最新美国发明专利第2021-01-05期 - 专利汇|PatentHub专利检索|专利查询网|发明专利查询分析

Document	Document Title
US10882986B2	Pipe produced with a polymer composition comprising a polyolefin The invention relates a pipe for the transport of water with improved resistance to chlorinated disinfectants. The pipe is produced with a polymer composition comprising a polyolefin and styrene isoprene blockcopolymer.
US10882981B2	Propylene-based polymer additives for improved tire tread performance A tire tread composition is disclosed. The tire tread composition includes components, by weight of the composition, within the range from: 5 to 75 wt % of a diene elastomer; 0 to 40 wt % of processing oil; 20 to 80 wt % of filler; a curative agent; and 5 to 30 wt % of a propylene-ethylene-diene terpolymer containing from 2 wt % to 40 wt % of ethylene and/or C4-C20 α-olefins derived units, from 0.5 to 10 wt % of diene derived units, and having a heat of fusion, as determined by DSC, of from 0 J/g to 80 J/g.
US10882968B2	Polypropylene foams and processes of making The present disclosure provides a linear polypropylene foam with, for example, low density and/or high expansion ratio, said linear polypropylene foam comprising at least one polypropylene, at least one alpha nucleating agent, and at least one beta nucleating agent. The present disclosure also provides compositions and processes for making said linear polypropylene foam.
US10882960B2	Method for the hydrophobic impregnation of fired ceramic molded bodies Fired clay moldings are hydrophobicized by applying a long chain alkyl-substituted alkoxysilane or hydrolysate thereof having up to 5 silicon atoms, and an alkoxy-functional silicone resin. The moldings, which may be roof tiles, are hydrophobicized to a significant depth, without discoloration.
US10882958B2	Polyamideimide copolymers and colorless and transparent polyamideimide film comprising the same A polyamideimide copolymer which is an imide of a polyamic acid resulting from copolymerizing an aromatic diamine monomer, an aromatic dianhydride monomer, and an aromatic dicarbonyl monomer and a colorless and transparent polyamideimide film including the polyamideimide copolymer. The polyamideimide copolymer according to the present disclosure makes it possible to provide a polyamideimide film exhibiting excellent scratch resistance while being colorless and transparent.
US10882956B2	Polyetherimide composition and associated article and additive manufacturing method A polyetherimide composition includes specific amounts of a polyetherimide, a block polyestercarbonate, a block poly-carbonate-polysiloxane, and a core-shell impact modifier in which the core includes a polysiloxane and the shell includes a poly(alkyl (meth)acrylate). Relative to a corresponding composition lacking the core-shell impact modifier, the polyetherimide composition exhibits increased impact strength while substantially retaining flame retardancy. Also described are associated articles, including articles formed by additive manufacturing, and a method of additive manufacturing.
US10882952B2	Side-chain-functionalized polyhydroxyalkanoate materials A process of forming a side-chain-functionalized polyhydroxyalkanoate (PHA) material is disclosed. The process includes forming a PHA material having a hydroxyl-terminated side-chain. The process also includes utilizing the PHA material having the hydroxyl-terminated side-chain to form a side-chain-functionalized PHA material having a side-chain with a terminal cross-linkable functional group, for example, sulfhydryl group, in order to form reversibly cross-linked PHA material.
US10882948B2	Copolymer for photoelectrocatalytic water splitting A copolymer containing carbazole- and cyanovinylene-based moieties, a photoelectrode comprising a metal oxide substrate and the copolymer as a photoelectrocatalyst component to the photoelectrode, as well as a photoelectrochemical cell including the photoelectrode. Methods of producing the copolymers, and methods of using the photoelectrochemical cell to produce hydrogen gas and oxygen gas through water splitting are also provided.
US10882947B2	Rapid curing epoxy adhesive compositions The present disclosure is directed to a curable composition comprising: a) an epoxy resin; b) an epoxy curing agent comprising at least one cycloaliphatic amine; c) at least 3 wt % of a metal triflate catalyst; d) optionally, a fatty acid polyamide; and e) optionally, a filler material. The compositions of the present disclosure are particularly suitable for use in structural assembly, in particular for potting and filling operations in sandwich structures. The present disclosure also relates to a composite assembly and to methods of using such epoxy resin based curable compositions.
US10882946B2	Polyester-epoxide polymer compositions Polyester-epoxide polymer (PEEP) compositions are disclosed. The PEEP compositions comprise a reaction product of a polyepoxide compound (eq. wt. 125 to 250 g/eq.) and a polyester polyol composition. The ratio of epoxy equivalents to hydroxyl equivalents is within the range of 0.8 to 3.5. The PEEP composition has a Tg within the range of −40° C. to 60° C. Elevated temperature-cure and low temperature-cure processes for making the PEEP compositions are also disclosed. In a simple yet innovative approach, a new class of polymers useful for adhesives, coatings, elastomers, and other valuable products is assembled from readily available starting materials without reliance on polyisocyanates or polyamines. The PEEP compositions have increased elongation and lower Tg when compared with traditional epoxy products.
US10882941B2	Initiator mixture, composition, the use thereof, polyol polymer preparation method, and polyol polymer obtained by the method The present invention relates to an initiator mixture, a composition, use thereof, a process of preparing polymer polyol, and a polymer polyol obtained by the process. The initiator mixture comprises: a first peroxide of formula (I) R1—O—O—R2, wherein R1 and R2 are independent an alkyl group or an alkanoyl group comprising 1 to 30 carbon atoms, preferably 3 to 20 carbon atoms, and more preferably 4 to 20 carbon atoms; and a second peroxide of formula (II) R3—O—O—R4—O—O—R5, wherein R3 and R5 are independently an alkyl group comprising 1 to 30 carbon atoms, preferably 3 to 20 carbon atoms, and more preferably 5 to 10 carbon atoms, and R4 is a cycloalkylene group comprising 3 to 30 carbon atoms, preferably 4 to 20 carbon atoms, and more preferably 5 to 10 carbon atoms.
US10882938B2	Quasicrystalline structures and uses thereof This invention relates generally to the field of quasicrystalline structures. In preferred embodiments, the stopgap structure is more spherically symmetric than periodic structures facilitating the formation of stopgaps in nearly all directions because of higher rotational symmetries. More particularly, the invention relates to the use of quasicrystalline structures for optical, mechanical, electrical and magnetic purposes. In some embodiments, the invention relates to manipulating, controlling, modulating and directing waves including electromagnetic, sound, spin, and surface waves, for pre-selected range of wavelengths propagating in multiple directions.
US10882925B2	Catalysts that produce polyethylene with broad, bimodal molecular weight distribution The present disclosure relates to ansa-metallocene catalyst compounds that include (1) a first indenyl ligand substituted at the 3-position with a substituted or unsubstituted C4-C40 hydrocarbyl group, wherein the hydrocarbyl group is branched at the β-position, and (2) a second indenyl ligand substituted at its 3-position with a substituted or unsubstituted alkyl group or a β-branched alkyl group. Catalyst systems prepared with the catalyst compounds, polymerization methods using such catalyst systems, and polyolefins made using the polymerization methods are also described.
US10882924B2	Procatalyst for polymerization of olefins The present invention relates to a procatalyst comprising the compound represented by formula A as an internal electron donor, Formula A wherein R is hydrogen or a methyl group, N is nitrogen atom; O is oxygen atom; and C is carbon atom. The present invention also relates to a process for preparing said polymerization procatalyst and to a polymerization catalyst system comprising said procatalyst, a co-catalyst and optionally an external electron donor. Furthermore, the present invention relates to a polyolefin obtainable by the process according to the present invention and to the use of the compound of formula A as in internal electron donor in catalysts for polymerization of olefins.
US10882921B2	Host cell comprising nucleic acids encoding bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1 and antibody production The presently disclosed subject matter provides antibodies that bind KLB and FGFR1, and methods of using the same. In certain embodiments, an antibody of the present disclosure includes a bispecific antibody that binds to an epitope present on FGFR1 and binds to an epitope present on KLB.
US10882916B2	Anti-C5a receptor antibodies The present invention concerns human antibodies recognising the human C5a receptor. By binding to C5aR the antibodies inhibit C5a signalling, whereby the pro-inflammatory signal is inhibited. Based on the role of C5a and its receptor in stimulation of inflammation the invention further relates to therapeutic use of said human anti-C5aR antibodies and in particular in relation to treatment of immunological disorders.
US10882909B2	Antigen binding constructs to CD3 Antigen binding constructs that bind to CD3, for example antibodies, including antibody fragments (such as minibodies and cys-diabodies) that bind to CD3, are described herein. Methods of use are described herein.
US10882908B2	Anti-LAG-3 antibodies and methods of use thereof The instant disclosure provides antibodies that specifically bind to LAG-3 (e.g., human LAG-3) and antagonize LAG-3 function. Also provided are pharmaceutical compositions comprising these antibodies, nucleic acids encoding these antibodies, expression vectors and host cells for making these antibodies, and methods of treating a subject using these antibodies.
US10882906B2	Claudin 5 antibody, and medicine containing said antibody Provided is a novel technique for controlling the blood-brain barrier. An antibody whose epitope is a region within an extracellular domain of Claudin 5 protein.
US10882900B2	Monoclonal antibody of human-derived procalcitonin, and preparation method and application thereof The present invention provides a monoclonal antibody that specifically binds to human-derived procalcitonin and application thereof. The present invention also provides a hybridoma cell line secreting the monoclonal antibody and having an accession number of CGMCC No. 10417, and a method for preparing an antibody against procalcitonin by using a procalcitonin mutant antigen as the immunogen.
US10882897B2	Neutralizing anti-influenza binding molecules and uses thereof Binding molecules, including bispecific antibodies that include at least two anti-influenza binding domains are disclosed, including binding molecules having a first binding domain that specifically binds influenza A virus and a second binding domain that specifically binds influenza B virus.
US10882892B2	Channelrhodopsin variants and uses thereof CsChrimson light-activated ion channel polypeptides, their encoding polynucleotides, and variants thereof are provided. Methods of introducing and using CsChrimson light activated ion channels and variants thereof for to alter cell activity and function are also provided.
US10882887B2	Papillomavirus chimeric protein and application thereof Provided is a papillomavirus chimeric protein, the skeleton thereof being a papillomavirus L1 protein or a mutant thereof, at least one human papillomavirus 33-type L2 protein or mutant polypeptide thereof being embedded on the skeleton. The present papillomavirus chimeric protein can be used for preparing a vaccine for preventing papillomavirus infections and infection induced disease.
US10882884B2	Stereoselective synthesis of phosphorothioate oligoribonucleotides The present invention relates to chiral phosphoramidites represented by formula (Ia) or formula (Ib) as novel monomers for the synthesis of stereodefined phosphorothioate MOE oligonucleotides. Furthermore, the present invention relates to a method for synthesizing stereodefined phosphorothioate MOE oligonucleotides using said novel chiral phosphoramidites.
US10882883B2	Derivatives of amphotericin B Disclosed are derivatives of amphotericin B (AmB) characterized by improved therapeutic index compared to AmB. The AmB derivatives include C16 ureas, carbamates, and amides according to Formula (I); C3′-substituted C16 ureas, carbamates, and amides according to Formula (II); C16 acyls according to Formula (III); C2′epi-C16 ureas, carbamates, and amides according to Formula (IV); and C16 oxazolidinone derivatives according to Formula (V). Also disclosed are pharmaceutical compositions comprising the AmB derivatives, and therapeutic methods of using the AmB derivatives.
US10882880B2	Process for efficient purification of neutral human milk oligosaccharides (HMOs) from microbial fermentation The present application discloses a simple process for the purification of neutral human milk oligosaccharides (HMOs) produced by microbial fermentation. The process uses a combination of cationic ion exchanger treatment, an anionic ion exchanger treatment, and a nanofiltration and/or electrodialysis step, which allows efficient purification of large quantities of neutral HMOs at high purity. Contrary to the purification currently used in fermentative production of neutral HMOs, the presented process allows the provision of HMOs without the need of a chromatographic separation. The so purified HMOs may be obtained in solid form by spray drying, as crystalline material or as sterile filtered concentrate. The provided HMOs are free of proteins and recombinant material originating from the used recombinant microbial strains and thus very well-suited for use in food, medical food and feed (e.g. pet food) applications.
US10882873B2	Method of forming tin-containing material film and method of synthesizing a tin compound A tin compound, tin precursor compound for atomic layer deposition (ALD), a method of forming a tin-containing material film, and a method of synthesizing a tin compound, the tin compound being represented by Chemical Formula (I): wherein R1, R2, Q1, Q2, Q3, and Q4 are each independently a C1 to C4 linear or branched alkyl group.
US10882870B2	Crystalline metal organic framework The present invention relates to a crystalline metal organic framework which comprises repeating units of formula (RR)-(IA) or (SS)-(IA) or (RS)-(IA) or (SR)-(IA); or alternatively of formula (RR)-(IB) or (SS)-(IB) or (RS)-(IB) or (SR)-(IB) and a composition containing it. It also relates to processes for their preparation and their uses as a separation agent and as a catalyst.
US10882867B2	Forms and compositions of a MK2 inhibitor The present invention provides solid forms of an MK2 inhibitor, compositions thereof, and methods of using the same.
US10882866B1	Spiro[3H-indole-3,2′-pyrrolidin]-2(1H)-one compounds and derivatives as MDM2-P53 inhibitors The present invention encompasses intermediates for preparing compounds of formula (I) wherein the groups R1 to R4, R7, A, D, E, F, V, W, X, Y, n, r and q are defined in claim 1, their use as inhibitors of MDM2-p53 interaction, pharmaceutical compositions which contain compounds of this kind, their use as medicaments, especially as agents for treatment and/or prevention of oncological diseases, and synthetic intermediates.
US10882865B2	Pyrrolopyrimidine compounds and uses thereof for modulating glucocerebrosidase activity Disclosed are new small molecules having a pyrrolopyrimidine core structure and the uses thereof for modulating glucocerebrosidase activity. Also disclosed are pharmaceutical compositions comprising the small molecules which may be administered in methods of treating diseases or disorders associated with glucocerebrosidase activity, including neurological diseases and disorders such as Gaucher's disease and Parkinson's disease. The small molecules may be utilized to generate activated glucocerebrosidase. The activated glucocerebrosidase thusly generated can be administered in enzyme replacement therapy and/or utilized in screening assays for new small molecules that bind to the activated glucocerebrosidase and/or modulate the activity of the activated glucocerebrosidase.
US10882859B2	Kinase inhibitors There are provided compounds of formula I, wherein X, Ak, s, A, R1 and R2 have meanings given in the description, which compounds have antiinflammatory activity (e.g. through inhibition of one or more of members of the JAK family) and have use in therapy, including in pharmaceutical combinations, especially in the treatment of inflammatory diseases, including inflammatory diseases of the lung, eye and intestines.
US10882856B2	5 or 8-substituted imidazo [1,5-a] pyridines as selective inhibitors of indoleamine and/or tryptophane 2,3-dioxygenases Disclosed herein are 5 or 8-substituted imidazo [1, 5-a] pyridines and pharmaceutical compositions comprising at least one such 5 or 8-substituted imidazo [1, 5-a] pyridines, processes for the preparation thereof and the use thereof in therapy. Disclosed herein are certain 5 or 8-substituted imidazo [1, 5-a] pyridines that can be useful for inhibiting indoleamine 2, 3-dioxygenase and/or tryptophane 2, 3-dioxygenase and for treating diseases or disorders mediated thereby.
US10882848B2	2-benzopyrazinyl-n-heteroaryl-2-phenyl-acetamide compounds The present invention provides compounds which are selective allosteric inhibitors of T790M and C797S containing EGFR mutants, their manufacture, pharmaceutical compositions containing them and their use as therapeutically active substances.
US10882847B2	Inhibitors of KRAS G12C mutant proteins Compounds having activity as inhibitors of G12C mutant KRAS protein are provided. The compounds have the following structure (I): or a pharmaceutically acceptable salt, tautomer, stereoisomer or prodrug thereof, wherein R1, R3a, R3b, R4a, R4b, G1, G2, G2, G3, G4, m1, m2, m3, m4, L1, L2 and E are as defined herein. Methods associated with preparation and use of such compounds, pharmaceutical compositions comprising such compounds and methods to modulate the activity of G12C mutant KRAS protein for treatment of disorders, such as cancer, are also provided.
US10882845B2	Crystal form of deuterated AZD9291, preparation method therefor, and use thereof A crystal form of a deuterated AZD9291 has an X-ray powder diffraction measured using Cu-Kα rays with diffraction peaks at 7.1±0.2, 8.5±0.2, 9.4±0.2, 10.3±0.2, 15.1±0.2, 16.3±0.2, 18.7±0.2, 22.0±0.2, 25.6±0.2, and 26.0±0.2. The crystal form of the deuterated AZD9291 is used in the preparation of medicaments for the treatment of cancer. The crystal form of the deuterated AZD9291 provided by the present invention has stable physical and chemical properties and good metabolic stability, and blood concentrations in vivo and concentrations in the brain thereof are significantly improved, achieving an improved therapeutic effect.
US10882843B2	5-aminopyrazole carboxamide derivative as BTK inhibitor and preparation method and pharmaceutical composition thereof The present application discloses novel 5-aminopyrazole carboxamide compounds as shown in formula (I), and stereoisomers, pharmaceutically acceptable salts, solvates, or prodrugs thereof. In addition, the present application further discloses a method for the preparation of the compounds, a pharmaceutical composition comprising a compound of the invention and the use of the compounds.
US10882842B2	Pyridinium compounds, a synthesis method therefor, metal or metal alloy plating baths containing said pyridinium compounds and a method for use of said metal or metal alloy plating baths The present invention concerns pyridinium compounds, a synthesis method for their preparation, metal or metal alloy plating baths containing said pyridinium compounds and a method for use of said metal or metal alloy plating baths.The plating baths are particularly suitable for use in filling of recessed structures in the electronics and semiconductor industry including dual damascene applications.
US10882840B2	Beta- and gamma-amino-isoquinoline amide compounds and substituted benzamide compounds Disclosed are beta and gamma-amino isoquinoline amide compounds and substituted benzamide compounds. In particular, the invention provides compounds that affect the function of kinases in a cell and that are useful as therapeutic agents or with therapeutic agents. The compounds of the invention are useful in the treatment of a variety of diseases and conditions including eye diseases such as glaucoma, cardiovascular diseases, and diseases characterized by abnormal growth, such as cancers. The invention further provides compositions containing the beta or gamma-amino isoquinoline amide compounds or substituted benzamide compounds.
US10882838B2	Cannabinergic compounds and uses thereof Disclosed are compounds and compositions that modulate cannabinoid receptors, methods of modulating cannabinoid receptors, and methods of treating various disorders related to the modulation of cannabinoid receptors. This disclosure is directed to methods of treating cannabinoid dependence, neuropathy, inflammation, glaucoma, a neurodegenerative disorder, a motor function disorder, a gastrointestinal disorder, hypothermia, emesis, loss of appetite, or anorexia associated with AIDS.
US10882837B2	Amide compounds and use thereof Disclosed are compounds of formula (I) below and pharmaceutically acceptable salts thereof, in which each of variables R1, R2, L, and Z is defined herein. Also disclosed are methods for reducing the glycemic level and treating glucagon-associated disorders with a compound of formula (I) or a salt thereof and a pharmaceutical composition containing same.
US10882830B2	Crystal form of ozanimod hydrochloride and processes for preparation therefor The present disclosure relates to crystalline form CS3 of ozanimod hydrochloride which can be used for treating autoimmune diseases, particularly used for preparing drugs for treating multiple sclerosis and ulcerative colitis and preparation method thereof.
US10882827B2	Enhanced erythropoiesis and iron metabolism The present invention relates to methods and compounds for regulating or enhancing erythropoiesis and iron metabolism, and for treating or preventing iron deficiency and anemia of chronic disease.
US10882821B1	Enantiomeric compound for the reduction of the deleterious activity of extended nucleotide repeat containing genes Aspects of the present disclosure include methods of reducing the deleterious impact of a target gene in a cell, such as the deleterious activity of a mutant extended nucleotide repeat (NR) containing target gene in a cell, by contacting the cell with an effective amount of an enantiomeric tetrahydrocarbazolamine compound. The deleterious activity (e.g., toxicity and/or dis-functionality of products encoded thereby) of a mutant extended NR containing target gene may be reduced, e.g., by reducing (and in some instances differentially, including selectively, reducing) the production or activity of toxic expression products (e.g., RNA or protein) encoded by the target gene. Kits and compositions for practicing the subject methods are also provided.
US10882816B2	Method for the preparation of 4-(heptafluoro-2-propyl) anilines The invention discloses a method for the preparation of substituted 4-(heptafluoro-2-propyl) anilines by reaction of 2-bromoheptafluoropropane with anilines in the presence of sodium dithionite, in a solvent and in the presence of a catalyst.
US10882814B2	Method for producing an ester Disclosed is a method for production of an ester obtained from a reaction between at least one alcohol having at least one hydroxyl group, such as a diol, and at least one linear of branched C3-C20 monocarboxylic acid, said reaction being performed in presence of at least one azeotropic solvent and optionally at least one antioxidant. Said method comprises the steps of (a) charging said alcohol, said monocarboxylic acid, and said azeotropic solvent and optionally said antioxidant to a reactor, (b) subjecting said alcohol and said carboxylic acid to esterification under reflux, (c) removing azeotropic solvent and unreacted carboxylic acid from yielded reaction mixture, (d) steam stripping off residual unreacted carboxylic acid, (e) neutralising yielded reaction product with an aqueous base, (f) separating water and organic phases, (g) recovering said organic phase and evaporating residual water, and (h) filtering off said antioxidant and possible remaining salts in yielded reaction product. The method is preferably performed in at least one reactor equipped with reflux, at least one vacuum pump, evaporation/distillation, steam stripping and decantation, and at least one filtration unit and optionally at least one coalescer filtre.
US10882812B2	Method for the production of 2,4-dihydroxybutyric acid Methods for the production of 2,4-dihydroxybutyrate (2,4-DHB) from erythrulose and other four-carbon sugars are disclosed. The improved methods facilitate the production of 2,4-DHB that is a precursor for biorenewable and animal nutrition chemicals among others.
US10882810B2	Process for the preparation of substituted phenoxyphenyl alcohols The present invention relates to a process for the preparation of the compounds of formula II using a lanthanoid salt.
US10882805B2	Processes for preparing 4-methyl-5-nonanone and 4-methyl-5-nonanol The present invention provides a process for preparing 4-methyl-5-nonanone of the following formula (3): the process comprising at least a step of subjecting 2-methylpentanoic anhydride of the following formula (1) and an n-butyl nucleophilic reagent of the following general formula (2) in which M represents Li, MgZ1, or ZnZ1, wherein Z1 represents a halogen atom or an n-butyl group, to a nucleophilic substitution. reaction Coproduce 4-methyl-5-nonanone (3), as well as a process for preparing 4-methyl-5-nonanol of the following formula (5), the process comprising at least steps of preparing 4-methyl-5-nonanone; and subjecting the obtained 4-methyl-5-nonanone and a reducing agent to a reduction reaction to produce 4-methyl-5-nonanol (5).
US10882803B2	Natural 1,2-alkanediols, compositions having natural 1,2-alkanediols and processes for making the same A process is incorporated herein for the synthesis of bio-1,2-alkanediols, comprising: providing a bio-alkene having a carbon chain of about 5 to about 20 carbon atoms and a bio-1-alkene regioselectivity of at least about 80%, at least about 92% and/or at least about 95%; and converting the bio-alkene to a bio-1,2-alkanediol having a carbon chain length of about 5 to about 20 carbon atoms. Methods for treating catalysts which may be incorporated in the process for the synthesis of bio-1,2-alkanediols are also included herein. Such bio-1,2-alkanediols are used in compositions and products alone as antimicrobial materials, or with existing bio-compounds and/or antimicrobials, preservatives, alternative preservation systems and/or hurdle technology components. The bio-1,2-alkanediols incorporate a natural and bio-based pathway for antimicrobial effects in various compositions such as cosmetic, pharmaceutical, industrial and household products.
US10882802B2	Process for catalytic hydrodefluorodimerization of fluoroölefins The present application provides a hydrodefluorodimerization process, which is useful in the synthesis of, for example, fluoroolefins that can be used as refrigerants, blowers and the like. The process is an “early-stage fluorination” process, wherein precursors containing fluorine are assembled into the desired product using a zerovalent nickel catalyst. Also provided is a liquid composition comprising one or more fluoroolefin produced by this catalytic process.
US10882800B2	Integrated gasification and electrolysis process Aspects of the invention relate to improvements in the flexibility with which oxygen and hydrogen, for example from electrolysis, may be supplied to processes having both gasification and methanation steps, as well as improvements in how such processes may be operated in response to variations in carbonaceous feeds. Offsets, between the ideal quantity of hydrogen and the quantity available from a given source may be compensated for by adjusting one or more operations of the process, and in particular such operation(s) that ultimately impact the quantity of CO and/or CO2 available downstream of the gasifier for conversion to methane in an RNG product stream.
US10882799B2	Primer for firearms and other munitions A primer includes a layered thermite coating comprising alternating layers of metal oxide and reducing metal (thermite) deposited upon a substrate. The layered thermite coating may include a primary ignition portion adjacent to the substrate, and a secondary ignition portion deposited on the primary ignition portion. The alternating thermite layers may be thinner within the primary ignition portion than in the secondary ignition portion. The primary ignition portion is structured for sensitivity to a firing pin strike to the opposite side of the substrate. The secondary ignition portion is structured to burn at a rate that will ignite smokeless powder or other ignitable substances used in munitions.
US10882794B2	Zirconium tin titanate compositions, ceramic bodies comprising same, and methods of manufacturing same Disclosed is a microcracked ceramic body, comprising a predominant phase (greater than 50 wt %) of zirconium tin titanate and a dilatometric coefficient of thermal expansion (CTE) from 25 to 1000 C of not more than 40×10−7° C.−1 as measured by dilatometry and methods for the manufacture of the same.
US10882793B2	Ferrite sheet production method and ferrite sheet using same A ferrite sheet manufacturing method according to the present invention includes (1) stacking a plurality of molded ferrite sheets to prepare a ferrite stack having gas discharge passages between adjacent molded ferrite sheets, and (2) sintering the ferrite stack. According to the present invention, productivity can be increased, and manufacturing costs can be reduced. In addition, a gas generated during combustion of a binder can be discharged using a gas discharge passage between repeatedly uneven portions disposed in one direction, thereby preventing wrinkles or waviness generated in a peripheral portion of a ferrite sheet. Furthermore, since it is possible to improve durability and reliability of an electromagnetic wave shielding material manufactured using the ferrite sheet, the ferrite sheet can be applied to various electronic products.
US10882775B2	Glass substrate A glass substrate comprising a rectangular glass sheet having a first main surface and a second main surface opposite the first main surface, the glass substrate having a first side and a second side which are adjacent to each other in a view along a thickness direction of the glass sheet, in which a thickness tolerance is less than 6.26 μm in a first cross section which is a cross section in the thickness direction of the glass sheet along a straight line parallel to the first side, the thickness tolerance being a difference between the maximum value and the minimum value of the thickness of the glass sheet.
US10882773B1	Water purification system A mobile water purification system having a trailer, a pretreatment subsystem having a cyclonic separator, a filtering subsystem fluidly connected with the pretreatment subsystem, the filtering subsystem having at least one bedded filter; a reverse osmosis subsystem fluidly connected with the filtering subsystem, the reverse osmosis subsystem having a waste output and a product output; a collection tank fluidly connected with and downstream of the reverse osmosis subsystem; a distribution subsystem fluidly connected with and downstream of the collection tank; a source water inlet mounted to the exterior and fluidly connected to the pretreatment inlet, the source water inlet outside of the at-least partially enclosed space; and a discharge water outlet mounted to the plurality of sidewalls and fluidly connected to the pressure tank, the discharge water outlet having an outlet opening outside of the at least partially-enclosed space.
US10882772B1	Stormwater collection, treatment, and aquifer replenishment installations and methods A stormwater collection, treatment, and aquifer replenishment installation includes a stormwater drain for receiving surface stormwater, a dry well downwardly extending underground to an outlet proximate to a water table over an aquifer, a tank structure at least partially disposed underground and coupled with the stormwater drain and the dry well in stormwater communication, a stormwater treatment system enclosed within the tank structure between the stormwater drain and the dry well for converting surface stormwater into treated stormwater, the tank structure for conducting surface stormwater to the stormwater treatment system between the stormwater drain and the dry well, and the dry well for receiving and gravity feeding treated stormwater from stormwater treatment system to the outlet.
US10882768B2	Method for processing contaminated wastewater from the preparation of isophorone, isophoronenitrile and isophoronediamine Contaminated wastewater from the preparation of isophorone, isophoronenitrile and isophoronediamine is treated by A) 1. treating the wastewater from the preparation of isophoronenitrile from the reaction of isophorone with hydrogen cyanide by alkaline hydrolysis of isophoronenitrile to isophorone, and the salts of hydrogen cyanide within a pH range of 12.0 to 13.7 and at temperatures of 60 to 200° C. and 2. processing the wastewater from A) 1. by an oxidation, or B) treating the wastewater from the preparation of isophoronenitrile from the reaction of isophorone with hydrogen cyanide by an oxidation, or C) processing the wastewater from A) 1. and the wastewater from the preparation of isophorone and/or the wastewater from the preparation of isophoronediamine by an oxidation.
US10882767B2	Method for removing ammonia nitrogen in aqueous solution A method for removing ammonia nitrogen in an aqueous solution is provided in the present invention. The method includes performing an electrolysis reaction using an electrolysis device, such that the ammonia nitrogen is converted into nitrogen gas, nitrate or nitrite. The electrolysis device includes an anode including metal nickel, nickel hydroxide or nickel oxyhydroxide, and a cathode including metal copper. The method has high selectivity of converting the ammonia nitrogen into the nitrogen gas.
US10882765B2	Method and system for operating a high recovery separation process A reverse osmosis system and method includes a feed pump pressurizing a feed stream, a first and second membrane array that generates permeate and brine streams. A first turbocharger uses first energy from the second brine stream to pressurize the first brine stream. A first and second auxiliary and bypass valves are associated with the first and second turbocharger. A second turbocharger uses second energy from the second brine stream to increase a second pressure of the feed stream. A first flow meter generates a first flow signal for the first permeate stream. A second flow meter generates a second flow signal for of the second permeate stream. A third flow meter generates a third flow signal for the second brine stream or the feed stream. A motor drives the first turbocharger or the feed pump. A controller controls the motor in response to the flow signals.
US10882764B2	Fluid sterilization apparatus A fluid sterilization apparatus includes: a flow passage tube in which a processing passage where a passing fluid is sterilized is formed; a first light source that irradiates the processing passage with ultraviolet light; an inflow passage formed in a direction that intersects an outer circumferential surface of the flow passage tube; and a communication passage that causes the inflow passage to communicate with the processing passage. The communication passage has a narrow passage in the middle of a path from the inflow passage toward an opening of a first end, the narrow passage being narrower than a passage toward the inflow passage.
US10882762B2	Method and system for removing hydrogen sulfide from sour oil and sour water Embodiments of the present invention are generally related to a system and method to remove hydrogen sulfide from sour water and sour oil. In particular, hydrogen sulfide is removed from sour water and sour oil without the need for special chemicals, such as catalyst chemicals, scavenger chemicals, hydrocarbon sources, or a large scale facility. The system and method in the present invention is particularly useful in exploratory oil and gas fields, where large facilities to remove hydrogen sulfide may be inaccessible. The present invention addresses the need for safe and cost effective transport of the deadly neurotoxin. Particular embodiments involve a system and method that can be executed both on a small and large scale to sweeten sour water and sour oil.
US10882758B2	Waste stream decontamination system The invention provides a method of decontaminating a waste stream liquid of solid particulate and one or more other pollutants, the method comprising the steps of: (i) removing solid particulate contaminant from the waste stream liquid by passing the waste stream liquid through at least one solids trap into a waste stream liquid holding reservoir whereby solid particulate is retained in the at least one solids trap; and (ii) removing one or more other pollutants from the waste stream liquid in the reservoir by contacting the waste stream liquid with at least one contaminant trap whereby the contaminant trap sequesters the one or more other pollutants within the contaminant trap.
US10882757B2	Anhydrous nickel chloride and method for producing the same Provided is anhydrous nickel chloride having a total content of impurity elements other than gas components of less than 10 wt. ppm; each content of boron, sodium, magnesium, aluminum, potassium, calcium, titanium, chromium, manganese, iron, copper, zinc, arsenic, silver, cadmium, indium, tin, thallium and lead of less than 1 wt. ppm, which can be produced by a method for producing anhydrous nickel chloride comprising the steps of carrying out ion exchange membrane electrolysis in an anolyte and a catholyte separated by an anion exchange membrane using raw metal nickel as an anode, a conductive material as a cathode and high purity hydrochloric acid as an electrolytic solution, to obtain a nickel chloride solution as the anolyte; concentrating the obtained nickel chloride solution by heating it at 80 to 100° C. under atmospheric pressure to obtain a concentrated nickel chloride solution; and dehydrating and drying the resulting concentrated nickel chloride solution by heating it at 180 to 220° C. under atmospheric pressure to obtain anhydrous nickel chloride.
US10882756B2	Regeneration of etch solutions containing trivalent manganese in acid media A method of regenerating an etch solution comprising a metastable complex of manganese(III) ions in a strong acid is described in which at least a portion of the manganese(III) ions in the metastable complex have been destabilized, causing them to disproportionate into manganese dioxide and manganese(II) ions. The method includes the steps of i) adding an effective amount of a reducing agent to the solution; ii) allowing the reducing agent to react with the solution to cause manganese dioxide to dissolve; and (iii) applying an electrical current to regenerate manganese(III) ions in the solution.
US10882753B2	Method for exchanging interlayer anions of a layered double hydroxide The invention relates to a method for exchanging interlayer anions of a layered double hydroxide (LDH) with other anions whose affinity for the LDH is lower than the one of the starting interlayer anions, which comprises the successive steps of: (1) exchanging the starting interlayer anions of a layered double hydroxide with polyoxometalate anions in order to obtain a layered double hydroxide with polyoxometalate anions as interlayer anions, and (2) exchanging the polyoxometalate anions of the layered double hydroxide obtained in step (1) with other anions whose affinity for the LDH is lower than the one of the starting interlayer anions in order to obtain a layered double hydroxide with other anions as interlayer anions.
US10882750B2	Method for preparing silica aerogel-containing blanket and silica aerogel-containing blanket prepared by using the same In the present invention are provided a method for preparing a silica aerogel-containing blanket, and a blanket which includes a silica aerogel and is manufactured using the same, wherein the method includes a step for preparing a reaction solution by reacting a silazane-based surface modification agent with an alcohol-based compound, a step for preparing a silica gel-base material composite by adding a silica precursor, water, and a polar organic solvent to the reaction solution to prepare a silica sol, and then immersing a base material for a blanket in the prepared silica sol to gelate the silica sol, and a step for drying the silica gel-base material composite.
US10882747B2	High-strength network structured nano-carrier material and preparation method and application thereof A high-strength network structured nano-carrier material and a preparation method and application thereof. A nano-cellulose solution and graphene are mixed and ultrasonication is performed in an ultrasonic pulverizer to obtain a nano-cellulose/graphene suspension. The suspension with a phenolic resin adhesive is mixed and stirred to obtain a nano-cellulose/graphene/phenolic resin suspension. The nano-cellulose/graphene/phenolic resin suspension is injected into a mold. The mold is placed in a freeze dryer for freezing and vacuum dried in two stages to obtain a nano-cellulose/graphene/phenolic resin aerogel. The aerogel is preheated and cured in a muffle furnace, then subjected to a high-temperature thermal decomposition treatment in a tube furnace to obtain a nano-carrier material having a high-strength network structure. The preparation method is simple and convenient, low in cost, environmentally friendly and green. The obtained carrier material has a good water resistance and a high mechanical property, and can carry more active substances.
US10882746B2	Method for the purification of yellow phosphor The present invention relates to a process for continuous purification of yellow phosphorus by adsorption onto activated carbon.
US10882743B2	Process for the production of hydrogen The invention relates to a process to convert hydrocarbons into hydrogen and a separate carbon phase, whereby in step a) the hydrocarbons are contacted with a molten salt, preferably comprising Zinc Chloride, at temperatures preferably above 500° C. and in step b) a solid or liquid carbon phase is separated from the molten salt at a lower temperature, preferably below 150° C. The molten salt is then preferably re-heated to the desired temperature and recycled to step a). The process avoids the emission of CO2, making the hydrogen produced in this way a zero CO2 emission fuel and which also produces a carbon product produced having a use value.
US10882739B2	Formation of antireflective surfaces Technologies are described for methods and systems effective for etching nanostructures in a substrate. The methods may comprise depositing a patterned block copolymer on the substrate. The patterned block copolymer may include first and second polymer block domains. The methods may comprise applying a precursor to the patterned block copolymer to generate an infiltrated block copolymer. The precursor may infiltrate into the first polymer block domain and generate a material in the first polymer block domain. The methods may comprise applying a removal agent to the infiltrated block copolymer to generate a patterned material. The removal agent may be effective to remove the first and second polymer block domains from the substrate. The methods may comprise etching the substrate. The patterned material on the substrate may mask the substrate to pattern the etching. The etching may be performed under conditions to produce nanostructures in the substrate.
US10882738B2	Wafer level package for a mems sensor device and corresponding manufacturing process A MEMS device package comprising a first die of semiconductor material including a contact pad and a second die of semiconductor material stacked on the first die. The second die is smaller than the first die. The second die includes a contact pad, and a conductive wire is coupled between the contact pad of the first die and a contact pad of the second die. A mold compound is on the second die and the first die. A vertical connection structure is on the contact pad of the second die. The vertical connection structure extends through the mold compound.
US10882735B2	Vertical stopper for capping MEMS devices Capped microelectromechanical systems (MEMS) devices are described. In at least some situations, the MEMS device includes one or more masses which move. The cap may include a stopper which damps motion of the one or more movable masses. In at least some situations, the stopper damps motion of one of the masses but not another mass.
US10882734B2	Device and method for conveying viscous material An apparatus for conveying viscous material from a drum-like container with a container bottom and a circumferential container wall extending from the container bottom to a container upper side and being open at the container upper side has, for closing the container a follower plate having a material outlet attached to a conveyor pump. The follower plate has an annularly circumferential wiper ring that has a radially outwardly extending contacting part for contact against an inside face, turned toward the follower plate, of the container wall. The contacting part can be pressurized with a variable pressing force for pressing against the inside face (36) of the container wall. The follower plate is mounted by moans of at least one vertically extending retaining rod on a horizontally extending crosspiece mounted on or close to a first end on a lifting device for raising and lowering of the crosspiece. Its second end is free.This task is accomplished by an apparatus having the features according to one aspect of the invention as well as by a method having the features according to another aspect of the invention. Advantageous further developments of the invention are subject matter discussed below.
US10882732B2	System and method for automatic fueling of hydraulic fracturing and other oilfield equipment A system and method for fueling multiple saddle tanks of hydraulic fracturing equipment from a single self-propelled cart. The cart having multiple retractable fuel lines for providing and obtaining fuel. Each retractable fuel supply line uses a flowmeter, a ball valve, and an electrically actuated valve to provide remote control to a controller based on a user's selected fueling requirements. An electronic reporting system provides fuel data to operators and users. Fuel data such as fuel tank status, an amount of fuel usage over a stage level, a daily level, or job level along with a fill level of the fuel tank.
US10882730B2	Method and apparatus for beverage dispensing including container stopper A system and method for dispensing sparkling and other non-pressurized beverages from a container. Sparkling wine and other beverages may be dispensed using a dispensing system that includes a stopper body that can be engaged with the container at the container opening. The stopper body may be arranged to introduce gas into the container during pouring-type dispensing, as well as re-pressurize and seal the container for storage, e.g., to keep a carbonation level of beverage remaining in the container.
US10882729B2	Beverage preservation keg with adjustable beer tap The present invention provides a beverage preservation keg with an adjustable beer tap, including a shell, an inner container, and a gas-liquid control device; the inner container includes an upper gas storage chamber and a lower beer storage chamber; the gas-liquid control device includes a keg spear, a dispenser and a beer discharge pipe; the keg spear matches and communicates with the gas storage chamber and the beer storage chamber, and the top end of the keg spear matches and is connected to the dispenser; the dispenser is connected to the matching beer discharge pipe. The present invention has the function of adjusting the beer flow rate, and the keg spear is provided with a pressure relief valve, which eliminates the need for a gas tube and a separate pressure relief valve to connect the keg spear to the gas storage chamber in series.
US10882727B2	Water purifier A water purifier includes a cooling water tank, a partition member mounted inside the cooling water tank and partitioning an inner space of the cooling water tank into an upper space and a lower space, a cold water pipe accommodated in the lower space; an evaporator accommodated in the upper space, and an agitator penetrating the partition member and disposed in the lower space. The partition member includes a bottom portion on which the evaporator is mounted and that defines a plurality of cooling water through-holes, and an outer wall portion extending upward along an edge of the bottom portion to define an evaporator accommodating portion. The outer wall portion is spaced apart from an inner wall of the cooling water tank to prevent ice formed in the evaporator accommodating portion from contacting the inner wall of the cooling water tank.
US10882725B2	Pallet dismantling system A pallet dismantling system includes a pallet that has a frame, a plurality of slats and a plurality of nails. Each of the nails extends through slats and engages the frame to fasten the slats on the frame. A tool is provided to disassemble the pallet and the tool includes a slot. The tool is selectively inserted between a selected one of the slats and the frame. Additionally, a selected one of the nails is positioned in the slot. The tool is urged to lift the selected slat from the frame. Moreover, the tool inhibits the nail from splintering the selected slat when the selected slat is removed from the frame.
US10882717B2	Elevator network for emergency operation An emergency operation controller for an elevator is connected to other emergency operation controllers of their respective elevators through network, and each controller constitutes a node in the network. The controller generates and transmits an emergency condition detection message to other controllers in the network which constitute adjacent nodes to the controller when the controller detects an emergency condition, and receives an emergency condition detection message from other controllers which constitute adjacent nodes to the controller in the network when other controllers detect an emergency condition. The emergency condition detection message includes a propagation count. The propagation count is configured to be decremented by one, each time one controller transmits the emergency condition detection message to other controllers which constitute next adjacent nodes. The emergency condition detection message is continuously transmitted until the propagation count reaches to zero.
US10882714B2	Winding head for a torroidal winding machine, torroidal winding machine comprising such a winding head and method A winding head includes an annular magazine for storing the quantity of wire required to wind a torus, a first mechanism for driving the magazine in rotation, and a traveler for guiding the wire, at the output of the magazine, around the torus. The winding head includes a second mechanism, distinct from the first mechanism, for driving the traveler in rotation, such that the magazine and the traveler can be driven in rotation independently of one another.
US10882713B2	Continuous body folding device and folding method A continuous body folding device includes a conveying part having a moving surface that moves while suctioning and holding a first region of a continuous body, the conveying part conveying the continuous body in the longitudinal direction thereof; a first folding reference part in which a first endless belt, which moves in a first circulatory pathway along a first virtual plane including the moving surface, moves along a first reference segment adjacent to a virtual line of the continuous body in the same direction at the same speed as the moving surface; and first guiding members that are disposed along the first reference segment, contact a second region of the continuous body, and fold the continuous body along the virtual line and move the second region toward the first region so that the angle formed by the first and second regions becomes smaller as the continuous body is conveyed downstream.
US10882712B2	Tape dispenser with opening for tape control Methods and devices for dispensing tape are disclosed. An example device may comprise a tape guide portion. The device may comprise a pair of side walls extending longitudinally rearward from the tape guide portion. The device may comprise a bar that at least partially extends from one of the pair of side walls towards the other of the pair of side walls. The device may comprise an aperture disposed through the tape guide portion to define a through hole from a top side to a bottom side of the tape guide portion for receiving a finger of a user to press tape extending from a tape roll against the bar to releasably affix the tape to allow cutting the tape.
US10882711B2	Brake assembly for a tape dispenser A tape dispenser housing wound adhesive tape includes a brake spoke tapering (i.e., narrowing) from a distal radial end to a proximal radial end relative to a tape rotational axis, wherein the brake spoke effectuates the braking of wound adhesive tape on a hub by contacting the wound adhesive tape, the hub, or both simultaneously.
US10882709B2	Rewinding machine Rewinding machine comprising a drive unit (1) for supplying a paper veil (2); a winding unit (3) for winding the paper veil supplied by the drive unit into a coil (W) around a winding core (4), comprising a primary roller (6) and a secondary roller (7) rotating in contact with the winding core (4), and a pressure unit (30) provided with a rotating roller (A, B, C) on the coil (W) that is being formed; a core exchange unit (5) for ejecting the formed coil (W) from the machine at the end of a winding cycle and inserting a new core to be wound; separation means (11) for interrupting the continuity of the paper veil at the end of a winding cycle; means for winding a drawing flap (34) of the veil (2) on the new core (4) at the beginning of a new winding cycle.
US10882703B2	Methods, systems, and apparatuses, for operating a material handling system A material handling apparatus includes a first pop-up belt abutting a first cam. The first pop-up belt is configured to facilitate movement of a package between a first conveyor and a second conveyor. a separator wall abuts a second cam. The separator wall is configured to control movement of the package between the first conveyor and the second conveyor. In response to the camshaft rotating in a first direction, the first cam causes the first pop-up belt to extend out from the first conveyor. The second cam causes the separator wall to move to a first position. I in the first position, the separator wall allows the package to move from the first conveyor to the second conveyor. In response to the camshaft rotating in a second direction, the first pop-up belt move to a retracted position while the separator wall to move to a second position.
US10882702B2	Method and apparatus for handling piece goods moved in at least two parallel rows The invention relates to a method and apparatus (10) for handling piece goods (2) for forming a palletizable layer or partial layer, with the piece goods (2) being moved in at least two parallel rows (1) and the layer comprising a plurality of piece goods (2). At least two piece goods (2) that are transported beside each other in parallel rows (1) are seized in a clamping and/or force-locking and/or form-locking manner, are then spatially separated from the at least two parallel rows (1) and are then brought into a specified relative target position (P1, P2) and/or target alignment in relation to subsequent piece goods (2). The apparatus (10) comprises at least one manipulator (5) for piece goods (2), and at least one transport device (3), where the piece goods (2) arranged in at least two parallel rows (1).
US10882701B2	Method and apparatus for detecting faults during object transport Provided is a method for detecting faults in the context of transport of objects, wherein by a transport device, a plurality of objects are transported in a predetermined alignment of these objects along a predetermined transport path, wherein the objects are transported while at least partially in contact with each other, and wherein the objects are located on a movable surface of the transport device, wherein, by at least one image capturing device, at least one first region is captured in which a plurality of these containers is located and at least one sub-region of this region is identified in which no object is located in the predetermined orientation, wherein furthermore a distinction is then made as to whether an object with an alignment deviating from the predetermined alignment or an empty space is located in this region.
US10882697B2	Storage apparatus and storage method A storage apparatus includes a storage shelf that stores a container, a purge device that is provided to the storage shelf and is able to perform a purge process on the container, and a purge determiner that determines at least one of a necessity of the purge process and a condition of the purge process in accordance with at least one of a transport source of the container to the storage shelf and a transport destination of the container from the storage shelf.
US10882695B2	Load handling system and method A load handling system and method of handling a load includes a load handling device with a load support that is configured for engaging a load and a first drive is adapted to drive said load support with respect to a load. A conveyor is moveable along the load support and a second drive is adapted to propel the conveyor with respect to the load support. The first and second drives are operated to handle a load. The load support may be a pair of forks or a platen or the like.
US10882683B2	Methods of forming repulpable containers A method of forming a shipping container includes mixing paper fibers with a binder fiber to form a mixture; disposing the mixture onto a surface to form a layer of the mixture; applying heat to form a paper fiber batt from the mixture having a fixed width and fixed length; and inserting the paper fiber batt within an interior of a corrugated box.
US10882680B2	Container for both cryopreservation and transportation A container for both cryopreservation and transportation including a thermal insulating container which has an inlet-outlet port for a substance to be stored and a lid for opening and closing the inlet-outlet port at the top thereof, a storage section which has a bottomed tubular shape, is fixed in the thermal insulating container and capable of taking in and out the substance stored from the inlet-outlet port, and a wave-suppression plate which is positioned laterally in a space between the storage section and an inner wall of the thermal insulating container, and suppresses waving of the cryogenic liquefied gas in a liquid state accumulated in the space between the storage section and the inner wall of the thermal insulating container.
US10882678B2	Reinforcement ring for capsules for obtaining beverages The present invention provides a reinforcement ring (10) for capsules for obtaining beverages, for example espresso coffee, comprising a side wall (1) and a flat surface, preferably having a uniform thickness (2), protruding from the side wall (1), wherein the side wall (1) and the protruding flat surface (2) are made in a single body and wherein the side wall (1) comprises reduced thickness areas (3), so as to reduce the total amount of material used for the production of the ring. A capsule for obtaining beverages comprising such a reinforcement ring (10) is also provided.
US10882675B2	Cookware and cook-packs for narrowband irradiation cooking and systems and methods thereof A methodology and product or system configurations are provided which allow food to be directly irradiated for cooking applications which involve the impingement of direct radiant energy on food or comestible items. Cooking vessels or cook-packs are used that are optically transmissive in visible or infrared narrow wavelength bands emitted in suitable narrowband cooking or heating systems.
US10882674B2	Tie-wrap assembly and method for using the same A tie-wrap assembly having a locking head, an elongated strap body spaced apart from the locking head, and a coupling member, wherein the coupling member is connected to and disposed between the locking head and the elongated strap body, and wherein the coupling member is fabricated from an elastomeric material.
US10882673B2	Dual-seal liner and non-removable closure assembly Non-removable closure assembly that resists rotational movement so as to be rendered substantially non-removable by the consumer. An induction heat seal liner is provided for sealing the finish (open end or mouth) of a plastic container, the liner being disposed between a closure cap and the container finish and being heat seal bonded to both, thus rendering the closure cap non-removable from the container finish. By non-removable it is meant that once heat seal bonded together the closure cap cannot be removed by a customer or consumer (a human) by hand, without substantially distorting the closure cap or container, e.g., it would require the human to use a mechanical tool (e.g., knife or wrench) and in the process of trying to remove the cap with the tool it would substantially deform the closure cap or container and render one or more of them unusable for their intended purpose.
US10882672B2	Safety capsule for a container A closure capsule for closing a container, comprising: a cap (2) to be associated with the container and comprising a frangible mouth (20); a cutter (3) for opening said frangible mouth (20); a covering (4) protecting said cap (2) and said cutter (3) and comprising an intactness band (40); first toothed connection means (5) afforded on the covering (4) and on the cutter (3) and that make said cutter (3) and said covering (4) rotate integrally. The closure capsule is movable from a initial configuration to an operative configuration, wherein the intactness band is removed and the frangible mouth is broken. In the initial configuration, the cap, the cutter and the covering contribute to the definition of walls of a reservoir (8) for containing a product to be dropped into the container in the operative configuration.
US10882671B2	Container and valve for a container Beverage container (1) and valve (6) for a beverage container (1). Valve (6), comprising a base element (26) and a snap ring or snap fingers (48) extending there from, positioned around an opening (27) through the base element (26), wherein within the snap ring or between the snap fingers (48) a valve housing (24) is provided, having at least one inlet opening (9) and a spring loaded valve body (29), biased towards the base element (26) and closing off the opening (27), wherein the valve body (29) is operable through the opening (27) for opening a fluid connection between the inlet opening (9) or openings and the opening (27) in the base element (26).
US10882670B2	Powder-type hair thickening agent storage container having plurality of spurting holes The present invention relates to a powder-type hair thickening agent storage container having a plurality of spurting holes, and to a powder-type hair thickening agent storage container having a plurality of spurting holes, the storage container having a cylindrical protrusion part, which protrudes from an upper surface thereof to spurt a powder-type hair thickening agent to an outside, and including: a barrel-shaped container part having the powder-type hair thickening agent stored therein; a packing part detachably coupled to an inside of the protrusion part, and having a discharge hole such that the powder-type hair thickening agent is spurted to the outside; and a cap part coupled to the protrusion part so as to encompass the same, and allowing the spurting amount of the powder-type hair thickening agent to be adjusted through the discharge hole.
US10882669B2	Beverage container Provided is a beverage container that includes a container main body capable of containing a beverage, a valve seat, a valve body, a seesaw member, and an operation portion. The valve seat defines a beverage spout. The valve body is disposed to be movable between a closing position for sealing the spout and an opening position for opening the spout. The seesaw member includes a first end portion, a second end portion, and a fulcrum portion, and is connected to the valve body, and is swingable using a fulcrum portion as a fulcrum. The operation portion includes a shaft portion and a lever portion. When the lever portion is rotated, the seesaw member is inclined, and the valve body is pushed up and moves from the closing position to the opening position.
US10882663B2	Side wall arrangement for a container and method for the production thereof and container having such a side wall arrangement The invention relates to a side wall arrangement for a container and a method for the production thereof and a container, in particular a pallet container, which comprises several side walls (16) that can be connected to one another on their narrow sides assigned to one another of the side walls (16) by means of a joint (18) or are connected to one another, such that a closed ring (14) is formed from the side walls (16) that can be folded together, wherein a loading hatch (19) is provided on the at least one side wall (16), said loading hatch (19) closing an opening (27) in a closed position (22), said opening (27) being open towards an end edge (37) of the side wall (16), and wherein the loading hatch (19) is flexibly connected to the side wall (16) by means of a hinge (21), wherein side edges (42) of the loading hatch (19) which border it in terms of width and side edges (43) of the side wall (16) which border the opening (27) in the side wall (16) are reduced in terms of wall thickness relative to its adjacent wall sections (28, 29) of the side wall (16) and the loading hatch (19) on at least one side edge (43) of the side wall (16) or at least one side edge (42) of the loading hatch (19), at least one tab (31) is provided which extends beyond the opposite side edge (42, 43) of the loading hatch (19) or the side wall (16) and can be transferred into the open position (23) or closed position (22) when opening and closing the loading hatch (19) after overcoming a holding force produced by the tab (31) or after overcoming a holding force produced by corner regions (51) of the side wall (16) projecting into the opening (27) and, in the closed position (22), the side edge (42) is positioned in the upper corner region (52) of the loading hatch (19) between the side edge (43) of the side wall (16) and the tab (31) positioned in the side wall (16) or the side edge (43) is positioned in the upper corner region (51) of the side wall (16) between the side edge (42) of the loading hatch (19) and the tab (31) that is arranged on the loading hatch (19).
US10882661B1	Devices and methods relating to modular storage In accordance with aspects of the present disclosure, an apparatus includes a holder having a flexible sheet with a foldable portion that is foldable along an axis to form an upper portion and a lower portion of the flexible sheet, wherein the upper portion contains at least one magnet embedded therein and the lower portion contains at least one magnet embedded therein. The apparatus further includes at least one rigid container dimensioned to fit within the holder when the holder is folded, where the rigid container includes at least a first magnet with the first magnet located to engage the at least one magnet embedded in the lower portion of the holder and the at least one magnet embedded in the upper portion of the holder.
US10882659B2	Apparatus for forming a monolithic compressed wood pallet with increased load capacity An apparatus for forming monolithic compressed wood pallets with increased load capacity includesa storage component having a chamber for collecting the mixture, inside which a first conveyor belt is accommodated for feeding a uniform layer of mixture toward an outlet. The first belt is wound around at least one motorized roller and entrained by it with a feed speed.The apparatus also includes a pressing component with a lower mold part and an upper mold part between which a receptacle for forming a pallet is provided.A second conveyor belt is interposed between the storage component and the pressing component. The apparatus further includes a component for modulating at least one among feed speed, the advancement speed, and the translation speed so as to obtain adjustment of quantity of mixture loaded/unloaded on/from upper portion of the second belt along an extension of the mat.
US10882657B2	Crush-tolerant container and blank and method for forming the same A blank for constructing a crush-tolerant container includes a first side panel, a bottom panel, a second side panel, and a top panel coupled together in series. At least one cutout and at least one bridge portion are defined along a first fold line between the top panel and the first side panel. The at least one bridge portion and the at least one cutout are configured to maintain the top panel in a plane spaced above a top edge of the first side panel when the container is formed and the top panel is not under a stacking load, and to allow the top panel to move downwardly such that at least a portion of the top panel is substantially co-planar with the top edge of the first side panel when the container is formed and the top panel is under the stacking load.
US10882654B2	System and method for freeze-drying and packaging A system and method for protecting biological or other material from contamination through the steps of filling, freeze-drying, packaging, storing and use are disclosed. A system can include a flexible container, a membrane configured to transmit air or solvent vapor out of the flexible container, and a membrane frame supporting the membrane and engaged with at least one column member. The at least one column member can be configured to maintain the membrane and the membrane frame a spaced distance from one or more contents received within the flexible container. Upon application of a downward force, the at least one column member can assume a collapsed configuration. A method can include inserting a biological material, for example, into a flexible container, freeze-drying the biological material, moving the freeze-dried biological material to a portion of the flexible container that includes at least one port, and sealing the biological material within the portion.
US10882653B2	Packaging machine with a protective cover, a token fastening capsule arranged thereon as well as a method A packaging machine that may include a protective cover and a token fastening capsule arranged on the protective cover. The protective cover may include a receptacle that is configured for receiving a token. The receptacle may have a first contact surface. The fastening capsule may include a cap for covering an opening of the receptacle and that includes a second contact surface. The first contact surface and the second contact surface may be in contact with each other when the cap covers the opening of the receptacle. In one embodiment, the receptacle and/or the cap is provided with a knurl, the knurl being provided on the first or the second contact surface. Further, a method of fastening a token on a protective cover is presented wherein the receptacle may be cold welded to the cap in view of the structure provided above.
US10882650B2	Carbonation preservation device The present disclosure provides a carbonation preservation device that attaches to the mouth of an open container holding carbonated liquid. More specifically, the present invention relates to a device for preventing loss of carbonation from a carbonated liquid stored within a container by purging the trapped air above the remaining liquid within the container and replacing it with carbon dioxide or mixture of gases. When in place, the carbonation preservation device purges the air and other gases from the volume above the remaining carbonated liquid and fills the volume with a gas, such as carbon dioxide, or a mixture of gases, in order to pressurize the container and prevent the escape of carbon dioxide from the remaining carbonated liquid in the container.
US10882646B2	Spacecraft systems and methods Embodiments provide a spacecraft airlock system. Embodiments provide a method and apparatus for attaching space exposed payloads to a space station.
US10882642B2	System and method of producing artificial gravity in an electromagnetized environment A method of the producing artificial gravity in an electromagnetized environment is provided with a bodysuit, a corridor, a plurality of mobile electromagnets, a plurality of mobile inertial measurement units (IMUs), a plurality of first fixed electromagnets, second fixed electromagnets, and at least one computing unit. The first fixed magnets and the second fixed magnets are integrated throughout the corridor to continuously generate a uniform magnetic field through the corridor. The mobile electromagnets are integrated throughout the bodysuit to electromagnetically interact with the first fixed electromagnets and the second fixed electromagnets, which simulates gravity as the bodysuit moves through the corridor. The mobile IMUs are integrated to the bodysuit so that the mobile IMUs sends spatial positioning and orientation data to the computing unit. This feedback data allows for better gravity simulation because the computing unit can then directionally and magnitudinally adjust the electromagnetic field of each mobile electromagnet.
US10882641B2	Multifunctional structure for electrical energy and mechanical environment management Provided is a multifunctional structure for electrical energy and mechanical environment management, which comprises a main structure module, four rechargeable/dischargeable power source modules (PSMs), a vibration reduction system and a sensor module. The main structure module includes a framework, an upper cover plate and a lower cover plate. Elastic blocks are arranged between the periphery of each PSM and walls of the square cavity used for accommodating the PSM. Elastic cushions are arranged between the bottom surface of each PSM and the lower cover plate, and between the top surface of each PSM and the upper cover plate. The multifunctional structure, by means of embedding the PSMs into the interior of the structure, can realize high integration of multiple functions, such as bearing, power supply and vibration reduction, and can greatly improve the load/mass ratio, the load/volume ratio and the function/structure ratio of a system platform.
US10882640B2	Energy efficient satellite maneuvering Energy efficient satellite maneuvering is described herein. One disclosed example method includes maneuvering a satellite that is in an orbit around a space body so that a principle sensitive axis of the satellite is oriented to an orbit frame plane to reduce gravity gradient torques acting upon the satellite. The orbit frame plane is based on an orbit frame vector.
US10882628B2	Drone with magnet fluid sealed bearing unit and drive motor having the bearing unit One object is to provide a drone capable of achieving desired performance by preventing entry of foreign matter such as water droplets or dust particularly into a power portion thereof. A drone of the present invention is provided with a fixed section having a motor housing for housing a motor therein and a rotary section having a propeller shaft supported via a bearing so as to be rotatable with respect to the motor housing and configured to rotate integrally with the propeller. In an opposed portion where fixed-side components constituting the fixed section and rotary-side components constituting the rotary section are opposed to each other, there is provided a foreign matter entry prevention unit configured to prevent foreign matter from entering an inside of the motor housing.
US10882625B2	Wing comprising a leading edge having means for preventing the deposition of residues A wing comprising a leading edge composed of a skin transparent to microwaves, magnetrons implanted under the skin and arranged in rows and in columns alongside one another, between two successive rows of magnetrons, a discharge row successively comprising an electrode and a ground electrode, where each electrode passes through the skin and where each ground electrode is under the skin.
US10882623B2	Advanced environmental control system in an integrated split pack arrangement with two bleed/outflow heat exchangers An environmental control system for providing conditioned air to a volume of an aircraft includes a ram air circuit including a ram air shell with at least one heat exchanger positioned therein. A dehumidification system is arranged in fluid communication with the ram air circuit and at least one compressing device is arranged in fluid communication with the ram air circuit and the dehumidification system. A plurality of mediums is receivable within the environmental control system. A first medium of the plurality of mediums is provided from the volume of the aircraft via at least one valve.
US10882617B2	Aircraft based augmented and virtual reality passenger social media interaction system and related method A system and method for passenger interaction receives an input from a passenger to create an actual, virtual reality (VR) or augmented reality (AR) environment within which the passenger wishes to immerse and then share via social media. The input includes a passenger order to immediately share the environment, delay sending or store the environment. Each environment includes a characteristic of the passenger as immersed within a location element and vehicle element associated with the vehicle in which the passenger is traveling. The system maintains a hardware suite capable of creation of the desired environment and displaying the environment to the passenger. The system then formats and transmits the environment in a format recognizable by a social media application.
US10882616B2	Safety link assembly for an aerial delivery apparatus A safety link assembly for use with an aerial delivery apparatus, the assembly comprising a main body, an ejectable connector, a retaining mechanism comprising a retaining lever rotatably mounted on a rotary axis on the main body and rotatable between a first retaining position, and a second releasing position, and a securing mechanism comprising a securing member moveable between a first securing position, and a second non-securing position, wherein the distance from the first region of the retaining lever to the rotary axis is less than the distance from the second region of the retaining lever to the rotary axis. Methods of performing an aerial delivery from an aircraft are also included.
US10882615B2	Multi-rotor aerial vehicle with single arm failure redundancy The present disclosure provides a multi-rotor Aerial Vehicle comprising at least five arms. Pairs of coaxial contra rotating rotors/propellers are configured on each arm defining a polygon. In the event of failure of any one of the rotors/propellers, a control system incorporating an autopilot, shuts off corresponding contra rotating rotor/propeller of the pair to maintain yaw stability thereby rendering the corresponding arm non-functional; and adjusts throttles of the coaxial contra rotating rotors/propellers of remaining functional arms to maintain tilt and lift stability of the Aerial Vehicle.
US10882614B2	Transport drone A transport drone includes: a drone body; a transport unit for carrying an object to be transported; a balancing unit comprising a balancing frame and a swinging device, wherein the balancing frame is connected to the transport unit; the swinging device is respectively connected to the balancing frame and the drone body; the swinging device has rotational freedom; a sensor placed on the balancing frame for detecting a tilt angle of the balancing frame; and a controller electrically connected to both the sensor and the swinging device, wherein the controller controls rotation of the swinging device according to the tilt angle detected by the sensor, so as to adjust the tilt angle of the balancing frame and keep the transport unit in a horizontal state. The transport drone ensures that the items to be transported are in a horizontal state, effectively preventing dumping or damage of the items.
US10882612B2	Mast bearing system for a tiltrotor aircraft A tiltrotor aircraft may be provided and may include a mast assembly, in which the mast assembly may include a mast; a bearing system; a housing; and a housing cap secured to the housing, wherein the bearing system is between the mast and the housing. The bearing system may further include a first bearing assembly including a first inner race, a first outer race, and a plurality of first tapered roller bearings; a second bearing assembly including a second inner race, a second outer race, and a plurality of second tapered roller bearings; an inner spacer and an outer spacer in which the inner and outer spacers are between the first and second bearing assemblies; and a retaining device in which the retaining device and the housing cap provide, at least in part, pre-loading for the first and second bearing assemblies.
US10882610B2	Electrical braking systems for rotorcraft A braking system for a rotorcraft having a rotor hub assembly includes a generator having an armature mechanically coupled to the rotor hub assembly such that the armature is rotatable in response to rotation of the rotor hub assembly and a braking unit in selective electrical communication with the generator. The braking unit is adapted to apply an electrical resistance to rotation of the armature, thereby reducing a rotational speed of the rotor hub assembly.
US10882608B2	Hydraulic system for a vehicle and method of using the same There is provided a hydraulic system for a vehicle. The hydraulic system has a hydraulic rotary actuator assembly rotationally coupled to a road wheel of the vehicle. The hydraulic rotary actuator assembly has a first operating mode, wherein a rotation of the road wheel causes the hydraulic rotary actuator assembly to pump a fluid from a fluid supply system. The hydraulic system further has a variable restrictor assembly coupled to the hydraulic rotary actuator assembly in the vehicle. The variable restrictor assembly controls a flow of the fluid flowing from the hydraulic rotary actuator assembly, to brake the rotation of the road wheel on a ground surface. The hydraulic system further has a variable restrictor controller coupled to the variable restrictor assembly. The variable restrictor controller controls the variable restrictor assembly, so as to enable a variation of a rate of braking of the road wheel on the ground surface.
US10882605B2	Riblet structure and object The present invention provides a riblet structure that further reduces drag, which is a sum of turbulent friction drag and pressure drag, and an object including such a riblet structure. An object such as an aircraft, plant, and pipeline includes a wavelike riblet pattern on a surface. The wavelike riblet pattern includes a large number of wavelike riblets. Each of the large number of wave riblets includes a wavelike ridge line, and a height thereof changes cyclically with respect to a fluid flow direction. With such a configuration, drag, which is a sum of turbulent friction drag and pressure drag, can be further reduced.
US10882600B2	Foldable unmanned aerial vehicle An unmanned aerial vehicle having an airframe whose horizontal dimension is efficiently reduced. This object is solved by an unmanned aerial vehicle that includes: a rotor; an arm; and an arm connector. The arm connector includes an arm holder that is a fixing member holding a part of the arm in a longitudinal direction of the arm. The part of the arm held by the arm holder is changeable by sliding the arm in the longitudinal direction of the arm relative to the arm holder. The arm holder is a movable member movable in directions in which the arm is turned upward and downward and/or rightward and leftward. The object is also solved by an unmanned aerial vehicle that includes: a rotor; an arm; and an arm connector. The arm is provided with a hinge on which the arm is foldable at a middle portion of the arm.
US10882597B2	Impact resistant fuselage An impact resistant fuselage of an aircraft, the fuselage extending along a central longitudinal direction, wherein transversal sections of the fuselage are comprised in a vertical plane perpendicular to the central longitudinal direction. The impact resistant fuselage comprises at least a ballistic material membrane extended along the longitudinal direction for absorbing high energy impacts. The membrane according to a transversal section, comprising at least one section between two tensional elements, wherein the material membrane is located inside the fuselage of the aircraft, the at least one section of the membrane is mechanically linked to the inside of the fuselage by the tensional elements, and the two tensional elements stress the membrane.
US10882594B2	Outboard motor raising/lowering device Provided is an outboard motor raising and lowering apparatus that is capable of automatically changing the speed of raising/lowering an outboard motor according to a status of the outboard motor. The outboard motor raising and lowering apparatus (1) includes: a first fluid passage that connects a pump (42), a second chamber(s) of one or more tilt cylinders (14), and a second chamber(s) of one or more trim cylinders (12); a second fluid passage that is connected to the first chamber of at least one of the one or more trim cylinders; a switching valve (60) provided at the second fluid passage; and a control section (100) configured to control the switching valve with reference to a watercraft status signal.
US10882592B1	Mobile low frequency sound source for underwater communication and navigation A low frequency underwater sound source for use in an autonomous underwater vehicle includes a cylindrical body having a front portion, a rear portion, a cylindrical piezo-ceramic ring transducer disposed therebetween, and a resonant pipe surrounding the transducer. A gap is formed between an inner surface of the pipe and an outer surface of the transducer. Alternatively, the sound source includes a cylindrical body, a front fairing disposed forward of the cylindrical body, a plurality of metal rods connecting the front of the cylindrical body and the rear of the fairing, a spherical piezo-ceramic transducer disposed between the cylindrical body and the fairing, and a resonant pipe mounted at the front end of the cylindrical body. The spherical transducer is disposed within a cavity within the resonant pipe. A cylindrical orifice is formed between the front end of the resonant pipe and the rear of the fairing.
US10882574B2	Method of track link manufacture A method of fabricating a track link comprises creating a rail portion of a track link from a high alloy steel, creating a main body portion of a track link from a low alloy steel, and friction adhering the rail portion onto the main body portion.
US10882572B2	Trailer underbody fairing system The present disclosure pertains to fairings for use on a trailer having a movable bogie. In one implementation, panels of the fairing extend at least to a rear termination point of the movable bogie and include a slim hinge to prevent interference with a pair of wheels coupled to the bogie. Accordingly, implementations of the present disclosure include a fairing that allows for translation of the movable bogie, while also providing panel coverage up to and beyond a pair of wheels coupled to the bogie regardless of the bogie position relative to the trailer.
US10882570B1	Tailgate latch system A tailgate latch system is described. The tailgate latch system may comprise an actuatable button located on a pickup truck tailgate, at least one rotatable rod located in the tailgate interior that is configured to rotate clockwise or counterclockwise upon actuating the button and a rotary latch that is configured to disengage a bedside striker pin upon rotation of the at least one rotatable rod.
US10882568B2	Vehicle front-end assembly A vehicle front-end assembly includes a vehicle frame and a skid plate. The vehicle frame has a first front side member and a second front side member. Each of the first and second front side members has a corresponding front-end portion with a downward facing surface. The skid plate has a main section, a first attachment flange extending from a first lateral side of the main section and a second attachment flange extending from a second lateral side of the main section. The first attachment flange is attached to the downward facing surface of the first front side member. The second attachment flange is attached to the downward facing surface of the second front side member such that the main section covers a forward area of an underside of the vehicle.
US10882560B2	Vehicle-body lower structure A vehicle-body lower structure includes: a side sill; and a cross member, wherein the side sill includes a side sill outer and a side sill inner, a bulk having a shape corresponding to the cross member is provided on the opposite side of the side sill inner from the cross member in a closed-section space formed by the side sill outer and the side sill inner, and the bulk includes a front wall portion, a rear wall portion placed behind the front wall portion in the vehicle-body front-rear direction, and a connecting wall portion connecting the front wall portion and the rear wall portion, the front wall portion and the connecting wall portion forming a first edge line extending in the vehicle width direction, and the rear wall portion and the connecting wall, portion forming a second edge line extending in the vehicle width direction.
US10882559B2	Support structure for a vehicle The present disclosure relates to a support structure (1) for a vehicle, comprising a support (2) which has an upper shell (3) and a lower shell (4), the extension of the support structure in the longitudinal extension of the vehicle being defined by the extension of the two shells (3, 4) in said direction, and comprising attachment points (14, 14.1) for connecting a link (27). A front attachment point and a rear attachment point are provided on each link attachment side (9, 9.1). The two attachment points (14, 14.1) are provided for an attachment insert (10) on each link attachment side (9, 9.1) of the support (2), wherein the attachment insert is connected to the shells (3, 4), is open towards a link (27) to be connected to the attachment points at least in the region of the attachment points (14, 14.1), and is produced as a separate component. This attachment insert has an upper chord (11), a lower chord (12), and a back section (13) connecting the upper chord (11) to the lower chord (12), wherein the upper chord (11) of the attachment insert (10) is connected to the upper chord (11) of the support (2), and the lower chord (12) of the attachment insert (10) is connected to the lower shell (4) of the support (2), wherein link connection part receivers (17, 17.1) provided by the attachment insert (10) are separated from the support (2) cavity located between the upper and the lower shell by the back section (13).
US10882558B2	Arrangement of central load-carrying tube of motor vehicle chassis with integrated rotary electric motor, method of its placement and use Arrangement of central load-carrying tube of motor vehicle chassis with integrated rotary electric motor, method of its placement and use, wherein one or more rotary electric motors (1) are placed inside the tubular structure of the central tube (2) of vehicle chassis. Advantageously, the tubular structure of the central tube (2) of vehicle chassis is further fitted with traction components (5), (6) and (7), which, together with the rotary electric motor, form a compact unit. Use of central load-carrying tube (2) according to claims 1 to 6, fitted with rotary electric motor (1) and traction components, as a chassis of the road, commercial and military vehicles.
US10882557B2	Vehicle lower structure A vehicle lower structure includes: a pair of rear side members having a kick-up part bent toward an upper rear side of a vehicle; a rear cross member that connect parts of the pair of rear side members on a rear side from the kick-up parts; a battery pack; and a bracket including a lower flange placed against a rear end of the battery pack, and has a lower fastening hole through which a first fastening member is inserted; and an upper flange that is placed against the rear cross member, and has an upper fastening hole through which a second fastening member is inserted. The bracket has a fragile portion at least either between the upper fastening hole and an end edge of the upper flange or between the lower fastening hole and an end edge of the lower flange.
US10882555B2	Method for operating an operating device for a transportation vehicle to assist a driver when coupling the transportation vehicle to a trailer, operating device, and transportation vehicle A method for operating a control device for a transportation vehicle to assist a driver maneuvering the transportation vehicle up to a trailer to couple the transportation vehicle to the trailer, wherein target coordinates of a coupling position provided for the transportation vehicle for coupling are determined by the control device and the process repeated, while a graphical distance display element is displayed to the driver by a display apparatus, a current distance value of a distance of the transportation vehicle from the coupling position is determined, and a size parameter of the graphical distance display element is adjusted based on the current distance value. A non-linear scaling function brings about a higher position resolution in a near region around the coupling position than outside the near region is used for a conversion from the respectively current distance value into a value of the size parameter.
US10882553B2	Kingpin assembly with a torque receiving configuration A kingpin assembly includes a pin that has a shaft with a spherical member extending therefrom. The kingpin includes a base that has a spherical interior surface which defines an interior area. The interior area includes an open end of the base and is bounded by a closed end of the base. The closed end of the base is opposite the open end. The spherical member is rotatingly disposed in the interior area with the shaft extending away from the open end. The closed end has a torque receiving configuration for receiving a torque applying tool thereon.
US10882542B2	Energy dissipating device and connection device comprising such an energy dissipating device An energy dissipating device includes a guide defining a guide surface having a curved cross-section. A deformer is slideably supported by the guide surface of the guide in a compression stroke direction of the device. A stopper is fixedly attached to the device and arranged at a distance from the deformer in the compression stroke direction. An energy dissipating member is arranged between the stopper and the deformer in the compression stroke direction, and includes a first end configured to engage with the stopper and a second end configured to engage with the deformer in response to a force thereon in the compression stroke direction.
US10882540B2	Robotic service device and handling method A robotic service device for a robotic picking system grid. The robotic service device can be configured for driving to any location on the grid in order to restart malfunctioning robotic load handling devices or to perform maintenance operations or cleaning in situ. Additionally, the service device may be used to rescue robotic load handling devices operational in the picking system. The robotic service device can include a releasable docking mechanism to enable it to dock and latch on to malfunctioning load handling devices. The service device can also be provided with a cleaning device and camera device to enable a condition of a grid and other robotic devices to be monitored.
US10882539B2	Railway vehicle having partially standardized carriages The railway vehicle comprises at least one end car, each arranged at a respective end of the railway vehicle, and, for each end car, a first car adjacent to this end car, and at least one second car, one of which is adjacent to the first car. Each second car comprises a second structural body. Each first car comprises a first structural body substantially identical to the second structural body of each second car, and a structural extension part attached on the first structural body and intended to be connected to the adjacent end car.
US10882535B2	Object interaction prediction systems and methods for autonomous vehicles Systems and methods for determining object motion and controlling autonomous vehicles are provided. In one example embodiment, a computing system includes processor(s) and one or more tangible, non-transitory, computer readable media that collectively store instructions that when executed by the processor(s) cause the computing system to perform operations. The operations include obtaining data associated with a first object and one or more second objects within a surrounding environment of an autonomous vehicle. The operations include determining an interaction between the first object and the one or more second objects based at least in part on the data. The operations include determining one or more predicted trajectories of the first object within the surrounding environment based at least in part on the interaction between the first object and the one or more second objects. The operations include outputting data indicative of the one or more predicted trajectories of the first object.
US10882532B2	Driving assistance device and driving assistance method An ECU as a driving assistance device has a traffic sign detection section, a lane entry detection section and a judgment section. The traffic sign detection section detects traffic signs including a speed limit symbol based on front-image data captured by an in-vehicle camera. The lane entry detection section detects that the own vehicle has entered a ramp lane to leave a highway. The judgment section detects an extent of a current driving lane as the ramp lane when following conditions (c1) and (c2) are satisfied after the lane entry detection section detects the entry of the own vehicle into the ramp lane: (c1) not less than two traffic signs are arranged along the current driving lane in forward direction of the vehicle; and (c2) an arrangement of speed limit symbols included in the detected traffic signs satisfy a predetermined speed reduction pattern.
US10882531B2	Control apparatus for vehicle drive-force transmitting apparatus A control apparatus for a vehicle drive-force transmitting apparatus that defines (i) a first drive-force transmitting path established by engagement of a first engagement device controlled by an on-off solenoid valve and (ii) a second drive-force transmitting path established by engagement of a second engagement device controlled by a linear solenoid valve. A third engagement device, which is, as well as the first engagement device, disposed in the first drive-force transmitting path, is configured to transmit a drive force during a driving state of the vehicle and to cut off transmission of the drive force during a driven state of the vehicle. In a case in which the second drive-force transmitting path is to be established in place of the first drive-force transmitting path, the second engagement device is engaged when the first engagement device is engaged, and the first engagement device is released after an inertia phase is started.
US10882530B2	Vehicle allocation system A vehicle allocation system includes for allocating, through autonomous driving, an allocation vehicle selected from a plurality of selection target vehicles is provided. Each of the plurality of selection target vehicles includes an electronic controller configured to perform hydraulic pressure control learning and autonomous driving control of a power transmission device in which a plurality of shift stages are established by combination of a plurality of hydraulic engaging devices. The at least one processing circuitry is configured to select a vehicle in which a progress degree of the hydraulic pressure control learning is low as the allocation vehicle from the selection target vehicles, based on progress degrees of the hydraulic pressure control learning before the vehicle allocation.
US10882528B2	Method and system for auxiliary power generation An auxiliary power system for a motor vehicle includes a power generator that generates electricity to charge one or more auxiliary power system batteries. The motor vehicle includes an engine and drive train that distributes power from the engine to the drive wheels. The drive train can include a transmission, a drive shaft and a differential that connects the engine to the drive wheels. The power generator can be connected to the drive train (e.g., the transmission, the drive shaft or the differential) to draw power to generate electricity as well as to apply braking loads on the drive wheels to increase the ability to stop the motor vehicle.
US10882524B2	Systems and methods for vehicle launch control Methods and systems are provided for launching a vehicle from rest in order to maximize performance for the vehicle launch event. In one example, a method comprises, in preparation of a launch of the vehicle driven by an engine from a resting state, rotating a set of vehicle tires via a controller by adjusting a torque of the engine while vehicle brakes are applied for a duration that is a function of real-time pressure sensor readings of the set of tires. In this way, tire temperature may be determined based on the real-time pressure sensor readings in order to control tire temperature to an optimal tire temperature for the launch event, where the optimal tire temperature is based on a coefficient of friction of the road surface the vehicle is launching from, and where the optimal tire temperature provides for optimal grip for the vehicle launch.
US10882521B2	Method and system for use of sensors in parked vehicles for traffic safety A method at computing device associated with a parked vehicle, the method including receiving a request for sensor information from an external computing device, the request including an area of interest; activating sensors of the parked vehicle; obtaining sensor data for the area of interest; and providing a response to the external computing device.
US10882513B2	Hybrid vehicle A hybrid vehicle is provided. A vehicle V has a gasoline particulate filter (GPF) provided on an exhaust passage to capture particulate matter (PM) included in exhaust, a generator motor connected to a crank shaft of an engine, an exhaust temperature sensor acquiring a filter temperature correlated with a temperature of the GPF, and an electronic control unit (ECU) performing motor drive control for rotating the crank shaft with the generator motor when a filter temperature is higher than or equal to a PM combustion start temperature and a PM combustion integration amount that is an integration amount of PM combusted in the GPF is less than a PM discharge integration amount.
US10882512B2	Drive system for a hybrid vehicle and method for operating said system A drive system for a hybrid vehicle and a method of operation of the drive system are provided. The drive system includes an internal combustion engine having a shaft, a vehicle transmission having a transmission input shaft and an output shaft, a transmission clutch between the transmission input and output shafts, an inertia-mass drive unit arranged between the internal combustion engine shaft and the transmission input shaft, a first clutch between the internal combustion engine shaft and inertia-mass drive unit and a second clutch between the inertia-mass drive unit and the transmission input shaft; and an electrical machine torque-transmittingly connected to the transmission input shaft. The inertia-mass drive unit may include rotational oscillation reduction device. Operation of the first, second and transmission clutches in coordination with electric motor and engine operation provides multiple operating modes while minimizing operator disturbance during transitions between engine deactivated and activated states.
US10882510B2	Engine autostop control Systems and methods are provided for determining an optimal point during operation of a hybrid electric vehicle towing a trailer at which the energy that can be recouped through regenerative braking is maximized. Operating conditions or characteristics of the hybrid electric vehicle and the brake characteristics of the trailer are considered in determining the optimal point at which the energy that can be recouped is maximized. At the optimal point at which the energy that can be recouped is maximized, the engine of the hybrid electric vehicle is turned off. Otherwise, the engine of the hybrid electric vehicle is left on.
US10882508B2	Motor control apparatus and method for damping engine vibration A motor control apparatus and method for damping engine vibration are provided. The apparatus includes a data collection device that collects engine information and motor information and a processor that determines a magnitude of engine torque vibration using the engine information and the motor information. A weighting value is determined by determining a position of a piston in a cylinder of an engine, ignition timing, an engine angular acceleration, and an engine velocity. A motor arti-phase torque is calculated by reflecting the determined weighting value in the magnitude of the engine torque vibration and a motor is operated based on the motor anti-phase torque to cancel out the engine torque vibration.
US10882501B2	Switching device and method for switching loads A switching apparatus for switching a first actuator and a second actuator between a power supply and a ground, including: a first switch for switching a first current path between the first actuator and the ground; a second switch for switching a second current path between the second actuator and the ground; and a third switch for switching a current path between the power supply and the first actuator and a current path between the power supply and the second actuator; in which, as a result of the switching, the third switch simultaneously closes or opens the current path to the first actuator and to the second actuator. Also described are a related brake system and method.
US10882500B2	Systems and methods for brake failure detection using retract braking A system for detecting aircraft brake failure using retract braking may comprise a landing gear including a wheel, a brake coupled to the wheel, and a wheel sensor coupled to the wheel. A brake controller may be coupled to the brake and the wheel sensor. The brake controller may be configured to receive a begin retract braking signal, command the brake to apply a braking force to the wheel, calculate a wheel speed characteristic using data from the wheel sensor, and determine whether the wheel speed characteristic indicates a failure of the brake.
US10882495B2	System and method for cleaning a vehicle-mounted sensor An aspect of the invention refers to a system for cleaning an external vehicle-mounted sensor surface. The system comprises an air nozzle arranged to discharge air onto a sensor surface; an air pump comprising a fluid inlet, an air outlet, an air-fluid interface and a variable volume compression chamber communicated with the air outlet; an air flow control device communicated with the air nozzle and the air outlet for controlling the flow of air therethrough; and a liquid pump communicated with the fluid inlet to supply a flow of pressurized liquid such that the volume of the compression chamber varies to generate a volume of pressurized air with an absolute pressure below 10 bar.
US10882493B2	System and method for vehicle authorization A system provides a personalized and secure user experience to access a secured asset, such as a vehicle. A first communication is transmitted, and a second communication is received in response to the first communication. An approach vector is determined based on the first communication and the second communication. The approach vector is compared with a known approach vector, a request for authentication is transmitted based on the comparison. A response to the request for authentication is received, and access to an asset is granted based on the approach vector and the response to the request for authentication.
US10882491B2	Lock device A lock device includes a locking member, a movable member, and a transmission mechanism. The locking member is moved between a lock position at which it locks a locking subject and an unlock position at which it unlocks the locking subject. The transmission mechanism transmits a drive force to the movable member and moves the movable member. A movement state of the movable member is shifted between a relative movement state in which it is moved relative to the locking member and an integral movement state in which it is moved together with the locking member to move the locking member toward the lock or unlock position. The lock device further includes a detector of which an output value varies in accordance with movement of the movable member or the transmission mechanism, and a controller that performs a failure determination based on a change in the output value.
US10882490B2	Control method for an electric seatbelt retractor and electric seatbelt retractor A control method for an electric seatbelt retractor and an electric seatbelt retractor including a spindle (2) and a seatbelt (3) wound thereon, and an electric motor (4) driving the spindle (2) via a rotor (3) in pull-in or in pull-out direction when activated, and a sensor device (10) detecting the movement of the spindle (2), wherein a spring (11) is provided, which is arranged between the spindle (2) and the rotor (3) enabling a relative movement of the spindle (2) to the rotor (3) or to a retractor-fixed part, wherein the electric motor (4) is controlled by a signal of the sensor device (10) generated by the relative movement of the spindle (2) to the rotor (3) or a retractor-fixed part with torsional tensioning or expanding the spring (11).
US10882480B2	Vehicle body structure The present invention provides a vehicle body structure comprising an exterior component configured to form an outer surface of a vehicle body and provided with an opening portion; and an attachment component attached on a vehicle body inner side of the exterior component with respect to the opening portion, wherein the exterior component includes an extended portion extended from a periphery of the opening portion toward the vehicle body inner side, and the extended portion includes an abutted portion configured to restrict a displacement of the attachment component to the vehicle body inner side by abutment against an abutment portion provided on the attachment component.
US10882469B1	Protective bedliner A bedliner (1) used for protecting metal truck beds and utility trailers from chemicals, such as chlorine, transported therein which causes the metal in the bed to corrode and rust when the chemicals spill and come into direct contact with the metal, said bedliner having an upper protective lip (12) and accordion-like protective retention wall (17).
US10882468B1	Work vehicle composite panoramic vision systems A composite panoramic vision system utilized onboard a work vehicle includes a display device, a vehicle-mounted camera array, and a controller. The vehicle-mounted camera array includes, in turn, first and second vehicle cameras having partially overlapping fields of view and positioned to capture first and second camera feeds, respectively, of the work vehicle's exterior environment from different first vantage points. During operation of the composite panoramic vision system, the controller receives the first and second camera feeds from the first and second cameras, respectively; generates a composite panoramic image of the work vehicle's exterior environment from at least the first and second camera feeds; and then presents the composite panoramic image on the display device for viewing by an operator of the work vehicle.
US10882467B2	Camera module A camera module, which is mounted on an inside of a front windshield of a vehicle and configured to image an external environment of the vehicle, includes multiple lens units on which an optical image of the external environment is incident, individually, and an imaging system to generate an outside image of the external environment by imaging through each of the lens units, individually.
US10882465B2	Vehicular camera apparatus and method A vehicular camera apparatus includes an image sensor, and a processor configured to divide an image acquired through the image sensor into a first field of view (FOV) range in a first direction and a second FOV range in the first direction, to process a first region corresponding to the first FOV range in the image, to process a second region corresponding to the second FOV range in the image, and to separately process the first region and the second region.
US10882452B2	Folding device for an exterior mirror A folding device to move a mirror head relative to a mirror base of a motor vehicle exterior mirror, the folding device including a carrier operatively connected to one of the mirror head or the mirror base, a motor arranged in the carrier, and which has a motor shaft, an output device operatively connected to one of the mirror base or the mirror head, and a gear mechanism to operatively connect the output device to the motor shaft. The motor shaft and the output device are located parallel with each other, and the motor, the output device, and the gear mechanism are positioned relative to each other via the carrier, such that the axial spacings of the motor shaft, the output device, and the gear mechanism located therebetween are determined via the carrier.
US10882451B2	Apparatus for providing vehicular environment information An apparatus for providing vehicular environment information, includes acquiring with at least one sensor vehicular environment data that is external to a vehicle. The at least one sensor comprises at least one camera, and the vehicular environment data comprises image data. The vehicular environment data is provided to a processing unit. The processing unit determines vehicular environment information. The determination of the vehicular environment information comprises use of the vehicular environment data. At least part of the image data is displayed on a display monitor on the basis of the vehicular environment information. The processing unit causes the display monitor to display the at least part of the image data.
US10882448B2	Method, device and computer-readable storage medium with instructions for identifying an exit side of a motor vehicle A method, a device and a computer-readable storage medium with instructions for identifying an exit side of a motor vehicle. In a first step, the existence of an exit situation is detected. If an exit situation exists, an exit side of the motor vehicle is ascertained. Finally, the opening of a door is simulated on the ascertained exit side. For example, a brightness can be increased on the ascertained exit side, outside sounds can be reproduced, or an air stream can be generated.
US10882439B2	Bendable cargo securement device and method A compact bendable cargo securement device for stabilizing unrestrained items in the bed or cargo area of a pick-up truck or storage area in a motorhome or recreational trailer is disclosed. It may also be used as a stabilizer doing woodwork and other jobs that require stability of the work platform. The device will conform to any surface and has the ability to wrap around objects—both regular and irregular shaped—and will hold them and keep them from shifting. As disclosed, the bendable cargo securement device is composed of a flexible tube loaded with filler material when used and deployed for securing objects. The flexible tube is preferably fabricated from rubber or any material allowing sufficient flexibility for the cargo securement device to wrap around items while having suitable strength to avoid puncture/destruction from deployment. Each end of the device requires a closure to contain the filler material.
US10882436B2	Mobile cellular transmission system A transport system includes a trailer with a transport bed adapted to receive a shelter having substantially rectangular base with approximate bottom dimensions of a standard International Organization for Standardization (ISO) freight container; first and second wheeled transport assembly positioned on the trailer, wherein each transport assembly is adapted to connect to each end of the shelter to move the shelter on or off the trailer; and base locking units at each corner of the bed to be secured to a shelter.
US10882432B1	Modular seating system Apparatus and methods are provided for a modular vehicle seating system. In one embodiment the seating system has a universal center module that is mountable to a seating position in a vehicle and includes seat pan and seat back portions. The seating system may further include a matched pair of modular side bolsters selectable from an assortment of matched pairs of side bolsters, where each matched pair has a particular physical property defined by a unique value in a range of values of the physical property in the assortment. The side bolsters are detachably connectable to the to left and right sides of the universal center module with fasteners.
US10882431B2	Road vehicle provided with an electric drive Road vehicle provided with an electric drive and having: at least one pair of drive wheels; at least one electric machine; a mechanical transmission that connects the electric machine to the drive wheels; a passenger compartment; at least one seat, which is housed in the passenger compartment and is provided with at least one mechanical exciter that is designed to generate mechanical vibrations at variable frequencies and intensities; and a control unit, which is designed to drive the mechanical exciter using a driving signal that derives from the noise generated by an internal combustion thermal engine and based on the speed of rotation of the electric machine and/or on the speed of rotation of the drive wheels and/or on the torque generated/absorbed by the electric machine.
US10882430B2	Vehicle seat Provided is an example of a vehicle seat that allows easy use of external pneumatic equipment such as an external air pillow. The vehicle seat includes an output portion configured to output an air having a pressure equal to or higher than an atmospheric pressure to an outside of the vehicle seat.
US10882426B2	Vehicle seat belt system A vehicle seating system includes a vehicle floor, a seat supported by the vehicle floor, a retractor mounted to the vehicle floor beneath the seat, a webbing guide supported by the seat, and a webbing extending from the retractor through the webbing guide.
US10882424B2	Controlling active isolation platform in a moving vehicle Systems and methods for actively isolating a payload from a disturbance. In one example, a seat system for a vehicle includes a seat, a support structure that allows the seat to move about an axis of a pivot, a first sensor positioned to detect movement of the vehicle, a second sensor positioned to detect lateral acceleration of the pivot, an actuator configured to move the seat, and a controller configured to receive a first signal from the first sensor and a second signal from the second sensor, generate a command signal based at least on the first and the second signal to instruct the actuator to position the seat at a desired command angle, wherein the controller is configured to correct the command signal for lateral accelerations caused by steering the vehicle, and provide a force command to the actuator to move the seat at the desired command angle.
US10882418B2	Method for classifying an occupant and providing the occupant classification for a safety device in a motor vehicle A method for classifying an occupant and providing the occupant classification for a safety device in a motor vehicle. The method includes reading in a first piece of information that indirectly describes the occupant; reading in a second piece of information that directly describes the occupant; classifying the occupant, taking the indirect and direct information into account; and providing the occupant classification to an interface to the safety device for the vehicle. A corresponding device is also described.
US10882416B2	Managing spacing between a group of vehicles An apparatus comprising an interface, a memory and a processor. The interface may be configured to receive (i) sensor data samples during operation of a vehicle and (ii) data from a telemetry system. The memory may be configured to store the sensor data samples over a number of points in time. The processor may be configured to (i) analyze the sensor data samples stored in the memory to determine (a) operational parameters of the vehicle and (b) information associated with a second vehicle and (ii) adjust the operational parameters in response to the information associated with the second vehicle. The data from the telemetry system and the information associated with the second vehicle may be used to determine an amount of space between the vehicle and the second vehicle. The operational parameters may be adjusted to keep the amount of space within a pre-determined range.
US10882415B2	System and method of pre-charge testing to prevent misuse of electric vehicle charging station A charging station for charging an electrically powered vehicle includes a power source that provides recharging power to one or more energy storage devices on the electrically powered vehicle and a charging device that controls energy transfer from the power source to the electrically powered vehicle. The charging device provides a control pilot signal to a vehicle control circuit of the electrically powered vehicle, with the control pilot signal being received by the vehicle control circuit upon connection of the electrically powered vehicle to the charging station. The charging device measures a voltage level of the control pilot signal upon connection of the electrically powered vehicle to the charging station, performs a selected pre-charge testing routine based on the measured voltage level of the control pilot signal, and enables charging of the electrically powered vehicle from the power source upon compliance with the selected pre-charge testing routine that was performed.
US10882414B2	Managing an installation for charging electric motor vehicle batteries in a parking lot The invention relates to a method for managing charging currents delivered by an installation (1) for charging electric vehicle batteries in a parking lot (P), comprising a set of electric charging terminals (B1, . . . BN) connected to an electric power distribution network (2), each terminal being able to deliver a charging current value to an electric vehicle (VE1, . . . VEj) connected thereto. The method comprises: determining a maximum permissible value of the current at a connection point (3) for connecting the installation (1) to the network (2); storing, in a central management system (4) linked to the terminals, on the one hand, the electric charging terminals of a first subset of said set corresponding to the occupied terminals and, on the other hand, the electric charging terminals of a second subset corresponding to the available terminals; measuring the sum of the charging currents delivered by the terminals of the first subset; computing, by the system (4), an available current value according to a difference between the maximum permissible value and the sum of the delivered charging currents; and, for each new electric vehicle entering the parking lot (P) for charging purposes: computing, by the system (4), a deviation between the computed available current value and a charging current value able to be delivered by a determined terminal of the second subset; if the deviation is negative, transmitting, to one or more terminals selected from the first set, an order to reduce the charging current value delivered by each terminal to the vehicle connected thereto, so as to cover the deviation in absolute value; and transmitting, to the determined terminal of the second subset, an authorization message for charging the new vehicle at a predetermined charging current value.
US10882413B2	Charging system for at least one accumulator battery of a vehicle including heat transfer fluid distribution for thermal conditioning of the battery and method for managing the recharging of said at least one battery A charging system for electrical accumulator vehicle batteries, comprising a charging station principally designed to generate a charging current for the batteries, a system for thermally conditioning the batteries, by the circulation of a heat transfer fluid. A vehicle-mounted segment comprises a component for measuring the battery temperatures, a system for measuring the state of charge of the batteries, and a heat transfer fluid distribution circuit. A non-vehicle-mounted segment comprises a ground module of the thermal conditioning system for generating a flux of a heat transfer fluid, a control-command module designed to determine, during charging, as a function of the states of charge of the batteries and the battery temperatures, the flow rates and temperatures of the heat transfer fluid and a charging current required to achieve a target final state, characterized by a target temperature and a target charge at the end of a given charging time.
US10882408B2	Mechanical connectors for contactless communication units Embodiments discussed herein refer to connectors that enable two structures or devices to be coupled together in a manner that enables consistent and reliable operation of contactless communications and power transfer. The connector integrates power and alignment such that when two connectors are coupled together the power connections are also responsible for connector alignment. The connector alignment ensures that contactless communication channels, spanning between the connectors, are aligned to enable consistent and reliable operation of contactless communications.
US10882406B2	Fuel cell system A control device is configured to control a first boost converter and a second boost converter. The control device is configured such that, when a prescribed state where an output of the second boost converter cannot be made at a ratio of an output voltage to an input voltage in the second boost converter to be equal to or more than a predetermined value is detected, the control device calculates a target output voltage of a fuel cell by using an voltage on an input side or an output side of the second boost converter measured by a measuring portion and a first value which is equal to or larger than a minimum boost ratio of the first boost converter, and controls the fuel cell so that an output voltage of the fuel cell is equal to or lower than the target output voltage.
US10882400B2	Systems and methods for improved vehicular safety Embodiments of a vehicular system with an L-shaped infotainment display for reducing driver distraction and improving safety are disclosed.
US10882393B2	Fuel supply device A fuel supply device includes a valve body and a filter unit accommodating an air filter and a valve cap are attached to a tubular portion provided on a side surface of an inlet pipe. When a fuel tank has a negative pressure, the valve body opens and the negative pressure is eliminated by clean atmospheric air introduction. A projection portion is provided on the filter unit side of the valve body. Accordingly, attachment of the valve body into the tubular portion and attachment of the tubular portion and the filter unit are reliably performed, the reliability of valve body opening and closing is improved, and attachment workability is improved.
US10882392B2	Fuel cell system A pipe of a fuel cell system includes a pipe, one end side of which is connected to a fuel cell stack, and another end side of which is positioned adjacent to a vehicle structural component, through which water, and discharge air of a product that contains water vapor, which are produced by the fuel cell stack, flow; and a spray portion that is provided on the other end side of the pipe, and that sprays the water and the discharge air flowing through the pipe onto the vehicle structural component.
US10882387B2	Hybrid drive train for a hybrid-drive motor vehicle A hybrid drive train for a hybrid-drive vehicle. A transmission which can be shifted to different gear ratios by shifting components, and which can be drivingly connected to an internal combustion engine via an internal combustion engine shaft, to an electric motor via an electric motor shaft, and to at least one vehicle axle via an output shaft. The internal combustion engine shaft and a power takeoff shaft that is drivingly connected to the output shaft can be connected via spur gear wheel sets, which can be selected by the shifting components and each of which forms a gear plane. The gear planes include a first and a second hybrid gear plane, each of which can additionally be drivingly connected to the electric motor shaft.
US10882385B2	Cover apparatus for truck cargo box The present invention relates to a cover apparatus for a truck cargo box, and more specifically to a cover apparatus for a truck cargo box, which enables stable opening and closing operations even when deformation occurs due to the deflection or warping of a truck cargo box and enables its covers to stably cover irregularly shaped loads, such as various types of wastes or scraps, thereby considerably improving transportation safety and the convenience of use. According to the present invention, there is provided the cover apparatus for a truck cargo box, which enables stable opening and closing operations via the hinges and the variable members, and enables its covers to stably cover irregularly shaped loads via the covers in each of which the plurality of blocks is connected to each other, thereby providing the effect of considerably improving transportation safety and the convenience of use.
US10882380B2	Air conditioning unit for a vehicle An air conditioning unit for a vehicle includes a first channel and a second channel, a blowing unit including a first blower fan and a second blower fan that rotate together by sharing a rotary shaft and a driving unit, a bypass channel, and a control door disposed among the outlets of the first channel and the second channel, the heating core, and the bypass channel to control air discharged from the first channel or the second channel to pass through the heating core or not to pass through the heating core through the bypass channel.
US10882376B2	Heating, ventilation, and air conditioning system An HVAC system including a front blower having a first front blower outlet and a second front blower outlet. The first front blower outlet and the second front blower outlet are arranged vertically relative to one another. A joint duct includes a first body portion and a second body portion. The first body portion includes a first duct inlet, which is connected to the first front blower outlet, and a first duct outlet. The second body portion includes a second duct inlet, which is connected to the second front blower outlet, and a second duct outlet. The first duct outlet and the second duct outlet are arranged horizontally relative to one another. An HVAC case defines a first inlet and a second inlet arranged horizontally relative to one another. The first duct outlet is connected to the first inlet, and the second duct outlet is connected to the second inlet.
US10882371B2	Single-tube vibration damper and dome bearing for motor vehicles A single-tube oscillation damper for a motor vehicle may include a damper tube that is at least partially filled with damping fluid and in which a piston rod is movable back and forth, an operating piston that can be moved with the piston rod, and an end remote from the piston rod for bearing in a dome bearing. The end may include a transition region from an outer diameter of the damper tube to an outer diameter of the single-tube end remote from the piston rod. The end may also comprise a support region arranged in the transition region. The single-tube oscillation damper may further include a stop plate and at least one damping element. The stop plate may be arranged on the support region, and the at least one damping element may be arranged on the stop plate at a side facing the end.
US10882370B2	Lift option kit A lift option kit that allows the user to alter the vertical suspension lift of a vehicle.
US10882369B2	Longitudinal leaf spring device having bump stop unit A longitudinal leaf spring device for the suspension of a body of a motor vehicle has a leaf spring unit in an elongated form, a coupling device for the mechanical coupling of the leaf spring unit to a motor vehicle axle and at least one bump stop unit having two separate elastic stop elements which can be connected, in a manner arranged vertically above one another, to a chassis or to the axle. According to the invention, perpendicular directions to a downwardly directed mean contact area of the upper stop element and to an upwardly directed mean contact area of the lower stop element each form an angle other than zero with the vertical.
US10882367B2	Amphibious vehicle An amphibious vehicle includes a vehicle body, a prime mover, a drive wheel, a water propulsion device, a drive wheel transmission, and a propulsion transmission. The drive wheel is disposed on a front side of the prime mover. The water propulsion device is disposed on a rear side of the prime mover. The drive wheel transmission is disposed on the front side of the prime mover and transmits power from the prime mover to the drive wheel. The propulsion transmission is disposed on the rear side of the prime mover and transmits the power from the prime mover to the water propulsion device.
US10882366B2	Electronic wheel unit for a vehicle wheel, and method for operating an electronic wheel unit of this kind A method for operating an electronic wheel unit disposed on a vehicle wheel of a vehicle includes providing the electronic wheel unit with a detecting device for detecting rotation angle positions of the vehicle wheel that are present at certain detection times, and a radio transmitter device for transmitting a sequence of individual electromagnetic signals which include data representative of the detected rotation angle positions and their associated detection times. The detecting device is further used to detect an amount of a wheel acceleration of the vehicle wheel and to set an interval of time between the detection times of the rotation angle positions to be shorter the greater the amount of wheel acceleration. A corresponding electronic wheel unit and a method and an apparatus for localizing respective installation positions of a plurality of such electronic wheel units on a vehicle are also provided.
US10882364B2	Tire with concave sidewalls A tire having a central axis and a radius further includes a circumferential tread having a convex cross-section. The convex cross-section is defined by a radius that is less than a maximum radius of the tire. A pair of sidewalls extends from opposite sides of the circumferential tread. Each of the pair of sidewalls has a concave cross-section that is defined by a radius that is greater than a maximum radius of the convex cross-section of the circumferential tread.
US10882360B2	Tire for running on rough terrain A tire for running on rough terrain for which an intended tire rotational direction is specified, comprises: a tread portion 2 provided with a first block 11 having a ground contacting top surface 16, and a base cross sectional shape 17. The ground contacting top surface 16 has a polygonal shape having a heel-side oblique edge 21 inclined with respect to the tire axial direction. The base cross sectional shape 17 is a polygon having a heel-side axial edge 22 extending in the tire axial direction. In the top view of the first block, an angle θa formed between the heel-side oblique edge 21 and the heel-side axial edge 22 is in a range from 5 to 45 degrees.
US10882359B2	Pneumatic tire In a tire 2 according to the present invention, an outer surface 52 of a crown rib 48e and an outer surface 54 of a shoulder rib 48s form a part of a tread surface 28. On a cross-section of the tire 2 along a plane that includes a rotation axis of the tire 2, an outline of the outer surface 52 of the crown rib 48e is represented as a first arc. A center of a circle to which the first arc belongs is disposed on the equator plane. An outline of the outer surface 54 of the shoulder rib 48s is represented as a second arc. A ratio of a distance from a center of a chord of the second arc to the second arc relative to a length of the chord of the second arc is not less than 0.03 and not greater than 0.05.
US10882355B2	Bicycle component comprising an adapter unit and adapter unit A bicycle component includes a hub shell for a wheel of an at least partially muscle-powered bicycle, wherein the hub shell is rotatably supported by at least one bearing device. An adapter unit is disposed on one end of the hub shell. The adapter unit includes an inner stopper having an inner stop face for transferring a clamping force to the bearing device and an outer stopper with an outer stop face transmitting at least part of the clamping force. The adapter unit includes a first and a second stopper component transmitting the clamping force.
US10882349B2	Thermal transfer recording medium A thermal transfer recording medium which includes a dye layer having storage stability and sufficient color development properties, and enables improvement in image quality of the printed matter. The thermal transfer recording medium according to an embodiment of the present invention includes a substrate, a heat-resistant lubricating layer provided on a first surface of the substrate, and a dye layer provided on a second surface of the substrate, wherein the dye layer includes a dye, a binder A, and a binder B which contains at least one of polyvinyl butyral and polyvinyl acetal, a solubility parameter of the binder A is within a range of 9.5 (cal/cm3)1/2 or more and 12.0 (cal/cm3)1/2 or less, and a melting viscosity of the binder A at 200° C. is 400 Pa sec or less.
US10882345B2	Ink-jet recording apparatus There is provided an ink-jet recording apparatus, including: a casing which is box-shaped, and which has an internal space; a recording head arranged in the internal space, and configured to jet ink droplets; a carriage which is movable, and is arranged in the internal space, and on which the recording head is mounted; and a dust-proof portion arranged between a movable space and an exterior of the casing, the movable space being a space, in the internal space, in which the carriage is movable.
US10882341B2	Recording apparatus A recording apparatus includes a recording head that performs recording on a medium, a transport belt that has an clinging surface that cling the medium, and transports the medium to a position facing the recording head, a first charging unit that is in contact with the transport belt to frictionally charge the clinging surface, and a second charging unit that applies a voltage to the transport belt to charge the clinging surface, in which a control unit, which switches between charging of the clinging surface by the first charging unit and charging of the clinging surface by the second charging unit, switches between the charging of the clinging surface by the first charging unit and the charging of the clinging surface by the second charging unit, according to a state of a surface of the medium, which is in contact with the clinging surface.
US10882337B1	System and method for producing high quality images with ultraviolet curable inks in a printer A printer includes a first printhead operatively connected to a source of ultraviolet (UV) curable ink having a first color, a first source of UV radiation following the first printhead in the process direction by a first predetermined distance, a second printhead operatively connected to the source of UV curable ink having the first color, and a second source of UV radiation following the second printhead in the process direction by a second predetermined distance that is greater than the firsts predetermined distance. The first predetermined distance enables the first source of UV radiation to fix the UV curable ink ejected by the first printhead before passing the second printhead and the second predetermined distance enables the ink ejected by the second printhead to flow over a portion of the substrate before the second source of UV radiation fixes the UV curable ink ejected by the second printhead.
US10882328B2	Thermal head for printer A printer includes a thermal head, an electrical connector capable of being connected to and disconnected from the thermal head, and a head cover of the thermal head. The head cover moves between a first position and a second position different from the first position to connect and a disconnect the thermal head and the electrical connector.
US10882327B2	Control device, printing apparatus and non-transitory computer-readable recording medium A control device controls an image printing by a printing execution unit. The control device performs: determination processing of determining whether a first condition indicating that a supply of ink from an ink supply unit to a printing head is possibly delayed at a partial printing is satisfied, for each of a plurality of band images included in an image to be printed and aligned in a sub-scanning direction; first printing processing of, in a case where the first condition is not satisfied, causing the printing execution unit to print the band image by single time partial printing; and second printing processing of, in a case where the first condition is satisfied, causing the printing execution unit to print each of N partial images included in the band image and aligned in the sub-scanning direction by single time partial printing, to print the band image by N times partial printings.
US10882321B2	Liquid supplier, liquid supply system, and method of manufacturing liquid supplier A liquid supplier can be attached to and detached from a case of a liquid ejection device, and includes a connection member located at an end of the case. The connection member includes a liquid outlet member including a liquid outlet port and a connection port, a container-side electric connector, a first receiving portion that receives a first positioning portion of the liquid ejection device, and a second receiving portion that receives a second positioning portion of the liquid ejection device. The width of the liquid supplier in the Z direction is smaller than a width in the Y direction and a width in the X direction. The liquid supplier further includes a tube whose one end is connected to the connection port, and into which liquid is injected from another end that is located outside the liquid ejection device.
US10882316B2	Liquid ejecting head and liquid ejecting apparatus A liquid ejecting head includes a nozzle plate, a multilayer substrate, and a pressure chamber substrate. The multilayer substrate includes a liquid chamber wall portion. The liquid chamber wall portion has a first wall surface facing a common liquid chamber. The multilayer substrate has a supply flow path which has an inlet portion coupled to the first wall surface and via which the common liquid chamber communicates with the first pressure chamber. When a direction from the common liquid chamber toward the first pressure chamber is defined as a first direction, and a direction intersecting the first direction is defined as a second direction, the supply flow path includes a first portion having a first width in the inlet portion and a second portion having a second width, in a first cross section along the first direction and the second direction. The first width is narrower than the second width.
US10882307B2	Sheet-fed printing press The invention relates to a sheet-fed printing press having a feeder, a delivery, and at least one sheet guiding cylinder, which is arranged between the feeder and the delivery, has a gripper system, and is assigned a digital printing system and a first sheet guiding system that removes sheets from the sheet guiding cylinder. The object of the invention is to devise a sheet-fed printing press that can be used in a more variable fashion, and with which a particularly wide spectrum of different products can be produced. According to the invention, the object is attained in that the first sheet guiding system (12) is configured for selectively transferring the sheets to a second sheet guiding system (8), which transfers the sheets to the sheet guiding cylinder (3), or for transferring said sheets to the delivery (11), wherein the second sheet guiding system (8) is configured as a perfecting system (8) and can be switched between an operating mode in which it feeds the sheets in a reversed position to the sheet guiding cylinder (3) and an operating mode in which it feeds the sheets in a non-reversed position to the sheet guiding cylinder.
US10882299B2	Method and device for applying an element to a component part by use of a manipulator A method for applying, in particular for evenly pressing across a surface, a component to a construction part by way of a manipulator, by receiving the component to be applied by means of a first vacuum pressure in a first interstice between a supporting member and the component, displacing the manipulator with the component towards the construction part, disposing the component at at least one partial surface of the construction part by way of the manipulator, where, during disposing, a second vacuum pressure is generated in a second interstice between the supporting member and the construction part, and mounting the component at the construction part by increasing the difference between the first and second vacuum pressures, where the manipulator continuously maintains the first vacuum pressure until completion of arrangement and at least partial attachment of the component at the construction part.
US10882283B2	Segmented protective display film A display film comprises a transparent glass layer including two or more co-planar glass layer segments and a thickness defined by a first major surface and a second major surface opposing the first major surface being less than 500 micrometers; interstitial polymer material separating adjacent segments; and transparent energy dissipation layer having a glass transition temperature of 27 degrees Celsius or less and a Tan Delta peak value of 0.5 or greater and being disposed on the first major surface.
US10882281B2	Double-layer conductive LED photoelectric glass with voltage compensation and manufacturing process thereof A double-layer conductive LED photoelectric glass with voltage compensation and manufacturing process thereof are provided in the present invention. The photoelectric glass includes two layers of electrically conductive glasses. Inner sides of the electrically conductive cladded layers of the two layers of electrically conductive glasses are oppositely provided. The electrically conductive cladded layer of one of the two layers of electrically conductive glasses is provided with a plurality of etched circuits. The etched circuits are divided into two sets, which are respectively located on two sides of the electrically conductive glass. LEDs are provided on each of the etched circuits. The positive electrode connecting terminal and the negative electrode connecting terminal of the LED are respectively provided on two sides of each etched circuit. A heat-resistant transparent adhesive layer is provided in the middle of the two layers of electrically conductive glasses.
US10882278B2	Palladium composite membrane A composite membrane for hydrogen separation and purification, including: a modified and activated support, a Palladium (Pd) layer, and an interstice layer between the second surface-modifying layer and the Pd layer. The support includes a support substrate, a first surface-modifying layer on the support substrate, and a second surface-modifying layer on the first surface-modifying layer.
US10882276B2	Continuous production of exfoliated 2D layered materials by compressive flow Described herein are methods for continuous production of an exfoliated two-dimensional (2D) material comprising passing a 2D material mixture through a convergent-divergent nozzle, the 2D material mixture comprising a 2D layered material and a compressible fluid. The method of the present disclosure employs physical compression and expansion of a flow of high-pressure gases, leaving the 2D layered material largely defect free to produce an exfoliated 2D layered in a simple, continuous, and environmentally friendly manner.
US10882275B2	Gas barrier film with protective coating layer containing inorganic particles A gas barrier film with a protective layer including inorganic particles is provided. A gas barrier effect of the gas barrier film is improved by including inorganic nanoparticles in a protective layer when a protective coating is performed to protect a gas barrier layer.
US10882267B2	Sealing pin, method of manufacturing assembly, and method of manufacturing gas sensor A sealing pin includes a distal end portion that is inserted into the cylindrical body and that presses the sealant in the sealing step and a slit that is provided to allow the sealing pin to avoid the sensor element when the sealing pin is inserted into the cylindrical body, that extends through the distal end portion in a direction perpendicular to an axial direction of the distal end portion, and that has a width larger than a thickness of the sensor element.
US10882265B2	Method for forming foamed shoe insole and related article The disclosure generally relates to a method for forming foamed shoe insoles as well as related shoe and shoe component articles. A foamed polymer having an open-cell foam interior structure and a continuous outer layer or skin can be formed conveniently such as by injection molding. The foamed polymer has a shape corresponding to two opposing shoe insole portions such that it can be cut or otherwise separated into two corresponding complementary foamed shoe insoles. The resulting open-cell foam interior structure and a continuous outer layer of the foamed shoe insoles can provide enhance spring or bounce effect when the insoles are incorporated into a shoe or sole component thereof.
US10882261B2	Tape-laying device and tape-laying method for flexibly and quickly laying tapes with different widths A tape-laying apparatus includes a material feeder configured to feed tapes, and a laying device configured for picking up and placing tapes onto a laying table. The laying device includes a transporter and a vacuum. The vacuum is connected to the transporter such that at least one tape is configured to be held on the transporter by a negative pressure generated by the vacuum. The transporter includes at least two endless transport belts, which circulate around deflection rollers. The transport belts run parallel to one another in a same transport plane.
US10882258B1	Microchip affixing probe and method of use Provided among other things is a method of affixing a small, single chip to a plastic item, the chip having a top surface having length and width dimensions, and having a height, the method comprising: (1) vacuum adhering a top-oriented surface of the chip to a probe of outer dimensions comparable to or smaller than those of the length and width; (2) conveying heat to the chip via the probe such that a bottom-oriented surface of the chip is sufficiently hot to melt the plastic; (3) applying via the probe the chip to the plastic such that the chip embeds in the plastic; and (4) releasing the chip from the probe, wherein the largest of the length and width is about 500 microns or less, and height is no more than about the smallest of length and width.
US10882254B2	Printing device A printing device is provided and includes: a table attaching portion, replaceably attaching a respective table of a first table for mounting a three-dimensional object and a second table including a mounting surface for mounting a medium and a plurality of pass-through holes passing through the mounting surface and a back surface on an opposite side of the mounting surface; an ejecting unit, ejecting a shaping material for shaping the three-dimensional object and a coloring material for coloring the three-dimensional object and the medium toward the table attached to the table attaching portion; a relative moving portion, relatively moving the table attaching portion and the ejecting unit in a vertical direction and a horizontal direction; and a suction portion, decompressing a side of the back surface of the second table when the second table is attached to the table attaching portion to adsorb the medium to the mounting surface.
US10882253B2	Removable cassette for 3D printers In example implementations, an apparatus includes a housing, a movable base, a tab portion and a coupling mechanism. The housing is comprised of a microwave transparent material. The movable base is coupled to the housing to receive build material that is digitally printed. The tab portion is coupled to a bottom portion of at least one wall of the housing. The tab portion stops the movable base. The coupling mechanism is coupled to the housing to removably attach the apparatus to a three dimensional printer.
US10882252B2	Variable force deposition for printing applications A method for forming an object includes rotating a first object forming device about a rotational axis at a first speed to apply a first force to the first object forming device. The first object forming device includes an additive manufacturing device.
US10882247B2	Additive manufacturing device with release mechanism An additive manufacturing device has a vessel for containing a polymerizable material, a build platform and a curing unit. The vessel has a flexible wall which is at least partially transparent to radiation at one or more wavelengths at which the material is polymerizable. The build platform is movable relative to the vessel to position a build surface thereof to face the flexible wall. The curing unit has a rigid component with a planar contact surface, the rigid component being at least partially transparent to radiation at the one or more curing wavelengths, and a radiation module positioned to emit radiation through the rigid component. The rigid component and the vessel are movable relative to each other. In a first position, the planar contact surface of the rigid component is in contact with the flexible wall, and in a second position, the rigid component is separated therefrom.
US10882244B2	Resin film, barrier film, and electrically conductive film, and production methods therefor A resin film formed of a resin containing a polymer containing an alicyclic structure and having crystallizability, wherein a crystallization degree of the polymer is 30% or more, and a thickness variation Tv of the resin film represented by the following formula (1) is 5% or less. The formula (1) is Tv [%]=[(Tmax−Tmin)/Tave]×100. In the formula (1), Tmax is a maximum value of the thickness of the resin film, Tmin is a minimum value of the thickness of the resin film, and Tave is an average value of the thickness of the resin film).
US10882243B2	Adjustable height membrane for hot drape forming a part Disclosed herein is an apparatus for adjusting membrane height for hot drape forming. The apparatus includes a frame including an enclosable interior space and sidewalls defining a perimeter of the interior space. The apparatus further includes an adjustable collar within the interior space of the frame. The adjustable collar extends about the perimeter of the interior space and is configured to move translationally within the interior space of the frame along the sidewalls in a first direction. The apparatus further includes a membrane extending across the interior space in a second direction, perpendicular to the first direction, and co-movably coupled with the adjustable collar, wherein a position of the membrane within the interior space is adjustable in the first direction as the adjustable collar moves translationally within the interior space.
US10882238B2	Method for making quenched granular absorbent A method of extruding self-clumping granular absorbent having cold water soluble amylopectin starch binder formed from starch-containing admixture sufficient for extruded sorbent pellets to produce flowable binder flowing between pellets clumping them together producing clumps of pellets that become hard when substantially dry that have a crush strength of at least 25 PSI and clump retention of at least 80% and preferably at least 90%. As a result, dried pellet clumps are easy to pick up leaving behind unspent pellets for continued sorbent use. A pellet quenching method rapidly cools and dries pellets before leaving the extruder preventing loss of cold water soluble starch and binder, preventing pellet shrinkage, and preventing pellet densification. An air conveyor transporting quenched pellets removed from the extruder further cools and dries the pellets producing pellets ready for sorbent use.
US10882232B2	Variegated building product and method An injection molded product is disclosed and includes a shingle resembling a cedar shingle tile formed from an amorphous or semi-crystalline thermoplastic and having a wood grain direction. The injection molded product also includes streaks in the shingle that are substantially parallel to the wood grain direction and the streaks extend through an interior of the shingle and appear as contrasting streaks on an exterior of the shingle to form a variegated wood grain appearance. The injection molded product further includes an injection molded vestige in the shingle. The injection molded vestige is located adjacent to a perimeter of the shingle and the injection molded vestige comprises a location at which material entered an injection mold through a gate.
US10882229B2	Methods and devices for applying bone cement to orthopedic prostheses to enhance bond strength An apparatus for forming a flowable material against a prosthetic implant can comprise a mold body having an outer surface and an inner surface. The inner surface can define a mold cavity that is selectively configured to at least partially accept the prosthetic implant in a forming position. An inlet port can be configured on the mold cavity that extends between the inner and outer surfaces. The mold cavity can substantially conform to a profile of a bone opposing surface of the prosthetic implant such that a void is created between the inner surface of the mold body and the bone opposing surface of the prosthetic implant. The inlet port can be configured to permit introduction of the flowable material into the void and against the bone opposing surface of the prosthetic implant.
US10882227B2	Foam mix-head bushing and method of manufacturing a vehicle interior panel with the bushing A bushing for a foam mix-head includes an injection port wall surrounding a vestigial area for foam accumulation, a substrate opening transition segment configured to be situated with an opening of a substrate, a seal housing, and a seal seated in a seal seat of the seal housing. The seal helps prevent leakage during a foaming operation, such as when manufacturing a vehicle interior panel having a foam layer between a skin layer and a substrate.
US10882222B2	Escape path for a production mold of a rotor blade The invention relates to a production mold for a rotor blade of a wind turbine plant, having two mold half-shells (3, 4) which during a production method of the rotor blade are disposed so as to be at least temporarily beside one another, and having at least one inner walkway (2c, 2d) that runs along so as to be between the two mold half-shells (3, 4), characterized by at least one escape path (40) which runs along below at least one of the two mold half-shells (3, 4).
US10882220B1	Method and system for fabricating dual curvature micro-truss structures A method and/or system for forming a micro-truss structure in an essentially arbitrary shape. A mold that has a transparent portion, and having an interior volume in the desired shape, is filled with photomonomer resin. The material for the transparent portion of the mold is selected to be a material that is index-matched to the photomonomer resin. The filled mold, placed into a bath of transparent fluid index-matched to the transparent portion of the mold, and illuminated, from outside the fluid, through a photomask, with collimated light. The collimated light travels through the photomask forming beams of light that enter the transparent fluid, propagate into the mold, and form a micro-truss structure in the shape of the interior volume of the mold. The micro-truss structure may then be removed from the mold, or part or all of the mold may be left adhered to the micro-truss structure, forming covering face sheets.
US10882219B2	Device for displaying image on apparel An image displaying device includes a background layer and a display layer. The display layer includes an inner surface and an outer surface. The inner surface is substantially smooth, and the outer surface includes a plurality of raised areas and recessed areas. The display layer has a first zone with a first thickness measured between the inner surface and a raised area and a second zone with a second thickness measured between the inner surface and a recessed area. The display layer also includes a coloring agent having a higher concentration in the first zone as compared to the second zone. The display layer has increased light transmissivity through the recessed areas and decreased light transmissivity through the raised areas such that a contrast of light transmissivity between the raised and recessed areas generates an image.
US10882212B2	Method and plant for manufacturing ceramic products A method and a plant (i.e., system or assembly) for manufacturing ceramic products comprising the steps of feeding a mixture of ceramic powders so as to obtain a powder material strip; compacting the powder material strip so as to obtain a compacted powder layer; acquiring a surface image of the compacted powder layer that reproduces the respective surface chromatic effects; processing said surface image so as to obtain a graphic decoration to be applied on the surface of the compacted powder layer that is coordinated with the respective chromatic effects in the thickness; and printing the graphic decoration on the surface of the compacted powder layer.
US10882210B2	System and method of making wood curls A system and method are provided for producing wood curls with reliable consistency and resiliency. Moisture content of wood blocks is determined and a plurality of cutting knives are installed on a disc of a curling machine and set to extend about 0.012 inches from the face of the disc. The wood blocks are fed through the curling machine and the feed rate is set based on the moisture content of the blocks and the sharpness of the cutting knives and readjusted based on the resiliency of previously cut curls in order to produce wood curls of a desired resilience.
US10882201B2	Method for controlling the manufacture of composite material parts and device for implementing same A method and device for cutting materials for manufacturing parts according to which an image of a cutting line is made recurrently downstream from a cutting head. The images produced are analyzed in real time to calculate amplitudes of deviations in the quality of the surface profiles of the cutting line as the part is being cut and comparing the calculated amplitudes to at least one predefined threshold value. The cutting is stopped in the event of the at least one threshold value being exceeded.
US10882200B1	Razor with rotatable blade head A razor has a rotary reel containing a plurality of razor blades. The reel is capable of being manipulated by an advancement knob disposed on a first side of the rotary reel housing. Upon sufficient use, a user may actuate the advancement knob to rotate out of position the used blade while simultaneously rotating into position a new blade.
US10882199B2	Position monitoring for a hair processing system A method of operating an automated hair processing system (10) and the automated hair processing system (10), comprising a portable hand-held hair processing appliance, a hair processing unit arranged at the appliance, and a position monitoring arrangement (30), the arrangement comprising a plurality of position sensors (32) arranged to be attached to a subject (12) whose hair is to be processed, a transmitter (34) that is operatively coupled with at least two position sensors (32) of the plurality of position sensors (32), and a position controller (42) that is arranged to detect a relative orientation between the at least two position sensors (32) of the plurality of position sensors (32) attached to the subject whose hair, and that signals a misorientation state.
US10882195B2	Method for making a soft actuator device By rotationally casting soft robots, no bonding of different material layers is required. Soft robots including one or more integrated enclosed compartments are constructed from fibers that are embedded directly into the mold prior to adding elastomeric precursors.
US10882194B2	Robot linear drive heat transfer An apparatus including a movable arm; a robot drive connected to the movable arm; and a heat transfer system. The robot drive includes a first drive configured to extend and retract the movable arm and a second drive configured to move the movable arm and the first drive along a linear path. The heat transfer system includes a first heat transfer member on the base and a second heat transfer member, where the heat transfer system is configured to transfer heat from the first drive to the first heat transfer member and then from the first heat transfer member to the second heat transfer member. The first heat transfer member travels with the base, and the first heat transfer member moves relative to the second heat transfer member as the base moves relative to the slide.
US10882188B2	Controller and control method for collaborative robot A robot controller and a robot control method, capable of preventing an operator from being sandwiched between a robot and a workpiece, when a conveyor for conveying the workpiece is stopped. The robot controller is configured to output a robot stop command when a conveyor starts the stop operation thereof. The robot stop command includes at least one of: a first stop command by which, when a movable section of the robot is positioned anterior to the workpiece, the movable section is moved at a higher velocity than the conveyor, and then is stopped after traveling a distance longer than a coasting distance of the conveyor; and a second stop command by which, when the movable section is positioned posterior to the workpiece, the movable section is moved at a lower velocity than the conveyor, and then is stopped after traveling a distance shorter than the coasting distance.
US10882187B2	Method of planning a cleaning route for a cleaning robot and a chip for achieving the same A method of planning a cleaning route for a cleaning robot: firstly, starting from an original point based on maps of grids, cleaning grid zones formed by the grids one by one until an entire region is cleaned, and then establishing a map of the entire region; secondly, searching the map of the entire region to find out uncleaned areas missed from cleaning, and then cleaning the uncleaned areas; thirdly, cleaning peripheral areas of the entire region based on the map of the entire region; and lastly, returning to the original point. A chip is also provided which stores procedures for controlling the cleaning robot to implement the method of planning a cleaning route.
US10882184B2	Servo motion control method and apparatus and robot using the same The present disclosure provides a servo motion control method and apparatus, as well as a robot using the same. The method includes: obtaining position parameters of a plurality of control vertices of a servo in a constant speed motion; creating a first smooth trajectory equation of the servo to move from the starting point to the ending point based on the position parameters of the plurality of control vertices; and controlling the servo to move based on the first smooth trajectory equation. The present disclosure is capable of realizing the smooth control of the motion of the servo from a starting position to an ending position, and avoiding the severe impacts during starting and stopping which affect the stability of the servo while the servo is in a constant high-speed motion.
US10882183B2	Robot controlling method and welding method A robot controlling method for operating an arm using a motor includes: performing, before the arm stops, addition to add a backlash compensation value to a position command which is input to the motor; and performing, in a period during which the robot arm is not in motion, subtraction to reduce the backlash compensation value added to the position command.
US10882182B2	Robot apparatus, control method of robot apparatus, and recording medium A robot arm includes a plurality of links and rotary joints for connecting the links with each other. A cable (wire rod) for communicating a drive signal to a drive actuator of each rotary joint is provided along each link. A reaction force table storing a reaction force value generated by the wire rod when the joint is driven in a divided storage area divided for each dynamic drive control condition is provided in a control system. In a case where each rotary joint is driven, the control device controls each rotary joint on the basis of a reaction force value obtained by referring to the reaction force table in accordance with the drive control condition.
US10882178B1	Sanitary tools Disclosed herein are sanitary tools including a sanitary tool for opening a door, which sanitary tool may include: a housing: an arm capable of ingress into or egress from the housing, or both; and a cartridge removably coupled to the housing, the cartridge having a sanitizing portion capable of receiving sanitizing material and capable of being abutted against a portion of the arm.
US10882177B2	Pegboard bracket Disclosed is a bracket that couples a pegboard to a table without requiring a separate table for a stand-alone table and a pegboard-coupled table. The bracket can include vertical and horizontal portions that couple to a pegboard and table, respectively. The bracket can further include tabs that grip the table or pegboard for additional support. The bracket therefore allows for a pegboard to be attached to a table, or for the table to be sold without the pegboard, therefore freeing substantial inventory for the seller of the table and pegboard combination.
US10882175B2	Electric hammer A hand-held electric hammer includes a handle arrangement on a tool carrier shank in which a striking mechanism actuated by an electric motor is accommodated and at the lower end of which a tool holder is arranged, which is suitable for receiving a tool attachment in the form of a spade blade, a demolition chisel, or a PVC scraper. The handle arrangement is designed as a T-shaped T-handle seated on the tool carrier shank, so that on both sides of the tool carrier shank there are two handles for both a left and a right hand of a user, whereby in the lower half of the tool carrier shank an additional handle stub is attached protruding in parallel with the T-handle from the tool carrier shank, which allows the electric hammer to be gripped with one hand on the T-handle and with the other hand on the additional handle stub.
US10882174B2	Versatile slide hammer method and apparatus The present invention provides a means to achieve enhanced control of repair forces in the automotive body repair industry. In particular, the present invention provides a modified slide hammer and a method to achieve repair through the controlled application of forces otherwise not attainable with existing embodiments. Additionally, the present invention provides an ease of use and versatility of application and mounting at the site of the work in conjunction with and in line with existing devices used in the repair process. The application of the present invention provides increased reliability in the delivery of intended forces at the site of the work. Further, the inherent isolation of repair forces to the intended site of the work by the use of the present invention reduces the likelihood of secondary damage, material waste, or catastrophic failure thereby also enhancing the safety of the operator and the effectivity of repair. Specifically, the present invention may be implemented in conjunction with existing frame pullers in the automotive body repair industry to affect repair while providing facility to avoid obstructions in the path of applied forces.
US10882172B2	Powered hand-held fastening tool A powered hand-held fastening tool includes a housing defining a handle, a frame, a motor-driven flywheel journaled to the frame, and an elongated driver that is selectively coupled to the flywheel to drive a fastener into a workpiece. The flywheel and driver have complementary sloped surfaces that mesh with each other to transmit energy from the flywheel to the driver to accelerate the driver along the driver axis. A follower assembly for selectively coupling the driver to the flywheel includes a solenoid actuator.
US10882170B2	Key locking stud installation tool A tool for installing a stud having a plurality of locking keys into a workpiece bore includes a main body, an actuator within the main body, a nosepiece adjacent the main body and having an anvil portion, and a mandrel disposed within the nosepiece. The actuator includes a movable piston, a shaft extending axially from the piston, and a coupler on a shaft end opposite the piston. The mandrel includes a threaded head portion and a body portion, and is releasably secured to the coupler.
US10882169B2	Tool for torsion bar repair A method and tool assembly (10) for unloading and reloading spring energy from a torsion bar (11) in a torsion bar suspension system of a motor vehicle. The tool assembly (10) includes a generally C-shaped body (14) having a screw shaft (24) threaded through a boss (22) in a lower section (18) thereof. An anti-rotation stem (38) includes a knurled flat face (40) which increases versatility of the tool assembly (10) by enabling anti-slip operation with various vehicle types. A counter-torque tool perch (46) extends from the lower section (18) of the tool body (14) for applying a counter-rotational torque to the body (14) during use of the tool assembly (10).
US10882167B2	Crimping devices including a pistol-grip air hammer and a crimp socket with a sloped key A crimping device includes a hammer and a crimp socket that includes an aperture, a socket face, and a sloped key that projects radially into the crimp socket and extends at least a portion of the depth of the aperture. A height of the radial projection of the sloped key increases along a depth of the aperture.
US10882166B2	Pulse tool An electric hand held pulse tool for performing tightening operations where torque is delivered in pulses to tighten screw joints. The pulse tool includes a bidirectional electric motor, an output shaft, a sensor for monitoring a parameter reflecting a delivered torque pulse, and a control unit for controlling the electric motor. The sensor provides information regarding the monitored parameter to the control unit. The control unit, during a tightening operation performed by the pulse tool in a first direction, controls the motor to provide at least one torque pulse on the output shaft in a second direction that is opposite to the first direction. The sensor monitors a parameter reflecting a delivered torque pulse on the output shaft in the second direction. The control unit also determines information about the nature and state of a joint, due to the torque pulse on the output shaft in the second direction.
US10882159B2	Control valve for shot peening A control valve (100) comprises a conduit (102), a controller (104), a sensor unit (106; 146, 148), a cylindrical housing (112) and one or more regulating columns (124, 126). The conduit further comprises a hollow cylindrical body (114) and two smaller and shorter cylindrical extensions (116, 118) for the insertion of the regulating columns which are orthogonal to the hollow cylindrical body and provide a contactless means to control the flow of the medium (101) in the conduit.
US10882154B2	Machine tool A chip antiscatter mechanism is included and configured to suppress scattering of chips generated during machining of a machining object. The chip antiscatter mechanism includes chip stirring means configured to stir the chips, by jetting a gas into a dry machining region above a table including the machining object, fluid curtain forming means configured to form a fluid curtain by jetting a fluid such as liquid or gas membranously from above to an outside of the dry machining region so as to surround the dry machining region, and to form a closed region including the dry machining region by the membranous fluid curtain, and discharging means configured to receive and discharge the fluid jetted membranously by the fluid curtain forming means.
US10882152B2	Mounting tool for grooved pieces Various embodiments include a structure for positioning a tool on an elongated recess of a workpiece, wherein the elongated recess extends along a first longitudinal axis and has end surfaces on two end faces. The structure may include a plate having a cutout extending along an axis; a centering device; and a clamping device fixedly connected to the plate and the centering device. The cutout, when the second longitudinal axis is aligned parallel to the first longitudinal axis, enframes the elongated recess. The centering device includes a centering jaw movable within the cutout along the second longitudinal axis and also movable into and out of the elongated recess. The clamping device, on the side of the plate facing the elongated recess, includes clamping jaws movable along the second longitudinal axis to come into mechanical contact with one of the end surfaces of the end faces of the elongated recess.
US10882151B2	Automatic pallet changer in machine tool An automatic pallet changer 2 includes: a pallet housing unit 11 having a plurality of pallet placement portions; and a pallet transfer unit 12 configured to transfer a pallet P that is at a required pallet placement portion and has an un-machined workpiece W attached thereto to a standby station S2 and configured to transfer a pallet P that is at the standby station S2 and has a machined workpiece W attached thereto to a required pallet placement portion. The pallet housing unit 11 includes: main housing portions 13a to 13f that have a plurality of rows of pallet placement portions, each having a plurality of stages, and are disposed to face the machine tool body 1; and three rows of secondary housing portions 14 that have one stage of pallet placement portions and are disposed above the machine tool body 1.
US10882140B2	Three-dimensional laminating and shaping apparatus, control method of three-dimensional laminating and shaping apparatus, and control program of three-dimensional laminating and shaping apparatus The temperature of a molten pool is measured based on an image captured by an infrared camera or the like. A three-dimensional laminating and shaping apparatus include a material ejector that ejects a material of a three-dimensional laminated and shaped object. The three-dimensional laminating and shaping apparatus includes a light beam irradiator that irradiates the ejected material with a light beam. The three-dimensional laminating and shaping apparatus includes an image capturer that captures a molten pool of the material formed by irradiating the ejected material with the light beam. The three-dimensional laminating and shaping apparatus includes a temperature deriving unit that derives a temperature of the molten pool based on a luminance of an image of the molten pool captured by the image capturer.
US10882136B2	Method and apparatus for forming a conductive track A method for forming a conductive track on a surface (21) of a substrate (11) that includes providing the substrate (11), wherein the substrate (11) comprises deposited material (23) along a path on a surface (21) of the substrate (11). Generating a laser beam having an optical axis and an energy distribution within a cross-sectional area of the laser beam incident on the surface (21). The energy distribution of the laser beam is non-circularly symmetric about the optical axis at the surface (21). The method further includes directing the laser beam to move along the path to irradiate the deposited material (23) to provide a conductive track along the path. A selected orientation of the energy distribution within the cross-sectional area is aligned with the direction of movement of the laser beam.
US10882131B2	Dynamic duty cycle for a welding and cutting apparatus A welding apparatus is configured to obtain values of one or more real-time operating parameters associated with the welding apparatus. Using the values of the one or more operating conditions, the welding apparatus is configured to determine a dynamic duty cycle of the welding apparatus, given the present/current operating conditions of the welding apparatus.
US10882129B2	Electrochemical machine capable of removing electrolytic product Provided is an electrochemical machine. More particularly, provided is an electrochemical machine which removes an electrolytic product generated while electrochemical machining (ECM) so as to improve the quality of ECM and allows micro ECM. The electrochemical machine according to an embodiment of the present invention may include: a processing tub filled with an electrolyte; a processed object immersed in the electrolyte filled in the processing tub; a storage unit for storing the electrolyte; an electrolyte supply unit for supplying the electrolyte stored in the storage unit to the processing tub; a manifold comprising an inflow path, to which the electrolyte supplied by the electrolyte supply unit flows, and an outflow path connected to the inflow path for discharging the electrolyte flowing to the inflow path to the processed object, wherein a discharge hole of the outflow path is immersed in the electrolyte filled in the processing tub; an electrode which is fixed to the manifold so as for one end thereof to pass the outflow path and to be projected toward a lower part of the discharge hole and is electrically connected to the processed object; and a power unit for supplying power to the electrode and the processed object.
US10882125B2	Blade size limiter A power tool includes a motor; an arbor attachment mechanism that includes a shaft configured to be driven by the motor about a spin axis. The arbor attachment mechanism is configured to hold a blade onto the shaft. The power tool includes a blade size limiter that is configured to prevent attachment of a blade with a radius greater than a predetermined size, and is configured to be connected to the arbor attachment mechanism independently of the attachment of the blade to the arbor attachment mechanism and such that the blade size limiter is at a distance from the spin axis of the shaft.
US10882124B2	Saw blade stabilizer and method A saw blade stabilizer is provided. The saw blade stabilizer includes a housing and a shaft at least partially within a cavity of the housing. A piston is connected to one end of the shaft. A mechanical wedge is connected to a second end of the shaft in the housing. A stabilizer contact element slideably receives a portion of the mechanical wedge. Movement of the piston slides the portion of the mechanical wedge within the stabilizer contact element and moves the stabilizer contact element in a first direction not in line with the movement of the piston.
US10882120B2	Cutting tool and method of manufacturing machined product A cutting tool may include a body, a cutting edge, and a flute. The body may include a rotation axis and extend from a first end to a second end. The cutting edge may be located at the first end. The flute spirally may extend from the cutting edge toward a side of the second end. The cutting edge may include a first cutting edge and a second cutting edge extending from the first cutting edge toward an outer peripheral surface of the body in a front view. The flute may include a first thinning portion located continuously with the first cutting edge at a side of the first end, and a second thinning portion located continuously with the second cutting edge at a side of the first end. A thinning angle of the first thinning portion may be smaller than a thinning angle of the second thinning portion.
US10882114B2	Apparatus for producing fine particles and method for producing fine particles An apparatus and a method for producing fine particles includes a vacuum chamber, a material feeding device connected to the vacuum chamber and feeding material particles into the vacuum chamber from material feeing ports, and a plurality of electrodes connected to the vacuum chamber. Tip ends of the electrodes protrude into the vacuum chamber to generate plasma, and a collecting device is connected to the vacuum chamber and collects fine particles. The electrodes generate discharge inside the vacuum chamber and produce the fine particles from the material. The material feeding ports of the material feeding device are arranged in a lower side than (below) the plural electrodes in the vertical direction in the vacuum chamber.
US10882113B2	Apparatus for additive manufacturing of three-dimensional objects An apparatus (1) for additive manufacturing of three-dimensional objects (3) by successive, selective layer-by-layer exposure and thus successive, selective layer-by-layer solidification of construction material layers of construction material (4) that can be solidified by means of an energy beam. The apparatus can include a process chamber (14) comprising a working plane (A) with a first working plane area (A1) and another working plane area (A2), a coating device (6) provided for forming construction material layers to be exposed selectively and to be solidified selectively in the construction plane (E) and comprising a coating element assembly group (8) which is movably supported, at least one coating element, a shielding device (18) provided for shielding the second working plane area (A2), wherein the shielding device (18) can include at least one shielding band (20) guided movably along supporting points (19).
US10882109B2	Silicon compound-coated metal particles The present invention relates to silicon-compound-coated fine metal particles, with which surfaces of fine metal particles, composed of at least one type of metal element or metalloid element, are at least partially coated with a silicon compound and a ratio of Si—OH bonds contained in the silicon-compound-coated fine metal particles is controlled to be 0.1% or more and 70% or less. By the present invention, silicon-compound-coated fine metal particles that are controlled in dispersibility and other properties can be provided by controlling the ratio of Si—OH bonds or the ratio of Si—OH bonds/Si—O bonds contained in the silicon-compound-coated fine metal particles. By controlling the ratio of Si—OH bonds or the ratio of Si—OH bonds/Si—O bonds, a composition that is more appropriate for diversifying applications and targeted properties of silicon-compound-coated fine metal particles than was conventionally possible can be designed easily.
US10882108B2	System of non-crushing for casting The present invention relates to a non-crushing casting system including mold units for receiving a molten material from a melting furnace and casting the molten material to form a plurality of unit shape materials having a predetermined size; and a conveyor unit for performing infinite looping of mold units to detach the unit shape materials of the cast molten material, and for conveying and discharging the detached unit shape materials. According to the present invention, to manufacture a subsidiary raw material for steel manufacture having a certain unit size, ferromanganese or ferrosilicon is melted, and then cast in molds having a predetermined size.
US10882099B2	Tool manufacturing method and tools produced thereby A tool manufacturing method includes the steps of preparing a cylindrical blank, dividing the blank into sections, changing an outer diameter of one of the sections, and shaping the sections to complete a tool. During the shaping step, the section whose outer diameter is changed is shaped into a symmetrical polygon for serving as a head portion of the tool and shaping another section to obtain a polygon with alternate concavities and convexities thereon for serving as an engaging portion of the tool. Accordingly, the progressive execution of the method prevents the deterioration of the blank made of a high carbon content metal material, allows the tool to keep good mechanical properties, increases the manufacturing efficiency, and reduces manufacturing costs.
US10882098B2	Striking unit and method for material processing by the use of high kinetic energy A method of processing a material by use of high kinetic energy comprises a piston driven from a start position by a hydraulic system pressure by a drive chamber, by only one stroke, to transfer high kinetic energy to a blank/tool to be processed, whereafter there is a risk that a rebound of the piston will occur, so a step is taken in connection with said stroke performed, to prevent said piston from making a rebound with an essential content of kinetic energy to avoid negative effects as a result, whereafter the piston is returned to said start position by means of a second chamber, wherein a valve means closes the driving connection between the system pressure and the piston, the valve means is controlled by a pilot valve controlling the entire striking progress, and the second chamber is pressurized with the system pressure during the entire striking progress.
US10882094B2	Spinning forming method In a spinning forming method, a plate including a peripheral portion at which a ring-shaped projection is provided is used, the projection projecting in a thickness direction of the plate. Further, while rotating the plate, a transform target portion of the plate is locally heated, and a processing tool is pressed against the transform target portion to transform the plate. According to this configuration, a heat capacity of the peripheral portion of the plate can be increased. With this, when heating the vicinity of the peripheral portion of the plate, the peripheral portion can be prevented from becoming high in temperature. As a result, deformation of the peripheral portion of the plate can be suppressed.
US10882092B2	Method of manufacturing a tube and a machine for use therein A method is used to manufacture an article using a machine having a fixed base and a press structure movable toward the fixed base. The machine also includes a die assembly and a container both coupled to the fixed base. The machine further includes a mandrel assembly comprising a rotatable platform coupled to the press structure and having a first platform mandrel aligned with the die assembly and a second platform mandrel aligned with the container. The method includes the steps of placing a first starting component into the die assembly, pressing the first starting component to form the article, moving the second platform mandrel into the container simultaneously with the step of pressing the first starting component, and rotating the rotatable platform to align the second platform mandrel with the die assembly and to align the first platform mandrel with the container.
US10882084B2	Shielded containment cabinet and method of use A shielded containment cabinet device for use for the cleaning under high visibility and high protection for user, while using reduction flow pressurized water for cleaning of materials.
US10882083B2	Integrated scraper-sponge An integrated scraper-sponge includes scraper layer is fixed between the first and second sponge and/or abrasive layers. The support structure body includes an area configured and dimensioned to fit between at least a major portion the interface, and/or a plurality of apertures are provided within the area of the support structure body, and a plurality of openings. The scraper layer includes an edge that can be used to remove solidified or other contaminants.
US10882081B2	Chemical compositions and method for degassing of processing equipment A chemical composition for use in degassing of vessels is taught, said chemical composition including 1-10% by weight of an oxyalkylated dodecyl thiol; and 1-20% by weight of an alkyl di-substituted 9-decenamide. A method is further provided for degassing a vessel. The method includes charging said vessel with chemical composition and a carrier medium, wherein said chemical composition comprises 1-10% by weight of an oxyalkylated dodecyl thiol and 1-20% by weight of an alkyl di-substituted 9-decenamide.
US10882074B2	Multilayer coating film and coated article FF properties of a multilayer coating film configured to exhibit a red color through a lustrous layer (14) and a translucent colored layer (15) are improved to achieve a metallic textured color having a high-quality color tone. The lustrous layer (14) is configured such that Y(10°) is 50 or more and 950 or less and that Y(25°) is 0.05 or more and 0.35 or less times the Y(10°), where Y(10°) represents a Y value, of an XYZ color system, of reflected light measured at a light receiving angle of 10° and Y(25°) represents a Y value of the reflected light measured at the light receiving angle of 25° in a case where a light incident angle is 45°. An inclination of a tangent to the spectrum of the spectral transmittance of the colored layer (15) at the wavelength of 620 nm is 0.012 nm−1 or more and 0.03 nm−1 or less, defined as an absolute value.
US10882070B2	Method of manufacturing a steering shaft assembly A method of manufacturing a steering shaft assembly includes heating an inner shaft and heating an outer shaft. The method also includes applying a plastic coating to at least a portion of the inner shaft. The method further includes cooling the plastic coating and pressing the outer shaft and the inner shaft together.
US10882069B2	Storage container for tube viscous construction material A storage container for a cylindrical tube of viscous construction material includes a body dimensioned to receive a cylindrical tube of viscous construction material. A nozzle enclosure is attached to a top end of the body and is dimensioned to receive a nozzle of a cylindrical tube of viscous construction material. A plug is positioned in the nozzle enclosure and dimensioned to fit into an inner diameter of the nozzle of the cylindrical tube of viscous construction material. A gasket is positioned between the body and the nozzle that substantially prevents air in the body from entering into the nozzle enclosure. A base seals the cylindrical tube of viscous construction material in the body.
US10882066B2	Device for detecting and replenishing salt solution in salt spray machine and salt spray machine thereof A device for detecting and replenishing a salt solution in a salt spray machine and the salt spray machine includes a salt solution collector installed at the bottom of the salt spray machine and configured to collect the salt solution, a return pipe is connected to the salt solution collector and the salt solution storage tank, and a pH value sensor, a water level sensor and the salt concentration sensor are connected to the salt solution storage tank.
US10882065B2	Agricultural vehicle with adjustable row unit An agricultural vehicle comprises a left frame and a right frame. A left wheel is rotatable with respect to the left frame and a right wheel is rotatable with respect to the right frame. A first leg extends upward from the left frame and a second leg extends upward from the right frame to connect the legs to the beam. A data processor estimates a reference point on or below the vehicle and an angular orientation or attitude of the beam relative to the reference point based on positions of location-determining receivers associated with the beam. An upper carriage is laterally movable along the beam. A lower carriage is suspended from the upper carriage by a plurality of vertical supports, such that a target lateral position of the upper carriage establishes an actual lateral position of the lower carriage.
US10882060B2	Pressurizable fluid container and flexible dispenser A flexible dispensing apparatus for coupling to pressurized fluid containers is described. It includes a flexible tube and a handle assembly. The handle assembly houses a second end of the tube. The handle assembly has a first side connected to a second side, a slide trigger, a roller coupled to the bottom of the slide trigger with a dowel pin, a spray nozzle assembly, a magnet reservoir, and a magnet. The first side has an inclined ramp that runs along a length of the first side and extends into the second side above and beyond a seam that is formed by the connection of the two sides. The tube is within a channel in the handle assembly formed between the inclined ramp and the roller. When the roller is rolled toward the end of the ramp it pinches the flexible tube near the top of the inclined ramp.
US10882058B2	Solid-jacket screw centrifuge with a solid discharge chamber designed as a drying chamber A solid-jacket screw centrifuge is disclosed. The centrifuge has a rotatable drum with a horizontal axis of rotation which encloses a bowl with a rotatable screw, an inlet for introducing material to be centrifuged into the bowl, at least one liquid and at least one solid discharge, where at least the solid discharge is assigned a non-rotatable housing surrounding it, at least radially bounding a discharge chamber, where the discharge chamber is designed as a drying chamber for the solid matter and has axial walls and one or more walls in the radial direction. The housing extends axially parallel to the axis of rotation at most into the conical region of the drum or the screw.
US10882053B2	Electrostatic air filter An electronic air filter having a plurality of electrodes supported by rigid fixtures that are attached to a common case. The rigid fixtures that support the electrodes with different electrical potentials are attached to each other or to a common body in a way that increases or maximizes the creeping discharge path along the surface. Even conductive contaminants do not, therefore, provide an electrical shortage between the electrodes.
US10882045B2	Polymerase chain reaction device including ejection nozzles Examples include polymerase chain reaction (PCR) devices. Example PCR devices comprise a fluid input, ejection nozzles, and a set of microfluidic channels that fluidly connect the fluid input and the ejection nozzles. Each microfluidic channel comprises a reaction chamber, and examples further comprise at least one heating element, where the at least one heating element is positioned in the reaction chamber of each microfluidic channel. The at least one heating element is to heat fluid in the reaction chamber of each fluid channel. The device may eject fluid via the ejection nozzles.
US10882041B2	Systems and methods for mobile device analysis of nucleic acids and proteins A portable system for extracting, optionally amplifying, and detecting nucleic acids or proteins using a compact integrated chip in combination with a mobile device system for analyzing detected signals, and comparing and distributing the results via a wireless network. Related systems and methods are provided.
US10882039B2	Fluidic module, device and method for aliquoting a liquid A fluidic module includes first and second measuring chambers, first and second fluid inlet channels connected to the first and second measuring chambers, respectively, and first and second fluid outlet channels connected to the first and second measuring chambers, respectively. Upon rotation of the fluidic module about a center of rotation, liquids are centrifugally driven into the first and second measuring chambers via the first and second fluid inlet channels, respectively, so that compressible media previously present within the first and second measuring chambers are compressed by the liquids driven into the first and second measuring chambers, respectively. Upon a reduction of the rotational frequency and upon an expansion, resulting therefrom, of the compressible media, the liquids present within the first and second measuring chambers are driven out of same via the first and second fluid outlet channels, respectively.
US10882038B2	Aluminum-doped, iminoacetic acid group-containing chelate resins The present invention relates to aluminium-doped chelate resins containing iminoacetic acid groups, to a production process for aluminium-doped chelate resins containing iminoacetic acid groups, and to a device comprising at least one layer of at least one aluminium-doped chelate resin containing iminoacetic acid groups, and to the uses of this device and of the chelate resins for removal of fluoride from water.
US10882036B2	Substrate and a method of manufacturing a substrate A substrate and a method of manufacturing a catalytic substrate body arranged within the catalytic convertor such that a principal flow of fluid through the catalytic convertor flows along a surface of the substrate body, wherein said surface has a plurality of openings to micro-channels that extend away from said surface; and at least a portion of the surface of the substrate body comprises a catalytically active material, wherein the substrate body is in the form of a pellet; a sheet; solid elongated bodies; solid rods; a solid body having a plurality of bores; a non-tubular elongated body; a non-hollow body; a sheet curved in the form or a spiral; or a combination thereof.
US10882033B2	Slurry composition for catalyst and method for producing same, method for producing catalyst using this slurry composition for catalyst, and method for producing Cu-containing zeolite A slurry composition for a catalyst and a method for producing the same, a catalyst and a method for producing the same using the slurry composition for a catalyst. The method omits many heretofore required treatment steps and reduces catalyst production cost. The method comprising the steps of providing a slurry composition for a catalyst, comprising at least an aluminosilicate, Cu, and water, and having a solid concentration of 0.1% by mass to 90% by mass, wherein a component for a catalyst has composition represented by Al2O3·xSiO2·yT2O·zCuO (wherein T is a quaternary ammonium cation, and x, y and z are numbers that satisfy 10≤x≤40, 0.1≤y<2.0, and 0.1≤z<2.0, respectively) in terms of molar ratio based on an oxide; coating at least one side of a support with this slurry composition; and heat-treating at 350° C. or higher.
US10882031B2	Catalyst for treating an exhaust gas, an exhaust system and a method A catalyst for treating an exhaust gas comprising SO2, NOx and elemental mercury in the presence of a nitrogenous reductant comprises a composition containing oxides of: (i) Molybdenum (Mo) and optionally Tungsten (W); and (ii) Vanadium (V); and (iii) Titanium (Ti); and (iv) Phosphorus (P), wherein, with respect to the total metal atoms in the composition, the composition comprises: (i) Mo in an amount of less than 2 at. %, and optionally up to 9 at. % W; (ii) from 2.5 to 12 at. % V; (iii) from 85 to 96 at. % Ti, and wherein the composition comprises (iv) P in an atomic ratio to the sum of atoms of Mo, W and V of from 1:2 to 3:2. The values expressed must total 100%.
US10882030B2	Crystalline transition metal tungstate A hydroprocessing catalyst has been developed. The catalyst is a crystalline transition metal tungstate material or metal sulfides derived therefrom, or both. The hydroprocessing using the crystalline transition metal tungstate material may include hydrodenitrification, hydrodesulfurization, hydrodemetallation, hydrodesilication, hydrodearomatization, hydroisomerization, hydrotreating, hydrofining, and hydrocracking.
US10882029B1	Graphene oxide and cobalt tin oxide nanocomposite and method of use A method for using a nanocomposite of tin cobalt oxide nanocubes and graphene oxide to photo-catalytically degrade a portion of an organic contaminant in a solution. The nanocubes have an average side length in a range of 400 nm-1.5 μm and a carbon to tin molar ratio in a range of 10:1-25:1. The nanocomposite may also be used for enhancing the efficiency of a liquid fuel.
US10882028B2	Ni-containing catalyst for the oligomerization of olefins The present invention relates to an oligomerization catalyst for oligomerization of low-molecular-weight olefins, to the use of said catalyst and to a process for oligomerization of low-molecular-weight olefins using the oligomerization catalyst according to the invention.
US10882027B2	Process for producing an oligomerization catalyst The invention relates to a process for producing an oligomerization catalyst comprising nickel oxide and a silicon-alumina support material, wherein the silica-alumina support material is in the ammonium form. The present invention further relates to a process for oligomerization of C3- to C6-olefins using the oligomerization catalyst produced according to the invention.
US10882020B1	Topologically segregated polymer beads and methods thereof Embodiments in accordance with the present disclosure are directed to polymer beads and uses thereof, including forming libraries of compounds for screening and assay purposes. A polymer bead, in accordance with embodiments, has an interior surface and an exterior surface that are topologically segregated from one another. The interior surface includes a protecting group and the exterior surface includes a deprotected group, which can also be referred to as a deprotected functional group. The protecting group can includes a nitrobenzenesulfonamide group that protects an amine group.
US10882017B2	System and method for rapid, high throughput, high pressure synthesis of materials from a liquid precursor The present disclosure relates to a system and method for synthesis of condensed, nano-carbon materials to create nanoparticles. In one embodiment the system may have a source of liquid precursor, a flow control element and a shock wave generating subsystem. The flow control element is in communication with the source of the liquid precursor and creates a jet of liquid precursor. The shock wave generating subsystem drives a shock wave through at least a substantial portion of a thickness of the jet of liquid precursor to sufficiently compress the jet of liquid precursor, and to increase a pressure and a temperature of the jet of liquid precursor, to create solid state nanoparticles.
US10882015B2	Screw machine and method for the processing of material to be processed A screw machine includes an inductive heating device for the processing of material to be processed. The inductive heating device is used to heat the material in a heating zone. In the heating zone, at least one housing portion is made of an electromagnetically transparent material at least partly, the material being non-magnetic and electrically non-conductive, whereas at least one treatment element shaft is made of an electrically conductive material at least partly. During the processing of the material, the inductive heating device generates an alternating magnetic field that produces eddy current losses in the at least one treatment element shaft, the eddy current losses leading to a temperature increase of the at least one treatment element shaft. The material is heated on the at least one heated treatment element shaft, in particular until it melts. The screw machine allows a simple and efficient melting of the material, with the result that a mechanical energy input and a resulting wear of the screw machine can be reduced significantly.
US10882013B2	Manufacturing method of granules and manufacturing apparatus thereof with ability to rock an agitating blade A dry stirrer configured to stir powder in a dry state, and a wet stirrer provided downward of the dry stirrer in the vertical direction and configured to stir the powder are used. In the wet stirrer, the powder is stirred together with a fluid component, so that granules are formed. The wet stirrer includes a stirring chamber having a cylindrical shape and having a central axis placed in the lateral direction, a cut blade configured to rotate around the central axis of the cylindrical shape in the stirring chamber, and an agitating blade configured to rotate along an inner wall that is a cylindrical side face inside the stirring chamber. When the agitating blade passes above the central axis of the stirring chamber in the vertical direction, the agitating blade is rocked.
US10882010B2	Humidifying membrane for reverse electrodialysis and method for manufacturing the same The present disclosure relates to a technique for manufacturing a humidifying membrane including a hydrophobic thin film-coating layer having a nano-sized crack morphology pattern on the surface of an aromatic hydrocarbon-based polymer ion exchange membrane and applying the membrane to a reverse electrodialysis process. The humidifying membrane including a hydrophobic thin film-coating layer having a nano-sized crack morphology pattern on the surface of an aromatic hydrocarbon-based polymer ion exchange membrane, manufactured according to the present disclosure, embodies a low bulk resistance of the ion exchange membrane and significantly improves ion selectivity, thereby overcoming the trade-off relationship between membrane resistance and ion selectivity, and thus may be commercially available as an anion and cation exchange membrane of a reverse electrodialysis device.
US10882009B2	Water-tight breathable membrane The present invention relates to shaped bodies comprising a composition (Z1), wherein said composition comprises at least one polymer having an elongation at break of >30% and at least one porous metal-organic framework material, to processes for producing shaped bodies of this kind and to the use of a composition (Z1) comprising at least one polymer having an elongation at break of >30% and at least one porous metal-organic framework material for production of a film, membrane or laminate having a water vapor permeability according to DIN 53122 at 38° C./90% rel. humidity of greater than 1000 g/(m2*d), based on a film thickness of 10 μm.
US10882004B2	Reducing peak compositions in regeneration gas for swing adsorption processes This invention provides a method to smooth out the concentration peak generated from the regeneration stream of a cyclic adsorption process such as PTSA or TSA process. A fixed-bed adsorber (called a capacitor) to process the spent regeneration gas from a TPSA or TSA unit to maintain a constant composition of the spent regeneration gas to the downstream unit. The adsorber operates in a once-through non-cyclic manner, very similar to the conventional fixed bed reactor or adsorber. The spent regeneration gas stream coming out of the adsorber will have a more uniform CO2 composition than without the capacitor.
US10882002B2	Zeolite adsorbents having a high external surface area and uses thereof The present invention concerns the use, for gas separation and/or gas drying, of at least one zeolite adsorbent material comprising at least one type A zeolite, said adsorbent having an external surface area greater than 20 m2·g−1, a non-zeolite phase (PNZ) content such that 0
US10881999B2	Air cleaner There is provided an air cleaner including: an outlet pipe through which air is discharged; an airflow meter that is inserted toward an interior of the outlet pipe through a wall of the outlet pipe; and a flow-regulating member that is formed projecting from an inner surface of the outlet pipe at a leading end side of the airflow meter, the flow-regulating member including an edge that is formed with a peaked shape with respect to the inner surface and that runs along a direction of flow of air, a rear end that is formed at a downstream end of the edge in the direction of flow, and that is shaped cut sharply toward the inner surface and a width-narrowing portion that decreases in width in a circumferential direction of the outlet pipe on progression downstream in the direction of flow.
US10881997B2	Method of sterilization verification A method of verifying sterilization comprises performing a sterilization cycle on a sterilizing cabinet, opening the door with the first filter overlying the vent port by a single user being non-sterile and ungowned and examining the first filter, by the single user being non-sterile and ungowned, to verify the integrity of the sterilization cycle in the sterilizing device, determining if the integrity of the first filter is acceptable by the single user being non-sterile and ungowned, and removing, by the single user being sterile and gowned, through the access port at least one tray from the interior of the sterilizing cabinet if the integrity of the first filter is acceptable.
US10881991B2	Filter insert and a filter arrangement A filter insert for being removably arranged in a filter housing includes a first connection arrangement for engaging a corresponding second connection arrangement of a filter housing lid for a connection to the filter housing lid. The first connection arrangement is arranged to simultaneously prevent a relative rotational movement between the filter insert and the filter housing lid and allow a relative axial movement between the filter insert and the filter housing lid.
US10881986B2	Liquid chromatography technique Liquid chromatography techniques are disclosed. Specifically, the liquid chromatography technique includes providing a liquid chromatography system having a coated metallic fluid-contacting element, and transporting a fluid to contact the coated metallic fluid-contacting element. Conditions for the transporting of the fluid are selected from the group consisting of the temperature of the fluid being greater than 150° C., pressure urging the fluid being greater than 60 MPa, the fluid having a protein-containing analyte incompatible with one or both of titanium and polyether ether ketone, the fluid having a chelating agent incompatible with the one or both of the titanium or the polyether ether ketone, and combinations thereof.
US10881984B2	Composition and a process for reducing aromatics from a hydrocarbon feedstock The present disclosure relates to a composition for reducing aromatics from a hydrocarbon feedstock. The composition comprises a solvent mixture. The solvent mixture includes a primary solvent, a first co-solvent, a second co-solvent, and a secondary solvent. The present disclosure also relates to a process for reducing aromatics from a hydrocarbon feedstock.
US10881977B1	Leg assembly of a toy figure A leg assembly of a toy figure is provided to include a leg unit that includes a thigh component and a shank component. The thigh component has a first leg hole in a rear surface thereof, and a first recess extending from the rear surface in a front-rear direction. The shank component is rotatably connected to the thigh component, and has a second recess extending from a rear surface thereof in the front-rear direction. The leg unit is switchable between an upright state where the first recess and the second recess cooperatively define a second leg hole, and a bent knee state where an angle between the thigh component and the shank component is smaller than that in the upright state.
US10881976B2	Connecting element of a toy construction kit The invention relates to fastening elements of a toy construction kit and can be used for creating toy construction kit elements which are connected by means of connecting elements. A connecting element of a toy construction kit consists of two parts, a receiving part and a removable part, which, when brought together, fasten together under the effect of magnetic forces such as to be disconnectable and rotatable about the coupling point by 360°. The receiving part consists of a disc, a collar, and a neodymium magnet in the form of a truncated cone-shaped collar, which have different diameters and are fastened to one another. The removable part consists of a disc with a through opening, a collar, and a neodymium magnet, which have different diameters, and a metal rod, which are fastened to one another.
US10881975B2	Toy building set with an overload-safe linear actuator A toy building set comprising a number of toy building elements and an overload-safe linear actuator having a center axis and with two spindle parts comprising a first spindle part with an internal thread arranged concentrically to the center axis, and a second spindle part with an external thread screwed into the internal thread on the first spindle part, and wherein the thread on the one spindle is at least twice as long as the thread on the second spindle part. One of the spindle parts being provided with a slot extending through the spindle part longitudinally of the thread configured on the spindle part and essentially along the entire thread, it is accomplished that it is easy to adjust the length of the actuator by pulling or pressing the two spindle parts together or away from each other.
US10881974B2	Building toy A building toy and a method of building with it. The toy is designed to be constructed of a rigid and generally non-deformable material such as, but not limited to, wood and particularly hardwood, and is constructed in the fashion of a log-style building toy. The toy utilizes interconnecting notches in its construction, but provides for a variety of specialized pieces which allow for interconnection of parts where there is one notch but not another, as well as the ability to build roofs, floors, and specialty structures such as fireplaces through the use of specialized components. Further, the use of more strongly connecting components allows for stronger structures to be built. This includes, but is not limited to various types of bridges, including arch, suspension, and cable stay.
US10881973B2	Pivot coaster systems, apparatuses, and methods An apparatus for providing lateral movement on a roller coaster includes a main chassis, a passenger chassis, and a hub. The main chassis is configured to ride on a track. The passenger chassis is rotatably supported on the main chassis via the hub. The hub and main chassis are behind the passenger chassis. The hub allows the passenger chassis to perform a full lateral rotation relative to the main chassis.
US10881970B2	Game system A game system, comprising: a data processing system configured to execute program instructions allowing a user to engage in digital game play; a physical toy; and a detection device configured to detect a presence of the toy within a detection area of the detection device; wherein the toy comprises two or more identification elements each detectable by the detection device when the identification element is positioned within the detection area, wherein the toy is configured to allow a user to selectively position the toy with a user-selected subset of one or more of said identification elements within the detection area; and wherein the data processing system is configured to control said digital game play responsive to the detected subset of identification elements.
US10881967B2	Method, apparatus, and computer-readable medium for executing a multi-player card game on a single display An apparatus, computer-readable medium, and computer-implemented method for executing a multi-player card game on a single display, including generating playing cards corresponding to each player in a plurality of players, transmitting a plurality of images to a plurality of regions of a single display, each region corresponding to a player in the plurality of players, each region being located at a position on the single display which is closer to a physical location reserved for the corresponding player than to any other physical location reserved for any other player, and the plurality of images including a representation of the playing cards corresponding to each player, receiving one or more inputs from one or more players in the plurality of players, and transmitting one or more new images to the single display in response to the one or more inputs.
US10881966B2	Networked game system A network game system of high interest in which a contingency and/or unpredictability intervenes in a data exchange between players in a network game is provided. When a map item and a character are selected, a game apparatus transmits a data exchange request and character information to a server apparatus. The received character information is stored in a character management table of the server apparatus. When a predetermined time elapses after the data exchange request, other-character information is specified, and the character management table is updated. The other-character information is transmitted to the game apparatus, and the game apparatus updates each table based on the received information.
US10881963B2	Location based reward distribution system Embodiments of the invention broadly contemplate a location based rewards distribution system. Various embodiments of the invention provide rewards, for example video game unlock codes, based on a user physically visiting a specific physical location.
US10881961B2	Location-based achievements framework A method of encouraging actions by users with respect to a game networking system is disclosed. An indication of a presence of a user of a game networking system at a physical location is received. An opportunity for the user to perform an action within a game associated with the game networking system to obtain an achievement pertaining to the game is identified. The availability of the opportunity is triggered based on the presence of the user at the physical location. A notification to the user of information pertaining to the opportunity is communicated.
US10881960B2	Shared social asset in game Methods, systems, and computer programs are presented for online game cooperation. One method includes an operation for receiving a first request from a first user to place a game asset in a first game board of the first user. The game asset is associated with a task to be performed in the game. Further, the method includes an operation for receiving a second request from a second user to place the game asset in a second game board of the second user. The first user and the second user make progress by interacting with the game asset in their respective game boards. When the first user or the second user receives a transactional reward for interacting with the game asset, the transactional reward is also given to the other user. A final reward is given to the first user and to the second user upon completion of the task.
US10881955B2	Video game overlay A video server is configured to provide streaming video to players of computer games over a computing network. The video server can provided video of different games to different players simultaneously. This is accomplished by rendering several video streams in parallel using a single GPU (Graphics Processing Unit). The output of the GPU is provided to graphics processing pipelines that are each associated with a specific client/player and are dynamically allocated as needed. A client qualifier may be used to assure that only clients capable of presenting the streaming video to a player at a minimum level of quality receive the video stream. Video frames provided by the video server optionally include overlays added to the output of the GPU. These overlays can include voice data received from another game player.
US10881951B2	Avatar-incentive healthcare therapy An avatar-incentive healthcare therapy system has a physiological monitor for generating a physiological parameter indicative of physical health. An academic test for generating a test score is indicative of mental acuity. The avatar has outward characteristics and game play capabilities proportional to the physiological health and the mental acuity so as to incentivize improved physical health and academic performance.
US10881950B2	Program, method, and system of transmitting or receiving message A controller receives a message from a first user terminal of user terminals belonging to a chat group. In a case where the type of the message is of a normal message, the controller transmits the message to each of the user terminals. In a case where the type of the message is selection of the game icon, the controller generates a game message according to logic corresponding to the game icon and transmits the game message to each of the user terminals.
US10881947B2	Game A method of playing a game between two or more players. The game comprises game-tokens, and playable-tokens comprising a plurality of action-tokens. The action tokens comprise a sequence of first action-tokens, and a sequence of second action-tokens wherein each second action-token corresponds to the identifier of a respective one of the first action tokens. The method comprises: providing one of the game-tokens to each player of the game; dealing a respective plurality of playable-tokens to each player; and playing in turn, by each player, a playable-token of the player's respective plurality of playable tokens if permitted by rules. According to the rules: a first action-token is playable against one of the game-tokens if the action-token is first in the sequence of first action-tokens, a subsequent action-token is playable against one of the game-tokens if the subsequent action-token follows or corresponds to a previous action-token most recently-played against the one of the game-tokens, at least one action-token played against one of the game-tokens is disregarded when the subsequent action-token played at least by the player of that one game token corresponds to the previous action-token. A player loses or is at risk of losing their game-token if the subsequent action-token is last in the sequence of first action-tokens, and a player is out of the game if the player loses their game-token.
US10881946B1	Board sport learning kneeboard A truck with two rigid bodies and an elastomeric component wherein a front truck and a rear truck may be connected with a frame to comprise a riding device with a longitudinal roll axis coincident with a virtual line between a front virtual pivot point and a rear virtual pivot point. Each virtual pivot point is located at the intersection of a line projecting upward from the central point of a hanger axle axis and a hanger pivot axis. Virtual pivot points are the points about which the front and rear hanger pivot axis rotate as a result of rider input leaning to the right or left.
US10881945B2	Skateboard A skateboard includes a board adapted for a user to stand with both feet thereon and having a major axis, and a front steering device and a rear steering device respectively disposed on front and rear sections of a bottom surface of the board along the major axis and each having two wheels. The front or rear steering device has a wheel seat disposed on the bottom surface of the board rotatably around a rotation axis which inclines downwards from front to rear, and a wheel rack disposed on the wheel seat rotatably or swingably around a main axis. An abutted surface is defined where the wheel seat and the wheel rack are abutted against each other. On an imaginary vertical plane including the major axis, where the rotation axis passes the abutted surface is in front of where the main axis passes the abutted surface.
US10881936B2	Exercise assembly for performing different rowing routines An exercise assembly structured to perform different rowing routines characterized different rowing motions. A resistance device is movable within a chamber and is cooperatively structured therewith to resist such movement. A drive assembly includes two drive sections each independently connected in driving relation to said resistance device. A connector structure includes two connector members each attached to a handle and connected in driving relation to a different one of said drive sections. The handle is selectively movable through the plurality of different rowing motions, at least one of which results in the two drive sections concurrently driving the resistance member and being concurrently driven by the two connector members. At least one other rowing motion of the handle is defined by each drive section alternately driving the resistance member and being alternately driven by interconnected ones of said connector members.
US10881933B2	Ball game having an illumination device A ball game includes a base frame; a bed disposed on the base frame; a plurality of legs attached to the base frame and extending downward to place on a support surface; a ring lamp secured to the base frame; and a plurality of holes each through one of the legs.
US10881922B2	Iron-type golf club head or other ball striking device A ball striking device, such as an iron-type golf club head, includes a face having a ball striking surface and a body connected to the face. The body has a sole surface extending rearward from a leading edge of the face, and a toe surface extending rearward from a toe edge of the face. The sole surface configured to confront the playing surface. The iron-type club head may have an elongated channel extending from a heel side in the sole member to an end point within the toe surface. The elongated channel is recessed from the sole surface and toe surfaces and is spaced from the leading and toe edges of the face. The iron-type club head may also have a plurality of weighting elements that are adjustable by the user.
US10881916B2	Golf club head Golf club heads are described having a club head portion, a shaft portion connected to the club head portion, and a grip portion connected to the shaft portion. The club head portion has a heel portion, a sole portion, a toe portion, a crown portion, a hosel portion, and a striking face. The striking face can have a center face roll contour, a toe side roll contour, a heel side roll contour, a center face bulge contour, a crown side bulge contour, and a sole side bulge contour. The toe side roll contour can be more lofted than the center face roll contour. The heel side roll contour can be less lofted than the center face roll contour. The crown side bulge contour can be more open than the center face bulge contour, and the sole side bulge contour can be more closed than the center face bulge contour.
US10881912B2	Adjustable proprioceptive neuromuscular trainer A balance board may include an upper plate having a top surface; a base configured to contact the ground; and a center assembly pivotally connecting the upper plate with the base, the center assembly including a top pivot including a first multi-axial joint set at least partially within the upper plate and a lower pivot including a second multi-axial joint disposed proximate the upper plate. The first multi-axial joint may be a first ball and socket joint; the second multi-axial joint may be a second ball and socket joint; and the first ball and socket joint may be disposed at least partially within the second ball and socket joint. In addition, the balance board may further include an adjustable angle stop system comprising at least one adjustable angle stop movable at adjustable intervals to change a maximum angle by which the upper plate may be pivoted.
US10881910B2	Interactive athletic equipment system Systems and techniques for the collection and display of athletic information. Athletic data relating to a single person or group of people is collected at a central location, and subsequently displayed at a desired remote location so that the person or people can review and critique their performance. In addition, athletic data for multiple persons can be collected at a central location, and subsequently displayed to a user at a desired remote location, so that the user can compare his or her athletic activities to others.
US10881909B2	Training instrument and input device A non-limiting example training instrument comprises a hollow main body formed of an aluminum alloy. The main body is constituted by two gripping portions opposite to each other with a space therebetween and a coupling portion coupling the two gripping portions. A load sensor is arranged in the coupling portion inside the main body. The load sensor is a load cell, a strain gauge affixed to an interior of the main body, and a part of the main body to which the strain gauge is affixed functions as a strain body. Therefore, if a user applies a force so as to bring the two gripping portions close to each other or a force so as to move the two gripping portions away from each other, a load thereof is detected by the load sensor.
US10881907B2	Method and system for virtual fitness training and tracking service A machine implemented method and system, including: transmitting one or more credentials of a user account from a user device to an exercise management system (EMS) having a processor and one or more sensors where the EMS is disposed on an exercise equipment disposed in a selected at least one fitness center and the exercise equipment is part of a selected at least one exercise plan; transmitting the one or more credentials of the user account from the EMS to a cloud server having a processor; transmitting the selected at least one exercise plan for the new user account from the cloud server to the EMS; transmitting an exercise equipment information from the EMS; forming a user exercise data by the EMS for the exercise equipment based on data received from the one or more sensors and transmitting an exercise feedback from the EMS.
US10881906B2	Track estimation device A track estimation device includes: a reliability determination unit configured to determine the reliability of satellite positioning information; an update timing determination unit configured to determine the timing of updating a parameter to estimate track of cycling based on the reliability of satellite positioning information; and an update unit configured to update the parameter based on a result of the timing determination. When the reliability determination unit determines that reliability of the satellite positioning information is low, the track estimation unit estimates the track based on the parameter by autonomous navigation.
US10881904B2	Power stepper app A system designed for exercising while sitting includes a rigid housing configured to receive at least one sensor to detect motion. The sensor is configured to identify an oscillatory motion of a knee raising and lowering through pivoting of an ankle of a user wherein a heel of a foot of the user lifts off of a surface and wherein a toe of the user remains planted on the surface. A mobile device in wireless communication with the motion sensor runs an application that provides a user with a multitude of features. The features include exercise statistics, energy spent, and steps taken. A further feature of the mobile device application is to provide a user with a virtual environment on the screen of the mobile device. Exercise performed by the user is translated into forward motion in the provided virtual environment.
US10881898B2	Exercise device and methods Disclosed is an exercise device having a platform and a roller. The platform has a surface sized and shaped to support a body part of a user and a pair of handles. The roller is coupled to the platform and configured to rotate relative to the platform. The platform is configured to translate in a first direction when the roller rotates in a first direction of rotation and translate in a second direction when the roller rotates in a second direction of rotation.
US10881896B2	Exercise machine reversible resistance system An exercise machine reversible resistance system for reversing the directional force of resistance against an exercise implement before, during, or after the performance of a routine of one or more exercises. The exercise machine reversible resistance system generally includes a frame, an elongated member movably positioned upon the frame, wherein the elongated member has a first run and a second run, a resistance device that applies a resistance force to the elongated member in a single direction, an exercise implement movably connected to the frame and a clutch connected to the exercise implement. The clutch is adapted to selectively engage the first run or the second run of the elongated member for selective control of the resistance direction of the exercise implement.
US10881895B2	Leg training fitness device with dumbbell quick attach mechanism A leg training fitness device comprises a weight attachment portion and a body attachment portion having a base support and a lateral support. To workout legs, a dumbbell is attached to the weight attachment portion. Next, a foot is inserted into the body attachment portion such that the foot is supported by the base support and the lateral support. A variety of leg workouts can be performed without requiring expensive and unwieldly equipment. Additionally, leg workouts are easily performed with the device without having to wait for leg workout machines to become available. In one embodiment, the foot is strapped to the body attachment portion and the dumbbell is strapped to the weight attachment portion. In another embodiment, the base and lateral supports rotate into an open and closed configuration that allows hooks attached to a lower surface of the base and lateral supports to clamp or release the dumbbell.
US10881894B2	Barbell spotting apparatus Provided herein are embodiments of a barbell spotting apparatus having all the benefits of a free-floating, unconstrained barbell in both the horizontal and vertical axes with the safety of a dedicated spotting mechanism, while addressing safety, noise, and space concerns raised by typical barbell apparatus. The embodiments herein permit a loaded barbell to be positioned in line with the axis of motion of the lift to be performed at both the beginning and end of the lift.
US10881892B2	Workout apparatus A workout apparatus 10 includes base 12. A lifting arm 14 is pivotally connected to base 12 and movable on base 12 between a raised position and a lowered position, the lifting arm 14 including a first end 14a pivotally connected to base 12 and a second end 14b opposite the first end, the second end 14b including a gripping end piece 16. At least one weight post 32 extends outward from lifting arm 14 at a location between first end 14a and second end 14b of lifting arm 14. A braking system 18 is mounted to base 12 and coupled to lifting arm 14. Braking system 18 allows lifting arm 14 to move toward the raised position freely. Braking system 18 is engaged as lifting arm 14 moves towards the lowered position to lower lifting arm 14 toward the lowered position at a controlled rate of speed.
US10881891B2	Fitness training apparatus A fitness training apparatus is described that can include at least one pole, at least one set of one or more adjustable members, and at least one elastic member. The at least one pole can be configured to extend from at least one vicinity of at least one shoulder of a user to another at least one vicinity of a waist of the user. The at least one set of one or more adjustable members can be adjustably coupled to the at least one pole. The at least one elastic member can be configured to be adjustably coupled to the at least one set of one or more adjustable members. Related methods, techniques, articles, systems, and apparatuses are also described.
US10881886B2	Fire suppression systems A method of fire suppression may include injecting a reactive agent into a reaction zone to produce a catalytically active species for fire suppression and conveying the catalytically active species to a fire to catalytically interfere with flame chemistry of the fire. Fire in a fuel tank may be suppressed by injecting the reactive agent into a convective flow of a mixture of fuel and oxidizer in a fuel tank, the reactive agent reacting in the fuel tank to release a species which catalytically interferes with flame chemistry to suppress fire in the fuel tank. Fire at an airplane crash may be suppressed by releasing the reactive agent from the container at the crash site to produce an active species to catalytically interfere with a fire at the crash site.
US10881876B2	Radiation method and apparatus for radiating a fluence map having zero fluence region The present disclosure provides a radiation method for radiating a fluence map having a zero-fluence region under a movement of MLC (Multi-Leaf Collimator) includes a determining step of determining at least one basic fluence map from the fluence map. The basic fluence map includes a first non-zero fluence region and a second non-fluence region having the zero-fluence region therebetween. The radiation method includes a first radiating step including radiating the first non-zero fluence region, along with moving a first group of leaf pairs and moving a vertical jaw to shade the first group of leaf pairs, and a second radiating step including radiating the second non-zero fluence region, along with moving a second group of leaf pairs and withdrawing the vertical jaw to expose the second group of leaf pairs.
US10881875B2	Pre-optimization method for quick prediction of achievability of clinical goals in intensity modulated radiation therapy An achievability estimate is computed for an intensity modulated radiation therapy (IMRT) geometry (32) including a target volume, an organ at risk (OAR), and at least one radiation beam. Namely, a geometric complexity (GC) metric is computed for the IMRT geometry that compares a number NT of beamlets of the at least one radiation beam available in the IMRT geometry for irradiating the target volume and a number n of these beamlets that also pass through the OAR. A GC metric ratio is computed of the GC metric for the IMRT geometry and the GC metric for a reference IMRT geometry for which an IMRT plan is achievable. If the clinician is satisfied with this estimate then optimization (38) of an IMRT plan for the IMRT geometry (32) is performed. Alternatively, a reference IMRT geometry is selected by comparing the GC metric with GC metrics of past IMRT plans.
US10881873B2	Apparatus for relaxing smooth muscles of human body An apparatus includes a controller body configured to determine whether a light irradiation mode is selected and an operation is started through a user's manipulation, the controller body comprising a wireless transmission unit configured to transform an LED driving signal output according to the selected light irradiation mode into a radio signal and transmit the radio signal, and a wireless electrode probe configured to wirelessly receive the LED driving signal from the controller body by establishing wireless communication with the wireless transmission unit. The wireless electrode probe is configured to be driven by the LED driving signal received from the controller body to emit the light of a predetermined wavelength range, which increases concentration of a material for relaxing smooth muscles of a human body.
US10881872B1	Apparatus and methods for controlling and applying flash lamp radiation Apparatus and methods are disclosed for treating allergic rhinitis (seasonal and perennial hay fever), by application of flash lamp radiation. The nasal cavity can be illuminated in a safe and effective manner, with non-coherent light from a flash-lamp or other suitable source. This illumination can be accomplished in any suitable manner, including by use of a handheld device. Such handheld embodiments may contain a power source (battery or AC), control circuitry, light source (flash-lamp or diode laser), lens (focusing or non-focusing), light filter, and/or fiber-optic for delivering light to the nasal cavity. Embodiments include using any suitable light energy, such as visible light in the red wavelengths with a power output of 1 to 10 Joules per cm2. The device can be pre-programmed to deliver a specified amount of light in a specified amount of time using multiple pulses (in the case of a flash lamp) or a continuous wave (in the case of a diode laser). In many useful embodiments, a rigid fiber-optic extends from the lens/light filter a length of 10 to 20 mm, although it can be any convenient and useful size and shape. Contact sensors can be arrayed on the device for various purposes, such as to restrict illumination to times when the fiber optic is inserted into the nasal cavity. This and/or other safety features can prevent the high-intensity light from being fired into open space, a person's eyes, and/or otherwise causing a potential vision or other hazard. Preferably, the device can be easily and comfortably inserted into a nostril. The fiber-optic can be angled (either in its own shape or by the user manipulating it to a convenient angle/position) so as to allow the user to easily grip the device and insert the fiber-optic without having to use a mirror or other aid. Light from the device can be emitted at a specified light frequency that causes a desired immunosuppressive response in the cellular system.
US10881868B2	Torque limiting mechanism between a medical device and its implantation accessory A torque limiting mechanism between a medical device and an implantation accessory is disclosed. In a particular embodiment, a delivery system for a leadless active implantable medical device includes a delivery catheter and a torque shaft disposed within the delivery catheter. The delivery system also includes a docking cap having a distal end for engaging an attachment mechanism of the leadless active implantable medical device. The delivery system also includes a torque limiting component coupled to a distal end of the torque shaft and a proximal end of the docking cap.
US10881865B2	Far field telemetry communication with a medical device during a recharge session where a prior pairing with the medical device may not exist Far field telemetry communications are conducted during recharge sessions between an external device and an implantable medical device. The two devices may not have been previously paired together for far field telemetry and may have been paired with other devices for far field telemetry during previous recharge sessions and/or programming sessions. Embodiments provide for temporary bonding of the two devices for far field telemetry during the recharge session. The implantable medical device of the recharge session may maintain a programming bond with an external device other than the external device conducting the recharge session. Safeguards against establishment of inadvertent programming sessions between the external device that has conducted a recharge session and implantable medical devices that may or may not be bonded to that external device are provided.
US10881864B2	Methods and systems for generating stimulation waveforms for a neurostimulation therapy The methods and systems herein generally relate to generating stimulation waveforms for a therapy of a neurostimulation (NS) device in a patient. The methods and systems receive a target stimulation waveform from a user interface, calculate a timing resolution of the target stimulation waveform, determine target amplitude resolutions of the target stimulation waveform, identify whether a mathematical relationship exists between the target amplitude resolutions, and automatically designate one of a first, second, or third generator circuits based on at least one of the timing resolution, the amplitude, or the mathematical relationship. The systems and methods further transmit the target stimulation waveform and an activation instruction for the designated one of the first, second, or third generator circuits along the communication link to a NS device. The NS device includes the first, second, and third generator circuits configured to generate different first, second, and third types of stimulation waveforms.
US10881862B2	Estimating RV-timings from left ventricular (LV) sensing times for adaptive cardiac resynchronization therapy using DDD/VDD LV pacing without a right ventricular (RV) lead Methods and/or devices may be configured to estimate right ventricular-timings from left ventricular (LV) sensing times for adaptive cardiac therapy using DDD/VDD LV pacing without using a right ventricular (RV) lead. One embodiment employs a subcutaneous device (SD) in a patient and a leadless pacing device (LPD) coupled to a patient's heart. Heart activity including atrial and ventricular events are sensed from the patient's heart using the SD. Left ventricular events (LVS) are sensed using the LPD. The SD is used to determine whether cardiac resynchronization pacing therapy (CRT pacing) is appropriate based upon the heart activity sensed by the SD. The SD is further configured to determine timing of CRT pacing pulses for delivery to cardiac tissue through the LPD.
US10881858B1	Electrical substance clearance from the brain Apparatus is provided that includes an extracranial electrode, configured to be placed outside and in electrical contact with a skull of a subject identified as at risk of or suffering from a disease; and a cerebrospinal fluid (CSF) electrode, configured to be implanted in a ventricular system of a brain of the subject. Control circuitry is configured to drive the extracranial and the CSF electrodes to clear a substance from brain parenchyma of the subject into the ventricular system of the brain. Other embodiments are also described.
US10881857B2	Implanted pulse generators with reduced power consumption via signal strength/duration characteristics, and associated systems and methods Implanted pulse generators with reduced power consumption via signal strength-duration characteristics, and associated systems and methods are disclosed. A representative method for treating a patient in accordance with the disclosed technology includes receiving an input corresponding to an available voltage for an implanted medical device and identifying a signal delivery parameter value of an electrical signal based on a correlation between values of the signal delivery parameter and signal deliver amplitudes. The signal deliver parameter can include at least one of pulse width or duty cycle. The method can further include delivering an electrical therapy signal to the patient at the identified signal delivery parameter value using a voltage within a margin of the available voltage.
US10881856B2	Movement disorder therapy system and methods of tuning remotely, intelligently and/or automatically The present invention relates to systems adapted for remotely and intelligently tuning movement disorder of therapy systems. The present invention still further provides systems adapted for quantifying movement disorders for the treatment of patients who exhibit symptoms of such movement disorders including, but not limited to, Parkinson's disease and Parkinsonism, Dystonia, Chorea, and Huntington's disease, Ataxia, Tremor and Essential Tremor, Tourette syndrome, stroke, and the like. The present invention yet further relates to systems adapted for remotely and intelligently or automatically tuning a therapy device using objective quantified movement disorder symptom data to determine the therapy setting or parameters to be transmitted and provided to the subject via his or her therapy device. The systems of the present invention also are adapted to provide treatment and tuning intelligently, automatically and remotely, allowing for home monitoring of subjects.
US10881851B2	Pacing guidewire Guidewires and methods for transmitting electrical stimuli to a heart and for guiding and supporting the delivery of elongate treatment devices within the heart are disclosed. A guidewire can comprise an elongate body, including first and second elongate conductors, and at least first and second electrodes. A distal end portion of the elongate body can include a preformed bias shape, such as a pigtail-shaped region, on which the first and second electrodes can be located. The preformed bias shape can optionally be non-coplanar relative to an intermediate portion of the elongate body. The first and second elongate conductors can be formed of a single structure or two or more electrically connected structures. The conductors can extend from proximal end portions to distal end portions that electrically connect to the first and second electrodes. A corewire can extend the length of the elongate body, can at least partially form the first conductor, and can be at least partially surrounded by the second conductor.
US10881849B2	Compact muscle stimulator Systems, methods, and devices are provided herein providing electrical muscle stimulation (EMS). In some instances, an EMS device may be provided. The EMS device may be compact, light, and unobtrusive such that it can be used by a person going about his or her daily activities. In some instances, the EMS device may comprise additional sensors for increased functionality and may be capable of interacting with additional devices or platforms to provide a full-fledged EMS device capability.
US10881846B2	Medical valve with a variable diameter seal A medical valve assembly includes a tube extending between a first and second tube end along an axis, and a plunger plate extends radially from the second tube end. A valve housing surrounds the tube and includes a radially inwardly extending flange. A compression member is biased against the plunger plate and compresses an elastomeric seal from a non-compressed condition to a compressed condition to establish a sealed condition of the medical valve assembly. An inner surface of the elastomeric seal in the non-compressed condition has a plurality of planar portions and a plurality of radiused portions, with adjacent planar portions interconnected with one of the radiused portions to improve a closure of the elastomeric seal during compression. The inner surface preferably includes three planar portions and three radiused portions to define a generally triangular-shaped inner surface as viewed in cross section in the non-compressed condition.
US10881844B2	Systems for producing an aerosol and related methods of use Systems for producing an aerosol and related methods of use are described.
US10881838B2	Endoscopic balloon catheter Embodiments of the present disclosure are directed to apparatuses, systems, and methods for merging a balloon catheter onto a locked guidewire. In one implementation, a balloon catheter may include an inflatable balloon affixed thereto and a slit extending from a distal end of a guidewire lumen to a position proximal of the balloon. The slit may be widened by a working member of an adapter to allow passage of the locked guidewire into the guidewire lumen of the balloon catheter. The balloon catheter may be merged onto the guidewire via the slit and delivered to the desired treatment device without requiring the guidewire to be unlocked. Advantageously, access to at least one desired treatment site may be maintained with the guidewire during merging of the balloon catheter.
US10881837B2	Guidewire system One aspect relates to a guidewire system, a measuring system, and a method for manufacturing such guidewire system. The guidewire system includes a guidewire and a surface acoustic wave sensor device. A portion of a surface of the guidewire is coated by the surface acoustic wave sensor device. The surface acoustic wave sensor device may be configured for measuring a pressure change. The surface acoustic wave sensor device includes a piezoelectric substrate and a transducer. A thickness of the surface acoustic wave sensor device perpendicular to a longitudinal direction of the guidewire is smaller than 100 μm.
US10881836B2	Sheath assembly for insertion of a cord-shaped element, particularly a catheter, into the body of a patient Sheath assembly for the insertion of a cord-shaped element (32, 105), comprising an introducer sheath (101) and an auxiliary sheath (104) for insertion into the introducer sheath (101) together with the cord-shaped element (32, 105), with first fastening means (106) for detachably fastening the auxiliary sheath to the introducer sheath, and with second fastening means (107) for detachably fastening the cord-shaped element to the auxiliary sheath, wherein the introducer sheath (101) has a first sheath housing (13, 114) and a distal tubular section (11, 41 a) that terminates in the first sheath housing, and a first flushing device (108), wherein the auxiliary sheath (104) has a second sheath inner chamber (111), a distal, tubular part (112) and a second flushing device (109).
US10881834B2	Safety catheter system and method A catheter integral with a valved needle-free connector provides a safety catheter device configured to receive a blunt cannula and sharp needle forming an insertion mechanism. The sharp needle is mounted within a needle tube and a control handle is used to slide the sharp needle out of and into the protective needle tube. When the insertion mechanism is mounted to the connector and the control handle is used to slide the sharp needle out of the tube, a blunt cannula first moves into contact with and enters the bore of the valve mechanism of the connector opening it and protecting it from damage that may be caused by the sharp needle. The sharp needle is then extended through the connector and extends out the distal end of the catheter so that a venipuncture procedure may be performed to properly locate the catheter in the patient's circulatory system. Once located, the needle may be retracted into the insertion mechanism, the insertion mechanism disconnected from the connector, and discarded.
US10881828B2	Sensor adaptor, apparatus, and method for monitoring end-tidal carbon dioxide A sensor adaptor couples a face mask to a gas sampling tube connected to a device detecting end-tidal carbon dioxide. The sensor adaptor includes a shaft and connector. The shaft includes a channel providing a pathway for the carbon dioxide to travel toward the gas sampling tube. One end of the shaft includes an adaptor tip which extends through an exit port of the face mask. A connector is attached to the other end of the shaft and couples the sensor adaptor to the gas sampling line. A gripper may surround the shaft and prevent improper advancement of the shaft into the face mask. The sensor adaptor can be designed for use with any gas sampling tube and any face mask including exit ports.
US10881827B2	Providing a mask for a patient based on a temporal model generated from a plurality of facial scans A method for identifying a mask for a patient includes: receiving a plurality of images of a patient's face; analyzing the plurality of images to generate a temporal model of the patient's face, determining a mask for the patient using the temporal model of the patient's face, and identifying the mask to the patient.
US10881826B2	Method of obtaining a 3D scan of a patients face A method of obtaining a 3D scan of a patient's face includes receiving a request for a 3D scanner from the patient, sending the 3D scanner to the patient, receiving the 3D scan of the patient's face obtained from the 3D scanner from the patient, receiving the 3D scanner from the patient, and using the 3D scan of the patient's face to make, select, or customize a patient interface device for the patient.
US10881822B2	Method, system and software for protective ventilation A system including a breathing apparatus and a processor is configured to raise a first positive end-expiratory pressure PEEP level to at least a second PEEP level above said first PEEP level and subsequently lowering said second PEEP level to said first PEEP level and to calculate a lung mechanics equation relating total lung volume above functional residual capacity (FRC) to transpulmonary pressure (PTP) of a lung connected to said breathing apparatus, based on a change in end-expiratory lung volume (DEELV) between said first PEEP level and said second PEEP level.
US10881818B2	Smart oscillating positive expiratory pressure device An oscillating positive expiratory pressure system including an oscillating positive expiratory pressure device having a chamber, an input component in communication with the chamber, wherein the input component is operative to sense a flow and/or pressure and generate an input signal correlated to the flow or pressure, a processor operative to receive the input signal from the input component and generate an output signal, and an output component operative to receive the output signal, and display an output.
US10881817B2	Secretion loosening and cough segmenting therapy The present system (10) comprises a subject interface (22), a segmenter (12), a loosener (14), sensors (18), and computer processors (28). The segmenter is configured to selectively control gas flow through the subject interface to provide high amplitude pressure oscillations (44) during exhalation such that the high amplitude pressure oscillations aid cough productivity in the subject. The loosener controls gas flow through the subject interface to provide low amplitude pressure oscillations (43, 63) during inhalation (48, 68) and exhalation (49) such that the low amplitude pressure oscillations loosen respiratory secretions. The computer processors detect trigger events based on the output signals such that the one or more trigger events include a loosening trigger event and a segmenting trigger event (66); and responsive to detecting the loosening trigger event, control the loosener to provide the low amplitude pressure oscillations, and, responsive to detecting the segmenting trigger event, control the segmenter to provide the high amplitude pressure oscillations.
US10881811B2	Portable infusion pump The present invention relates to a medicament delivery device comprising a housing, a compartment inside said housing for positioning a medicament container, an injection needle arranged to said housing, being connectable to said medicament container for delivering a dose of medicament, a manually operated activation mechanism for activating said device, an actuation mechanism operably connected to said activation mechanism and arranged to, upon activation of said activation mechanism, extend said injection needle from a first position inside said housing to a second position wherein a penetration of a patient is performed, a plunger rod arranged in said housing capable of acting on said medicament container for delivering a dose of medicament through said injection needle, a driver capable of acting on said plunger rod for delivering a dose of medicament. The invention is characterised in that said device comprises a needle cover operably arranged in said housing from a first position inside said housing to a second extended position outside said housing for shielding said injection needle when said injection needle is in said second position.
US10881810B2	Drug delivery device with a cap A drug delivery device comprises a cap releasably secured to a main body of the drug delivery device and a needle assembly retained within the cap. The drug deliver device also includes a pre-stressed biasing element disposed between the cap and the needle assembly and configured to bias the needle assembly in a distal direction with respect to the drug delivery device while the cap is secured to the main body. The drug delivery device further comprises one or more locking elements each having a locked position and an unlocked position. In the locked position, the locking elements prevent the needle assembly from engaging with a cartridge retained within the main body. In an initial position, the cap is configured to retain the locking elements in the locked position. In an intermediate position, the cap is configured to release the locking elements to allow the needle assembly to engage with the cartridge.
US10881800B2	Device for dispensing a fluid A device (1) and the use thereof for dispensing fluid under aseptic conditions. The device (1) comprises conveying device (2) and container (3) with a variable inner volume. The conveying device comprises cylinder (4) with at least three openings (5, 6, 7) which are arranged along longitudinal central axis (11). Displaceable first and second pistons (9, 10) are arranged in the cylinder. The end faces (11, 12) of the pistons and inner wall (13) of the cylinder, delimit a variable fluid volume (14). The first opening is brought into fluidic communication with dispensing opening (15) and the second opening is brought into fluidic communication with the container. Each of the pistons comprise three seals (16, 16′, 16″) which are offset and sealingly close off the cylinder. Adjacent piston seals have inner spacing (di) which is equal to a shortest spacing (aA1) between two adjacent openings (5, 6 or 6, 7).
US10881798B2	Needle assisted injection device having reduced trigger force An injector includes a trigger mechanism including: a trigger member disposed about an axis having an aperture and a protrusion, and a ram assembly having a ram configured to pressurize a medicament container for expelling a medicament therefrom, the ram assembly further having a trigger engagement member configured to engage the aperture of the trigger member when the trigger member is in a pre-firing condition; an energy source associated with the ram for powering the ram to expel the medicament; and a user-operable firing-initiation member having an aperture engaged with the protrusion of the trigger member and operable for causing an axial translation of the trigger member in a proximal direction from the pre-firing condition to a firing condition in which the trigger engagement member is released from the retaining portion to allow the energy source to fire the ram.
US10881787B2	Wearable liquid supplying device for human insulin injection A wearable liquid supplying device for human insulin injection is fixed on a body of human through a ring belt and includes a substrate, a flow-guiding-and-actuating unit, a sensor and a driving chip. The substrate has a liquid storage chamber. The flow-guiding-and-actuating unit has a liquid guiding channel in communication with a liquid storage outlet of the liquid storage chamber and a liquid guiding outlet. The sensor measures a blood glucose level and generates measured data correspondingly. The driving chip receives the measured data from the sensor and controls the actuation of the flow-guiding-and-actuating unit and the open/closed states of the switching valves. The flow-guiding-and-actuating unit is enabled to generate a pressure difference so that the insulin liquid is transported to the liquid guiding outlet through the liquid guiding channel and flows into the microneedle patch for allowing the microneedles to inject the insulin liquid into the subcutaneous tissue.
US10881786B2	Wearable liquid supplying device for human insulin injection A wearable liquid supplying device for insulin injection is fixed on a user's body through a ring belt and includes a carrier body, a flow-guiding-and-actuating unit, a sensor, an air bag, a miniature air pump and a driving chip. The sensor measures sweat on human skin to detect a level of the blood glucose. The driving chip receives the glucose monitoring data and accordingly controls the actuation of the flow-guiding-and-actuating unit and the open/closed states of the switching valves. The miniature air pump is enabled to inhale gas into the air bag, so that the air bag is inflated and the ring belt contacts the human skin tightly. The flow-guiding-and-actuating unit is enabled to generate a pressure difference so that the insulin liquid is transported to a liquid guiding outlet through a liquid guiding channel and flows into the microneedle patch for being injected into the subcutaneous tissue.
US10881784B2	Medication safety devices and methods A medication safety device and method can include an infusion pump and a drug library in communication with the infusion pump. The drug library can have upper hard and soft limits and lower hard and soft limits associated with at least one drug. A graphical user interface can display a bar chart showing upper and lower soft limit bars for the at least one drug. The upper and lower soft limit bars can be grabbed and dragged on the graphical user interface in touch-screen fashion to new positions associated with new upper and lower soft limits. The graphical user interface and associated hardware and software can be configurable to responsively re-analyze data and compare a particular infusion to the new upper and lower soft limits.
US10881783B2	Processing infusion pump data for presentation on operator interface A server computer processes infusion pump data for presentation on an operator interface. The computer includes a network circuit configured to provide communications over a network and a processing circuit. The processing circuit receives infusion pump history data from a plurality of infusion pumps, including an indication that a user inputted to an infusion pump a parameter which was outside of a prestored limit, an indication that a user was notified that the parameter was outside the prestored limit, an indication that the infusion pump parameter was returned to within the prestored limit, and an indication that the user started infusion on the pump at the parameter within the prestored limit. Display data indicating reprogram and override events is generated for display on an operator interface.
US10881782B2	Intravenous tube holding assembly An intravenous tube holding assembly for organizing and protecting a plurality of intravenous tubes includes a tensioner is removably coupled to an intravenous tube pole. The tensioner is biased in a first direction and the tensioner is urgeable in a second direction. A retainer is provided that has a plurality of engaging slots therein. Each of the engaging slots engages a respective one of a plurality of intravenous tubes for organizing the intravenous tubes. A fastener is provided and the fastener is coupled to the retainer. The fastener releasably engages the tensioner such that the tensioner accommodates a weight of the intravenous tubes in the retainer. Moreover, the tensioner is urged in the second direction when the intravenous tubes are tugged upon.
US10881781B1	Blood processing apparatus and method for detoxifying bacterial lipopolysaccharide A detoxification method includes the steps of inducing flow of patient blood through an extracorporeal device inlet and outlet in fluid connection to the circulatory system of a patient. Biological agents including lipopolysaccharide (LPS) contained within patient blood can be detoxified by passing patient blood over a biochemical reactor surface having attached or immobilized Saccharomyces boulardii alkaline phosphatase enzyme, with the biochemical reactor being contained within the extracorporeal device.
US10881778B2	Medical treatment system and methods using a plurality of fluid lines A medical treatment system, such as peritoneal dialysis system, may include control and other features to enhance patient comfort and ease of use. For example, a peritoneal dialysis system may include a control system that can adjust the volume of fluid infused into the peritoneal cavity to prevent the intraperitoneal fluid volume from exceeding a pre-determined amount. The control system can adjust by adding one or more therapy cycles, allowing for fill volumes during each cycle to be reduced. The control system may continue to allow the fluid to drain from the peritoneal cavity as completely as possible before starting the next therapy cycle. The control system may also adjust the dwell time of fluid within the peritoneal cavity during therapy cycles in order to complete a therapy within a scheduled time period. The cycler may also be configured to have a heater control system that monitors both the temperature of a heating tray and the temperature of a bag of dialysis fluid in order to bring the temperature of the dialysis fluid rapidly to a specified temperature, with minimal temperature overshoot.
US10881777B2	Recirculating dialysate fluid circuit for blood measurement A blood based solute monitoring system for measuring at least one blood solute species that has a first recirculation flow path in fluid communication with a dialyzer. The first recirculation flow path is configured to allow a fluid to recirculate through a dialyzer such that the concentration of at least one solute species in the fluid becomes equilibrated to the solute species concentration of the blood in a blood compartment of the dialyzer. The blood solute monitoring system has at least one sensor to measure a fluid characteristic.
US10881775B2	Dialysis machine and ultrafiltration The invention relates to a dialysis machine capable of performing ultrafiltration without the need for a dedicated ultrafiltration pump. The system uses a pair of membrane flow balance pumps wherein the operation and/or the volume flow rate of the pumps can be modified during operation to bring about a net movement of dialysate either into or from the dialyser. The direction of flow of the dialysate in the dialyzer is reversible and the dialyzer can comprise two dialysate inlets, one at each end, and two dialysate outlets, one at each end.
US10881773B2	Transcutaneous energy transfer systems The present disclosure relates to an improved transcutaneous energy transfer (TET) system that generates and wirelessly transmits a sufficient amount of energy to power one or more implanted devices, including a heart pump, while maintaining the system's efficiency, safety, and overall convenience of use. The disclosure further relates one or more methods of operation for the improved system.
US10881771B2	Device and a method for augmenting heart function A device, a kit and a method are presented for permanently augmenting the pump function of the left heart. The basis for the presented innovation is an augmentation of the physiologically up and down movement of the mitral valve during each heart cycle. By means of catheter technique, minimal surgery, or open heart surgery implants are inserted into the left ventricle, the mitral valve annulus, the left atrium and adjacent tissue in order to augment the natural up and down movement of the mitral valve and thereby increasing the left ventricular diastolic filling and the piston effect of the closed mitral valve when moving towards the apex of said heart in systole and/or away from said apex in diastole.
US10881768B2	Drive line infection prevention using a flexible artificial skin ultra violet (UV) light emitter A driveline for an implantable blood pump including a percutaneous outer tube configured to connect with the blood pump when the blood pump is implanted within a body of a patient and an external controller outside of the body of the patient and at least one ultra-violet light emitter coupled to the outer tube.
US10881767B2	Cannula tip for use with a VAD The present invention includes various embodiments of methods of circulating blood in a mammalian circulatory system, and various blood circulation assemblies adapted to perform such circulation. In one embodiment of the present invention, a blood circulation assembly includes a blood circulation device having an inlet and a discharge; a first cannula including a proximal portion in communication with the inlet, the proximal portion having a wall extending around a first longitudinal axis and having outer and inner faces, said inner face defining a bore, and a distal portion including an outer face tapering distally toward said axis and at least two openings extending from said outer face and merging with one another to form a hollow space within said distal portion, said hollow space communicating with said bore of said proximal portion; and a second cannula including a proximal portion in communication with the discharge, the proximal portion having a wall extending around a first longitudinal axis and having outer and inner faces, said inner face defining a bore, and a distal portion including an outer face tapering distally toward said axis and at least two openings extending from said outer face and merging with one another to form a hollow space within said distal portion, said hollow space communicating with said bore of said proximal portion.
US10881764B2	Controlling operation of a reduced pressure therapy system based on dynamic duty cycle threshold determination Negative pressure wound therapy apparatuses and dressings, and systems and methods for operating such apparatuses for use with dressings are disclosed. In some embodiments, controlling the delivery of therapy can be based on monitoring and detecting various operating conditions. An apparatus can have a controller configured to monitor a duty cycle of a source of negative pressure. Based on the monitored duty cycle, the controller can determine whether a leak is present and provide an indication to a user. The controller can determine a duty cycle threshold in order to achieve an optimal or near optimal balance between an uninterrupted delivery of therapy, avoidance inconveniencing a user, conserving power, achieving optimal or near optimal efficiency, and/or limiting vibrational noise. In some embodiments, the duty cycle threshold is determined based at least in part on a capacity of a power source and an operational time of the apparatus.
US10881761B2	Preparation of high purity collagen particles and uses thereof Disclosed herein is a method of producing collagen particles. Each of the collagen particle is characterized in having a particle size of about 10-250 μm, in which the integrity of collagen fibers therein is relatively intact.
US10881755B2	Ultraviolet illumination with optical elements Ultraviolet illumination with optical elements to irradiate objects and/or fluid for purposes of sterilization, disinfection, and/or cleaning. The objects and/or fluid can be irradiated using an ultraviolet illuminator having at least one ultraviolet light emitting source. An ultraviolet transparent housing encapsulates the at least one ultraviolet light emitting source. The ultraviolet transparent housing includes an ultraviolet transparent material that emits ultraviolet light from the at least one ultraviolet light emitting source while preventing humidity from penetrating the ultraviolet transparent housing and damaging the at least one ultraviolet light emitting source. At least one ultraviolet transparent optical element is located about the ultraviolet transparent housing interspersed with the ultraviolet transparent material.
US10881749B2	Probes and methods of imaging a bacterial infection Embodiments of the present disclosure provide for labeled probes such as labeled maltoside probes and labeled maltotriose probes, methods of making labeled probes, pharmaceutical compositions including labeled probes, methods of using labeled probes, methods of diagnosing, localizing, monitoring, and/or assessing bacterial infections, using labeled probes, kits for diagnosing, localizing, monitoring, and/or assessing bacterial infections, using labeled probes, and the like.
US10881748B2	Nitroxide containing amyloid binding agents for imaging and therapeutic uses The present invention provides methods of using nitroxide spin-labeled amyloid beta-binding compounds to image amyloid. The present invention also provides nitroxide spin-labeled amyloid beta-binding compounds.
US10881747B2	Synthesis and composition of amino acid linking groups conjugated to compounds used for the targeted imaging of tumors The present disclosure relates to compounds that are useful as near-infrared fluorescence probes, wherein the compounds include i) a pteroyl ligand that binds to a target receptor protein, ii) a dye molecule, and iii) a linker molecule that comprises an amino acid or derivative thereof. The disclosure further describes methods and compositions for incorporating the compounds as used for the targeted imaging of tumors. Conjugation of the amino acid linking groups increase specificity and detection of the compound. Methods and compositions for use thereof in diagnostic imaging are contemplated.
US10881741B2	Single chain Fc fusion proteins The present invention provides novel, single chain Fc fusion proteins having improved properties. The invention provides single chain fusions of soluble proteins fused to the Fc region of an immunoglobulin via a novel linker comprising a constant region of an immunoglobulin light chain linked to a CH1 constant region of an immunoglobulin heavy chain. This novel linker confers favorable properties on the Fc fusion proteins of the invention such as improved bioactivity and increased half-life as compared to non-Fc fusion counterparts or as compared to prior art Fc fusion proteins. The novel Fc fusion protein scaffold as described herein may be designed to include soluble proteins of interest capable of binding or interacting with any target of interest. Preferably, the Fc fusion protein of the invention is a dimer. The dimer preferably forms via a disulfide bond between free cysteine residues in the hinge region of two monomeric Fc fusion proteins of the invention.
US10881738B2	Oligomer-beta blocker conjugates The invention provides small molecule drugs that are chemically modified by covalent attachment of a water-soluble oligomer. A conjugate of the invention, when administered by any of a number of administration routes, exhibits a different biological membrane crossing rate as compared to the biological membrane crossing rate of the small molecule drug not attached to the water-soluble oligomer.
US10881733B2	Benzamide and active compound compositions and methods of use The present invention describes compositions, including pharmaceutical compositions, comprising a PD-1 axis binding antagonist, a CTLA4 antagonist, or a DNA demethylating agent and a benzamide compound and methods for use thereof, for example in the treatment of cancer. In some implementations, the methods for use including methods of treating conditions where enhanced immunogenicity is desired such as increasing tumor immunogenicity for the treatment of cancer.
US10881732B2	Enhancing the therapeutic activity of an immune checkpoint inhibitor The present invention provides antagonists and methods of use thereof in the treatment of cancer and abnormal immune suppression diseases.
US10881731B2	Methods for inducing an immune response The present invention relates to methods for inducing an immune response, in particular methods for adjuvanting the immune response to an antigen comprising the separate administration of a saponin and a TLR4 agonist.
US10881729B2	Vaccine adjuvant compositions Embodiments described herein relate to combinatorial compositions and uses thereof, for example, as vaccine adjuvant compositions, for enhancing immune response, for inducing differentiation of nave T cells to differentiate into IFN-γ-producing T cells, and for preventing and treating infections. The combinatorial composition comprises TLR and CLR agonists. The combinatorial composition comprises at least one TLR4 agonist and at least one Dectin-1 agonist, wherein the at least TLR4 agonist is monophosphoryl lipid A (MPLA) or glycopyranosyl lipid A (GLA), or the combinatorial composition comprises at least one TLR7/8 agonist and at least one Mincle agonist.
US10881727B2	Hepatitis C virus immunogenic compositions and methods of use thereof The present disclosure provides heterodimeric polypeptides comprising: 1) a variant hepatitis C virus (HCV) E2 polypeptide and an HCV E1 polypeptide; 2) a variant HCV E1 polypeptide and an HCV E2 polypeptide; or 3) a variant HCV E1 polypeptide and a variant HCV E2 polypeptide, where the variant HCV E2 polypeptide and/or the HCV E1 polypeptide comprises one or more T cell epitopes, present in an HCV polypeptide other than an HCV E1 polypeptide or an HCV E2 polypeptide. The present disclosure provides nucleic acids encoding a polyprotein that includes E1 and variant E2, E2 and variant E1, or variant E2 and variant E1. The present disclosure provides a method of producing an E1/E2 heterodimer of the present disclosure. The present disclosure provides a method of inducing an immune response in an individual. The present disclosure provides variant E2 polypeptides and variant E1 polypeptides; and nucleic acids encoding same.
US10881725B2	Recombinant modified vaccinia virus Ankara (MVA) equine encephalitis virus vaccine The present invention relates to recombinant modified vaccinia virus Ankara (MVA) and to methods of using the same. In particular, the invention relates to recombinant MVA comprising a nucleotide sequence encoding for a structural protein of an equine encephalitis virus (EEV) excluding encoding for a capsid protein of the EEV, a composition in particular a pharmaceutical composition, a vaccine or kit comprising the recombinant MVA, uses and methods thereof e.g., suitable for treating and/or preventing a western, Venezuelan, and/or eastern equine encephalitis virus caused disease.
US10881720B2	Nanoparticles for immune stimulation The invention relates, in part, to nanoparticles, methods for preparing nanoparticles and methods of administering nanoparticles for immune stimulation. An immune-stimulating nanoparticle of the invention may include, at least in part, a polymer substrate comprising a biodegradable polymer and may include at least one antigen and/or at least one adjuvant.
US10881718B2	Bifunctional conjugate compositions and associated methods Bifunctional conjugate compositions are provided comprising a Signal-1 moiety bound to a first polymer carrier, wherein the combined size of the Signal-1 moiety and the first polymer carrier is about 1 nanometer to about 500 nanometers; and a Signal-2 moiety bound to a second polymer carrier, wherein the combined size of the Signal-2 moiety and the second polymer carrier is about 1 nanometer to about 500 nanometers. In some embodiments, the Signal-1 moiety and the Signal-2 moiety are bound to the same polymer carrier. Associated methods are also provided.
US10881716B2	Rapid-acting insulin formulation comprising a substituted anionic compound A composition in aqueous solution includes insulin and at least one substituted anionic compound chosen from substituted anionic compounds consisting of a backbone formed from a discrete number u of between 1 and 8 (1≤u≤8) of identical or different saccharide units, linked via identical or different glycoside bonds, the saccharide units being chosen from the group consisting of hexoses, in cyclic form or in open reduced form, said compound comprising partially substituted carboxyl functional groups, the unsubstituted carboxyl functional groups being salifiable. A pharmaceutical formulation including the composition is also set forth.
US10881713B2	Method and apparatus for interface control with prompt and feedback A method, system, apparatus, and/or device that may include a display configured to display a virtual object and a sensor configured to detect a viewer input. The method, system, apparatus, and/or device may include a processing device configured to: associate a first cursor with a first form of a user input; associate a second cursor with a second form of the user input; determine the first form of the user input is associated with a type of the virtual object; display the virtual object with the first cursor to the viewer; detect the viewer input from the viewer of the display; determine whether the form of the viewer input detected by the sensor is the first form, the second form, or an unknown form; and in response to the form of the viewer input being the first form, execute an executable instruction associated with the user input.
US10881709B2	Immune system modulators and compositions The present invention described herein relates to molecules and compositions that interact with molecules that suppress the immune system. More specifically, embodiments described herein concern the discovery, manufacture, and use of compositions that remove immunosuppression the immune system by binding to immunoregulatory peptides that interact with receptors on immune cells, compositions that can stimulate immune cells, and compositions that are cytotoxic to tumor cells.
US10881708B2	Ang (1-7) derivative oligopeptides for the treatment of pain The present invention provides oligopeptides, in particular, Ang-(1-7) derivatives, and methods for using and producing the same. In one particular embodiment, oligopeptides of the invention have higher blood-brain barrier penetration and/or in vivo half-life compared to the native Ang-(1-7), thereby allowing oligopeptides of the invention to be used in a wide variety of clinical applications including in treatment of cognitive dysfunction and pain.
US10881706B2	Product containing plant derived exosomes A product containing plant derived exosome that may be used in cancer treatment and wound healing. The product enables to provide a low-cost product, which does not cause toxic effects in human body, does not cause damage in the healthy cells during the course of the cancer treatment, does not pose any infection risk since it does not require any procedure such as radiotherapy or surgery, and the side effects occurring in chemotherapy treatment are not experienced. Wheatgrass, garlic and ginger can be used alone or in combination in the product as the plant source.
US10881700B1	Compositions including extracts of gray mangrove leaves and methods of treatment using such compositions in treatment of viral infections Human Immunodeficiency Virus (HIV) causes AIDS, a life-threatening disease characterized by immunosuppressive, opportunistic infections and malignancies. Although many drugs have been approved over the past decade as suitable for use in the treatment of individuals with HIV, the need for antiviral drugs of greater efficiency is still pressing. One valuable source for antiviral bioactivity has been proven to be the natural products of a wide range of plants. In this study, we investigated the anti-reverse transcriptase (RT)-HIV-1 potential activity of Avicennia marina (gray mangrove) collected from the Red Sea shore, Saudi Arabia. Metabolites from A. marina were extracted using organic solvents followed by solid phase extraction (SPE) and high-performance liquid chromatography (HPLC). Gas chromatography mass spectrometry (GC-MS) was applied to assess the active HPLC fractions and to establish a correlation between the fractions' chemical composition and biological activity. The chemical analyses revealed the existence of many polyphenol compounds. Polyphenol compounds have been proven to act as multi-target anti-HIV agents. Furthermore, imaging-based High-Content Screening (HCS) with a set of cellular staining was established to characterize mechanisms of activity and potential side-effects, such as toxicity and cell cycle arrest. In summary, we discovered and assessed for the first time anti-RT-HIV-1 activity for A. marina collected from Red Sea shore, Saudi Arabia. Our results suggest this plant is a promising candidate for the development of potential novel HIV-1 inhibitors.
US10881699B2	Cosmetic compositions A method of reducing the appearance of hyperpigmented skin or inflamed skin is disclosed. The method can include topically applying to hyperpigmented skin or inflamed skin a composition comprising an effective amount of an extract of Rhododendron ferrugineum leaf to reduce melanocyte pigmentation in the skin or to reduce tumor necrosis factor alpha (TNF-α) and cyclooxygenase-1 and -2 (COX-1 and COX-2) activity in the skin.
US10881698B2	Diagnosis and treatment for respiratory tract diseases The invention provides methods and compositions for the diagnosis, prognosis and treatment of respiratory tract diseases. Specifically, the invention provides diagnosis, prognosis and treatment of respiratory infections using bitter and sweet taste signal transduction pathways. In one aspect, the invention relates to a method for treating a respiratory infection by administering a composition to the respiratory tract of a subject in an amount capable of activating bitter taste signaling and/or inhibiting sweet taste signaling. The composition comprises at least a bitter receptor agonist and, optionally, a pharmaceutically acceptable carrier for delivering the composition to the respiratory tract. In another aspect, the invention relates to a composition for treatment of a respiratory infection. Such composition comprises at least a bitter receptor agonist and, optionally, a pharmaceutically acceptable carrier for delivering the composition to the respiratory tract.
US10881693B2	Processes for making and using a mesenchymal stem cell derived secretome The present application provides methods and processes for making and using a mesenchymal stem cell secretome, as well as methods for treating ocular conditions and/disorders with the mesenchymal stem cell secretome described herein.
US10881691B2	Cell preparations for extemporaneous use, useful for healing and rejuvenation in vivo The present invention relates to new plasma or new platelet-rich plasma preparations, new cell dissociation methods, new cell associations or compositions, a method of preparation thereof, a use thereof, devices for the preparation thereof and preparations containing such a platelet-rich plasma preparation and cell associations or compositions. Specifically, the invention provides plasma or platelet-rich plasma alone or in cell composition preparations for use in tissue regeneration and bone regeneration and pain reduction.
US10881689B2	Materials and methods for engineering cells and uses thereof in immuno-oncology Materials and methods for producing genome-edited cells engineered to express a chimeric antigen receptor (CAR) construct on the cell surface, and materials and methods for genome editing to modulate the expression, function, or activity of one or more immuno-oncology related genes in a cell, and materials and methods for treating a patient using the genome-edited engineered cells.
US10881688B2	Modified gamma delta T cells and uses thereof The present invention provides composition and methods for the treatment of cancer or infectious diseases in a human. The invention includes the generation and administration of gamma delta T cells that express chimeric antigen receptors (CARs) comprising an antigen binding domain, a hinge domain, a transmembrane domain, a costimulatory signalling domain with the inclusion or not of a CD3 zeta signalling domain. Expression of CAR sequence omitting the CD3 zeta signalling domain in gamma delta T cells, provides for a CAR-T therapy in vivo, which will effect cytolysis only on target cells providing ligands for activation of the gamma delta T cell receptor (TCR).
US10881683B2	Nucleic acid molecule The present invention is directed to provide nucleic acid molecules that promote proliferation of pancreatic islet β-cells. A proliferation promoting agent for promoting proliferation of pancreatic islet β-cells according to the present invention contains at least one of a nucleic acid molecule having SEQ ID NO: 1 or a nucleic acid molecule having SEQ ID NO: 2: (SEQ ID NO: 1) UAAAGUGCUGACAGUGCAGAU (SEQ ID NO: 2) AGCUACAUCUGGCUACUGGGUCUC.
US10881682B2	Therapeutic compositions comprising n-alkyl-hydroxy polymers The disclosure describes methods and therapeutic compositions comprising polymers modified with N-alkyl-hydroxy groups comprising one or more carbon atoms. The compositions are useful for gene delivery, and exhibit broad-spectrum antiviral activity and low toxicity in vitro.
US10881681B2	CD73 inhibitors and pharmaceutical uses thereof CD73 (also known as ecto-5′-nucleotidase) inhibitor compounds are provided, as well as compositions and uses thereof for treating or preventing CD73-associated or related diseases, disorders and conditions, including cancer- and immune-related disorders. CD73 inhibitor compounds include compounds having the structure set forth in Formula I and pharmaceutically acceptable esters or salts thereof.
US10881677B2	Composition for modulating IRAK1 The present invention relates to the treatment of breast cancer, more particularly triple negative breast cancer (TNBC), with the use of an inhibitor of Interleukin 1 Receptor Associated Kinase 1 (IRAK1) such as ginsenosides. It also relates to a method for aiding in categorising or determining prognosis in a breast cancer patient or in selecting a therapeutic strategy comprising assessing the level of IRAK1 nucleic acid, protein or activity in a sample and, in some aspects, further assessing the paclitaxel resistance status of the patient and if the patient is resistant to paclitaxel therapy, treating the patient with an inhibitor of IRAK1 activity. In addition, a screening method for identifying a compound useful for treating breast cancer comprises determining the effect of a test compound on IRAK1 nucleic acid, protein or activity level and selecting a compound that reduces said level.
US10881672B2	Pharmaceutical tetracycline composition for dermatological use Provided herein is a topical composition and related methods for making and using the composition. In a first aspect, the topical composition comprises minocycline, a magnesium salt, and a sulfite compound in a non-aqueous solvent. In yet another aspect, the topical composition comprises a tetracycline-class drug, a source of magnesium, a monohydric aliphatic alcohol, and a polyol, wherein (i) the ratio between the monohydric aliphatic alcohol and the propylene glycol is in the range of 1:1 to 99:1 by weight and (ii) the tetracycline-class drug is dissolved in the topical composition.
US10881670B2	Oral testosterone tridecanoate therapy The present disclosure provides methods and compositions for testosterone replacement therapy. The methods and compositions employ a fixed dose dosing regimen that does not require titration or dose adjustments and that can provide a therapeutically effective amount of a testosterone ester while avoiding unacceptably high testosterone levels.
US10881669B2	Inhibitors of the plasmodial surface anion channel as antimalarials Disclosed are inhibitors of the plasmodial surface anion channel (PSAC) inhibitors and the use thereof in treating or preventing malaria in an animal such as a human, comprising administering an effective amount of an inhibitor or a combination of inhibitors. An example of such an inhibitor is a compound of formula I, or a pharmaceutically acceptable salt thereof, wherein R1 to R7 are as described herein.
US10881668B2	Acetamide thienotriazolodiazepines and uses thereof The present invention provides compounds of Formula (I), and pharmaceutically compositions thereof. Compounds of Formula (I) are binders of bromodomains and/or bromodomain-containing proteins (e.g., bromo and extra terminal (BET) proteins). Also provided are methods, uses, and kits using the compounds and pharmaceutical compositions for inhibiting the activity (e.g., increased activity) of bromodomains and/or bromodomain containing proteins and for treating and/or preventing in a subject diseases associated with bromodomains or bromodomain-containing proteins (e.g., proliferative diseases, cardiovascular diseases, viral infections, fibrotic diseases, metabolic diseases, endocrine diseases, and radiation poisoning). The compounds, pharmaceutical compositions, and kits are also useful for male contraception.
US10881665B2	Formulations for treatment of post-traumatic stress disorder Provided herein are compositions for reducing symptoms of post-traumatic stress disorder. The compositions include a combination of an N-methyl-D-aspartate (NMDA) receptor antagonist and an anti-depression agent.
US10881654B2	Selective PFKFB4 inhibitors for the treatment of cancer Methods and pharmaceutical compositions for inhibiting 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4) and the treatment of cancer are described.
US10881647B2	Neosaxitoxin combination formulations for prolonged local anesthesia Since each of the site I sodium channel blockers have a unique activity and cannot be used to extrapolate the same effective dosage for another site I sodium channel blocker, studies were conducted to identify dosages of neosaxitoxin (“NeoSTX”) and bupivacaine, alone or in combination with epinephrine, to provide two to three days of pain relief in humans. Bupivacaine-NeoSTX combinations produce more reliable blockade and longer duration blockade compared to NeoSTX alone. The three-way combination of NeoSTX-bupivacaine-epinephrine produces more prolonged local anesthesia than the two-way combination of NeoSTX-bupivacaine. Addition of epinephrine to this NeoSTX-bupivacaine combination dramatically prolongs the duration of complete blockade to a mechanical stimulus. These results led to development of specific combination dosage formulations.
US10881645B2	Methods for controlling blood pressure and reducing dyspnea in heart failure Methods for controlling, maintaining, or reducing blood pressure, and/or for treating, preventing, or alleviating symptoms such as dyspnea, in a patient suffering from or susceptible to acute heart failure. The methods involve the administration of an effective amount of a pharmaceutical composition comprising a short acting dihydropyridine compound such as clevidipine. The pharmaceutical composition may be administered at an initial dose, and if blood pressure is not controlled or maintained within a target blood pressure range or reduced to within a target blood pressure range, the initial dose may be titrated to achieve a blood pressure within the target blood pressure range. The patient may have a systolic blood pressure of about 120 mmHg or above.
US10881644B2	Treatment of asthma and chronic obstructive pulmonary disease with anti-proliferate and anti-inflammatory drugs Embodiments of the present invention provide a method for treatment of respiratory disorders such as asthma, chronic obstructive pulmonary disease, and chronic sinusitis, including cystic fibrosis, interstitial fibrosis, chronic bronchitis, emphysema, bronchopulmonary dysplasia and neoplasia. The method involves administration, preferably oral, nasal or pulmonary administration, of anti-inflammatory and anti-proliferative drugs (rapamycin or paclitaxel and their analogues) and an additive.
US10881643B2	Sphingosine pathway modulating compounds for the treatment of cancers The invention provides methods and compositions for treating cancers and myeloproliferative disorders using sphingosine kinase-1 inhibitors, such as SK1-I, and selective sphingosine-1-phosphate receptor agonists, such as ozanimod.
US10881642B2	Autophagy enhancer and use thereof Provided are a compound of chemical formula 1 or 2 and a use thereof. The compound can be advantageously used in the prevention or treatment of metabolic diseases including type 2 diabetes, insulin resistance, or obesity, on the basis of a mechanism of autophagy activation through the promotion of lysosome production.
US10881640B2	Topical pharmaceutical compositions for treatment of pilonidal sinus wounds A topical composition comprising about 5 wt % to about 12.5 wt % of metronidazole or a pharmacologically acceptable salt thereof in a non-aqueous vehicle. The composition may be used in the treatment of skin damage due to inflammatory skin conditions; thermal, chemical or electrical burns; infections or radiation treatment. One advantage of the composition is that topical administration of metronidazole results in a primarily local effect, and thus, side effects observed from systemic administration are avoided.
US10881638B2	Eye health composition Ophthalmic nutraceutical composition comprising: vitamins; trace elements; carotenoids; omega-3 fatty acids; and resveratrol.
US10881635B2	Tannin-containing gastrointestinal formulations and methods of use Tannin-containing compositions and methods of using same to enhance or maintain immune function during simplified nutrition feeding. Pharmaceutical compositions, including enteral nutrition compositions, are provided. The compositions comprise such tannins as proanthocyanidins and/or hydrolysable tannins. Administering the tannins to the gastrointestinal tract of a subject receiving simplified nutrition, such as with enteral nutrition therapy or parenteral nutrition therapy, attenuates or prevents deleterious effects on the gastrointestinal immune system that would otherwise occur with the simplified nutrition.
US10881634B2	Method for treatment or prevention of a disease associated with a decrease in bone mass and method of improving bone architecture and bio mechanical strength of bone The present invention provides a method for treatment or prevention of a disease associated with a decrease in bone mass comprising administering to a subject in need of such treatment a composition comprising an effective amount of genistein phosphate conjugate. The present invention also provides a method of improving bone architecture and bio-mechanical strength of bone comprising administering to a subject in need of such treatment of a composition comprising an effective amount of genistein phosphate conjugate. The present invention administering to a subject in need of such treatment a composition comprising an effective amount of genistein phosphate conjugate can effectively increase the oral bioavailability so as to reduce the symptoms and the risk of complications of menopausal women, increase bone mineral content, bone density and bio-mechanical strength of bone, and slow down osteoporosis.
US10881633B2	Compositions and methods for stimulating ventilatory and/or respiratory drive A method of stimulating ventilatory and/or respiratory drive in a subject in need thereof includes administering to the subject a therapeutically effective amount of a composition comprising a D-cysteine alkyl ester, adduct thereof, or pharmaceutically acceptable salt, tautomer, or solvate thereof.
US10881629B2	Methods and compositions for increasing the anaerobic working capacity in tissues Provided are compositions comprising beta-alanylhistidine peptides and/or beta-alanines, and methods for administering these peptides and amino acids. In one aspect, the compositions and methods cause an increase in the blood plasma concentrations of beta-alanine and/or creatine.
US10881620B2	Biomolecule preservation The present invention provides a way to capture a biomolecule such as a protein in one or more layers of covalently bonded amorphous silica, forming a cage or shell which preserves the shape of the protein and prevents denaturation caused by heat and/or aging and/or non-physiological conditions, through unfolding and loss of secondary and/or higher order structure.
US10881619B2	Compositions, devices and methods for multi-stage release of chemotherapeutics In one aspect, the present disclosure provides microparticles that are configured to release a first drug over a first time period and to release a second drug over a second time period, wherein a lag period of substantially no drug release occurs between the first and second time periods. In other aspects, the present disclosure pertains to the use of such microparticles in delivery systems and methods of treatment. In another aspect, the present disclosure pertains to drug delivery systems that comprising a folded inflatable drug delivery balloon that comprises folds and microparticles positioned within the folds.
US10881611B2	Extracellular vesicles derived from osteoblastic lineage cells for therapeutic and diagnostic use The present invention relates to RANKL+ cellular vesicles isolated from osteoblastic lineage cells, optionally immortalised, their use for the therapeutic treatment of bone pathologies and for diagnostic purposes, and processes for the production of said vesicles.
US10881610B2	Orally disintegrating tablet An orally disintegrating tablet is disclosed possessing both advantageous hardness and disintegrability. The orally disintegrating tablet is (a) a compression molding product of a mixture comprising: a pharmaceutically active ingredient-containing composition selected from a group consisting of a pharmaceutically active ingredient-containing powder and pharmaceutically active ingredient-containing granules; rapidly disintegrating granules; and a lubricant, (b) wherein the rapidly disintegrating granules comprise a sugar and/or a sugar alcohol, and one or more organic and/or inorganic, hydrophilic and water-insoluble additives.
US10881608B2	Biodegradable intravitreal tyrosine kinase implants Biocompatible intraocular implants include a tyrosine kinase inhibitor and a biodegradable polymer that is effective to facilitate release of the tyrosine kinase inhibitor into the vitreous of an eye for an extended period of time. The therapeutic agents of the implants may be associated with a biodegradable polymer matrix, such as a matrix that is substantially free of a polyvinyl alcohol. The implants can be placed in an eye to treat or reduce the occurrence of one or more ocular conditions.
US10881605B2	Methods for the preparation of injectable depot compositions Injectable depot compositions comprising a biocompatible polymer which is a polymer or copolymer based on lactic acid and/or lactic acid plus glycolic acid having a monomer ratio of lactic to glycolic acid in the range from 48:52 to 100:0, a water-miscible solvent having a dipole moment of about 3.7-4.5 D and a dielectric constant of between 30 and 50, and a drug, were found suitable for forming in-situ biodegradable implants which can evoke therapeutic drug plasma levels from the first day and for at least 14 days.
US10881602B2	Composition and process for shaping or altering the shape of hair Disclosed herein is a composition for shaping or altering the shape of hair, such as by straightening hair, wherein the composition contains a reducing agent, a neutralizing agent, a dimethicone copolyol, a cellulose compound, and water, wherein the pH of the composition ranges from about 2 to less than about 7. Also disclosed is a process for shaping or altering the shape of hair.
US10881599B2	Whitening composition including novel kaempferol-based compound derived from post-fermented tea The present specification relates to a whitening composition including a novel compound isolated from a post-fermented tea, an isomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, or a solvate thereof, and may be widely used in various areas related to skin whitening and skin care.
US10881596B2	Cosmetic composition for enhancing properties of pre-colored keratin fibers The present invention is on a cosmetic composition for improving color brilliance and wash fastness of artificially-colored keratin fibers. The effect is achieved by the combination of pyrrolidone carboxylic acid esters, pyrrolidone carboxylic acid and/or its salts, and amodimethicone microemulsion. A process for treating keratin fibers, a use of the composition and well as a kit-of-parts is disclosed.
US10881590B2	Wet wiper articles and methods for cleaning removable dental appliances A wet wiper for cleaning an oral cavity or an oral appliance. The wet wiper comprises a water insoluble substrate and a physiologically acceptable cleansing composition. Methods for cleansing oral cavities and oral appliances are also provided, such methods comprising the step of contacting the surface of an oral cavity or an oral appliance with a wet wiper of the present invention for a sufficient time to permit cleaning.
US10881588B2	Methods and kits for inserting a tube through the nasopharynx of a patient Methods of inserting a tube through the nasopharynx of a patient are disclosed. The methods of inserting a tube through a nasopharynx of a patient includes the steps of inserting the tube through a naris of the patient; and when a distal end of the tube is proximate a rear surface of the nasopharynx, pulling on or holding in place a thread-like member attached to a tube portion of the distal end of the tube so as to alter an initial direction of the distal end of the tube and point the distal end of the tube towards a throat of the patient. Kits for inserting a tube through the nasopharynx of a patient are also disclosed. The kits include a tube sized so as to move through a nasopharynx of a patient; and a thread-like member that is attachable to a tube portion of a distal end of the tube and can be tensioned so as to alter an initial direction of the distal end of the tube and point the distal end of the tube towards a throat of the patient. Methods of making kits for inserting a tube through the nasopharynx of a patient are further disclosed.
US10881586B1	Stuffed animal bottle holder apparatus A stuffed animal bottle holder apparatus for securing a baby bottle to a car seat or stroller includes a stuffed torso. A pair of hind legs and a head are coupled to the torso. The head has a pair of eyes, a pair of ears, and a nose coupled to a snout portion. The snout portion has a bottle cavity extending into the torso that is configured to receive the baby bottle. A bottle ring is coupled to the head. A pair of arms coupled to the torso and a pair of hands coupled to the pair of arms are used to secure the apparatus to the car seat. Each of the pair of hands comprises a palm and a plurality of fingers coupled to the palm. The torso, the pair of hind legs, the head, the pair of arms, and the pair of hands form a stuffed animal.
US10881585B2	Pill compliance device and monitoring system A pill compliance device maintains a patient's pill supply and monitors the patient's access to pills contained in the device to memorialize the patient's compliance with his/her pill-taking regimen. The device has a housing, including an inner pill or capsule storage compartment and an electronics unit, a removable cover, a switch to detect removal of the cover and magnet away from the housing, and to detect a replacement of the cover and magnet to the housing, wherein activating the switch triggers a transition from an active state, to a dormant state, and vice versa. A transition from the dormant state to the active state, by replacing the cover to the housing generates a pill-taken signal. A microcontroller generates a compliance notification signal that is communicated wirelessly, to memorialize the apparent compliance.
US10881584B2	Topical pharmaceutical compounds and methods Kits for allowing pharmacist to easily compound medications are provided. The kits include a mixing container, a first active ingredient and an inactive ingredient. It is further provided that methods of mixing compounds. Some kits include coloring agents that aid in the establishment proper mixing. Other kits include colored labels located on the ingredients.
US10881578B2	Traction apparatus Disclosed embodiments provide a traction apparatus for promoting growth of a human penis. A light source is integrated with the traction apparatus for providing near infrared light to the penis and simultaneously apply a traction force. Embodiments include a base section, arm section, and head section. Magnetic mounts including electrical conductors supply electricity to the arm section and head section, providing power for a light source. The light source is configured to output light in near infrared wavelengths. The light can provide therapeutic effects that can enhance penis growth beyond that of a conventional traction device.
US10881576B2	Walking assistant harness A walking assistant harness attached to a leg of a trainee so as to assist walking of the trainee includes: a thigh frame placed along a front side or a rear side of a thigh of the trainee; and a thigh fixation belt connected to the thigh frame at a connection portion, so as to fix the thigh of the trainee to the thigh frame, and the connection portion includes a connecting position adjustment mechanism configured to adjust a connecting position with the thigh fixation belt in a right-left direction of the trainee.
US10881572B2	Natural assist simulated gait therapy adjustment system Apparatus and associated methods relate to a natural gait therapy device having an adjustable gait timing linkage assembly configured to operate an adjustable knee support assembly and an adjustable height foot assembly to simulate a normal walking pattern for a user based on characteristics of the user. In an illustrative example, the adjustable gait timing linkage assembly includes a chain sprocket configured to adjust a degree of heel lift and a length to the point of the heel lift during a normal walking simulation. In some embodiments, a gait stride adjustment assembly may adjust a stride length to accommodate different sized users. The gait stride adjustment assembly may advantageously contribute to the natural walking pattern simulation.
US10881569B2	Method of assisting a subject to stand using a medical apparatus A medical apparatus for standing aid includes a backrest (4) that has at least one side thereof provided with a crank rocker mechanism that includes a crank mechanism (1), a triangle linkage mechanism (2), and a rocker mechanism (3), the crank mechanism (1) is rotatably connected to the triangle linkage mechanism (2) such that an included angle between a second driven link (BE) of the triangle linkage mechanism (2) and the crank mechanism (1) is always smaller than 90°, and the crank mechanism (1) driving the triangle linkage mechanism (2), the rocker mechanism (3) and the backrest (4) connected to the triangle linkage mechanism to perform interactive movement repeatedly along a predetermined curve trajectory in response to a driving force from a drive effect of a driving unit (100), so that the backrest (4) connected to the second driven link (BE) assists a trainee in standing up repeatedly by obliquely supporting the trainee's waist.
US10881566B2	Patient support apparatus with body slide position digitally coordinated with hinge angle An articulated patient support apparatus includes upper and lower body support frames hinged together to form a patient support assembly which is hinged to head and foot end supports. One end of the assembly includes a length compensator to enable hinged angulation between the body support frames. Hinge motors are connected between the frames to cause hinged articulation therebetween. One or both of the body support frames has a body slide assembly mounted thereon to enable part of a patient's body to move linearly along the particular body support frame by operation of a slide motor to compensate for hinged articulation of the frames. The hinge motors and slide motor have encoders interfaced to a controller to digitally coordinate sliding movement with hinging articulation.
US10881560B1	Patient transport system This invention includes embodiments which disclose patient transportation devices such as toboggans or litters, which may include adjustable handle lock and positioning systems, a handle attachment and detachment system which renders the handle readily attachable and detachable to the transportation device and/or an anchor system for securing or stabilizing rescue stretchers and rescue litters when rescuing and transporting patients.
US10881559B2	Lightweight collapsible casualty litter Collapsible, lightweight, and easy-to-assemble litters for transporting injured or incapacitated persons are disclosed. For example, a collapsible apparatus for transporting persons includes a frame assembly having a pair of frame rails. Each frame rail includes at least two telescoping rods connected by a hinge that can be configured to allow the frame rails to be folded upon each other. The collapsible apparatus can additionally include one or more collapsible tension rods secured to the pair of frame rails for selectively maintaining a lateral displacement of the pair of frame rails when the frame assembly is in an assembled configuration and a stretcher bed carried by the frame assembly that is configured to receive and support a person between the pair of frame rails when the frame assembly is in the assembled configuration.
US10881556B2	Absorbent article having a cavity portion and a projection that fits in the cavity portion In an absorbent article (200), a pair of slits (40) each extending in a front and rear direction with a predetermined width is formed in an absorbent body (23) at a front and rear direction region at least at a crotch portion (C2) such that to section a first portion (11) at middle, and a second portion (12) and a third portion (12) at both sides of the first portion in a width direction, respectively, projection portions (23P) projected toward both sides in the width direction at middle in the front and rear direction of the first portion (11) are included in the absorbent body, and cavity portions (23D) in which the projection portions (23P) fit outwardly in the width direction are formed at a front and rear direction position corresponding to the projection portions (23P) in the second portion (12) and the third portion (12), respectively.
US10881554B2	Method and apparatus for producing absorbent sanitary articles A method for producing absorbent sanitary articles, including: advancing in a machine direction a continuous composite tape comprising a first elastic band and a second elastic band, folding said continuous composite tape around a longitudinal axis parallel to the machine direction, cutting second connection zones of the second elastic band with two cuts spaced apart from each other, removing scrap portions of the second elastic band between said cuts, cutting first connection zones of the first elastic band, and folding in opposite directions portions of the first connection zone and overlapping end edges of the first connection zone to corresponding end edges of the second connection zone.
US10881546B2	Body side member of an ostomy appliance An ostomy appliance comprising a body side member (20) for attachment to a skin surface of a user. The body side member includes a backing layer (22), an adhesive layer (24), and at least one release liner (38). The release liner is at least partly embossed (40) to form interconnected cavities (42) between the release liner and the adhesive surface. When fluid is distributed into the cavities, the adhesive surface is wetted.
US10881542B2	Stent delivery device A stent delivery device for deploying a low column strength stent may include an inner member having a distal region and a stent receiving area disposed therein. A low column strength stent convertible between a compressed configuration and an expanded configuration may be disposed on the stent receiving area. The stent receiving area may include a soft durometer polymer configured to permit the low column strength stent to sink into the soft durometer polymer when the low column strength stent is in the compressed configuration. An outer member may be moveable between an extended position in which the outer member extends over the stent and a retracted position in which the outer member is proximal of the stent.
US10881541B1	Systems and methods for treating venous compression/obstruction syndromes Apparatus and methods are provided for treating patients exhibiting symptoms of hypertension, isolated systolic hypertension, heart failure with preserved ejection fraction, May-Thuner Syndrome or dyspnea by diagnosing and reducing narrowing of a patient's iliac vein caused by extrinsic localized compression using a stent having circumferential differential radial stiffness and delivery catheter for aligning and deploying such stents.
US10881537B2	Structural hydrogel polymer device The present invention relates generally a manufacturing process which results in a completely hydrogel polymer device that maintains lumen patency which allows for numerous applications. Catheters and stents are particular examples, and their composition, mechanical characteristics, and the significantly unique ability to conduct and allow fluids to pass from one end to the other without physiological rejection, inflammation, or manifestation of complications due to implant or otherwise undesirable outcomes when used for ambulatory and or therapeutic interventions is the purpose of the invention.
US10881534B2	Modular lower limb prosthesis system A lower limb modular prosthetic system that may be fabricated by a 3D printer capable of printing with composite fiber filament, nylon, or metal. The production process may include a 3D printer that is capable of routing fiber in specifically programmed patterns. The components of the prosthetic system may be designed for direct patient end-use, and may be energy returning in nature.
US10881532B1	Shock and torsion absorber for elevated vacuum suspension The present invention teaches a shock and torsion absorber that includes a base member having an accommodation space and an exhaust opening, a cushion member joined to a bottom end of the base member, a limit member including a positioning element and a seal element, and a joint member having an intake element, a trough, and a axial channel. A piston is housed in the joint member. The axial channel allows a shaft to thread through via the positioning element and to join with the shaft limit element. A bottom end of the positioning element is connected to the cushion member. The piston is connected to a top end of the positioning element. An upper vacuum chamber is formed above the seal element in the joint member. A lower vacuum chamber is formed beneath the piston and the seal element.
US10881530B2	Surgical instrument and method A surgical instrument comprises a member defining a longitudinal axis and is connectable with a spinal implant. The member is connected to a handle disposed transverse relative to the axis and rotatable about the axis. An image guide is connected with the member and oriented relative to a sensor to communicate a signal representative of a position of the spinal implant. Systems, implants, spinal constructs and methods are disclosed.
US10881529B2	Spinal implant and method for fabricating the same A spinal implant is provided that includes a body extending in direction at least substantially along a body axis, between a first end portion and a second end portion. The spinal implant also includes a first bearing surface disposed relative to the first end portion, and defining a first relief pattern that is configured to inhibit movement of the spinal implant relative to one or more vertebrae in at least substantially all directions. A method for manufacturing the spinal implant involves use of selective laser sintering.
US10881528B2	Center lordotic mesh cage An implant assembly including a curved mesh cage and angled endplates. The implant assembly offers a safe and secure mesh cage while providing lordosis/kyphosis angling at the center of the construct instead of at the end of the cage only. One or more angled endplates may be included which allow the surgeon to make a construct unique to the patient's anatomy. The endplates press-fit into corresponding holes in the mesh cage for a secure fit.
US10881516B2	Subchondral treatment to prevent the progression of osteoarthritis of the joint Methods for the prevention, or delayed onset or progression of, bone marrow edema or bone marrow lesion, and subchondral treatment to prevent the progression of osteoarthritis of a joint are disclosed. The methods involve treating the subchondral bone, while preserving, as much as possible, the joint's articular and cartilage surface. The methods could be performed before, during, or after an initial arthroscopic surgery to repair the joint. Associated devices and instruments for treatment of the subchondral bone are also disclosed.
US10881515B2	Implantation of cartilage The invention is directed towards a process for implanting a cartilage graft into a cartilage defect and sealing the implanted cartilage graft with recipient tissue. The invention is also directed towards a process for repairing a cartilage defect and implanting a cartilage graft into a human or animal. The invention is further directed toward a repaired cartilage defect.
US10881512B2	Dual-flange prosthetic valve frame A method of replacing the function of a native mitral valve is achieved by inserting a distal end portion of a delivery apparatus into a patient's body, wherein a prosthetic mitral valve is disposed along the distal end portion of the delivery apparatus. The prosthetic mitral valve includes a collapsible and expandable annular body having a network of struts interconnected at a plurality of nodes to form a plurality of open cells. Atrial and ventricular flanges are coupled to the annular body and extend radially away from the annular body. Three commissure support posts extend from the ventricular flange toward a ventricular end of the prosthetic valve and a valve member is secured to the commissure support posts. The prosthetic mitral valve is positioned within the native mitral valve of the patient's heart and the native mitral valve is pinched between the atrial and ventricular flanges.
US10881510B2	Replacement heart valves, delivery devices and methods A replacement heart valve and method of treating valve insufficiency includes an expandable frame configured to engage a native valve annulus. A valve body is coupled to the frame. The valve body can include a leaflet portion and possibly a skirt portion. A portion of the frame has a foreshortening portion configured to longitudinally expand when urged to a radially compacted state and longitudinally contract when urged to a radially expanded state. In one embodiment the valve skirt is attached to the frame so that it can adapt to changes in the length of the frame. A delivery device in some embodiments can use one or more coverings, such as sheaths, to controllably release the replacement heart valve at a native heart valve.
US10881505B2	Ophthalmosurgical injector system An ophthalmosurgical injector system includes an injector, which has a handpiece, a plunger, and a dispensing device; an intraocular lens, which has an optic body and two C-shaped haptic arms protruding therefrom; and a cartridge, in which the intraocular lens is received. The dispensing device has an inlet opening at the proximal end and an outlet opening at the distal end. When the plunger is moved forward, the intraocular lens is conveyed from the cartridge through the inlet opening to the outlet opening of the dispensing device. When the intraocular lens is held in the cartridge in a compressed and preloaded state, a subregion of each of the haptic arms bears on and covers the optic body. In a plan view, the optic body of the preloaded intraocular lens has a circular surface area with a diameter of at least 4.0 mm that is not covered by the haptic arms.
US10881501B2	Soft tissue repair allografts and methods for preparing same Allografts for soft tissue repair, including breast reconstruction and other plastic surgery procedures, are disclosed. One allograft is made from decellularized dermal tissue and constitutes a collagen matrix having substantially uniform density and porosity. Another allograft is a hybrid bilayer tissue form that is made from decellularized dermal and adipose tissues. Methods for making both allografts are also disclosed.
US10881499B2	Bone tendon constructs and methods of tissue fixation Techniques and reconstruction systems for ligament repair and fixation. A bone tendon graft is prepared by folding the bone block over a suspensory fixation device (for example, a knotless suture construct such as a knotless, adjustable, self-cinching suture loop/button construct, a suture, crosspin, or screw, etc.). A flexible strand is then used to suture the bone plug to the tendon so that the overall graft is shortened significantly and the suspensory fixation device is securely attached. The technique does not require passage of the suspensory fixation device through the bone block which makes the graft passage easier since the graft is pulled from the tip. The technique also allows shortening of the overall graft.
US10881497B2	Composite vascular flow diverter A vascular flow diverter includes a tubular mesh framework which includes a mesh cover and an opening. The tubular mesh framework is collapsible and configured to expand from a collapsed shape to a tubular shape when the vascular flow diverter is deployed. The mesh cover conforms to the shape of the tubular mesh, is surrounded by the tubular mesh framework, and is less porous than the tubular mesh framework. The opening is located within the mesh cover. A delivery wire passes through the opening in order to guide the flow diverter into place over an aneurysm.
US10881489B2	Hybrid orthodontic archwires Hybrid orthodontic archwire designs are disclosed. Hybrid archwires may have bracket-archwire sections and interproximal archwire sections in which each section can vary in cross-section shape, size, and/or material properties. Bracket-archwire sections may be configured to promote torque control and may have rectangular cross-sections. Interproximal archwire sections may be configured to be bent into force-promoting loops and may have round cross sections. Each archwire section may be straight or bent into any shape. Hybrid archwires may have sliding sections and non-sliding sections. Non-sliding sections may have male connectors configured to prevent the archwire from sliding relative to the orthodontic brackets and/or may have cross-sectional shapes, sizes, or coatings that resist sliding relative to sliding sections. Sliding sections may have linear archwire segments. Hybrid archwires may have distal or posterior non-sliding sections and an intermediate anterior or medial sliding section.
US10881486B2	Three-dimensional printed dental appliances using lattices Method and apparatus for fabricating an oral appliance are described for correcting malocclusions on a dentition of a subject. A three-dimensional representation of the dentition may be captured and a free-form structure having a lattice structure which matches at least part of a surface of the dentition is generated. The lattice structure defines a plurality of open spaces such that the free-form structure is at least partially transparent. The lattice structure may then be manufactured by impregnating or covering a coating into or upon the lattice structure such that the oral appliance is formed.
US10881480B2	Systems and methods for endoluminal valve creation A device for manipulating tissue at a vessel includes an elongated member having a proximal end and a distal end, a guide member at the distal end of the elongated member, the guide member having a blunt distal tip for engagement against an interior wall of the vessel, and a tissue cutting device at the distal end of the elongated member, wherein the tissue cutting device has a sharp tip that is proximal to the blunt distal tip of the guide member.
US10881478B1	Methods for protecting robotic surgery systems with sterile barriers A method of preparing a robotic surgery apparatus for a medical procedure can include covering a manipulator unit of the robotic surgery apparatus with a first sterile barrier by coupling a drape coupler of the first sterile barrier to a bottom surface of the manipulator unit and wrapping a drape of the first sterile barrier around side and top surfaces of the manipulator unit. The drape can be coupled to the drape coupler. The drape can be made of material that is more flexible than material of the drape coupler. The method can include covering an arm of the robotic surgery apparatus supporting the manipulator unit with a second sterile barrier that is distinct from the first sterile barrier by coupling the second sterile barrier to the arm and wrapping the second sterile barrier around the arm.
US10881466B2	Systems, methods, and computer-readable media of providing distance, orientation feedback and motion compensation while navigating in 3D A system for navigating to and interacting with a region of interest during a respiratory cycle is provided. The system includes an extended working channel, a computing device including a memory and at least one processor, a plurality of images stored in the memory, a display device that displays a user interface. The user interface includes at least one image of the plurality of images depicting the region of interest and a progression of the extended working channel through the airway, and a probability diagnostic and/or treatment zone defining a probable distribution of a trajectory of the tool once deployed beyond an opening of the extended working channel displayed in the at least one image. The respiratory cycle is divided into inhalation and exhalation. The user interface is configured to depict movement of the region of interest and the airways during the respiratory cycle.
US10881465B2	Systems and methods for assessing organ and/or tissue transplantation by simulating one or more transplant characteristics Systems and methods are disclosed for assessing organ and/or tissue transplantation by estimating blood flow through a virtual transplant model by receiving a patient-specific anatomical model of the intended transplant recipient; receiving a patient-specific anatomical model of the intended transplant donor, the model including the vasculature of the organ or tissue that is intended to be transplanted to the recipient; constructing a unified model of the connected system post transplantation, the connected system including the transplanted organ or tissue from the intended transplant donor and the vascular system of the intended transplant recipient; receiving one or more blood flow characteristics of the connected system; assessing the suitability for an actual organ or tissue transplantation using the received blood flow characteristics; and outputting the assessment into an electronic storage medium or display.
US10881464B2	Lower extremities leg length calculation method A method of calculating leg length discrepancy of a patient including: receiving patient bone data associated with a lower body of the patient; identifying anatomical landmarks in the patient bone data; orienting a first proximal landmark and a second proximal landmark relative to each other and an origin in a coordinate system; aligning a first axis associated with a first femur and a second axis associated with a second femur with a longitudinal axis extending in a distal-proximal direction, wherein the first and second distal landmarks are adjusted according to the alignment of the first and second axes; calculating a distance between the first and second distal landmarks in the distal-proximal direction along the longitudinal axis; and displaying at least one of the distance or a portion of the patient bone data on a display screen.
US10881461B2	Method of analyzing hollow anatomical structures for percutaneous implantation A method of analyzing a hollow anatomical structure of interest for percutaneous implantation. The method comprises acquiring image data of an anatomical region of interest that includes the anatomical structure of interest, and generating a segmented model of the anatomical region of interest using the acquired image data. The method further comprises obtaining image(s) of the anatomical structure of interest by sectioning out intervening anatomical structures from the segmented model thereof, identifying one or more pertinent landmarks of the anatomical structure of interest in the acquired image(s), and measuring at least one of a circumference, a maximal diameter, or a minimal diameter of one or more features of the anatomical structure of interest contained in the acquired image(s) to determine an anatomical structure size. The method still further comprises reconciling the anatomical structure size and an implant size.
US10881458B2	Peri-vascular tissue ablation catheters An intravascular catheter for peri-vascular and/or peri-urethral tissue ablation includes multiple needles advanced through supported guide tubes which expand around a central axis to engage the interior surface of the wall of the renal artery or other vessel of a human body allowing the injection an ablative fluid for ablating tissue, and/or nerve fibers in the outer layer or deep to the outer layer of the vessel, or in prostatic tissue. The system may also include a means to limit and/or adjust the depth of penetration of the ablative fluid into and beyond the tissue of the vessel wall. The catheter may also include structures which provide radial and/or lateral support to the guide tubes so that the guide tubes expand uniformly and maintain their position against the interior surface of the vessel wall as the sharpened injection needles are advanced to penetrate into the vessel wall. A method can involve injection/infusion of the ablative fluid over an extended time period of at least 10 seconds or with two injections at two different penetration depths to reduce or eliminate patient pain during ablation.
US10881457B2	Irrigated ablation catheter having irrigation ports with reduced hydraulic resistance An irrigated ablation catheter includes a tip electrode with a thin shell and a plug to provide a plenum chamber. The tip electrode has an inlet of a predetermined size and noncircular shape, and outlets in the form of fluid ports formed in the thin shell wall. The plurality of the fluid ports is predetermined, as is their diameter. Each fluid port has a tapered configuration, for example, a frustoconical configuration, with a smaller inlet diameter and a larger outlet diameter.
US10881456B2	Systems and methods of performing medical procedures A medical method is provided, including a medical device having a distal assembly including at least one electrode and at least one treatment element, the medical device generating information regarding at least one of a physiological measurement and an operational parameter of the medical device; a plurality of surface electrodes affixable to a skin of the patient, wherein the surface electrodes are in electrical communication with the distal assembly to obtain position information of the medical device; and a processor pairing the position information and the at least one of a physiological measurement and an operational parameter of the medical device.
US10881451B2	Lead screw assembly for articulation control in surgical instrument An apparatus includes a body, a shaft assembly, an articulation section, an end effector, an articulation connector, and an articulation drive assembly. The shaft assembly extends distally from the body. The end effector is connected to the articulation section such that the end effector is configured to deflect relative to the longitudinal axis of the shaft assembly. The articulation connector is configured to translate relative to the shaft assembly to deflect the end effector relative to the longitudinal axis. The articulation drive assembly is configured to translate the articulation connector relative to the shaft assembly. The articulation drive assembly includes a rotatable housing and a first lead screw assembly. The first lead screw assembly includes a first half and a second half. The first lead screw assembly is slidably coupled with the shaft assembly and is configured to translate in response to rotation of the rotatable housing.
US10881449B2	Multi-function bi-polar forceps An end effector is disclosed. The end effector includes a first jaw member. The first jaw member comprises a first electrode. The first jaw member defines a first aperture at a distal end. The end effector includes a second jaw member. The second jaw member comprises a second electrode. The second jaw member defines a second aperture at a distal end. The second jaw member is operatively coupled to the first jaw member. The first and second apertures are configured to define a single aperture when the first and second jaw members are in a closed position. The first and second electrodes are configured to deliver energy.
US10881447B2	Multi-electrode electrical pulse delivery system for treatment of biological tissues Systems and methods for treating or manipulating biological tissues are provided. In the systems and methods, a biological tissue is placed in contact with an array of electrodes. Electrical pulses are then applied between a bias voltage bus and a reference voltage bus of a distributor having switching elements associated with each of the electrodes. The switching elements provide a first contact position for coupling electrodes to bias voltage bus, a second contact position for coupling electrodes to the reference voltage bus, and a third contact position for isolating electrodes from the high and reference voltage buses. The switching elements are operated over various time intervals to provide the first contact position for first electrodes, a second contact position for second electrodes adjacent to the first electrodes, and a third contact position for a remainder of the electrodes adjacent to the first and second electrodes.
US10881444B2	Electrosurgical apparatus with retractable blade An electrosurgical apparatus with a retractable blade for use in cold plasma applications, electrosurgical cutting and mechanical cutting is provided. The electrosurgical apparatus employs a tip of the retractable blade as a sharp conductive point to generate a plasma beam or discharge. When the blade is retracted within the electrosurgical apparatus, it is electrically energized while an inert gas flows over it, producing a cold plasma discharge. In the de-energized state, the blade is advanced and used as a traditional, mechanical surgical blade.
US10881441B2	Methods and apparatus for deploying sheet-like materials Implant delivery systems for delivering sheet-like implants include a delivery shaft, an implant expander, a sheath, and a sheet-like implant. In some embodiments, the delivery shaft has a proximal end and a distal end. The implant expander is mounted to the distal end of the delivery shaft. The implant expander includes a central portion and a plurality of leg portions radiating from the central portion. The implant expander is evertable between an unstressed configuration in which a distal surface of the implant expander defines a concave surface, and a first compact configuration in which the distal surface of the implant expander defines a convex surface. The implant expander has a first lateral extent when the implant expander is free to assume the unstressed configuration. The sheath defines a lumen having a lumen diameter. At least a portion of the delivery shaft is slidably disposed in the lumen. The lumen diameter is smaller than the first lateral extent of the implant expander so that the sheath holds the implant expander in the first compact configuration when slidably disposed therein. The sheet-like implant overlays at least a portion of the distal surface of the implant expander with portions of the sheet-like implant extending between the leg portions of the implant expander and the sheath. Methods of treating a rotator cuff of a shoulder are also disclosed.
US10881436B2	Implant with intramedullary portion and offset extramedullary portion An implant comprises a unitary body including an intramedullary portion connected to an extramedullary portion. The unitary body is configured to attach a first bone section to a second bone section. The intramedullary portion has a first longitudinal axis, and is configured for insertion into the first bone section. The intramedullary portion includes at least one first fastener aperture having an aperture axis oriented obliquely relative to the first longitudinal axis. The extramedullary portion is configured to abut a surface of the second bone section and includes at least one second fastener aperture disposed to transversely receive a bone fastener inserted in the second bone section. The extramedullary portion has a second longitudinal axis offset from, the first longitudinal axis.
US10881435B2	Polyaxial pedicle screw The invention relates to a polyaxial pedicle screw (2) comprising a screw anchor (4), which has a threaded shaft (6) and a head (8), and comprising a fork head (10), which is U-shaped in side view and has a receiving opening (16) for a corrective element, in particular a correcting rod, and two arms (12), wherein the head is polyaxially pivotably mounted in a distal end region (14) of the fork head and the fork head can be fixed in a pivoted position intended by the surgeon relative to the head, and also comprising a pressure piece (18) which can be arranged in the fork between the head and the corrective element which, on the one hand, rests on the head and, on the other hand, can be loaded by the corrective element, wherein the region of one arm of the fork head the pressure piece is supported by means of a pivot bearing (54) against this arm in the axial direction (20), and that diametrically opposite the pressure piece has a receiving region (42) for a positioning force (44) acting in the axial direction, which attempts to the pivot the pressure piece in the distal direction relative to the pivot bearing and in this way exerts the temporarily acting force in the direction of the head (8).
US10881431B2	Hair implanter with automatically retracting needle The present disclosure relates to a hair implanter with an automatically retracting needle, and more specifically, to a hair implanter with an automatically retracting needle configured to automatically move a needle backward by a force of a spring when the needle is moved forward to a predetermined position to allow hair transplantation work to be smoothly performed.
US10881427B2	Surgical cutting instrument A surgical cutting instrument including a first tubular member, a second tubular member, a sleeve member, a third tubular member, and an orientation member. The first tubular member includes a cutting tip. The second tubular member has a distal region forming a cutting window. The first tubular member is co-axially disposed within the second tubular member such that the cutting tip is selectively exposed at the cutting window. The first and second tubular members are co-axially disposed within the sleeve member. The third tubular member is co-axially disposed around an intermediate section of the first tubular member, an intermediate region of the second tubular member and the sleeve member. The orientation member is rotatable to transmit a rotational force applied to the orientation member to selectively rotate the second and third tubular members relative to the sleeve member to effectuate spatial rotation of the cutting window.
US10881424B2	Removable fluid reservoir and ultrasonic surgical instrument including the same A fluid reservoir includes a housing having a body, a leading end, and a trailing end enclosing a fluid chamber storing fluid therein, sealed inflow and outflow ports disposed at the leading end of the housing, and a heat exchanger disposed at the trailing end of the housing. An ultrasonic surgical instrument includes a housing defining a barrel portion and a fixed handle portion extending from the barrel portion, an ultrasonic transducer received at least partially within the barrel portion of the housing, a waveguide operably coupled to the ultrasonic transducer and extending distally from the housing to a blade configured to treat tissue with ultrasonic energy produced by the ultrasonic transducer and transmitted along the waveguide, and a fluid management system disposed within the housing. The fluid reservoir is configured for releasable engagement with the fixed handle portion to facilitate cooling of the blade with fluid.
US10881423B2	Surgical morcellator Embodiments described a shield for a surgical morcellator. Specifically, embodiments disclose a denticulate shield for the distal tip of a surgical morcellator with notches, wherein the notches are configured to catch loose morcellated tissue and prevent the loose morcellated tissue from being falling or remaining into the patient.
US10881416B2	Patient specific instrumentation (PSI) for orthopedic surgery The patient specific instrument (PSI) assembly for guiding a surgical tool on a tibia during a knee replacement surgery includes an extra-medullary portion at a distal end, an elongated rod connected at a distal end to the extra-medullary portion and extending in a direction along a mechanical axis of the tibia, and an upper mounting portion at a proximal end. The extra-medullary portion has a pair of spaced apart malleoli clamping elements with a size and/or relative position that is patient-specific for engaging respective ones of the lateral and medial malleoli. The upper mounting portion including a base body connected to a proximal end of the elongated rod and a surgical guide having guide openings extending therethrough and anchor element(s) on the upper mounting portion in locations adapted to overlay a peripheral contour of the tibia. The peripheral contour of the tibia including an anterior surface of the proximal tibia.
US10881414B2	Anti-migration surgical ligation clip The present disclosure provides a surgical clip for ligating a blood vessel or tissue structure. The surgical clip includes a first leg member including a first inner surface and a first plurality of protrusions disposed on the first inner surfaces. The surgical clip also includes a second leg member including a second inner surface and a second plurality of protrusions disposed on the second inner surface. The surgical clip further includes a hinge member joining the first leg member and the second leg member. The at least one of the first and second plurality of protrusions includes a gable structure that extends along a longitudinal direction of the first or second inner surface. The orientation and the geometric shape of the protrusions of the surgical clip allow for increased resistance to the migration or sliding of the clip along a longitudinal direction of the blood vessel or tissue structure, while providing a balanced closure force. The surgical clip can prevent the longitudinal migration along the blood vessel or tissue structure.
US10881412B2	Method and system for balloon counterpulsation during aortic valve replacement Methods and systems for regulating aortic regurgitation during aortic valve replacement or repair procedures utilize a temporary aortic valve (TAV) catheter and a controller. The temporary aortic valve catheter has an expandable occlusion device which can partially occlude the aortic lumen during ventricular diastole with a lesser occlusion during ventricular systole. Exemplary balloon structures include multiple, independently inflatable balloons which are inflated in synchrony with the cardiac cycle by the controller. By controlling aortic regurgitation, the repair or replacement protocols can be conducted with less interference from blood flow.
US10881403B2	Endocutter control system Surgical stapling systems and methods for stapling tissue during a surgical procedure are provided. In an exemplary embodiment, a control system is provided for controlling at least one motor coupled to a drive system on a surgical stapling device for driving one or more drive assemblies. The control system can be configured to communicate with the drive system of the stapling tool and to control and modify movement of one or more drive assemblies based on certain feedback.
US10881402B2	Surgical end effector adjunct attachment Various embodiments of a frame for attaching an adjunct to an end effector of a surgical device are provided. In one embodiment, the end effector can include upper and lower jaws, and the frame can include features for releasably engaging one or the jaws. The frame can also include retaining features for coupling an adjunct to a tissue-facing surface of the frame, thereby releasably coupling the adjunct material to the jaw of the end effector. In some implementations, the frame can include a plurality of retaining features that are configured to engage the adjunct material to create a tension in the adjunct material, which can further assist with securing the frame to the jaw. In other embodiments, a removable applicator member is provided for retaining at least one adjunct material and for aligning and coupling the adjunct material to a frame.
US10881401B2	Staple firing member comprising a missing cartridge and/or spent cartridge lockout Surgical stapling instruments are disclosed comprising missing staple cartridge and/or spent cartridge lockouts. In various instances, such lockouts are positioned in a shaft of the surgical stapling instruments.
US10881396B2	Surgical instrument with variable duration trigger arrangement A motorized surgical instrument is disclosed. The surgical instrument includes a displacement member, a motor coupled to displacement member, a control circuit coupled to the motor, a parameter sensor coupled to the control circuit and a position sensor coupled to the control circuit. The control circuit is configured to receive a parameter output of the parameter sensor indicative of a force applied to translate the displacement member, determine a duration during which the parameter output is maintained at or above a predetermined fault threshold, receive a position output of the position sensor indicative of at least one position of the displacement member during the duration, and effect a motor control action based on the duration and the at least one position.
US10881391B2	Sealing pack assembly for use with endoscopic stitching device An endoscopic stitching device includes an elongate shaft assembly, a tool assembly coupled with the elongate shaft assembly, and a sealing pack disposed in the elongate shaft assembly. The sealing pack defines a central lumen configured to receive an axial rod therethrough, and first and second lumens dimensioned to receive respective first and second needle receiving blades therethrough. The sealing pack includes a body portion, a plurality of outer lips extending outwardly from the body portion, and a plurality of inner lips extending inwardly from the central lumen. Each outer lip of the plurality of outer lips is configured to engage the elongate shaft assembly in a sealing relation. Each inner lip of the plurality of inner lips is configured to engage the axial rod in a sealing relation.
US10881390B2	Fastener for holding a constricting cord in a reduced-diameter state around a cardiac valve annulus, and installation of the fastener A cord that has been previously affixed around an annulus can be fastened using a sliding member that locks into a housing. Before those two parts are locked together, the cord is free to slide through a channel in the sliding member, and a shear pin prevents the sliding member from moving. After those two parts are locked together, portions of the cord are squeezed between the upper surface of the sliding member and one wall of the housing, and other portions of the cord are squeezed between the lower surface of the sliding member and another wall of the housing, so that the cord can no longer slide. After locking, a sliding cutting element can be actuated to cut off portions of the cord that are proximal with respect to the two locked parts.
US10881374B2	Mammography imaging arrangement for tomosynthesis The invention relates to a tomosynthesis process in the context of mammography, in which several individual images of a breast are taken at different projection angles and in which of information thus acquired, tomographic images are synthesized with the help of an applicable image processing software. The mutual geometry of the imaging means of the imaging apparatus when taking these individual images is determined according to the invention by arranging in the imaging apparatus a calibration structure (20), which includes balls (21) or other small objects absorbing X-radiation which are such placed that their projections will become imaged on said individual images.
US10881371B2	System and method for imaging a subject A method and system is disclosed for acquiring image data of a subject. The image data can be collected with an imaging system in a selected manner and/or motion. More than one projection may be combined to generate and create a selected view of the subject.

1 2 3 4 5 6 7 8 9 10