| Document | Document Title |
|---|---|
| US09360846B2 |
Servomotor control systems and methods
Systems and methods for controlling servomotors are described herein. Servomotor controllers and related control circuitry are configured to generate control signals for controlling the servomotor. The control signals include directional control signals to control the rotational direction and position of the servomotor, and power control signals control the rotational speed and/or torque of the servomotor. |
| US09360842B2 |
Mechanism for selecting and actuating functions of a clockwork movement
The present application relates to a mechanism for selecting and actuating n functions of a clock movement, where n is an integer no lower than 1, preferably no lower than 2, more preferably no lower than 3, including a winding mechanism rod ending in a crown, a device for actuating a function, said device being kinematically connected to the crown and arranged such as to move and assume n selection positions and n actuation positions in which the actuation device is kinematically connected to an actuation member of the selected function, and a selecting device arranged such as to move the actuation device into a selection position. Said mechanism further includes a base onto which the actuation device is moveably mounted such as to be moved and positioned, by the selecting device, into a selection position facing the actuation member of the selected function, and such as to be moved, by an axial movement of the winding mechanism rod, into the actuation position thereof in order to engage with said actuation member of the selected function. |
| US09360841B1 |
Watch with a time-setting bezel and shaft connection
A watch with a time-setting bezel includes a watch face containing a time-telling mechanism including at least one hand, the watch face enclosed in a casing, a rotatable bezel mounted on an annular shoulder of the casing, the rotatable bezel having an axis of rotation substantially perpendicular to the watch face, the rotatable bezel having a cylindrical gear element fixed to the rotatable bezel and projecting into the casing, anda shaft having an axis of rotation substantially orthogonal to the axis of rotation of the rotatable bezel, the shaft mechanically coupled to the cylindrical gear so that the rotation of the bezel drives the rotation of the shaft. |
| US09360840B2 |
Complex spatial light modulator and 3D image display including the same
Provided are a complex spatial light modulator and a three-dimensional (3D) image display including the same. The complex spatial light modulator includes a spatial light modulator configured to modulate a phase of a light beam, a prism array disposed after the spatial light modulator and including an array of prism portions each having a first prism surface and a second prism surface, and a diffractive device configured to diffract a light beam that has passed through the prism array. Accordingly, both the phase and amplitude of the light beam may be modulated. |
| US09360839B2 |
Light-exposure unit and image formation apparatus
A light exposure unit includes: a board on which to mount light-emitting elements; an optical system configured to cause light emitted from the light-emitting elements to converge; a support member holding the board and the optical system; and a heat sink member configured to dissipate heat from the optical system. |
| US09360834B1 |
Replaceable unit for an electrophotographic image forming device having positioning features for electrical contacts
A replaceable unit for an electrophotographic image forming device according to one example embodiment includes an electrical contact positioned on a first side of a housing of the replaceable unit for contacting an electrical contact in the image forming device. A guide on the first side of the housing is positioned closer to a front of the housing than the electrical contact and leads rearward toward the electrical contact. The guide includes an inside surface that faces inward sideways toward a second side of the housing. At least a portion of the inside surface is angled inward sideways from front to rear permitting contact between the inside surface and an electrical connector in the image forming device to draw the electrical connector in the image forming device inward sideways relative to the replaceable unit during insertion of the replaceable unit into the image forming device. |
| US09360833B2 |
Charging member, process cartridge and electrophotographic apparatus
The present invention provides a charging member having an elastic layer on a surface thereof in which occurrence of compression set is reduced. The charging member includes an electro-conductive support and an elastic layer provided on the support as a surface layer, wherein the elastic layer is a rubber layer made of a crosslinked product of a rubber mixture including acrylonitrile butadiene rubber and polybutadiene, the polybutadiene includes 1,2-syndiotactic polybutadiene, and the elastic layer is formed by irradiating a surface of the rubber layer with electron rays. |
| US09360832B2 |
Electrophotographic image forming apparatus
An image forming apparatus includes a developing cartridge with a developing roller for developing a latent image and a development coupling for receiving a driving force from a main assembly coupling for rotating the developing roller. The apparatus also includes a contacting and spacing member provided on a drum supporting frame, with the contacting and spacing member being movable between a first position for contacting the developing roller to a photosensitive drum and a second position for spacing the developing roller from the photosensitive drum. The developing cartridge is provided with a projection that the contacting and spacing member contacts, and the projection projects in a longitudinal direction of the developing roller. |
| US09360831B2 |
Developing unit, process cartridge and image forming apparatus
A developing unit includes: a frame; a flexible container, provided inside the frame, for accommodating a developer, wherein the flexible container includes an opening for permitting discharge of the developer; an urging member, provided inside the frame, for urging the flexible container to deform the flexible container; and a developer carrying member for carrying the developer discharged from the opening of the flexible container. The flexible container includes a projected portion projecting toward an outside of the flexible container. The projected portion is moved depending on deformation of the flexible container, by urging of the flexible container, to stir the developer discharged from the opening. |
| US09360830B1 |
Image forming apparatus having a support unit to move a light element of the image forming apparatus
An image forming apparatus includes a light emitting element unit disposed at an operating position closely opposed to a photoconductor in a printing operation and having a light emitting element that forms an image on the photoconductor, a support unit mounted in the image forming apparatus to support the light emitting element unit, and an elastic member disposed between the light emitting element unit and the support unit. In a state in which the light emitting element unit is disposed at the operating position, the support unit supports the light emitting element unit with the elastic member being disposed therebetween. |
| US09360829B2 |
Image processing apparatus including two portions for receiving discharged sheet
In an image processing apparatus, a control device controls a releasing member to release a release object onto a sheet to perform an image processing; controls a first rotating body to rotate to convey the sheet on which the releasing member has released the release object; controls a second rotating body to rotate to convey the sheet whose leading edge has passed through the first rotating body; determines whether a cover is in an open position or a close position relative to a housing of the image processing apparatus based on a signal outputted by a cover sensor; and restricts, when the cover is determined to be in the open position based on the signal, a rotation of the second rotating body while the first rotating body rotates. |
| US09360823B2 |
Image forming apparatus having communication board for near field communication
An image forming apparatus includes: an image forming unit; a housing configured to store the image forming unit, the housing including an outer peripheral wall; a power supply unit disposed inside the housing; and a near field communication board including an antenna for near field communication, the near field communication board being disposed at a position of the outer peripheral wall apart from the power supply unit by a communicable distance or more. |
| US09360821B2 |
Image forming apparatus
According to an embodiment, there is provided an image forming apparatus that forms a color image using a plurality of discolorable coloring materials and a plurality of non-discolorable coloring materials. In a case where insufficiency of at least one coloring material from among the plurality of discolorable coloring materials and the plurality of non-discolorable coloring materials is detected, the image forming apparatus performs color image formation using the plurality of discolorable coloring materials and the plurality of non-discolorable coloring material in combination. |
| US09360814B2 |
Printed board and image forming apparatus
The printed board includes a slit portion and a first conductive member that is provided straddling the slit portion. In a state in which the printed board is attached to an apparatus to which one end of a second conductive member having an elastic force is connected, another end of the second conductive member contacts the first conductive member, and the another end of the second conductive member passes through the slit portion. |
| US09360811B2 |
Image fixing device and image forming apparatus having the same
An image fixing device includes a heat source configured to generate heat, a fixing belt heated by the heat source and disposed to be rotatable, a rotational member disposed to be opposite to the fixing belt and to press a printing medium to the fixing belt, and a supporting member to support an inner circumferential surface of the fixing belt so as to form a fixing nip between the fixing belt and the rotational member and having a plurality of heat insulation grooves formed in a surface thereof so as to reduce thermal conductivity of the supporting member. By the configuration of the present general inventive concept, it is possible to prevent or minimize a heat loss of the fixing belt and thus to enhance image forming efficiency. |
| US09360810B2 |
Fixing device and fixing temperature control method of fixing device
According to one embodiment, a fixing device includes determination means for determining the size of a medium, heating means for including plural heat-generating members which are two-dimensionally arranged such that the heat-generating members are lined up along two parallel lines or more which are vertical to a transport direction of the medium and divided at locations on the parallel lines, and are disposed so as to come into contact with an inner side of the rotating body, and a switching unit which switches individual conduction, and heats the medium, pressing means for forming a nip by performing pressing and contact at a position of the plural heat-generating members, and heating control means for selecting a group of the heat-generating members which are lined up in the two-dimensional arrangement, conducting the selected group of the heat-generating members, and controlling the heating means. |
| US09360809B2 |
Image forming apparatus
An image forming apparatus includes: a sheet conveyance section configured to convey a long sheet; a toner image forming section configured to form a toner image on the long sheet conveyed by the sheet conveyance section; a fixing section configured to fix the toner image formed by the toner image forming section on the long sheet; and an information presenting section configured to display information relating to sheet conveyance, the information relating to sheet conveyance including waste sheet information indicating a conveyance amount of the long sheet conveyed by the sheet conveyance section during a non-image formation period. |
| US09360806B2 |
Image forming apparatus
An image forming apparatus is provided. The image forming apparatus includes a chassis having an opening, a cover, photosensitive members, an intermediate transfer belt, a primary-transfer member, a secondary-transfer roller, a cleaner device, a waste toner container, which is movable along a predetermined direction to be removably installed in the chassis through the opening and stores residual toner, a connector, and a feed roller, which is arranged within the feeding path to feed the recording sheet in the feeding path. The feed roller is arranged in a position to at least partially fall within a vertical range of the waste toner container and to be aligned with the waste toner container along an axial direction of the second feed roller. |
| US09360802B2 |
Image forming apparatus
An image forming apparatus includes an image forming device that forms an image on a recording medium with a powdery material, the image being sized so as to extend beyond an edge of the recording medium; a collecting device that collects the material that has extended off the recording medium as a result of the image forming device forming the image; and a restricting unit that controls the image forming device in such a manner that the image forming device reduces an amount of use of the material in a region of the image that extends off the recording medium to a larger degree on an outer side of the image than a side of the image near the recording medium. |
| US09360798B2 |
Developer replenishing apparatus and image forming apparatus with rotational velocity control
A replenishing apparatus includes a rotatable cylindrical-shaped container having a discharge opening through which toner is discharged, and a guide member provided rotatably with the container. The guide member has a first face on an inner face of the container and a second face which guides the toner scooped by the first face toward the discharge opening. A controller controls a drive portion to rotate the container in a first mode that performs replenishment control in a first drive condition and in a second mode that performs replenishment control in a second drive condition in which a quantity of rotation of the container per unit time is less than the first drive condition. The controller switches the mode from the first mode to the second mode based on a detection result about a quantity of developer. |
| US09360796B2 |
Angled toner paddles for a replaceable unit of an image forming device
A replaceable unit for an electrophotographic image forming device according to one embodiment includes a housing having a reservoir for storing toner and an outlet for exiting toner from the housing. A channel in fluid communication with the outlet has an inlet positioned between the first end and the second end of the reservoir. A rotatable auger is positioned along the channel. Paddles extend from a rotatable shaft in the reservoir. A first set of one or more paddles are positioned between a first end of the reservoir and the inlet of the channel and a second set of one or more paddles are positioned between a second end of the reservoir and the inlet of the channel. The first and second sets of paddles are angled to direct toner away from the first end and the second end of the reservoir, respectively, and toward the inlet of the channel. |
| US09360793B2 |
Developing cartridge and process cartridge
A developing cartridge includes a developing roller with a shaft, a housing with a wall portion, a developing electrode, a first contact portion, a second contact portion, and a connecting portion. The developing electrode includes a first contact portion contacting the shaft and has a first surface against which an apparatus electrode of an image forming apparatus body slides, a second contact portion disposed next to the first contact portion, and a second surface configured to contact an electrode of the image forming apparatus. The connecting portion includes a first inclined surface connecting the first surface and the second surface with each other and being contiguous with the first surface. The first inclined surface is inclined toward the second contact portion from the first contact portion such that the first inclined surface extends in a direction away from the wall portion. |
| US09360791B2 |
Image forming apparatus using a clock signal generated by a spread spectrum clock oscillator, and a controlling method thereof
An image forming apparatus outputs a clock signal used for outputting image data, outputs first image data in accordance with the outputted clock signal, outputs second image data in accordance with a clock signal for which the output clock signal is caused to change by a spread spectrum clock oscillator circuit, calculates a logical OR of the two outputs, and outputs image data, which is the calculation result, to an image forming unit. A laser device provided in the image forming unit is controlled in accordance with the outputted image data. |
| US09360785B2 |
Toner for electrostatic image development, two-component developer, and image formation process
Disclosed are a toner for electrostatic image development and an image formation process using the same which can achieve high varnish application property and high adhesion of a heat-fixed image to a varnish layer even when the varnish layer is formed on the fixed image formed by an image formation process of an electrophotographic system.The toner for electrostatic image development includes toner particles containing at least a binder resin, a colorant and a parting agent, and the binder resin contains a polyfunctional acrylate-modified polyester resin obtained by modification with a polyfunctional acrylate compound. In the toner for electrostatic image development, it is preferable that the toner particles have a core-shell structure, in which the surface of a core particle is coated with a shell layer, and the polyfunctional acrylate-modified polyester resin is contained in the shell layer. |
| US09360783B2 |
Toner for electrostatic image development
The toner includes: a second amorphous polyester resin including a structural unit represented by any of the following general formulas (1) to (3); and a first amorphous polyester resin including no structural units represented by the general formulas (1) to (3). R1, R2, R5, R9 and R10 are each independently an alkyl group having 4 to 15 carbon atoms or an alkenyl group having 4 to 15 carbon atoms, R3, R4, R7, R8 and R11 are each independently an alkylene group having 4 to 14 carbon atoms or an alkenylene group having 4 to 14 carbon atoms, R6 is a saturated or unsaturated divalent aliphatic hydrocarbon group having 4 to 15 carbon atoms, and R12 is a saturated or unsaturated trivalent aliphatic hydrocarbon group having 4 to 14 carbon atoms, and X is an aromatic ring, a carbocyclic ring or a group represented by the following formula (A). |
| US09360780B2 |
Toner, two-component developer, toner set, toner container, printed matter, image forming apparatus, and image forming method
To provide a toner, containing: a noncrystalline resin; and a crystalline resin, wherein the crystalline resin has a weight average molecular weight of 100,000 to 180,000, wherein a temperature range of the toner, within which a loss tangent (tan δ) as measured by a dynamic viscoelasticity measurement is 6 or greater, is 20° C. or greater, and wherein a fixed toner image has 60° glossiness of 30 to 50, where the fixed toner image is obtained by forming an unfixed toner image having a deposition amount of 0.4 mg/cm2 on a recording medium having 60° glossiness of 30 for a measurement, and fixing at temperature at which temperature of the toner image is a lowest temperature of the temperature range +10° C., at 0.15 MPa, for a nipping duration of 50 msec. |
| US09360778B2 |
System and method for lithography patterning
Disclosed is a lithography system. The lithography system includes a lithography exposure tool designed for performing an exposure process to a radiation-sensitive material layer coated on an integrated circuit substrate; an alignment module coupled with the lithography exposure tool, designed for alignment measurement, and configured for transferring the integrated circuit substrate to the lithography exposure tool; and an alignment calibration module designed to calibrate the alignment module relative to the lithography exposure. |
| US09360777B2 |
Apparatus and method for alignment processing
The present invention employs a plurality of photomasks each having first and second apertures of which widths are set so that adjacent end regions of the adjacent first and second alignment regions overlap with each other with an overlapping dimension approximately equal to a tracking accuracy of an alignment device. The photomasks are arranged alternately in a direction intersecting the scanning direction of the substrate so that the first and the second apertures are arranged at a constant pitch. In this state, two polarized lights, that are different in at least one of polarization direction and incident angle to a substrate, are made to be incident into the first and the second apertures, respectively, to irradiate an alignment film on the substrate with the two lights that have passed through the first and the second apertures, respectively, to form the first and the second alignment regions adjacently to each other. |
| US09360775B2 |
Method of manufacturing a projection objective and projection objective
The disclosure relates to a method of manufacturing a projection objective, and a projection objective, such as a projection objective configured to be used in a microlithographic process. The method can include defining an initial design for the projection objective and optimizing the design using a merit function. The method can be used in the manufacturing of projection objectives which may be used in a microlithographic process of manufacturing miniaturized devices. |
| US09360772B2 |
Carrier method, exposure method, carrier system and exposure apparatus, and device manufacturing method
A carrier system equipped with a fine movement stage holding a mounted wafer and can move along a predetermined plane, a chuck main section which holds the wafer above a predetermined position and can move vertically, and vertical movement pins supporting the wafer held by the chuck main section on the fine movement stage from below when the fine movement stage is positioned at the predetermined position and are vertically movable. A controller drives the chuck main section and the vertical movement pins downward until a lower surface of the wafer comes into contact with the fine movement stage while maintaining a hold state by the chuck main section to the wafer and a support state by the vertical movement pins to the wafer, and when the lower surface of the wafer comes into contact with the fine movement stage, the hold state and the support state are released. |
| US09360767B2 |
Method and apparatus for maintaining depth of focus
A method includes directing a beam of radiation along an optical axis toward a workpiece support, measuring a spectrum of the beam at a first time to obtain a first profile, measuring the spectrum of the beam at a second time to obtain a second profile, determining a spectral difference between the two profiles, and adjusting a position of the workpiece support along the optical axis based on the difference. A different aspect involves an apparatus having a workpiece support, beam directing structure that directs a beam of radiation along an optical axis toward the workpiece support, spectrum measuring structure that measures a spectrum of the beam at first and second times to obtain respective first and second profiles, processing structure that determines a difference between the two profiles, and support adjusting structure that adjusts a position of the workpiece support along the optical axis based on the difference. |
| US09360766B2 |
Method and system for lithography process-window-maximixing optical proximity correction
The present invention relates to an efficient OPC method of increasing imaging performance of a lithographic process utilized to image a target design having a plurality of features. The method includes the steps of determining a function for generating a simulated image, where the function accounts for process variations associated with the lithographic process; and optimizing target gray level for each evaluation point in each OPC iteration based on this function. In one given embodiment, the function is approximated as a polynomial function of focus and exposure, R(ε, f )=P0+f2·Pb with a threshold of T+Vε for contours, where P0 represents image intensity at nominal focus, f represents the defocus value relative to the nominal focus, ε represents the exposure change, V represents the scaling of exposure change, and parameter “Pb” represents second order derivative images. In another given embodiment, the analytical optimal gray level is given for best focus with the assumption that the probability distribution of focus and exposure variation is Gaussian. |
| US09360765B2 |
Lithographic apparatus and device manufacturing method
A lithographic projection apparatus includes a support structure configured to hold a patterning device, the patterning device configured to pattern a beam of radiation according to a desired pattern; a substrate table configured to hold a substrate; a projection system configured to project the patterned beam onto a target portion of the substrate; a liquid supply system configured to provide liquid to a space between the projection system and the substrate; and a shutter configured to isolate the space from the substrate or a space to be occupied by a substrate. |
| US09360764B2 |
Exposure apparatus and device manufacturing method
An exposure apparatus includes a measuring member disposed in a substrate stage for holding the substrate, at a side of a surface holding the substrate of a substrate stage, an auxiliary member disposed at a side of the surface of the substrate stage, with a gap with the measuring member, and a sealing member contacting a surface of the auxiliary member, disposed to cover the gap, and for suppressing penetration of the liquid locating on a surface of the measuring member, or the surface of the auxiliary member into the gap, and wherein the sealing member has a shape forming a space where a part of the surface of the measuring member contacts gas, while the liquid is on the surface of the measuring member and the liquid contacts an edge of the sealing member. |
| US09360763B2 |
Projection optical system, exposure apparatus, and exposure method
An immersion projection optical system having, for example, a catadioptric and off-axis structure, reduces the portion of an image space filled with liquid (immersion liquid). The projection optical system, which projects a reduced image of a first plane onto a second plane through the liquid, includes a refractive optical element (Lp) arranged nearest to the second plane. The refractive optical element includes a light emitting surface (Lpb) shaped to be substantially symmetric with respect to two axial directions (XY-axes) perpendicular to each other on the second plane. The light emitting surface has a central axis (Lpba) that substantially coincides with a central axis (40a) of a circle (40) corresponding to a circumference of a light entering surface (Lpa) of the refractive optical element. The central axis of the light emitting surface is decentered in one of the two axial directions (Y-axis) from an optical axis (AX). |
| US09360762B2 |
Illumination system, lithographic apparatus and method
An illumination system comprising an array of controllable mirrors configured to direct radiation towards a pupil plane and an array of lenses configured to direct radiation sub-beams towards the array of controllable mirrors, wherein a first lens of the array of lenses and a controllable mirror of the array of controllable mirrors forms a first optical channel having a first optical power and a second lens of the array of lenses and a controllable mirror of the array of controllable mirrors forms a second optical channel having a second optical power, such that a radiation sub-beam formed by the first optical channel has a first cross-sectional area and shape at the pupil plane and a radiation sub-beam formed by the second optical channel has a second different cross-sectional area and/or shape at the pupil plane. |
| US09360756B2 |
Composition for forming fine resist pattern and pattern formation method using same
The present invention provides a fine pattern-forming composition enabling to form a resist pattern having high dry etching resistance, and also provides a pattern formation method using that composition. This formation method hardly causes pipe blockages in the production process. The composition is used for miniaturizing a resist pattern by fattening in a process of forming a negative resist pattern from a chemically amplified resist composition, and comprises a polymer containing a repeating unit having a hydroxyaryl group and an organic solvent not dissolving the negative resist pattern. In the formation method, the fine pattern-forming composition and the resist composition are individually cast with the same coating apparatus, so as to prevent pipe blockages. |
| US09360753B2 |
Resist composition and patterning process
A resist composition is provided comprising a (co)polymer comprising recurring units of acid labile group-substituted (meth)acrylic acid, styrenecarboxylic acid or vinylnaphthalenecarboxylic acid and/or recurring units having an acid labile group-substituted phenolic hydroxyl group, an acid generator, and a metal salt of carboxylic acid or a metal complex of β-diketone. Due to a high contrast of alkaline dissolution rate before and after exposure, high resolution, high sensitivity, and controlled acid diffusion rate, the composition forms a pattern with satisfactory profile and minimal LER. |
| US09360751B2 |
Imprinting stamp and nano-imprinting method using the same
An imprinting stamp and a nano-imprinting method using the imprinting stamp are provided. The imprinting stamp includes a first substrate; one or more field regions on the first substrate, the first substrate including nano-patterns; and a first dummy pattern region on the first substrate and adjacent to the field region, the dummy pattern region including first dummy patterns having greater dimensions than that of the nano-patterns, the first dummy patterns being a plurality of polygons, each of the polygons having a vertex pointing in a first direction proceeding from the field region toward the first dummy pattern region. |
| US09360750B2 |
Balancing mask loading
Among other things, techniques for balancing mask loading are provided for herein. In some embodiments, one or more windows are defined within a layout. Based upon polygons comprised within respective windows, a localized mask loading is computed for the layout. In some embodiments, a global mask loading is also computed for the layout. Using the localized mask loading and the global mask loading, if computed, a loading effect of a plurality of mask pattern schemes is evaluated to identify a mask pattern scheme having a desired loading effect. |
| US09360749B2 |
Pellicle structure and method for forming the same
A pellicle structure, a pellicle-mask structure, and a method for forming the pellicle structure are provided. The pellicle structure includes a pellicle film made of a carbon-based material. In addition, the pellicle film is configured to protect a mask structure in a lithography process. The pellicle-mask structure includes a mask substrate having a mask pattern formed over the mask substrate and the pellicle frame disposed on the mask substrate. The pellicle-mask structure further includes the pellicle film disposed on the pellicle frame. |
| US09360747B2 |
Transmission type screen
This is to provide a transmission type screen where a viewing angle at which an image projected by a projector can be visually recognized is extremely wide, and image visibility from the both surfaces of the screen is excellent.The present invention relates to a transmission type screen comprising a light transmissive support and a light diffusion layer on at least one surface of the light transmissive support, wherein the light diffusion layer contains light diffusion fine particles and a xerogel. It preferably relates to the above-mentioned transmission type screen wherein the xerogel contains inorganic fine particles and a resin binder, and the inorganic fine particles are particles dispersed in an aggregated form having an average primary particle diameter of 18 nm or less and an average secondary particle diameter of 500 nm or less. |
| US09360746B2 |
Underwater image projection system and method
Some embodiments include an underwater projection system having a water feature and an ambient light in communication with the underwater projection system. A projector is disposed within the water feature and is designed to project an image out of the water feature into a body of water. A controller is in communication with the projector and operates both the ambient light and the projector. |
| US09360742B1 |
Swivel camera mount
A swivel camera mount is configured to attach a camera to a mount base which, in turn, may be secured to sport equipment, musical instruments, vehicles, and the like. The swivel camera mount includes an inner rotating component that couples to a camera or camera housing and allows a user to rotate a camera within a horizontal plane. The inner rotating component is securely coupled within an outer sleeve component by a coupling mechanism that allows the swivel camera mount and a coupled camera or camera housing to couple to the mount base. Additionally, the outer sleeve component includes protrusions that allow the swivel mount component to pivot in one or more vertical planes. |
| US09360736B2 |
Camera module
A camera module may include: a frame having an opening formed therein; an auto-focusing unit mounted on the frame; and a position adjusting part formed in the auto-focusing unit. A distance from an optical axis to the position adjusting part may be smaller than a distance from the optical axis to the opening. |
| US09360735B2 |
Camera module
Disclosed herein is camera module including: a lens barrel; an auto-focusing actuator; and a handshake compensating actuator, wherein the auto-focusing actuator and the handshake compensating actuator include a common magnet for actuating auto-focusing and handshake compensation, an auto-focusing corner magnet, a coil for auto-focusing, and a coil for handshake compensation, one surface of the common magnet for actuating auto-focusing and handshake compensation and the auto-focusing corner magnet face the coil for auto-focusing and the other surface of the common magnet for actuating auto-focusing and handshake compensation faces the coil for handshake compensation. |
| US09360733B2 |
Color display device
The present invention provides a solution for a highlight or multicolor display device, in which each display cell can display high quality color states. More specifically, an electrophoretic fluid is provided which comprises three types of pigment particles, having different levels of size, threshold voltage or charge intensity. |
| US09360728B2 |
Liquid crystal display panel and method of manufacturing the same
A liquid crystal display panel is provided. The liquid crystal display panel includes a first substrate comprising a pixel area and a non-pixel area surrounding the pixel area, a thin-film transistor (TFT) disposed on the pixel area of the first substrate and a pixel electrode connected to the TFT, and a plurality of metal wirings disposed on the non-pixel area of the first substrate and one or more dummy patterns disposed adjacent to the metal wirings. The TFT includes a gate electrode, a source electrode, and a drain electrode, and the dummy patterns are formed of a same material as at least one of the gate source, the source electrode, and the drain electrode. |
| US09360725B2 |
Liquid-crystal display and element substrate thereof
An element substrate is provided, including a substrate, a metal layer and a planarization layer. The metal layer is located on the substrate. The metal layer has a first edge in a first direction. The planarization layer is located on the metal layer. The planarization layer includes a contact hole. The contact hole has a contiguous wall and a bottom side. The metal layer is exposed in the bottom side. A contour line of the contiguous wall on a vertical plane is a curved line. The first edge corresponds vertically with a critical point on the contour line. The slope of a tangent line on the critical point of the contour line is smaller than 0.176. |
| US09360720B2 |
Liquid crystal display device
A first semiconductor layer is formed in the shape of an island in an active area displaying images on an array substrate. A second semiconductor layer is formed in the shape of an island outside the active area. A first insulating film covers the first and second semiconductor layers. A gate line is formed on the first insulating film and extends in a first direction. The gate line includes a gate electrode crossing the first semiconductor layer and a crossing portion crossing the second semiconductor layer. A second insulating film covers the gate line. A source line is formed on the second insulating film and extends in a second direction. The source line includes a source electrode contacting with the first semiconductor layer. A drain electrode is formed on the second insulating film apart from the source line and contacting with the first semiconductor layer. |
| US09360718B2 |
Liquid crystal display panel
The present invention provides a liquid crystal display panel capable of preventing the occurrence of display unevenness in the perimeter of the display area in the FFS mode. The liquid crystal display panel of the present invention includes a pair of substrates; a sealing material; and a liquid crystal layer enclosed by the pair of substrates and the sealing material. One of the pair of substrates includes a pixel electrode provided with multiple slits, and a flat plate-shaped common electrode located on a different layer from the pixel electrode, with an insulating film between the pixel electrode and the common electrode; a non-display area includes a gate driver, multiple gate lead-out wires extending from the gate driver toward a display area, and a common lead-out wire electrically connected to the common electrode; the common lead-out wire intersects the multiple gate lead-out wires; and the common electrode covers an area between the common lead-out wire intersecting the multiple gate lead-out wires and a part of the perimeter of the display area along the common lead-out wire. |
| US09360714B2 |
Display device
The liquid crystal lens is formed by placing a TN type liquid crystal with a twist angle of 90 degrees between the first and second substrates. A first substrate having a flat surface with a slit is formed on the liquid crystal side of the first substrate, and a second electrode having a comb electrode, as seen in a plane view, is formed on the liquid crystal side of the second substrate. The slit formed in the first electrode extends in the same direction as the comb electrode of the second electrode, and the slit is located in the center between the comb electrodes of the second electrodes as seen in a plane view, to prevent the electric lines of force, moving from directly above the second electrode to the first electrode, from spreading in the plan direction, thereby preventing light leakage directly above the second electrode. |
| US09360706B2 |
Backlight module and corresponding liquid crystal display device
The present invention relates to a backlight module and a corresponding liquid crystal display panel. The backlight module includes a backboard having multiple concave portions formed on an inner surface of the backboard and multiple light sources mounted in the concave portions. The backlight module and the corresponding liquid crystal display device of the present invention can reduce the thickness of direct-type backlight module without affecting the optical quality of the lights emitted from the backlight module and increasing the manufacturing cost of the backlight module. |
| US09360702B2 |
Array substrate and transflective liquid crystal display panel
An array substrate and a transflective liquid crystal display panel. The array substrate includes: a plurality of sub-pixel areas defined by gate lines and data lines distributed across each other, each of the sub-pixel areas comprising a transmission area and a reflection area, wherein, the array substrate further comprises an adjustment module; the adjustment module is configured to transmit an adjustment signal to the reflection area and adjust the reflection area from opaque state to transparent state upon an external light intensity being smaller than a preset light intensity. |
| US09360701B2 |
Liquid crystal device, electronic apparatus and lighting device
In a liquid crystal device, when the local dimming is adopted, at a light guide plate of a lighting device, light guide plate portions having a trapezoidal planar shape where two sides facing each other in the Y-axis direction have different lengths are arranged in the X-axis direction to have reverse orientations in the Y-axis direction. A light emitting element emits the light of a light source from the end surface of the light guide plate portion which is located at a short side into the light guide plate portion. A light scattering surface is installed at the space between the light guide plate portions. |
| US09360693B2 |
LCD panel with new control line topology
A liquid crystal display (LCD) that includes a plurality of segments, and a plurality of control lines to activate the plurality of segments. Each of the plurality of segments is associated with an intersection of two of the control lines, and each of the plurality of control lines intersects with each of the other plurality of control lines. |
| US09360689B2 |
Optical modulator including grapene
The present invention provides for a one or more layer graphene optical modulator. In a first exemplary embodiment the optical modulator includes an optical waveguide, a nanoscale oxide spacer adjacent to a working region of the waveguide, and a monolayer graphene sheet adjacent to the spacer. In a second exemplary embodiment, the optical modulator includes at least one pair of active media, where the pair includes an oxide spacer, a first monolayer graphene sheet adjacent to a first side of the spacer, and a second monolayer graphene sheet adjacent to a second side of the spacer, and at least one optical waveguide adjacent to the pair. |
| US09360682B1 |
Camera headband device and system with attachable apparatus
A headband camera device which transmits streaming video, images, GPS location data and voice communications via a smart phone app or transmit and store data independent of the smart phone app. A Bluetooth module or other short range transmission module in the headband facilitates voice communication by interfacing with a user's Bluetooth enabled smartphone or within a Wifi location. Alternatively, the camera headband device transmits streaming video, sends images and 2-way communications independently of a smartphone over a wireless network by use of an internal SIM card. |
| US09360677B2 |
Display panel, display device, and terminal device
A translucent liquid crystal display panel (2) includes pixel pairs as display units each formed by a left-eye pixel (4L) and a right-eye pixel (4R) and arranged in a matrix shape. A through hole (4Ld) arranged in a color layer (4Lc) of a color filter has a slit shape whose longitudinal direction is identical to the orientation direction of a cylindrical lens (3a) constituting a lenticular lens (3). Similarly, a through hole (4Rd) arranged in a color layer (4Rc) of a color filter has a slit shape whose longitudinal direction is identical to the orientation direction of the cylindrical lens (3a) constituting the lenticular lens (3). This suppresses the phenomenon that a hue is changed by a field-of-view angle and/or an external light condition on the translucent display panel capable of displaying an image directed to a plurality of viewpoints. |
| US09360671B1 |
Systems and methods for image zoom
A method is provided that includes operating a first camera to capture a first image stream and operating a second camera to capture a second image stream. The method further includes initially using the first image stream to display a first field of view in a live-view interface of a graphic display and, while displaying the first image stream in the live-view interface, receiving an input corresponding to a zoom command. The method further includes, in response to receiving the input: (a) switching from using the first image stream to display the first field of view in the live-view interface to using a combination of the first image stream and the second stream to display a transitional field of view of the environment in the live-view interface and (b) subsequently switching to using the second image stream to display the second field of view in the live-view interface. |
| US09360667B2 |
Beam splitting module and projector device using the same
A beam splitting module and a projector device using the same are provided. The beam splitting module comprises a projector, a first reflective mirror and a second reflective mirror. The projector projects a first split image, a second split image and a third split image. The first reflective mirror reflects the first split image to a real image forming plate to form a first projection image. The second reflective mirror reflects the second split image to the real image forming plate to form a second projection image. The third split image is projected on the real image forming plate through a space between the first reflective mirror and the second reflective mirror to form a third projection image. |
| US09360665B2 |
Confocal optical scanner
A confocal optical scanner according to one aspect of the present invention includes an optical filter. The optical filter includes a plate-shaped body including a first surface and a second surface opposite to the first surface. The first surface has a plurality of pinholes. The optical filter further includes a plurality of first microlenses on the second surface. The first microlenses are disposed nearly coaxially with the pinholes, respectively. |
| US09360659B2 |
Method for presenting and evaluation of images of micro-titer plate properties
Selected properties of a microplate comprising a plurality of sample wells are obtained by repetitively performing focusing functions to determine sequentially a well surface z-position and then a plate bottom z-position for a corresponding current x-y position based on an intensity indicative of a best focus of the well surface and the plate bottom respectively. The well surface z-position and the plate bottom z-position corresponding to each of the plurality of x-y positions are determined by repeating the steps of positioning the objective lens, performing the focusing function to determine the well surface z-position, and performing the focusing function for the plate bottom z-position. The well surface z-positions and the plate bottom z-positions at the plurality of x-y positions are used to generate data to determine the selected properties of the microplate. |
| US09360651B2 |
Covert rooftop vent enclosure and adjustable multi-tiered rack for electronic surveillance equipment
An apparatus for supporting electronic equipment on the exterior of an outdoor structure includes a base member configured to be coupled to the exterior of the outdoor structure, a first housing coupled to the base member, and at least one shelf disposed within the first housing. Each shelf includes a support surface, a plurality of support orifices disposed therethrough, and at least one first communication orifice disposed therethrough. A plurality of support members is configured to be inserted through the support orifices. A floor member is coupled to the first housing and has at least one second communication orifice disposed therethrough. The plurality of support members is configured to couple the at least one shelf to the floor member. A substantially transparent second housing is mounted on the floor member. |
| US09360650B2 |
Laser alignment device with a movable mirror, laser-target alignment sensor with movable mirrors and laser alignment method
A laser alignment device with at least one movable mirror, a laser-target alignment sensor with movable mirrors and a laser alignment method are disclosed. The laser alignment device with the movable mirror comprises an image acquisition means for collecting incident lasers, a moveable mirror for reflecting the lasers to the image acquisition means and is operable to move linearly with respect to the image acquisition means, and a lens for forming an image of a target in the image acquisition means. The present disclosure achieves linear motion of the movable mirror with high accuracy in a small range, which in turn achieves fast and accurate alignment of the laser. It solves the problem of laser spots overlapping, reduces alignment time and improves shooting accuracy. |
| US09360648B2 |
Systems and methods for the management of fiber optic cables
The present disclosure relates to a fiber optic retention device to properly accommodate for cable management arrangements and schemes in telecommunication infrastructures that are massive in scale and/or require subsequent adaptation of the infrastructures. One embodiment includes a C-shaped opening with a door that snap mounts to the body with two snaps and pivot posts. One embodiment includes a C-shaped opening with a door that snap mounts to the body and is retained by a living hinge on an opposite end. One embodiment includes a C-shaped opening with flexible fingers that retain the cables within the opening. One embodiment includes a C-shaped opening with a door which moves parallel to a front opening. The door includes an angled surface to allow cables pressed onto the angled surface to move the door against a biasing member. |
| US09360645B2 |
Module, living hinge
Provided is a one-piece injection molded part which is used to assemble an optical module, the one-piece injection molded part including: a plurality of plates and a plurality of living hinges. The plurality of plates includes an input faceplate, an output faceplate, a left side plate, a right side plate, a bottom plate and a lid plate and is integrally formed. |
| US09360640B2 |
Ferrule fixing member
A ferrule fixing member includes a fixing member configured to fix a ferrule to hold an optical fiber to a retaining member including a retaining hole to insert the ferrule, a locked portion configured to be locked to a locking portion formed on the retaining member and to be restricted from moving, with respect to the retaining member, in an insertion direction of the ferrule and in a direction orthogonal to the insertion direction, and a main body configured to elastically press the ferrule toward the bottom of the retaining hole by elastic deformation thereof. |
| US09360634B2 |
Structures and techniques for aligning a multicore fiber in a ferrule or production jig
An alignment block for aligning a multicore fiber has a body with a front face and a rear face, and includes a capillary extending between a front opening at the first face and a rear opening at the rear face. The capillary has an inner circumference that includes an alignment surface corresponding to the multicore fiber alignment surface. The front opening is shaped to fit closely around the multicore fiber so as to prevent non-longitudinal movement of the multicore fiber relative to the alignment block body. The rear opening is shaped to fit around the multicore fiber so as to allow a selected amount of non-longitudinal movement of the multicore fiber relative to the alignment block body. The capillary provides tapered transition between the rear opening and the front opening. Movement of the multicore fiber along the capillary causes the multicore fiber alignment surface to be urged against the capillary alignment surface so as to align the multicore fiber cores relative to the alignment block body. |
| US09360633B2 |
Method for assembling optical connector
To provide a method for assembling an optical connector with which the optical connector can be easily assembled. An optical connector is assembled by preparing a holding cap that holds a frame member and a plug housing while maintaining a relative positional relationship between the frame member and the plug housing, inserting a ferrule into the frame member, and connecting the plug housing and the rear housing to each other. |
| US09360632B2 |
Ferrule
A ferrule 10 includes holding holes 16, a light incidence/emission plane 21 to pass light entering or emitted from optical fibers F2 respectively held at the holding holes 16, lenses 31 disposed on an optical axes between the respective holding holes 16 and the light incidence/emission plane 21, and two or more guide portions. A second optical axis L2 between the light incidence/emission plane 21 and the ferrule 10 on the other side is inclined relative to a Z direction. A positional relation between the guide portions is 180-degree rotationally symmetric around a reference axial line extending in the Z direction. The lenses 31 is disposed disproportionately in a direction opposite to an inclination direction of the second optical axis L2 from a position line-symmetric relative to a straight line crossing with the reference axial line and parallel to an X direction. |
| US09360628B2 |
Fiber stretcher module for use in the 1550 nm wavelength range
Embodiments of the present invention are generally related to embodiments of the present invention relate to a fiber stretchers module for use in the 1550 nm wavelength range. In one embodiment of the present invention, a fiber stretcher module for use in the 1550 nm wavelength range comprises a fiber having a relative dispersion slope, RDS, and a relative dispersion curvature, RDC, wherein a ratio of said slope to said curvature is between about 30 nm and about 0 nm, having a dispersion value of less than about −10 ps/(nm·km) at about 1550 nm, and a RDS is equal to or greater than 0. |
| US09360626B2 |
Fiber-based multi-resonator optical filters
Optical filters comprising one or more optically-coupled Fabry-Perot resonators are disclosed. In some embodiments, the one or more optically coupled Fabry-Perot resonators include a graded index fiber. In some embodiments, the one or more optically coupled Fabry-Perot resonators are coupled end-to-end, whereas in other embodiments the one or more optically coupled Fabry-Perot resonators are side-coupled through evanescence. One or more implementations of an optical filter allow a spectral response of an input light beam to be controlled, through various approaches, e.g., by exposing a component fiber to ultra-violet radiation. |
| US09360624B2 |
Splice protector for fiber optic ribbons
A fiber optic cable assembly includes first and second fiber optic ribbons and a splice protector. The ribbons are spliced together such that the corresponding spliced fibers at the splice have a common lengthwise axis, widthwise axis orthogonal to the lengthwise axis, and thickness axis orthogonal to the lengthwise and widthwise axes. The splice protector supports the ribbons that are spliced to one another at the splice. The splice protector may include or even consist essentially of an adhesive that provides a flexible support for the splice. The splice protector may be at least half as flexible when cured over the splice as the first and second ribbons in bending about the widthwise axis. |
| US09360619B2 |
Moatless bend-optimized multimode fiber
An optical fiber including a multimode core having a radius, R1, and a maximum relative refractive index, α1MAX, at a wavelength λ0, an inner clad region surrounding the core and having a radial thickness, T2, and a minimum relative refractive index, Δ2MIN, of about 0.0% at a wavelength of λ0, and an outer clad layer, which is doped with chlorine at greater than or equal to 0.5 weight %, surrounding the inner clad region and having a radial thickness, T3, and a maximum relative refractive index, Δ3MAX, at a wavelength of λ0. The optical fiber satisfies the following relationship: Δ1MAX>Δ3MAX>Δ2MIN, and the optical fiber exhibits an overfilled bandwidth of greater than or equal to about 1.5 GHz-km at λ0. |
| US09360613B2 |
Planar light source apparatus and display apparatus using same
A planar light source apparatus includes a point light source and a light guide plate shaped like a flat plate with a rectangular shape in a plan view. The light guide plate includes an output surface confronting an opening portion, a pair of second side surfaces opposed to each other, and a hole opening in a non-output surface and formed near one of the first side surfaces at a position where the point light source is to be arranged. Each of the pair of second side surfaces is at least partially configured as a prism whose ridge line extends in a direction perpendicular to the output surface and whose cross-section, when sectioned in a direction parallel to the output surface, has a sawtooth-like shape in which concavity and convexity are repeated. A light of the point light source can be efficiently uniformized in the light guide plate, and thus unevenness of brightness can be prevented. |
| US09360612B2 |
Method for producing high-brightness light-emitting fabric using acrylic optical fibers, and high-brightness light-emitting fabric
The present invention relates to a light-emitting fabric, in which acrylic optical fibers and general fibers are woven together, and light is emitted to the surface of the fabric through the optical fibers floating on the surface of the union fabric. According to the present invention, part of the clad portion of the optical fibers is removed by melting so as to prevent the total reflection of the clad portion and to emit high-brightness patterns or characters having a higher brightness than those emitted by optical fibers having a conventional clad portion. Also, a semi-circular core portion is flattened so as to prevent the light from being refracted unnecessarily, and thus the high-brightness light-emitting fabric which can express complex patterns or characters at a higher resolution without emitting environmental pollutants can be provided. |
| US09360609B2 |
2D/3D projector with rotating translucent cylinder for alternating light polarisation
A 3D image projector having a translucent rotatable hollow cylinder, the hollow cylinder having differently polarized sections, and the projector being capable of passing a light beam generally orthogonally through a wall of the hollow cylinder is disclosed. |
| US09360608B2 |
Polarizing element
Provided is a polarizing element having excellent optical properties and high light resistance to intense light. This polarizing element is provided with a transparent substrate, an absorbing layer disposed on the transparent substrate and constituting grid-shaped convexities arrayed at a pitch smaller than the wavelengths in the optical bandwidth used, a dielectric layer formed on the absorbing layer, and a reflective layer formed on the dielectric layer. Because the absorbing layer, which interferes with and absorbs light, is in contact with the transparent substrate, heat dissipation can be improved and heat resistance of the polarizing plate can be improved. |
| US09360606B2 |
Color filter substrate and display panel
An embodiment of the invention provides a color filter substrate which includes: a substrate having a surface; a light-shielding layer disposed on the surface; a first color filter layer; and a second color filter layer disposed on the surface, the light-shielding layer has a first sidewall in direct contact with the first color filter layer, the first sidewall and the surface form a first angle, the light-shielding layer has a second sidewall in direct contact with the second color filter layer, the second sidewall and the surface form a second angle, and the second angle is less than the first angle. |
| US09360599B2 |
Optical element and method of manufacturing same
An optical element 1 comprises a base 2 having a surface 2a formed with a depression 3 and a formed layer 4 disposed on the base 2. The formed layer 4 has a main part 5 located within the depression 3 when seen in the depth direction of the depression 3 and an overhang 6 located on the surface 2a of the base 2 while being connected to the main part 5. A curved surface 4b opposing a bottom face 3b of the depression 3 in the main part 5 is provided with an optical function part 10. |
| US09360595B2 |
Antifog optical article and manufacturing method thereof
[Problem to be Solved]To provide: an antifog optical article wherein a suitable water-repellent layer is formed in the process of application of antifog coating having a water-absorbing layer consisting primarily of urethane or acrylic resin having a polyoxyethylene chain on a base material; and a manufacturing method of the antifog optical article.[Solution] A water-absorbing layer consisting primarily of urethane or acrylic resin having a polyoxyethylene chain represented as —(CH2CH2O)n- is formed on a surface of a glass or plastic base material, a water-repellent layer consisting primarily of at least one of amino-modified silicone and mercapto-modified silicone is formed on a surface of the water-absorbing layer, and a contact angle with respect to water on a surface of the water-repellent layer is set equal to or larger than 100 degrees. |
| US09360594B2 |
High water content silicone hydrogel contact lenses
Silicone hydrogel contact lenses having a high water content are described. The lenses are derived from a polymerizable composition including a first siloxane monomer represented by formula (1): wherein m of formula (1) represents one integer from 3 to 10, n of formula (1) represents one integer from 1 to 10, R1 of formula (1) is an alkyl group having from 1 to 4 carbon atoms, and each R2 of formula (1) is independently either a hydrogen atom or a methyl group; the lenses also include units derived from a second siloxane monomer having a number average molecular weight of at least 7,000 daltons, and at least one vinyl-containing cross-linking agent. The lenses have average equilibrium water contents from about 30% wt/wt to about 70% wt/wt when fully hydrated. Batches of silicone hydrogel contact lenses and methods of making silicone hydrogel contact lenses are also described. |
| US09360593B2 |
Polycarbonate resin, production method therefor, and optical molded body
The polycarbonate resin of the present invention has a structural unit represented by general formula (A): (in formula (A), X is an alkylene group having 1 to 4 carbon atoms). |
| US09360592B2 |
Thin microstructured optical films
Presently described are optical films, such as a brightness enhancing film, having a polymerized microstructured surface disposed on a preformed polymeric film wherein the film has a thickness of no greater than 3 mils and the polymerized microstructured surface consists of the reaction product of a substantially non-brominated polymerizable resin composition. |
| US09360591B2 |
Microstructured film comprising nanoparticles and monomer comprising alkylene oxide repeat units
Presently described are microstructured films, such as brightness enhancing films, having a microstructured surface. The microstructured surface comprises the reaction product of a polymerizable composition comprising at least 20 wt-% of inorganic nanoparticles and a non-aromatic multi-(meth)acrylate monomer comprising at least three contiguous alkylene oxide repeat units. The multi-(meth)acrylate monomer typically comprises two or three (meth)acrylate groups. The alkylene oxide repeat units have the formula —[O-L]- wherein each L is independently a C2-C6 alkylene. Also described is a polymerizable resin composition comprising at least 20 wt-% of inorganic nanoparticles having a refractive index of at least 1.68 and a non-aromatic multi-(meth)acrylate monomer comprising at least three contiguous alkylene oxide repeat units. |
| US09360590B2 |
Metamaterial-based optical dispersion compensation
A metamaterial-based dispersion compensator includes a plurality of layers arranged in a geometric structure; wherein the plurality of layers comprise engineered metamaterials; wherein the engineered metamaterials and the geometric structure are configured to compensate dispersion across a wavelength spectrum. The metamaterial-based dispersion compensator utilizes a specifically engineered frequency response, in a compact metamaterial form-factor, to correct for naturally occurring and problematic dispersion in physical systems such as in optical communication systems. |
| US09360588B2 |
Utility mapping and data distribution system and method
A system and method of mapping underground utilities and other subsurface objects involves one or more of acquiring utility location data using a number of different detectors and sensors, processing the multiple detector/sensor output data to produce mapping data, storing the mapping data in a database, and providing access to and use of the stored mapping data by subscribing users on a usage fee basis. |
| US09360587B2 |
Proximity sensing method
The present invention relates to a proximity sensing method for proximity sensing unit in a mobile device. The proximity sensing method comprises steps of comparing a sensed value of the proximity sensing unit with a predetermined offset value or a first predetermined range to determine if the sensed value is smaller than the predetermined offset value or if the sensed value is within the first predetermined range; and providing an offset value for confirming if an object is near the mobile device according to the determination that if the sensed value is smaller than the predetermined offset value or within the first predetermined range. |
| US09360585B2 |
Borehole independent neutron porosity measurement
A method for estimating a borehole independent porosity of a subterranean formation includes processing a neutron logging data point, preferably including average near and far detector neutron count rates with suitable input data to obtain the porosity estimate. The borehole independent formation porosity may be obtained without any compensation and without any reliance on the measurement or estimation of sensor standoff and/or borehole caliper. |
| US09360584B2 |
Systems and methodology for detecting a conductive structure
Various embodiments include apparatus and methods to detect and locate conductive structures below the earth's surface. Tools can be configured with receiving sensors arranged to receive signals generated from a conductive structure in response to a current flowing on the conductive structure. Magnetic-related values from the signals can be processed, relative to the tool, to determine a position of a conductive structure from which the signal was generated in response to current flowing on the conductive structure. Additional apparatus, systems, and methods are disclosed. |
| US09360579B1 |
Advanced steering tool system, method and apparatus
A steering tool is movable by a drill string to form an underground bore along an intended path. A sensing arrangement of the steering tool detects its pitch and yaw orientations at a series of spaced apart positions along the bore, each position is characterized by a measured extension of the drill string. The steering tool further includes a receiver. At least one marker is positioned proximate to the intended path, for transmitting a rotating dipole field to expose a portion of the intended path to the field for reception by the receiver. The detected pitch orientation, the detected yaw orientation and the measured extension of the drill string are used in conjunction with magnetic information from the receiver to locate the steering tool. The steering tool may automatically use the magnetic information when it is available. A customized overall position determination accuracy can be provided along the intended path. |
| US09360578B2 |
Systems and methods for optimizing low frequency output from airgun source arrays
A technique provides a source design and method for increasing low frequency output of a marine source array. The approach comprises providing a plurality of airguns. At least some of the airguns are activated to generate an effective bubble energy. The effective bubble energy may be optimized through use, preparation and/or arrangement of the airguns. |
| US09360577B2 |
Method and apparatus for processing seismic data
Methods and apparatuses for processing seismic data carrying information about a subsurface structure are provided. One method includes splitting the seismic data in groups, each group including subsets of seismic data for which a distance from a respective shot point to a receiver line in a patch of active detectors corresponding to the shot point is within a predetermined range for the group, and extracting signal data for each block Hankel matrix based on an SVD analysis thereof. Another method includes extracting signal data by subtracting from seismic data an estimated noise model obtained by rank reduction of a Hankel matrix followed by dip filtering, enhanced based on a least square matching filter with the seismic data. |
| US09360575B2 |
Simultaneous shooting nodal acquisition seismic survey methods
A method of performing a seismic survey including: deploying nodal seismic sensors at positions in a survey region; activating a plurality of seismic sources; and using the nodal seismic sensors to record seismic signals generated in response to the activation of the plurality of signals. |
| US09360573B2 |
System and method for generating 3D images of non-linear properties of rock formation using surface seismic or surface to borehole seismic or both
A system and method of characterizing properties of a medium from a non-linear interaction are include generating, by first and second acoustic sources disposed on a surface of the medium on a first line, first and second acoustic waves. The first and second acoustic sources are controllable such that trajectories of the first and second acoustic waves intersect in a mixing zone within the medium. The method further includes receiving, by a receiver positioned in a plane containing the first and second acoustic sources, a third acoustic wave generated by a non-linear mixing process from the first and second acoustic waves in the mixing zone; and creating a first two-dimensional image of non-linear properties or a first ratio of compressional velocity and shear velocity, or both, of the medium in a first plane generally perpendicular to the surface and containing the first line, based on the received third acoustic wave. |
| US09360572B2 |
Liquid mixture used to test and validate test devices for inspecting objects or persons
A liquid mixture is used to test and validate test devices for inspecting objects or persons, said mixture containing glycerol and sodium hydroxide, in a weight ratio of glycerol to solid hydroxide between 6.5 and 3.8, and containing water. |
| US09360567B2 |
Scintillating organic materials and methods for detecting neutron and gamma radiation
Embodiments incorporate a method and apparatus for detection of radiation. Embodiments detect fast and/or thermal neutrons. Embodiments detect neutrons in high backgrounds of gamma rays. Embodiments can have high sensitivity and/or high gamma discrimination. Embodiments include a given single material that detects fast neutrons and simultaneously detect gamma rays with moderate energy resolution. Embodiments utilize liquid, viscous liquid, gel, and/or solid scintillating materials. Embodiments incorporate a scintillating matrix, such as a liquid, having a highly polar matrix, such as a liquid solvent, dissolved dyes, and a high concentration of a dissolved organo metallic compound. The use of a single material for a large area detector of fast neutrons and gamma rays can provide material and cost benefits. |
| US09360566B2 |
Radiation detector
Provided is a radiation detector, including: a two-dimensional light receiving element including a plurality of pixels; and a scintillator layer having multiple scintillator crystals two-dimensionally arranged on a light receiving surface of the two-dimensional light receiving element, in which: the scintillator crystal includes two crystal phases, which are a first crystal phase including a material including a plurality of columnar crystals extending in a direction perpendicular to the light receiving surface of the two-dimensional light receiving element and having a refractive index n1, and a second crystal phase including a material existing between the plurality of columnar crystals and having a refractive index n2; and a material having a refractive index n3 is placed between adjacent scintillator crystals, the refractive index n3 satisfying a relationship of one of n1≦n3≦n2 and n2≦n3≦n1. |
| US09360559B2 |
GNSS navigation solution using inequality constraints
Information such as altitude or speed limits for a specific geographic region can be utilized to improve position and velocity estimation for a mobile device using inequality constraints. The inequality constraints can be used as pseudo-measurements when needed to improve position and velocity estimation. |
| US09360554B2 |
Methods and apparatus for object detection and identification in a multiple detector lidar array
LiDAR (light detection and ranging) systems use one or more emitters and a detector array to cover a given field of view where the emitters each emit a single pulse or a multi-pulse packet of light that is sampled by the detector array. On each emitter cycle the detector array will sample the incoming signal intensity at the pre-determined sampling frequency that generates two or more samples per emitted light packet to allow for volumetric analysis of the retroreflected signal portion of each emitted light packet as reflected by one or more objects in the field of view and then received by each detector. |
| US09360552B2 |
Apparatus and method for creating tissue doppler image using synthetic image
An apparatus and method capable of producing a tissue Doppler image without repeatedly transmitting ultrasound signals by the ensemble number to each scan line. An ultrasound beam is transmitted in a non-sequential manner and a plurality of receive beams received in response to each transmission of the transmit beam are grouped into an increment data group of a scan line index increasing direction and a decrement data group of a scan line index decreasing direction. Auto correlation is performed on the increment data group of the scan line index ascending order and decrement data group of the scan line index descending order, weights are applied to respective auto correlation values for the increment and decrement data group, and then the auto correlation values with the weight applied are summed to compute a mean phase. At least one of velocities, powers and variances in response to the mean phase is outputted to produce TDI. |
| US09360550B2 |
Ultrasonic observation apparatus, operation method of the same, and computer readable recording medium
An ultrasonic observation apparatus includes: a first conversion unit that converts an ultrasonic signal as a time domain signal reflected from a specimen into a frequency domain signal; a regression analysis unit that calculates a regression expression for the frequency domain signal; an attenuation correction coefficient calculation unit that calculates an attenuation correction coefficient which is obtained by dividing a difference between first-order coefficients in the regression expressions at two points having different reception depths by a difference between the reception depths at the two points; an attenuation correction processing unit that performs attenuation correction processing on the frequency domain signal based on the attenuation correction coefficient; a second conversion unit that converts the frequency domain signal after the attenuation correction processing, into a second time domain signal; and an image data generation unit that generates ultrasonic image data based on the second time domain signal. |
| US09360549B1 |
Methods and apparatus for a self-calibrated signal injection setup for in-field receive phased array calibration system
Methods and apparatus provide calibration of a system using a cable check configuration and a calibration test configuration. A short to ground reflects an injected signal to characterize a first signal path in the cable check configuration. Switch setting can then be adjusted to inject a signal that is coupled to an array element and received from a feed. The signal paths can be characterized to enable in-field calibration testing. |
| US09360546B2 |
Systems, methods, and apparatus for indicating direction of arrival
Systems, methods, and apparatus for projecting an estimated direction of arrival of sound onto a plane that does not include the estimated direction are described. |
| US09360545B2 |
Magnetic resonance system and operating method for flow artifact reduction in slab selective space imaging
In a SPACE (Sampling Perfection with Application optimized Contrasts using different flip angle Evolutions) or equivalent magnetic resonance imaging pulse sequence, the dephasing gradient is generated (activated) so as to occur immediately in front of the second refocusing pulse, thereby eliminating the long time duration that occurs in conventional SPACE or equivalent sequences between excitation and readout. This long time duration has been identified as a source for flow-related artifacts that occur in images reconstructed from data acquired according to conventional SPACE or equivalent sequences. By eliminating this long time duration, such flow-related artifacts are substantially reduced, if not eliminated. |
| US09360544B2 |
Accelerated MR thermometry mapping involving an image ratio constrained reconstruction
A medical apparatus (300, 400, 500, 600) includes a magnetic resonance imaging system (301). The medical apparatus further includes a memory (330) containing instructions (350, 352, 354, 456, 458, 460) for execution by a processor (324). Execution of the instructions causes the processor to acquire (102, 202) baseline magnetic resonance data (332) and reconstruct (104, 204) a first image (334) using the baseline magnetic resonance data. Execution of the instructions further causes the processor acquire (106, 212) undersampled magnetic resonance data (336), which is undersampled in k- space in comparison to the baseline magnetic resonance data. Execution of the instructions further causes the processor reconstruct (108, 214) a second image (338) using the undersampled magnetic resonance data and the first image. The second image is reconstructed using an image ratio constrained reconstruction algorithm (354). A temperature map (340) is calculated (110, 216) using the second image. |
| US09360543B2 |
System and method for parallel magnetic resonance image reconstruction using digital beamforming
Systems and methods for beamforming algorithms for transmit-receive parallel magnetic resonance imaging (“pMRI”) applications are described. For any transmit configuration (e.g., using a single or multiple transmit elements) a weighted sum of the complex image data from each receiver is formed with a spatially-varying weighting. The weighting factor is obtained by solving an optimal refocusing problem at a set of points in the image space, which can include all the pixels in the image. The optimal refocusing of the transmit-receive configuration accounts for the spatially-varying SNR in deriving the coefficients of the weighted sum at every image pixel. |
| US09360542B2 |
System and method for spectrally-resolved three-dimensional magnetic resonance imaging without frequency-encoding gradients
A system and method for acquiring spectrally-resolved three-dimensional data with a magnetic resonance imaging (“MRI”) system without frequency-encoding gradients are provided. An MRI system is directed to produce a radio frequency (“RF”) pulse that rotates net magnetization about an axis, after which a first phase-encoding gradient is established along a first direction, a second phase-encoding gradient is established along a second direction that is orthogonal to the first direction, and a third phase-encoding gradient is established along a third direction that is orthogonal to the first and second directions. Spectrally-resolved data are acquired at a point in k-space that is defined by the first, second, and third phase-encoding gradients, and is acquired by sampling a magnetic resonance signal at a plurality of time points during a period of time in which no magnetic field gradients are established by the MRI system. |
| US09360533B2 |
Reading circuit for a magnetic field sensor with sensititivy calibration, and related reading method
A reading circuit for a magnetic-field sensor, generating an electrical detection quantity as a function of a detected magnetic field and of a detection sensitivity, is provided with an amplification stage, which is coupled to the magnetic-field sensor and generates an output signal as a function of the electrical detection quantity. In particular, the reading circuit is provided with a calibration stage, integrated with the amplification stage and configured so as to control a feedback loop in such a way as to compensate a variation of the detection sensitivity with respect to a nominal sensitivity value. |
| US09360532B2 |
Current detection apparatus
A current detection apparatus for detecting a current from a battery flowing through a harness. The apparatus includes a resistor having a current carrying member disposed between a terminal of the battery and the harness, a circuit board provided thereon with a current detection circuit for detecting a current flowing through the resistor, and a casing having a recessed portion for accommodating the circuit board, a cover for closing an opening of the recessed portion. The circuit board includes a solder junction between the circuit board and a terminal protruding from an inside bottom of the recessed portion and passing through a through hole arranged on the circuit board, and an open end of the recessed portion that can be engaged with the cover is non-parallel to the circuit board so that at least a portion of the circuit board including the solder junction lies outside of the recessed portion. |
| US09360520B2 |
Test mode control circuit of semiconductor apparatus and control method thereof
Various embodiments of a test mode control circuit of a semiconductor apparatus and related methods are disclosed. In one exemplary embodiment, the test mode control circuit may include: a test mode control block configured to generate a plurality of control signal sets in response to a first address signal set and a second address signal set which are sequentially inputted; a test mode transfer block configured to transfer a plurality of test mode signals, which are generated according to a combination of the plurality of control signal sets, to a plurality of circuit blocks of the semiconductor apparatus; and a plurality of global lines configured to transmit the plurality of control signal sets to the test mode transfer block. |
| US09360515B2 |
Fault detection device for inverter system
To provide a fault detection device for an inverter system, that detects a fault in the inverter system including an inverter circuit 2 that converts DC power into AC power and a motor 5 driven thereby. When a driving start signal Sig1 of the inverter circuit 2 is input, a test voltage applying unit 20 applies a predetermined first test voltage to a current measuring unit 10 that measures current flowing in the inverter circuit 2, and it is determined whether the current measuring unit 10 has failed, based on the first test voltage. A control unit 30 applies a predetermined second test voltage to the inverter circuit 2 and the motor 5, and it is determined whether the inverter circuit 2 and a motor coil have failed, based on the second test voltage. |
| US09360512B2 |
Method of capacitive measurement by non-regular electrodes, and apparatus implementing such a method
A method for providing corrected measurements of absolute capacitance of an object in the proximity of at least two independent electrodes of a non-optimized shape integrated in a human-machine interface device for detecting the object. The method includes measuring, for each electrode, an actual value of absolute capacitance between the electrode and the object, and calculating a prediction by applying a multi-variable nonlinear prediction model to the actual values of absolute capacitance so as to obtain an image of probability densities. Then, using the probability densities as corrected absolute capacitance values for detecting the object. |
| US09360510B2 |
Parasitic capacitance cancellation in capacitive measurement
An integrated circuit compensates for parasitic capacitance in a capacitive measuring apparatus wherein a capacitance measurement is done by repeatedly transferring charge from a capacitor to be measured to a reference capacitor. |
| US09360509B2 |
Nanoscale sensors with nanoporous material
A nanocoaxial sensor includes an outer conductor, an inner conductor, a nanoporous dielectric material disposed between the outer and inner conductors, a nanocavity sized to allow target species to enter the nanocavity between the outer and inner conductors. |
| US09360507B2 |
Displacement tamper sensor and method
A displacement sensor for sensing displacement of a first surface relative to a second surface includes a coil mounted on the first surface, and encircling a region in plane; and a conductor extending lengthwise from the second surface through the region. The conductor has a volume that varies along its length. An AC source drives the coil to generate a magnetic field that pierces the region and induces eddy currents in the conductor. Eddy current losses resulting from the eddy currents vary in dependence on the volume of the conductor above and beneath the plane. A sensing circuit is coupled to the AC source to detect changes in eddy current losses, and thereby displacement. Detection of displacement may be used to signal tamper/intrusion. The sensor may further include a visual or audible output to signal such displacement. |
| US09360506B2 |
System and method of monitoring the waveform of the voltage of the electrical grid
The present invention relates to a system for monitoring the electric network voltage waveform, comprising: switching means (11) connected to the voltage lines (A, B, C) of a three-phase system, comprising two thyristors (T1, T2) connected to two of the voltage lines (A, B, C) and at least two capacitors (C1, C2) connected to said thyristors (T1, T2), said means (11) being configured to open and close said thyristors (T1, T2) in response to a trigger signal; means for measuring (12) the voltages in said voltage lines and at the input of said capacitors; a thyristor trigger circuit (14) for providing a trigger signal to either thyristor (DT1, DT2) when the voltage in the terminals of said thyristor (T1, T2) crosses zero; control means (13, 23) for giving said trigger order (OD) or not. The control means comprise: a PLL (231, 331) configured to obtain an image signal from the voltage signals of said voltage lines (A, B, C), from the phase angle (φ) of the three-phase system and from the temporal variation thereof; an adaptive notch filter (232, 432) for providing filtered voltage signals between the voltage lines (VAC_f, VBC_f); means for filtering the voltages at the input of the capacitors (VC1_f, VC2_f); a zero crossing detector (235, 535) configured to provide said trigger order (OD). |
| US09360503B2 |
Method for determining a sampling time of a signal, device for determining the same, and method for determining a sampling parameter of a signal
A method for determining a sampling time of a signal, the method including: determining a candidate sampling time of a signal for input to a sampling circuit; determining a resultant sampling time at which the sampling circuit samples the signal when input with the candidate sampling time; and determining a sampling time of the signal based on a noise shaping of a difference between the resultant sampling time and the candidate sampling time. |
| US09360502B2 |
Increasing current carrying capability through direct liquid cooling of test contacts
Testing methods and systems are described. One method for testing an electronic device includes providing a probe in electrical contact with a device. The method also includes positioning an interface of the probe and the device in a liquid medium. The method also includes transmitting a current from the probe through the interface while the interface is in the liquid medium. Other embodiments are described and claimed. |
| US09360500B2 |
Device for measuring a battery current
The present invention relates to a device for measuring a battery current of a battery. The device has a measuring distance, over which the entire battery current to be measured flows during the measurement. A measuring device measures a voltage drop across the measuring distance. On the basis of the measured voltage drop and a resistance of the measuring distance, a current determining device determines the battery current, wherein the measuring distance is formed by at least part of a cable with a temperature-dependent resistor. |
| US09360499B2 |
Socket for testing a semiconductor device and test equipment including the same
A test socket has a housing with an inlet configured to receive a substrate. A plurality of terminals are coupled to the housing, and a plurality of sliding pins are coupled to the terminals. The pins are configured to make contact with respective pads or terminals of the substrate to be tested. The pins have different lengths or positions to send and receive test signals. |
| US09360497B2 |
Controlling sensor use on an electronic device
Described are methods and systems for controlling sensor use on an electronic device, the electronic device having a first sensor defining at least one first sensor axis, the method comprising: detecting a first sensor reading; determining an orientation of the electronic device; and, disabling the detection of the first sensor reading in respect an identified first sensor axis when the first sensor reading in respect of the identified first sensor axis is substantially not expected to change for at least a predetermined amount of time. |
| US09360495B1 |
Low density underwater accelerometer
A low density accelerometer includes a buoyant outer layer and a rigid hollow housing within the outer layer. The housing includes an upper member and a lower member and is configured to form a groove at the junction of the upper and lower member. A disk shaped sensing element configured in a ring defining an aperture is configured to engage the groove along an outer edge of the annular ring. A solid proof mass is configured to fit in the center of the annular ring and configured with a threaded bore on an upper surface of the proof mass. The mass is secured to the sensing element by a retainer such as a Belleville washer in contact with the upper surface of the sensing element circumferentially about the aperture and a threaded fastener passing through the retainer and the aperture in the sensing element, and threadingly engaging the threaded bore in the proof mass. |
| US09360493B1 |
Multi-channel aspirating and dispensing instrument
A pipette receiver and its variations are discussed for use in a multi-channel pipetting device typically used for medical, biological or biochemical research and development. There is a plurality of individual positive air displacement channels that are fitted to individual disposable pipette tips intended to pipette into associated “plates”. These “plates” may be Micro-titer plates, wells or vials each typically containing 96 wells in an 8×12 array usually spaced 9 mm apart. Other common plates contain 384 wells 4.5 mm apart in the same footprint of the 96, or a 1536 well plate fitting the same footprint. |
| US09360491B2 |
Systems and methods for detection and quantification of analytes
Devices, systems, and methods for detecting molecules of interest within a collected sample are described herein. In certain embodiments, self-contained sample analysis systems are disclosed, which include a reusable reader component, a disposable cartridge component, and a disposable sample collection component. In some embodiments, the reader component communicates with a remote computing device for the digital transmission of test protocols and test results. In various disclosed embodiments, the systems, components, and methods are configured to identify the presence, absence, and/or quantity of particular nucleic acids, proteins, or other analytes of interest, for example, in order to test for the presence of one or more pathogens or contaminants in a sample. |
| US09360488B2 |
Methods and compositions for diagnosis and prognosis of renal injury and renal failure
The present invention relates to methods and compositions for monitoring, diagnosis, prognosis, and determination of treatment regimens in subjects suffering from or suspected of having a renal injury. In particular, the invention relates to using a measured urine concentration of one or more of TIMP2 and IGFBP7 in combination with one or more of a measured serum creatinine and a measured urine output, which results are correlated to the renal status of the subject, and can be used for diagnosis, prognosis, risk stratification, staging, monitoring, categorizing and determination of further diagnosis and treatment regimens in subjects suffering or at risk of suffering from an injury to renal function, reduced renal function, and/or acute renal failure. |
| US09360487B2 |
Multiplex MRM assay for evaluation of cancer
The current disclosure provides specific peptides, and derived ionization characteristics of the peptides from the estrogen receptor (ER), progesterone receptor (PR), and/or antigen Ki67 (Ki67) proteins that are particularly advantageous for quantifying the ER, PR, and/or Ki67 proteins directly in biological samples that have been fixed in formalin by the method of Selected Reaction Monitoring/Multiple Reaction Monitoring (SRM/MRM) mass spectrometry. Such biological samples are chemically preserved and fixed wherein the biological sample is selected from tissues and cells treated with formaldehyde containing agents/fixatives including formalin-fixed tissue/cells, formalin-fixed/paraffin embedded (FFPE) tissue/cells, FFPE tissue blocks and cells from those blocks, and tissue culture cells that have been formalin fixed and or paraffin embedded. A protein sample is prepared from a biological sample using the Liquid Tissue™ reagents and protocol, and the ER, PR, and/or Ki67 proteins are quantitated in the Liquid Tissue™ sample by the method of SRM/MRM mass spectrometry by quantitating in the protein sample at least one or more of the peptides described for one or more of the ER, PR, and/or Ki67 proteins. These peptides can be quantitated if they reside in a modified or in an unmodified form. An example of a modified form of an ER, PR, and/or Ki67 peptide is phosphorylation of a tyrosine, threonine, serine, and/or other amino acid residues within the peptide sequence. |
| US09360486B2 |
Allergen fragments
The present invention relates to a peptide derived from the ragweed pollen allergen Amb a (1) and comprising (6 to 50) amino acid residues and pharmaceutical preparations comprising said peptide and uses thereof. |
| US09360484B2 |
Anti-FcRH5 antibodies and immunoconjugates and methods of use
The present invention is directed to compositions of matter useful for the treatment of hematopoietic tumor in mammals and to methods of using those compositions of matter for the same. |
| US09360482B2 |
Process for the identification of a compound which inhibits the binding of the second bromodomain of each of human BRD-2, BRD-3, and BRD-4
A process for the identification of compounds with a molecular weight in the range 100 to 750 which inhibit the binding of the first and/or second bromodomains of human BRD-2 to 4 to acetylated lysine residues of their physiological partner proteins which comprises selecting those compounds which are able to: a) form a hydrogen bonding interaction in which the compound accepts a hydrogen bond from the sidechain NH2 group of the asparagine residue found at: BRD-2BRD-2BRD-3 BRD-4BRD-4 BD1BD2BD1BRD-3 BD2BD1BD2 ASN156ASN429ASN116ASN391ASN140ASN433 or b) accept a water-mediated hydrogen bond in which the compound accepts a hydrogen bond from a water that is itself hydrogen-bonded to the sidechain hydroxyl of the tyrosine residue found at BRD-2 BRD-3 BRD-4 BD1BRD-2 BD2BD1BRD-3 BD2BD1BRD-4 BD2 TYR113TYR386TYR73TYR348TYR97TYR390 and c) which are also able to form a Van der Waals interaction with a lipophilic binding region of a binding pocket such that one or more heavy atoms of the said compounds lie within a 5 Å range of any of the heavy atoms of the following bromodomain residues which define the binding pocket: BRD-2BRD-2BRD-3 BRD-4BRD-4 BD1BD2BD1BRD-3 BD2BD1BD2 TRP97TRP370TRP57TRP332TRP81TRP374 PRO98PRO371PRO58PRO333PRO82PRO375 ASP161ASP434ASP121GLU396ASP145GLU438 ILE162VAL435ILE122VAL397ILE146VAL439 MET165MET438MET125MET400MET149MET442 pharmaceutical compositions containing such compounds, and their use in therapy. |
| US09360481B2 |
Predictive biomarker for cancer treatment with ADCC-enhanced antibodies
The present invention is directed to methods for identifying which patients diagnosed with cancer will most benefit from treatment with an anti-cancer therapy comprising an ADCC-enhanced antibody. |
| US09360480B2 |
Assay method for peptide specific T-cells
A method of assaying for peptide-specific T-cells comprises adding peptide to a fluid sample of fresh peripheral blood mononuclear cells, and detecting a cytokine such as interferon-y produced by T-cells that have been pre-sensitized to the peptide. The assay method is quick and cheap and is expected to be useful for the study of various disease states including Hepatitis B, Hepatitis C, tuberculosis, malaria, HIV and influenza. |
| US09360479B2 |
Rapid lateral flow assay method for low quantity liquid or dry samples
This invention describes a device for assaying a dry or small volume liquid sample on a lateral flow capillary assay by utilizing a supplementary non-sample aqueous solution that will push the sample up the assay without diluting or significantly diluting the original sample. This invention enables a sample to be assayed rapidly and/or on-site when the sample is in dried or solid form, or when the liquid volume is too small to complete an assay. As an option, the device can display a colored signal when a sufficient amount of liquid sample has been collected or added to the device. The minimal liquid volume requirement of the device significantly reduces the sample collection time to a matter of seconds and resolves situations in which fluids available for collection are not abundant. Therefore, this invention allows the lateral flow test device to be a more rapid, efficient, and versatile apparatus. |
| US09360478B2 |
Monitoring an immunoassay
A method of monitoring an immunoassay comprises determining the position of the flow edge of fluid across an immunoassay region. This allows, for example, early detection of possible errors in the test. For example the speed of the movement of the fluid flow edge may be determined from measurements of the position of the fluid flow edge at times throughout the test, and the determined speed may be compared with one or more thresholds to determine whether the test is proceeding correctly. A further method of monitoring an immunoassay comprising monitoring the variation with time of a reference zone of an immunoassay region. This can provide the user with early information as to whether the test is proceeding correctly. The above methods may also be used to provide methods to improve the run conditions of a test during its development. The method may be applied to a competitive assay. |
| US09360476B2 |
Microfluidic system and method to test for target molecules in a biological sample
A system and method to test for the presence of target molecules in a biological test sample includes test molecules, a microfluidic chip, and irradiating and detection devices. The test molecules include bio-recognition molecules conjugable with the target molecules, and the corresponding conjugates. The microfluidic chip includes sample channels and flow focusing channels adjoining the sample channels. A buffer exiting from the focusing channels directs a single-file stream of the test molecules through one of the sample channels. The irradiating device delivers radiation for absorption by the test molecules in the single-file stream. After absorption, the test molecules emit fluorescence of a distinct fluorescent spectrum for each of the conjugates. The detection device monitors identifies the presence of the conjugates by monitoring for the distinct fluorescent spectrum. Thus, the test system and method identifies the presence of the target molecules in the test sample. |
| US09360460B2 |
Device for calibrating and testing echotomographic equipment
A device for calibrating and testing echotomographic equipment comprises an electric motor, a pair screw—female screw, wherein the screw is connected to an outlet shaft of the motor and the female screw is mobile with respect to a supporting plane, so as to transform a rotary motion of the motor shaft into a linear motion, a piston connected to the female screw and linearly mobile, coherently to the female screw, a membrane stressed by the piston, means apt to allow propagating ultrasound waves towards/from said membrane. |
| US09360459B2 |
Porosity inspection system for composite structure with non-parallel surfaces
A method and apparatus for inspecting a composite structure. A thickness profile of a portion of a region of a composite structure is identified. The region has a cross-section with non-parallel surfaces. An estimated thickness for a location within the region and outside of the portion is identified using the thickness profile. An indication of whether the location has undesirable porosity is generated based on information about attenuation of response sound signals and the estimated thickness for the location. |
| US09360457B2 |
NMR systems and methods for the rapid detection of analytes
This invention features systems and methods for the detection of analytes, and their use in the treatment and diagnosis of disease. |
| US09360456B2 |
Detecting apparatus, power receiving apparatus, power transmitting apparatus, and contactless power supply system
There is provided a detecting apparatus including one or a plurality of magnetic coupling elements that include a plurality of coils, a positioning unit disposed near at least one coil from among the plurality of coils included in the one or plurality of magnetic coupling elements, and a detector that measures an electrical parameter related to the one or plurality of magnetic coupling elements or to a circuit that at least includes the one or plurality of magnetic coupling elements, and determines from a change in the electrical parameter whether a foreign matter capable of generating heat due to magnetic flux is present. |
| US09360455B2 |
Methods for analysis of isomeric lipids
A method for analyzing a sample that contains a plurality of lipid isomers is described that involves forming one or more lipid metal ion adducts and transporting the one or more lipid metal ion adducts through a differential mobility spectrometer to cause separation of the one or more lipid metal ion adducts from each other. The lipid isomers can be chosen, for example, from fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, polyketides, sterol lipids, and prenol lipids. Particular examples include phosphatidylcholine regioisomers such as 1-palmatoyl-2-oleoyl-sn-phosphatidylcholine (POPC) and 1-oleoyl-2-palmatoyl-sn-phosphatidylcholine and triacylglycerols containing palmetic and oleic acid groups. The metal chosen can include a cationization reagent that contains sodium, potassium, silver or lithium. |
| US09360451B2 |
Method for diagnosing whether a subject is at high risk for developing atherosclerotic vascular disease
A method for diagnosing whether a subject is at high risk for developing atherosclerotic vascular disease (ASVD) is provided. The method comprises the following steps: (1) providing a specimen from a subject; (2) analyzing the specimen by using a gradient gel electrophoresis analysis; and (3) based on the result of the gel electrophoresis analysis in step (2), determining if the subject is at high risk for developing atherosclerotic vascular disease. |
| US09360447B2 |
Methods and systems for detecting the hydration of sensors
A sensor system includes a sensor and a sensor electronics device. The sensor includes a plurality of electrodes. The sensor electronics device includes a connection detection device, a power source, and a delay circuit. The connection detection device determines if the sensor electronics device is connected to the sensor and transmits a connection signal. The delay circuit receives the connection signal, waits a preset hydration time, and couples the regulated voltage from the power source to an electrode in the sensor after the preset hydration time has elapsed. Alternatively, the sensor electronics device may include an electrical detection circuit and a microcontroller. The electrical detection circuit determines if the plurality of electrodes are hydrated and generates an interrupt if the electrodes are hydrated. A microcontroller receives the interrupt and transmits a signal representative of a voltage to an electrode of the plurality of electrodes. |
| US09360445B2 |
Relative humidity and condensation measurement with a capacitive humidity sensor
A method and apparatus for measuring relative humidity including condensing environmental conditions using a circuit with a capacitive humidity sensor and a reference resistor each connected to an input of a switch device and thence a quadrature sampling circuit. A sinusoidal source is first connected to the reference resistor and secondly to the capacitive humidity while a signal ground is first connected to the capacitive humidity sensor and secondly to the reference resistor. This produces a first voltage and a second voltage that are each sampled in quadrature. A complex ratio of the sampled voltages is calculated and converted into a representation of relative humidity. |
| US09360441B2 |
Measuring head for a device for measuring the concentration of at least one gas in a gas sample
A measurement head is provided for a device for measuring the concentration of at least one gas, in particular oxygen. A gas sample a measurement element (1) is arranged in the region of an opening on a circuit board (11). To convey gas a duct (16, 17) is formed in each of two metal bodies, which surround the measurement element (1) and serve as magnetic poles. During operation of the measurement head the gas sample flows substantially perpendicularly, first through one of the metal bodies (12, 13), and then through the opening (18) on a side of the measurement element (1) facing the opening and emerges again through the other metal body (14, 15). |
| US09360440B2 |
Non-homogeneous sample handling apparatus and X-ray analyzer applications thereof
A sample handling apparatus/technique/method are provided for a material analyzer, including: a sample cell insert for carrying sample to and from a sample focal area of the analyzer; a removable sample carrying device for providing sample to the cell insert; and an actuator to flow sample from the carrying device to the sample cell insert. The removable sample carrying device may be a syringe, and the actuator pushes a plunger of the syringe to expel the sample to the sample cell insert. The sample cell insert may be mounted onto a sample cell, the sample cell being insertable into the analyzer for sample analysis. The sample handling apparatus may be used in combination with an optic-enabled x-ray analyzer, the x-ray analyzer including an x-ray engine with an x-ray excitation path and an x-ray detection path, wherein the x-ray excitation and/or the x-ray detection path define the sample focal area. |
| US09360439B2 |
Imaging system
An imaging system used for material discrimination of an objet is provided. The imaging system includes an X-ray source and an imaging sensor. The X-ray source generates multienergy polychromatic X-ray, wherein there is an integral-multiple relationship between the multi-energy-band of the X-ray. The object is placed between the X-ray source and the imaging sensor. The X-ray is transmitted toward and imaged by the imaging sensor through the object. An imaging multi-energy-band of the imaging sensor corresponds to the multi-energy-band of the X-ray. |
| US09360438B2 |
Method for radiographically inspecting a component by means of X-ray beams using a smoothing agent and smoothing agent for carrying out the method
The present invention relates to a method for radiographically inspecting a component by means of X-rays, where at least one component surface to be radiographed is provided with a surface structure, with at least the surface provided with the surface structure being smoothed by means of a smoothing material to level out the surface structure, with at least one organic compound and at least one metal powder being used as smoothing material, with the X-ray absorption behavior of the smoothing material essentially equaling the X-ray absorption behavior of the material of the component, as well as to a smoothing material for carrying out the method in accordance with Claim. |
| US09360430B2 |
Induction device
A device for sustaining a plasma in a torch is provided. In certain examples, the device comprises a first electrode configured to couple to a power source and constructed and arranged to provide a loop current along a radial plane of the torch. In some examples, the radial plane of the torch is substantially perpendicular to a longitudinal axis of the torch. |
| US09360427B2 |
Fluorescent detection of curing difference between surfaces
Pyrene can be used as a fluorescent probe for various industrial purposes. For example, it can be included in photocurable or thermally curable compositions and monitoring the fluorescence emission spectra before and after some curing will provide an indication of how much curing has occurred. Such monitoring can be carried out multiple times during a manufacturing process. Monitoring can also be done at different locations of a composition such as at inner and outer surfaces of a photocured or thermally cured layer. |
| US09360422B2 |
Near-infrared optical probe and associated disposable sheath
An optical probe with associated disposable polymer sheath for near-infrared optical interrogation of fluids within bioprocessing vessels by means of transmission or transflection spectroscopy provides for the determination of quantities and parameters of substances in fluids contained within bioprocessing vessels. Associated methods for use of the optical probe and associated sheath to determine quantities of substances in fluids and parameters of fluids during bioprocesses are provided. |
| US09360417B2 |
Gas measurement device
A gas measurement device for measuring the concentration of a plurality of gas components by means of absorption measurement comprising a light source for infrared radiation (3) or a thermal radiator (4) as a light source (5), an optics (22) for bundling the light of the light source (5), a band pass filter (4) and a photoacoustic measurement cell (12) for measuring a plurality of gas concentrations, wherein a Fabry-Perot filter (6) is provided in front of the photoacoustic measurement cell (12) in addition to the band pass filter (4) for selecting the absorption spectra. |
| US09360415B2 |
Dynamic reconstruction of a calibration state of an absorption spectrometer
A reference harmonic absorption curve of a laser absorption spectrometer can have a reference curve shape derived from a reference signal generated by the detector in response to light passing from the laser light source through a reference gas or gas mixture. The reference gas or gas mixture can include one or more of a target analyte and a background gas expected to be present during analysis of the target analyte. A test harmonic absorption curve having a test curve shape is compared with the reference harmonic absorption curve to detect a difference between the test curve shape and the reference curve shape. Operating and/or analytical parameters of the laser absorption spectrometer are adjusted to correct the test curve shape to reduce the difference between the test curve shape and the reference curve shape. |
| US09360410B2 |
Method and particle analyzer for determining a broad particle size distribution
A method and a particle analyzer are provided for determining a particle size distribution of a liquid sample including particles of a lower size range, particles of an intermediate size range, and particles of an upper size range. A dark-field image frame is captured in which the particles of the lower size range and the particles of the intermediate size range are resolved, and a bright-field image frame is captured in which the particles of the intermediate size range and the particles of the upper size range are resolved. Absolute sizes of the particles of the intermediate size range and the particles of the upper size range are determined from the bright-field image frame. Calibrated sizes of the particles of the lower size range are determined from the dark-field image frame by using the particles of the intermediate size range as internal calibration standards. |
| US09360406B2 |
Method and apparatus for self-calibration of density profiler
A process and system for self-calibration of a density profiler is disclosed. The process may include measuring a density profile of a fluid in a vessel using a plurality of sensors or a single sensor, and measuring a density profile of the fluid in the vessel using a plurality of sample ports. A density of the fluid proximate a location of at least one of the plurality of sample ports based on the sensor measured density profile may then be interpolated. A density of the fluid proximate a location of at least one of the plurality of sensors based on the sample port measured density profile may also be interpolated. Adjustment of a calibration of at least one of the plurality of sensors may then be made based on both the interpolated sample port density and the interpolated sensor density. |
| US09360405B2 |
Instrument for gravimetric moisture determination with position-changing device
An instrument (10) for gravimetrically determining moisture content has a housing (20), with a weighing device (40) arranged inside. The weighing device (40) has a load receiver (60) onto which a sample (62) is placed. The housing has a stationary housing part (21) and a movable housing part (22), the movable housing part alternately occupying a measuring position and a loading position. In the loading position, the respective housing parts are spaced apart from each other, allowing a sample to be put on the load receiver. In the measuring position, the respective housing parts form an essentially enclosed testing compartment (30) that surrounds the load receiver. A means (70), arranged in the testing compartment, heats a sample that is placed on the load receiver. The movable housing part is moved between the respective positions by a position-changing device. |
| US09360404B2 |
Filtering member and filtering method
It has been difficult to conduct high-sensitivity, high-precision measurement due to externally generated contamination or cross-contamination. Thus, the invention includes (1) a filter unit having a filter at a bottom of a container for holding a liquid, the filter being adapted to filter a liquid, and (2) an attachment cover having a first opening and a second opening, the filter unit being attachable to and detachable from the attachment cover via the first opening, and the attachment cover being adapted to, when the filter unit is attached to the attachment cover, allow filtration by the filter in a state in which an inner face of the attachment cover is tightly in contact with an outer face of the filter unit, and discharge a resulting filtrate through the second opening. |
| US09360402B2 |
Electrokinetic device for capturing assayable agents in a dielectric fluid utilizing removable electrodes
Electrokinetic devices and methods are described with the purpose of collecting assayable agents from a dielectric fluid medium. Electrokinetic flow may be induced by the use of plasma generation at high voltage electrodes and consequent transport of charged particles in an electric voltage gradient. In one embodiment, an ionic propulsion device for providing a sample for a bio-specific assay of aerosol particles comprises a housing receiving a sample of aerosol particles and enclosing a high voltage electrode to generate a plasma of electrically charged particles. A carrier assembly is removably receivable in the housing, the carrier assembly comprising a non-conductive carrier and an electrode removably secured to the carrier. Incident to the carrier assembly being received in the housing, the electrode is subject to a voltage so that flow of charged aerosol particles generates a net air flow through the housing and said charged aerosol particles are deposited on the electrode, and said electrode can be removed from said carrier and placed in an extraction vessel for a bio-specific assay. |
| US09360398B2 |
Devices and methods for the collection and detection of substances
The present invention provides a single self-contained device for collecting, extracting, on-site testing, and transferring for forensic confirmatory analysis, a wide variety of substances including, but not limited to, drugs of abuse, explosives, weapons of mass destruction, food toxins and industrial wastes. Samples can be obtained from a surface by swabbing a suspect area or the testing of solid materials (pills, capsules, powders), air samples and biological and non-biological fluids by placing the substance in the device. The device includes a swab, a retention well including a wash, and analysis technologies that can be, for example, a lateral flow testing system. The swab is rinsed with a wash prior to testing thereby not compromising the chemistry of the detection technologies and allowing for a wide variety of applications under a number of field conditions. Also, the device is a single self-contained unit instead of having a separate reagent droppers or sprays, making it compact and easy to use. Moreover, the device is designed to not only collect and test samples but to seal the originally target analyte, not affected by testing procedures, in a specially designed cap for shipping under chain of custody documentation to a forensic laboratory for confirmatory testing. |
| US09360393B2 |
Determining damage and remaining useful life of rotating machinery including drive trains, gearboxes, and generators
A method for predicting remaining useful life of a wind or water turbine or component determines in step (116) an accumulated damage for the turbine or component and compares this in step (118) to preset damage limit obtained in step (114). This provides a simple approach to estimating remaining useful life, giving the turbine operator an indication of the condition of turbines or farms under management. |
| US09360386B2 |
Amplifier-embedded pressure sensor
An amplifier-embedded pressure sensor includes: a pressure-detecting element which detects the differential pressure between the fluid and the space where the pipe including a fluid passage of the fluid is installed, and outputs the pressure signal; an amplifier circuit board having an amplifier circuit for amplifying the pressure signal; a housing to which the pressure-detecting element is fixed; and a separation part which is fixed to the housing and separates a space inside the housing into a first space where the pressure-detecting element is disposed and a second space where the amplifier circuit board is disposed. The housing includes an inflow port for letting cooling gas for cooling the amplifier circuit board flow into the second space and a discharge port for discharging the cooling gas from the second space. |
| US09360383B2 |
System and method to measure force or location on an L-beam
Force and location sensing systems and methods are disclosed. A method comprises bending a L-beam at an initially unknown location on a force-supporting portion of the L-beam, the L-beam substantially having a tension side and a compression side, measuring a first local stress at a first location on the tension side, measuring a second local stress at a second location on the tension side, measuring a third local stress at a third location on the compression side, and measuring a fourth local stress at a fourth location on the compression side. A weight-sensing storage system capable of tracking removed items is disclosed with a product image captured via a camera, a plurality of sensors on an L-beam, a first signal from the plurality of sensors indicating a first state prior to change of the product image, and a second signal indicating lower strain on the L-beam than the first signal. |
| US09360380B2 |
Method and apparatus for monitoring waterbed environment using temperature measurements
A method and apparatus for monitoring waterbed environment are described. The method may comprise determining a first temperature at a location within the water column of a surface body of water that is representative of the upper thermal boundary condition between surface water and pore water environments, and determining at least a second temperature at the location at a first depth below a waterbed surface. The first and second temperatures are then used to monitor a waterbed environment. Certain embodiments are particularly useful for monitoring spatiotemporal variations of riverbed surface elevations, such as scour and deposition, over a time period. Probe/sensor assemblies are disclosed for practicing the method. |
| US09360377B2 |
Non-intrusive temperature measurement assembly
A temperature sensor assembly for use with a process vessel wall includes a base structure, a first temperature sensor, a second temperature sensor, and a processor. The base structure forms a contact area with an external surface of the process vessel wall. The first temperature sensor extends through the base structure to measure a temperature of the external surface of the process vessel wall. The second temperature sensor is at a second surface spaced from the first surface to measure a temperature of the second surface of the base structure. The processor is connected to the first and second temperature sensors, and adapted to determine an internal process vessel wall temperature value as a function of the measured temperature of the external surface of the process vessel wall, the measured temperature of the second surface of the base structure, base structure parameters, and process vessel wall parameters. |
| US09360374B2 |
Laser adjustment device, laser adjustment system and laser adjustment method for infrared radiation thermometer thereof
The invention is directed to a laser adjustment device, a laser adjustment system and a laser adjustment method for an infrared thermometer. The laser adjustment device of the present invention includes a first adjustment seat and a second adjustment seat. The first adjustment seat includes a base, a fixing portion, a first adjustment portion, a second adjustment portion, and a first pivot portion. The second adjustment seat includes a connecting portion, a receiving portion and a second pivot portion. The first adjustment seat is pivoted about the first pivoting portion via the first adjustment portion, a first elastic member, and a first adjustment member. The second adjustment seat is pivoted about the second pivot portion via the second adjustment portion, a second elastic member, and a second adjustment member. |
| US09360372B2 |
System and method for using a portable near IR LED light source and photogrammetry for boresight harmonization of aircraft and ground vehicle components
Disclosed is a system and method for using a portable near (infrared light emitting diode) IR LED light source and photogrammetry for boresight harmonization of aircraft and ground vehicle components. In one embodiment, orientation and positional parameters of two or more fixed points and distances between the two or more fixed points are measured using the portable near IR LED light source with a photogrammetric system. The two or more fixed points are reference points within the aircraft or the land vehicle. Further, the measured orientation and positional parameters of the two or more fixed points and the distances between the two or more fixed points on the aircraft or the land vehicle are compared with specified design parameters of the component in the aircraft or the land vehicle. Furthermore, the component in the aircraft or the land vehicle is harmonized based on an outcome of the comparison. |
| US09360366B1 |
Self-referencing spectrometer on mobile computing device
This invention discloses a self-referencing spectrometer that simultaneously auto-calibrate and measure optical spectra of physical object utilizing shared aperture as optical inputs. The concurrent measure and self-calibrate capabilities makes it possible as an attachment spectrometer on a mobile computing device without requiring an off-line calibration with an external reference light source. Through the mobile computing device, the obtained spectral information and imagery captured can be distributed through the wireless communication networks. |
| US09360359B2 |
Fluid meter with improved piston guidance
The invention relates to a fluid meter (27) comprising a housing (28) defining at least one crankcase (29) and two cylinders (25, 26), a crankshaft (11) disposed in the crankcase (29), two pistons (3, 4) respectively mounted in the cylinders (25, 26) for reciprocal movement, a first connecting rod (12) connected to one of the pistons (3) and to the crankshaft (11) for rotating the crankshaft (11) in response to the movement of the one piston (3), and a second connecting rod (13) connected to the other piston (4) and to the crankshaft (11) for rotating the crankshaft (11) in response to the movement of the other piston (4), wherein the first and second connecting rods (12, 13) have yoke slots (16, 17) for receiving a crank pin (19) radially offset from the crankshaft (11). The invention is characterised in that the first connecting rod (12) has a guiding rod (20) extending in a longitudinal direction of the cylinders, the guiding rod (20) being adapted to engage a corresponding cavity (22) in the second connecting rod (13) to support and guide the connecting rods (12, 13) in relation to each other during movement. The invention further relates to a multiple fluid meter assembly (61) comprising at least two fluid meters (27) as defined above, and to a fuel dispensing unit comprising a fluid meter (27) or a multiple fluid meter (61) as defined above. |
| US09360352B2 |
Method for determining lightning hazard distribution of power network
A method for determining a lightning hazard distribution of a power network, includes: deriving a shielding failure lightning hazard distribution of the power network and a back flashover lightning hazard distribution of the power network from the number of ground lightning in each grid and ranges of hazardous currents, and deriving a historical lightning hazard distribution of the power network from a lightning faults database of the power network and the grids; and determining the lightning hazard distribution of the power network by integrating the shielding failure lightning hazard distribution of the power network, the back flashover lightning hazard distribution of the power network and the historical lightning hazard distribution of the power network. |
| US09360349B2 |
Capsule for scientific instrument
A capsule including two shells secured to each other so to be joined by a common closed surface and together defining, on both sides of the surface, a closed space delimited by the shells. At least one of the two shells is a flexible membrane configured to deform under effect of a physical magnitude. At least the membrane is made of at least partially amorphous metal alloy to optimize dimensions of the capsule. |
| US09360346B2 |
Monitoring a black cell enviroment in real-time
A system of monitoring a black cell environment using sensors is presented, in which the sensors can be easily replaced during a sealed period of the black cell environment. The black-cell monitoring system includes at least one sealed vessel that is disposed within the black cell environment. The vessel is configured to store a hazardous mixed substance and is sealed from the external environment for a pre-determined amount of time. The black-cell monitoring system also includes at least one tubing that extends from the outside of the vessel to the inside of the vessel. The black-cell monitoring system also includes a fiber optic cable that is disposed within the lumen of the tubing. At least a portion of the fiber optic cable is disposed within a portion of the tubing located inside the sealed vessel. |
| US09360344B2 |
Parallel reading of an analog sensor by two control units
An arrangement for reading a sensor element in a vehicle includes a sensor element. The sensor element has at least one analog signal output. The arrangement further includes a first control unit. The first control unit has at least one first signal input. The arrangement further includes a second control unit. The second control unit has at least one second signal input. The signal output is connected to the at least one first signal input. The signal output is further connected to the at least one second signal input using a voltage divider. |
| US09360343B2 |
Monitoring use of a single arm walking aid
A method, system or computer usable program product for monitoring single arm walking aid use of a user including providing a sensor on at least one of a left shoe, a right shoe and a single arm walking aid, using the sensor, determining a relative position of a set of footsteps by a left foot, a set of footsteps by a right foot, and a set of placements of the single arm walking aid, and using the relative position data, determining whether the user is practicing correct single arm walking aid use. |
| US09360341B2 |
Map preparation apparatus and computer-readable medium
A map preparation apparatus includes a position information acquisition section, an input information acquisition section, and a selection section. The position information acquisition section acquires position information of a user who is moving. The input information acquisition section acquires input information including a date and time when the user starts moving and a date and time when the user finishes moving. The selection section selects map information from preregistered map information on the basis of the position information acquired by the position information acquisition section and on the basis of the input information acquired by the input information acquisition section. The selected map information includes a route in a ratio equal to or larger than a predetermined ratio. The route is taken from the date and time when the user starts moving to the date and time when the user finishes moving. |
| US09360336B2 |
Navigation device having a range indicator for an electric driving operation and motor vehicle having a navigation device
A navigation device has an evaluation unit for determining a maximal range, which can be traveled in the current driving operation mode with an amount of energy stored in an energy storage device of the motor vehicle, and a display unit for displaying a road map, on which a border of an action field delimited by the determined at least one maximum range is presented. A range indicator can be adapted with low expenditure to different types of road maps. On the basis of the graphic data of the road map to be indicated, a graphic processing unit produces a representation of the road map with a region that is offset in terms of height in relation to a map plane. An extension of a border of the region that is offset in terms of height corresponds to the extension of the border of the action field. |
| US09360335B1 |
Dynamic rerouting during navigation
Initial navigation directions are generated to guide a vehicle along an initial route between an origin and a destination. When the vehicle is a certain location disposed along the initial route, an alternate route to the destination is determined, such that the alternate route and the initial route diverge at a point of divergence between the current location of the vehicle and the destination. Boundaries of an announcement window within which the alternate route can be suggested are determined in view of a current speed of the vehicle. When the point of divergence is within the announcement window, generating, by the one or more processors, an interactive prompt to suggest that the alternate route be selected, such that the interactive prompt is not generated when the point of divergence is outside the announcement window. |
| US09360334B2 |
System and method for setting an end location of a path
A system for setting an end location of a path of operation of a machine at a work site includes a position sensor configured to determine a position of a path at the work site and a controller. The controller is configured to determine a position of a first path and a position of a second path, the first path and the second path defining a pair of paths on opposite sides of the path of operation and determine a physical characteristic of the pair of paths based upon the position of the first path and the position of the second path. The controller is further configured to determine whether the physical characteristic of the pair of paths is less than a threshold characteristic and set the end location of the path of operation if the physical characteristic of the pair of paths is less than the threshold characteristic. |
| US09360333B2 |
Method and apparatus calculating estimated time of arrival from multiple devices and services
An approach is provided for calculating a final estimated time of arrival to at least one destination location based, at least in part, on multiple estimated time of arrival provided by one or more devices and/or services for one or more routing segments. The approach involves determining at least one route, wherein the at least one route includes a plurality of segments navigated using a plurality of devices or services. The approach also involves receiving at least one individual estimated time of arrival from at least one of the plurality of devices or services, wherein the at least one individual estimated time of arrival is for at least one of the plurality of segments associated with the at least one of the plurality of devices or services, and wherein the at least one individual estimated time of arrival is calculated independently by the at least one of the plurality of devices or services. The approach further involves causing, at least in part, a calculation of a total estimated time of arrival based, at least in part, on the at least one individual estimated time of arrival. |
| US09360331B2 |
Transfer of data from image-data-based map services into an assistance system
A method for transferring data from an image-data-based map service for use in an assistance system of a vehicle includes the following: ascertaining the position and/or orientation of the vehicle, retrieving image data of the vehicle surroundings from the image-data-based map service, extracting items of information from the image data of the map service, and transferring the items of information into the assistance system. |
| US09360329B2 |
Navigation device and position registration method
The present invention provides a navigation device which includes an obtaining unit that, when updating contents introduction data which introduces the latest updating contents of an arbitrary home page is sent from the outside, obtains the updating contents introduction data, a position information generation unit that generates position information according to the latitude and longitude information included in the updating contents introduction data, and a position registration unit that registers the position information in a predetermined storage unit. |
| US09360328B2 |
Apparatus and method for recognizing driving environment for autonomous vehicle
An apparatus and a method are provided for recognizing driving environment for an autonomous vehicle. The apparatus includes a controller configured to receive navigation information from a satellite navigation receiver. The controller is further configured to receive map data from a map storage and image data from an image sensor regarding captured images from around a vehicle and distance information from a distance sensor regarding sensed objects positioned around the vehicle. The controller is also configured to determine a fusion method for information measured by the image sensor and the distance sensor based on a receiving state of the satellite navigation receiver and precision of the map data to recognize the driving environment. |
| US09360321B2 |
Navigation based on at least one sensor and a three dimensional map
The invention relates to a method for navigation of an aerial vehicle. The method comprises providing a sensor image from an aerial vehicle sensor. The method also comprises to repeatedly, until at least one predetermined criterion is reached, perform the step of setting input data, where the input data comprises information related to pitch angle, roll angle, yaw angle and three-dimensional position of the aerial vehicle, the step of providing a two-dimensional image from a database based on the input data, where the database comprises three-dimensional geo-referenced information of the environment, and the step of comparing the sensor image and the two dimensional image from the database. The method further comprises using the input data for which the two images correspond best to each other for determining at least one of the following quantities pitch angle, roll angle, yaw angle and three-dimensional position of the aerial vehicle. The invention also relates to a system, a computer program and a computer program product. |
| US09360320B2 |
Autonomous coordination of agents via attraction and repulsion
A method of controlling movement of an agent operating within an autonomous system includes determining, using a processing device associated with the agent, at least one point of interest (POI) within an area of operation by the autonomous system; determining, from the at least one POI, a POI of highest attraction for the agent and calculating an attraction force for the agent, based on the location of the POI of highest attraction; determining proximity of the agent to one or more additional agents operating within the autonomous system, and calculating a repulsion force for the agent so as to maintain a minimum separating distance between the agent and the one or more additional agents; calculating a resultant force for the agent based on the attraction force and the repulsion force; and changing a direction of the agent based on the resultant force. |
| US09360318B1 |
Gyro MEMS sensor package
An integrated circuit packaging structure comprises at least one Micro Electrical Mechanical Systems (MEMS) gyroscope die mounted directly on a multi-layer flexible substrate having at least one metal layer and wire-bonded to the flexible substrate and a lid or die coating protecting the MEMS die and wire bonds. |
| US09360316B2 |
System architecture for a constant footprint, constant GSD, constant spatial resolution linescanner
A line scanner scans in a cross track direction and moves forward on a platform in an along track direction. The line scanner includes a plurality of detectors forming a left array and a plurality of detectors forming a right array. The left array and the right array are tilted away from a line formed in the along track direction. The left array is configured to detect scene radiance from a surface of an object when the line scanner is scanning the surface on the right side of the line formed in the along track direction. The right array is configured to detect scene radiance from the surface of the object when the line scanner is scanning the surface to the left side of the line formed in the along track direction. The detectors in each respective array are configured to simultaneously detect the scene radiance. |
| US09360313B2 |
Compass and clinometer apparatus having the compass
A compass includes a case, a first support shaft, a second support shaft, and a needle. The case includes an upper plate, a lower plate, and a side wall that connects edge portions of the upper plate and the lower plate. The first support shaft is coupled to the lower plate and protrudes toward the upper plate, and the second support shaft is coupled to the upper plate and protrudes toward the lower plate. The needle includes a support unit, a first indicator unit, and a second indicator unit. The support unit is disposed between the first support shaft and the second support shaft, and includes a first support groove that is formed close to the first support shaft and a second support groove that is formed close to the second support shaft. The first indicator unit is coupled to one side of the support unit, and the second indicator unit is coupled to the support unit to face the first indicator unit with the support unit therebetween. |
| US09360309B2 |
Method and apparatus for monitoring of component housing wall thickness and wear monitoring
A method for monitoring wall thickness of an industrial piping component or pump/fluid machinery, including a pump casing for a pump used for pumping an abrasive fluid or slurry, comprising providing a signal containing information about a ultrasonic-based transducer pulse from a discrete ultrasonic-based transducer attached directly on an industrial piping component or pump/fluid machinery at a local point of interest and configured to inject the ultrasonic-based transducer pulse into the industrial piping component or pump/fluid machinery at the local point of interest and sense the ultrasonic-based transducer pulse reflected off a wall of the industrial piping component or pump/fluid machinery at the local point of interest; and determining with an electronic monitoring system the thickness of the wall of the industrial piping component or pump/fluid machinery at the local point of interest based at least partly on the signal received containing information about the discrete ultrasonic-based transducer pulse sensed. The discrete ultrasonic-based transducer may include a discrete ultrasonic-based piezoelectric transducer. |
| US09360308B2 |
Methods for measuring a thickness of an object
A method for analyzing an object includes measuring a first reflectivity of light from a surface and measuring a second reflectivity of light from the object, after the object is formed on the surface. A variation between the first and second reflectivities is calculated, and the variation is transformed by a predetermined transform. A thickness of the object is determined based on the transformed variation. |
| US09360302B2 |
Film thickness monitor
A measurement unit comprising a light source and a photodetector may be formed in a cavity in a substrate. The light source produces light that impinges a material layer and is reflected back to the photodetector. Through methods such as interferometry and ellipsometry, the thickness of the material layer may be calculated from the light intensity data measured by the photodetector. It is emphasized that this abstract is provided to comply with the rules requiring an abstract that will allow a searcher or other reader to quickly ascertain the subject matter of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims. |
| US09360299B1 |
Incoherent digital holographic adaptive optics
In one embodiment, generating an aberration-compensated image of an object field includes generating a full-field complex hologram of the object field, generating a guide star complex hologram of a guide star selected from the object field, performing mathematical correlation between the guide star complex hologram and the full-field complex hologram, and generating from the correlation an aberration-compensated image of the object field from the correlation. |
| US09360298B2 |
Surface emitting laser and optical coherence tomography measuring apparatus using the surface emitting laser
A surface emitting laser operable to change a wavelength of emitted light includes a first reflecting mirror, a second reflecting mirror, wherein a cavity is formed between the first reflecting mirror and the second reflecting mirror along the optical axis of the surface emitting laser, an active layer formed within the cavity, a region formed within the cavity, and a movable part situated within the region, the movable part having a refractive index different from a refractive index of the region. The wavelength of emitted light is changeable by changing the position of the movable part along the direction of the optical axis in the region. |
| US09360297B2 |
Optical coherence tomography device having a plurality of calibration reflecting surfaces
Provided is an optical tomographic device including a measurement optical system that irradiates light from a light source to inside a subject and guides reflected light therefrom; a reference optical system that guides the light from the light source as reference light; a calibration optical system that irradiates a calibration reflecting surface with light from the light source, and guides the reflected light reflected by the calibration reflecting surface; a light-receiving element that receives the interfering light for measurement formed by synthesizing the reflected light guided by the measurement optical system and the reference light, and the interfering light for calibration formed by synthesizing the reflected light guided by the calibration optical system and the reference light; and an arithmetic logic unit that corrects the received interfering light for measurement by using an analysis result obtained by analyzing the received the interfering light for calibration. |
| US09360291B2 |
Systems and methods for control and calibration of a CMM
A method of operating an articulated arm CMM is provided. Instructions for the CMM can be inputted to the CMM arm by an action chosen from the group consisting of placing the arm in a predefined position and moving the arm in a predefined manner. |
| US09360290B2 |
CMM with modular functionality
An articulated arm CMM system comprises an articulated arm comprising a plurality of articulated arm members, a measuring probe at a distal end, and a base at a proximal end, the base comprising a docking portion. The articulated arm CMM system also includes a plurality of feature packs configured to electronically connect to the articulated arm via the docking portions and provide additional electronic functionality. |
| US09360285B1 |
Projectile cartridge for a hybrid capillary variable velocity electric gun
A projectile cartridge for a hybrid capillary variable velocity electric launcher comprising a launcher and breech/barrel assembly as well as a projectile and a pulsed power supply for supplying adjustable amounts of electric energy to permit variable projectile velocity. The projectile cartridge also includes at least an anode and cathode section, a fuse wire, a capillary liner, and the projectile, which may include both a slug and a sabot jacket. A hybridization medium is included with restraining mechanisms. |
| US09360280B2 |
Barrier mounting apparatus
An assembly for use in a shield includes a protective panel, protective panel securing hardware and an adjustable mount. The protective panel is ballistic-resistant and/or blast resistant. The protective panel securing hardware secures the protective panel to the adjustable mount and to extend in an upwards direction from the adjustable mount. The adjustable mount is structured and sized to be securable on top of shield bases having a plurality of alternative geometries. |
| US09360276B1 |
Holster holder
Certain exemplary embodiments can provide a system, machine, assembly, device, and/or manufacture, such as an ambidextrous and/or reversible holster holder, that can be reversibly configured for mounting a belt-attaching holster to an approximately vertical surface in either a right-hand arrangement or a left-hand arrangement, the belt-attaching holster potentially comprising a belt loop and/or a belt clip. |
| US09360274B2 |
Sling strap retention device
A sling strap retention device is provided. The sling strap retention device includes a structure with a first flexible member and a second flexible member, the first flexible member and the second flexible member further comprising a first end and a second end, a first side and a second side, a front surface, and a back surface, wherein the first and second flexible members may be oriented one over the other with the back sides of the first and second flexible members in opposition and coupled along a length of the members. The first and second flexible members may be configured to flex and couple to one another to form opposing closed loops. These closed loops may be configured to couple to and retain therein a sling strap of a weapon. |
| US09360273B1 |
Firearm retaining apparatus
Embodiments provide a firearm retaining apparatus. |
| US09360272B2 |
Adjustable buttstock clamp
An adjustable buttstock clamp for a rifle is disclosed which includes a cam lever having a mechanical locking feature configured to engage with a groove in a buttstock extension shaft when in the locked position. A buttstock recoil pad may be attached to an extension shaft that can telescope in and out of the body of the buttstock, allowing the user to adjust the length of pull of the rifle and angle of the recoil pad. In one embodiment, the shaft includes a number of grooves on its surface along the length of the shaft and the shaft is held in place using a band clamp that is activated by the cam lever. When the cam lever is in the locked position, the locking feature engages with one of the grooves of the shaft to hold the buttstock recoil pad at the desired length and angle. |
| US09360270B2 |
Launcher with multi-part pusher, and method
A launcher includes a pusher that has parts that move relative to one another to provide desired forces or accelerations to corresponding parts of an object to be launched. Pressurized gasses are used to move the pusher to eject the object from the launcher. The parts of the pusher engage the different parts of the object to account for differences in shape and/or orientation of the parts of the objects, and to provide desired accelerations to the object parts. The pusher parts may include a piston or diaphragm that moves relative to an outer annular part of the pusher. The piston or diaphragm may press against a warhead explosive or other payload of a missile, with the outer part pressing against a fuselage or casing of the missile, in which the payload is mounted. Use of the pusher with multiple parts minimizes stresses between the object parts. |
| US09360268B2 |
Crossbow with a release mechanism
A trigger mechanism for use in a crossbow having a bowstring, the trigger mechanism comprising a housing having a slot formed therein, a trigger lever pivotally mounted in the housing and having a trigger that extends partially outside the housing, a catch pivotally mounted in the housing, and a disarm mechanism received in the housing that is moveable between a neutral first position and a disarm second position. The catch has a first end configured to retain the bowstring in a cocked position and a second end configured to operatively engage the trigger lever. When the disarm mechanism is in the disarm second position and the user draws the bowstring further into the housing slot, the trigger mechanism is configured to allow the catch to move from the catch first position into the catch second position without requiring the user to engage the trigger (e.g., squeezing or pulling the trigger). |
| US09360267B1 |
Archery bow string draw board
An archery bow draw board for an anchored compound archery bow having a riser, limbs, at least one cam with a pulley, or two cams, a bow string with a cable. The draw board is connectable to the bow string and includes a base plate supporting a gallows vertical pole and a gear box and side plate fixed therebelow. A worm drive on a shaft is mounted within the gear box and is turnable by an outwardly extending crank handle. An axel with a fixed reel and worm gear extends from the side plate into the gear housing wherein the worm gear meshes with the worm drive to drive the reel in either direction by turning the crank. The worm drive and worm gear hold the reel in place upon releasing the crank. A gallows horizontal extension is located on top of the gallows pole with a first pulley, and a second pulley in line with and spaced from the first pulley away from the gallows pole. A cord is wrapped around the reel and extending upwardly along the pole to the horizontal extension and over the pulleys and then downwardly adapted to hook onto and pull the draw string. Numeric indicia is fixed on the gallows pole and a bow draw length marker coordinated on the cord indicates draw length of bow string pulled by the draw board. A scale maybe placed between the cord and the bow string to indicate actual draw poundage as the bow string is pulled. |
| US09360265B2 |
Mechanism for defeating armor using ballistic weapons
A system includes a ballistic weapon having a barrel and a firing system having a controller. The controller is configured to receive a firing command and in response, when operating in a first mode of operation, to trigger repeated firing of the ballistic weapon such that the barrel of the ballistic weapon reseats in between consecutive firings of the ballistic weapon. The controller may also be configured to receive the firing command and in response, when operating in a second mode of operation, to trigger a single firing of the ballistic weapon. The controller may further be configured to receive the firing command and in response, when operating in a third mode of operation, to trigger repeated firing of the ballistic weapon such that the barrel of the ballistic weapon does not reseat in between consecutive firings of the ballistic weapon. |
| US09360262B2 |
Heat exchanger for vehicle
A heat exchanger for a vehicle is disclosed. The heat exchanger includes a heat radiating portion provided with first and second connecting lines formed alternately by stacking a plurality of plates, and receiving first and second operating fluids respectively into the first and second connecting lines. The first and second operating fluids exchange heat with each other during passing through the first and second connecting lines. The heat exchanger also includes a bifurcating portion connecting an inflow hole for flowing one operating fluid of the first and second operating fluids with an exhaust hole for exhausting the one operating fluid, adapted for the one operating fluid to bypass the heat radiating portion according to a temperature of the one operating fluid, and mounted at an exterior of the heat radiating portion. |
| US09360258B2 |
Fin configuration for air cooled heat exchanger tubes
An air cooled, finned heat exchanger tube includes a metallic tube through which fluid to be cooled is flowable. The tube has an outer surface on which axially spaced axial indentations are formed over its circumference, and a plurality of axially spaced fins each of which has a main element formed with heat transfer promoting patterns and a base angled with respect to said main element. The base is frictionally and irremovably secured within a corresponding indentation so that said tube outer surface is completely covered. |
| US09360254B2 |
Expandable raku kiln
A raku kiln has a fire ring with a cylindrical sidewall and bottom made of refractory material with a kiln shelf supported a few inches above the bottom to enclose a space that is superheated by burners. A firing-chamber rests on the fire ring and is lifted by a two aligned pulleys on top of a pole which rotates to move the chamber out of the way. A vertical pole mates with tubes on the chamber for vertical guidance during raising and lowering of the chamber. Flanges on the lower end of the chamber allow adding an extension chamber. |
| US09360252B2 |
Process and apparatus for removing heat and water from flue gas
Disclosed is a process for use with flue gas having a moisture content M. The flue gas is introduced to strong brine adapted to exothermically absorb moisture. Simultaneously, heat is withdrawn. This produces heat, water-enriched brine and a gas having a moisture concentration less than M. The strong brine can be recovered by distillation from enriched brine to produce water. The brine temperature throughout absorption can remain within 2° F. of a temperature T in the range 220° F.-300° F. The heat withdrawal can be associated with gas-liquid phase change of a working fluid. The terminus of the heat flow can be associated with gas-liquid phase change of the working fluid. The working fluid can: as liquid, flow only by gravity, convection or wicking; and, as gas, flow only by diffusion or convection. The heat flow can drive a boiler producing steam. M can be greater than 15 wt. % water. |
| US09360251B2 |
Method and integrated device for separating air and heating an air gas originating from an air separation device
The invention relates to an integrated device for separating air and heating a gas in the air resulting from said air separation, comprising: an air separation device (9); a heat exchanger (13, 43); a channel for conveying the gas in the air to the heat exchanger; and a channel for conveying water to the heat exchanger, the water-conveying channel being connected to the water inlet or water outlet of a water preheat exchanger (5) or a water deaerator (27). According to the invention, the preheat exchanger and/or the deaerator are connected to an oxy-combustion boiler (19) in order to convey water to and from the boiler, said boiler also being connected to the separation device in order to receive an oxygen-enriched gas (17). |
| US09360244B2 |
Engine driven heat pump
An engine driven heat pump includes a temperature switch that opens and closes in accordance with the peripheral temperature of an inverter and a control device that includes a signal reception unit, and a temperature open contact point that opens at a predetermined temperature or higher is provided in the temperature switch, and an abnormal-time open contact point that opens when abnormality occurs in a battery charging circuit is provided in the battery charging circuit, and a signal generation contact point that generates a state signal indicating a state of the inverter is provided in the inverter, and the temperature open contact of point the temperature switch, the abnormal-time open contact point of the battery charging circuit, and the signal generation contact point of the inverter are connected in series with respect to the signal reception unit of the control device. |
| US09360236B2 |
Thermal energy system and method of operation
A thermal energy system includes a first thermal energy system, a closed loop geothermal energy system, an intermediate heat pump thermally coupling the first thermal energy system with the geothermal energy system, and a second thermal energy system thermally connected to the geothermal energy system. The first and second thermal energy systems have opposite net thermal energy demands from the geothermal system. The geothermal energy system has first and second groups of borehole heat exchangers and each borehole heat exchanger contains a working fluid. Each borehole heat exchanger includes an elongated tube having a closed bottom end and first and second adjacent elongated conduits interconnected at the bottom end. Each group of borehole heat exchanger is selectively and alternatively connectable to the intermediate heat pump. The first thermal energy system may be a refrigeration system having condensers and the closed loop geothermal energy system may provide cooling of the condensers. |
| US09360234B2 |
System for improved hybridization of thermal solar and biomass and fossil fuel based energy systems
A hybridization system (15) for use in a hybrid energy plant (35, 50, 60, 70) that includes a first thermal energy unit (10) powered by solar energy and a second non-solar thermal energy unit (11) for providing thermal energy to a user (16) via first and second heat transfer fluids (HTF) respectively. The hybridization system includes a mixing unit (45) for mixing the thermal energy of the first and second heat transfer fluids either directly or indirectly so as to form a unified heat transfer fluid that is fed to the user. In some embodiments a thermal energy storage unit (28) and mixing unit (45) are coupled directly or indirectly to the first and second thermal energy units for receiving, storing and mixing thermal energy from the thermal energy units, so as to form either directly or indirectly a unified heat transfer fluid that is fed to the user. |
| US09360233B2 |
Heated container having chemical heating mechanism
A self-heating food container configured to hold food and to heat food within the container is provided. The container includes a body wall. A space is defined within the body wall. A chemical heater is located within the space, which upon activation, is configured to generate heat, thereby increasing the temperature of the contents cavity. |
| US09360228B2 |
Ventilation control system and method
A system and method of controlling a ventilation system is provided based on a determination of local dew point and automatically activating an exhaust fan before condensate appears on structure and objects and ideally before visible condensation forms in the air of an enclosed area. Firmware in the control circuit detects the presence of hardware components and operates a control circuit in one of a plurality of modes based on the detected hardware components that are coupled to the control circuit. |
| US09360222B1 |
Axilinear shaped charge
This invention is a shaped explosive device with a liner that produces a single combination jet consisting of a forward rod portion and rearward flattened spade shaped portion, this jet has a velocity gradient form tip to tail. The jet produced by the shaped charge is axisymmetric for the forward rod portion and planar symmetric for the aft wide spade portion somewhat like linear shaped charge, thusly termed the “Axi-Linear” shaped charge. The forward rod portion of each jet erodes a round hole in the target followed by the aft flattened spade portion of the jet creating a long slotted deep cavity centered on the round hole and in the lateral direction of the spade jet. |
| US09360221B2 |
Gas turbine burner
A gas turbine includes a compressor and at least one combustor downstream from the compressor. The combustor includes a burner having an inner shroud extending axially along at least a portion of the burner, an outer shroud radially separated from the inner shroud and extending axially along at least a portion of the burner, and a plurality of stator vanes extending radially between the inner shroud and the outer shroud. The stator vanes have an inner end proximate the inner shroud and an outer end proximate the outer shroud. The burner further includes a vortex tip at one of either the inner end or the outer end of the stator vanes. The vortex tip provides a gap between the inner end and the inner shroud or the outer end and the outer shroud, and the vortex tip includes a plurality of fuel ports. The gas turbine further includes a turbine downstream from the combustor. |
| US09360220B2 |
Micro-mixer nozzle
The present application provides a micro-mixer combustion nozzle for mixing a flow of fuel and a flow of air in a gas turbine engine. The micro-mixer combustion nozzle may include a fuel plate with a number of fuel plate apertures and a fuel plate passage in communication with the flow of fuel and an air plate with a number of air plate apertures and an air plate passage in communication with the flow of air. The fuel plate passage and the air plate passage may align to mix in part the flow of fuel and the flow of air. |
| US09360218B2 |
Injection device for a combustion chamber of a turbine engine
A fuel injection device is provided. The device includes a pilot injector opening out into a venturi and an annular row of multipoint injection orifices opening out axially in a downstream direction and radially outside the venturi, the venturi being connected at its downstream end to a separation wall. The outer peripheral edge of the separation wall has a diameter greater than the diameter of the annular row of injection orifices, whereby the separation wall forms a thermal protection screen for these orifices against heat radiation coming from the chamber. |
| US09360217B2 |
Flow sleeve for a combustion module of a gas turbine
A combustion module for a combustor of a gas turbine includes an annular fuel distribution manifold disposed at an upstream end of the combustion module. The fuel distribution manifold includes an annular support sleeve having an inner surface. The combustion module further includes a fuel injection assembly having an annular combustion liner that extends downstream from the fuel distribution manifold and that terminates at an aft frame, and an annular flow sleeve that circumferentially surrounds the combustion liner. The flow sleeve extends downstream from the fuel distribution manifold and terminates at the aft frame. The flow sleeve extends continuously between the support sleeve and the aft frame. A forward portion of the flow sleeve is positioned concentrically within the support sleeve where the forward portion is slidingly engaged with the inner surface of the support sleeve. |
| US09360216B2 |
Gas turbine
A gas turbine includes downstream side members that face a passage and have guide faces arranged in the passage side as it goes toward the upstream side. In a cross section including an axis center of a rotor shaft extending in a flow direction of a gas main stream, extension sections of the guide faces continuing to the upstream end portion of the guide faces are arranged downstream from the cavity inner wall portion of the upstream side member facing the cavities. |
| US09360212B2 |
Controlling sootblowers according to rules, rankings of sootblowers, and fuzzy functions that evaluates fuzzy functions only related to temperature and pressure
A system and method to control of sootblowers in a fossil fueled power plant, in particular to plant applications systems using a graphical programming environment in combination with a set of rules to activate sootblowers. The system can be constrained by time limits and/or rule based time limits. Actual blower activation is typically based on the current status of key control variables in the process which alter the actual activation time within a constraints system. The system does not typically require knowledge or models of specific cleanliness relationships. The result is a system without sequences or queues that readily adapts to changing system conditions. |
| US09360211B2 |
Coal fired boiler plant and coal drying method for coal fired boiler plant
Coal is properly dried and the efficiency of a boiler is increased while suppressing any reduction in efficiency of the boiler and the generation of hydrocarbon gas components. Employed are a coal dryer that dries coal, a boiler in which the coal that is dried in the coal dryer is mixed with air for combustion and burned, an air heater that heats the air for combustion that is supplied to the boiler using combustion exhaust gas discharged from the boiler, a precipitator that collects dust included in the combustion exhaust gas, a desulfurization plant that performs a desulfurization process on the combustion exhaust gas, and heat recovery equipment that heats a heating medium using the combustion exhaust gas. The coal dryer dries the coal using the heat energy of the heating medium that has been heated in the heat recovery equipment. |
| US09360206B2 |
Illumination system for percussion instruments
An illumination system and method for percussion instruments is disclosed. The system comprising of housing, one or more sensors, one or more light sources controlled by said sensors, and a power source to operate the illumination system. Said sensors and said light sources are self-contained within said housing. Also, the system further comprises a means for supporting said illumination system in close proximity to a striking surface of said percussion instruments. |
| US09360205B2 |
Lighting apparatus for vacuum apparatus
A lighting apparatus for a vacuum apparatus that allows light to enter the inside of the vacuum apparatus through an observation window and makes it possible to see the inside of the vacuum apparatus through the observation window by illuminating the inside of the vacuum apparatus includes a coupling adapter that is removably coupled to the observation window via a coupling unit, an opening that is formed in a central part of the coupling adapter and allows the inside of the vacuum apparatus to be seen through the observation window, and a plurality of LEDs (light-emitting diodes) that are placed in the coupling adapter and face the observation window. The lighting apparatus is attached to the observation window for seeing the inside of the vacuum apparatus and illuminates the inside of the vacuum apparatus. |
| US09360204B2 |
Light-emitting device
A light-emitting device includes a light-emitting element and a wavelength conversion layer. The light-emitting device further includes the translucent member having a translucent base and the wavelength conversion layer formed on the translucent base. The wavelength conversion layer does not contact the light-emitting element, and is sealed in the light-emitting device. |
| US09360197B2 |
Security lighting systems for perimeter fences
A security light for a fence includes a light module having an LED unit and a junction box. The junction box contains electrical components for operating the LED unit, and has a rear end with a rear wall and a front end having a front opening that opposes the rear wall. A clamp assembly is coupled with the junction box and opposes the rear end of the junction box to define an opening for a fence post. The front opening of the junction box provides access to the interior of the junction box for conducting electrical wiring operations. A front cover plate is assembled with the junction box for covering the front opening of the junction box. When the junction box is clamped to the fence post, the front cover plate is removable for providing access to the interior of the junction box. |
| US09360192B2 |
LED illuminating device
An LED illuminating device includes a printed circuit board, at least one LED chip group arranged on the printed circuit board, and a lens assembly, wherein the LED illuminating device further includes a reflector provided between the LED chip group and the lens assembly, wherein the reflector is configured to diffusely reflect light from the LED chip group so that the light is uniformized and emerges in a direction of the lens assembly. |
| US09360191B2 |
Lighting device
The present invention relates to a lighting device. Light flux controlling member 120 of lighting device 100 according to the present invention distributes light emitted from light emitting element 110 at least sideward and rearward. The light emitted from light flux controlling member 120 is diffused and transmitted to a cover. Housing 170 is formed in a shape that does not block a main component of the light emitted rearward from light flux controlling member 120. Lighting device 100 can distribute the emitted light from light emitting element 110 forward, sideward and rearward in all directions. |
| US09360190B1 |
Compact lens for high intensity light source
The present invention relates to a compact optic lens for a high intensity light source having improved output beam characteristics. The compact optic lens provides increased light output without increasing device cost or device size to enable coverage of many beam angles. |
| US09360189B2 |
Ceramic conversion element, optoelectronic component comprising a ceramic conversion element, and methods for producing a ceramic conversion element
A ceramic conversion element includes a multiplicity of first regions and a multiplicity of second regions, wherein the first regions vitreous, ceramic or monocrystalline fashion, at least either the first regions or the second regions are columnar and have a preferred direction forming an angle of at most 45° with a normal to a main surface of the conversion element, the first regions convert electromagnetic radiation in a first wavelength range into electromagnetic radiation in a second wavelength range different from the first wavelength range, the second regions convert electromagnetic radiation in the first wavelength range into electromagnetic radiation in a third wavelength range different from the first and second wavelength ranges, wherein the second regions are formed by a resin into which phosphor particles are embedded. |
| US09360188B2 |
Remote phosphor element filled with transparent material and method for forming multisection optical elements
Lighting components and fixtures having optical elements with multiple portions are disclosed. A wavelength conversion element can be mounted over a source, the wavelength conversion element including wavelength conversion material remote to the source, such as on or near the outside surface of a conversion element. The element can be filled with a transparent and thermally conductive material which thermally couples the remote conversion material and the source, aiding in thermal dissipation and improving fixture efficacy. An optical element can be formed by using an embossing plate to form a first portion, partially curing the first portion, removing the embossing plate, and introducing material to form a second portion. |
| US09360187B2 |
Light source
This light source 1 is provided with a luminescent cylinder 3A housing a luminescent part 2 to generate light; a light guide cylinder 3B connected to the luminescent cylinder 3A on a one end side, and configured to guide the light generated by the luminescent part 2, to an exit window 4 provided on the other end side; and a cylindrical reflective cylinder 9 inserted and fixed between the exit window 4 of the light guide cylinder 3B and a portion connecting the luminescent cylinder 3A and the exit window 4, and having an inner wall surface as a reflective surface 9a to reflect the light. |
| US09360182B2 |
Multi-mode lighting apparatus
A multi-mode lighting system includes a collector unit having a base including a cavity and a transparent or translucent cover mounted on the base. The system further includes a lighting module having a base, a transparent or translucent cover and a photovoltaic element mounted therein. A plurality of fiber optic filaments extend from the collector to the lighting module to transmit radiation from first ends of the fiber optic filaments to second ends of the fiber optic elements. The first ends of the fiber optic filaments are disposed in an array in the collector unit to receive radiation and second ends are disposed in an array in the lighting module to emit radiation received by the first ends of the fiber optic filaments. Radiation transmitted by the fiber optic filaments illuminates an area external to the lighting module and impinges the photovoltaic element to generate electricity. |
| US09360180B2 |
Ceiling-recessed luminaire
Embodiments of the invention include a luminaire with an elongated luminaire body and at least one longitudinal luminaire flange each of which extend longitudinally from one end of the luminaire body. The luminaire body being shorter than the luminaire length measured from the ends of both longitudinal luminaire flanges. The luminaire body can include a channel with a plurality of light sources, optical elements, power lines, and/or control lines. A connector is also disclosed according to some embodiments of the invention that can be used to physically and/or electrically couple two luminaires together. The connector can couple the luminaires at a T-bar. |
| US09360177B2 |
Portable light, such as a stick light
A portable light includes an elongated housing having a first end and a second end, and an opening formed in a side of the elongated housing between the first and second ends. The portable light also includes a light source positioned within the opening of the elongated housing, and an actuator positioned within the opening of the elongated housing and electrically coupled to the light source. The actuator is operable to control operation of the light source. The portable light further includes a faceplate removably coupled to the elongated housing over the opening. The faceplate includes a lens that covers the light source and a movable member that covers the actuator. |
| US09360176B2 |
Remote phosphor LED constructions
A white light source includes a short wavelength LED and a phosphor layer that emits light at longer visible wavelengths. A dichroic reflector transmits the longer wavelength light, and reflects some LED light onto the phosphor such that as light travels from the LED to the dichroic reflector it does not pass through the phosphor. The LED may emit blue light, and the dichroic reflector may transmit a second portion of the LED light, such that the light source output light includes both the second portion of the LED light and the longer wavelength phosphor light. The LED may be mounted on a flexible substrate having a cavity region and neighboring region, the LED being mounted in the cavity region. A dielectric layer may be thinner in the cavity region than in the neighboring region, or a hole may extend completely through the dielectric layer in the cavity region. |
| US09360174B2 |
Linear LED illumination device with improved color mixing
A linear multi-color LED illumination device that produces uniform color throughout the output light beam without the use of excessively large optics or optical losses is disclosed herein. Embodiments for improving color mixing in the linear illumination device include, but are not limited to, a shallow dome encapsulating a plurality of emission LEDs within an emitter module, a unique arrangement of a plurality of such emitter modules in a linear light form factor, and special reflectors designed to improve color mixing between the plurality of emitter modules. In addition to improved color mixing, the illumination device includes a light detector and optical feedback for maintaining precise and uniform color over time and/or with changes in temperature. The light detector is encapsulated within the shallow dome along with the emission LEDs and is positioned to capture the greatest amount of light reflected by the dome from the LED having the shortest emission wavelength. |
| US09360173B2 |
LED bulb and illumination device
An illumination tool has an LED light source; and a light reflecting part which is provided at a front of the LED light source. The light reflecting part is given a slant so as to approach the LED light source toward a center. |
| US09360171B2 |
Flexible substrate lighting fixtures
A lighting fixture can comprise a flexible substrate and an array of light emitting diodes (LEDs) coupled to the flexible substrate. In various embodiments, the array of LEDs can be disposed at one region of the flexible substrate, with another area of the flexible substrate free from LEDs. Light emitted from the LED array can be incident upon the area that is free from LEDs, and that area can manage the incident light to achieve a desired effect. Accordingly, the flexible substrate can filter, diffuse, refract, transmit, diffract, imprint information upon, or otherwise purposely manipulate light generated by associated LEDs The flexible substrate may be manipulated into different forms for different lighting fixtures styles and models and for different applications. |
| US09360170B2 |
Light emitting diode bulb with glare shield structure
The present invention relates to a light emitting diode bulb with a glare shield structure. It uses a glare shield structure to separate the sensor from the light emitting diode. A joggle structure or a sleeve structure is used for the glare shield structure to separately match the separated condenser lens and the lamp base to form glare shield means to prevent the sensor from being interfered by irradiated, refracted or reflected light from the light emitting diode. The structure is simple to be assembled and the cost of assembling is reduced. |
| US09360164B2 |
Particle manipulation system with stay-wet algorithm
A MEMS-based particle manipulation system which uses a particle manipulation stage and a sensor to detect when the sample volume is exhausted or nearly exhausted. The sensor sends a signal to a fluid control means that reverses the pressure between one of the output channels and the input channels, to keep the surfaces wet with a volume of the sample fluid. This volume can be maintained in the channel until an operator intervenes, or it can be repeatedly shuttled back and forth between the input channel and an output channel. By keeping the channels wet, material from the sample stream does not become adhered to the channel walls, which might otherwise irreversibly change or damage the device. |
| US09360159B2 |
Fluidtight and thermally insulating tank
A fluidtight and thermally insulating tank wall comprises:a multi-layer structure comprising a fluidtight barrier (5) and a thermally insulating barrier (4), retaining rods (22) attached to the bearing wall (7) between the insulating elements and extending in the direction of the thickness of the multi-layer structure to hold the multi-layer structure on the bearing wall, in which crossmembers (30) are attached to the retaining rods (22) such that in each instance a crossmember extends between two retaining rods at the interface between two insulating elements, the cover panels (11) of the insulating elements being connected to the crossmembers (30) so as to be held against the bearing wall via the crossmembers, and the fluidtight barrier (5) being connected to the crossmembers (30) so as to be held against the cover panels of the insulating elements via the crossmembers. |
| US09360157B1 |
Barrier insert for traffic cones
An insert for attaching barricade tape, rope or other flexible line to traffic cones. The insert includes a clip-shaped body having legs that are biased apart to form a jaw area for the tape. The legs are squeezed together by hand and inserted into top openings of the cones. Features on the lower ends of the legs internally engage the upper portion of the cone when released, mounting the insert to the cone with the barricade tape retained in the jaw area. |
| US09360156B2 |
Equipment mount
A frame having one or more wall mount angle brackets. The wall mount brackets have a plate for mounting to a wall and a horizontally projecting surface. Outer brackets connect through slotted plates to the wall brackets allowing for variation in the depth of the object supported by the frame, i.e. the distance that the object projects from the wall. The outer brackets are themselves made of two pieces that join through slotted plates allowing for variation in the height of the supported object. |
| US09360153B2 |
Supporting apparatus
A supporting apparatus includes a first connection member, a second connection member defining a fixing groove, a third connection member, a fourth connection member and a fifth connection member. The first connection member, the second connection member and the third connection member are rotationally connected to each other head to hail to form a triangle and can be detached from each other. The fourth connection member is detachably attached to and rotatable around the third connection member. The fifth connection member is detachably attached to and rotatable around the fourth connection member. The second connection member defines a connection hole. A portion of the fifth connection member is detachably received in the connection hole to support the triangle. |
| US09360152B2 |
Lift mechanism systems and methods
The invention includes a display positioning assembly comprising a support, a display supported by the support, and a balance mechanism carried by the display and operatively connected to the support. The invention also includes an article for selectively exposing a display comprising a generally planar support surface having a first side and a second side opposite the first side. A balance mechanism operatively connected to a display may be positionable between a storage position proximate the first side of the generally planar support surface and an exposed position proximate the second side of the generally planar support surface. The invention also includes an assembly for arresting the free fall of an object. The assembly may comprise an outer slide in sliding or rolling engagement with an inner slide, and a brake comprising at least one pivot member may be coupled to the inner slide. |
| US09360148B2 |
Bursting head device
Provided are articulating, rotating pipe bursting head devices for bursting a buried pipe and simultaneously pulling a replacement pipe through the same location. The bursting heads can comprise an integrated, substantially hollow cone body having one or more cutting knives arranged radially about its outer surface, and an end cap at its posterior end. Protruding from the posterior end of the end cap is a swiveling quick release coupling means for linking the bursting head to a replacement pipe carrier such as a universal duct puller. The swiveling quick release coupling means allows for rotation and articulation of the replacement pipe relative to the bursting head during operation, enhancing entry of the replacement pipe into an existing pipe underground. The bursting head body further can comprise an axial opening at its anterior end for receiving a cable, an internal magnetized cable gripping mechanism and a quick-release tool. |
| US09360144B2 |
Conduit with joint covered by a boot
An exemplary embodiment provides a shrouded conduit joint assembly that includes a joint assembly and a boot shroud. The joint assembly includes a first ferrule having a first seal, and a second ferrule having a second seal. A clamp operatively engages the first ferrule and the second ferrule. The boot shroud surrounds the joint assembly and is spaced from the joint assembly to create a leak detection space between the joint assembly and the boot shroud. |
| US09360141B2 |
Ball joint pipe connection
A pipe connection includes a ball joint having shell parts and pipe connection elements at the ends of the shell parts which face away from each other are to be connected to a respective pipe section. The shell parts surround one another in a contacting manner and define a respective longitudinal center line; they are rotatable relative to one another between an aligned position, in which the longitudinal center lines coincide, and a rotated position, in which the longitudinal center lines form an angle which differs from zero. The shell parts together enclose an axial passage which extends between the ends of the shell parts. A sealing element is provided between the outermost and innermost shell part. A lining extends between the outermost shell part and the corresponding pipe connection element. The inner lining surface has a curvature corresponding to that of the outer surface of the innermost shell part. |
| US09360137B2 |
Garden hose and hose irrigation system comprising said garden hose
The invention relates to a garden hose with at least one cover layer. The aim of the invention is to improve the grip of the hose relative to the hand of the user and/or on a connection to a connecting element via a compression-type fitting. For this purpose, a relief structure is produced on an outward surface of a cover layer of the hose. The relief structure can substantially improve the haptic impression and/or, when the connection is tight, bring about an interlocking or at least semi-interlocking engagement of retaining elements of a connecting element with the relief structure and substantially increase the retaining force which prevents the hose end from accidentally slipping off the connecting element. |
| US09360135B1 |
Subsea clamp for hoses and control lines
A clamp for a tubular hose or cable is disclosed. The clamp comprises a first clamp half, a second clamp half, and a hinge pin. The first clamp half has a first end and a second end and defines a first concave semi-cylindrical face. The first end of the first clamp half carries means for mounting the clamp. The second clamp half has a first end and a second end and defines a second concave semi-cylindrical face. The first clamp half and the second clamp half come together along a parting line and are retained together by a hinge pin. The clamp halves are provided with snap-in liners for easy use. Alternative mounts for mounting the clamp on subsea wire line or tubulars is also disclosed. |
| US09360130B2 |
Method for greasing the mated threads of a threaded connector and related device
A method for greasing the mated threads of a valve stem and a stem nut of a motor-operated valve without the need to actuate the valve and without the need for an internal grease path within the stem nut includes pressurizing one end of the thread interface defined by the mating threads with pressurized grease. A device for carrying out the method may include a thread lubricator that has a bore that receives the free end of the valve stem and an adapter nut that attaches the thread lubricator to the valve housing. Pressurized grease flows into the thread lubricator and to the one end of the tread interface. |
| US09360128B2 |
Graphite/metal valve seal assembly for high temperature control valves
A sliding stem control valve includes a valve body, a seat ring located within the valve body and a valve plug slidably mounted within the valve body, the valve plug and the valve seat cooperating to control fluid flow through the control valve. A seal assembly is located between the valve plug and the valve seat, the seal assembly including a metal/graphite seal ring located between a first backup ring and a second backup ring. A biasing element is located adjacent the second backup ring and a retainer ring is located adjacent the biasing element to maintain the biasing element adjacent the second backup ring. |
| US09360126B2 |
Relief valve assembly with anti-frozen shielding hat
A relief valve assembly includes a relief valve, a hollow shell disposed on the relief valve so as to form a relieving chamber, and a cap mounted to the hollow shell and closing off a distal end of the relief valve to an external environment. The hollow shell has a distal aperture and a proximal aperture, and the distal end of the relief valve is inserted into the hollow shell through the proximal aperture and protrudes through the distal aperture. The relief valve includes a relief port forming a fluid flow path between a valve chamber of the relief valve and the relieving chamber, and the hollow shell extends past the relief port along a longitudinal axis of the relief valve. The relief valve includes a slide member configured to move in response to an over-pressure condition, and a fluid vents from the valve chamber to the relieving chamber through the relief port. |
| US09360125B2 |
Turbo purge valve-check valve OBD vacuum relief
An integrated valve assembly, which integrates two check valves and a solenoid assembly which functions as a purge valve. When the solenoid assembly is in an open position, during a first mode of operation, vacuum pressure places the first check valve in an open position and the second check valve in a closed position, and during a second mode of operation, pressurized air places the first check valve in a closed position, and vacuum pressure generated by a venturi valve member places the second check valve in an open position. Each check valve utilizes a nylon insert along with an over molded rubber seal. The design of the check valves prevents actuation at low vacuums and flows when the vehicle is shut off. The integrated valve assembly eliminates the need for an OBD relief valve, and simplifies the EVAP system, saving costs, complexity, and eliminates several possible leak connections. |
| US09360123B2 |
Valve
Disclosed herein is a valve. The valve includes a first member having a first port therethrough, a second member in operable communication with the first member having a sealing surface thereon on an inner radial surface of the second member and a second port therethrough that is movable relative to the first member. The valve also has a seal sealingly engaged with the first member and slidably sealingly engagable with the second member, and a support member movably disposed relative to the first member and the second member. The support member has a support surface dimensioned similarly to the sealing surface, and is movable with the second member relative to the first member so that upon such movement the seal is continuously supported by at least one of the sealing surface and the support surface. |
| US09360122B2 |
Expanding disk gate valve
An expanding disk gate valve assembly comprises two gate disks and an elastomeric disk. A first flange on a first gate disk mates to a second flange on a second gate disk forming an internal volume surrounding the elastomeric disk. An elastomeric sheath covers the mated disks with the first gate disk being radially offset from, and radially movable relative to, the second gate disk. A width of the gate disk assembly is less than a width between two valve seats when the gate disk assembly is in an open position. In a closed position, the first flange moves radially toward the second flange, compressing elastomeric disk, and causes the elastomeric disk to expand axially against the two gate disks, forcing them apart, and increasing the gate disk assembly width so that the gate disk assembly actively seals against the valve seats. |
| US09360117B2 |
Seal
A mechanical seal for providing a fluid-tight seal between relatively rotatable elements includes a stationary part for securing to a housing, which has a stationary seal face, a rotary part for securing to a shaft, which includes a rotary seal face, a spring urging the rotary seal face into engagement with the stationary seal face and a toroidal sealing member between the rotary component and the shaft. The toroidal sealing member is accommodated within a recess of the rotary part, and the recess is defined by two members of which the first rotary part member includes the seal face and a second rotary part member is positioned between the first rotary part member and the spring. |
| US09360116B2 |
Seal and method for manufacturing thereof
A seal includes a sealing lip having a sealing region with a pumping structure that can abut on a first component. The pumping structure causes a liquid medium to move in a direction from a first axial side of the seal towards or to a second axial side of the seal when the first component rotates relative to a second component. The pumping structure includes at least one pumping groove that extends along a direction of extension and at least one retaining structure disposed in the at least one pumping groove. The at least one retaining structure reduces a cross-section of the at least one pumping groove, in at least one direction perpendicular to the direction of extension, to a value of between 50% and 90% of an extension of the cross-section of the pumping groove outside the at least one retaining structure along the at least one direction. |
| US09360114B2 |
Coated O-ring
The invention relates to a coated O-ring for forming a seal, in which the core of the O-ring comprises a polymer and/or synthetic rubber, and the coating comprises an inorganic coating with a thickness between 10 nm and 1 μm, resulting in an O-ring that shows a lower permeation than an uncoated O-ring and where the coating shows little or no cracking when the local curvature of the O-ring in any direction is changed by 20%.The coating is preferably applied by Atomic Layer Deposition, but also other deposition techniques such as (PE)CVD, E-beam evaporation, and reactive evaporation may be used.A further elastomer layer may cover the one or more coating layers for further mechanical and/or chemical protection. |
| US09360112B2 |
Assembly for sealing a sliding interface
An assembly is disclosed for sealing the sliding interface between two objects capable of sliding or moving with respect to one another, but where the sliding interface must provide a substantial seal against pressure loss therethrough, such as where an assembly seals the sliding interface between a piston and a cylinder or between a rod and a bushing. The sliding interface includes a seal located in a seal groove, wherein the seal ring height is less than the height of the seal groove and the inner diameter of the seal is greater than the base of the groove. In one aspect, the difference in height is set by a shim and a piece of material of the same height as that of the seal ring. |
| US09360105B2 |
Organ type electronic shift lever
Disposed is an organ type electronic shift lever formed on a console surface at a periphery of a driver seat in a vehicle. The electronic shift lever may include a step motor coupled to the console surface and having both ends to which motor rotation shafts are connected, a pair of lever arms each having one end rotatably coupled to one or each of the motor rotation shafts, a pair of lever pins each rotatably coupled to the other end of one or each of the lever arms, a shift lever having side portions rotatably connected to the lever arms by the lever pins and a rear end to which a magnetic unit is coupled, a display unit formed on the shift lever, and a recognition sensor formed in the console surface and sensing a position of the magnetic unit. When the shift lever is moved forward or rearward while forming an inclination angle with the console surface, a gear shift stage of the vehicle is changed. |
| US09360102B2 |
Gearing
A gearing having a shaft that projects from the gear interior into the environment, the shaft being sealed with the aid of at least one contactless seal, and the opening of the contactless seal, which is oriented toward the interior of the gearing, i.e., the spatial region of the gearing that contains the lubricating oil, being disposed above the lubricating oil level that comes about when the gearing is not in operation, a tin piece being disposed between the opening and the gear-tooth piece situated closest to this opening and generating lubricating oil waves and/or lubricating oil foam from the lubricating oil bath. |
| US09360100B2 |
Method, system and apparatus to provide for universal bellhousing between engine and transmission of vehicle
A universal bellhousing which may be adapted to a variety of automotive engine and transmission combinations and method of making the same is disclosed. The bellhousing is made by spin forming a sheet of steel and welding a transmission plate onto the cone. The cone and transmission plate are indexed to mount to a specified engine-transmission combination. |
| US09360093B2 |
Six-degree-of-freedom cam-controlled support platform
A platform is provided, which platform is adapted to engage a base through a multiplicity of pulley engaging cables. A first end of each cable is attached to a cam follower assembly located on the base and a second portion of the cable is attached to the platform. A motor driving the multiplicity of cams, cam followers, and cables will move the platform, the platform typically being suspended above the base on the cables or the cables and compression springs. |
| US09360089B2 |
Infinitely variable transmissions, continuously variable transmissions, methods, assemblies, subassemblies, and components therefor
Inventive embodiments are directed to components, subassemblies, systems, and/or methods for infinitely variable transmissions (IVT). In one embodiment, a control system is adapted to facilitate a change in the ratio of an IVT. In another embodiment, a control system includes a carrier member configured to have a number of radially offset slots. Various inventive carrier members and carrier drivers can be used to facilitate shifting the ratio of an IVT. In some embodiments, the traction planet assemblies include planet axles configured to cooperate with the carrier members. In one embodiment, the carrier member is configured to rotate and apply a skew condition to each of the planet axles. In some embodiments, a carrier member is operably coupled to a carrier driver. In some embodiments, the carrier member is configured to couple to a source of rotational power. Among other things, shift control interfaces for an IVT are disclosed. |
| US09360086B2 |
Multi-speed gearbox
Transmission comprising four planetary gear sets, shafts and six shift elements. Sun of first set is connected to fifth shaft, which is connected to sun of second set and is couplable to housing by second brake. Driveshaft is connectable by first clutch to fourth shaft connected to carrier of second set and is couplable by first brake to housing. Driveshaft is connectable by second clutch to seventh shaft connected to ring gear of second set and sun of third set, and is connectable by third clutch to eighth shaft connected to carrier of third set. Eighth shaft is connectable by fourth clutch to third shaft connected to ring gear of fourth set. Sixth shaft is connected to ring gear of third set and carrier of first set. Sun of fourth set is coupled to housing. Output shaft is connected to carrier of fourth set and ring gear of first set. |
| US09360085B2 |
Gear train of automatic transmission for vehicle
A gear train may include an input shaft adapted to receive torque of an engine, an output shaft adapted to output changed torque, a first planetary gear set including a first sun gear, a first planet carrier, and a first ring gear as rotation elements thereof, a second planetary gear set including a second sun gear, a second planet carrier, and a second ring gear as rotation elements thereof, and a third planetary gear set including a third sun gear, a third planet carrier, and a third ring gear as rotation elements thereof. |
| US09360081B2 |
Torsional vibration damper for hydrokinetic torque coupling device
A torsional vibration damper of a hydrokinetic torque coupling device, comprises a driven plate rotatable about a rotation axis, an intermediate plate rotatably mounted about the driven plate coaxially with the rotation axis, a back plate rotatably mounted about the intermediate plate coaxially with the rotation axis, a plurality of circumferentially acting elastic members interposed between the driven plate and the intermediate plate, and a damper retainer plate non-moveably secured to the back plate coaxially with the rotation axis. The damper retainer plate is operatively connected to the elastic members. The driven plate, the intermediate plate and the back plate are aligned with each other along a radial axis perpendicular to said rotation axis. |
| US09360078B2 |
Hydraulic shock absorber
In a friction member (22), a base section (92) is constituted by a bottom section (101) and a tube section (102). The bottom section (101) has a bored disk shape, and the tube section (102) has a cylindrical shape extending from an outer circumferential side of the bottom section (101) in the axial direction. An elastic rubber section (91) has a minimum inner diameter section (137), diameter expanding sections (138), (139) which are disposed at each side in the axial direction of the minimum inner diameter section (137). A tube section adhering surface (126) is installed at outer circumferential side of a tube section (102). A cutout section (151) is at least partially formed at a bottom section adhering surface (128) fixed to the bottom section (101) and the tube section (102) side of an open surface at an opposite side in the axial direction, and a deepest section (155) of the cutout section (151) is shallower than a position in the axial direction of the minimum inner diameter section (137). |
| US09360075B2 |
Vibration isolation system and method
A vibration isolator (100) includes a flexure (102), a constrained VEM layer coupler (104), and a constrained VEM layer (106) configured to oppose relative translational and rotational motion between points of the flexure. The flexure may be a loop flexure and may include multiple loops that may be elliptical, circular, rectangular or square in overall aspect, for example. In multi-loop embodiments, the loops may share a common major axis or their major axes may be at an angle to one another. The device enhances damping by providing an increase in viscoelastic surface area over that available in the surface area of the flexure and provides a method of adjusting the strain in the VEM as the flexure undergoes deflection. |
| US09360068B2 |
Disk brake
A disc brake that suppresses braking noises when a vehicle moves backward include an urging spring urging a friction pad toward a rotationally exiting side of a disc when the vehicle moves forward, the urging spring being arranged between a hook portion of the friction pad and a torque receiving portion of a carrier. The urging spring formed through bend of an elastic plate material has its spring constant that is set to be a small value to avoid resonance frequency causing noise where the base end side thereof is fixed to the hook portion of the backing plate while the top end side thereof elastically abuts to the torque receiving portion of the carrier. The urging spring is located at the position that is outside in the radial direction from the center position of the hook portion in its width direction. |
| US09360066B2 |
Method for producing a brake carrier for a disc brake and brake carrier for a disc brake
In a method for producing a brake carrier for a disc brake of a vehicle braking system, wherein the brake carrier has at least one guiding shaft for guiding a brake lining in a guiding direction in relation to a receiving region for a brake disc, first a brake carrier blank is produced in a casting step and then the brake carrier blank is reworked. In the casting step, the brake carrier blank forms two converging tapers, facing the receiving region, in the region in which the guiding shaft is formed and, during the reworking, material is removed in the region of the tapers to produce the at least one guiding shaft, with the effect that the receiving region for the brake disc has a predetermined clear width transversely in relation to the guiding direction. |
| US09360063B2 |
Method for the reconditioning and use of brake discs of the rear stator type with studs, assembled disc and corresponding stack of discs
A method for the reconditioning and use of brake discs of the rear stator type with studs. The method includes the steps of using a first disc (12) during a first life, using a second disc (112) during a first life, after the first life of the first disc and the first life of the second disc, machining a friction surface on one of the discs and a rear surface on the other of the discs so that one of the surfaces has at least one shoulder (17) and the other of the surfaces has at least one notch (118). Finally, the first disc is nested in the second disc such that the notch and the shoulder cooperate so as to center the discs. |
| US09360062B2 |
Brake system for utility vehicles
The present invention relates to a brake system for utility vehicles, comprising an actuation unit, a transmission element and a converter unit, wherein the actuation unit moves the transmission element along a transmission axis, the converter unit being arranged on a wheel axis and comprising at least one piston element. According to the invention, the transmission axis intersects the wheel axis at least in the region of the converter unit, and the transmission element is designed to transmit a force onto the piston element in order to move the latter transverse to the wheel axis. |
| US09360057B2 |
Electromagnetic clutch
An electromagnetic clutch can be manufactured with reduced steps and cost. In the electromagnetic clutch, an electromagnetic coil unit 4 for causing a rotor and an armature to magnetically adhere to each other to enable power transmission from a drive source to a driven device includes: a bobbin 42 around which an electromagnetic coil 41 is wound; a power supply connector 43 attached to a connector mounting portion 424 formed in the bobbin 42, to supply external power to the electromagnetic coil 41; and a field core 44 in which a through hole 443a is formed. In the field core 44, a proximal part of the power supply connector 43 and the bobbin 42 are stored in a storage portion in a state where a distal part of the power supply connector 43 is exposed to outside from the through hole 443a, and the storage portion is filled with resin. |
| US09360049B2 |
Bearing position with a single row polygonal bearing
A bearing position for rotatably mounting a shaft or an axle in a housing. The bearing position comprises a rolling bearing, which is designed as a roller bearing, with a bearing ring, which is assigned to the housing, where said bearing ring forms an outer rolling raceway, which faces radially inwards and on which rolling elements are guided, said rolling elements mutually interacting with a shaft, which forms an inner rolling raceway, or with an inner bearing ring. A polygonal bearing is provided as the roller bearing; and said polygonal bearing encloses a bearing ring with at least one elastic section, which forms a transversely convex raceway curvature. This arrangement guarantees that at least one rolling element is supported and guided in a radially prestressed manner without radial clearance on the rolling raceway. |
| US09360044B2 |
Radial needle bearing
In rollers used in a radial needle bearing, the circularity of crowning sections provided at opposite ends of each roller is 0.6 μm or smaller. This allows for reduction of sound (noise) produced when the radial needle bearing rotates by itself and can also allow for reduction of sound (noise) of a rotational machine when the radial needle bearing is installed and rotates therein. |
| US09360043B2 |
Ball bearing
A ball bearing having first and second races and, disposed in a gap between the two races, a row of balls of radius RK that roll along facing tracks of the two races, wherein centers of the balls move on a circular path surrounded by a torus circumscribing all the balls of the row and having the toroidal radius RK, a toroidal angle coordinate φ, and a poloidal angle coordinate θ, wherein each track has with each ball two nearly punctiform contact areas P1, P2; P3 P4 at respective contact angles θP1, θP2; θP3 and θP4, wherein the cross section of the track in the region of the contact points P1 . . . P4 has a finite transverse radius of curvature RL1 . . . RL4, with RLv>RK, and wherein in the vicinity of a contact point P1 . . . P4 the transverse radius of curvature (RL) is a continuous and differentiable function of the poloidal angle coordinate θ: RL=RL(θ) that increases outward from the respective contact point P1 . . . P4 in both poloidal directions: RL(θ)≧RL(θPv). |
| US09360030B2 |
Assembly of an elongate thin lip in an elongate narrow slit and use for assembling an air guide onto a shroud
An assembly of a first element, such as a fan shroud, with a second element, such as an air guide, realized by assembling an elongate thin lip belonging to the second element in an elongate narrow slit formed by the three sides of an elongate planar plate attached in parallel to a planar wall of the first element. The elongate thin lip includes a concave edge and includes, at either side thereof, extended tips, and the elongate slit includes, at either side thereof, areas in which the thickness of the slit is increased, configured to engage with the extended tips of the lip so that the insertion of the lip into the slit begins by inserting the tips into the areas and then continues with gradual insertion of the rest of the concave edge of the lip as the lip is being advanced. |
| US09360027B2 |
Proportional control valve
A proportional valve including a housing having an inlet and an outlet, and a valve element movably positioned in the housing between the inlet and the outlet. The valve element having a pilot valve opening, a first pressure chamber with a pressure acting on the valve element in a first direction, and a second pressure chamber with a pressure acting on the valve element in a second direction opposite to the first direction. A pilot valve element actuated by a drive mechanism to cooperate with the pilot valve opening to form a pilot valve. A flow resistance between the inlet and the first pressure chamber is smaller than a flow resistance between the inlet and the second pressure chamber. The pilot valve opens into a third pressure chamber connected to the outlet via a throttled flow path. |
| US09360026B2 |
Positioner
In a comparing circuit, the value of a control signal from a higher-level device and a normal range that is set for the control signal are compared, and the result is sent to a control unit. The control unit, when sent the result indicating that the value of the control signal is outside of the normal range, forcibly adjusts the electric current signal (the adjusted electric current) to the electropneumatic converter to zero, regardless of the deviation between the value indicated by the control signal and the value indicated by the valve opening signal. The adjustment of the electric current in the control unit is performed using a normal function that is possessed by the control unit, that is, the function for changing continuously the value of the electric current signal in accordance with the deviation. |
| US09360023B2 |
Hydraulic regeneration system and method for a material handling vehicle
A hydraulic system has a cylinder and ram assembly that raises and lowers a load carrying carriage on a material handling vehicle. The fluid exhausting from the cylinder, while the carriage is lowering, is controlled to recover energy from that fluid. A first path routes the exhausting fluid to drive the pump as a hydraulic motor. A second path routes the exhausting fluid to a reservoir, bypassing the pump. In a first lowering mode, the second path is closed and the first path is opened. In a second lowering mode, both the first and second paths are open and the flow through each one is proportionally controlled. In a third lowering mode, only the second path is opened. The mode to use is selected based on the desired lowering speed of the carriage. |
| US09360022B2 |
Radial compressor and method for producing a radial compressor
A radial compressor has a compressor housing, a rotatably supported compressor shaft in the compressor housing, at least one compressor impeller arranged on the compressor shaft, and a fluid discharge element arranged downstream of a last compressor impeller in a fluid path in the compressor housing and which has a predetermined extension in radial direction and in axial direction of the radial compressor, wherein the fluid discharge element has a fluid passage for guiding fluid that is accelerated by the last compressor impeller out of the compressor housing, which fluid passage extends in a circumferential direction by a predetermined angular amount, and wherein the fluid discharge element is formed of material having a defined material structure, and the fluid passage is formed as a subsequently introduced spatial interruption in a material cohesion of the material structure. A method of producing the radial compressor is also disclosed. |
| US09360021B2 |
Thermal control system based on nonlinear zonal fan operation and optimized fan power
An approach is provided in which a cooling manager retrieves pre-characterization data corresponding to a fan that electronic components included in a computer system. The pre-characterization data includes operational zones based upon fan power measurements and fan speed settings. The cooling manager sets the fan to a first speed setting within a first operational zone, and detects that one of the components generates a temperature change value that exceeds a specified temperature change value corresponding to the component. In turn, the cooling manager selects a second operational zone and sets the fan to a second speed setting within the second operational zone. |
| US09360019B2 |
Fan
A blower fan includes a heat source contact portion. A side wall portion includes a tongue portion. In a plan view, The heat source contact portion is arranged to cover a portion of a region surrounded by a third imaginary straight line tangent to an outer circumferential surface of a blade support portion and extending in parallel with the second imaginary straight line toward the air outlet in the first region, a fourth imaginary straight line tangent to the outer circumferential surface of the blade support portion and extending in parallel with the first imaginary straight line in the third region, the outer circumferential surface of the blade support portion, and the air outlet. |
| US09360016B2 |
Body cooling system
A system for cooling a user's body is provided. The body cooling system provides a rigid head covering, a ventilation component and an internal deflector component. The ventilation component may be integrated into or be removably attached to the rigid head covering. The internal deflector component directs air flow from the ventilation component along the user's body. |
| US09360009B2 |
Multi-channel, rotary, progressing cavity pump with multi-lobe inlet and outlet ports
A multi-channel, rotary, progressing cavity pump comprising a housing having an outer wall defined by overlapping cylindrical chambers, a first end wall defining an inlet port, and a second end wall defining an outlet port, said inlet and outlet ports communicating with each chamber; meshed, lobed rotors disposed within said housing and comprising a plurality of lobes having first and second axially-facing end surfaces, said surfaces defining a twist angle, and each lobe defining a helix angle; each rotor being disposed in one chamber of said housing so that a lobe apex sealingly engages the outer wall defined by its associated chamber, and said surfaces sealingly engage said end walls; whereby, when said rotors are rotated in the same direction in unison, (i) an axial progressing cavity is created between said rotors, and (ii) a plurality of peripheral progressing cavities are created between said rotors and said housing. |
| US09360007B2 |
Piston pump
A piston pump is provided comprising a cylinder with an inner cylinder wall and a working space. The piston pump includes a piston inside the cylinder and has a piston head with a first and second projections extending from its lateral surface to the cylinder wall. These first and second projections enclose a cavity between the piston head and the cylinder wall. The piston head also includes a channel for routing a flushing fluid to the cavity. The first and second projections are configured to promote flow of the flushing fluid out of the cavity and into the working space of the cylinder. |
| US09360003B2 |
Magnetically actuated disposable cartridge pump, a pump system, and a method of pumping
A disposable pump element has at least one first part, in which channel structures are recessed in the surface, and a second part sealingly covering the first part. A larger portion of the first part is applied to a rigid carrier structure. The first part has at least one flexible region, and at the flexible region thereof, the first part is not applied to the rigid carrier structure. A system for pumping, and a method for pumping a liquid, both employ the disposable pump element. |
| US09360000B2 |
Reciprocating pumps and related methods
Reciprocating fluid pumps include a pump body including a cavity therein, a plunger located at least partially within the cavity, and a shift canister assembly disposed within the cavity. The shift canister assembly includes a sealing surface for forming a seal against the pump body. An area covered by the seal between the sealing surface and the pump body is less than about 75% of an outer cross-sectional area of the shift canister assembly. The shift canister assembly may include a shift canister and a shift canister cap attached thereto, the shift canister cap comprising the sealing surface. Reciprocating fluid pumps include a shift canister, a shift piston at least partially disposed within the shift canister, and a shift canister cap attached to the shift canister on a longitudinal end of the shift canister opposite the shift piston. Methods include forming such reciprocating pumps. |
| US09359998B2 |
Liquid treatment apparatus
The invention provides a liquid treatment apparatus such as a reverse osmosis apparatus wherein a portion of an inlet liquid permeates through a filter or a membrane e.g. to provide freshwater from saltwater. The apparatus comprises a pump which provides the necessary pressure of the liquid to drive the permeation process, and a recovery unit which transfers pressure of a residue quid to the inlet liquid. The pump and the recovery unit are driven at synchronous and variable speed to control the output and thereby e.g. to adjust for fouling of the filter or membrane. The invention further provides methods of controlling the synchronous speed, e.g. based on a pressure or based on the consumption of the produced liquid. |
| US09359992B2 |
Systems, methods and apparatuses for harvesting power generated in a footwear
The systems, methods and apparatuses described herein provide a footwear hydraulic system for harvesting power generated by pressing a foot on a surface and providing a cushion for the impact. In certain aspects, a hydraulic system for a footwear may comprise at least one chamber with a first and second compartments separated by an elastic membrane. The first compartment may be filled with gas and the second compartment may be filled with liquid. The gas may provide impact cushion and transient energy storage, and the liquid may pressured to push a generator to produce energy. The pressure may be generated by pressing the footwear on a surface and/or the elastic membrane of the chamber trying to restore its shape. |
| US09359990B2 |
Plasma generating device and internal combustion engine
The size of the plasma produced by a plasma-generating device that generates plasma using electromagnetic (EM) radiation is enlarged. The plasma-generating device has an EM-wave-generating device that generates EM radiation, a radiation antenna that emits the EM radiation supplied from the EM-wave-generating device to a target space, and a receiving antenna located near the radiation antenna. The receiving antenna is grounded such that an adjacent portion that is close to the radiation antenna has a higher voltage while the EM radiation is emitted from the radiation antenna. The plasma-generating device generates plasma in the target space near the radiation antenna and the adjacent portion by emitting EM radiation from the radiation antenna. |
| US09359988B2 |
Direct current electric starter solenoid manual activation device
A manual activation device for activating a starter assembly. The present invention may include a push rod that is connected to a solenoid plunger. The starter may be activated manually by pushing the rod and thereby pushing the solenoid plunger into the gears. Therefore, if there is an electrical or mechanical malfunction with the starter or the vehicle, the push rod may be pushed in to start the vehicle. |
| US09359984B2 |
Valve assembly for an injection valve and injection valve
A valve assembly for an injection valve may include a valve body having a central longitudinal axis and a cavity with a fluid inlet portion and a fluid outlet portion, the fluid inlet portion having a step, a valve needle axially movable in the cavity, the valve needle preventing a fluid flow through the fluid outlet portion in a closing position and releasing the fluid flow through the fluid outlet portion in an open position, and an electro-magnetic actuator unit configured to actuate the valve needle and comprising an axially movable armature, the armature including a first armature part fixedly coupled to the valve needle and a second armature part axially movable relative to the first armature part, the second armature part configured such that the second armature part is mechanically decoupled from the first armature part by hitting the step when the valve needle reaches its open position. |
| US09359976B2 |
Engine with pulse-suppressed dedicated exhaust gas recirculation
An engine assembly includes an intake assembly, a spark-ignited internal combustion engine, and an exhaust assembly. The intake assembly includes a charge air cooler disposed between an exhaust gas recirculation (EGR) mixer and a backpressure valve. The charge air cooler has both an inlet and an outlet, and the back pressure valve is configured to maintain a minimum pressure difference between the inlet of the charge air cooler and an outlet of the backpressure valve. A dedicated exhaust gas recirculation system is provided in fluid communication with at least one cylinder and with the EGR mixer. The dedicated exhaust gas recirculation system is configured to route all of the exhaust gas from the at least one cylinder to the EGR mixer for recirculation back to the engine. |
| US09359974B2 |
High performance liquid rocket propellant
Disclosed is a process of fueling a rocket engine or air-breathing engine for a hypersonic vehicle with a high performance hydrocarbon fuel characterized by a hydrogen content greater than 14.3% by weight, a hydrogen to carbon atomic ratio greater than 2.0 and/or a heat of combustion greater than 18.7 KBtu/lb. The disclosed fuels generally have a paraffin content that is at least 90% by mass and a C12-C20 isoparaffin content of at least 40% by mass. |
| US09359973B2 |
Multitube valveless pulse detonation engine
Disclosed herein is a valveless multitube pulse detonation engine including: a plurality of detonation tubes, wherein each detonation tube comprises an independent discharge outlet, and the plurality of detonation tubes interconnected at a common air/fuel mixture intake port. In the disclosed engine, an air and fuel mixture is detonated in the detonation tubes simultaneously, and the common air/fuel mixture intake port minimizes back-pressure caused by detonating the air/fuel mixture by directing multiple reverse shock waves into one another and effectively using the back-pressures as reacting surfaces for one another and effectively reducing the effect of back flowing shock waves moving towards upstream. The detonation tubes may be non-linear, and may have independent discharges. The independent discharges may be coupled to an adapter nozzle terminating in a combined exhaust outlet. |
| US09359969B2 |
Method for regulating HCCI combustion in a reactor of an internal combustion engine
A method for regulating HCCI combustion of fuel in a reactor of an internal combustion engine is described in which a multivariable regulation is used, manipulated variable changes Δuk for the instantaneous regulating cycle k being determined on the basis of at least system deviations Δxk-1 and manipulated variable changes Δuk-1 of a preceding regulating cycle k−1. |
| US09359966B2 |
Evaporative emission control
A method for operating a fuel system is disclosed. The method includes sequentially purging fuel vapors from each of a plurality of regions of a canister. Purging a region includes opening an air inlet valve associated with that region and maintaining air inlet valves associated with each other region closed to direct fuel vapors to at least one purge outlet. |
| US09359965B2 |
Turbo-charger system
A turbocharger system includes a compressor that is connected with a turbine operated by an exhaust gas by a rotary shaft and compresses and supplies external gas to a combustion chamber of an engine, an intercooler and a throttle valve disposed in an intake line connecting the compressor with the combustion chamber of the engine, a branch line connecting an intake line between the compressor and the intercooler with an intake line between the intercooler and the throttle valve, a shutoff valve disposed in the branch line to selectively open/close the branch line, and an engine control unit controlling the operation of the shutoff valve. |
| US09359962B2 |
Engine braking
A system and method for controlling the quantity of compressed air that may enter into an engine cylinder during the intake stroke of a piston during an engine braking event. A control throttle may be positioned to restrict the quantity of compressed air that may enter into the cylinder during the intake stroke. The control throttle may also be positioned downstream of the engine and configured to adjustably restrict the quantity of exhaust gas that may be delivered to a turbine. By restricting the exhaust gas delivered to the turbine, the power generated by the turbine that is used by the compressor to compress intake air may also be reduced. Moreover, by controlling the power available to the compressor, the quantity of compressed intake air may be controlled, which allows for control of the quantity of compressed air that enters into the cylinder during the compression stroke. |
| US09359960B2 |
Gas turbines with multiple gas flow paths
Gas turbines with multiple gas flow paths are provided. In this regard, a representative gas turbine includes: a spool; a compressor; a turbine mechanically coupled to the spool; the compressor having a first set of blades and a second set of blades, the second set of blades being located downstream of the first set of blades, the first set of blades and the second set of blades being driven by the spool; and means for enabling the first set of blades to rotate at a lower rotational speed than the second set of blades. |
| US09359957B2 |
Planet gear for air turbine starter system
A planet gear for use in an air turbine starter is formed of a first part having a set of gear teeth at a first axial location. A shaft extends axially away from the first set of gear teeth. A second part is interference fit on the first part, with the second part having a second set of gear teeth. The second part is mounted on the shaft of the first part. An outer diameter of the shaft is selected to be significantly larger than an inner diameter of a cylindrical portion of the second part which is interference fit on the shaft. A ratio of the outer diameter to the inner diameter is between 1.0005 and 1.0100. A planetary gear system, an air turbine starter and a method of installing a planet gear are also disclosed. |
| US09359956B2 |
Relighting a turbofan engine
The method and apparatus for in-flight relighting of a turbofan engine involve in one aspect selectively controlling an accessory drag load on one or more windmilling rotors to permit control of the windmill speed to an optimum value for relight conditions. |
| US09359955B2 |
Apparatus and method incorporating a transition AFT support for a gas turbine engine
An apparatus for supporting an aft portion of a transition duct in a gas turbine engine includes a transition aft frame that engages with an annular shaped stator component disposed in a turbine section of the gas turbine engine. The transition aft frame includes radially inner and outer panels and circumferentially spaced first and second side panels connecting the inner and outer panels. A forward face of the stator component includes first and second connection points circumferentially spaced apart. The transition aft frame includes first and second attachment structures that respectively engage with the first and second connection points when the transition duct is aligned axially with the stator component. The first and second attachment structures are spaced apart in a manner effective to transfer moment load from the first and second attachment structures to the first and second side panels respectively. |
| US09359953B2 |
Combined cycle power plant with solar assisted cooling of compressor inlet air
Disclosed is a solar assisted combined cycle power plant having a compressor that pressurizes combustion air, a combustor that mixes and burns the combustion air and gas turbine fuel to generate a high-temperature combustion gas, a gas turbine that drives the compressor by using the combustion gas, an exhaust heat recovery steam generator that obtains steam from thermal energy of a gas exhausted from the gas turbine, and a steam turbine that is driven by using the steam obtained by the exhaust heat recovery steam generator. The solar assisted combined cycle power plant includes a solar collector to turn supplied water to warm water; a heat accumulator that stores pressurized hot water from the solar collector and the exhaust heat recovery steam generator; and a spray device that handles the pressurized hot water as spray water and sprays the spray water onto the air to be taken into the compressor. |
| US09359951B2 |
Inlet bleed heat system and related method for a compact gas turbine inlet
An inlet system for a gas turbine includes an inlet air duct; a silencer disposed in the inlet air duct, the silencer including a plurality of panels with spaces between the panels; and a conduit with orifices disposed to inject inlet bleed heat into each of the spaces. A method of conditioning inlet air for a gas turbine includes flowing air through spaces between panels of a silencer in an inlet air duct of the gas turbine, and injecting inlet bleed heat through orifices and into each of the spaces. |
| US09359944B2 |
Method for controlling an exhaust gas recirculation apparatus for heavy construction equipment
The present disclosure relates to a method for controlling an exhaust gas recirculation apparatus for heavy construction equipment, and more particularly, to a method for controlling an exhaust gas recirculation apparatus for heavy construction equipment, capable of controlling exhaust gas at an appropriate pressure at an appropriate step when making exhaust gas discharged from an engine flow into the engine together with fresh gas. |
| US09359943B2 |
Mixing block
A mixing block to supply a throttle-able hydrogen and air mixture to an internal combustion engine includes a bore through the mixing block between an air intake side and an engine intake side. A slider chamber is disposed orthogonal to and intersecting the bore, where the slider chamber houses a movable slider biased to at least partially block the bore but throttle-able to overcome the bias and reduce blockage of the bore. A jet chamber is disposed parallel to and intersecting the slider chamber and extending away from the slider chamber a distance sufficient to accommodate a shaped needle, where the needle is connected to the slider on one side such that the needle moves within the jet chamber as the slider moves in the slider chamber. |
| US09359936B2 |
System and operating method for a supercharged internal combustion engine with charge-air cooling
A engine system, comprising a cylinder head with one or more cylinders, an outlet opening of a cylinder coupled to an exhaust line for discharging the exhaust gases via an exhaust-gas discharge system; an inlet opening of a cylinder coupled to an intake line for supplying charge air via an intake system, the intake system including one or more compressors for compressing the charge air and a charge-air cooler coupled to the intake system, the charge-air cooler including a first refrigerant evaporator through which a refrigerant and charge air can flow. The use of a refrigerant evaporator allows air charge to cool to a temperature below the ambient temperature. |
| US09359927B2 |
Exhaust gas purification system for an internal combustion engine
The present invention discloses an exhaust gas purification system for an internal combustion engine, which is provided with: a low pressure EGR mechanism that is equipped with a low pressure EGR passage and a low pressure EGR valve; a selective reduction type catalyst that is arranged in a portion of the exhaust passage downstream; a supply device which serves to supply an ammonia derived compound to said selective reduction type catalyst; and a control unit that causes said supply device to supply the ammonia derived compound when said low pressure EGR valve is in a valve open state, makes the amount of the ammonia derived compound supplied from said supply device larger in cases where an amount of the low pressure EGR gas flowing through said low pressure EGR passage is large, in comparison with the case where it is small. |
| US09359925B2 |
Oil separator in a positive crankcase ventilation system of an engine
An oil separator in a positive crankcase ventilation (PCV) system is described herein. The oil separator includes an oil separation conduit in fluidic communication with an intake conduit and an oil reservoir and an entry conduit including an entry conduit orifice arranged at an angle of between 80 and 100 degrees with regard to the oil separation conduit, the entry conduit orifice opening into the separation conduit at a point between the separation conduit outlet and the separation conduit inlet. |
| US09359924B2 |
Engine crankcase ventilation filter assembly; components; feature; and methods
Crankcase ventilation filter systems are described, along with components and selected features thereof. Example features include preferred use of a backpressure limiting valve regulation (regulator) arrangement; and, a vacuum limiting valve regulation (regulator) arrangement. An example embodiment is provided which use two filter cartridges and two drain arrangements. Another example is provided which uses a single cartridge. Example filter cartridges are depicted and described. |
| US09359923B2 |
Method and system for fuel vapor management
Methods and systems are provided for ventilating a crankcase in an engine. In one example, when the engine is operating boosted under cruising conditions, fuel vapors from the crankcase may flow to each of a compressor inlet and an intake manifold of the engine. In this way, the crankcase may be effectively purged. |
| US09359913B2 |
Steam turbine inner shell assembly with common grooves
An inner shell assembly for a steam turbine includes an inner shell with a plurality of grooves of preset dimensions, and a plurality of nozzle carriers respectively securable in the plurality of grooves. Each of the nozzle carriers supports at least one nozzle and bucket for a turbine stage via a dovetail, where the inner shell, the plurality of nozzle carriers and the nozzles and buckets define a steam path. A radial position of the dovetails in the nozzle carriers within its corresponding grooves is selectable according to the steam path, and an axial width of each of the nozzle carriers is selectable according to the steam path. |
| US09359906B2 |
Rotor blade root spacer with a fracture feature
A rotor assembly is provided that includes a rotor disk, a rotor blade and a root spacer. The rotor disk includes a slot. The rotor blade includes a blade root that is arranged within the slot. The root spacer is arranged within the slot between the rotor disk and the blade root. The root spacer includes a base segment, a side segment and a fracture feature. The base segment radially engages the rotor disk. The side segment is radially separated from the rotor disk by a gap. The fracture feature may radially fracture the root spacer at an intersection between the base segment and the side segment. |
| US09359905B2 |
Turbine engine rotor blade groove
A rotor blade for a gas turbine engine has an airfoil, a base integrally joined to the airfoil, and a root integrally joined to the base and mountable in a slot in a rotor hub of the gas turbine engine. The root has a dovetail including at least one contact face that, when mounted, contacts a surface of the slot to retain the rotor blade in the hub. The root includes a neck between the base and the dovetail, and a groove in the neck for redirecting stress in the rotor blade. In certain embodiments, the groove is at a distance from the at least one contact face, has a length less than a length of the dovetail, and/or has an initial non-zero depth at the side of a trailing edge of the airfoil and tapers to a zero depth in the direction of the leading edge of the airfoil. |
| US09359899B2 |
Drive shaft system
A drive shaft system (100) comprising a shaft (80) connected to a motor via a coupling (50) and arranged to transmit a rotary movement from the motor to the rotor, at least two supports (65,75) arranged to position the shaft within a shaft housing (90), each support comprising at least one bearing (95,98), and at least one forcing element (135,145) arranged to force at least one of the supports against either an inner side of the shaft housing or an outer side of the shaft (80); such as to prevent turning and radial movements of the supports within the shaft housing while enabling axial movement of the shaft within the shaft housing. The bearings may be forced at either their inner or outer rings, and may be enclosed in a bearing housing (120) for protection and stiffness. |
| US09359894B2 |
Cutting bit and bit assembly
A cutting bit and bit assembly for mounting at a cutting machine. The bit includes an axially tapered bit body having a recess extending axially within the body. The recess has an innermost region and a mouth region that is generally convex and/or tapered radially outward to abut a corresponding concave or tapered surface of a projection to secure the cutting bit at a holder body. An annular step is positioned within the recess at the mouth region to prevent dust and contaminant fluid or particles from passing axially into the recess. |
| US09359893B2 |
Apparatus for the milling cutting of rock, minerals or other materials
An apparatus for the milling cutting of rock, minerals or other hard materials has a tool drum which is rotatably mounted on a drum carrier about a drum axis and on the peripheral shell surface of which are disposed, in distributed arrangement, a plurality of tool carriers, which carry cutting tools and can be rotatingly driven, where their shaft axes run transversely to the drum axis. A first group of tool carriers and a second group of tool carriers are provided, where the rotational direction of the first group is counter to the rotational direction of the second group, and the shaft axes of the tool carriers of the first group and of the second group are oriented at different setting angles relative to the radial direction of the tool drum. |
| US09359892B2 |
Spring assisted active mud check valve with spring
An apparatus, a method and a system control fluid flow through a passageway. A downhole tool pumping apparatus may have a body and an active valve block. The body has a cavity housing a reciprocating piston defining first and second chambers within the cavity. The active valve block has active valves configured to be actively actuated between an open position and the closed position. Two or more hydraulic lines may be connected to each active valve for controlling actuating between the open position and the closed position. A piston having a conduit is slidably disposed through the passageway and selectively closes the conduit of the piston by moving at least one of the piston and a plug. |
| US09359891B2 |
LWD in-situ sidewall rotary coring and analysis tool
An apparatus for estimating a property of an earth formation includes a carrier configured to be conveyed through a borehole penetrating the formation and a single probe configured to be extended from the carrier and to seal with a wall of the borehole. The apparatus further includes a fluid analysis sensor disposed at the carrier and configured to sense a property of a formation fluid sample extracted from the formation by the probe. A coring device is disposed at the carrier and configured to extend into the probe, to drill into the wall of the borehole, and to extract a core sample. A core sample analysis sensor is disposed at the carrier and configured to sense a property of the core sample. A processor is configured to receive data from the fluid analysis sensor and the core sample analysis sensor and to estimate the property using the data. |
| US09359887B2 |
Recoverable data acquisition system and method of sensing at least one parameter of a subterranean bore
A recoverable data acquisition system includes at least a portion of at least one sensor be positionable within a tubular of a completion system, the at least a portion being recoverable therefrom and a retainer movably disposed at the tubular between at least a first position and a second position, a cavity being defined between the tubular and the retainer when the retainer is in the first position, the at least a portion of the at least one sensor being removable from the cavity in response to movement of the retainer from the first position to the second position. |
| US09359884B2 |
Positioning tool
A positioning tool for determining the position of the tool in a case downhole. The positioning tool utilizes a detecting unit which includes at least a first magnet and a first sensor in a first plane as well as a second sensor also arranged in the first plane. The first and second sensors are configured to detect changes in a magnetic field generated by the first magnet. The first sensor is arranged at a first distance from the first magnet and the second sensor is arranged at a second distance from the first sensor in the first plane. |
| US09359883B2 |
Zonal compositional production rates in commingled gas wells
A production logging tool (PLT) is conveyed within production tubing containing production fluid flow established by zonal fluid flow from formation zones. The PLT measures a flow rate of the production fluid flow at each of a plurality of depths associated with a corresponding one of the zones. A flow rate of the zonal fluid flow from each zone is determined based on the flow rates of the production fluid flow measured at each of the depths. The PLT measures proportions of compositional components of the production fluid flow at each of the depths. A flow rate of each compositional component of the zonal fluid flow from each zone is determined based on the determined flow rate of the zonal fluid flow from each zone and the proportions of compositional components of the production fluid flow measured at each of the depths. |
| US09359880B2 |
Methods and systems for managing underground assets
Systems and methods for managing underground assets are disclosed. One or more computing devices may be used to receive a request for clearance to excavate including a location identifier, resolve a location based on the location identifier, and retrieve asset data corresponding to the location from an asset location database. The asset location database can include location data regarding the positions of a plurality of assets associated with a plurality of different asset owners and may be maintained by one or more updates regarding the positions of assets from computing devices associated with the different asset owners. The systems and methods can include determining if one or more assets are buried proximate the location based on the retrieved data and transmitting data related to the determination of assets buried proximate the location. |
| US09359877B2 |
Method and apparatus for single-trip time progressive wellbore treatment
A single trip multizone time progressive well treating method and apparatus that provides a means to progressively stimulate individual zones through a cased or open hole well bore. The operator can use pre-set timing devices to progressively treat each zone up the hole. At each zone the system automatically opens a sliding sleeve and closes a frangible flapper, at a preselected point in time. An adjustable preset timing device is installed in each zone to allow preplanned continual frac operations for all zones. An optional “Stand-Down-Mode” can be integrated into the timing system so that if pumping stops the timers go into a sleep mode until the pumping resumes. The apparatus can consist of three major components: a packer, a timing pressure device, and a sliding sleeve/isolation device. The packer may be removed. |
| US09359874B2 |
Systems and methods for killing a well
A well system and associated method, in which a kill weight fluid can be flowed into a wellbore via a flow passage extending from the surface to a downhole location, and prior to the flowing, the flow passage is installed with a casing string into the wellbore. A well system and associated method, in which a flow passage is positioned external to a casing, and wherein a downhole well parameter is measured via the flow passage. Another method can include flowing a kill weight fluid into a wellbore via a flow passage extending along a casing string, the flowing being performed while a formation fluid flows into the wellbore. |
| US09359872B2 |
Downhole system with filtering and method
A downhole system includes a tubular having a plurality of spaced apertures radially extending through a wall of the tubular. A section of the tubular blocking radial fluid flow through the wall between an interior and exterior of the tubular. The section arranged from a first end to a second end of the tubular. A plurality of filter pucks respectively inserted into at least some of the plurality of apertures. The filter pucks each including a body configured for insertion in one of the apertures and a filtering element within each body; and, at least one control or monitoring line arranged on the section. Further is a method of controlling sand in a downhole system. |
| US09359871B2 |
Debris catcher for retrievable barrier
A basket is attached below a retrievable bridge plug used during the pressure testing of a well to verify integrity prior to fracturing operations. After the pressure integrity test above the plug, the plug is released and retrieved and a series of balls of increasing diameter are dropped on increasingly larger ball seats to allow shifting sleeves to an open position from the heel of the well toward the surface to sequentially frac in that direction. If any segments of the sealing element break off they are captured and removed in the basket that has flow through opening small enough to retain the debris and allow flow through the basket during removal. The basket is slotted for through fluid flow and can have a breakaway for the support rod if the basket sticks when the plug is removed. |
| US09359868B2 |
Recovery from a subsurface hydrocarbon reservoir
Methods and systems for improving recovery from a subsurface hydrocarbon reservoir are described. A method includes drilling a horizontal well in a zone proximate to a contiguous section of cap rock over a reservoir interval. A refrigerant is flowed through the horizontal well to freeze water in the zone, forming a freeze wall in contact with the contiguous section of cap rock. A chamber is formed above the reservoir interval, wherein the chamber includes the contiguous section of cap rock and at least one freeze wall. |
| US09359866B2 |
Downhole tool actuator
A resettable downhole tool actuator comprises a housing, a collet slidable within the housing and defining a seating with which a ball is engageable, in use, the collet being mounted upon a moveable support including a piston and arranged such that, when the bail engages the seating, fluid flow through an axially extending passage provided in the support is restricted, the housing including an increased diameter region arranged such that, when the seating is aligned with the increased diameter region, outward deflection of the collet permits the ball to pass through the seating and through the axially extending passage. |
| US09359865B2 |
Pressure actuated ported sub for subterranean cement completions
A shifting sleeve has differential piston areas so that applied pressure displaces the sleeve against spring bias, which preferably is a series of Belleville washer stacks associated with modular mandrel components, to obtain the desired opposing force to the movement initiated with pressure applied to differential piston areas. An indexing feature is located between the sleeve and the mandrel passage wall and on a predetermined number of cycles disables the Belleville washer stacks from biasing the sleeve in an opposed direction as when pressure is applied. At this time the pressure in the mandrel acting on the differential piston area simply shifts the sleeve to open a lateral port so that fracturing through the cement that was earlier placed with the port closed can take place. |
| US09359863B2 |
Downhole plug apparatus
The present invention relates to downhole tools and methods of removing such tools from wellbores. More particularly, the present invention relates to downhole tools designed to be comprised of dissolvable materials or frangible materials and methods for dissolving or fragmenting such downhole tools in situ. |
| US09359859B2 |
Casing valve
A safety mechanism (401) comprising: (i) an obstructing member (412,414) moveable between a first position where fluid flow is permitted, and a second position where fluid flow is restricted; (ii) a movement mechanism (416,418); (iii) a wireless receiver (360), optionally a transceiver, adapted to receive a wireless signal such as electromagnetic or acoustic. The movement mechanism (416,418) is operable to move the obstructing member (412,414) from one of the first and second positions to the other of the first and second positions in response to a change in the signal being received by the wireless receiver (360). The safety mechanism also has (iv) a valve (401) in a casing sub; the valve (401) being adapted to move from one of the first and second positions to the other of the first and second positions, and then back to the first of the first and second positions. |
| US09359850B2 |
Varying radial orientation of a power cable along the length of an umbilical
A power triad of an umbilical may be rotated during multiple transition lengths to position each power cable of the power triad equally at radial orientation over the length of the umbilical. A first portion of the umbilical includes the triad in a first radial orientation, a second portion of the umbilical includes the triad in a second radial orientation, and a third portion of the umbilical includes the triad in a third radial orientation. The triad is rotated a first one hundred twenty degrees from the first radial orientation to the second radial orientation during a first transition length. The triad is rotated a second one hundred twenty degrees from the second radial orientation to the third radial orientation during a second transition length. The use of three radial orientations along the length of the umbilical may reduce imbalances between the power cables of the triad. |
| US09359849B2 |
Method and system for hydraulically presetting a metal seal
A system and method is provided for hydraulically presetting a metal-to-metal seal, which may be installed in an annular space between wellhead components. A hydraulic running tool may be landed on a first wellhead component and coupled to a second wellhead component, for example, via a hydraulic or mechanical coupling assembly. Fluid pressure may then be applied to the hydraulic running tool to move the components axially together, thereby setting the metal-to-metal seal (i.e., axially compressing and radially expanding the seal). A coupling may secure the wellhead components in place relative to one another, while fluid pressure is being applied so that the metal-to-metal seal remains in the set position after the hydraulic tool is removed. |
| US09359846B2 |
Hydraulic deployment of a well isolation mechanism
A hydraulic setting tool. The tool is configured to allow hydraulic setting of a bridge plug, packer or other radially expansive mechanical well isolation mechanism. Wireline or slickline deployment may be utilized. In either case, parameters of the setting application may be recorded. In the case of wireline deployment such parameters and downhole data may be monitored in real-time allowing an operator to make intelligent setting application adjustments as necessary. |
| US09359845B2 |
Subsea conductor anchor
A method of completing a subsea wellbore includes providing one or more conductor anchoring assemblies on an outer surface of a conductor; forming the subsea wellbore; positioning the conductor in the subsea wellbore; and energizing the one or more conductor anchoring assemblies into contact with the subsea wellbore, thereby stabilizing the conductor in the subsea wellbore. In yet another embodiment, the method further includes extending the subsea wellbore; positioning a casing inside the conductor, wherein the casing includes a casing anchoring assembly; and energizing the casing anchoring assembly into contact with the conductor. |
| US09359844B2 |
Downhole driving unit having a spring member for assembling a hydraulic motor housing
The present invention relates to a downhole driving unit (11) for insertion into a well, comprising a driving unit housing (51), a hydraulic motor (23) comprising a hydraulic motor housing (93), a wheel assembly (90) comprising a stationary part (91) and a rotational part (92), the stationary part being connected with the driving unit housing and being rotatably connected with the rotational part, the stationary part and the rotational part constituting the hydraulic motor housing, the rotational part comprising a wheel ring (99) closed from one end, wherein the wheel assembly comprises a spring member (113) assembling the hydraulic motor housing. The present invention also relates to a downhole system comprising the driving unit according to the invention and an operational tool connected with the driving unit for being moved forward in a well or borehole as well as to a use of the driving unit according to the invention in a well or borehole for moving itself and/or an operational tool forward in a well or borehole. |
| US09359843B2 |
Anchoring system and method of anchoring and unanchoring the same
An anchoring system includes a housing having a radial opening therein, and a piston disposed within the housing which is axially movable therein. A slip is in operable communication with the piston such that movement of the piston in a first axial direction relative to the housing causes movement of the slip in a first radial direction relative to the housing to anchor the anchoring system to a structure and movement of the piston in a second axial direction allows the slip to move in a second radial direction that allows unanchoring of the anchoring system. A sleeve is configured to cause movement of the piston in the second axial direction when moved in the second axial direction relative to the housing, in response to either mechanically pulling the sleeve in the second axial direction or increasing pressure applied against the piston. |
| US09359841B2 |
Downhole robots and methods of using same
A wellbore workstring. The workstring comprises a tubular string and a plurality of robots coupled to the tubular string. The robots establish a wireless communication network within a wellbore and deploy actuators to move themselves relative to the tubular string. |
| US09359837B2 |
Multi capacity riser tensioners
A hydraulic cylinder unit for connection to a wire line riser tensioner system includes a hydraulic cylinder comprising a cylinder piston separating a first cylinder chamber from a second cylinder chamber. A low pressure tank is arranged as a closed cylinder. A first conduit is inserted into the closed cylinder and provides a fluid communication between the low pressure tank and the first cylinder chamber. A second conduit provides a fluid communication between a high pressure fluid reservoir and the second cylinder chamber. A feedback conduit provides a fluid communication between the first cylinder chamber and the second cylinder chamber. A valve element comprising at least one valve is configured to be in a fluid communication with the at least one first conduit and the at least one feedback conduit. The valve element is configured to provide a reversible switching between a first alternative configuration and a second alternative configuration. |
| US09359834B2 |
Method for installing multiple sensors in unrolled coiled tubing
A method for installing multiple fiber optic cables in coiled tubing in oil and gas operations. |
| US09359831B2 |
Top drive main shaft with threaded load nut
A top drive system is provided. In one embodiment, a top drive includes a drive stem and a load nut with mating threaded surfaces that enable the drive stem to be threaded through the load nut and to support weight of a connected drill string via the load nut. One or both of the mating threaded surfaces may have a threadform with one or more undercut thread roots. Additionally, a portion of the mating threaded surfaces, such as thread roots of the drive stem, can be shot-peened. Additional systems, devices, and methods are also disclosed. |
| US09359828B2 |
Self-sharpening cutting elements, earth-boring tools including such cutting elements, and methods of forming such cutting elements
Cutting elements for earth-boring tools comprise a substrate including at least one material selected from the group consisting of CoCr, CoCrMo, CoCrW, and Ti. A polycrystalline superabrasive material may be attached to the substrate. Earth-boring tools comprise a body. At least one cutting element is attached to the body. The at least one cutting element comprises a substrate including at least one material selected from the group consisting of CoCr, CoCrMo, CoCrW, and Ti. A polycrystalline superabrasive material may be attached to the substrate. Methods of forming cutting elements for earth-boring tools comprise disposing a substrate including at least one material selected from the group consisting of CoCr, CoCrMo, CoCrW, and Ti in a container. Particles of superabrasive material may be disposed in the container. The particles of superabrasive material may be sintered with the substrate in the container to form a polycrystalline superabrasive material attached to the substrate. |
| US09359827B2 |
Hardfacing compositions including ruthenium, earth-boring tools having such hardfacing, and related methods
Hardfacing compositions include grains of hard material embedded within a cobalt-based metal alloy that includes ruthenium. Earth-boring tools include such hardfacing compositions on one or more surfaces thereof. Methods of applying hardfacing to an earth-boring tool include embedding grains of hard material in a molten cobalt-based metal alloy including ruthenium on a surface of an earth-boring tool, and cooling and solidifying the molten cobalt-based metal alloy with the grains of hard material embedded therein. |
| US09359822B2 |
Floating plug pressure equalization in oilfield drill bits
A drill bit of the type used to drill a wellbore in the earth can comprise a bore formed in the drill bit, and a plug sealingly and reciprocably disposed in the bore, whereby the plug prevents fluid communication between sections of the bore in the drill bit. The plug can comprise a spherically-shaped member. The plug can comprise a floating plug sealingly and reciprocably disposed in the bore, whereby pressure in the different sections of the bore on respective opposite sides of the plug is substantially equalized. |
| US09359821B2 |
Inner gauge ring drill bit
A drill bit comprises a plurality of annular blades coupled to a bit body. A plurality of gauge pads is coupled to the bit body and defines an outer cutting diameter. A circumferentially continuous gauge ring is coupled to the bit body and defines an inner cutting diameter. An inner cutting structure is coupled to the bit body and has a cutting diameter substantially equal to the inner cutting diameter. |
| US09359816B2 |
Roller shutter
The present invention relates to a roller shutter in which a slat connection structure is very flexible so as to reduce manufacturing and maintenance costs. The roller shutter of the present invention comprises: a plurality of slats continuously connected in the vertical direction; a winding unit for winding or unwinding the plurality of slats in the vertical direction; a shutter box arranged above a door frame of a building; and a guide frame for guiding the edges of the plurality of slats. The winding unit is arranged inside the shutter box. The plurality of slats are connected in the vertical direction such that the slats can be pivoted. One end of each slat has a hook, and the hook is curved with a predetermined radius of curvature. The other end of each slat has an accommodation groove curved at a predetermined radius of curvature. The hook of one slat is accommodated in the accommodation groove of another slat adjacent to said slat such that the hook is movable in the circumferential direction, thus enabling said slat and the other slat adjacent thereto in the vertical direction to pivot relative to one another. The hook has an inner surface and an outer surface. The accommodation groove has a first inner surface, a second inner surface, a closed surface, and an opening. The radius of the second inner surface of the accommodation groove is larger than that of the first inner surface. The first inner surface extends in the circumferential direction so as to form a cylinder. The inner surface of the hook and the first inner surface of the accommodation groove have the same radius, and the outer surface of the hook and the second inner surface of the accommodation groove have the same radius. |
| US09359810B2 |
Fluidtight fire door
The subject of the present invention is a watertight fire door for closing an opening in a building or edifice comprising, on the one hand, a fixed frame and at least one opening leaf and, on the other hand, sealing means that provide sealing between the fixed frame and the opening leaf when the door is closed. The or each opening leaf comprises, on the one hand, a framework surrounding an empty space capable of accepting or forming a thermal insulator and being sandwiched between two layers and of thermal insulation each essentially produced from a material having low thermal conductivity or diffusivity and, on the other hand, if appropriate, at least one thermal break. |
| US09359808B2 |
Triple-glazed insulating unit with improved edge insulation
An insulating unit includes a first spacer frame between first and second sheets, e.g. glass sheets, and a second spacer frame between the second sheet and a third sheet. A first surface of the first spacer frame is adhered to inner surface of the first sheet, and an opposite second surface of the first spacer frame is adhered to a first surface of the second sheet, by a moisture impervious adhesive layer. A first outer surface of the second spacer frame is adhered to a second surface of the second sheet, and an opposite second outer surface of the second spacer frame is adhered to an inner surface of the third sheet, by the adhesive layer. The first spacer frame and the second spacer frame have an offset of greater than zero. |
| US09359807B2 |
Transparent panel with electrically conductive coating
A transparent panel is described. The transparent panel has at least one transparent substrate and at least one electrically conductive coating on at least one surface of the transparent substrate. The electrically conductive coating has at least two functional layers which are arranged one above the other, and each functional layer has at least an optically highly refractive material layer, which has a refractive index greater than or equal to 2.1, and a smoothing layer, which is above the optically highly refractive material layer. The smoothing layer contains at least one non-crystalline oxide, a first matching layer, which is above the smoothing layer, an electrically conductive layer, which is above the first matching layer, and a second matching layer, which is above the electrically conductive layers. The total thickness of all the electrically conductive layers is between 40 nm and 75 nm, and the electrically conductive coating has a low ohm/square sheet resistance. The optically highly refractive material contains at least one mixed silicon/metal nitride. |
| US09359802B2 |
Garage door drive apparatus
A drive arrangement to open and close a door curtain of an overhead sectional door. The arrangement includes a door guide track for guiding movement of the door curtain between a closed, lowered position and an open, overhead position, and a drive mechanism for driving the door curtain between the closed and open positions. The drive mechanism comprises a drive belt located to a side of the door opening, guided to follow an inverted L-shaped locus by a drive belt guide track, a linkage between the drive belt and the door curtain, and a drive motor which drives the drive belt to open and close the door curtain as the drive belt follows the locus. |
| US09359801B2 |
Damper for furniture
The invention relates to a damper (1) for furniture, especially hinges, comprising a housing (2) in which a piston (8) is connected to a piston rod (3) and can be displaced. A fluid flows through at least one flow channel (11) on or in the piston (8) during a movement of the piston (8) inside the housing (2). A connecting element (4) having a seat (5) for coupling a drive element thereto is provided on the piston rod (3) on the end section projecting from the housing (2). The seat (5) has a cut-out section (18) on the face of the of the piston rod (3) accommodated therein, said cut-out section allowing the direct mechanical contact of a face (17) of the piston rod (3) and a drive element accommodated in the seat (5) so that there is a direct flux of force in the axial direction from the drive element accommodated in the seat towards the piston rod (3) when pressure is applied. |
| US09359798B2 |
Door latch for electrical equipment enclosure
A latch for an electrical device enclosure, wherein the latch comprises a moveable member operable in response to high pressure conditions inside the enclosure, and is configured to prevent opening of the enclosure in the event of high pressure conditions inside the enclosure. |
| US09359794B2 |
Method for operating an intelligent door knob
A method is provided for operating a door lock system with a knob. An apparatus controls transmission of displacement or rotational mechanical energy. A bolt is coupled to a door and the bolt is coupled to an input rod and an output rod. The bolt locks and unlocks a door in response transmission of displacement or delivery of rotational mechanical energy. At least one of an interior or exterior knob is coupled to the bolt and the apparatus that controls transmission of displacement or rotational mechanical energy. An energy source is used that is coupled to the apparatus that controls transmission of displacement or rotational mechanical energy. A wireless communication device is used to communication with a mobile device. Authorization is provided with the mobile device to engage the apparatus that controls transmission of displacement or rotational mechanical energy and allows a door user to manually open the door. |
| US09359792B1 |
Combination of lock with adjustable key and core
A combination of a lock and a key includes a cylinder having a housing, multiple index rings and multiple cores. The housing has slot laterally defined through the wall thereof the housing. At least one first post and at least one second post respectively extend radially from the first end and the second end of the housing. The index rings are located in the housing and each have at least one column with a first mark. At least one cap restricts the index rings to the housing. Each index ring has one core received therein. The key has a handle, a shaft and multiple unlocking members mounted to the shaft. Each unlocking members has a second mark and a top portion. The index rings are removed and re-arranged by removing the cap via the slot so as to obtain different combinations by the first and second marks. |
| US09359790B2 |
Electronic key for a vehicle
An electronic key, e.g., a wireless key for a vehicle, is disclosed. The key has a housing with a housing wall having a semi-transparent display section. An information symbol for representing information to be displayed to a user is further provided. The display section has a housing wall section with reduced wall thickness, wherein a light-impermeable layer, in which recesses representing the information symbol are produced, is applied to an inner side of the housing. The combination of a housing wall section of reduced thickness and the light-impermeable layer on the inner side of the housing as an information symbol provided in the display section creates an information symbol that may be very sharp and bright when backlit and, due to the semitransparent formation of the display section, is not visible when not backlit. |
| US09359788B2 |
Clutch driving mechanism and methods of making and using thereof
A clutch driving mechanism, comprising a motor, a worm, a torsion spring and a clutch rotating arm, wherein the motor is rotationally coupled with the worm, wherein the worm is operably coupled to at least a portion of the torsion spring, and the torsion spring is operably coupled to at least a portion of the clutch rotation arm. |
| US09359786B1 |
Tent wall system
A system to elevate an internal object in a tent above the ground is provided. The system includes tent wall structure having tent wall material that is in contact an internal attachment that is in contact with the internal object and the tent wall material is also in contact with an anchor external to the tent. The system provides a means to elevate a hammock or other object inside a tent. |
| US09359785B2 |
Metal post reinforcement arrangement and a method of repairing and/or reinforcing damaged metal posts
A metal post reinforcement arrangement adapted to be clamped about a broken section of a metal post, including two opposing brackets wherein when a bolt fixes one bracket to the other about the metal post the bolt divides the broken section into upper and lower portions so as to provide support and/or structural integrity when the reinforcement arrangement is clamped about the broken section and wherein each bracket has a substantially semi circular cross-sectional configuration along said bracket length that includes a longitudinal central segment terminating on opposed sides with internally directed curved edges with corresponding upwardly extended rounded shoulders that provide substantially triangular dimples on the internal side of the bracket, and wherein a peripheral flange stems out from a rounded dip from each substantially triangular dimple such that said brackets are adapted to be fixed around metal posts having different shapes. |
| US09359776B2 |
Walkable photovoltaic floor
Walkable photovoltaic floor, constituted of pieces of laminated glass composed of at least two layers of glass (1 and 2), joined together by an encapsulant (6), by an intermediate layer of photovoltaic material (3), and by a peripheral sealed frame (4). |
| US09359773B2 |
Non-vinyl resilient flooring product and methods of making same
Described herein are methods for manufacturing resilient floor coverings made from non-vinyl materials. |
| US09359770B1 |
System for mounting wall panels to a wall
A system for mounting wall panels to an existing wall structure, includes wall panels, each formed by a main wall panel section and at least two bent end sections; fastening extrusions, each including a base section adapted to be secured to the existing wall structure and a rigid wall extending at an angle therefrom; and a latch arrangement for securing the wall panels to the rigid wall, the latch arrangement including a latch housing, a movable latch member mounted in the latch housing for either engaging within through openings of respective ones of the rigid wall and the bent end sections, or applying a force on each bent end section positioned against a respective rigid wall, and a force application member for moving the movable latch member into a position to cause locking of respective ones of the rigid wall and the bent end sections. |
| US09359768B2 |
Adjustable all-season window awning/light shelf and operating mechanism therefor
An adjustable window awning/light shelf includes a canopy attached to supports on both sides of the window. The supports are engaged with vertical drive screws providing for the possibility of moving the canopy up and down. Each drive screw is connected with a common drive shaft. During the cooling season, the canopy is disposed at the top of the window, shading the window from the sun. During the heating season, the canopy is brought down to the bottom of the window by rotating the drive shaft, which in turn rotates the drive screws and moves the supports with the canopy down. Canopy's angle relative to the window increases. When in the bottom position, the awning performs as a light shelf, reflecting sunlight into the window and increasing the amount of sunlight and solar heat entering the building through the window. |
| US09359767B2 |
Z-shaped closure member with filter retention features
A Z-closure member for raised seam roofs is formed through bending techniques into a shape having a ventilated central vertical member, an upper mounting flange terminating in an upper tab member, and a lower flange member extending in an opposing direction from the upper mounting flange member and terminating in a flexible locking tab. The lower flange is secured to a raised seam roofing panel with fasteners, while the vent cap formed with a return lip is engaged with the upper flange by capturing the upper flange within the return lip. A fastener can be inserted through the vent cap return lip and the upper flange to secure the vent cap to the Z-closure member. A mesh filter is trapped against the vertical member by the upper tab member and the lower flexible locking tab. A seal can be added to the lower flange to seal against the roofing panel. |
| US09359766B2 |
System, method and apparatus for thermal energy management in a roof
A roof product has a thermal heat storage layer, a vent layer with channels for transferring excess heat through a length of the roof product, and a flame retardant to suppress fire through the vent layer. These three materials form a unitary structure. The roof product may have a radiant layer, the thermal heat storage layer and the vent layer to form the unitary structure. The roof products are assembled in an abutting configuration on the roof of a building. The vent layer vents excess heat from an eave of the roof up to a ridge of the roof and out to atmosphere. The roof products manage thermal energy in the roof by storing thermal heat with the unitary roof product during a heating cycle; venting excess heat through the unitary product; and releasing the stored thermal heat from the unitary product into or out of the building during a cooling cycle. |
| US09359762B2 |
Building product and method of manufacture and use
A building product and method for manufacturing a building product made from an oriented polymer composition which can be split to provide a surface of the building product with a plurality of visible fibrils to form an aesthetic representative of split wood. |
| US09359752B2 |
Toilet discharge valve assembly having moveable buoyant float therein
A toilet flush valve that has a moveable buoyant float therein, wherein the float has an open bottom end to trap air therein and wherein the housing includes controls to selectively release air to allow the float to move upwardly therein to permit flushing. By timing when one or two air vents on the housing are open, the duration and volume of the flush can be controlled, with the buoyancy provided by the water lifting the float to open the flush valve. This provides a flushing system with minimal activation energy. |
| US09359751B2 |
Plumbing trap flushing device
A plumbing trap flushing device for use in association with one of a drain in a sink, an overflow drain in a basin, a drain in a bathtub, an overflow drain in a bathtub and the like is disclosed. The plumbing trap flushing device includes a connector, a conduit and a nozzle. The connector is releasably attachable to a tap. The conduit is in flow communication with the connector and has an outside diameter and an inside diameter. The outside diameter is dimensioned to fit into the drain, whereby when the conduit is in the drain air and water freely flows around the conduit into the drain. The nozzle is in flow communication with the distal end of the conduit. The nozzle has a nozzle inside diameter less than the inside diameter of the conduit whereby the water exits the nozzle in a stream. |
| US09359750B1 |
Method and apparatus for cleaning and clearing P-trap systems
Embodiments of an apparatus for draining liquid generally include a liquid inlet, a p-trap, an additive reservoir, a fluid outlet, a float switch, a valve, and a fitting, wherein the liquid inlet allows for introduction of liquid, the p-trap allows for maintenance of a liquid level whereby contact is provided between the liquid and an additive contained in the additive reservoir, the fluid outlet is configured to maintain the liquid level above an additive reservoir bottom interior surface, the float switch provides indication of high liquid level, the valve allows for blockage of fluid flow between the p-trap and the liquid inlet, and the fitting allows for introduction of high-pressure fluid into the apparatus. Embodiments of a method for clearing a liquid draining apparatus generally include ceasing flow of liquid there into, operating a valve to substantially prevent reverse flow of liquid therefrom, and providing high-pressure fluid into the apparatus. |
| US09359748B1 |
Shower device with multi-product dispensing capability
A two-stage coaxial shower head that allows conventional water flow through the shower head or a mixture of product and water through a product low flow nozzle. The product may be such liquids as soap, moisturizer, shampoo, or hair conditioner. Products are contained within product pressure reservoirs each with a product section and a piston. During a shower, a user rotates a selector dial at the multi-ported spool valve to select a product or conventional water flow for rinsing. When a product is selected water flow through a water supply tube from the multi-ported spool valve to the shower head will cease and pressure to force water down to the lower part of a product reservoir to raise the piston in the product pressure reservoir to reject product that is transported to a shower head section. A version using electronics instead of hydraulics is also presented. |
| US09359747B2 |
Sanitary fitting comprising a fitting housing and an electrical control unit
A sanitary fitting having a fitting housing with an electrical control unit for controlling the water flow through at least one water line which sanitary fitting can be maintained or repaired with particularly little effort particularly in applications involving vandalism. This is achieved by having a fitting housing that can be firmly fixed at the installation site with an assembly cover, which can be released from the fitting main body and which covers electrical control unit, turbine and hydraulic control elements within the fitting housing main body and which provides direct access for maintenance and servicing purposes. |
| US09359745B2 |
Bucket edge protection system
An edge protection segment for an edge protection system of a ground engaging implement is disclosed. The edge protection segment includes a first side, a second side, a width, a wedge portion, an exterior leg, and an interior leg. The second side is oppositely disposed and lateral to the first side. The width is up to 6 centimeters and is the distance between the first side and the second side. The exterior leg and the interior leg each extend from the wedge portion. The wedge portion, the exterior leg and the interior leg each extend between the first side and the second side. |
| US09359744B2 |
Multipiece wear assembly
A multipiece wear assembly including an adapter and a wear part. The adapter has a nose portion with a first predetermined configuration. The wear part is assembled onto the adapter nose portion by relative longitudinal movement and defines a blind cavity opening to a rear thereof. The blind cavity of the wear part has a second predetermined configuration. In one form, the second predetermined configuration defined by the blind cavity is greater than the first predetermined configuration defined by the adapter nose portion such that a relief is provided between the adapter nose portion and the blind cavity when the adapter and wear part are arranged in operable combination relative to each other. Lock structure is provided on one of the adapter nose portion and wear part for maintaining the wear part and adapter nose portion in operable combination. In one form, a modular securement member extends generally perpendicular to a longitudinal axis of the tooth assembly with a portion of the securement member filling the relief defined between confronting surfaces on the blind cavity and the adapter nose portion. |
| US09359743B2 |
Control system for hybrid construction machine
A control system for a hybrid construction machine includes: a turning motor provided in a turning circuit; a pressure detector for detecting a turning pressure of the turning motor; a variable displacement type of fluid pressure motor for regeneration which is rotated by means of pressurized fluid guided from the turning motor; a motor generator adapted to be rotated integrally with the fluid pressure motor; and a controller adapted to predict a turning regeneration flow from the turning motor on the basis of the turning pressure detected by pressure detector to control a tilt angle of the fluid pressure motor on the basis of the predicted turning regeneration flow. |
| US09359738B2 |
Quick coupling for pipe pile
The present invention relates to a quick coupling for pipe pile, comprising an upper end plate, a lower end plate and a screw hook made of spring steel for coupling the upper and lower end plate, a plurality of tapped holes are uniformly provided on the upper end plate, a plurality of holes corresponding to the tapped holes are provided on the lower end plate, a lock hole is positioned at the lower portion of the hole, while the cross-section area of the lock hole is bigger than the cross-section area of the hole. One end of the screw hook is provided with a screw end mating with the tapped hole on the upper end plate, while the other end is provided with a hook end mating with the lock hole on the lower end plate, whereby the upper and lower end plate can be coupled firmly. |
| US09359737B2 |
Environmentally-friendly safe weir comprising both water way and fishway
Disclosed herein is an environmentally-friendly safety weir with both a waterway and a fishway. The safety weir includes a waterway pipe (100), a fishway pipe (200), and a control unit (300). The waterway pipe includes: a horizontal waterway pipe (110) that is provided on an embankment; a vertical waterway pipe (120) that extends from each of opposite ends of the horizontal waterway pipe downward; a bottom waterway pipe (130) that horizontally extends from the vertical waterway pipe outward; and a water entering-and-exiting pipe (140) that extends from the bottom waterway pipe upward. The fishway pipe is provided on the waterway pipe and is configured such that the level of water in the fishway pipe is controlled by adjusting the amount of air in the fishway pipe. The control unit includes: a first air supply pipe that is connected to the waterway pipe; and a second air supply pipe that communicates with the fishway pipe. |
| US09359735B2 |
Auger snow blower
In an auger snow plow, right and left forward rotating augers and right and left backward rotating augers are disposed on a same axis and aligned in a width direction of an auger housing. A blower housing is disposed at a rear portion of the auger housing and also positioned at a widthwise center of the auger housing. A blower is disposed inside the blower housing. The right and left forward rotating augers are positioned at least in an entire range of a width of the blower housing. The right and left backward rotating augers are separately positioned on both sides of the right and left forward rotating augers and positioned only at a more outer side than the width of the blower housing in the width direction. |
| US09359732B2 |
Pet waste collection and disposal apparatus
A device for collecting and disposing of pet waste includes a housing containing a vacuum source. The housing is configured to receive a disposable liner bag. When closed, the housing holds the liner bag securely therein. The mouth of the bag is fed through the access port of the device such that the access port is insulated from contact with the waste being picked up. A bail holds the bag in place. A filtered bag is presented for use in the device. |
| US09359730B2 |
Bollard coverings and methods of manufacture and use thereof
A bollard covering formed from a body, a body connector, a first center, a second center, a bottom, and a top is disclosed. The body connector and bottom further comprise post guide surfaces. In order to secure the bollard covering to the post, one or more holes are provided within the bottom, threaded to accommodate a set screw, or the like. Bollard covering elements are joined by welding, bonding, or mechanical fastening. Bollard coverings may be formed from standard inventory elements in order to create a standard inventory or a customized bollard covering product that may be economically configured on an individual bollard covering basis, or on small or large scale runs, with as much variation in optional components, features, and conveniences as may be required by the marketplace. |
| US09359728B2 |
Milling drum comprising a, more particularly replaceable, material guiding device and material guiding device for a milling drum
The present invention relates to a milling drum for a ground milling machine, wherein a material guiding device is provided, which diverts the milled material in the direction of stagger of milling devices disposed one behind the other, as regarded in the direction of rotation. For this purpose, in particular, a wear plate is provided, which can be selectively replaced on the material guiding device. A further aspect of the present invention relates to such a material guiding device and also to a wear plate for such a material guiding device. |
| US09359727B2 |
Adjustable bolster swing legs for mounting and aligning and reorienting crawlers for slipform paving machines
A paving machine for spreading, leveling and finishing concrete having a main frame, center module, bolsters laterally movably, and a crawler track associated with respective aft and forward ends of the bolsters. A bolster swing leg for each crawler track supports an upright jacking column. A worm gear drive permits rotational movements of the crawler track and the jacking column. A hinge bracket is interposed between each swing leg and a surface of the bolsters to enable pivotal movements of the swing leg. A length-adjustable holder engages the pivot pin on the hinge bracket and pivotally engages the swing leg. The holder permits pivotal motions of the swing leg in its length-adjustable configuration and prevents substantially any motion of the swing leg in its fixed-length configuration. A feedback loop cooperates with transducers keeping the crawler tracks position. The paving machine can be reconfigured into a narrowed transport configuration. |
| US09359726B2 |
Paver having dowel bar inserter with automated dowel bar feeder
A paver for laying down a strip of concrete and inserting therein dowel bars parallel to the strip. A dowel bar inserter orients the bars and places them into the concrete. A pair of transport chains transverse to the travel direction extends across a width of the inserter. Pairs of generally L-shaped opposing cups hold the bars so that they can drop downwardly from the cups towards the strip. The chains move in a single direction. A dowel bar holding magazine, above the chains, stores bars, and gravitationally moves the bars towards the chains for pick-up by cups as the chains move the cups past a bar loading station. Elastic bands extend about a bar engaging surface defined by a wheel and resiliently bias the bars moving along the chain turn-around section against the wheel. |
| US09359725B2 |
Stepwise repeated destabilization and stabilization of highly collapsible soil mass by ‘soil nailing technique’ used for construction of railway/road underpass
The excavations of side vertical walls for building and underpasses must be shored so that the excavations adjacent to the neighboring properties do not cave in during the constructions. A Soil Nailing system has been used for stabilization of excavations and natural slopes for the last few decades in India and Abroad. Soil Nailing Technique used steel anchor rods inserted directly into the soil mass as a driven nails and when Nails are placed in pre-drilled holes to form grouted nails. In both the cases, it restrained load and the side deformations. In the present study, an innovative technique of ‘Soil Nailing’ has been developed for stepwise vertical de-stabilization and stabilization of compacted collapsible sandy soil for the construction of railway underpasses in live railway loading conditions. This technique is successfully implemented first time in the world for controlled destabilization of vertical cut slope and again stabilization for creating a space for pushing of box for railway underpasses for the length of 22 m and 50 m at two sites, namely Yamuna Bazzar and Apsara border, respectively, in Delhi, India. This Soil Nailing Technique of controlled destabilization of soil and again stabilization in steps has proved a superficial method of stabilization with the other methods for such kind of dynamic loading situations. |
| US09359720B2 |
Self-adhesive water-activable glass web
The invention relates to a self-adhesive wall covering comprising a glass textile with a closed structure, consisting of glass fibers and of a water-permeable polymer binder, and an adhesive coating comprising both a pressure-sensitive adhesive (PSA) and a water-activable latent adhesive. The definitive attachment to the wall of this repositionable self-adhesive covering takes place, after hanging, by applying one or more coats of water-based paint. |
| US09359718B2 |
Aqueous solution composition
This invention relates to a composition characterized by containing, as essential components, deacetylated chitin and/or a deacetylated chitin derivative, and glyoxylic acid; a solution-containing gel formed from the composition; a water-insoluble chitosan coating; and a material obtained by treating a base material with the composition. According to the present invention, it is possible to provide a chitosan composition, which in a “one-pack” form, has a pot life. Even when dried at room temperature after coating or impregnation of a base material, the chitosan coating can be water-insolubilized with reduced yellowing. |
| US09359717B2 |
Laundry treatment apparatus
The laundry treatment apparatus includes a cabinet having a receiving space for reception of laundry, a feeder configured to feed at least one of air or moisture into the receiving space, a support structure placed in the receiving space, the support structure providing a support space to allow a surface of the laundry to be supported by the support space, a guide affixed in the receiving space, the guide being configured to set a movement range of the laundry to prevent the laundry from deviating from the support space, and a press structure separably coupled to the support structure, the press structure being configured to apply pressure to the laundry positioned in the support space. |
| US09359713B2 |
Drying apparatus, washing machine having the same and method of controlling the drying apparatus
A drying apparatus that is capable of effectively removing foreign substances, such as dead mite bodies and dust adhered to bedding, a washing machine having the drying apparatus, and a method of controlling the drying apparatus. When bedding having a large volume, such as a blanket or a cover, is washed, a bedding-dusting operation using rotation of a drum and high-temperature hot air is performed before and after a bedding washing course is performed, so that foreign substances, such as dead mite bodies or dust, are dusted off bedding and the effects of washing bedding can be improved. In addition, a section in which the bedding-dusting operation is to be performed, is automatically or manually selected as before bedding washing or after bedding washing so that various operations can be performed and the effects of washing bedding can be improved. |
| US09359705B2 |
Washing machine and drying machine
A washing machine includes a vibration damping device located in an outer casing for damping vibration of a tub using a cylinder enclosing an operating fluid including a functional fluid such as a magnetic viscous fluid changing a viscosity when an electrical energy is applied to the fluid. The vibration damping device includes the cylinder, a shaft inserted into the cylinder, a coil disposed in the cylinder, two yokes disposed between the cylinder and the shaft so as to be located at both axial sides of the coil respectively, the yokes forming a magnetic circuit together with the shaft and cylinder, a sealing member disposed axially outside one of the yokes in the cylinder to seal the operating fluid, and two bearings located axially outside the respective yokes in the cylinder to support the shaft so that the shaft is axially reciprocable. |
| US09359703B2 |
Sewing machine
The sewing machine has: a base plate that has a guide slit for guiding a bobbin thread that is set on the bottom face side of the throat plate 1; and a bobbin thread guide member that has a guide groove for guiding the bobbin thread supplied from a bobbin and includes a cutting blade provide at the end position of the guide groove to cut the bobbin thread guided along the guide groove to an appropriate length. The bobbin thread guide member is secured to the base plate and has a holding member, which holds the end of the bobbin thread, in the guide groove, so as to maintain the state when the bobbin thread was cut. |
| US09359700B2 |
Weft insertion system and weaving machine comprising such a system
A weft insertion system includes at least one rapier provided with weft yarn clamping means for drawing a weft and a reed provided with dents made of a magnetic material, and wherein the rapier has at least one permanent magnet whose direction of polarization extends along a direction which is perpendicular to a longitudinal axis of the reed dents when the reed is in a back position and to a translation direction of the rapier, the at least one permanent magnet exerts an attractive magnetic effort (E, E′) between the rapier and the dents of the reed and the reed has a variable magnetic permeability along its longitudinal axis, and the rapier has a lateral face oriented towards the reed and the at least one permanent magnet has a direction of polarization perpendicular to the direction of travel of the rapier and secant with the lateral face. |
| US09359699B2 |
Industrial two-layer fabric
The object of the present invention is to provide an industrial two-layer fabric which exhibits excellent air permeability with good wear resistance to prevent the wire mark or the hydration mark, while exhibits high rigidity. The present invention includes at least one upper surface side fabric constituted by upper surface side warps and upper surface side wefts, at least one lower surface side fabric constituted by lower surface side warps and lower surface side wefts, and lower surface side warps serving as binding weft yarns, and includes three upper surface side warps arranged to be adjacent to each other in the upper surface side fabric, whereby the upper surface side wefts pass over three consecutive upper surface side warps, and then, pass under one upper surface side warp to pass over another upper surface side warp, and then, passes under three consecutive upper surface side warps. |
| US09359697B2 |
Adjustable spinning wheel
A spinning wheel assembly, including a collapsible frame and a spinning assembly connectable thereto. The spinning assembly includes a first grooved pulley and a plurality of differently sized second grooved pulleys, each pulley being rotatably connectable to the frame. A spindle is removably connectable to a respective grooved second pulley, and an endless belt is operationally connected to the first and second pulleys. Each respective grooved second pulley has at least one circumferential groove defining an effective diameter and at least one unique effective diameter. |
| US09359696B2 |
Method for manufacturing poly(ethyleneterephthalate) drawn fiber, poly(ethyleneterephthalate) drawn fiber and tire-cord
Disclosed are a method for manufacturing a drawn fiber, which is suitable for manufacturing a poly(ethylene terephthalate) drawn fiber showing superior strength and dimensional stability and having a high fineness of 2000 denier or more without breakage or reduction in physical properties during the manufacturing process, and a poly(ethylene terephthalate) drawn fiber and a tire-cord obtained therefrom. |
| US09359695B2 |
Lignin-based active anode materials synthesized from low-cost renewable resources
A method of making an anode includes the steps of providing fibers from a carbonaceous precursor, the carbon fibers having a glass transition temperature Tg. In one aspect the carbonaceous precursor is lignin. The carbonaceous fibers are placed into a layered fiber mat. The fiber mat is fused by heating the fiber mat in the presence of oxygen to above the Tg but no more than 20% above the Tg to fuse fibers together at fiber to fiber contact points and without melting the bulk fiber mat to create a fused fiber mat through oxidative stabilization. The fused fiber mat is carbonized by heating the fused fiber mat to at least 650° C. under an inert atmosphere to create a carbonized fused fiber mat. A battery anode formed from carbonaceous precursor fibers is also disclosed. |
| US09359693B2 |
Gallium-nitride-on-diamond wafers and manufacturing equipment and methods of manufacture
A method for integrating wide-gap semiconductors, and specifically, gallium nitride epilayers, with synthetic diamond substrates is disclosed. Diamond substrates are created by depositing synthetic diamond onto a nucleating layer deposited or formed on a layered structure that comprises at least one layer of gallium nitride. Methods for manufacturing GaN-on-diamond wafers with low bow and high crystalline quality are disclosed along with preferred choices for manufacturing GaN-on-diamond wafers and chips tailored to specific applications. |
| US09359684B2 |
Methods of fabricating self-aligned metal layer structure and optic
A method of fabricating a self-aligned metal layer structure is disclosed. The method includes: providing a substrate including a conductive layer; forming a pattern in the conductive layer; and electroplating the conductive layer to form thereon an electroplated metal layer such that the pattern is directly transferred in the electroplated metal layer in a self-aligned manner. Methods of fabricating optics are also disclosed. The methods are capable of high accuracy in alignment, and the optics can be used in the production of a lens module. |
| US09359680B2 |
Ruthenium or osmium complexes and their uses as catalysts for water oxidation
The present invention provides ruthenium or osmium complexes and their uses as a catalyst for catalytic water oxidation. Another aspect of the invention provides an electrode and photo-electrochemical cells for electrolysis of water molecules. |
| US09359679B2 |
Methods for cyclically etching a metal layer for an interconnection structure for semiconductor applications
Embodiments of the present disclosure provide methods for etching a metal layer, such as a copper layer, to form an interconnection structure in semiconductor devices. In one example, a method of patterning a metal layer on a substrate includes supplying a first etching gas mixture comprising a hydro-carbon gas and a hydrogen containing gas into a processing chamber having a substrate disposed therein, the substrate having a metal layer disposed thereon, supplying a second gas mixture comprising the hydrogen containing gas to a surface of the etched metal layer disposed on the substrate, and supplying a third gas mixture comprising an inert gas into the processing chamber to sputter clean the surface of the etched metal layer. |
| US09359677B2 |
Method for inhibiting corrosion
A method for inhibiting corrosion comprises the steps of providing a fluid; adding a corrosion inhibitor comprising at least one amphiphilic chemical to the fluid; and monitoring micelles presence in the fluid. A method for determining the amount of corrosion inhibitor that is sufficient to inhibit corrosion, a method for monitoring the activity of an amphiphilic chemical and a system for inhibiting corrosion in a conduit are also disclosed. |
| US09359675B2 |
Producing two-dimensional sandwich nanomaterials based on graphene
Two-dimensional nanomaterials are produced in a process comprising the steps of (a) providing (a1) a mixture comprising graphene oxide particles, water and at least one cationic surfactant and/or nonionic surfactant or (a2) a mixture comprising graphene particles, at least one solvent useful for solution exfoliation of graphite and at least one cationic surfactant and/or nonionic surfactant, (b) adding at least one sol precursor compound to the mixture from step (a), (c) reacting the mixture from step (b) in a sol/gel process to form gel from the at least one sol precursor compound on the graphene oxide particles or, respectively, the graphene particles, (d) removing the at least one surfactant, and (e) optionally heating the gel-coated graphene oxide particles for at least 1 min to at least 500° C. under inert gas atmosphere to reduce the graphene oxide to graphene. |
| US09359674B2 |
Apparatus and method for dielectric deposition
The disclosed invention includes apparatus and methods that may be used for plasma-based deposition of thin layers of material on separate or continuous web substrates at very low temperatures with very low defect density. It achieves superior control of gas phase chemistry by controlling the sequence of introduction of gaseous components. It also has substantially independent control over the rate of chemical processes in the gas and of the amount of power and energy of ion bombardment. Such control enables high quality single and multi-layer films to be deposited cost effectively and uniformly over larger areas under very low temperature conditions. |
| US09359671B2 |
Coating a substance with graphene
Technologies are generally described for a system and process effective to coat a substance with graphene. A system may include a first container including graphene oxide and water and a second container including a reducing agent and the substance. A third container may be operative relationship with the first container and the second container. A processor may be in communication with the first, second and third containers. The processor may be configured to control the third container to receive the graphene oxide and water from the first container and to control the third container to receive the reducing agent and the substance from the second container. The processor may be configured to control the third container to mix the graphene oxide, water, reducing agent, and substance under sufficient reaction conditions to produce sufficient graphene to coat the substance with graphene to produce a graphene coated substance. |
| US09359659B2 |
Method for recovering valuable material from lithium-ion secondary battery, and recovered material containing valuable material
A method for recovering a valuable material from a lithium-ion secondary battery, the method contains: roasting a lithium-ion secondary battery containing a valuable material in a metal battery case thereof to obtain a roasted material; stirring the roasted material with liquid to separate contents containing the valuable material from the inside of the metal battery case; and sorting the contents separated by the separation and the metal battery case to obtain a recovered material containing the valuable material. |
| US09359655B2 |
Metallurgical composition for the manufacture of ferrochrome
The invention relates to a pelletizing feed containing chromite ore, at least one nickel salt, and silicon carbide as the only carbonaceous material and the only reducing agent. The invention also relates to process for manufacturing the pelletizing feed comprising the steps providing chromite, at least one nickel salt and silicon carbide, and mixing chromite, at least one nickel salt and silicon carbide. The invention also relates to use of the pelletizing feed as a starting material for the manufacture of sintering feed. The invention also relates to a sintering feed in the form of pellets containing the pelletizing feed. The invention also relates to sintered pellets containing the sintering feed. The invention also relates to process for manufacturing the sintered pellets. The invention also relates to use of the sintered pellets as a component of smelting feed. The invention also relates to smelting feed comprising sintered pellets. The invention also relates to process for manufacturing ferrochrome alloy. The invention also relates to ferrochrome alloy obtainable by the method. |
| US09359652B2 |
Thermal treatment method for micromechanical horological parts
Thermal treatment method for a micromechanical horological component derived from the LIGA method and exhibiting very low thermal inertia, said method including the step which consists in locally heating one area of the micromechanical horological component to increase hardness by local phase modification, the component being heated for a sufficiently short time that only the locally heated area is affected by the thermal treatment, the phase of the untreated portions of the component remaining unchanged. |
| US09359649B2 |
Methods for collection, storage and transportation of biological specimens
The present invention provides methods for collecting, storing or transporting liquid suspension of biological specimens containing analytes of interest in a dry state. The dried biological specimens containing analytes of interest are reconstituted and released for subsequent analysis by compressing or centrifuging the matrix. Also provided are method of using kits for collecting, storing, transporting and recovering biological specimens containing analytes of interest. |
| US09359646B2 |
Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene
The present invention relates to a kit and nucleic acid chip for diagnosing bladder cancer using a bladder cancer-specific marker gene. More particularly, the invention relates to a kit and nucleic acid chip for diagnosing bladder cancer, which can detect the promoter methylation of a bladder cancer-specific gene, the promoter or exon region of which is methylated specifically in transformed cells of bladder cancer. The use of the diagnostic kit or nucleic acid chip of the invention enables diagnosis of bladder cancer at an early stage of transformation, thus enabling early diagnosis of bladder cancer, and can diagnose bladder cancer in a more accurate and rapid manner compared to a conventional method. |
| US09359641B2 |
Method and system for accurate alignment and registration of array for DNA sequencing
In a genome sequencing system and methodology, a protocol is provided to achieve precise alignment and accurate registration of an image of a planar array of nanoballs subject to optical analysis. Precise alignment correcting for fractional offsets is achieved by correcting for errors in subperiod x-y offset, scale and rotation by use of minimization techniques and Moiré averaging. In Moiré averaging, magnification is intentionally set so that the pixel period of the imaging element is a noninteger multiple of the site period. Accurate registration is achieved by providing for pre-defined pseudo-random sets of sites, herein deletion or reserved sites, where nanoballs are prevented from attachment to the substrate so that the sites of the array can be used in a pattern matching scheme as registration markers for absolute location identification. Information can be extracted with a high degree of confidence that it is correlated to a known location, while at the same time the amount of information that can be packed on a chip is maximized. |
| US09359638B2 |
Multi-nucleic-acid amplification reaction tool
According to one embodiment, a multi-nucleic-acid amplification reaction tool includes a support and a plurality of types of primer sets. The support is configured to be able to support a reaction field of a liquid phase. A plurality of types of primer sets are fixed in a releasable state, for each type, on mutually independent fixing regions of at least a surface of the support, which is in contact with the reaction field, when the liquid phase forms the reaction field. A plurality of types of primer sets are configured to amplify the respectively corresponding target sequences. |
| US09359634B2 |
Fast reaction kinetics of enzymes having low activity in dry chemistry layers
The present invention concerns a method for determining an analyte as well as a diagnostic element suitable therefore. In one particular form, a method for determining an analyte includes contacting a sample containing the analyte with a diagnostic element comprising a dry reagent layer. The dry reagent layer contains a mutated dehydrogenase which is specific for the analyte and an artificial coenzyme. The method also includes determining at least one of analyte presence and an amount of the analyte. |
| US09359633B2 |
Biochemical markers for CVD risk assessment
A method of bioassay for the quantification of peptide fragments comprising a neo-epitope formed by cleavage of a protein of an atherosclerotic plaque such as lumican, versican, perlecan, decorin, biglycan, collagen type III, CRP, ApoE, or elastin, by a proteinase, said comprises contacting a sample such as urine or serum with an antibody reactive with the neo-epitope and determining the level of binding of said immunological binding partner to peptide fragments in said sample. The assay is predictive of risk of cardiovascular disease events. |
| US09359632B2 |
Devices, systems and methods for sample preparation
Devices, systems and methods including a sonicator for sample preparation are provided. A sonicator may be used to mix, resuspend, aerosolize, disperse, disintegrate, or de-gas a solution. A sonicator may be used to disrupt a cell, such as a pathogen cell in a sample. Sample preparation may include exposing pathogen-identifying material by sonication to detect, identify, or measure pathogens. A sonicator may transfer ultrasonic energy to the sample solution by contacting its tip to an exterior wall of a vessel containing the sample. Multipurpose devices including a sonicator also include further components for additional actions and assays. Devices, and systems comprising such devices, may communicate with a laboratory or other devices in a system for sample assay and analysis. Methods utilizing such devices and systems are provided. The improved sample preparation devices, systems and methods are useful for analyzing samples, e.g. for diagnosing patients suffering from infection by pathogens. |
| US09359628B2 |
Protein glycosylation modification in methylotrophic yeast
The present invention provides genetically engineered strains of Pichia capable of producing proteins with reduced glycosylation. In particular, the genetically engineered strains of the present invention are capable of expressing either or both of an α-1,2-mannosidase and glucosidase II. The genetically engineered strains of the present invention can be further modified such that the OCH1 gene is disrupted. Methods of producing glycoproteins with reduced glycosylation using such genetically engineered stains of Pichia are also provided. |
| US09359625B2 |
Chemical engineering processes and apparatus for the synthesis of compounds
The present invention provides methods for producing cannabinoids and cannabinoid analogs as well as a system for producing these compounds. The inventive method is directed to contacting a compound according to Formula I or Formula II with a cannabinoid synthase. Also described is a system for producing cannabinoids and cannabinoid analogs by contacting a THCA synthase with a cannabinoid precursor and modifying at least one property of the reaction mixture to influence the quantity formed of a first cannabinoid relative to the quantity formed of a second cannabinoid. |
| US09359622B2 |
Method for biotechnological production of dihydrochalcones
A method for production of a dihydrochalcone, especially of phloretin, using a transgenic microorganism, containing a nucleic acid section (a), comprising or consisting of a gene coding for a bacterial chalcone isomerase, and/or a nucleic acid section (a′), comprising or consisting of a gene coding for a plant chalcone isomerase, and a nucleic acid section (b), comprising or consisting of a gene coding for a bacterial enoate reductase, corresponding transgenic microorganisms, containing a nucleic acid section (a), comprising or consisting of a gene coding for a bacterial chalcone isomerase, and/or a nucleic acid section (a′), comprising or consisting of a gene coding for a plant chalcone isomerase, and/or a nucleic acid section (b), comprising or consisting of a gene coding for a bacterial enoate reductase, and host cells, containing one or more identical or different such vectors. |
| US09359619B2 |
Biomass liquefaction processes, and uses of same
Described are processes for the liquefaction of lignocellulosic biomass under the digestive action of dicarboxylic acid(s). Such digests can exhibit enhanced flowability, reduced volume, and significant biomass conversion to dissolved components, and can in some embodiments be further liquefied by contact with an enzyme. Products resultant of these steps can be used for their sugar content to manufacture biofuels or other products. |
| US09359611B2 |
Recombinant microorganism and methods of production thereof
The invention relates, inter alia, to novel genetically modified microorganisms capable of using CO to produce 1-butanol and/or a precursor thereof, novel methyltransferases and nucleic acids encoding same, methods for producing genetically modified microorganisms using said novel methyltransferases, and methods of producing 1-butanol and/or a precursor thereof by microbial fermentation. |
| US09359610B2 |
Method for purifying GLA-domain coagulation proteins
A method for purifying GLA-domain coagulation proteins, includes the following steps: a) bringing a sample containing one or more GLA-domain coagulation proteins into contact with an affinity substrate on which nucleic aptamers which bind specifically to the GLA-domain coagulation proteins are immobilized, in order to form complexes between (i) the nucleic aptamers and (ii) the GLA-domain coagulation protein(s), b) releasing the GLA-domain coagulation protein(s) from the complexes formed in step a), and c) recovering the GLA-domain coagulation protein(s) in a purified form. |
| US09359606B2 |
Anti-clusterin monotherapy for cancer treatment
The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19. |
| US09359605B2 |
Method of treating cancer by inhibition of DNA repair proteins
Methods of treating cancer using antisense oligonucleotides directed against DNA double-strand break repair proteins such as BRCA2 or RAD51 are provided. The antisense oligonucleotides can be used alone, in tandem or in combination with other cancer therapies, in particular with therapies that lead to DNA damage, inhibition of DNA repair or inhibition of DNA synthesis, such as radiation, platinum drugs, alkylating agents, PARP inhibitors, or inhibitors of thymidylate synthase. |
| US09359603B2 |
Modulation of pre-mRNA using splice modulating oligonucleotides as therapeutic agents in the treatment of disease
The present invention encompasses a class of compounds known as splice modulating oligonucleotides (SMOs) that modulate pre-mRNA splicing, thereby affecting expression and functionality of a specific protein in a cell. The present invention further provides compositions and methods for modulating pre-mRNA splicing using a SMO of the invention to abrogate disease-causing mutations in a protein. Accordingly, the present invention provides compositions and methods of treating a subject at risk of, susceptible to, or having a disease, disorder, or condition associated with aberrant or unwanted target pre-mRNA expression or activity. |
| US09359593B2 |
Xeno-free generation of tissue-specific progenitor cells
The invention relates to purified, tissue-specific progenitors, methods of making and using such tissue-specific progenitors. |
| US09359590B2 |
Derivation and culture of human embryo-derived cells
The present invention concerns methods for deriving and culturing embryonic cells and in particular to methods for maintaining the undifferentiated state of stems cells and cell lines in culture. The invention also concerns cells and cell lines derived by the methods of the invention. |
| US09359589B2 |
Use of at least one chelating agent introduced into the culture medium of magnetotactic bacteria in order to stimulate the growth thereof
The invention relates to the use of at least one chelating agent, including an iron chelating agent, in order to stimulate the growth of magnetotactic bacteria. |
| US09359587B2 |
Yeast strains and methods of use thereof
The present invention relates to yeast strains and, in particular, to yeast stains for use in fermentation processes. The invention also relates to methods of fermentation using the yeast strains of the invention either alone or in combination with other yeast strains. The invention thither relates to methods for the selection of yeast strains suitable for fermentation cultures by screening for various metabolic products and the use of specific nutrient sources. |
| US09359583B2 |
Fabric care compositions
The present invention is directed to fluid fabric enhancing compositions and processes of making and using same. Such fluid fabric enhancing compositions have a desirable fabric enhancer active efficiency that is, at least in part, due to the particle index of such fluid fabric enhancing compositions. Certain chemical processing and physical processing methods are not required to produce such compositions. |
| US09359580B2 |
Method for extraction and purification of oils from microalgal biomass using high-pressure CO2 as a solute
The present invention provides methods for the isolation of oils from intact or lysed microorganisms in aqueous media with pressurized carbon dioxide as a solute. Such oils may be used for the production of biofuels. Also provided for are methods for harvesting and rupturing whole cell microorganisms in aqueous media with pressurized carbon dioxide as a solute. |
| US09359575B2 |
Nanoparticle macro-compositions
Embodiments of the present invention may include a macro-composition with a special structure. The structure includes a layered macro-composition made of a nanoparticle as an inner nucleus, an intermediate layer around the nucleus, and an outer layer intercalated with the nucleus or encapsulating the nucleus and the intermediate layer. A plurality of the layered macro-compositions is bonded together by bonds, so that each layered macro-composition is bonded to at least one other such layered macro-composition. Embodiments include a macro-composition made of three 3-layered macro-compositions joined in a chain by two bonds. These macro-composition assemblies may take the shape of layered macro-compositions bonded together in chains, or forming other shapes, such as rings. The layered macro-composition may be no more than about 100 nanometers in size, for example. The bonds of the complex macro-composition may have an average length of no more than about 100 nanometers, for example. Embodiments may be added to lubricants such as oil or grease, to increase their performance. |
| US09359574B2 |
Lubricating oil composition
To provide is a lubricating oil composition capable of exerting an improved fuel-saving performance and having an improved shear stability.The lubricating oil composition comprises (A) a mineral base oil having kinematic viscosity at 100° C. of no more than 5 mm2/s and % CP of no less than 90; and (B) a polymer having weight average molecular weight of no more than 15000. |
| US09359572B2 |
Modified vegetable oil lubricants
Lubricants based on renewable feedstocks and methods of making them. |
| US09359570B2 |
Polytetrahydrobenzoxazines and bistetrahydrobenzoxazines and use thereof as a fuel additive or lubricant additive
Polytetrahydrobenzoxazines and bistetrahydrobenzoxazines, obtainable by (A) reacting at least one diamine of the formula H2N-A-NH2 with a C1- to C12-aldehyde and a C1- to C8-alkanol at 20 to 80° C. with elimination and removal of water, (B) reacting the condensation product from (A) with a phenol which bears a long-chain substituent at 30 to 120° C., and optionally (C) heating the reaction product from (B) to 125 to 280° C. The resulting polytetrahydrobenzoxazines and bistetrahydrobenzoxazines are suitable as fuel or lubricant additives, especially as detergent additives for diesel fuels. |
| US09359558B2 |
Carbon to liquids system and method of operation
A method of operating a carbon to liquids system is provided. The method includes receiving a flow of syngas and reacting, in a reactor, the syngas and a catalyst in a Fischer-Tropsch reaction to produce a product including steam, wherein the reactor includes a polymeric material that is configured to permit the permeation of the steam therethrough. The method also includes recycling the permeated steam to a vessel positioned upstream from the reactor. |
| US09359557B2 |
Process for producing volatile organic compounds from biomass material
Embodiments of the present invention provide for efficient and economical production and recovery of ethanol or other volatile organic compounds, such as acetic acid, from solid biomass material, particularly on a larger scale, such as on the commercialization or industrial scale. According to one aspect of the invention, the method comprises (a) generating at least about 10 tons of prepared biomass material by adding a microbe, optionally an acid, and optionally, an enzyme to a solid biomass; (b) storing the prepared biomass material for at least about 24 hours in a storage facility to allow production of at least one volatile organic compound from at least a portion of the sugar in the solid biomass; and (c) capturing the at least one volatile organic compound by using a solventless recovery system. |
| US09359551B2 |
Phosphor, manufacture thereof; light-emitting device, and image display device utilizing phosphor
Provided is a chemically and thermally stable phosphor having different emission characteristics than the conventional phosphor and exhibiting high emission intensity if combined with an LED of 470 nm or less. The phosphor of the present invention is represented by a composition formula: MdAeDfEgXh (d+e+f+g+h=1; M is one or more kinds of elements selected from Mn, Ce, Pr, Nd, Sm, Eu, Tb, Dy, and Yb; A is one or more kinds of elements selected from Mg, Ca, Sr, and Ba; D is one or more kinds of elements selected from Si, Ge, Sn, Ti, Zr, and Hf; E is one or more kinds of elements selected from B, Al, Ga, In, Sc, Y, and La; and X is one or more kinds of elements selected from O, N, and F) and parameters d, e, f, g, and h satisfy the predetermined condition. |
| US09359549B2 |
Organic electroluminescent materials and devices
Compounds comprising a metal complex having novel ligands are provided. In particular, the compound is an iridium complex comprising novel aza DBX ligands. The compounds may be used in organic light emitting devices, particularly as emitting dopants, providing improved efficiency, low operating voltage, and long lifetime. |
| US09359545B2 |
Branched viscoelastic surfactant for high-temperature acidizing
A treatment fluid for use in a subterranean formation penetrated by the wellbore of a well includes: (i) water; (ii) a strong acid; and (iii) a branched viscoelastic surfactant having a hydrophobic portion with a total of 16 to 20 carbons; wherein the pH of the treatment fluid is less than 0.5; and wherein the viscosity of the treatment fluid is less than 5 cP at 40 sec−1. A method of treating a zone of a subterranean formation penetrated by a wellbore includes the steps of; (A) forming the treatment; (B) introducing the treatment fluid through the wellbore into the zone; and (C) allowing time for the strong acid in the treatment fluid to spend in the formation. |
| US09359543B2 |
Wellbore servicing methods and compositions comprising degradable polymers
Methods of servicing a wellbore and/or a subterranean formation including introducing a wellbore servicing fluid into the wellbore and/or the subterranean formation to degrade a degradable polymer therein by contacting the degradable polymer with a liquid neutralized degradation accelerator. The wellbore servicing fluid comprises a particulate salt degradation accelerator and a neutralizer activator. The particulate salt degradation accelerator is formed by reacting a degradation accelerator solution with an acid, the neutralizer activator is capable of dissociating the acid by neutralization from the particulate salt degradation accelerator so as to form the liquid neutralized degradation accelerator. |
| US09359539B2 |
Vehicle lamp
Provided is a vehicle lamp 1 using a lamp body 3 formed using a resin composition containing a base resin and plant fiber, in which the lamp body 3 and a front cover 2 have good adhesiveness therebetween and there is no separation in the bonding between the lamp body 3 and the front cover 2 even after some time. The lamp body 3 is formed using a resin composition containing a base resin and plant fiber, and in a bonding part between the lamp body 3 and the front cover 2, the bonding is performed using a moisture curing adhesive. |
| US09359538B2 |
Sealant for use in ink jet recording heads and ink jet recording head
Provided is a sealant for use in ink jet recording heads, comprising a cationically polymerizable resin; a fluorine-containing compound that is liquid at a temperature in a range of 20° C.±15° C.; and a cationic polymerization initiator. |
| US09359534B2 |
Hot-melt adhesives with improved adhesion on low-energy surfaces
A hot-melt adhesive composition, the use thereof, and a composite body including the hot-melt adhesive composition. The hot-melt adhesive composition includes a polyolefin P, which is solid at 25° C., a soft resin WH with a softening point between −10° C. and 40° C., and a polar modified polyolefin wax PW. |
| US09359532B2 |
Pulverulent adhesive which is dispersible in water
The invention relates to a pulverulent adhesive for textile reinforcing plies which is dispersible in water, comprising: a) 85 to 97% by weight of at least one at least partially capped, low-molecular isocyanate, b) 15 to 3% by weight of an alkyl naphthalene sulphonate as wetting agent, and also c) 0 to 10% by weight of additives, binders being excluded, with the proviso that the formulation components a+b+c produce 100% by weight. |
| US09359531B2 |
Temporarily repositionable pressure sensitive adhesive blends
Temporarily repositionable pressure sensitive adhesive compositions which are blends of a silicone-modified pressure sensitive adhesive component, a high Tg polymer component and a crosslinker are presented. The silicone-modified pressure sensitive adhesive includes a copolymer that is the reaction product of an acidic or basic monomer, a (meth)acrylic or vinyl monomer, and a silicone macromer. The high Tg polymer component contains acid or base functionality such that when mixed, the silicone-modified pressure sensitive adhesive component and the high Tg polymer component form an acid-base interaction. |
| US09359530B2 |
Release liner for pressure sensitive adhesives and method of use
A double-sided adhesive tape assembly that includes a double-sided tape having a pressure sensitive adhesive (“PSA”) on each side thereof and a delaminatable release liner in contact with the pressure sensitive adhesive (“PSA”) on one or both sides of the double-sided tape is disclosed. A roll of the double-sided adhesive tape assembly is also disclosed. Methods of making and using the double-sided adhesive tape assembly are also disclosed. |
| US09359518B2 |
Aqueous binder for granular and/or fibrous substrates
The invention provides an aqueous binder for granular and/or fibrous substrates, said binder comprising, as active constituents, a polyamine and a saccharide compound. |
| US09359514B2 |
Ink jet recording water-based ink and method for producing the same
Disclosed are an ink jet recording water-based ink having excellent long-term storage stability and ejection stability at a pigment concentration greater than or equal to a certain level and a simple and efficient method for producing such a water-based ink. The present invention provides an ink jet recording water-based ink in which the total content of polyvalent metals as impurities in the water-based ink is not more than 1.2 ppm in terms of 1 mass % of a pigment concentration. Furthermore, the present invention provides a method for producing an ink jet recording water-based ink; the method enables efficient production of the above-mentioned ink jet recording water-based ink through a contact treatment with a particulate chelating resin in which each resin particle contains both an alkali metal-bonded chelating group and a hydrogen-bonded chelating group. |
| US09359513B1 |
Dopant inks, methods of making dopant inks, and methods of using dopant inks
Printable dopant formulations, methods of making such dopant formulations, and methods of using such dopant formulations are disclosed. The dopant formulations provide a printable dopant ink with a viscosity sufficient to prevent ink spreading when deposited in a pattern on a substrate. Furthermore, an ion exchange purification process provides the dopant formulation with a reduced metal ion concentration, and thus a relatively high purity level. Consequently, the dopant residue remaining on the substrate after curing and/or dopant activation process is relatively uniform, and therefore can be easily removed. |
| US09359512B2 |
Aqueous dispersible siloxane-containing polymer inks useful for printing
A siloxane-containing ink composition for variable data lithographic printing includes a nano-particle polymer or blend of nano-particle polymers, wherein the polymer or polymers of the blend are water dispersible at temperatures below 100 degrees Celsius; and solids content is in an amount of greater than 25 percent by total weight. |
| US09359507B2 |
Ambient curable corrosion resistant sol-gel coating and composition and process for making the same
A coating composition and a method for coating metallic substrates for corrosion resistance. In at least one embodiment, the coating composition comprises acid, metal acetate, epoxy silane, aminosilane and water. |
| US09359505B2 |
Gas barrier film, process for production of gas barrier film, and electronic device
The present invention provides a gas barrier film having high barrier properties, folding/bending resistance and smoothness and excellent cutting suitability, and also provides an organic photoelectric conversion element equipped with the gas barrier film. The gas barrier film is characterized by having a gas barrier layer unit (5) on a side face of at least one surface of a base material (2), wherein the gas barrier layer unit (5) comprises a first barrier layer (3) formed by a chemical vapor deposition method and a second barrier layer (4) formed by applying a silicon compound onto the first barrier layer (3) to form a coating film and modifying the coating film, and wherein the second barrier layer (4) has an unmodified region (4B) on a side facing the base material and a modified region (4A) on a side facing the front layer of the film. |
| US09359504B2 |
Sintering-assisted deposition of uniform titania nanocrystalline coatings over Al flakes in aqueous solution
A process of forming a multi-layered pigment comprising the steps of: providing a metal core material; treating the metal core material with an acid, depositing a passivation layer onto the metal core material; densifying the metal core material having the passivation layer reducing a pore size of the passivation layer; and depositing a high refractive index material onto the sintered material wherein the high refractive index layer is uniform and crack free. |
| US09359497B2 |
Method for polymerisation of (meth)acrylic acid in solution, polymer solutions obtained and their uses
The present invention relates to a new solvent-free preparation method of a (meth)acrylic acid polymer in solution, where said polymer has a molecular weight less than 8,000 g/mol and a polydispersity IP index between 2 and 3 by radical polymerization, the polymers obtained by this means, and their applications in industry. |
| US09359495B2 |
Rubber composition for heat resistant conveyor belts, and heat-resistant conveyor belt
A rubber composition for heat-resistant conveyor belts according to the present technology contains an ethylene-butene copolymer and an ethylene-propylene-diene copolymer. The mass ratio of the ethylene-butene copolymer to the ethylene-propylene-diene copolymer [(ethylene-butene copolymer)/(ethylene-propylene-diene copolymer)] is from 5/95 to 95/5; and the amount of diene units in the ethylene-propylene-diene copolymer is 2.0% by mass or less per 100 parts by mass of the total of the ethylene-butene copolymer and the ethylene-propylene-diene copolymer. |
| US09359486B2 |
Plasticized polymeric compositions
The present invention provides plasticized polymer compositions comprising an 7V-allcyl-2-pyrrolidone and a fatty acid ester. These compositions exhibit enhanced hardness, tensile strength, and/or elongation at break without the use of phthalate-based plasticizers. The plasticized polymeric compositions can be employed in a wide variety of applications, such as in sheeting, tubing, and coatings. |
| US09359484B2 |
Processes for making polyolefin nanocomposites
A process for making a silica-polyolefin composite. The process has the steps of (a) reacting silica particles and an alkyl halosilane in the presence of a solvent and a catalyst to form silane-functionalized silica particles and (b) reacting the silane-functionalized silica particles with a vinyl-terminated polyolefin. There are other processes for making a silica-polyolefin composites. There are other processes for making metal phosphate-polyolefin composites. |
| US09359482B2 |
Methods for reducing contamination in plastics recovered from durable goods
A process for reducing the content of residual organic substances in mixtures of plastics from durable goods can include separating a feed stream into two or more mixtures of flakes and preforming a cleaning process to remove a portion of one or more of the absorbed organic substances from one or more of the mixtures. Each mixture can contain one or more plastic types and at least one organic substance absorbed into the one or more plastic types. The flakes in the mixtures can have an average particle diameter of less than 10 millimeters. |
| US09359476B2 |
Polyamide resin, preparation method therefor, and molded product including same
The polyamide resin of the present invention is a polyamide resin containing an amine group and a carboxyl group, wherein the amine group concentration is about 200 to 300 μeq/g and two to six times as high as the carboxyl group concentration. The polyamide resin has excellent long-thermal stability. |
| US09359465B2 |
Polyisobutylenes and process for making same
The present invention generally relates to alcohol-terminated polyisobutylene (PIB) compounds, and to a process for making such compounds. In one embodiment, the present invention relates to primary alcohol-terminated polyisobutylene compounds, and to a process for making such compounds. In still another embodiment, the present invention relates to polyisobutylene compounds that can be used to synthesize polyurethanes, to polyurethane compounds made via the use of such polyisobutylene compounds, and to processes for making such compounds. In yet another embodiment, the present invention relates to primary alcohol-terminated polyisobutylene compounds having two or more primary alcohol termini and to a process for making such compounds. In yet another embodiment, the present invention relates to primary terminated polyisobutylene compounds having two or more primary termini selected from amine groups or methacrylate groups. |
| US09359464B2 |
Stable formaldehyde-free microcapsules
The present invention relates to water-dispersible core-shell microcapsules essentially free of formaldehyde. In particular it concerns oligomeric compositions comprising, and the microcapsules obtained from, particular reaction product between a polyamine component and a particular mixture of glyoxal and a C4-6 2,2-dialkoxy-ethanal. The present invention comprises also the invention's core-shell microcapsules as part of a perfuming composition or of a perfuming consumer product. |
| US09359463B2 |
Amphiphilic and non-water soluble (meth)acrylic comb polymers
Non water-soluble polymers with a comb structure and a (meth)acrylic skeleton on which are grafted side chains containing at least one hydrophobic monomer of the styrene or (meth)acrylic ester type on C1 to C4, and at least one hydroxy or methoxy polylakylene glycol monomer. The levels of monomers are such that the polymer is amphiphilic because it is both rich in hydrophobic monomer and polylakylene glycol monomer. These products, used in paper coating dispersions, enable an increase in their Brookfield™ viscosity, a reduction in their ACAV viscosity, and an improvement in their water retention, which makes them particularly well suited for dry extract and/or high deposit speed coatings. |
| US09359456B2 |
Catalytic hydroformylation of vinyl terminated polyolefins
This invention relates to a polyolefin composition comprising one or more of the following formulae: wherein the PO is the residual portion of a vinyl terminated macromonomer (VTM) having had a terminal unsaturated carbon of an allylic chain and a vinyl carbon adjacent to the terminal unsaturated carbon; and wherein the VTM is preferably a vinyl terminated polymer having greater than 30% allyl chain ends with an Mn of greater than 10,000. |
| US09359453B2 |
Phosphonate and phosphonic acid RAFT agents and monomers, along with methods of their manufacture and use
An intermediate compound for forming a RAFT agent is provided that can have the formula: where n is an integer from 1 to 20; m is an integer from 0 to 20; R1 is H, an alkyl group, or a cyano group; R2 is H, an alkyl group, or a cyano group; Y is OH, COOH, or NH2; and X is OH, COOH, NH2, a nitrobenzyl, benzyl, or para-methyl benzyl group. A RAFT agent is also provided that comprises a thiocarbonylthio-containing organic compound having a phosphonic end group. A method is also provided for forming a polymer chain on a surface of a nanoparticle utilizing the RAFT agent, along with nanoparticles and nanocomposites formed therefrom. |
| US09359448B2 |
Anti-BAFF-anti-IL-17 bispecific antibodies
Bispecific antibodies are provided that specifically bind B-cell Activating Factor of the TNF Family (BAFF) and Interleukin-17A (IL-17) and are characterized as having high affinity and strong neutralizing properties to both BAFF and IL-17. The bispecific antibodies of the invention are expected to be useful in treating Lupus Nephritis (LN), Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), Psoriasis (Ps), Ankylosing Spondylitis (AS), Psoriatic Arthritis (PA), primary Sjögren's Syndrome (pSS), or Multiple Myeloma (MM). |
| US09359446B2 |
Antibody to a carbonic anhydrase
The present invention relates to an antibody binding to a carbonic anhydrase, wherein the antibody comprises (a) the amino acid sequences SEQ ID NOS. 1 (CDR 1), 2 (CDR 2) and 3 (CDR 3) determining the CDRs of the VH region, and the amino acid sequences SEQ ID NOS. 4 (CDR 1), 5 (CDR 2) and 6 (CDR 3) determining the CDRs of the VL region; or (b) the amino acids sequences of (a), wherein at least one amino acid is conservatively substituted in any one of the amino acid sequences SEQ ID NOS. 1 to 6. |
| US09359442B2 |
Anti-CD33 antibodies and methods for treatment of acute myeloid leukemia using the same
The present invention relates to antibodies that bind CD33. More particularly, the invention relates to anti-CD33 antibodies, fragments and homologues of these antibodies, humanized and resurfaced versions of these antibodies, functional equivalents and improved versions of these antibodies, immunoconjugates and compositions comprising these antibodies, and the uses of same in diagnostic, research and therapeutic applications. The invention also relates to a polynucleotide encoding these antibodies, vectors comprising the polynucleotides, host cells transformed with polynucleotides and methods of producing these antibodies. |
| US09359439B2 |
Fab-glycosylated antibodies
The present invention pertains to a method for controlling the circulation half-life of antibodies by adjusting the amount of sialic acid in the carbohydrates attached to the Fab part of the antibodies. Furthermore, the present invention provides antibodies having an increased circulation half-life. |
| US09359438B2 |
Human neonatal Fc receptor antibodies and methods of use thereof
The disclosure relates to antibodies that bind FcRn and methods of using these antibodies. |
| US09359437B2 |
Antibodies comprising chimeric constant domains
Antibodies, antigen-binding proteins and Fc-fusion proteins that comprise recombinant polypeptides containing a chimeric heavy chain constant region sequence are provided that bind to certain Fc receptors however have reduced effector functions. Methods of making constructs for expression of such chimeric Fc-containing antibodies, antigen-binding proteins and Fc-fusion proteins in cell systems, and methods of producing and isolating the chimeric Fc-containing proteins are provided. |
| US09359433B2 |
FGF modulation of in vivo antibody production and humoral immunity
The invention provides methods for increasing or decreasing antibody production in vivo by inhibiting or promoting the activity of fibroblast growth factor-2 (FGF2) respectively. |
| US09359427B2 |
Methods for culturing human myeloid leukaemia cells and cells derived therefrom
The present invention pertains to a method for culturing a suspension of immortalized human blood cells, preferably cells of myeloid leukaemia origin or cells derived therefrom, wherein said method provides a high productivity, a high cell viability and growth rate and a high batch-to-batch consistency, and can be scaled up without altering these parameters. |
| US09359424B2 |
Multimeric polypeptides of HLA-G including alpha1-alpha3 monomers and pharmaceutical uses thereof
Multimeric polypeptides and pharmaceutical uses thereof; multimers comprising alpha3 and alpha1 peptides of an HLA-G antigen and methods of producing such multimers, pharmaceutical compositions comprising the same, as well as their uses for treating various diseases including organ/tissue rejection. Said multimers comprise at least two monomers, each of said monomers being selected in the group consisting of a peptide P2 of formula P1-X3 or X2-X3, wherein P1 is of formula X1-X2, wherein X1 represents a peptidic linker including a cysteine amino acid and X2 represents an alpha1 domain (or alpha1 peptide) of HLA-G and X3 represents an alpha3 domain of HLA-G. |
| US09359422B2 |
Single chain relaxin polypeptides
The present invention relates to biologically active single chain relaxin polypeptides comprising a relaxin B chain derived from relaxin-3, the polypeptides being truncated by one or more amino acids at the C-terminus of the relaxin-3 B chain. Typically the single chain relaxin polypeptides are antagonists of the RXFP3 receptor, and in some embodiments are selective antagonists of the RXFP3 receptor. |
| US09359421B2 |
Suppressor of the endogenous interferon-gamma
The invention relates to suppressors of endogenous human interferon-gamma (INF-γ) applicable in treatment of diseases associated with impaired activity of endogenous IFN-γ. The suppressors of the invention are useful in treating autoimmune diseases and for prevention of graft arteriosclerosis and rejection of organs in allograft transplanted patients. The invention includes inactive analogues or variants of IFN-γ having preserved affinity to the IFN-γ receptor, genetically modified in the domain responsible for triggering the signal transduction pathway. |
| US09359420B2 |
Single chain trail fusion polypeptides and encoding nucleic acids
The present invention refers to single-chain fusion proteins comprising three soluble TNF superfamily (TNFSF) cytokine domains and nucleic acid molecules encoding these fusion proteins. The fusion proteins are substantially non-aggregating and suitable for therapeutic, diagnostic and/or research applications. |
| US09359412B2 |
OprF/I fusion proteins, their preparation and use
The present invention relates to a novel trimeric OprF/I fusion protein comprising a portion of the Pseudomonas aeruginosa outer membrane protein F which is fused with its carboxy terminal end to a portion of the amino terminal end of the Pseudomonas aeruginosa out membrane protein I, wherein said portion of the Pseudomonas aeruginosa outer membrane protein F comprises the amino acids 190-342 of SEQ ID NO: 1 and wherein said portion of the Pseudomonas aeruginosa outer membrane protein I comprises the amino acids 21-83 of SEQ ID NO: 2, and further to a novel Opr F/I fusion protein which contains a disulphide bond pattern, preferably selected from the group consisting of (a) Cys18-Cys27-bond, (b) Cys18-Cys27-bond and Cys33-Cys47-bond, and (c) Cys18-Cys47 and Cys27-Cys33-bond, and to immunogenic variants thereof having at least 85% identity to the amino acid sequence of SEQ ID NO: 3. The present invention also relates to a novel method for producing said OprF/I fusion proteins and to their use for the preparation of a pharmaceutical composition and for the preparation of antibodies or antibody derivatives which specifically bind said novel OprF/I fusion proteins. |
| US09359404B2 |
Methods and products for treating preeclampsia and modulating blood pressure
The invention relates to methods for altering biological parameters in a subject, such as reducing blood pressure in a subject, by displacing CLIP, using a CLIP inhibitor. The methods are useful for treating disorders such as preeclampsia and high blood pressure. |
| US09359402B2 |
EphA2 T-cell epitope agonists and uses therefore
EphA2 T-cell epitope are provided herein. The epitopes include peptides corresponding to specific fragments of human EphA2 protein containing one or more T-cell epitopes, and conservative derivatives thereof. The EphA2 T-cell epitopes are useful in an assay, such as an ELISPOT assay, that may be used to determine and/or quantify a patient's immune responsiveness to EphA2. The epitopes also are useful in methods of modulating a patient's immune reactivity to EphA2, which has substantial utility as a treatment for cancers that overexpress EphA2, such as renal cell carcinoma (RCC). The EphA2 epitopes also can be used to vaccinate a patient against EphA2, by in vivo or ex vivo methods. |
| US09359397B2 |
Method for manufacturing protein drug
The present invention provides a method for manufacturing a virus-free protein drug, comprising (a) a filtration step of filtering a virus-containing protein solution through a small-pore size virus removal membrane to obtain a virus-free protein solution, the filtration step (a) comprising (q) a low-pressure filtration step of filtering the solution through the small-pore size virus removal membrane at a filtration pressure of 0.30 kgf/cm2 or lower to obtain the virus-free protein solution, wherein the solution prior to filtration in the low-pressure filtration step (q) has a pH (X) and a salt ionic strength (Y (mM)) that satisfy the following equations 1 and 5: 0≦Y≦150X−590 (Equation 1) and 3.5≦X≦8.0 (Equation 5) or the following equations 4 and 5: Y=0 (Equation 4) and 3.5≦X≦8.0 (Equation 5). |
| US09359396B2 |
Material for supported synthesis and method for growing oligonucleotides or peptides
The invention concerns a material composed of a porous support on which functionalized nanoparticles are grafted by covalent bonding, characterized in that at least part of the nanoparticles grafted by covalent bonding is housed inside surface pores of the support, and in that the support is silica-based and is in the form of porous particles of heterogeneous shape and size, the size of the particles being larger than 1 μm and preferably within the range of 5 to 200 μm.The invention further concerns a growth method for oligonucleotides or peptides characterized in that growth is performed on a material formed of a porous support on which functionalized nanoparticles are grafted by covalent bonding, characterized in that at least a part of the nanoparticles grafted by covalent bonding is housed inside surface pores of the support. |
| US09359395B2 |
Prodrugs of steroidal CYP17 inhibitors/antiandrogens
Prodrugs of C-17-heterocyclic-steroidal drugs providing improved oral bioavailability and phamacokinetics are described. The drugs are inhibitors of human CYP 17 enzyme, as well as potent antagonists of both wild type and mutant androgen receptors (AR), and are useful for the treatment of urogenital and/or androgen-related cancers, diseases and/or conditions, such as human prostate cancer, breast cancer, and prostate hyperplasia. The disclosure describes methods of synthesizing and using the prodrugs in cancer therapy. |
| US09359394B2 |
Stereoselective glycosylation reactions
Disclosed is a method for selective synthesis of 1,2-cis-α-linked glycosides which does not require the use of the specialized protecting group patterns normally employed to control diastereoselectivity. Thioglycoside acceptors can be used, permitting iterative oligosaccharide synthesis. The approach eliminates the need for lengthy syntheses of monosaccharides possessing highly specialized and unconventional protecting group patterns. |
| US09359393B2 |
Photoresponsive nucleic acid manufacturing method
The present invention provides a manufacturing method that can easily manufacture a compound known as photoresponsive (photocoupling) nucleic acids at high yield in a shorter period of time than that of the conventional technology. The present invention relates to a method of manufacturing a photoresponsive nucleic acid which includes a step of reacting a nucleic acid having groups represented by the Formula I, the Formula III, the Formula IV, or the Formula V and a compound represented by the Formula II, or reacting a nucleic acid having groups represented by the Formula VI, the Formula VIII, the Formula IX, or the Formula X and a compound represented by the Formula VII by heating them by microwaves in the presence of a metal catalyst, a basic substance, and a solvent. |
| US09359391B2 |
Selective C—O bond cleavage of oxidized lignin and lignin-type materials into simple aromatic compounds
A method to cleave C—C and C—O bonds in β-O-4 linkages in lignin or lignin sub-units is described. The method includes oxidizing at least a portion of secondary benzylic alcohol groups in β-O-4 linkages in the lignin or lignin sub-unit to corresponding ketones and then leaving C—O or C—C bonds in the oxidized lignin or lignin sub-unit by reacting it with an organic carboxylic acid, a salt of an organic carboxylic acids, and/or an ester of an organic carboxylic acids. The method may utilize a metal or metal-containing reagent or proceed without the metal or metal-containing reagent. |
| US09359387B2 |
Organosilicon compound having conjugated diene structure and making method
The invention provides a conjugated diene structure-containing organosilicon compound having formula (1): R1nX3-nSi-A-CR2═CR2—CR2═CH2 (1) wherein R1 is a monovalent hydrocarbon group, X is halogen or organoxy, n is 0, 1 or 2, R2 is hydrogen or a monovalent hydrocarbon group, and A is a divalent hydrocarbon group. The organosilicon compound is prepared by reacting a conjugated diene structure-bearing olefin compound with a hydrogensilyl-containing compound in the presence of a platinum catalyst and an acid amide compound, organic amine salt compound, nitrile compound, aromatic hydroxy compound, or carboxylic acid compound. |
| US09359384B2 |
Organohalosilane and use thereof in electrolytes of non-aqueous lithium ion batteries
An organohalosilane represented by formula I, where R1, R2, and R3 independently, at each occurrence, represent —(CH2)xCH3 where x is an integer from 0 to 5, or a halogen substituent where the halogen is F or Cl, and at least one substituent from R1, R2, and R3 is the halogen substituent; R4 is a C1-C5 alkoxyl or a tertiary amine represented by —NR5R6, where R5 and R6 independently, at each occurrence, represent a same or different C1-C5 alkyl; m is an integer from 1 to 20; and n is an integer from 0 to 5. The organohalosilane is used for preparation of an electrolyte solution of a non-aqueous lithium ion battery. |
| US09359383B2 |
β-ketoimine ligand, method of preparing the same, metal complex comprising the same and method of forming thin film using the same
The β-ketoimine ligand is represented by the following formula 1: wherein R1 and R2 are each independently a C1-C5 alkyl group. A metal complex compound includes the β-ketoimine ligand. A method of forming the β-ketoimine ligand and a method of forming a thin film using the metal complex compound including β-ketoimine ligand are provided. |
| US09359376B2 |
Substituted methylformyl reagents and method of using same to modify physicochemical and/or pharmacokinetic properties of compounds
The present invention relates to the synthesis and application of novel chiral/achiral substituted methyl formyl reagents to modify pharmaceutical agents and/or biologically active substances to modify the physicochemical, biological and/or pharmacokinetic properties of the resulting compounds from the unmodified original agent. |
| US09359374B2 |
Polymorphic forms of rifaximin
Provided for in the instant application are two additional forms of rifaximin, namely rifaximin polymorphic forms APO-III and APO-IV. Also provided are allegedly novel processes for preparing the previously disclosed rifaximin polymorphic forms APO-I and APO-II. Rifaximin is a non-aminoglycoside antibiotic that has previously been found to be useful for the treatment of traveller's diarrhea caused by Escherichia coli bacteria, as well as in the treatment of irritable bowel syndrome, diverticular disease, hepatic encephalopathy, pyogenic skin infections and as an antibacterial prophylactic prior to colon surgery. |
| US09359371B2 |
Bicyclic substituted pyrimidine compounds
Disclosed are bicyclic group substituted pyrimidine compounds, pharmaceutical acceptable salts thereof or stereoisomers thereof. Also disclosed are preparation methods, pharmaceutical formulations, and pharmaceutical compositions of the compounds, and use of the compounds, pharmaceutical formulations, and pharmaceutical compositions for preparing a medicament for treating and/or preventing sexual dysfunction diseases and diseases with lower urinary tract symptoms. |
| US09359369B2 |
Tricyclic sulfonamide compounds and methods of making and using same
The invention provides tricyclic sulfonamide compounds and their use in treating medical disorders, such as obesity. Pharmaceutical compositions and methods of making various tricyclic compounds are provided. The compounds are contemplated to have activity against methionyl aminopeptidase 2. |
| US09359366B2 |
Intermediate of Ticagrelor and preparation method therefor, and preparation method for Ticagrelor
Disclosed are intermediates of Ticagrelor and a preparation method therefor, and a preparation method for Ticagrelor. Specifically, disclosed is an intermediate, namely, a compound of Formula (VI), for preparing Ticagrelor. Further disclosed is a method for preparing the intermediate and a method for preparing Ticagrelor by using the intermediate. Ticagrelor is prepared by using the intermediate, so that the synthesis process is simple, and a defect that long reaction times under high temperature that are required in the existing methods are avoided. The method is suitable for mass production in industry, energy consumption is reduced, pollution of the environment is reduced, and discharge of waste is reduced. |
| US09359364B2 |
Pharmaceutical formulations, processes, solid forms and methods of use relating to 1-ethyl-7-(2-methyl-6-(1H-1,2,4-triazol-3-yl)pyridin-3-yl)-3,4-dihydropyrazino[2,3-b] pyrazin-2(1H)-one
Provided herein are formulations, processes, solid forms and methods of use relating to 1-ethyl-7-(2-methyl-6-(1H-1,2,4-triazol-3-yl)pyridin-3-yl)-3,4-dihydropyrazino[2,3-b]pyrazin-2(1H)-one. |
| US09359363B2 |
Identification of compounds that disperse TDP-43 inclusions
Herein, methods of modulating inclusion formation and stress granules in cells are described. The methods comprise contacting a cell with an inclusion inhibitor. Methods for screening for modulators of TDP-43 aggregation are also described. |
| US09359362B2 |
Triazolo and tetrazolo pyrimidine derivatives as HNE inhibitors for treating COPD
The present invention relates to novel heterocyclically fused diaryldihydropyrimidine derivatives, to processes for their preparation, to their use alone or in combination for the treatment and/or prevention of diseases and also to their use for preparing medicaments for the treatment and/or prevention of diseases, in particular for the treatment and/or prevention of disorders of the lung and the cardiovascular system. |
| US09359361B2 |
Immune system modulators
The present invention relates to a compound of Formula I: or a pharmaceutically acceptable salt thereof, wherein the symbols are as defined in the specification; a pharmaceutical composition comprising the same; and a method for treating or preventing autoimmunity disease using the same. |
| US09359357B2 |
Forms of rifaximin and uses thereof
The present invention relates to Rifaximin amorphous forms, to their use in medicinal preparations and to therapeutic methods using them. |