a melting point within a prescribed temperature range; a latent heat. The latent heat storage material includes a compound (A) represented by a formula (A), an inorganic salt (B) represented by a formula (B) and composed of a cation of an alkali metal and an anion of the same element as the anion of the quaternary alkyl salt, and water. The compound (A) is a material that forms a clathrate hydrate together with the water, the composition ratio of the compound (A) and water is a composition ratio that gives a congruent melting point of the clathrate hydrate, and the molar ratio of the inorganic salt (B) to the compound (A) is 0.1 or more and 10 or less. |
| US11884863B2 |
Liquid-crystalline medium
A liquid-crystalline medium having least one compound of the formula I, and at least one compound of the formulae ST-1 to ST-17, in which R1 and R1*, A1 and A1*, Z1 and Z1*, X, L1 and L2, RST, ring A, ZST, p and q have the meanings indicated in claim 1, and the use thereof for an active-matrix display, in particular based on the VA, PSA, PA-VA, SS-VA, SA-VA, PS-VA, PALC, IPS, PS-IPS, UB-FFS, U-IPS, FFS or PS-FFS effect. |
| US11884862B2 |
Liquid-crystalline medium
Compounds of the formula I in which R1 is alkyl or alkoxy in which CH2 groups are optionally replaced, and X1 is alkyl OCF3, CF3, CHF2, OCF2CF3, CCF2CHFCF3, OCF═CF2, OCH═CF2 or F, a liquid-crystalline medium containing a compound of formula I, and use thereof in electro-optical liquid-crystal displays, in particular in TN, STN, TN-TFT, OCB, IPS, PS-IPS, FFS, HB-FFS or PS-FFS-, positive VA displays and in shutter spectacles for 3D effects and LC lenses. |
| US11884855B2 |
Synthesis of europium halide perovskites in solution phase
A solution phase synthesis process for preparing a rare earth perovskite, the process includes reacting an alkali metal material with a first surfactant ligand in the presence of a first solvent to obtain a first precursor complex solution; reacting a rare earth metal halide with a second surfactant ligand in the presence of a second solvent to obtain a second precursor complex solution; and reacting the first precursor complex solution with the second precursor complex solution in the presence of a third surfactant ligand and a third solvent to obtain the rare earth perovskite; wherein: the rare earth perovskite is in the form of nanocrystals; and the first solvent and third solvent comprise a non-coordinating solvent. |
| US11884853B2 |
Electroluminescent display devices and methods of making the same
A nanoparticle conjugate includes a quantum dot (QD) and a thermally activated delayed fluorescence (TADF) molecule bound to the QD. In some instances, the TADF molecule can be directly bound to a surface of the QD. In other instances, the TADF molecule can be indirectly bound to the QD via an interaction with one or more capping ligands disposed on a surface of the QD. Nanoparticle conjugates described herein can be incorporated into emissive layers of electroluminescent light-emitting diode devices to yield electroluminescent quantum dot-containing light-emitting diode (QD-LED) devices. |
| US11884846B2 |
Adhesive composition having a gel content based on cross-linking via keto groups or aldehyde groups
Described is an adhesive composition in the form of an aqueous polymer dispersion comprising tackifiers, a compound crosslinking via keto or aldehyde groups and a pressure-sensitive adhesive polymer which is formed by emulsion polymerization from soft (meth)acrylic ester monomers, acid monomers, monomers having keto or aldehyde groups, styrene and optionally further monomers, wherein the polymerization may be carried out in the presence of chain transfer agents. The pressure-sensitive adhesive polymer has certain gel contents. The pressure-sensitive adhesive composition may be used to produce adhesive labels, adhesive tapes or adhesive films. |
| US11884844B2 |
Composition for post-polishing to be used after primary polishing of silicon wafers
A polishing composition used in wafer polishing process for eliminating protrusion around laser mark, thereby achieving a flat polished surface, as well as a wafer polishing method using the polishing composition. A post-polishing composition for elimination of a laser mark remaining after polishing of silicon wafer with a primary polishing composition containing silica particles, water, and a basic compound, the post-polishing composition including silica particles, water, a tetraalkylammonium ion, and a water-soluble polymer, wherein the mass ratio of the tetraalkylammonium ion to SiO2 of the silica particles is 0.200 to 1.000:1; the mass ratio of SiO2 dissolved in the polishing composition to SiO2 of the silica particles is 0.100 to 1.500:1; and the mass ratio of the water-soluble polymer to SiO2 of the silica particles is 0.005 to 0.05:1. The silica particles have an average primary particle diameter of 1 nm to 100 nm. |
| US11884837B2 |
Scratch and mar resistant automotive coatings
Described herein is a 2K solvent borne coating system. The coating system includes an epoxy component (A), including: i) an epoxy resin; ii)—a solvent; iii)—at least one compound of formula (I): [(ER)x(R′O)y(HO)z(R″)t(SiO(4-x-y-z-t)]m (I) and/or oligomer or polymer compounds of the compound of formula (I), and iv)—optionally, at least one non-catalytic additive; and an acid resin component (B), including: an carboxylic acid resin; a solvent; optionally, at least one catalyst; and optionally, at least one additive. Also described herein are a 2K coating composition, a method to coat an automotive substrate with the composition, and a scratch and mar resistant coated surface of the 2K coating composition. |
| US11884832B2 |
Material restoration composition and method
A method of restoring a material surface utilizes a first composition (referred to herein as Composition A) and a second composition (referred to herein as Composition B). Methodologies guide application of Composition A and optionally Composition B to enact various restoration advantages to existing or new material surfaces. Composition A may be first applied to a material surface to remove surface contaminants and lift stains. During the described methodology, a user must wait a predetermined amount of time for Composition A to permeate the material surface. Optionally, Composition B may be subsequently applied to bond voids and damages areas of the material surface, or to add a new surface altogether above the original surface. A user may wait a predetermined amount of time for Composition B to cure. |
| US11884825B2 |
Exocyclic amine substituted coumarin compounds and uses as fluorescent labels
The present application relates to exocyclic amine-substituted coumarin derivatives and their uses as fluorescent labels. These compounds may be used as fluorescent labels for nucleotides in nucleic acid sequencing applications. |
| US11884823B2 |
Pneumatic tire
The invention is directed to a pneumatic tire comprising a vulcanization rubber composition, the vulcanizable rubber composition comprising: from 30 to 90 phr of a first functionalized styrene-butadiene rubber having a glass transition temperature Tg1 ranging from −70 to −50° C.; from 10 to 50 phr of a second functionalized styrene-butadiene rubber having a glass transition temperature Tg2 ranging from −110 to −70° C.; wherein Tg2−Tg1 is at least 10° C.; from 0 to 40 phr of at least one additional elastomer; from 50 to 150 phr of silica; from 0 to 50 phr of a hydrocarbon resin; and from 10 to 50 phr of an oil. |
| US11884814B2 |
Resin composition
Resin compositions including (A) a hollow organic polymer particle, (B) an epoxy resin, and (C) a curing agent provide cured products having a superior smear removal properties. |
| US11884811B2 |
Resin composition, resin film and organic electroluminescent device
Provided is a resin composition including a resin containing a polymer, a hygroscopic particle, and an organic solvent-soluble dispersant. Preferably the ratio of the dispersant relative to 100 parts by weight of the hygroscopic particle is 0.1 part by weight or more and 1000 parts by weight or less, and the absolute value of the difference in refractive index between the resin and the hygroscopic particle is 0.05 or less. Also provided are a resin film formed by molding the resin composition into a film shape, and an organic electroluminescent device including the resin film. |