最新美国发明专利第2012-06-12期 - 专利汇|PatentHub专利检索|专利查询网|发明专利查询分析

Document	Document Title
US08198305B2	1,2-benzisoxazol-3-yl compounds This invention relates to novel 1,2-benzisoxazol-3-yl compounds, their derivatives, pharmaceutically acceptable salts, solvates, and hydrates thereof. This invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions that are beneficially treated by administering an antagonist of both dopamine and serotonin receptors.
US08198302B2	Compositions and methods with enhanced therapeutic activity Novel quinone and catechol compositions, compositions containing prodrugs of quinone and catechol compositions, and methods of use for the treatment of solid tumor cancers and other vascular proliferative disorders. The disclosure particularly relates to the discovery of dual activity agents capable of generating both a vascular targeting effect and direct tumor cell cytotoxicity in order to achieve an enhanced anti-tumor response in a patient.
US08198294B2	Treatment of dyskinesia The invention relates to the use of compounds which inhibit selectively mu opioid receptor activity, or activation, for the treatment of dyskinesia (which, for example, may arise as a side effect of L-DOPA therapy). The compounds used are preferably mu opioid receptor antagonists such as cyprodime.
US08198293B2	Oxymatrine compositions and related methods for treating and preventing chronic infectious diseases Compositions and methods for treating chronic infectious diseases using substantially pure oxymatrine or pharmaceutically acceptable salts or esters thereof are disclosed. In one embodiment described herein, the chronic infectious disease is chronic fatigue syndrome. Further described are compositions having an anti-infective amount of substantially pure oxymatrine or pharmaceutically acceptable salts or esters thereof.
US08198287B2	Substituted heteroaryl pyridopyrimidone derivatives A pyrimidone derivative represented by formula (I) or a salt thereof, or a solvate thereof or a hydrate thereof are disclosed and claimed. Wherein m, n, o, Y, Z, R1, R2, R3, R4, R5 R6 and R7 are as described herein. Also disclosed are the salts of compounds of formula (I). The invention relates also to a medicament comprising the said derivative or a salt thereof as an active ingredient which is used for preventive and/or therapeutic treatment of a neurodegenerative disease caused by abnormal activity of GSK3β, such as Alzheimer disease.
US08198279B2	Pyrido[2,3-b]pyrazin-8-substituted compounds and their use The present invention pertains generally to the field of therapeutic compounds for treating proliferative disorders, cancer, etc., and more specifically to certain pyrido[2,3-b]pyrazin-8-substituted compounds, as described herein, which, inter alia, inhibit RAF (e.g., B—RAF) activity. The present invention also pertains to pharmaceutical compositions comprising such compounds, and the use of such compounds and compositions, both in vitro and in vivo, to inhibit RAF (e.g., BRAF) activity, to inhibit receptor tyrosine kinase (RTK) activity, to inhibit cell proliferation, and in the treatment of diseases and disorders that are ameliorated by the inhibition of RAF, RTK, etc., proliferative disorders such as cancer (e.g., colorectal cancer, melanoma), etc.
US08198276B2	Kinase inhibitor compounds Pyrimidinone derivatives have enhanced and unexpected drug properties as inhibitors of protein kinases and are useful in treating disorders related to abnormal protein kinase activities such as inflammatory diseases and certain types of cancer.
US08198275B2	Adamantyl diamide derivatives and uses of same The present invention provides adamantyl-diamide derivatives of formula (I): wherein R1 and R2 are as defined herein, or a pharmaceutically acceptable salt thereof; and pharmaceutical compositions and methods using the same.
US08198272B2	Triazolium salts as PAR1 inhibitors, production thereof, and use as medicaments The invention relates to novel compounds of formula I where X, A−, Q1, Q2, Q3, R2, R3, R4, R5, R6, R7, R8 and R9 are each as defined below. The compounds of formula I have antithrombotic activity and inhibit especially protease-activated receptor 1 (PAR1). The invention further relates to a process for preparing the compound of formula I and to the use thereof as a medicament.
US08198270B2	Compounds for proteasome enzyme inhibition Peptide-based compounds including heteroatom-containing, three-membered rings efficiently and selectively inhibit specific activities of N-terminal nucleophile (Ntn) hydrolases. The activities of those Ntn having multiple activities can be differentially inhibited by the compounds described. For example, the chymotrypsin-like activity of the 20S proteasome may be selectively inhibited with the inventive compounds. The peptide-based compounds include an epoxide or aziridine, and functionalization at the N-terminus. Among other therapeutic utilities, the peptide-based compounds are expected to display anti-inflammatory properties and inhibition of cell proliferation.
US08198268B2	Tianeptine sulfate salt forms and methods of making and using the same Disclosed herein is a novel sulfate salt of tianeptine with improved properties. Also described herein are novel pharmaceutical compositions comprising tianeptine sulfate salt, methods of making, and related methods of treatment.
US08198267B2	Substituted oxazolidinones and their use The invention relates to novel substituted oxazolidinones, to processes for preparation thereof, to the use thereof for treatment and/or prophylaxis of diseases, and to the use thereof for producing medicaments for treatment and/or prophylaxis of diseases, especially of thromboembolic disorders.
US08198262B2	Methods for treating multiple myeloma using 4-(amino)-2-(2,6-dioxo(3-piperidyl))-isoindoline-1,3-dione Methods of treating, preventing and/or managing cancer as well as and diseases and disorders associated with, or characterized by, undesired angiogenesis are disclosed. Specific methods encompass the administration of an immunomodulatory compound alone or in combination with a second active ingredient. The invention further relates to methods of reducing or avoiding adverse side effects associated with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy which comprise the administration of an immunomodulatory compound. Pharmaceutical compositions, single unit dosage forms, and kits suitable for use in methods of the invention are also disclosed.
US08198257B2	CYP46A1 gene for the treatment of alzheimer's disease The invention relates to a viral vector for treating Alzheimers disease, which vector comprises a cholesterol 24-hydroxylase (CYP46A1) encoding nucleic acid. In a preferred embodiment, the viral vector may be an Adeno-Associated-Virus (AAV) vector, preferably an AVV5 vector. The vector may be useful for the manufacture of a pharmaceutical composition for the treatment of Alzheimers disease in a subject, wherein the vector is to be administered directly into the brain of the subject or by intravenous or intrathecal injection.
US08198256B2	Treatment of influenza The present invention provides a double-stranded RNA which inhibits replication of influenza B viruses by RNA interference, in which the double-stranded RNA comprises an RNA having 19 to 25 nucleotides homologous with a part of an mRNA transcribed from a genomic RNA of the influenza B viruses and an antisense RNA thereof.
US08198254B2	Annexin A9 (ANXA9) biomarker and therapeutic target in epithelial cancer Amplification of the ANXA9 gene in human chromosomal region 1q21 in epithelial cancers indicates a likelihood of both in vivo drug resistance and metastasis, and serves as a biomarker indicating these aspects of the disease. ANXA9 can also serve as a therapeutic target. Interfering RNAs (iRNAs) (such as siRNA and miRNA) and shRNA adapted to inhibit ANXA9 expression, when formulated in a therapeutic composition, and delivered to cells of the tumor, function to treat the epithelial cancer.
US08198251B2	Combination motif immune stimulatory oligonucleotides with improved activity Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
US08198249B2	Methods and compositions for the treatment of obesity, insulin related diseases and hypercholesterolemia A process of enhancing insulin excretion in a subject includes administering to the subject a polyphenol active ingredient. The polyphenol active ingredient is a purified cyanidin-3-glycoside alone or purified cyanidin alone. The pharmaceutically acceptable carrier is administered with the polyphenol active ingredient.
US08198246B1	Pharmaceutical composition of nanoparticles The invention discloses a pharmaceutical composition of liposome nanoparticles for lodging in a target tissue cell in situ of an animal subject, the nanoparticles comprising at least one thermal triggered phase-transition compound as a targeting drug delivery system for physical cancer therapy.
US08198244B2	Regulation of skin characteristics by DICKKOPF1 (DKK1) The present disclosure is generally related to methods of inducing non-palmoplantar skin to develop a palmoplantar phenotype, for example, methods for increasing skin thickness, decreasing skin pigmentation, and/or decreasing hair growth. In particular, disclosed herein are methods of using topical administration of DKK1 to increase skin thickness, decrease skin pigmentation, or reduce hair growth. Also disclosed are topical DKK1 compositions for inducing non-palmoplantar skin to develop a palmoplantar phenotype.
US08198239B2	Methods for treating wounds The invention is directed to novel cellular factor-containing solution compositions (referred to herein as “CFS” compositions), including novel sustained-release cellular factor-containing solution compositions (referred to herein as “SR-CFS” compositions), methods of making such novel compositions and uses thereof.
US08198237B2	Concentrated protein preparations of bone morphogenetic proteins and methods of use thereof Disclosed herein are heretofore undescribed preparations of highly concentrated, solubilized proteins, such as but not limited to, Bone Morphogenetic Proteins. Such protein preparations can be formulated in an aqueous carrier at protein concentrations in excess of 10 mg/ml when using the methods of manufacture taught herein. Such methods yield stable protein preparations in either solubilized or lyophilized form. The protein preparations of the present invention are particularly beneficial when administered either locally or systemically, in part, because low administration volumes can be accomplished. This is especially important for local treatment of certain anatomic locations such as, for example, the synovial fluid of a joint when treating osteoarthritis with BMP-7 or the intradiscal space when treating degenerative disc disease with BMP-7.
US08198236B2	Methods and compositions for the treatment of cancer Oligopeptides which can be used to treat cancer are disclosed. Further disclosed are methods of treating cancer, including breast cancer, skin cancer, prostate cancer and multiple myeloma (MM). These methods include administration of a polypeptide encoded by the Mesd gene, or an oligopeptide comprising a contiguous subsequence of a Mesd polypeptide.
US08198233B2	Synthetic peptides that enhance tight junction permeability The present invention provides novel peptides that facilitate the opening of mammalian tight junctions, i.e. tight junction agonists. The present invention also provides methods for the treatment of disease by administering to a subject suffering from the disease a composition comprising a peptide tight junction agonist of the invention in combination with a therapeutically effective amount of an active agent.
US08198232B2	Combination therapy for the treatment of diabetes and conditions related thereto and for the treatment of conditions ameliorated by increasing a blood GLP-1 level The present invention concerns combination of an amount of a GPR119 agonist with an amount of a dipeptidyl peptidase IV (DPP-IV) inhibitor such that the combination provides an effect in lowering a blood glucose level or in increasing a blood GLP-1 level in a subject over that provided by the amount of the GPR119 agonist or the amount of the DPP-IV inhibitor alone and the use of such a combination for treating or preventing diabetes and conditions related thereto or conditions ameliorated by increasing a blood GLP-1 level. The present invention also relates to the use of a G protein-coupled receptor to screen for GLP-1 secretagogues.
US08198230B2	Synthetic mimics of mammalian cell surface receptors: method and compositions The present invention relates to new synthetic receptors. More particularly, the present invention relates to the use of the synthetic receptors for delivering a protein, peptide, drug, prodrug, lipid, nucleic acid, carbohydrate or small molecule into a target cell via receptor-mediated endocytosis. According to the invention, novel synthetic mimics of cell surface receptors have been designed and methods for use of the same are disclosed.
US08198228B2	Solidification matrix using an aminocarboxylate A solidification matrix includes a biodegradable aminocarboxylate, sodium carbonate, and water. The biodegradable aminocarboxylate, sodium carbonate, and water interact to form a hydrate solid. The solidification matrix may be used, for example, in a solid detergent composition.
US08198221B2	Engine wear protection in engines operated using ethanol-based fuel Lubricant formulations and methods for producing lubricant formulations are described that provide improved wear protection in engines operated using ethanol-based fuels. The improved wear protection may be provided by an increased amount of overbased calcium detergent present in the formulation.
US08198216B2	Granular formulation A dry spreadable or broadcast granule having an applied composition comprising an active chemical agent capable of forming a microemulsion upon dilution with water.
US08198212B2	Heat-sensitive recording material A heat-sensitive recording material is proposed, which comprises a substrate and a heat-sensitive recording layer that contains color formers and color acceptors, where the color formers are selected from the list comprising: 3-diethylamino-6-methyl-7-anilinofluoran, 3-dibutylamino-6-methyl-7-anilinofluoran, 3-(N-methyl-N-propyl)amino-6-methyl-7-anilinofluoran, 3-(N-ethyl-N-isoamyl)amino-6-methyl-7-anilinofluoran, 3-(N-methyl-N-cyclohexyl)amino-6-methyl-7-anilinofluoran, 3-(N-ethyl-N-tolyl)amino-6-methyl-7-anilinofluoran, and 3-(N-ethyl-N-tetrahydrofuryl)amino-6-methyl-7-anilinofluoran, the heat-sensitive recording layer contains two color acceptors, which are: N-(p-toluenesulfonyl)-N′-3-(p-toluenesulfonyloxyphenyl)urea with the following formula (1): and a urea-urethane compound with the following formula (2): where the ratio of the two color acceptors, i.e., the ratio of N-(p-toluenesulfonyl)-N′-3-(p-toluenesulfonyloxyphenyl)urea according to formula (1) to the urea-urethane compound according to formula (2), is in the range of 10:1 to 1:1, based on wt. % in the heat-sensitive recording layer.
US08198208B2	Bromination process A bromination process includes contacting fly ash with liquid bromine to increase the mercury adsorbing ability of the fly ash. The resultant brominated fly ash can be used to adsorb mercury in a high temperature combustion gas.
US08198205B2	Aromatic block copolymer, decomposition method thereof and analysis method using the decomposition method Provided is a decomposition method of an aromatic block copolymer, wherein the aromatic block copolymer comprises a segment 1 represented by the following general formula (1) and a segment 2 comprising a structural unit represented by the following general formula (2) and/or a structural unit represented by the following general formula (3), and the segment 2 is subjected to chemical decomposition. (wherein m represents an integer of 5 or more, Ar1 represents a divalent aromatic group that may have a substituent, and Ar1s of 5 or more may be the same as or different from each other,) Ar10—X10 (2) Ar20—Y20—Ar21—X20 (3) (wherein Ar10, Ar20 and Ar21 each independently represent a divalent aromatic group that may have a substituent, X10 and X20 each independently represent an oxygen atom, a sulfur atom, an alkylene group having 1 to 10 carbon atoms or a fluorine-substituted alkylene group having 1 to 10 carbon atoms, and Y20 represents a sulfonyl group, a carbonyl group or a fluorine-substituted alkylene group having 1 to 10 carbon atoms).
US08198200B2	Web materials having both plastic and elastic properties An extruded web is disclosed. The extruded web can be either a nonwoven material of a films. The web comprises a plasto-elastic material where the plasto-elastic material is a combination of a first polyolefin and a second polyolefin (either a polymeric blends or a polymeric mixture). The claimed combination of polyolefins results in a material that has substantially plastic properties when a sample taken from said web is subjected to an initial strain cycle (such that the web is provided with a set of at least 30% by an initial strain cycle) and substantially elastic properties when a sample taken from the web is subjected to at least a second strain cycle.
US08198199B2	Epitaxial film, piezoelectric element, ferroelectric element, manufacturing methods of the same, and liquid discharge head There are disclosed an epitaxial film, comprising: heating an Si substrate provided with an SiO2 layer with a film thickness of 1.0 nm or more to 10 nm or less on a surface of the substrate; andforming on the SiO2 layer by use of a metal target represented by the following composition formula: yA(1−y)B (1), in which A is one or more elements selected from the group consisting of rare earth elements including Y and Sc, B is Zr, and y is a numeric value of 0.03 or more to 0.20 or less, the epitaxial film represented by the following composition formula: xA2O3−(1−x)BO2 (2), in which A and B are respectively same elements as A and B of the composition formula (1), and x is a numeric value of 0.010 or more to 0.035 or less.
US08198198B2	Method for forming electrode pattern of ceramic substrate The present invention relates to a method for forming electrode patterns of a ceramic substrate including the steps of: forming a plurality of conductive adhesion patterns on the ceramic substrate to be separated apart from one another; forming a plating seed layer, covering the conductive adhesion patterns, on the ceramic substrate; forming photoresist patterns, exposing parts corresponding to the conductive adhesion patterns, on the plating seed layer; forming a plating layer on the plating seed layer exposed by the photoresist patterns; removing the photoresist patterns; and etching parts of the plating seed layer exposed by removal of the photoresist patterns.
US08198194B2	Methods of forming p-channel field effect transistors having SiGe source/drain regions Methods of forming p-channel MOSFETs use halo-implant steps that are performed relatively early in the fabrication process. These methods include forming a gate electrode having first sidewall spacers thereon, on a semiconductor substrate, and then forming a sacrificial sidewall spacer layer on the gate electrode. A mask layer then patterned on the gate electrode. The sacrificial sidewall spacer layer is selectively etched to define sacrificial sidewall spacers on the first sidewall spacers, using the patterned mask layer as an etching mask. A PFET halo-implant of dopants is then performed into portions of the semiconductor substrate that extend adjacent the gate electrode, using the sacrificial sidewall spacers as an implant mask. Following this implant step, source and drain region trenches are etched into the semiconductor substrate, on opposite sides of the gate electrode. These source and drain region trenches are then filled by epitaxially growing SiGe source and drain regions therein.
US08198193B2	Manufacturing method of semiconductor substrate A manufacturing method of a semiconductor substrate includes the following steps: forming a first wiring layer on a substrate; forming an interlayer insulating film having a via hole on the wiring layer; forming carbon nanotubes in the via hole; performing a fluorination treatment entirely to the substrate; forming an embedded film in the via hole having the carbon nanotubes therein; and polishing the substrate to entirely flatten the substrate.
US08198191B2	Method of preparing low resistance metal line, patterned metal line structure, and display device using the same Disclosed herein is a method of preparing a low resistance metal line, in which a wet plating technique is used instead of a vacuum film forming process in order to simplify the process and decrease the manufacturing cost. In addition, a self-assembled monolayer is formed that facilitates the increased adsorption density and strength of the metal catalyst resulting in the formation of a high-density metal catalyst layer, thereby obtaining a high-quality metal line. Also disclosed herein, are a patterned metal line structure, and a display device using the same.
US08198190B2	Semiconductor device and method for patterning vertical contacts and metal lines in a common etch process Interlayer connections, i.e., vertical connections, may be formed on the basis of a hard mask material, which may be positioned below, within or above an interlayer dielectric material, wherein one lateral dimension is defined by a trench mask, thereby obtaining a desired interlayer connection in a common patterning process. Furthermore, the thickness of at least certain portions of the metal lines may be adjusted with a high degree of flexibility, thereby providing the possibility of significantly reducing the overall resistivity of metal lines in metal levels, in which device performance may significantly depend on resistivity rather than parasitic capacitance.
US08198188B1	Self-aligned VIAS for semiconductor devices A semiconductor device and systems and methods for forming a semiconductor device are provided. A method of manufacturing a semiconductor device can include patterning a first conductive element on a first layer of a semiconductor device, patterning a second conductive element on a second layer of a semiconductor device, and forming an electrical connection in a third layer of the semiconductor device at a predetermined location between the first and the second conductive elements, the connection between the first and the second conducting elements having a geometry that is larger in at least one dimension relative to the corresponding dimension of the second conductive element at the predetermined location.
US08198187B2	Manufacturing method of semiconductor device Disclosed is a method of manufacturing a semiconductor device that does not have a defect, such as wire breakage, due to an uplifted portion created at a rewiring pattern in a multilayer wire structure. Before a wiring layer is formed on an insulation layer, the insulation layer is exposed via a mask. The mask has a weak exposure part and a strong exposure part. The mask is positioned such that the weak exposure part corresponds to an arrangement position of a wire line of an underlying wiring layer, and such that the strong exposure part corresponds to an arrangement position of a via part of the underlying wiring layer. The underlying wiring layer is a layer immediately below the insulation layer.
US08198186B2	Semiconductor device and method of confining conductive bump material during reflow with solder mask patch A semiconductor device has a semiconductor die with die bump pads and substrate with trace lines having integrated bump pads. A solder mask patch is formed interstitially between the die bump pads or integrated bump pads. The solder mask patch contains non-wettable material. Conductive bump material is deposited over the integrated bump pads or die bump pads. The semiconductor die is mounted over the substrate so that the conductive bump material is disposed between the die bump pads and integrated bump pads. The bump material is reflowed without a solder mask around the integrated bump pads to form an interconnect between the semiconductor die and substrate. The solder mask patch confines the conductive bump material within a footprint of the die bump pads or integrated bump pads during reflow. The interconnect can have a non-fusible base and fusible cap.
US08198184B2	Method to maximize nitrogen concentration at the top surface of gate dielectrics An integrated circuit having a gate dielectric layer (414, 614, 814) having an improved nitrogen profile and a method of fabrication. The gate dielectric layer is a graded layer with a significantly higher nitrogen concentration at the electrode surface than near the substrate surface. An amorphous silicon layer (406) may be deposited prior to nitridation to retain the nitrogen concentration at the top surface (416). Alternatively, a thin silicon nitride layer (610) may be deposited after anneal or a wet nitridation process may be performed.
US08198182B2	Annealing method for semiconductor device with silicon carbide substrate and semiconductor device In an atmosphere in which a silicon carbide (SiC) substrate implanted with impurities is annealed to activate the impurities, by setting a partial pressure of H2O to be not larger than 10−2 Pa, preferably not larger than 10−3 Pa, surface irregularity of the silicon carbide (SiC) substrate is controlled to be not greater than 2 nm, more preferably not greater than 1 nm in RMS value.
US08198172B2	Methods of forming integrated circuits using donor and acceptor substrates Methods for fabricating integrated circuit devices on an acceptor substrate devoid of circuitry are disclosed. Integrated circuit devices are formed by sequentially disposing one or more levels of semiconductor material on an acceptor substrate, and fabricating circuitry on each level of semiconductor material before disposition of a next-higher level. After encapsulation of the circuitry, the acceptor substrate is removed and semiconductor dice are singulated. Integrated circuit devices formed by the methods are also disclosed.
US08198168B2	Method of manufacturing capacitive insulating film for capacitor According to the invention, a Ti film is formed on a substrate and is annealed at the temperatures of 350° C.-400° C. under oxidative environment, so that a TiO2 film having a rutile crystal structure is formed. Since the TiO2 film having a rutile crystal structure has a high dielectric constant, it is useful for a capacitive insulating film for a capacitor.
US08198162B2	Semiconductor device and a method of manufacturing the same Provided is a manufacturing method of a semiconductor device wherein the generation of voids is prevented in aluminum-based electrodes or the like. The method is suitable for manufacturing a semiconductor device adapted for vehicles, which is required to have a high reliability. However, it is very difficult that power semiconductor devices such as power MOSFETs, in particular, trench gate type power MOS devices are formed without having any void since the thickness of aluminum-based electrodes thereof is as large as about 3500 to 5500 nm (2.5 μm or more). In the present invention, a method is provided wherein at the time of forming an aluminum-based electrode metal film positioned over a wafer and having a thickness of 2.5 μm or more over a highland/lowland-repeated region in a line and space form by sputtering, the temperature of the wafer is set to 400° C. or higher and lower than 500° C.
US08198160B2	Vertical transistor phase change memory Vertical transistor phase change memory and methods of processing phase change memory are described herein. One or more methods include forming a dielectric on at least a portion of a vertical transistor, forming an electrode on the dielectric, and forming a vertical strip of phase change material on a portion of a side of the electrode and on a portion of a side of the dielectric extending along the electrode and the dielectric into contact with the vertical transistor.
US08198158B2	Method for thin film memory A multi-layer thin-film device includes thin film memory and thin film logic. The thin film memory may be programmable resistance memory, such as phase change memory, for example. The thin film logic may be complementary logic.
US08198157B2	Methods of forming non-volatile memory devices including dummy word lines A non-volatile memory device may include a semiconductor substrate including an active region at a surface thereof, a first memory cell string on the active region, and a second memory cell string on the active region. The first memory cell string may include a first plurality of word lines crossing the active region between a first ground select line and a first string select line, and about a same first spacing may be provided between adjacent ones of the first plurality of word lines. The second memory cell string may include a second plurality of word lines crossing the active region between a second ground select line and a second string select line, and about the same first spacing may be provided between adjacent ones of the second plurality of word lines. Related methods are also discussed.
US08198154B2	Method of forming bottom-drain LDMOS power MOSFET structure having a top drain strap Lateral DMOS devices having improved drain contact structures and methods for making the devices are disclosed. A semiconductor device comprises a semiconductor substrate; an epitaxial layer on top of the substrate; a drift region at a top surface of the epitaxial layer; a source region at a top surface of the epitaxial layer; a channel region between the source and drift regions; a gate positioned over a gate dielectric on top of the channel region; and a drain contact trench that electrically connects the drift layer and substrate. The contact trench includes a trench formed vertically from the drift region, through the epitaxial layer to the substrate and filled with an electrically conductive drain plug; electrically insulating spacers along sidewalls of the trench; and an electrically conductive drain strap on top of the drain contact trench that electrically connects the drain contact trench to the drift region.
US08198152B2	Transistors comprising high-k metal gate electrode structures and adapted channel semiconductor materials In sophisticated semiconductor devices, a replacement gate approach may be applied, in which a channel semiconductor material may be provided through the gate opening prior to forming the gate dielectric material and the electrode metal. In this manner, specific channel materials may be provided in a late manufacturing stage for different transistor types, thereby providing superior transistor performance and superior flexibility in adjusting the electronic characteristics of the transistors.
US08198151B2	Method for fabricating a metal gate structure A method of fabricating a metal gate structure is provided. The method includes providing a semiconductor substrate with a planarized polysilicon material; patterned the planarized polysilicon material to form at least a first gate and a second gate, wherein the first gate is located on the active region and the second gate at least partially overlaps with the isolation region; forming an inter-layer dielectric material covering the gates; planarizing the inter-layer dielectric material until exposing the gates and forming an inter layer-dielectric layer; performing an etching process to remove the gates to form a first recess and a second recess within the inter-layer dielectric layer; forming a gate dielectric material on a surface of each of the recesses; forming at least a metal material within the recesses; and performing a planarization process.
US08198149B2	Method for fabricating active device array substrate A method for fabricating an active device array substrate is provided. A first patterned semiconductor layer, a gate insulator, a first patterned conductive layer and a first dielectric layer is sequentially formed on a substrate. First contact holes exposing the first patterned semiconductor layer are formed in the first dielectric layer and the gate insulator. A second patterned conductive layer and a second patterned semiconductor layer disposed thereon are simultaneously formed on the first dielectric layer. The second conductive layer includes contact conductors and a bottom electrode. The second patterned semiconductor layer includes an active layer. A second dielectric layer having second contact holes is formed on the first dielectric layer, wherein a portion of the second contact holes exposes the active layer. A third patterned conductive layer electrically connected to the active layer through a portion of the second contact holes is formed on the second dielectric layer.
US08198147B2	Superior fill conditions in a replacement gate approach by using a tensile stressed overlayer In a replacement gate approach for forming high-k metal gate electrodes in semiconductor devices, a tapered configuration of the gate openings may be accomplished by using a tensile stressed dielectric material provided laterally adjacent to the gate electrode structure. Consequently, superior deposition conditions may be achieved while the tensile stress component may be efficiently used for the strain engineering in one type of transistor. Furthermore, an additional compressively stressed dielectric material may be applied after providing the replacement gate electrode structures.
US08198146B2	Semiconductor device and manufacturing method thereof An object is to realize an integrated circuit included in a semiconductor device which has multiple functions, or to increase the size of an integrated circuit even when the integrated circuit is formed using a silicon carbide substrate. The integrated circuit includes a first transistor including an island-shaped silicon carbide layer provided over a substrate with a first insulating layer interposed therebetween, a first gate insulating layer provided over the silicon carbide layer, and a first conductive layer provided over the first gate insulating layer and overlapped with the silicon carbide layer; and a second transistor including an island-shaped single crystal silicon layer provided over the substrate with a second insulating layer interposed therebetween, a second gate insulating layer provided over the single crystal silicon layer, and a second conductive layer provided over the second gate insulating layer and overlapped with the single crystal silicon layer.
US08198144B2	Pillar structure for memory device and method A method of forming a memory device. The method provides a semiconductor substrate having a surface region. A first dielectric layer is formed overlying the surface region of the semiconductor substrate. A bottom wiring structure is formed overlying the first dielectric layer and a second dielectric material is formed overlying the top wiring structure. A bottom metal barrier material is formed to provide a metal-to-metal contact with the bottom wiring structure. The method forms a pillar structure by patterning and etching a material stack including the bottom metal barrier material, a contact material, a switching material, a conductive material, and a top barrier material. The pillar structure maintains a metal-to-metal contact with the bottom wiring structure regardless of the alignment of the pillar structure with the bottom wiring structure during etching. A top wiring structure is formed overlying the pillar structure at an angle to the bottom wiring structure.
US08198140B2	Wiring substrate for mounting semiconductors, method of manufacturing the same, and semiconductor package A wiring substrate for mounting semiconductors is provided with an insulation film, wires formed in the insulation film, and a plurality of electrode pads that electrically connect to the wires through vias. The electrode pads are provided to have their surfaces exposed to both of the front surface and the rear surface of the insulation film, and at least a part of the side surface of the electrode pads is buried in the insulation film. The insulation film is formed by forming electrode pads on the respective two metallic plates, thereafter, laminating an insulation layer and wires on the respective metallic plates to cover the electrode pad, and adhering the insulation layers to each other for integration, and thereafter, removing the metallic plates.
US08198138B2	Methods for providing and using grid array packages Methods for providing and using semiconductor device assemblies or packages include providing or using various elements of a semiconductor device assembly or package. Such a semiconductor device package or assembly may include a substrate and a semiconductor die adjacent to a first surface of the substrate. The substrate of such a semiconductor device assembly or package may also include a second surface opposite from the first surface, an opening extending from the first surface and the second surface, contact pads on the second surface, and substrate pads on the second surface, adjacent to the opening. Bond pads of the semiconductor die may be aligned with the opening through the substrate. Intermediate conductive elements, such as bond wires, may extend from bond pads of the semiconductor die, extend through the opening, protrude beyond the second surface of the substrate, and extend to substrate pads on the second surface. An encapsulant, which may fill the opening and cover the intermediate conductive elements, protrudes beyond a plane in which the second surface of the substrate is located. Discrete conductive elements, such as solder balls, may protrude from the contact pads of the substrate.
US08198135B2	Method for producing flexible integrated circuits which may be provided contiguously The present invention provides a method for producing integrated circuits which are mechanically flexible and can be provided contiguously on a common flexible carrier substrate. The method includes a step of continuously providing a first flexible substrate which has conductor-line patterns, and a step of mounting the integrated circuits on the first flexible substrate and connecting the integrated circuits to the conductor-line patterns of the first flexible substrate, and a step of covering the circuits mounted on the first flexible substrate with a second flexible substrate, recesses being provided in the first or second flexible substrates in order to make the conductor-line patterns of the first flexible substrate accessible. The step of covering has the sub-step of continuously providing a flexible film with recesses and laminating same onto the flexible integrated circuits mounted on the first flexible substrate, or a sub-step of applying, by a printing technique, a cover on the flexible integrated circuits mounted on the first flexible substrate.
US08198133B2	Structures and methods to improve lead-free C4 interconnect reliability Controlled collapse chip connection (C4) structures and methods of manufacture, and more specifically to structures and methods to improve lead-free C4 interconnect reliability. A structure includes a ball limited metallization (BLM) layer and a controlled collapse chip connection (C4) solder ball formed on the BLM layer. Additionally, the structure includes a final metal pad layer beneath the BLM layer and a cap layer beneath the final metal pad layer. Furthermore, the structure includes an air gap formed beneath the C4 solder ball between the final metal pad layer and one of the BLM layer and the cap layer.
US08198132B2	Isolated stacked die semiconductor packages Semiconductor packages that contain isolated, stacked dies and methods for making such devices are described. The semiconductor package contains both a first die with a first integrated circuit and a second die with a second integrated circuit that is stacked onto the first die while also being isolated from the first die. The first and second dies are connected using an array of metal connectors containing both a base segment and a beam segment extending over the first die and supporting the second die. This configuration can provide a thinner semiconductor package since wire-bonding is not used. As well, since the integrated circuit devices in the first and second dies are isolated from each other, local heating and/or hot spots are diminished or prevented in the semiconductor package. Other embodiments are also described.
US08198129B2	Methods of depositing antimony-comprising phase change material onto a substrate and methods of forming phase change memory circuitry A method of depositing an antimony-comprising phase change material onto a substrate includes providing a reducing agent and vaporized Sb(OR)3 to a substrate, where R is alkyl, and forming there-from antimony-comprising phase change material on the substrate. The phase change material has no greater than 10 atomic percent oxygen, and includes another metal in addition to antimony.
US08198128B2	Nano-array and fabrication method thereof The invention provides a method for fabricating a nano-array comprising the following steps. A template with a plurality of nano-holes is provided. A polymer is embossed by the template to integrally form a plurality of nano-protrusions thereon, and demolding to reveal the nano-protrusions. The nano-protrusion has a concave or convex top surface.
US08198127B2	Charge mapping memory array formed of materials with mutable electrical characteristics A memory cell array including a data line; a capacitor; and a transistor coupled between the data line and the capacitor. At least one of the capacitor and the transistor includes a material with a mutable electrical characteristic. A memory cell array including a first transistor coupled between a first node, a second node, and a third node; and a second transistor coupled between the second node and a fourth node. The first transistor includes a material with a mutable electrical characteristic.
US08198125B2	Method of making monolithic photovoltaic module on flexible substrate A method of making a monolithic photovoltaic module having a flexible substrate is described. The method includes the following steps. First, a flexible substrate is provided, and a first adhesive layer, a metal layer, and a second adhesive layer are formed thereon. The second adhesive layer, the metal layer and the first adhesive layer are etched with at least one etching paste. In addition, a patterned semiconductor body layer patterned by an etching paste or a laser scribing is formed thereon. Furthermore, transparent top electrodes patterned by an etching paste or a cold laser scribing are formed on the patterned semiconductor body layer.
US08198123B2	Apparatus and methods for manufacturing thin-film solar cells Improved methods and apparatus for forming thin-film layers of semiconductor material absorber layers on a substrate web. According to the present teachings, a semiconductor layer may be formed in a multi-zone process whereby various layers are deposited sequentially onto a moving substrate web.
US08198122B2	Bulk chloride species treatment of thin film photovoltaic cell and manufacturing method A method for forming a thin film photovoltaic device. The method includes providing a transparent substrate comprising a surface region. A first electrode layer is formed overlying the surface region. A copper layer is formed overlying the first electrode layer and an indium layer is formed overlying the copper layer to form a multi-layered structure. The method subjects at least the multi-layered structure to a thermal treatment process in an environment containing a sulfur bearing species to form a bulk copper indium disulfide material. The bulk copper indium disulfide material comprises one or more portions of copper indium disulfide material and a copper poor surface region characterized by a copper-to-indium atomic ratio of less than about 0.95:1. The method subjects the copper poor surface and one or more portions of the bulk copper indium disulfide material to a chlorine species to convert the copper poor surface from an n-type characteristic to a p-type characteristic and to convert any of the one or more portions of the bulk copper indium disulfide material having the copper-to-indium atomic ratio of less than about 0.95:1 from a n-type characteristic to an p-type characteristic. A window layer is formed overlying the copper indium disulfide material.
US08198118B2	Method for forming a robust mask with reduced light scattering A mask and method for forming the same including carrying out a photolithographic patterning process the method including providing a substantially light transparent portion; forming a substantially light shielding layer disposed over the substantially light transparent portion; forming at least one barrier layer disposed over the substantially light shielding layer; forming a resist layer disposed over the at least one barrier layer; patterning the resist layer for producing a circuitry pattern; and, carrying out an etching process according to the circuitry pattern to expose a portion of the substantially light transparent portion to form a mask.
US08198117B2	Photovoltaic devices with conductive barrier layers and foil substrates Methods and devices are provided for absorber layers formed on foil substrate. In one embodiment, a method of manufacturing photovoltaic devices may be comprised of providing a substrate comprising of at least one electrically conductive aluminum foil substrate, at least one electrically conductive diffusion barrier layer, and at least one electrically conductive electrode layer above the diffusion barrier layer. The diffusion barrier layer may prevent chemical interaction between the aluminum foil substrate and the electrode layer. An absorber layer may be formed on the substrate. In one embodiment, the absorber layer may be a non-silicon absorber layer. In another embodiment, the absorber layer may be an amorphous silicon (doped or undoped) absorber layer. Optionally, the absorber layer may be based on organic and/or inorganic materials.
US08198107B2	Method for manufacturing light emitting diode assembly A method for manufacturing a light emitting diode (LED) assembly comprises the steps of: covering a light-reflection layer onto a substrate layer, covering a light-emitting layer onto the light-reflection layer, and forming a P type electrode and an N type electrode extended from the light-emitting layer, perforating through the light-reflection layer, and exposed from the substrate layer to form an LED chip structure; packaging the LED chip structure with a light-transmissible packaging material and keeping the P type electrode and the N type electrode exposed from the light-transmissible packaging material to form a molded LED chip cell; and electrically connecting the P type electrode and the N type electrode of the molded LED chip cell to a circuit board, so as to manufacture the LED assembly.
US08198104B2	Method of manufacturing a semiconductor device A method of manufacturing a semiconductor device on a semiconductor substrate, includes the steps of forming a first metal film on a front surface of the semiconductor substrate; forming a second metal film on the surface of the first metal film; activating a surface of the second metal film to provide an activated surface; and forming a plated film on the activated surface by a wet plating method in a plating bath that includes a reducing agent that is oxidized during plating and that has a rate of oxidation, wherein the second metal film is a metal film mainly composed of a first substance that enhances the rate of oxidation of the reducing agent in the plating bath. Wet plating is preferably an electroless process.
US08198102B2	Methods of fabricating magnetic memory devices with thin conductive bridges A magnetic memory device includes a free layer and a guide layer on a substrate. An insulating layer is interposed between the free layer and the guide layer. At least one conductive bridge passes through the insulating layer and electrically connects the free layer and the guide layer. A diffusion barrier may be interposed between the guide layer and the insulating layer. The device may further include a reference layer having a fixed magnetization direction on a side of the free layer opposite the insulating layer and a tunnel barrier between the reference layer and the free layer. Related fabrication methods are also described.
US08198101B2	Bifunctional polyazamacrocyclic chelating agents A bifunctional polyazamacrocyclic chelating agent of the formula (I): wherein: and the variables A, L, Q, Q1, X, Y, Z, Z1, m, n and r are as defined in the description of the present application. Also described is a complex of the above chelating agent to an ion of a metal ion, such as an ion of 90Y, 111Li or 177Lu; a conjugate of the complex covalently attached to a biological carrier; and a pharmaceutical composition containing the conjugate. A method of therapeutic treatment of a mammal involving administration of the pharmaceutical composition is also described.
US08198100B2	Detecting method, detection device and detection kit A detection device and a detecting method using the detection device are provided in which a magnetic particle is used as a marker particle, and the ratio of a region with reversed magnetization to the whole area of a free layer of a magnetoresistive effect film is increased by a stray magnetic field generated through a biochemical reaction from the magnetic particle remaining on a surface of the magnetoresistive effect film, so that a large detection signal is obtained and obtained detection data can be stored with stability.
US08198097B1	Free radicals urine test kit for use in the home A do-it yourself test kit as a diagnostic agent for the detection of malonyldiadeyde and other aldehydes in the urine, which are formed in the course of the lipid peroxidation process caused by the free radicals. Also disclosed is a process for the preparation of the test, including suggested formulations of antioxidants as body's protectors against oxidative stress to the cells and help to reduce the risk of developing diseases due to the attack of free radicals.
US08198096B2	Emissive polymers and devices incorporating these polymers The present invention relates to a class of luminescent and conductive polymer compositions having chromophores, and particularly solid films of these compositions exhibiting increased luminescent lifetimes, quantum yields and amplified emissions. These desirable properties can be provided through polymers having rigid groups designed to prevent polymer reorganization, aggregation or π-stacking upon solidification. These polymers can also display an unusually high stability with respect to solvent and heat exposures. The invention also relates to a sensor and a method for sensing an analyte through the luminescent and conductive properties of these polymers. Analytes can be sensed by activation of a chromophore at a polymer surface. Analytes include aromatics such as heterocycles, phosphate ester groups and in particular explosives and chemical warfare agents in a gaseous state. The present invention also relates to devices and methods for amplifying emissions by incorporating a polymer having an energy migration pathway and/or providing the polymer as a block co-polymer or as a multi-layer.
US08198094B2	Methods of using gelsolin levels to characterize a subject's risk of developing rheumatoid arthritis The invention relates to the use of gelsolin to treat inflammatory diseases (e.g., rheumatoid arthritis) and to the use of gelsolin to diagnose, monitor, and evaluate therapies of inflammatory diseases (e.g., rheumatoid arthritis).
US08198093B2	Methods for sorting particles A method of sorting stained particles in a flow cytometer by generating a mathematical model based upon extracted features of waveform pulses produced in response to the stained particles. Waveform pulses can then be analyzed to determine the probability the stained particles belong in either a first or a second population and a decision boundary can be established. Sorting decisions can be made based upon the extracted features of the waveform pulses relative to the decision boundary in combination with other desirability factors for particles or droplets containing the particles.
US08198090B2	Cartridge, residual liquid removing method, and automatic analyzer A cartridge is provided that can remove a residual liquid all around the leading end of a pipette, without requiring any new equipment, regardless of the viscosity of the residual liquid. This cartridge includes a plurality of tanks, each of which has an upper opening, and a liquid is introduced into or led out from at least one of the plurality of tanks 110 to 119 with a pipette. The cartridge further includes waste liquid tanks 120 to 122. The waste liquid tanks 120 to 122 each includes a capillary phenomenon generation portion. A residual liquid present at the leading end of the pipette is brought into contact with the capillary phenomenon generation portion of the waste liquid tanks, and the residual liquid is transferred to the capillary phenomenon generation portion through the capillary phenomenon to be removed from the pipette.
US08198089B2	Flocculent yeast and method for production thereof It is to provide a novel Kluyveromyces marxianus transformant having thermotolerance and flocculation property, suitable for the industrial production of bioethanol, by introducing a foreign flocculation gene into Kluyveromyces marxianus, and an efficient method for producing the transformant. The present inventors focused on the flocculation gene FLO of Saccharomyces cerevisiae as a foreign gene to confer flocculation property to Kluyveromyces marxianus and produced a linear DNA fragment comprising a known expression promoter sequence and a FLO gene sequence derived from Saccharomyces cerevisiae. As a result of introducing this linear DNA fragment into Kluyveromyces marxianus, the present inventors have confirmed that Kluyveromyces marxianus transformant can be obtained efficiently, and that the flocculation property of the above transformant is unexpectedly and significantly enhanced. The present invention has been thus completed.
US08198083B1	Organotypic slices of the central nervous system An organotypic slice and a method of preparing an organotypic slice from a central nervous system tissue, wherein the organotypic slice comprises a brain slice obtained from a brain wherein mature synapses have not been established and the organotypic slice is seeded with a population of stem cells; wherein the organotypic slice has enhanced viability as compared to an organotypic slice comprising a similar brain slice not seeded with a population of stem cells.
US08198078B2	Fucosyl transferase gene A DNA molecule is provided which comprises a sequence according to SEQ ID NO: 1 having an open reading frame from base pair 211 to base pair 1740 or having at least 50% homology to the above-indicated sequence, or hybridizing with the above-indicated sequence under stringent conditions, or comprising a sequence which has degenerated to the above-indicated DNA sequence because of the genetic code, the sequence coding for a plant protein having fucosyltransferase activity or being complementary thereto.
US08198071B2	Substrate for biochip, biochip, method for manufacturing substrate for biochip, and method for manufacturing biochip A base plate having a surface on which a plurality of hydroxyl groups can be introduced, a metallic membrane disposed on the base plate and having a plurality of wells reaching the base plate, and a crosslinkable polymer membrane disposed on the metallic membrane are included.
US08198068B2	Method for stonewashing fabrics using cellulase A method of forming localized variation of color density in the surface of a dyed cellulosic fabric with reducing back staining, with a composition comprising a cellulose having the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having at least 75% sequence identity with SEQ ID NO: 2 is provided. A method for biopolishing a cellulose-containing fabric by using the new endoglucanase is also provided.
US08198067B2	Delivery of disease control in aquaculture and agriculture using microbes containing bioactive proteins A microbial biomass, made from algae, bacteria, fungi, yeast, or combinations thereof, provides a feed for animals raised either in agriculture or aquaculture. A feed additive, and a therapeutic composition can also be made from a microbial biomass of algae, bacteria, fungi, yeast, or combinations thereof. The feed, feed additive, and therapeutic composition can comprise one or more proteins, peptides, antibodies, antibody fragments, or a combination thereof, wherein said proteins, peptides, antibodies, antibody fragments, or a combination thereof are non-native to the microbes of the biomass. The biomass can have therapeutic, bioactive, nutritional, and/or immunogenic properties.
US08198065B2	Mutant strains of lactic acid bacteria having a non-phosphorylable lactose permease The invention concerns lactic acid bacteria strains wherein the phosphorylable histidine of the IIA domain of lactose permease is replaced by a non-phosphorylable amino acid. Said strains have a reduced post-acidification and are useful in particular for preparing fermented dairy products.
US08198063B1	Rapid deglycosylation of glycoproteins The present invention provides methods for rapid deglycosylation of glycoproteins.
US08198057B2	Ethanol production by fermentation of chinese tallow tree A method for producing ethanol by fermentation includes the preparation of a starter culture, inoculation of a mash with the starter culture, fermentation of the mash, and recovery of ethanol from the mash. The starter culture includes a tallow base with Chinese tallow tree parts and water which are inoculated with micro-organisms, where the micro-organisms include yeast. The micro-organisms are grown in the tallow base, and used to inoculate the mash. The mash is then fermented, and ethanol is recovered from the mash.
US08198052B2	Primers for nucleic acid amplification in detecting β-actin and test method using these primers It is intended to provide novel primers for nucleic acid amplification to be used in detecting mRNA of a housekeeping gene, more particularly, confirming the amplification of β-actin or GAPDH. More specifically speaking, primers containing oligonucleotides having nucleotide sequences represented by any of SEQ ID NOS: 2 and 4 to 49 (in the case of β-actin) or oligonucleotides having nucleotide sequences represented by any of SEQ ID NOS: 52 to 96 (in the case of GAPDH) can be selected, combined and used.
US08198048B2	Mammalian sweet taste receptors The present invention provides isolated nucleic acid and amino acid sequences of sweet taste receptors comprising two heterologous G-protein coupled receptor polypeptides from the T1R family of sensory G-protein coupled receptors, antibodies to such receptors, methods of detecting such nucleic acids and receptors, and methods of screening for modulators of sweet taste receptors.
US08198044B2	Systems for the expression of orthogonal translation components eubacterial host cells The invention relates to compositions and methods for the in vivo production of polypeptides comprising one or more unnatural amino acids. Specifically, the invention provides plasmid systems for the efficient eubacterial expression of polypeptides comprising one or more unnatural amino acids at genetically-programmed positions.
US08198033B2	Methods and materials for observing apoptosis The invention provides methods and materials for observing protein fragments generated during apoptosis in order to observe this process in mammalian cells. Embodiments of the invention can be used for example to observe apoptosis in order to examine the sensitivity of a mammalian cancer cell to apoptosis inducing agents.
US08198031B2	Detecting and profiling molecular complexes Methods are provided for detecting the formation of complexes of molecules, especially proteins, in a sample, such as a cell or tissue lysate. In one aspect, a cleaving probe specific for a first protein in a complex and one or more binding compounds specific for one or more second proteins in a complex are provided. Upon binding, the cleaving probe is induced to generate an active species, such as singlet oxygen, that cleaves molecular tags attached to the binding compounds only in the local region of the cleaving probe. The released molecular tags are separated from the assay mixture and from one another to provide a readout that is related to the number and types of proteins present in the complex.
US08198030B2	Recombinant platelet collagen receptor glycoprotein VI and its pharmaceutical use The invention relates to Glycoprotein VI (GPVI), its isolation, purification, and methods for recombinant production. Especially, the invention relates to the use of GPVI, preferably recombinant GPVI, in the treatment of disorders and pathological events correlated directly or indirectly to blood coagulation disorders such as thrombotic and cardiovascular diseases. The extracellular recombinant protein can also be used for establishing screening assays to find potential inhibitors of the membrane bound GPVI in order to inhibit binding of thrombocytes and platelets, respectively, to collagen. Changes in GPIV can be used to monitor platelet age and exposure to thrombotic and cardiovascular diseases.
US08198029B2	3'-OH unblocked nucleotides and nucleosides base modified with non-cleavable, terminating groups and methods for their use in DNA sequencing Provided are novel nucleotides, nucleoside, and their derivatives described herein, that can be used in DNA sequencing technology and other types of DNA analysis. In one embodiment, the nucleotide or nucleoside with an unprotected 3′-OH group is derivatized at the nucleobase to include a fluorescent dye attached via a linker to a non-cleavable terminating group. The non-cleavable-fluorescent group is designed to terminate DNA synthesis so that DNA oligomers can be sequenced efficiently in a parallel format. These reagents and methods will lead to more accurate identification of polymorphisms and other valuable genetic information.
US08198023B2	Prevention and alleviation of steric hindrance during single molecule nucleic acid synthesis by a polymerase The present invention provides compositions and methods for reducing steric hindrance in the product of nucleic acid polymerase reaction. Methods and compositions of the invention encompass application of exonucleases, endonucleases, and uracil-DNA glycosylases to a nucleic acid polymerase reaction such that newly formed nucleic acid strands are modified (e.g., cleaved) while the polymerase reaction continues to proceed.
US08198021B2	Target and method for inhibition of bacterial RNA polymerase Target and method for inhibition of bacterial RNA polymerase disclosed are targets and methods for specific binding and inhibition of RNAP from bacterial species.
US08198018B2	Optical component made of an inorganic-organic hybrid material for the production of refractive index gradient layers with high lateral resolution and method for the production thereof An organic-inorganic hybrid material comprising (a) at least one soluble organic polymer and (b) at least one mono- or polynuclear metal complex having at least one ligand which comprises at least one photochemically and/or thermally polymerizable functional group. Also disclosed is an optical component which is made by using the hybrid material.
US08198017B2	Producing method of wired circuit board A producing method of a wired circuit board includes the steps of preparing a two-layer base material including a metal supporting layer and an insulating layer, covering an upper surface of the insulating layer and respective side end surfaces of the insulating layer and the metal supporting layer with a photoresist, placing a photomask so as to light-shield an end portion and a portion where a conductive layer is to be formed of the upper surface, exposing to light the photoresist covering the upper surface from above the photoresist via the photomask, exposing to light the photoresist covering the respective side end surfaces from below the photoresist, forming an exposed portion of the photoresist into a pattern by removing an unexposed portion thereof to form a plating resist, and forming an end-portion conductive layer and the conductive layer.
US08198014B2	Resist cover film forming material, resist pattern forming method, and electronic device and method for manufacturing the same To provide a material including: a silicon-containing polymer having at least an alkali-soluble group and is represented by the following general formula (1); and an organic solvent capable of dissolving the silicon-containing polymer. (SiO4/2)a(R1tSiO(4-t)/2)b(O1/2R2)c general formula (1) where R1 represents at least one of a monovalent organic group, hydrogen atom and hydroxyl group, R2 represents at least one of a monovalent organic group and hydrogen atom (where R1 and R2 each may appear twice or more, and at least one of R1 and R2 contains an alkali-soluble group), “t” represents an integer of 1 to 3, “a,” “b,” and “c” represent the relative proportions of their units (where a≧0, b≧0 and c≧0, and “a,” “b,” and “c” are not 0 at the same time), and (R1tSiO(4-t)/2)b may appear twice or more.
US08198008B2	Photosensitive resin composition, photosensitive element, method for forming resist pattern and method for producing printed wiring board A photosensitive resin composition comprising: (A) a binder polymer; (B) a photopolymerizable compound that has an ethylenically unsaturated bond; and (C1) a compound represented by general formula (1) below, wherein, at least one R represents a C1-10 alkoxy group or a C1-12 alkyl group; the sum of a, b, and c is 1 to 6; and when the sum of a, b, and c is 2 to 6, each R may be the same as or different from one another.
US08198004B2	Resist composition A resist composition which is stable relative to solvents used in immersion lithography processes and displays excellent sensitivity and resist pattern profile, and a method of forming a resist pattern that uses such a resist composition are provided. The resist composition is in accordance with predetermined parameters, or is a positive resist composition comprising a resin component (A) which contains an acid dissociable, dissolution inhibiting group and displays increased alkali solubility under the action of acid, an acid generator component (B), and an organic solvent (C), wherein the component (A) contains a structural unit (a1) derived from a (meth)acrylate ester containing an acid dissociable, dissolution inhibiting group, but contains no structural units (a0), including structural units (a0-1) containing an anhydride of a dicarboxylic acid and structural units (a0-2) containing a phenolic hydroxyl group.
US08198003B2	Photosensitive paste composition, barrier rib prepared using the composition and plasma display panel comprising the barrier rib Photosensitive paste compositions, barrier ribs of plasma display panels (PDPs) including the same, and PDPs including the barrier ribs are provided. More particularly, a photosensitive paste composition includes an organic component and an inorganic component, where the organic component and the inorganic component each have an average refractive index of less than 1.5. The organic component used in the photosensitive paste composition is not harmful to the human body, is inexpensive, is generally easily obtained, and succumbs readily to thermal decomposition. Accordingly, using such an organic component, barrier ribs of PDPs having high resolution and high compactness by exposure to light only once can be prepared.
US08198000B2	Method of producing polymerized toner A method for producing a toner is provided. The method comprises the steps of (1) dispersing a water-soluble polyvinyl alcohol having a degree of polymerization of 1,500 to 2,500 and a degree of saponification of 75 to 98% in an aqueous medium to prepare an aqueous dispersion of the polyvinyl alcohol, (2) preparing a mixture of monomers, (3) mixing the aqueous dispersion with the monomer mixture, and (4) polymerizing the monomers.
US08197994B2	Compound or its tautomer, metal complex compound, colored photosensitive curing composition, color filter, and production Provided is a colored photosensitive curing composition useful for color filters in primary colors, including blue, green, and red, having a high molar absorption coefficient and allowing a reduction in film thickness and superior color purity and fastness. A colored photosensitive curing composition, comprising, as its colorant, a dipyrromethene-based metal complex compound obtained from a metal or metal compound and a dipyrromethene-based compound represented by the following Formula (I): wherein in Formula (I), R1 to R6 each independently represent a hydrogen atom or a substituent group; and R7 represents a hydrogen or halogen atom, or an alkyl, aryl or heterocyclic group.
US08197993B2	Method of manufacturing transfer mask and method of manufacturing semiconductor device The present invention is a method of manufacturing a transfer mask with use of a mask blank in which a thin film for pattern formation and a chromium-based thin film made of a material containing chromium are stacked on a transparent substrate in this order. The thin film for pattern formation is made of material containing silicon and a transition metal other than chromium. The chromium-based thin film is made of a material containing chromium. Exposure light having a wavelength of 200 nm or less is applied to the transfer mask. In the manufacturing method, the transfer mask is produced by performing, in the following order, a process of forming a resist film having a transfer pattern on the chromium-based thin film, a process of forming a transfer pattern in the chromium-based thin film with use of a mask of the resist film having the transfer pattern, a process of forming a transfer pattern in the thin film for pattern formation with use of a mask of the chromium-based thin film having the transfer pattern, and a process of removing the chromium-based thin film by etching. The manufacturing method further includes a cleaning process of at least one of alkali solution cleaning, hot water cleaning, and ozone-containing water cleaning on the produced transfer mask until a width of the transfer pattern of the thin film for pattern formation is reduced by 4 nm or a space width of the thin film for pattern formation is increased by 4 nm.
US08197992B2	Photomask blank, photomask blank manufacturing method, and photomask manufacturing method A photomask blank manufacturing method that forms, on a light-transmissive substrate, a thin film for forming a transfer pattern, thereby producing a thin-film coated substrate and then presses the thin-film coated substrate. The pressing is carried out, for example, by a cold isostatic pressing method in a range of 1000 to 10000 atmospheric pressure.
US08197991B2	Manufacturing method of a semiconductor device An exposure mask provides a minute pattern formation which enables the high integration of semiconductor devices by preventing the generation of a scum in a space between a first pattern and a second pattern. The exposure mask includes a first pattern and a second pattern adjacent to the first pattern. A space is formed between the first pattern and the second pattern. The first pattern and the second pattern may each include a square wave shaped edge that is adjacent to the space. The square wave shaped edge includes a plurality of concave portions and convex portions.
US08197985B2	Fuel cell system with load applying mechanism A fuel cell system includes a fuel cell stack, a fluid unit, a load applying mechanism, and a casing. The casing contains the fuel cell stack, the fluid unit, and the load applying mechanism. A heat insulating member is provided between the fuel cell stack and the load applying mechanism. The heat insulating member limits heat transmission from the fuel cell stack to the load applying mechanism. The load applying mechanism includes metal springs for applying a load to the fuel cell stack in a stacking direction of the fuel cell stack.
US08197984B2	Fuel cell stack A fuel cell stack includes a box-shaped casing and a stack body in the box-shaped casing. The stack body is formed by stacking a plurality of unit cells. The casing includes end plates, a plurality of side plates, angle members, and coupling pins. The angle members couple adjacent ends of the side plates. The coupling pins couple the end plates and the side plates.
US08197983B2	Method of manufacturing a fuel cell by electrically connecting a first cell and a second cell coupled over both sides of a membrane with a predetermined gap between the first cell and the second cell A fuel cell and a method of manufacturing the fuel cell are disclosed. A method of manufacturing a fuel cell by electrically connecting a first cell and a second cell that are coupled over both sides of a membrane with a predetermined gap between the first cell and the second cell, where the first cell and the second cell each has an anode on one side and a cathode on the other side, may include perforating a hole in the membrane between the first cell and the second cell, and electrically connecting the anode of the first cell with the cathode of the second cell through the hole using a conductive member. This method does not entail unnecessary increases in volume or complicated flow paths, and the method can reduce electrical resistance while simplifying the peripheral equipment.
US08197982B2	Fuel cell with internal flow control A fuel cell stack is provided with a plurality of fuel cell cassettes where each fuel cell cassette has a fuel cell with an anode and cathode. The fuel cell stack includes an anode supply chimney for supplying fuel to the anode of each fuel cell cassette, an anode return chimney for removing anode exhaust from the anode of each fuel cell cassette, a cathode supply chimney for supplying oxidant to the cathode of each fuel cell cassette, and a cathode return chimney for removing cathode exhaust from the cathode of each fuel cell cassette. A first fuel cell cassette includes a flow control member disposed between the anode supply chimney and the anode return chimney or between the cathode supply chimney and the cathode return chimney such that the flow control member provides a flow restriction different from at least one other fuel cell cassettes.
US08197978B2	Fuel cell systems with fuel utilization and oxidation monitoring A solid oxide fuel cell (SOFC) system includes at least one oxygen partial pressure sensor or at least one open circuit voltage fuel cell (OCVFC) sensor which is fluidly integrated with said SOFC system. Further embodiments include methods of operating a fuel cell system including the steps of providing the fuel cell system including a fuel cell stack and at least one open circuit voltage fuel cell sensor fluidly integrated with said fuel cell stack, supplying fuel to the system thereby causing the system to generate electrical energy, and using the signal from the sensor to monitor or adjust performance of the system.
US08197977B2	Fuel cell system with improved fluid unit configuration A fuel cell system includes a fuel cell stack, a heat exchanger, an evaporator, a reformer, and a combustor. A fluid unit including at least the heat exchanger, the evaporator, and the reformer is provided at one end of the fuel cell stack in a stacking direction. The combustor is provided inside the evaporator The combustor has a combustion gas path for discharging a combustion gas produced in the combustor. The reformer is provided at a position in the middle of the combustion gas path.
US08197971B2	Lithium anodes for electrochemical cells Provided is an anode for use in electrochemical cells, wherein the anode active layer has a first layer comprising lithium metal and a multi-layer structure comprising single ion conducting layers and polymer layers in contact with the first layer comprising lithium metal or in contact with an intermediate protective layer, such as a temporary protective metal layer, on the surface of the lithium-containing first layer. Another aspect of the invention provides an anode active layer formed by the in-situ deposition of lithium vapor and a reactive gas. The anodes of the current invention are particularly useful in electrochemical cells comprising sulfur-containing cathode active materials, such as elemental sulfur.
US08197967B2	Long life and low corrosion lead storage battery with a separator including silica and oil A lead storage battery of the present invention has an electrode plate pack comprising a plurality of negative electrode plates in each of which a negative electrode active material layer is retained by a negative electrode grid, a plurality of positive electrode plates in each of which a positive electrode active material layer is retained by a positive electrode grid, and a plurality of separators separating the positive electrode plate and the negative electrode plate; a positive electrode connecting member connected to each positive electrode plate of the electrode plate pack, and a negative electrode connecting member connected to each negative electrode plate of the electrode plate pack. The positive and negative electrode grids, and the positive and negative electrode connecting members comprise a Pb alloy including at least one of Ca and Sn; the negative electrode active material layer includes Sb; and the separator includes silica.
US08197963B2	Lithium ion secondary battery A lithium ion secondary battery includes an electrode assembly having a first electrode plate, a second electrode plate, and a separator interposed therebetween; a case in which the electrode assembly is received; a cap plate formed with a terminal hole and an electrolyte injection hole; and a washer installed at an upper portion of the cap plate, the washer having at least one transparent part formed thereon or having a transparent part formed on an entire surface thereof.
US08197961B2	Battery module with bending collector plates A secondary battery according to the invention includes six power generation elements and a case having six mounting spaces in which the power generation elements are disposed, respectively. A positive electrode connecting portion of a positive electrode current collector plate of one of the power generation elements adjacent to each other is connected via a connecting hole in a partition wall to a negative electrode connecting portion of a negative electrode current collector plate of the other power generation element, whereby the secondary battery is provided. The positive electrode connecting portion of the positive electrode current collector is formed so as to bend more easily in an approaching direction B2, which is opposite to a detaching direction B1, than a first positive electrode plate welded portion and a positive electrode plate adjacent distal portion, where bending portions are provided on both sides, do.
US08197960B2	Battery module A battery module comprising: a plurality of battery cells of substantially rectangular parallelepiped shape; a first casing having a first holding section 42 that holds one end of the plurality of battery cells; a second casing having a second holding section 52 that holds the other end of the plurality of battery cells; and a plurality of insulating members arranged between the battery cells; wherein the battery cells are arranged lined up so that adjacent main walls thereof extending between the one ends and the other ends face each other and the plurality of insulating members are arranged in mutually separated fashion between the main walls.
US08197956B2	Flexible battery restraint for electronic devices A battery restraint apparatus for electronic devices includes a flexible, resilient substrate having opposite, elongated end portions. An elongated aperture is formed in the substrate adjacent each end portion. The substrate has elastic memory that allows it to be flexed and bent and to thereafter resiliently recover to its original shape. The battery restraint apparatus is configured to be removably secured to an electronic device and snugly overlie a battery compartment opening thereof.
US08197955B2	Electrolyte membrane, methods of manufacture thereof and articles comprising the same Disclosed herein is a method of forming an electrolyte membrane comprising forming a mixture; the mixture comprising a polyhydroxy compound, an aromatic polyhalide compound and an alkali metal hydroxide; disposing the mixture on a porous substrate; reacting the mixture to form a proton conductor; and crosslinking the proton conductor to form a cross-linked proton-conducting network. Disclosed herein too is an article comprising a porous substrate; and a crosslinked proton conductor disposed on the porous substrate.
US08197952B2	High starch light weight gypsum wallboard The invention generally provides gypsum-containing slurries including stucco, naphthalenesulfonate dispersant, and pregelatinized starch. The naphthalenesulfonate dispersant is present in an amount of about 0.1%-3.0% by weight based on the weight of dry stucco. The pregelatinized starch is present in an amount of at least about 0.5% by weight up to about 10% by weight of pregelatinized starch by weight based on the weight of dry stucco in the formulation. Other slurry additives can include trimetaphosphate salts, accelerators, binders, paper fiber, glass fiber, and other known ingredients. The invention also comprises the gypsum-containing products made with such slurries, for example, gypsum wallboard, and a method of making gypsum wallboard.
US08197940B2	Aqueous suspension for pyrolytic spray coating The durability of a transparent pyrolytic spray applied coating is improved by providing a spray solution of metal acetylacetonates having different particle size distribution. More particularly, the particle size distribution of each of the metal acetylacetonates is a function of its melting temperature, and optionally of its melting temperature and solubility.
US08197939B2	Method for producing a flexible composite elastomeric polyurethane skin The present invention relates to a method for producing a flexible elastomeric composite polyurethane skin comprising a first and a second flexible polyurethane layer obtained by spraying a first and a second polyurethane reaction mixture onto one another. The first reaction mixture is an aliphatic polyurethane reaction mixture which is free of lead and formulated to produce a polyurethane elastomer having a flexural modulus smaller than 35 MPa. The second reaction mixture is an aromatic polyurethane reaction mixture producing a polyurethane elastomer having a smaller flexural modulus. The thickness of the aliphatic polyurethane layer could be made so small with respect to the thickness of the aromatic polyurethane layer that the composite skin has an average flexural modulus smaller than 30 MPa. Notwithstanding the lower reactivity of the aliphatic polyurethane reaction mixture, especially when using a higher NCO-index to reduce the “rubbery feel” and the emission of VOCs and/or a flexibiliser to achieve a higher flexibility, sufficiently short cycle times can be achieved due to the accelerated curing observed when spraying the aromatic polyurethane sufficiently early against the aliphatic polyurethane layer.
US08197937B2	Perfluoropolyether polymer grafted polyaniline containing intermediate transfer members An intermediate transfer media, such as a belt, that includes a polyaniline grafted to or chemically bonded to a perfluoropolyether phosphoric acid polymer.
US08197936B2	Cutting structures A polycrystalline diamond compact cutter that includes a thermally stable polycrystalline diamond layer, a carbide substrate, and a polycrystalline cubic boron nitride layer interposed between the thermally stable polycrystalline diamond layer and the carbide substrate such that at least a portion of the polycrystalline cubic boron nitride layer is radially surrounded by the thermally stable polycrystalline diamond layer is disclosed.
US08197931B2	White polyester film and reflection sheet A white polyester film containing voids, wherein a resin constituting the film has a layer (layer A) formed by using a polyester resin and a cyclic olefin copolymerized resin, and wherein a void ratio taken in a cross-section of the layer is more than 25% and 75% or less and the average particle size of the cyclic olefin copolymerized resin in the film is 0.1 μm or more and 3 μm or less.
US08197929B2	Aliphatic polyester based resin reflection film and reflection plate To obtain a reflection film that does not undergo yellowing or a reduction in reflectance with a lapse of time by using, has excellent deadfold properties, generates less calorific when incinerated, and is degradable by microorganisms when subjected to earth filling, and causes no problem of waste disposal, the reflection film includes an aliphatic polyester based resin as a base resin and fine powder filler. The reflection film has pores inside thereof at a porosity of 50% or less. Preferably, the fine powder filler includes titanium oxide.
US08197927B2	Slip-cling stretch film A multilayer stretch film having a high slip surface and an aggressive cling surface for wrapping items or loads for ease of transport is disclosed. In one embodiment, there is disclosed a multilayer film comprises a first surface having a coefficient of friction at least less than about 0.9, comprising at least polypropylene and high-density polyethylene, a second surface having a cling force to the first surface at least greater than about 5 g/in, comprising at least a styrenic block copolymer, and a core layer, positioned between the first surface and the second surface, comprising at least linear low-density polyethylene or its blend.
US08197922B2	Flexlock with headed pintle and conical buttressing Flexlock non-textile fabrics use intimately linked elements that are formed from formable, preferably solid phase forgeable materials into generally triangular shapes with hinging connection features along edges of a generally triangular overall shape. These hinging connection portions permit other elements to rotate about axes that intersect at intersections. Buttressing portions are located near these intersections and include cylindrical or conical shapes that abut the buttressing portions of adjacent formed elements. This abutting can occur even when adjacent elements are rotated or twisted out of a common plane. Connection portions include direct formed engagements with knuckles of the other elements. These connection portions and the engaged knuckles can include headed pintles, axles, or oppositely facing conical protrusions, and may be configured to permit the non-textile fabric to bend on itself within its own thickness without undue strain on the connection features.
US08197920B2	Process for obtaining a polymer film for high-resolution inkjet printing, the obtained film, printing system and method Process for improving the resolution of inkjet printing of polymer films comprising a base polymer according to which a copolymer additive comprising a polymer group A and a polymer group B is blended with the base polymer, group A having a lower surface tension than that of the base polymer and group B being compatible with the base polymer.
US08197918B2	Image transfer sheet The present invention includes an article and method for transferring an image from one substrate to another. The method includes providing or obtaining an image transfer sheet that is comprised of a substrate layer, a release layer and an image-imparting layer that may comprise a low density polyethylene or other polymeric component having a melting temperature within a range of about 90 degrees C. to about 700 degrees C. An image is imparted to the low density polyethylene area with an image-imparting medium. A second image-receiving substrate can be provided. The second image-receiving substrate is contacted to the first image transfer sheet at the polymer, image-imparting layer. Heat is applied to the image transfer sheet so that the low density polyethylene encapsulates the image-imparting medium and transfers the encapsulates to the image-receiving substrate, thereby forming a mirror image on the image-receiving substrate.
US08197917B2	Decoration A decoration includes a first, lower decoration member and a second, lower decoration member detachably connected to the first, lower decoration member. Each lower decoration member includes a lower main body having first and second lower branch portions and a lower engaging slot in an upper end thereof. The decoration further includes at least one upper decoration member. The upper decoration member includes an upper main body having first and second upper branch portions and an upper engaging slot in a lower end thereof. The lower engaging slots of the first and second lower decoration members are engaged with the upper decoration member, and the upper engaging slot of the upper decoration member is engaged with the first and second lower decoration members. The decoration can be quickly assembled and exhibit a rich visional appearance.
US08197915B2	Method of depositing silicon oxide film by plasma enhanced atomic layer deposition at low temperature A method of depositing a silicon oxide film on a resist pattern or etched lines formed on a substrate by plasma enhanced atomic layer deposition (PEALD) includes: providing a substrate on which a resist pattern or etched lines are formed in a PEALD reactor; controlling a temperature of a susceptor on which the substrate is placed at less than 50° C. as a deposition temperature; introducing a silicon-containing precursor and an oxygen-supplying reactant to the PEALD reactor and applying RF power therein in a cycle, while the deposition temperature is controlled substantially or nearly at a constant temperature of less than 50° C., thereby depositing a silicon oxide atomic layer on the resist pattern or etched lines; and repeating the cycle multiple times substantially or nearly at the constant temperature to deposit a silicon oxide atomic film on the resist pattern or etched lines.
US08197914B2	Method for depositing zinc oxide at low temperatures and products formed thereby The present invention discloses plasma enhanced chemical vapor deposition (PECVD) process for depositing n-type and p-type zinc oxide-based transparent conducting oxides (TCOs) at low temperatures with excellent optical and electrical properties on glass and temperature sensitive materials such as plastics and polymers. Specifically, it discloses PECVD process for depositing n-type ZnO by doping it with B or F and p-type ZnO by doping it with nitrogen excellent optical and electrical properties on glass and temperature sensitive materials such as plastics and polymers for TCO application. The process utilizes a mixture of volatile zinc compound, argon and/or helium as a diluent gas, carbon dioxide as an oxidant, and a dopant or reactant to deposit the desired ZnO-based TCOs.
US08197909B2	Plasma coatings and method of making the same According to at least one aspect of the present invention, a method is provided for forming a polymerized coating on a surface of a substrate. In at least one embodiment, the method comprises providing a plasma gun having an outlet; introducing a pre-polymer molecule into the outlet of the plasma gun to form a number of fragments of the pre-polymer molecule as a plasma output including a direct-spray component and an over-spray component; at least partially isolating the direct-spray component and the over-spray component from each other to respectively obtain an isolated directed-spray component and an isolated over-spray component; and depositing at least a portion of the isolated direct-spray component and the isolated over-spray component onto the surface of the substrate through the outlet to form a base polymerized coating. The plasma gun is optionally operated at atmospheric pressure.
US08197906B2	Method for producing organic thin film A method for producing an organic thin film in which an organic thin film is formed on the surface of a substrate, including a step (A) of bringing the substrate into contact with an organic solvent solution containing a metal-based surfactant having at least one hydrolysable group, and a catalyst capable of interacting with the metal-based surfactant, wherein the water contact within the organic solvent solution is either set or maintained within a predetermined range.
US08197904B2	Bisphenol A and aromatic glycidyl ether-free coatings Disclosed are Bisphenol A (BPA), Bisphenol F, Bisphenol A diglycidyl ether (BADGE), and Bisphenol F diglycidyl ether (BFDGE)-free coating compositions for metal substrates including an under-coat composition containing a polyester (co)polymer, and an under-coat cross-linker; and an over-coat composition containing a poly(vinyl chloride) (co)polymer dispersed in a substantially nonaqueous carrier liquid, an over-coat cross-linker, and a functional (meth)acrylic (co)polymer. Also provided is a method of coating a metal substrate using the BPA, BPF, BADGE and BFDGE-free coating system to produce a hardened protective coating useful in fabricating metal storage containers. The coated substrate is particularly useful in fabricating multi-part foodstuffs storage containers with “easy-open” end closures.
US08197902B2	Low VOC coating composition A pigmented, aqueous coating composition comprising i) an aqueous dispersion of non-crosslinkable addition oligomer of weight average molecular weight of from 5000 to 15000 Daltons and calculated Fox Tg greater than 0° C. and less than 50° C. ii) an aqueous dispersion of addition polymer of weight average molecular weight greater than 53,000 Daltons, calculated Fox Tg greater than 10° C. and less than 40° C. and mean particle diameter of less than 150 nanometers, where the ratio of i):ii) is from 0.25:1 to 2.70:1, based on % weight dispersion solids.
US08197897B2	Method of manufacturing pneumatic tire Provided is a method of manufacturing a pneumatic tire which enables an inner liner layer made of a thermoplastic resin or a thermoplastic elastomer composition to be formed without decreasing the productivity and deterioration the working environment. Powder 8 of a thermoplastic resin or a thermoplastic elastomer composition having an average particle diameter of not more than 1 mm is sprayed and adhered onto the inner surface of an uncured tire or a cured tire. Thereafter, the inner surface of the tire is heated under pressure so as to thermally fuse the powder 8 and bond the powder 8 to the inner surface of the tire, thereby forming an inner liner layer 7.
US08197896B2	Method for producing a pressure-sensitive adhesive tape or sheet It is provided a method for producing a pressure-sensitive adhesive tape or sheet which is superior in a heat-resistance. A mixture is prepared by uniformly mixing a specific polymer having hydrolyzable silyl end groups and urethane linkages and/or urea linkages in the main chains or side chains with tackifying resins. A fluorine-containing compound selected from the group consisting of boron trifluoride, complex of boron trifluoride, fluorinating agent and alkali metal salt of fluorine-containing inorganic acid is uniformly mixed into the mixture to obtain a precursor of a pressure-sensitive adhesive agent. The adhesive precursor is applied on the surface of a tape substrate or sheet substrate. It is obtained a pressure-sensitive adhesive layer having three-dimensional reticulation structures by curing the specific polymer having hydrolyzable silyl end groups. Thereby, it is obtained the pressure-sensitive adhesive tape or sheet.
US08197894B2	Methods of forming sputtering targets In various embodiments, sputter-target formation includes application of a layer having an intermediate coefficient of thermal expansion between the backing plate and the target material.
US08197891B2	Perpendicular magnetic recording medium and method for manufacturing same A perpendicular magnetic recording medium is disclosed in which each magnetic crystal grain in the magnetic recording layer has a multilayer structure and has a configuration like a truncated cone shape, in which the crystal grain of the final layer deposited in the film surface side at the final stage is smaller than the diameter of the crystal grain in the initial layer deposited on the substrate side at the initial stage. The invention improves S/N (signal output to noise ratio) by enhancing signal output and reducing noises. The medium is produced by a simple manufacturing method suitable for mass production, and provides a medium of high recording density by improving recording resolution.
US08197889B2	Metal nanowires with an oxide sheath and production method for same A one-dimensional composite structure which comprises at least one nanowire. The nanowire comprises a metal core and a metal oxide sheath.
US08197886B2	Method of manufacturing solid electrolytic capacitor The present invention provides a method of manufacturing a solid electrolytic capacitor including a step of forming a conductive polymer layer by chemical oxidization polymerization of a monomer using a solution containing a metal salt of carbon-fused bicyclic sulfonic acid as an oxidizing agent. The molar ratio X of a carbon-fused bicyclic sulfonate ion to a metal ion in the solution is less than the stoichiometric ratio Y of the metal salt of carbon-fused bicyclic sulfonic acid. This is allowed to provide a solid electrolytic capacitor with a sufficiently low equivalent series resistance (ESR) and high heat resistance.
US08197884B2	Process for producing a sol-gel-based absorber coating for solar heating Process for producing a solar absorber coating, which comprises the steps: coating of a substrate with a titanium precursor solution to produce a titanium dioxide layer by the sol-gel technique and heat treatment of the coated substrate to pyrolyse and crystallize the layer, characterized in that silver ions are added to the titanium precursor solution prior to coating in such an amount that the heat-treated layer has a proportion by mass of silver in the range from 10% to 80% and pyrolysis and crystallization of the layer are carried out with illumination of the layer with visible light.
US08197882B2	Method for forming thin film pattern, thin film manufacturing device, conductive thin film wiring, electro-optic device, electronic apparatus, and non-contact card medium A contact angle for a liquid on a substrate is set by a surface treatment process such that defects do not occur in a thin film pattern. In particular, the contact angle is set in a range of 15° to 45°. By doing this, it is possible to provide a device, a conductive thin film wiring device, and a method for forming a thin film pattern in which defects such as disconnections and short circuits can be prevented in a thin film pattern which is formed by an ink jet method.
US08197880B2	Methods for manufacturing amino acid mimetic copolymers and use of same A method of using a biocompatible polymer is used. Biocompatible polymers are manufactured to include an ammo acid mimetic monomer and one or more hydrophobic acrylate monomers. The amino acid mimetic monomers are selected to mimic the side chain of the amino acids asparagine or glutamine. The amino acid mimetic monomer can be a methacryloyl or acryloyl derivative of 2-hydroxyacetamide, 3-hydroxypropionamide, alaninamide, lactamide, or glycinamide. These amide functional groups offer the advantage of moderate hydrophilicity with little chemical reactivity. The amino acid mimetic monomer can be copolymerized with one or more hydrophobic acrylate monomers to obtain desired coating properties.
US08197879B2	Method for selectively coating surfaces of a stent A stent mandrel fixture for supporting a stent during the application of a coating substance is provided. A method supporting a stent during the application of a coating substance is also provided.
US08197876B2	Method of making standard of identity cream cheese that is flowable at refrigerated temperatures A method of producing a standard of identity cream cheese that is flowable at refrigerated temperatures is provided. The method includes providing freshly made or reheated standard of identity cream cheese at a temperature of at least about 150° F. The cream cheese is then cooled while at least intermittently shear mixing the cream cheese. At least some of the shear mixing is carried out while the cream cheese is at a temperature of 70° F. or greater. The flowable standard of identity cream cheese can be converted from a flowable state at refrigerated temperatures to a solid state at refrigerated temperatures by reheating the flowable standard of identity cream cheese to a temperature above 100° F., and cooling the cream cheese to refrigerated temperatures without mixing.
US08197856B2	Kit for promoting hair growth A kit for promoting hair growth on areas of the scalp that has been affected by fungal infections. The kit reduces the loss of hair, gradually destroys the cause of the loss of hair, and eventually restores the normal hair growth in the areas of the scalp affected by the fungi. The kit is comprised of a first powdered mixture and three liquid compositions. The elements of the kit are applied to the scalp of an individual experiencing hair loss due to fungi.
US08197854B2	Nutritional supplement for use under physiologically stressful conditions A nutritional supplement for use in physiologically stressful conditions is disclosed. The nutritional supplement may include one or more of vitamin A, vitamin E, vitamin D3, vitamin C, vitamin B1, riboflavin, niacin, folic acid, vitamin B6, biotin, pantothenic acid, vitamin B12, magnesium, zinc, selenium, chromium, copper, iron, alpha lipoic acid, lutein and lycopene.
US08197849B2	Cross-linked oxidated hyaluronic acid for use as a vitreous substitute A composition comprising a polymer that comprises oxidated hyaluronic acid cross-linked by a dihydrazide is disclosed. The polymer is a hydrogel exhibiting the following properties: a) transparent and colorless; and b) transforming from a liquid state into a gel-matrix at 37° C. These characteristics make it useful as a vitreous humor substitute.
US08197844B2	Active electrode for transdermal medicament administration A transdermal medicament patch includes a biocompatible substrate having a therapeutic face on one side configured for disposition against the skin of a patient, a biocompatible adhesive on the therapeutic face, a planar medicament matrix covering a portion of the therapeutic face, and a release liner covering the portion of therapeutic that is not obscured by the medicament matrix. An aperture formed through the release sheet affords direct access by medicament to the entire surface of the medicament matrix opposite from the therapeutic face of the substrate. An active electrode positioned between the medicament matrix and the therapeutic face of the substrate includes an electrically conductive backing layer positioned against the therapeutic face of the substrate and a pH-control layer covering less than all of the side of the backing layer opposite from the therapeutic face of the substrate. One active electrode design criterion relates the relative size of the pH-control layer to the size of the backing layer; another relates the size of portion of the area of the backing layer that is free of the pH-control lawyer to the size of the pH-control layer. The pH-control layer is made of an electrically conductive material capable of moderating changes in the hydrogen-ion concentration in the medicament matrix during iontophoretic current flow. An electrical contact electrically coupled through the substrate to the backing layer includes a hollow, electrically conductive snap fitting having an open end and a cooperating stud that is inserted into the open end of the snap.
US08197842B2	Dietary supplement and method A novel dietary supplement and methods for the manufacture of the same are disclosed for feeding to equines and other animals. The dietary supplement of the present invention is beneficial to the health of equines and other animals. The dietary supplement of the present invention consists of safe and natural ingredients rather than drugs, and is orally administrable. The ingredients of the dietary supplement make the dietary supplement of the present invention highly beneficial to the health of equines and other animals.
US08197838B2	Sustained release systems of ascorbic acid phosphate A novel method of preparing a controlled release composition is disclosed. Specifically, the present invention relates to a method of preparing controlled release compositions of ascorbic acid phosphate and absorbable polymers. Also disclosed is a novel controlled release composition of ascorbic acid phosphate made by the method of the present invention.
US08197834B2	Solid formulations of hydrogen cyanamide for agricultural applications Agricultural crops are protected from the growth of weeds and other undesirable organisms by the application of hydrogen cyanamide in a granular formulation.
US08197831B2	Stable S-(+)-abscisic acid liquid and soluble granule formulations The present invention generally relates to stable S-(+)-abscisic acid liquid and soluble granule formulations and methods of making and using such formulations.
US08197830B2	Dissolvable pads for solution delivery to a surface A dissolvable pad for delivery of a solution to a surface includes a water soluble substrate, and a solution retained in or on said water soluble substrate and available for use without activation by water. The water soluble substrate is soluble in water so as to be safely disposable into public water systems by exposing it to water after the solution therein has been desirably employed. Because the solution in the water soluble substrate is available for use without exposing the substrate to water, the substrate may function as an applicator, and, in some embodiments, as a scrubbing substrate as well.
US08197828B2	Compositions that include a hydrophobic compound and a polyamino acid conjugate Various compositions that include a hydrophobic compound and a polyamino acid conjugate are prepared. The compositions described herein are useful for a variety of drug, biomolecule, and imaging agent delivery applications.
US08197825B2	Recombinant MVA virus and the use thereof The present invention relates to recombinant vaccinia viruses derived from the modified vaccinia virus Ankara (MVA) and containing and capable of expressing foreign genes which are inserted at the site of a naturally occurring deletion in the MVA genome, and the use of such recombinant MVA viruses for the production of polypeptides, e.g. antigens or therapeutic agents, or viral vectors for gene therapy, and the use of such recombinant MVA viruses encoding antigens as vaccines.
US08197823B2	Vaccine for porcine reproductive and respiratory syndrome, a preparion method and use thereof Aspects of the present inventions discloses a Super-Virulent Variant Strain of Porcine Reproductive and Respiratory Syndrome Virus, characterized in that nucleotides 1594th-1680th are deleted in its Nsp2 gene. The present invention also discloses a Vaccine prepared with the Super-Virulent Variant Strain of the Virus for prevention of Porcine Reproductive and Respiratory Syndrome. The present invention may further discloses preparations, assay methods and/or the application of the Vaccine in preparing medicaments to resist Super-Virulent Variant Strain of Porcine Reproductive and Respiratory Syndrome Virus by immunizing pigs.
US08197818B2	EML4-ALK fusion gene The present inventors found that a fusion gene present in some cancer patients is an oncogene. The present invention relates to a polypeptide as a novel fusion protein, a polynucleotide encoding the polypeptide, a vector comprising the polynucleotide, a transformed cell comprising the vector, a method for detecting the fusion protein or polynucleotide, a method for screening a therapeutic agent for cancer, and a method for treating cancer that is shown to be positive for the fusion gene. Further, the present invention relates kit, primer set, and probe useful in the detection of cancer that is shown to be positive for the fusion gene.
US08197814B2	Method for treating the Th2-mediated disease A recombinant antibody or the antibody fragment thereof which specifically reacts with an extracellular domain of human CCR4; a DNA which encodes the recombinant antibody or the antibody fragment thereof; a method for producing the recombinant antibody or the antibody fragment thereof; a method for immunologically detecting CCR4, a method for immunologically detecting a cell which expressed CCR4 on the cell surface, a method for depleting a cell which expresses CCR4 on the cell surface, and a method for inhibiting production of Th2 cytokine, which comprise using the recombinant antibody according or antibody fragment thereof; a therapeutic or diagnostic agent for Th2-mediated immune diseases; and a therapeutic or diagnostic agent for a blood cancer.
US08197812B2	IL-1-like cytokine antibodies Nucleic acids encoding mammalian, e.g., primate, IL-1ζ, purified IL-1ζ polypeptides and fragments thereof. Binding proteins, e.g., antibodies, both polyclonal and monoclonal, are also provided. Methods of using the compositions for both diagnostic and therapeutic utilities are provided.
US08197811B2	Methods of use of sialoadhesin factor-2 antibodies Monoclonal antibodies have been generated that bind to human sialoadhesion factor-2. These antibodies are useful as diagnostic and therapeutic reagents.
US08197809B2	CD9-specific human antibodies The present invention relates to a CD9-specific human antibody, more precisely a CD9-specific human antibody composed of human derived CD9-specific complementarity determining region (CDR) and framework region (FR). The human antibody of the present invention recognizes CD9 extracellular loop 2 domain (CD9-ECL2) as an epitope and thereby strongly binding thereto. The human antibody of the present invention also has CD9 antigen neutralizing effect and at the same time inhibiting effect on tumor cell lines. Therefore, it can be effectively used for the prevention and treatment of cancer overexpressing CD9.
US08197803B2	Method of forming a conformable solvent-based bandage and coating material Liquid hemostatic coating materials comprise a cyanoacrylate monomer and a solvent system comprising a volatile, non-reactive liquid that is non-stinging and non-irritating to a user. The material forms a coating or bandage in the form of a film that when applied and adhered to a surface or to the skin of a user inhibits the application surface from adhering to another surface.
US08197801B2	Use of compounds for the preservation of the human or animal body and compositions comprising same The present invention relates to the use of at least one compound of formula (I) R—(OCH2)n—OR′ in which R and R′, identical or different, represent a linear or branched alkyl radical comprising 1 to 5 carbon atoms and n is an index with a value comprised between 1 and 8, and/or at least one dialdehyde acetal type compound for the preservation of the human or animal body and/or the embalming of dead bodies.It also relates to a composition comprising same and a process for preserving a human or animal body and/or embalming a dead body comprising the administration of the composition to the dead body in particular by injection, perfusion, immersion or topical application.
US08197799B2	Hair care formulations This invention relates to hair conditioning formulations comprising at least one aminofunctional polyorganosiloxane. Furthermore, the invention relates to the use of these formulations for the treatment of keratin-containing fibers, preferably human hair.
US08197798B2	Hair treatment compositions The invention provides a hair treatment composition comprising a combination of a sugar, an aliphatic amino acid and a basic amino acid. The composition is particularly suitable for the treatment of hair which is dry, damaged and/or prone to manageability problems.
US08197796B2	Biocompatible polymeric contrast agents and radiopaque materials for medical devices In accordance with the present invention, a high intensity radiopaque contrast agent is disclosed. The agent may be coated on or incorporated within bulk materials, which may then be subsequently utilized to fabricate a radiopaque medical device. Primary effects through chemistry include higher radiopaque concentrations per unit weight of the radiopaque element or agent. Secondary effects include selective placement of the radiopaque elements which may further enhance the radiopacity of the device with reduced requirements of the radiopaque agent. Such a radiopaque contrast agent may be produced in various forms such as a dendrimer and/or incorporated as the end groups of polymeric chain. In addition one can incorporate biological and/or pharmaceutical agents in combination with the present invention.
US08197795B2	Method for monitoring early treatment response Disclosed is a method for monitoring early treatment response of a cancer treatment comprising measuring by magnetic resonance spectroscopy (MRS), for example, proton MRS, the amount of Choline present in the cancerous tissue before and after treatment; the treatment comprises administration of a cell surface receptor inhibitor, for example, an EGFR inhibitor, whereby a decrease in the amount of Choline after treatment is indicative of a positive response. The decrease in the amount of Choline represents the decrease in the internal cell membrane as a result of down regulation of the organelles and their secretory granules and their transport vesicles. Disclosed also is a method for determining effectiveness of a cell surface receptor inhibitor in the treatment of cancer. Further, the present invention provides for a method for monitoring protein translation in an animal having a cancerous tissue by MRS.
US08197793B2	Methods of radiofluorination of biologically active vectors The invention relates to conjugates of formula (V) or (VI): wherein X is —CO—NH—, —NH—, —O—, —NHCONH—, or —NHCSNH—; their use as radiopharmaceuticals, processes for their preparation, and synthetic intermediates used in such processes.
US08197790B2	Method of making a filter material including activated carbon particles having carbon nanofilaments A method of making a filter material for producing potable water comprises providing activated carbon particles, depositing one or more nanofilament precursors at least partially onto the surface of the activated carbon particles, agitating the activated carbon particles and deposited nanofilament precursors in the presence of carbonaceous vapor, and heating the activated carbon particles and the deposited nanofilament precursors in the presence of carbonaceous vapor at a temperature and time sufficient to produce the filter material comprising activated carbon particles having carbon nanofilaments on the surface of the particles.
US08197789B2	Method of selectively eliminating metallic carbon nanotubes, semiconducting carbon nanotubes and preparation method thereof using the same Metallic carbon nanotubes (“CNTs”) may be selectively eliminated and semiconducting CNTs may be prepared using light-irradiation. The light provided by the light-irradiation may have a wavelength of about 180 nm to about 11 μm. Further, the light may have an intensity of about 30 mW/cm2 to about 300 mW/cm2. The light-irradiation may be simple and controllable, and may not require any special instruments except a light source.
US08197785B2	Split flow contactor Systems and methods for contacting a liquid, gas, and/or a multi-phase mixture with particulate solids. The system can include a body having a first head and a second head disposed thereon. Two or more discrete fixed beds can be disposed across a cross-section of the body. One or more unobstructed fluid flow paths can bypass each fixed bed, and one or more baffles can be disposed between the fixed beds.
US08197784B2	Method for the production of trichlorosilane High yields of trichlorosilane are achieved in the reaction of tetrachlorosilane and hydrogen at a temperature in the range of 900° C. to 1300° C. and a pressure above the critical pressure of the reactants.
US08197772B2	Biochip package body, method of forming the same, and biochip package including the biochip package body A biochip package body, a method of forming the same, and a biochip package including the biochip package body are provided. The biochip package body includes a mounting package body having a mounting plate. The mounting plate has at least one protruding portion that protrudes therefrom. The protruding portion has a chip mounting portion and a chip protection portion. The chip mounting portion is disposed substantially in the center of the protruding portion. The chip protection portion surrounds the chip mounting portion.
US08197766B2	Catalytic converter, holding material for catalytic converter and production method thereof The present invention relates to a holding material for a catalytic converter including a catalyst carrier, a metal casing for receiving the catalyst carrier, and the holding material wound around the catalyst carrier and interposed in a gap between the catalyst carrier and the metal casing, the holding material having a plurality of high-density sites which are spaced apart from one another in the holding material, each site having a higher density than sites of the holding material in which the higher density sites are not provided.
US08197765B2	Waste gas purification apparatus A waste gas purification apparatus comprises: a heater, which heats waste gas mixed with reaction air to separate it into a solid reactant and a vapor purification gas; a water reserve tank unit, which has a water reserve tank communicated with the heater; a dust collector unit, which comprises a dust collector collecting the purification gas inflowed from the first process unit, and a water reserve tank communicated with lower portion of the dust collector; a scrubber unit, which comprises a scrubber inhaling the purification gas inflowed from the dust collector unit, and a reserve tank communicated with lower portion of the scrubber; and a collector, which has an adsorber and a remover filtering the purification gas inflowed from the scrubber unit, a water distributor being installed in upper portion of the remover and lower portion of the adsorber.
US08197764B2	Device for producing a product gas from a fuel, such as biomass A device for producing a product gas from a fuel, such as biomass, comprises a reactor which is delimited by a base and reactor walls. The reactor walls comprise a peripheral wall and an upper wall. The reactor comprises a supply opening for the supplying of biomass, as well as at least one riser for chemically converting the biomass supplied to a product gas and a solid. The riser is provided inside the peripheral wall and comprises an upper end and a tower end. The reactor furthermore has a discharge opening for discharging the product gas. The riser is attached to at least one reactor wall. The lower end of the riser is at a distance above at least one section of the base which is underneath it and is freely movable under the effect of thermal expansion.
US08197760B2	Heat medium heating-cooling apparatus and heat medium temperature control method Provided are a heat medium heating-cooling apparatus and a heat medium temperature control method, which can control the heat medium temperature stably and more efficiently. The heat medium heating-cooling apparatus includes a heat medium heating unit (12) as well as a bypass line (19) thereof with switching valves 20a, 20b switching the direction of a flow of the heat medium to the heat medium heating unit or the bypass line. Decisions are made based on the present temperature (PV) in a reactor (11), a preset target temperature (SV), stable temperature range (α) and control switching temperature (β). According to the resulted four decisions of “stable heating”, “stable cooling”, “inclined heating” and “inclined cooling”, the temperature control according to either of the heating control at a heating control unit or the cooling control at a cooling control unit is conducted.
US08197759B2	Zwitterionic dyes for labeling in proteomic and other biological analyses The invention relates to compositions and methods useful in the labeling and identification of proteins. The invention provides for highly soluble zwitterionic dye molecules where the dyes and associated side groups are non-titratable and maintain their net zwitterionic character over a broad pH range, for example, between pH 3 and 12. These dye molecules find utility in a variety of applications, including use in the field of proteomics.
US08197754B2	Sample dispensing apparatus and automatic analyzer including the same The invention provides a small-sized automatic analyzer being compact, enabling a large number of analysis items to be carried out, and having a high processing speed. The automatic analyzer is particularly suitably applied to a medical analyzer used for qualitative/quantitative analysis of living body samples, such as urine and blood. A plurality of sample dispensing mechanism s capable of being operated independently of each other are provided to suck a sample from any one of a plurality of sample suction positions and to discharge the sucked sample to any one of a plurality of positions on a reaction disk. The automatic analyzer having a high processing capability can be thus realized without increasing the system size.
US08197753B2	APC process parameter estimation A virtual analyzer is provided to estimate either an attribute of a reactant applied during performance of, or an amount of a reactant exhausted by, a process having multiple process parameters (MPPs) that is performed to control an amount of a pollutant emitted into the air. The virtual analyzer includes an interface which receives signals corresponding to attributes of the MPPs. If the process is a wet flue gas desulfurization (WFGD) process, the signals include a signal corresponding to a measured pH level of the applied reactant. If the process is a selective catalytic reduction (SCR) process, the signals include a signal corresponding to a measured amount of the reactant exhausted by the process.
US08197751B2	Apparatus for chemiluminescent assay and detection An apparatus includes a system for guiding chemiluminescence and a system for preventing a variation in dark currents. The apparatus includes a first light shielding BOX having a sample container holder and a shutter unit therein, the shutter unit including a top plate which is partly formed by a movement of a plate member, and a second light shielding BOX having a photodetector therein. While a measurement is not implemented, the shutter unit is closed to block entrance of stray light to the photodetector, and while a measurement is implemented, the plate member is moved to open the shutter unit, and the tip of the photodetector is inserted into a through hole formed in the top plate, so that the distance between the bottom of the sample container and a sensitive area of the photodetector is reduced to several millimeters or less.
US08197750B2	Laboratory device for processing samples and methods using the same The invention relates to devices and methods for the identification of test tubes in a test tube rack using RFID technology.
US08197745B1	Perm selective asymmetric hollow fibre membrane for the separation of toxic mediators from blood A permselective asymmetric hollow fiber membrane for the separation of toxic mediators from blood, a process for the preparation of such a membrane, and the use of such a membrane in hemodialysis, hemodiafiltration, and hemofiltration for treatment of toxic mediator-related diseases.
US08197741B2	Method for producing clay thin film A method for producing a clay thin film, which is formed of clay alone or in combination with an additive and has a structure where oriented clay particles are laminated, the method including paste-making in which clay alone or in combination with an additive are dispersed in a dispersion medium formed of water, an organic solvent, or a mixed solvent of water and an organic solvent to prepare clay paste; coating in which a thin film is formed by coating the clay paste on a substrate; planarization in which the thin film is planarized; drying in which water, an organic solvent, or water and an organic solvent are removed from the thin film; and separation in which the thin film is separated from the substrate.
US08197738B2	Method for filling a gap between a substrate and a work placed thereon Provided are a method, an apparatus and a computer program for filling a liquid material, which do not require complicated parameter calculation and which are practiced with easier control. In the method for filling a gap between a substrate and a work placed thereon with the liquid material discharged from a discharge unit by utilizing a capillary action, the method is characterized in forming an application pattern made up of a temporarily stopping point and a non-stopping region along an outer periphery of the work, and correcting a discharge amount of the liquid material by increasing or reducing a time during which the discharge unit is stopped at the temporarily stopping point. The apparatus and the program for carrying out the method are also provided.
US08197736B2	Method for providing a footwear antislip tread A method for providing an antislip tread and an antislip tread provided with the method. The tread has a plurality of antislip inserts made of fabric or nonwoven fabric which emerge from the surfaces intended for contact with the ground. The inserts made of fabric or nonwoven fabric may also form a substantially continuous surface with the surface made of rubber or plastic material.
US08197734B1	Composite sheet materials and processes for manufacturing same Provided are, among other things, systems, methods and techniques for manufacturing sheet material. In one representative embodiment, a sheet of fabric material is positioned across a patterning template that has a number of openings; and the sheet of fabric material and the patterning template are fed through an extrusion device in which extrusion material coats the fabric material and forces the fabric material into the openings in the patterning template, thereby producing a composite sheet material.
US08197733B2	Wood grain extrusions The invention is the provision of an elongated imitation wood product or component which has a plastic core and a plastic coating on at least one surface with the coating, which is of two different colours and which has a randomly swirled pattern, giving a realistic appearance of the wood grain of natural wood to the product. The invention further is in the method and equipment for producing such a realistic imitation wood product or component made of plastic.
US08197732B2	Composite reinforced oriented strand board The present invention resides in one aspect in a building material that comprises wood and a composite polymeric material that is combined with the wood in a heterogenous admixture. The composite polymeric material incorporates fibers in a polymeric matrix. The fibers can be chopped, continuous, or combinations thereof. In addition, the fibers can be unidirectionally oriented and/or randomly oriented. Suitable fibers for use in the composite polymeric material are glass, polymers, carbon, combinations thereof, and the like. However, the present invention is not limited in this regard as other fibers known to those skilled in the pertinent art to which the invention pertains can be used without departing from the broader aspects of the present invention. Suitable polymeric material for the polymeric matrix include thermoplastic polymers, thermosetting polymers, or a combination of thermosetting and thermoplastic polymers.
US08197724B2	Delensing of ophthalmic lenses using gas Contact lens delensing methods are described, and the present delensing methods include using a gas to facilitate separation of a polymerized contact lens product from a contact lens mold member. The contact lens mold member is compressed to deform a portion of the mold member, and gas, such as air, is directed toward the polymerized contact lens product in contact with the portion. The contact lens mold member can be compressed as the mold member and lens product rotate. A vacuum device can be used to separate the polymerized contact lens product from the contact lens mold member after compressing the portion of the mold member and directing the gas towards the mold member. Delensing systems used to practice the present methods are also described.
US08197720B2	Core/shell type semiconductor nanoparticle and method for production thereof Disclosed are core/shell type semiconductor nanoparticles exhibiting a sufficient emission intensity without causing a blink phenomenon (blinking). The core/shell-type semiconductor nanoparticles have an average particle size of from 2 to 50 nm and comprise an intermediate layer between a core portion and a shell portion, wherein band gap widths of bulk crystals which have the same compositions as those of the core portion, the intermediate portion and the shell portion, respectively, are in the order of: core portion
US08197718B2	Paste composition and solar cell element using the same Provided are a paste composition making it possible to improve the adhesive property of a backside electrode and restrain an aluminum electrode layer from exfoliating, and a solar cell element having an electrode formed by use of this composition. The paste composition is a paste composition for forming an electrode (8) on a silicon semiconductor substrate (1) which comprises aluminum powder, an organic vehicle, and a tackifier. The solar cell element has the electrode (8) formed by painting a paste composition having the above-mentioned characteristic onto the silicon semiconductor substrate (1) and then firing the resultant.
US08197716B2	Electromagnetic-wave suppressing material, electromagnetic-wave suppressing device, and electronic apparatus An electromagnetic-wave suppressing material is provided. The electromagnetic-wave suppressing material includes an ionic liquid and nanometer-order particles mixed with the ionic liquid, where 10 wt % or more of the nanometer-order particles is mixed with respect to 100 wt % of the ionic liquid.
US08197712B2	Phosphor composition and method for producing the same, and light-emitting device using the same A light-emitting device is produced using a phosphor composition containing a phosphor host having as a main component a composition represented by a composition formula: aM3N2.bAlN.cSi3N4, where “M” is at least one element selected from the group consisting of Mg, Ca, Sr, Ba, and Zn, and “a”, “b”, and “c” are numerical values satisfying 0.2≦a/(a+b)≦0.95, 0.05≦b/(b+c)≦0.8, and 0.4≦c/(c+a)≦0.95. This enables a light-emitting device emitting white light and satisfying both a high color rendering property and a high luminous flux to be provided.
US08197711B2	Active optoceramics with cubic crystal structure, method of production of the optoceramics, and uses thereof The transparent polycrystalline optoceramic has single grains with a symmetric cubic crystal structure and at least one optically active center. The optoceramic has the following formula: A2+xByDzE7, wherein 0≦x≦1.1, 0≦y≦3, 0≦z≦1.6, and 3x+4y+5z=8, and wherein A is at least one trivalent rare earth cation, B is at least one tetravalent cation, D is at least one pentavalent cation, and E is at least one divalent anion. The method of making the optoceramic includes preparing a powder mixture from starting materials, pre-sintering, sintering and then compressing to form the optoceramic. Scintillator media made from the optoceramic are also described.
US08197704B2	Plasma processing apparatus and method for operating the same The invention provides a plasma processing apparatus and a method for purging the apparatus, capable of preventing damage of components caused by pressure difference during purging operation of a vacuum reactor, and capable of preventing residual processing gas from remaining in the vacuum reactor. Inert gas is introduced through an inert gas feed port 233 on a side wall of a depressurized processing chamber (V1) 226 of a plasma processing apparatus, and the interior of the processing chamber (V1) 226 is brought to predetermined pressure by the inert gas, and thereafter, the inert gas is supplied to processing gas supply paths 213 and 216 (V2) communicated to a plurality of through holes 224 for introducing processing gas, so as to introduce the inert gas through the plurality of through holes 224 into the processing chamber (V1) 226.
US08197699B2	Process for preparing methylhydroxyalkylcellulose having a small number of coloured particles The present invention describes a process for preparing methylhydroxyalkylcellulose having a small number of colored particles by separation of methylhydroxyalkylcellulose from aqueous suspension with subsequent washing of the methylhydroxyalkylcellulose using a specially equipped rotary pressure filter.
US08197694B1	Safe transportation and storage for capillary columns A holder for capillary columns (130) is realized by a mechanical holding device, also called a lead holder, which can be a mechanical pencil. The user holds the holding device in one hand and presses on an actuator (100) at the top of the holder, springably urging a plurality of jaws (115) to open. The user then slidably inserts the capillary column into the holder a desired distance and releases the actuator, causing the jaws to close around the capillary column and hold it in position within the holder. Next, a cap (140, 140′) is optionally slidably urged over the end of the holder in order to protect the exposed tip (135) of the capillary column. Removal of the capillary column is accomplished by reversing the above procedure to release the capillary column, allowing the column to be withdrawn.
US08197688B2	Hollow fiber membrane module There is provided a hollow fiber membrane module (1) comprising: a membrane bundle (20) of a plurality of hollow fiber membranes (10); a cylindrical body (30) housing the membrane bundle (20); a fixing portion (40, 50) in which at least one end of the membrane bundle (20) is fixed to the cylindrical body (30); and a raw water outflow nozzle (34) for allowing raw water to flow out from the vicinity of the fixing portion (40). Raw water supplied into the cylindrical body (30) is allowed to permeate from the outside into the inside of each hollow fiber membrane (10). A soft potting portion (42) has, in its surface to be in contact with raw water, at least one groove (43).
US08197687B2	Contaminant adsorbent fluted filter element A contaminant adsorption filter element is provided that includes a self-assembled monolayers on mesoporous supports (SAMMS) contained in a filter element having a plurality of pockets such as a fluted filter media. The plurality of pockets are filled with mesoporous material that is functionalized for a target contaminant. A method of making a filter element having mesoporous material filled flutes is also provided.
US08197683B2	System for conditioning fluids utilizing a magnetic fluid processor The invention is a system and method for conditioning fluids utilizing a magnetic fluid processor or device that includes an elongated housing comprising a core enclosed by a magnetic component in combination with an electrical return path. The process utilizes said device to affect and electron configuration within fluids by generating a magnetic field, thereby separating, for example, metals and organic or inorganic materials from fluids, in order to achieve desired fluid composition and properties.
US08197682B2	Magnetic field processor for conditioning fluids The invention is a magnetic fluid processor for conditioning fluids that includes an elongated housing comprising a core enclosed by a magnetic component in combination with an electrical return path. In one embodiment, the processor includes an elongated housing comprising a hollow core for storing an inert gas, said core enclosed by a magnetic component. The processor is electrically coupled to an electrical return path, which alters a magnetic configuration within fluids, thereby separating metals and organic or inorganic materials from fluids, in order to achieve desired fluid composition and properties.
US08197678B2	Refining coal-derived liquid from coal gasification, coking and other coal processing operations A method of treating a coal-derived liquid byproduct from a coal gasification process includes subjecting the coal-derived liquid to a vacuum distillation process, thereby separating the coal-derived liquid into condensed gas and coal-derived liquid bottoms. The coal-derived liquid bottoms are mixed with a bottoms solvent capable of dissolving the coal-derived liquid bottoms. The solvent/bottoms mixture is introduced along with a linear chain hydrocarbon solvent into a liquid extractor. The Raffinate is separated from the solvent for the coal-derived liquid/bottoms mixture, thereby producing in a heavy extract. The condensed gas is subjected to atmospheric distillation producing a bottoms fraction and another condensed fraction. The bottoms fraction may be used as fuel or for diesel fuel production. The condensed fraction is extracted with a linear hydrocarbon solvent in an extractor to produce light neutral oil and a Raffinate which is a cresylic acid feed stock.
US08197663B2	High speed tin plating process Methods for the electrolytic preparation of tin coated metals are disclosed. Organic polybasic acids, such as methanedisulfonic acid [CH2(SO3H)2], 1,3-acetonedisulfonic acid [CO(CH2SO3H)2], anhydrides, and their water soluble salts, and mixtures thereof may be used as the electrolyte in the plating process or as the flux in the reflow process. Acetone, gamma-butyrolactone, or a mixture thereof, may be applied to a tin plated surface, either before or after reflow. The methods of the invention produce plated material that is free of blue haze.
US08197659B2	Plating apparatus, plating method and multilayer printed circuit board A method for manufacturing a multilayer printed circuit board including providing a core substrate having a penetrating-hole, forming an electroless plated film on a surface of the substrate and an inner wall surface of the penetrating-hole, electrolytically plating the substrate while moving with respect to the surface of the substrate an insulating member in contact with the surface of the substrate such that an electrolytic plated film is formed on the electroless plated film, an opening space inside the penetrating-hole is filled with an electrolytic material, and a through-hole conductor structure is formed in the penetrating-hole, forming an etching resist having an opening pattern on the electrolytic plated film, and removing an exposed pattern of the electrolytic plated film exposed by the opening pattern and a pattern of the electroless plated film under the exposed pattern such that a conductor circuit is formed on the surface of the substrate.
US08197652B2	NOx sensor A sensor for specifying a concentration of a predetermined gas component in a measurement gas on the basis of a current flowing in an electrolyte by decomposition of the predetermined gas component, includes an internal space; a reference gas space; a pumping cell capable of pumping out oxygen in the internal space by applying a predetermined voltage between a first electrode and a second electrode; and a measuring cell including third and fourth electrodes and measuring a current flowing when a voltage is applied between the third electrode and the fourth electrode; wherein the first electrode is formed of porous cermet consisted of a noble metal and an oxygen ion conductive solid electrolyte, and the porosity of the first electrode is greater than or equal to 10% and less than or equal to 50%.
US08197651B2	Ion-selective electrode Disclosed is an ion-selective electrode having excellent mechanical strength, excellent durability, low membrane resistance and good ion response accuracy. This ion-selective electrode comprises a response glass membrane which has ion selectivity and is made of an oxynitride glass containing Li.
US08197650B2	Silicon electrochemical sensors Described herein are substrates, sensors and systems related to measuring the concentration of an analyte such as hydrogen ion in a sample. Redox active moieties whose reduction and/or oxidation potentials are sensitive to the presence of an analyte are immobilized onto a silicon surface. Immobilized redox active moieties whose reduction and/or oxidation potential are insensitive to the analyte can be used for reference. Voltammetric measurements made using such modified silicon surfaces can accurately determine the presence and/or concentrations of analytes in a sample of interest. The silicon electrochemical sensors of the invention are robust and can be made so as not to require calibration or re-calibration.
US08197644B2	Remotely controlled decoking tool used in coke cutting operations The described system allows an operator to remotely switch between cutting and boring while removing solid carbonaceous residue from large cylindrical vessels called coke drums which typically utilize a cutting head for ejecting high pressure fluids into the coke bed; a flow diversion apparatus; and a shifting apparatus.
US08197643B2	Refining segment for pulp processing with a deflector arrangement attached at the bars surfaces A refining segment intended for refiners of disc-type for working fibrous material. A first portion has a first pattern of coarse bars and a second portion has a second pattern of fine bars. The second portion is positioned outside the first portion. The second pattern has a higher density of bars than the first pattern. The refining segment has a deflector arrangement protruding from a bar surface of the coarse bar. The bar surface faces the rotational direction. The deflector arrangement has a deflector surface directing a flow of fibrous material away from the bar surface. A refining apparatus has two opposing rotatable refining discs, separated by a refiner gap. At least one of the two refining discs has the above described patterns and deflector arrangements.
US08197642B2	Inorganic board and method for manufacturing the same An object of the present invention is to provide an inorganic board lighter in weight and excellent in strength and rigidity, and a method of producing the inorganic board. An inorganic board described in claim 1 for accomplishing the object comprises a hydraulic inorganic material, an inorganic lightweight material, a woody reinforcing material and a calcium silicate hydrate, wherein a ratio of the calcium silicate hydrate to the hydraulic inorganic material is 3-54 parts by mass: 100 parts by mass. Thus, by making an inorganic board, made of a hydraulic inorganic material, an inorganic lightweight material and a woody reinforcing material as main components, further contain a calcium silicate hydrate, an inorganic board which is lightweight and excellent in strength and rigidity can be obtained.
US08197640B2	Paper making process using cationic polyacrylamides and crosslinking compositions for use in same The present invention relates to methods for manufacturing paper or paperboard with improved strength, the methods comprising the addition of the reaction product of a cationic polyacrylamide and an aqueous aldehyde generating compound or a glyoxal releasing compound, or glyoxal itself, prepared at the mill site at high concentrations, then diluted and added into a fiber furnish prior to forming or drying of the paper or paperboard sheet.
US08197639B2	Vapour phase digester and a method for continuous cooking The system and method reduce the liquid/wood ratio at the top of a vapor phase digester in a continuous digester plant. Chips that are to be cooked in the vapor phase digester are fed as a mixture of chips and liquid at a liquid/wood ratio that exceeds 8:1 in a transfer line to an inverted top separator arranged at the top of the vapor phase digester. The top separator feeds the chips upwardly. More than 50% of the liquid content of the mixture of chips and liquid is withdrawn in the top separator and the remaining liquid is fed out from the top separator to the top of the vapor phase digester. A pile of chips and a liquid volume are established at the top, wherein the pile of chips is disposed above the liquid surface of the liquid volume.
US08197638B2	Semiconductor manufacturing device and method for manufacturing semiconductor devices Wafer contamination is prevented, while preventing damage to a high-frequency electrode and a susceptor. A main body 41 of the susceptor 40 of an MMT apparatus is composed of a heater arranging plate 42, an electrode arranging plate 48, and a supporting plate 56 all made from quartz. A circular electrode arranging hole 49 with a fixed depth is concentrically formed on the upper surface of the electrode arranging plate 48, and quadrangular pillars 50 are formed protruding in a matrix on the bottom of the electrode arranging hole 49. Multiple insertion holes 52 are formed in a disk-shaped high-frequency electrode 51, and the high-frequency electrode 51 is installed in the electrode arranging hole 49 by inserting each pillar 50 into each insertion hole 52. The gaps Sa and Sb are provided between the high-frequency electrode 51 and the electrode arranging plate 48. The pillar 50 boosts the strength of the electrode arranging plate 48. Damage to the high-frequency electrode is prevented even if the thermal expansion coefficient of the high-frequency electrode is larger than that of the electrode arranging plate, since the gaps absorb the thermal expansion differential.
US08197637B2	Semiconductor fabrication apparatuses to perform semiconductor etching and deposition processes and methods of forming semiconductor device using the same A semiconductor fabrication apparatus and a method of fabricating a semiconductor device using the same performs semiconductor etching and deposition processes at an edge of a semiconductor substrate after disposing the semiconductor substrate at a predetermined place in the semiconductor fabrication apparatus. The semiconductor fabrication apparatus has lower, middle and upper electrodes sequentially stacked. The semiconductor substrate is disposed on the middle electrode. Semiconductor etching and deposition processes are performed on the semiconductor substrate in the semiconductor fabrication apparatus. The semiconductor fabrication apparatus forms electrical fields along an edge of the middle electrode during performance of the semiconductor etching and deposition processes.
US08197633B2	Method for manufacturing an end effector assembly A method of manufacturing a jaw member of an end effector assembly for use with an electrosurgical instrument is disclosed that includes the steps of providing an electrically conductive tissue engaging plate and a jaw support; covering one side of the electrically conductive tissue engaging plate with an electrically insulative, thermally non-degrading coating; placing and securing the electrically conductive tissue engaging plate and the jaw support into a jaw mold; and introducing a liquid substance into the jaw mold and allowing the liquid substance to cure around the electrically conductive tissue engaging plate and the jaw support. Alternatively, the method includes the steps of: providing an electrically conductive tissue engaging plate and a jaw support; covering one side of the electrically conductive tissue engaging plate with an electrically insulative, thermally non-degrading coating; and securing the side of the electrically conductive tissue engaging plate onto the jaw support with an adhesive.
US08197630B2	Laser welding system for sealing or cutting polymeric sheets A laser welding system for sealing or cutting polymeric sheets is described. The system comprises a laser source capable of delivering a laser beam. The laser beam is projected onto a region of the polymeric sheets where the sealing or cutting is to be performed. An optical device is provided to image the sealing or cutting as it is performed. An image analyser asserts the sealing or cutting quality. An integrated control means is provided to control the laser source, the projection of the laser beam, the optical device and the image analyser.
US08197629B2	Method for producing polarizing plate, polarizing plate, optical film, and image display A method of the present invention for producing a polarizing plate including a polarizer and a transparent protective film provided on one side of the polarizer with an adhesive layer interposed therebetween, include the steps of: (A) irradiating at least one side of a polarizer with vacuum ultraviolet rays to treat a surface of the polarizer; (B) bonding a first transparent protective film to the side of the polarizer, which has been subjected to the surface treatment step (A), with a first adhesive layer interposed therebetween to produce a temporary polarizing plate; and (C) peeling off the first transparent protective film and a surface layer of the polarizer, which has been subjected to the surface treatment, from the temporary polarizing plate. A thin polarizing plate in which shrinkage-induced bending is reduced may be obtained by the method.
US08197627B2	Pin-type chip tooling An apparatus for use with multiple chips having multiple posts as to engage at least a portion of a surface of one of the multiple chips, a frame configured to releasably constrain each of the posts so that, when unconstrained, each individual post can contact an individual chip and, when constrained, will allow a uniform vertical force to be applied to the chips.
US08197622B2	System and method for detecting features on a laminated veneer lumber billet The disclosure relates to systems and methods for detecting features on billets of laminated veneer lumber (LVL). In some embodiments, an LVL billet is provided and passed through a scanning assembly. The scanning assembly includes an x-ray generator and an x-ray detector. The x-ray generator generates a beam of x-ray radiation and the x-ray detector measures intensity of the beam of x-ray radiation after is passes through the LVL billet. The measured intensity is then processed to create an image. Images taken according to the disclosure may then be analyzed to detect features on the LVL billet.
US08197620B2	Method for determining the sensitive or insensitive nature of a hexogen The present invention relates to a process for determining the sensitive or insensitive nature of a crystalline hexogen. Said process comprises: the formulation of said crystalline hexogen in a matrix; the analysis of a sample of said matrix charged with said crystalline hexogen by differential scanning calorimetry; said matrix consisting essentially of at least one liquid polymer that is suitable for the formulation of binders for energetic materials charged with nitro organic explosives; and of at least one adsorbent for the volatile organic compounds, which is stable at the operating temperature of the analysis and which has low affinity for water. The present invention also relates to the crystalline hexogen in such a matrix.
US08197608B2	Dishwasher featuring alternating pump operation A method for operating a dishwasher is provided, in which the dishwasher includes at least one washing container, a re-circulation pump for conveying washing fluid to at least one spray device for acting upon items to be cleaned, which are located in the washing container, a lye pump for pumping away washing liquid from the dishwasher. The method includes executing a wash program at least including partial program steps pre-wash (V1, V2), clean (R1, R2), intermediate rinse, clear rinse (K1, K2) and dry, and operating the re-circulation pump and the lye pump at least temporarily in an alternating manner during at least one of the partial program steps (V1, V2, R1, R2, K1, K2).
US08197607B2	Dishwasher comprising a filter system A dishwasher is provided having a dishwashing container and a filter system for cleaning dishwashing liquid. The filter system includes a foam volume and the filter system and the dishwashing container are communicated with one another such that at least some of the dishwashing liquid can be discharged from the dishwashing container in association with a washing cycle of the dishwashing machine to the foam volume for passage of the discharged dishwashing liquid through the foam volume. Dishwashing residue contained in the dishwashing liquid is at least partially absorbed or retained by the foam volume such that the fine-grained dirt particles can be filtered out of the dishwashing fluid, a resoiling of the dishwashing fluid or the items to be cleaned can be minimized and the dishwashing result can be improved.
US08197605B2	Use of alkanesulfonic acid as agent for cleaning cement, mortar and concrete The present invention relates to the use of at least one alkanesulfonic acid of formula R—SO3H, in which R represents a saturated, linear or branched, hydrocarbon chain containing 1 to 4 carbon atoms, as agent for cleaning cement, mortar, concrete, lime, laitance and other derived products. The invention also relates to a method of cleaning cement, mortar, concrete, lime, laitance and other derived products using at least one alkanesulfonic acid.
US08197601B2	Vaporizer, vaporization module and film forming apparatus A vaporizer (300) is formed by connecting block-shaped vaporization modules (310). Each vaporization module has a discharge opening for a liquid source material; a vaporization chamber (370) for vaporizing the liquid source material, which is discharged from the discharge opening, to create a source gas; a liquid material flow path (320) formed so as to penetrate through joint surfaces connected to other vaporization modules; and a spray nozzle communicating with a portion in the middle of the liquid material flow path and leading the liquid source material, which flows in the flow path, to the discharge opening. Each vaporization module is connected at its joint surface to each of the other vaporization modules to cause the liquid material flow paths of all the vaporization modules to communicate with one another. When various flow rates ranging from low to high levels is required, the structure of the evaporator can be easily changed according to such rates without a reduction in evaporation efficiency.
US08197598B2	Method for manufacturing iron silicide nano-wires A method for making iron silicide nano-wires comprises the following steps. Firstly, providing a growing substrate and a growing device, the growing device comprising a heating apparatus and a reacting room. Secondly, placing the growing substrate and a quantity of iron powder into the reacting room. Thirdly, introducing a silicon-containing gas into the reacting room. Finally, heating the reacting room to a temperature of 600˜1200° C.
US08197596B2	Crystal growth method and reactor design A crystal growth process comprising providing a reactor having a crucible with an injector apparatus and a seed holder. The injector apparatus has an inner gas conduit and an outer gas conduit wherein an inert gas is introduced into the outer conduit. The injector apparatus has an upper injector and a lower injector and a gap therebetween. The upper injector temperature is maintained at a higher temperature than the lower injector.
US08197595B2	Method and device for producing thin silicon rods A method for producing thin silicon rods using a floating zone crystallization process includes supplying high frequency (HF) current to a flat induction coil having a central opening, a plurality of draw openings and a plate with a slot as a current supply of the HF current so as to provide a circumfluent current to the central opening. An upper end of a raw silicon rod is heated by induction using the flat induction coil so as to form a melt pool. A thin silicon rod is drawn upwards through each of the plurality of draw openings in the flat induction coil from the melt pool without drawing a thin silicon rod through the central opening having the circumfluent current.
US08197594B2	Silicon wafer for semiconductor and manufacturing method thereof Silicon wafers having a density of BMDs with sizes between 20 to 40 nm at positions ≧20 μm below the wafer surface in the range of 5×1011/cm3, and a density of BMDs with sizes of ≧300 nm≦1×107/cm3, exhibit reduced slip dislocation and warpage. The wafers are sliced from a crystal grown under specific conditions and then subjected to both low temperature heat-treatment and high temperature anneal.
US08197592B2	Crystal forms of quinacridones made from 2,9-dimethoxyquinacridone and 2,9-dichloroquinacridone Novel crystal forms of solid solutions of 2,9-dimethyoxyquinacridone and 2,9-dichloroquinacridone. The crystal forms may be formed by a process comprising the steps of: a) heating a mixture of 2,5-di(4-methoxyanilino)terephthalic acid, and 2,5-di(4-chloroanilino)terephthalic acid in polyphorsphoric acid at a temperature less than 1050 C to form a mixture of 2,9-dimethoxyquinacridone and 2,9-dichloroquinacridone; b) combining the mixture of 2,9-dimethoxyquinacridone and 2,9-dichloroquinacridone with water; and c) heating the mixture of 2,9-dimethoxyquinacridone and 2,9-dichloroquinacridone at a temperature not more than 110° C. Another crystal form may be formed by the process of heating a mixture of 2,9-dimethoxyquinacridone and 2,9-dichloroquinacridone in a polar aprotic solvent. These products are may be used for coloring fibers, plastics, paints, coatings, printing inks, color filters, cosmetics, automotive coatings, textiles, fibers, powder coatings, in-mold coatings, laminate films, and the like.
US08197591B2	Pearlescent pigments having a secondary coating comprising α-silanes and method for the production thereof The invention relates to a pearlescent pigment comprising a metal oxide-containing, platelet-shaped substrate and having a first and a second protective layer, wherein the metal oxide has a refractive index greater than 1.8, and in which the first protective layer comprises cerium oxide and/or hydrated cerium oxide and/or cerium hydroxide, the second protective layer consists substantially, preferably completely, of SiO2, wherein the second protective layer is disposed on top of the first protective layer, and between the first and second protective layers there can be disposed metal oxide layers which differ from cerium oxide and/or hydrated cerium oxide and/or cerium hydroxide and SiO2, wherein the second protective layer has an organochemical aftercoat and the organochemical aftercoat comprises at least one silane bonded to the second protective layer by means of at least one oxygen atom, said α-silane having the formula —O(4-n-m)—Si(—R1)m(—CH2—Y)n (I), in which 1≦n+m≦3; m=0 to 2; n=1 to 3 and R1 is a hydrogen atom or an Si—C-bonded C1-C20-hydrocarbon radical or a C1-C15-hydrocarbonoxy radical, in which in each case one or more methylene units not adjacent to one another can be replaced by the groups —O—, —CO—, —COO—, —OCO—, or —OCOO—, —S—, or —NRx— and in which one or more methine units not adjacent to one another can be replaced by the groups —N═, —N═N—, or —P═, wherein R1 can independently be the same or different, Rx can be a hydrogen atom or a linear, branched and/or cyclic C1-C15-hydrocarbon radical or aryl radical, and Y is a functional binding group reactive with a binder system.
US08197590B2	Fluorine-containing treatment composition Disclosed is a composition containing a fluorine-containing urethane compound (A) and a fluorine-containing polymer (B) having a repeating unit derived from a fluorine-containing monomer represented by the following formula (I): CH2═C(—X)—C(═O)-A-Rf (I) (wherein X represents a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a CFX1X2 group (wherein X1 and X2 respectively represent a hydrogen atom, a fluorine atom or a chlorine atom), a cyano group, a straight or branched chain fluoroalkyl group having 1-20 carbon atoms, a substituted or unsubstituted benzyl group, or a substituted or unsubstituted phenyl group; A represents a divalent group; and Rf represents a straight or branched chain perfluoroalkyl group having 1-6 carbon atoms).
US08197589B2	Use of a (1>3)-β-D-glucan as an emulsion stabiliser The present invention relates to the use of a (1→3)-β-D-glucan as an emulsion stabilizer. The present invention further relates to emulsions comprising a (1→3)-β-D-glucan in an amount of 0.01 to 10 wt. %, based on the total weight of the emulsion. The present invention also relates to bitumen binder compositions comprising a (1→3)-β-D-glucan in an amount of 0.005 to less than 0.1 wt. %, based on the total weight of the bitumen binder composition. The present invention further relates to emulsions comprising a novel biodegradable emulsifying agent, in particular in combination with a (1→3)-β-D-glucan.
US08197581B2	Self-regulating bio-gas treatment system A self-regenerating bio-gas treatment system that uses the bio-gas instead of atmospheric are as media transport between adsorber and desorber tanks. Each tank includes at least four horizontally stacked and evenly spaced apart, perforated trays each capable being filled with fluidized carbon which migrates downward in the adsorber tank to remove contaminants from the bio-gas. With the bio-gas function as its media transport, the carbon media continuously moves downward over the perforated trays and eventually collected in the bottom of the adsorber tank. The spent carbon is then delivered to the desorber tank. The desorber tank is filled with an inert gas produced by an inert gas generator which causes the carbon media to be regenerated. The inert gas strips the carbon media of contaminates and is then delivered to a ground flare. The carbon media is returned to the adsorber tank and re-used to treat bio-gas. A plurality of heat exchangers, blowers, valves and interconnecting conduits keep the bio-gas, the inert gas, and the carbon media continuously flowing through the system thereby enabling the system to be used at different sizes of landfills or treatment plants.
US08197579B2	Gas storage and release using piezoelectric materials Embodiments are described that generally relate to the storage and release of a gas using piezoelectric materials.
US08197577B2	System and method for underwater oil and gas separator A passive hydrocarbon containment system for containing hydrocarbons in a fluid comprises a subsea separator dome, an oil pathway in fluid communication with a hydrocarbon collector disposed within the collection dome, and a gas outlet pipe having a discharge height dimensioned and adapted in relation to the height of the oil pathway sufficient to keep a portion of the oil pathway submerged into a fluid such as seawater present in the collection dome interior void. The hydrocarbon containment system can be moored subsea and used to collect oil and gas coming out of the ocean floor. One advantage of the hydrocarbon containment system is that there are no moving parts. A further advantage is that the hydrocarbon containment system requires limited maintenance to pump out the collected oil as needed.
US08197576B2	CO2-facilitated transport membrane and method for producing the same A CO2-facilitated transport membrane of excellent carbon dioxide permeability and CO2/H2 selectivity, which can be applied to a CO2 permeable membrane reactor, is stably provided. The CO2-facilitated transport membrane is formed such that a gel layer 1 obtained by adding cesium carbonate to a polyvinyl alcohol-polyacrylic acid copolymer gel membrane is supported by a hydrophilic porous membrane 2. More preferably, a gel layer supported by a hydrophilic porous membrane 2 is coated with hydrophilic porous membranes 3 and 4.
US08197575B2	Laterite heap leaching with ferrous lixiviants A process for heap leaching a laterite that includes providing a primary and a secondary heap, with the primary heap comprising predominantly a nickel and cobalt containing sulfide or saprolitic type ore, and the secondary heap comprising predominantly a nickel and cobalt limonitic type ore; leaching the primary heap with a sulfuric acid solution to generate a solution that includes ferrous ions; and using the solution that includes the ferrous ion as the lixiviant to leach the secondary heap, to produce a pregnant leach solution that includes nickel, cobalt and manganese ions.
US08197573B2	Method and apparatus for depositing agents upon and within bio-char Methods and apparatuses for depositing agents relatively deep within pores of bio-char. Bio-char is first produced in an airtight oven by heating biomass feedstock. The bio-char is then cooled and steam is diffused into the pores of the bio-char. The steam-laden bio-char is immersed in a liquid bath containing soluble agents that are to be deposited in the pores of the bio-char. The liquid bath cools the char to below the condensation temperature of the steam, whereupon the condensing steam generates a partial vacuum within the pores, drawing the liquid into the pores. The bio-char is then removed from the liquid bath and dried so that the liquid within the pores evaporates, leaving behind the soluble agent. Accordingly, the invention yields bio-char that has soluble agent embedded relatively deep within its pores.
US08197570B2	Canister air filter and method for fabricating the same Embodiments for a filter and method for fabricating the same are provide herein. In one embodiment, a filter is provided that includes a first end cap, a second end cap, at least a first filtration media element and at least a first brace. The first end cap has an air flow aperture formed therethrough. The first and second end caps define a central axis. The first filtration media element is coupled to the first and second end caps and has an orientation curved around the central axis. The brace separates a first closed edge of the filtration media element from a second closed edge of the filtration media element.
US08197566B2	Gasifier additives for improved refractory life Embodiments disclosed herein provide hydrocarbon additives and methods of making and using the same. The additives are suitable for use in conjunction with gasifiers, furnaces, or other high-temperature vessels. The additives may be part of an input stream to a reaction vessel of a hydrocarbon gasifier. The additives may include materials that at least partially reduce the infiltration of slag into the refractory material.
US08197564B2	Method and apparatus for cooling syngas within a gasifier system A method of assembling a synthesis gas (syngas) cooler for a gasification system includes positioning a dip tube within a shell of the syngas cooler. The dip tube is configured to quench the syngas flowing through the shell and/or at least partially channel the syngas through the dip tube. The method also includes coupling an isolation tube to the dip tube such that the isolation tube is substantially concentrically aligned with, and radially outward of, the dip tube. The isolation tube is coupled in flow communication with a purge gas source and is configured to at least partially form a dynamic pressure seal. The method further includes coupling at least one of the isolation tube and the dip tube in fluid communication with a fluid retention chamber. The method also include at least partially filling the fluid retention chamber with fluid, thereby further forming the dynamic pressure seal.
US08197563B2	Fuel reformer A fuel reformer, includes: a reformer burner, which generates a flame in a reforming pipe disposed to surround at least the flame of the reformer burner, the reforming pipe being filled with a reforming catalyst and having corrugated portions on a surface facing the reformer burner and a bottom surface of the reforming pipe disposed adjacent to the flame in which a flame blocking member is disposed between the flame of the reformer burner and the reforming pipe to isolate the flame of the reformer burner from the reforming pipe.
US08197561B2	Process for drying coal A process for drying coal is provided in which coal is passed into a fluidized bed reactor and heated to a predetermined temperature. The dried coal is then fed to a cooler where the temperature of the product is reduced to approximately 200 degrees Fahrenheit and water is added to further passivate the coal.
US08197560B2	Fuel for fuel cell, fuel cartridge for fuel cell and fuel cell Disclosed is a fuel for fuel cells which contains at least one organic compound selected from the group consisting of methanol, ethanol, dimethyl ether and formic acid, and 1-200 ppm of a hydrocarbon compound in terms of a single component as determined by gas chromatography mass spectrometry. Also disclosed are a fuel cartridge for fuel cells and a fuel cell.
US08197558B2	Supercritical diesel fuel composition, combustion process and fuel system An embodiment of the invention is a composition of diesel, biodiesel or blended fuel (DF) with exhaust gas (EG) mixtures or with liquid CO2. The composition is in a liquid state near the supercritical region or a supercritical fluid mixture such that it quasi-instantaneously diffuses into the compressed and hot air as a single and homogeneous supercritical phase upon injection in a combustion chamber. Suitable temperatures and pressures are greater than about 300° C. and 100 bar, and the mole fraction of EG or CO2 (XEG or XCO2) in DF is in the range of 0.0-0.9. In a combustion process embodiment, composition embodiments are injected into a combustion chamber under supercritical conditions.
US08197556B2	Method for producing positive electrode for non-aqueous electrolyte secondary cell and method for producing non-aqueous electrolyte secondary cell A method for producing a non-aqueous electrolyte secondary cell by preparing a positive electrode by applying a positive electrode mixture onto a positive electrode core material, the mixture containing a positive electrode active material mainly made of a lithium nickel composite oxide and a binding agent containing polyvinylidene fluoride; measuring the amount of carbon dioxide gas generated when a layer of the positive electrode mixture is removed out of the positive electrode and the layer is heated to 200° C. or higher and 400° C. or lower in an inactive gas atmosphere; selecting a positive electrode satisfying the following formulas: y<(1.31x−258)/1000000(200≦x<300) formula 3 y<1.20x−225/1000000(300≦x≦400) formula 4 where x is a heating temperature (° C.) and y is the amount of carbon dioxide gas (mole/g) per 1 g of the lithium nickel composite oxide measured; and preparing the non-aqueous electrolyte secondary cell by using the positive electrode selected.
US08197554B2	Rotary actuator arrangement A rotary actuator comprises a motor, gearing connected for driving by the motor, an output drive member and bearings for carrying the output drive member, wherein the gearing comprises wave generator gearing and the gearing is at least partially located radially within the bearings. In addition, an artificial limb member comprises an actuator to effect movement of the limb member, wherein the actuator comprises a motor connected to wave generator gearing.
US08197552B2	Eustachian tube device and method Devices are provided for insertion into a Eustachian tube of an animal, e.g., a human being. The devices include an insertable member. The member has opposing surfaces and is formed at least in part from a biocompatible material that is degradable. The device may comprise a hole that is effective to provide sufficient fluid communication between the opposing surfaces of the insertable member to effect pressure equilibration therebetween. The device is able to be immobilized within the Eustachian tube for a predetermined period. Also provided are kits that include the device and methods for inserting the device into a Eustachian tube.
US08197551B2	Systems for inducing fluid flow to stimulate tissue growth Provided are apparatuses, systems, and methods for treating tissue at a tissue site in a mammal that includes a scaffold adapted to be disposed adjacent to the tissue site and to be fluidly coupled to a blood vessel of the mammal for receiving blood therefrom. Additionally, a scaffold is provided that includes a charged surface comprising a streaming potential.
US08197548B2	Disk fusion implant An implant strip is disclosed. In some cases, the prosthesis can take the form of an implant strip that may be implanted through the use of a surgical procedure that minimizes incision sizes and may be considered less invasive than typical spinal implant procedures. The implant strip includes provisions for implantation, including teeth, spacing provisions and various shapes.
US08197544B1	Method for distracting opposing vertebral bodies of a spine A system and method is provided for distracting opposite surfaces from the interior of a bone, such as a vertebral body. A working channel cannula provides a working channel through which an inserter and an injection cannula can simultaneously pass. The inserter transports a plurality of wafers into the interior of the bone to form a load-bearing stack bearing against the opposite surfaces. The injection cannula is used to inject a fluent material into and/or around the stack. In certain embodiments, the fluent material is a load-bearing or hardenable material, such as bone cement. In other embodiments, the fluent material can be a BMP, HAP, or other osteo-inductive, osteo-conductive, or pharmaceutical compositions. A syringe containing the fluent material is engaged to the injection cannula and is operable to inject the fluent material into the vertebral body under controlled pressure.
US08197543B2	Spinal prostheses A spinal prosthesis has a prosthetic vertebral body in the form of a hollow cylinder (1) with perforated wall and attached prosthetic intervertebral discs formed by springs (7,8) molded into silicone-rubber beads (9,10). Anchoring of the cylinder (1) to the damaged vertebra (II) is by means of entrapment of an elongate lug (12) of the cylinder 1 within a slot (16) of a plate (11) retained by screws (12) within a recess (13) of the damaged vertebra (II). The springs (7,8) of the resilient beads (9,10) are attached to the natural vertebrae (I,III) superior and inferior to the damaged vertebra (II) by fixing plates (3,4) which have flanges (20,21) that are held by screws (22) to those vertebrae (I,III). Where adjoining vertebrae are damaged, two or more prosthetic cylinders (1) for anchoring to the individual vertebra are used with interconnecting resilient beads (9;10).
US08197542B2	Self supporting implant in a human body and method for making the same without capsular contracture A self supporting breast implant includes a generally cone shaped partially absorbable medical mesh support member and a silicone shell defining a hollow core that is preferably filled or partially filled with a silicone gel. The support member is made of a polypropolene/poliglecaprone monofilament and may be attached to a patient's tissue by sutures or by absorbable hooks. A textured outer surface or shell is formed around the relatively smooth implant or inner shell and the inner shell is reduced in size to provide a small space between the inner shell and the outer shell to eliminate or at least minimize the adverse effects of capsular contraction.
US08197541B2	Accommodative lens implant, controlled by the ciliary muscle The invention relates to an accommodative lens implant controlled by the ciliary muscle, consisting of at least one or more lenses made of preferably biocompatible material and disposed on a common optical axis, the at least one lens being a component of a flexible, closed implant body that is transparent in the region of the actual lens, is engaged at its outer periphery with the ciliary muscle, and has a main axis that coincides with the visual axis, and in addition at least part of the implant body with the lens or lenses comprises a fluid filling, such that the axial position of the lens or the lens system can be altered by activation of the ciliary muscle, the implant body being inserted in the sulcus of the posterior chamber of the eye or attached to the ciliary muscle.
US08197540B2	Ocular implant iris diaphragm An ocular implant alters iris color for medical and cosmetic purposes and is made of an inert, nontoxic, foldable and preferably permeable to fluid flow material. It is an annular non-planar structure that fits over the iris yet leaves the natural lens uncovered and extends approximately to the iridocorneal angle. Two different kinds of arc sections of a non-uniform thickness make up the structure: passage arc sections and support arc sections. The passage arc sections permit humor aqueous flow under the implant. The support arc sections make contact with the iris and provide the necessary support for the passage arc sections. Auricles extend from the support arc sections and are configured to hold the implant in place by engaging the eye at the iridocorneal angle. The implant may include an artificial lens and preferably spurs on the support arc sections to anchor for the artificial lens.
US08197532B2	Intraluminal stent graft A method of making a tubular intraluminal graft in the form of a tubular diametrically adjustable stent having a tubular covering of porous expanded polytetrafluoroethylene which is less than 0.10 mm thick. The covering may be on the exterior surface of the stent, or on the interior surface of the stent, or both. The covering may be affixed to the stent by an adhesive which is preferably fluorinated ethylene propylene.
US08197530B2	Intraluminal stent graft A method of making a tubular intraluminal graft in the form of a tubular diametrically adjustable stent having a tubular covering of porous expanded PTFE which is less than 0.10 mm thick. The covering may be on the exterior surface of the stent, or on the interior surface of the stent, or both. The covering may be affixed to the stent by an adhesive which is preferably fluorinated ethylene propylene.
US08197527B2	Expandable implant devices for filtering blood flow from atrial appendages Implant devices for filtering blood flowing through the ostium of an atrial appendage have component structures one or more of which are expandable. Devices with component structures in their unexpanded state have a compact size suitable for intra-cutaneous delivery to an atrial appendage situs. The expandable component structures are expanded in situ to deploy the devices. A device may have sufficiently short axial length so that most or almost all of the device length may fit within the ostium region. An expandable component structure in the device may include a blood-permeable filter element. The device may be deployed so that this component structure covers the ostium so as to direct the blood flow to pass through the filter element. The filter elements used in the devices may have hole size distributions selected to filter out harmful-size emboli. The filter elements may be embedded in elastic material so that hole-size distributions remain substantially unaffected by expansion of the device structures. Anchors attached to a component structure engage tissue surrounding the device and maintain the devices in position. The anchors may include inflatable anchors which engage interior walls of the atrial appendage.
US08197526B2	Warming tool A warming article having a heat generating main body (4). The heat generating main body (4) is composed of a heat generating element (2) having water vapor generating capability and an air permeable holder (3) for holding the heat generating element (2). The heat generating main body (4) is configured to expand with heat generation of the heat generating element (2). The amount of water vapor generated from the warming article is preferably 1.0 to 100 mg/(cm2·10 min). The holder (3) preferably has a water vapor permeability of 1.5 to 10 kg/(m2·24 hr). The heat generating element (2) is preferably a sheet molded by papermaking and containing an oxidizable metal, a moisture-retaining agent, and a fibrous material.
US08197514B2	Implant for mutual support of the spinous processes of vertebral bodies An implant includes two implant components, each having at least two adjacent support arms, which are connected to one another at one end by means of a bridge and can be spread apart at their free ends, and at least one of which support arms forms a support surface, such that with the free ends of their support arms both implant components are directed towards the free ends of the support arms of the respective other implant component, and that both implant components have slide faces for the support arms of the respective other implant component which are arranged and shaped such that as the two implant components approach one another, the support arms slide on the slide faces of the respective other implant component, and are pivoted thereby, so that the spacing of the upper and lower support surfaces is thereby increased.
US08197512B1	System and method for spine stabilization using resilient inserts An apparatus for anchoring a rod to a bone fastener in a spine stabilization system. A first resilient insert may have two deflectable arms and a first channel formed therein. A second resilient insert may have two deflectable arms and a second channel formed therein. A cylindrical body may have a passage, wherein the first resilient insert and the second resilient insert have a width greater than the inner diameter of the cylindrical body when the first resilient insert is in a neutral state. Advancement of the first resilient insert or the second resilient insert into the passage deflects the two deflectable arms inward, causing the width of the first or second channel to decrease, and inhibiting the first resilient insert or the second resilient insert from moving relative to the cylindrical body.
US08197511B2	Suture anchor having a suture engaging structure and inserter arrangement A suture anchor and inserter arrangement, including a suture anchor for implanting in hard tissue, such as bone, and an inserter device for installing the suture anchor in hard tissue. The suture anchor carries thereon a suture-engaging structure formed from suture, which structure cooperates with working suture associated with the inserter device so as to attach the working suture to the suture anchor.
US08197507B2	Sutureless methods for laceration closure Tissue lacerations are closed using a vacuum cup applied to the tissue surface having a tissue-abutting, optically transparent mesh surface that under vacuum conforms with the tissue surface, apposing edges of the wound, and is optionally loaded with a bandage comprising a chitosan film and a collagen backing. An eye tissue surface wound is closed without sutures by closing the wound with a bioadhesive, biocompatible sclera or cornea wound patch comprising a chitosan film and a collagen backing, wherein the backing is bonded to the film without adhesive and protects the film against dissociation when the patch is exposed to a physiological fluid, and the film adheres to the sclera sufficient to retain apposed edges of the wound.
US08197504B2	Safe tissue puncture device A method for safely penetrating the tissue of a gastric wall includes deploying a tissue puncture assembly including a suction device proximate the gastric wall tissue, applying a vacuum source to the suction device to draw a portion of the gastric wall tissue thereto and extending a needle through the portion of gastric wall tissue drawn into contact with the suction device. A device for safely penetrating the tissue of a gastric wall includes a tissue puncture assembly including a suction device in the form of a cup with suction ports therein and an open end. A needle is surrounded by the cup and extends through the cup toward the open end.
US08197503B2	Side loading lancing device A lancing device including a rail having opposed side surfaces, a lancet that is receivable on the rail, and a firing mechanism configured to propel the lancet. The lancet has a sharp tip and a body configured to engage the opposed side surfaces of the rail.
US08197502B2	Method of maintaining constant movement of a cutting blade on an ultrasonic waveguide A method of maintaining a constant movement of a cutting blade of an ultrasonic waveguide includes providing an ultrasonic transducer operable to convert a received motional current into a movement of a cutting blade of an ultrasonic waveguide, a measurement circuit connected in a parallel configuration with the ultrasonic transducer, and a variable power source operable to supply current through a set of connection points to the parallel configuration and thereby create the motional current in the ultrasonic transducer. Current is supplied through a set of connection points of the parallel configuration with the variable power source to, thereby, create the motional current in the ultrasonic transducer and the motional current is regulated with a current controller by varying an output of the power source, thereby maintaining a substantially constant rate of movement of the cutting blade across a variety of cutting loads.
US08197500B2	Biological membrane-carrying aneurysm clip An aneurysm clip has a biological membrane and a metal clip. The membrane is harvested from an animal, crosslinked, and then has its antigens minimized. The membrane also has an active layer coupled thereto. The metal clip has a first clip bar and a second clip bar that are attached to each in a biased manner, a first clip arm that extends perpendicularly from the second clip bar, and a second clip arm that extends perpendicularly from the first clip bar. A first end of the biological membrane is coupled to the first clip arm, and a second end of the biological membrane is coupled to the second clip arm in a manner that defines a receiving portion.
US08197496B2	Method of closing an opening in a wall of the heart Disclosed is a closure catheter, for closing a tissue opening such as an atrial septal defect, patent foreman ovale, or the left atrial appendage of the heart. The closure catheter carries a plurality of tissue anchors, which may be deployed into tissue surrounding the opening, and used to draw the opening closed. Methods are also disclosed.
US08197488B2	Automatic locking casper distractor A vertebral distractor system includes a crossbar and a first distractor arm having a first end portion coupled to the crossbar and a second end portion with a first bore configured to axially receive a first coupling portion of a first pin. A second distractor arm includes a third end portion coupled to the crossbar and a fourth end portion with a second bore configured to receive a second coupling portion of a second pin. A first pin locking mechanism is configured to couple the first coupling portion and the first distractor arm within the first bore such that when the first coupling portion and the first distractor arm are coupled, movement of the first pin outwardly of the first bore is not allowed.
US08197485B2	Graft ligament strand tensioner A graft ligament strand tensioner is provided. The tensioner includes a body, a pair of suture rails connected to the body and a handle pivotally connected to the body. Each suture rail comprises a grooved outer channel for receiving a suture loop and a central mandrel for receiving a suture loop. The handle is pivotally connected to the body such that the handle can be pivoted relative to a longitudinal axis of the body only when the handle is under tension.
US08197479B2	Vessel sealer and divider An endoscopic bipolar forceps includes a housing and a shaft, the shaft having an end effector assembly at a distal end thereof, which includes two jaw members for grasping tissue therebetween. Each jaw member is adapted to connect to an electrosurgical energy source, enabling them to affect a tissue seal to tissue held therebetween. A drive assembly is included within the housing for moving the jaw members. A movable handle is also included, such that movement of the handle actuates the drive assembly to move the jaw members relative to each other. A knife channel is included within the end effector configured to allow reciprocation of a knife blade within the knife channel. The knife blade includes a proximal edge adapted to engage a proximal edge of the end effector to impede translation of the knife blade when the jaw members are in an open configuration and the knife blade is retracted within the end effector assembly.
US08197477B2	Tissue ablation methods Tissue is treated using a radiofrequency power supply connected to an applicator having a chamber filled with an electrically non-conductive gas surrounded by a thin dielectric wall. A radiofrequency voltage is applied at a level sufficient to ionize the gas into a plasma and to capacitively couple the ionized plasma with the tissue to deliver radiofrequency current to ablate or otherwise treat the tissue.
US08197473B2	Leaky-wave antennas for medical applications A device for directing energy to a target volume of tissue includes an inner conductor having a length and an outer conductor coaxially surrounding the inner conductor along the length. The outer conductor has a proximal portion and a distal portion. The distal portion of the outer conductor is provided with a number of apertures N defined therein for radiating energy, where N is an integer greater than 1, each aperture having a size and extending at an angle relative to a longitudinal axis of the outer conductor. At least one of the size and the angle of each aperture is varied in relation to the other apertures N−1 such that the energy radiated along the distal portion is substantially uniform.
US08197472B2	Tissue welding and cutting apparatus and method A surgical apparatus and methods for severing and welding tissue, in particular blood vessels. The apparatus includes an elongated shaft having a pair of relatively movable jaws at a distal end thereof. A first heating element on one of the jaws is adapted to heat up to a first temperature and form a welded region within the tissue, while a second heating element on one of the jaws is adapted to heat up to a second temperature and sever the tissue within the welded region. The first and second heating elements may be provided on the same or opposite jaws. A control handle provided on the proximal end of the elongated shaft includes controls for opening and closing the jaws, and may include an actuator for sending current through the first and second heating elements. The first and second heating elements may be electrically connected in series, and the first heating element may be bifurcated such that it conducts about one half of the current as the second heating element. A force-limiting mechanism provided either within the control handle, in the elongated shaft, or at the jaws limits the pressure applied to the tissue by the jaws to ensure that the tissue is severed and the ends effectively welded within a short amount of time.
US08197468B2	Surgical instrument handle with adjustable actuator position A surgical instrument handle is removably attachable to a surgical instrument head for operation of a microsurgical instrument on the head by manipulation of the instrument handle. The instrument handle has an elongate center rod with a piston mounted on the rod for reciprocating movement. The piston engages with a piston in the attached surgical instrument head for operation of the microsurgical instrument of the head. A tapered ring is mounted on the rod and engages with the piston for reciprocating the piston. A plurality of resilient arms extend along the length of the rod and engage against a sliding surface of the ring. The plurality of resilient arms are alternatively squeezed radially inwardly by the surgeon's hand and released by the surgeon's hand to allow the resilient arms to flex radially outwardly. The inward and outward movement of the plurality of arms reciprocates the piston on the handle rod to cause operation of the surgical instrument head. The radial position of the resilient arms relative to the handle is adjustable as desired by the surgeon.
US08197467B2	Modular, reduced-pressure, wound-closure systems and methods A modular, reduced-pressure, wound-closure system for providing a closing force on a surface would includes a flexible strap operable to be formed into a closed loop inbound and around the surface wound and a plurality of modular closing members coupled to the flexible strap. A reduced-pressure source is fluidly coupled to the plurality of modular closing members. The modular closing members are operable to generate a closing force on the surface wound. A portion of the modular closing members are releasably attached to the patient's epidermis proximate the surface wound and another portion are attached to the flexible strap. A reduced pressure from the reduced-pressure source is delivered to each modular closing member to generate the closing force on the surface wound. Methods and other systems are presented.
US08197463B2	Adjustable double balloon catheter with a through lumen for stone management A method for removing an object from a body lumen includes dispensing fluid into the body lumen, and causing the dispensed fluid to propel the object along the body lumen. A device for removing an object from a body lumen includes a fluid dispenser for dispensing fluid into the body lumen, and a pump in fluid communication with the dispenser.
US08197461B1	Controlled release system for delivering therapeutic agents into the inner ear A specialized drug delivery unit for inner ear treatment which employs a portion of carrier media material containing one or more therapeutic agents therein. The carrier media material is designed to release the therapeutic agents in a controlled manner over time. The drug delivery unit is sized for placement in the round window niche of a patient. The released therapeutic agents come in contact with the round window membrane and pass therethrough into the inner ear for treatment purposes. This system provides many benefits ranging from the ability to deliver drugs in a site specific, highly controlled manner to the transfer of such materials with minimal patient discomfort and monitoring requirements.
US08197458B2	Seam joining together at least two web materials A seam joining together at least two web materials in an overlapped manner, wherein the overlapped portions are bonded together by ultrasonic welding, heat bonding, laser welding or the like, in a bonding pattern extending over at least a part of the overlapped portion to form said seam. The bonding pattern has a main bonding pattern extending in longitudinal direction along at least a part of the overlapped portion, and at least one edge bonding pattern extending in longitudinal direction along at least a part of along and adjacent at least one side edge of the overlapped portion, the bonded area of said edge bonding pattern occupying no more than 30% of the total bonded area of the central bonding pattern plus the bonded area of the edge bonding pattern. The seam may be present in a personal care absorbent article.
US08197457B2	Disposable wearing article A disposable wearing article has an elasticized first band lying in a front half of a crotch region and attached to distal zones of a pair of leak-barrier sheets provided on a body side of the article and an elasticized second band lying in a rear half of the crotch region and attached to the distal zones. A dimension by which distal edge segments of the distal zones extending forward from the first band in a longitudinal direction are spaced from each other is gradually enlarged from the side of the first band toward the side of a front waist region.
US08197453B2	Catheter having increased curve performance through heat treatment The present invention includes catheters and catheter shafts having a curved portion, for example, a curved distal portion. The curved distal portion may be formed by subjecting the distal portion, which might include one or more polymeric segments or layers, to heat at or above the melt temperature thereof. Heating at or above the melt temperature may reduce residual stress and eliminate heat history.
US08197452B2	Vascular access device non-adhering surfaces A vascular access device may include a body and a layer of the body that communicates with a pathogenic environment to discourage adhesion of a pathogen to the layer and thus repress pathogenic activity. A method of repressing pathogenic activity in a vascular access device includes providing the device with a body, and coating the body with a layer that discourages adhesion of a pathogen to the layer.
US08197449B2	Injection device comprising an optical sensor The present invention relates to an injection device comprising an optically-based sensor for determining the position or setting of a dose setting member arranged to set a dose to be injected from the injection device. In particular, the present invention relates to an injection device comprising a rotatably mounted member having a plurality of optically coded paths arranged on an outer surface thereof. The rotatably mounted member is operatively connected to the dose setting member and is adapted to rotate with the dose setting member.
US08197445B2	Pain management dispenser A dispensing device for dispensing pain management medicaments to a patient comprising first and second threadably interconnectable sub-assemblies. The first of these sub-assemblies houses a novel collapsible fluid reservoir defining component while the second comprises a fluid delivery and control assembly that includes a novel flow control means that functions to control the flow of medicinal fluid from the fluid reservoir of the collapsible reservoir defining component toward the patient via a plurality of fluid flow control passageways.
US08197437B2	Systems and methods of modeling pharmaceutical propagation in a patient An injection system includes an injector for injecting a fluid into a patient and a controller in operative communication with the injector for control thereof. The controller controls a diagnostic injection of the fluid based upon at least one mathematical model individualized to the patient. The model(s) are determined by collecting data corresponding to a time response curve resulting from at least one test injection of the fluid into the patient. The time response curve represents a response of a region of interest of the patient over time due to the fluid passing therethrough. An imaging system having such an injection system is also disclosed, as is a system for effecting a medical procedure. A method of delivering such a fluid to a patient using such an injection system is also disclosed, as is a method of modeling propagation of such a fluid in a patient.
US08197435B2	Methods and devices for drug delivery to ocular tissue using microneedle Methods and devices are provided for targeted administration of a drug to a patient's eye. In one embodiment, the method includes inserting a hollow microneedle into the sclera of the eye at an insertion site and infusing a fluid drug formulation through the inserted microneedle and into the suprachoroidal space of the eye, wherein the infused fluid drug formulation flows within the suprachoroidal space away from the insertion site during the infusion. The fluid drug formulation may flow circumferentially toward the retinochoroidal tissue, macula, and optic nerve in the posterior segment of the eye.
US08197433B2	Ear tubes The invention provides a flexible ear tube (10) for draining and ventilating the middle ear, the tube (10) having a flexible substantially tubular stem (12) with a lumen (14), the stem (12) being sized to be inserted through an incision in the eardrum (16) and the tube having at least two separate flexible contact surfaces (18) extending from the stem (12) and adapted to engage different spaced-apart inner surfaces of the eardrum 16, each of the contact surfaces (18) having a first axis XX extending substantially perpendicularly to the central axis of the stem and a second axis YY extending substantially perpendicularly to the first axis wherein one of the axes is between 0.6 and 3 mm and the second of the axes is between 1 and 7 mm in length.
US08197430B1	Method and system to remove cytokine inhibitor in patients A method to treat cancer uses ultrapheresis, refined to remove compounds of less than 120,000 daltons molecular weight, followed by administration of replacement fluid, to stimulate the patient's immune system to attack solid tumors. In the preferred embodiment, the patient is ultrapheresed using a capillary tube ultrafilter having a pore size of 0.02 to 0.05 microns, with a molecular weight cutoff of 120,000 daltons, sufficient to filter one blood volume. The preferred replacement fluid is ultrapheresed normal plasma. The patient is preferably treated daily for three weeks, diagnostic tests conducted to verify that there has been shrinkage of the tumors, then the treatment regime is repeated. The treatment is preferably combined with an alternative therapy, for example, treatment with an anti-angiogenic compound, one or more cytokines such as TNF, gamma interferon, or IL-2, or a procoagulant compound. The treatment increases endogenous, local levels of cytokines, such as TNF. This provides a basis for an improved effect when combined with any treatment that enhances cytokine activity against the tumors, for example, treatments using alkylating agents, doxyrubicin, carboplatinum, cisplatinum, and taxol. Alternatively, the ultrapheresis treatment can be combined with local chemotherapy, systemic chemotherapy, and/or radiation.
US08197421B2	Method and apparatus for penetrating tissue A body fluid sampling system for use on a tissue site includes a single drive force generator. A plurality of penetrating members are operatively coupled to the force generator. The force generator moves each of the members along a path out of a housing with a penetrating member exit, into the tissue site, stops in the tissue site, and withdraws out of the tissue site. A flexible support member couples the penetrating members to define a linear array. The support member is movable and configured to move each of the penetrating members to a launch position associated with the force generator.
US08197414B2	Systems and methods for measuring arterial stiffness Disclosed herein is a system for monitoring a patient that includes a cuff configured to inflate to at least partially occlude an artery of the patient and a cuff controller configured to control inflation and deflation of the cuff. The system also includes a sensor configured to receive a signal associated with the at least partially occluded artery and generate an output signal based on the received signal. Also included is a signal analysis module configured to receive the output signal and determine a first hemodynamic parameter based on a first set of data obtained during inflation of the cuff and a second set of data obtained during deflation of the cuff.
US08197413B2	Transducers, devices and systems containing the transducers, and methods of manufacture A catheter assembly for an intravascular ultrasound system includes a catheter and an imaging core. The catheter includes a lumen extending along the longitudinal length of the catheter from the proximal end to the distal end and the imaging core is configured and arranged for inserting into the lumen. The imaging core includes a rotatable driveshaft, at least one transducer mounted to the distal end of the rotatable driveshaft, and a twisted wire cable coupled to the at least one transducer. In addition, a number of different transducer arrangements and methods of making transducers are presented.
US08197410B2	Ultrasonic diagnostic apparatus, ultrasonic image processing apparatus and ultrasonic image processing method An ultrasonic diagnosis device having a data collector that collects ultrasonic image data, obtained by scanning a predetermined site of a sample periodically moving, a strain gauge setting unit that sets a predetermined number of strain gauges which includes a plurality of segments connecting two end points one or more middle points existing between the end points in the interesting area, a motion vector information generator that generates motion vector information of the tissue including at least the strain gauges, an image generator that sets a predetermined number of strain gauges in the ultrasonic image data at different time phases during the period and generates a strain gauge image in which the strain gauges are overlapped at a corresponding position, by the use of a tracking process using the set strain gauges and the motion vector information of the tissue, and a display that displays the strain gauge image.
US08197409B2	Ultrasound guided high intensity focused ultrasound treatment of nerves A method for using high intensity focused ultrasound (HIFU) to treat neurological structures to achieve a desired therapeutic effect. Depending on the dosage of HIFU applied, it can have a reversible or irreversible effect on neural structures. For example, a relatively high dose of HIFU can be used to permanently block nerve function, to provide a non-invasive alternative to severing a nerve to treat severe spasticity. Relatively lower doses of HIFU can be used to reversibly block nerve function, to alleviate pain, to achieve an anesthetic effect, or to achieve a cosmetic effect. Where sensory nerves are not necessary for voluntary function, but are involved in pain associated with tumors or bone cancer, HIFU can be used to non-invasively destroy such sensory nerves to alleviate pain without drugs. Preferably, ultrasound imaging synchronized to the HIFU therapy is used to provide real-time ultrasound image guided HIFU therapy of neural structures.
US08197402B1	Free-hand laryngoscope gaper The laryngoscope gaper is a hands free medical device that keeps the patient's mouth open for the introduction of a flexible or rigid endoscope or for the introduction of a tracheal tube. The device includes a mouthpiece with teeth locator, tongue retractor, and laryngoscope guides. The tongue retractor and the mouth piece work to maintain the mouth in an open position during use of the laryngoscope.
US08197401B2	Stroboscope module with a coupling A stroboscope module has a coupling with which the stroboscope module can be connected to a light connection of an endoscope. The coupling comprises a sleeve and a base, with the base being arranged in the sleeve displacable in an axial direction between a first position and a second position. An elastically deformable cuff having an internal diameter is arranged within the sleeve, into which cuff the light connection of the endoscope can be inserted in the first position. The sleeve and the base compress the cuff in the second position such that the internal diameter of the cuff is reduced and the light connection of the endoscope is locked in the coupling. The sleeve and the base can be locked in the second position.
US08197397B2	Metrology device for videoendoscopic probe Image splitting device for videoendoscope, comprising an image splitting optical component to form on the sensitive surface of a video sensor housed in the distal end part of a videoendoscope a single composite image formed from two images of an observed target, viewed from two different angles; the image splitting optical component comprises two sections of identical convergent lenses, integrated into an opaque central element, maintaining the space between the two sections of lenses, each of the two sections of lenses are at least equal to a half-moon so that it is crossed by the optical axes of the lens.
US08197395B2	Pacemaker for treating physiological system dysfunction Disclosed is a device and method for preventing seizures due to physiological system dysfunction. The method is based on a conjectural model of the brain wherein each brain site is modeled as a chaotic oscillator; a normal brain generates an internal feedback signal to prevent long-term entrainment among the oscillators; and a pathological brain fails to provide this feedback signal. The device of the present invention measures and characterizes the brain sites to determine if entrainment is occurring among the oscillators, derives an appropriate feedback signal to counteract the entrainment, and applies the feedback signal to the critical brain sites. The feedback signal generated by the device supplements or takes the place of the feedback signal that would otherwise be generated by the normal brain.
US08197391B2	Ballet barre cover A cover for use with an elongated cylindrical ballet barre supported above a surface adapted to be gripped by the user comprising an elongated piece of a cushioning material encircling at least a portion of said barre and removably attached thereto.
US08197384B2	Engine start-up device for hybrid vehicle power transmitting device With an engine start-up device, an engine is started upon altering a start-up when shifting an automatic shifting portion relative to when the automatic shifting portion is not shifting. Thus, start-up of the engine is prevented from adversely affecting the shifting of the automatic shifting portion. The engine starts during the shifting of the automatic shifting portion, enabling further improved response in acceleration required by a driver than that achieved when the operation is commenced after the automatic shifting portion has completed the shifting.
US08197382B2	Multi-speed transmission A transmission is provided having an input member, an output member, four planetary gear sets, a plurality of coupling members and a plurality of torque transmitting devices. Each of the planetary gear sets includes first, second and third members. The torque transmitting devices may include clutches and at least one brake. The torque transmitting mechanisms are selectively engageable in combinations of at least two to establish at least eight forward speed ratios and at least one reverse speed ratio between the input member and the output member.
US08197379B1	Transmission mechanism for power tool A transmission mechanism includes a first gear unit having an axially-movable ring gear and a second gear unit having an axially-movable fixing ring. The fixing ring includes first and second protrusions on two sides, respectively. When the ring gear moves, the first inner teeth and the outer teeth of the second planet gear disk are engaged with each other or disengaged from each other. When the fixing ring moves, the first protrusions and the first positioning ridges are engaged with each other or disengaged from each other, or the second protrusions and the second positioning ridges are engaged with each other or disengaged from each other. By the different combinations of the statuses due to movement of the ring gear and the fixing ring, the input speed from the motor gear is transferred into four different speeds which is output from an output shaft.
US08197373B2	Power unit A power unit includes: an energy dispensing/synthesizing system in which a first body of rotation is connected to an output shaft of a prime mover and a second body of rotation is connected to a driven unit via a first power transmission path; a first power transmission system selectively operable between an operating state for enabling power transmission in the first power transmission path and an operating state for disconnecting the power transmission; a second power transmission path connecting between the output shaft of the prime mover and the driven unit; and a second power transmission system selectively operable between an operating state for enabling power transmission in the second power transmission path and an operating state for disconnecting the power transmission, wherein an auxiliary device is connected to a second body of rotation of the energy dispensing/synthesizing system.
US08197370B2	Chain tensioner having biased disabling mechanism A chain tensioner (1) having a plunger (12) slidably assembled in a cylinder portion (13) together with a return spring (11), the chain tensioner (1) further has a stopper plate (22) having a through-hole (22a) formed therein, through which the plunger (12) is inserted; and a biasing member (24) disabling movement of the plunger (12), by applying a biasing force to the end of the stopper plate (22) so as to incline the stopper plate (22), the chain tensioner is configured to apply a hydraulic pressure of a hydraulic oil of an engine to the stopper plate (22), so as to reduce the inclination of the stopper plate (22) against the biasing force applied by the biasing member (24), to thereby allow movement of the plunger (12).
US08197368B2	Transmission system for a self-propelled vehicle with variable travel speed, its control device, and vehicle equipped with such a transmission system A system for a self-propelled vehicle with variable travel speed, such as a mowing tractor, includes, between the primary driving shaft of the vehicle and an output shaft, such as the wheel drive shaft of the vehicle, at least one controlled variable speed drive with a belt and controlled mechanism for reversing the direction of travel of the vehicle, the primary driving shaft transmitting, via the variable speed drive, its motion to the input shaft of the reversal mechanism, itself able to directly or indirectly engage the output shaft, such as the wheel drive shaft of the vehicle, in such a way as to allow the vehicle to travel forward or in reverse respectively, at a variable travel speed. This transmission system is characterized in that the variable speed drive and the mechanism for reversing the direction of travel of the vehicle are controlled selectively from the same control device.
US08197361B2	Low lift golf ball A golf ball having a plurality of dimples formed on its outer surface, the outer surface of the golf ball being divided into plural areas, a first group of areas containing a plurality of first dimples and a second group of areas containing a plurality of second dimples, each area of the second group abutting one or more areas of the first group, the first and second groups of areas and dimple shapes and dimensions being configured such that the golf ball is spherically symmetrical as defined by the United States Golf Association (USGA) Symmetry Rules, and such that the golf ball exhibits a lift coefficient (CL) of less than about 0.270 at its peak trajectory and from a Reynolds Number (Re) from about 80,000 and a spin rate in the range of about 2,900 rpm to about 3,000 rpm to a Re of about 170,000 and a spin rate in the range of about 3,400 rpm to about 3,550 rpm.
US08197360B2	Multi-layered golf balls containing polyethylene powder A multi-layered golf ball having an inner core, at least one intermediate layer, and outer cover is provided. The intermediate layer is made from a polyurea composition containing ultra-high molecular weight polyethylene powder particulate dispersed therein. The intermediate layer provides the ball with advantageous properties including improved durability, toughness, hardness, and impact-resistance.
US08197359B2	Golf ball with single layer core having specific regions of varying hardness A golf ball comprising a single layer core and a cover layer disposed about the single layer core, the single layer core being formed from a substantially homogenous formulation and comprising a geometric center and an outer surface wherein an inner core region is disposed about the geometric center and an outer core region is disposed about the inner core region and is adjacent the outer surface, the outer core region having a thickness of about 15 mm or less. The inner core region has a first hardness (IC1h) and the outer core region has a second hardness (OC2h) such that the second hardness (OC2h) is greater than the first hardness (IC1h), represented by the relationship (OC2h)>(IC1h) and a hardness of the outer surface (OSh) is greater than a hardness of the geometric center (GCh), represented by the relationship (OSh)>(GCh) to define a positive hardness gradient.
US08197358B1	Golf club head with composite weight port A golf club head having a face component, a crown, and a composite sole with one or more weight ports for receiving one or more weight inserts is disclosed herein. At least part of each of the weight ports is integrally formed in the composite sole, and each of the weight ports include a weight receiving region for receiving a weight and a screw receiving region for receiving a screw that secures the weight in the weight port.
US08197354B2	Iron-type golf clubs A set of iron-type golf clubs includes long irons with channel back configurations and short irons with cavity back configurations. The rear face configurations transition from channel backs through to pure cavity backs for increased performance continuum for the set. Additional design parameters for the set may also be systematically varied through the set, such as groove type and depth, loft angle, cavity volume, hitting face roughness, and sole width. At least one of the clubs of the set includes a sandwich-type construction for the hitting face having a dampening element disposed between a hitting face insert and a lightweight reinforcing core. In one embodiment, at least one club head is oversized.
US08197352B2	Methods and systems for amusement park conveyor belt systems A water transportation system and method are described, generally related to water amusement attractions and rides. Further, the disclosure generally relates to water-powered rides and to a system and method in which participants may be actively involved in a water attraction. This transportation system comprises at least two water stations and at least one water channel connecting the at least two water stations for the purpose of conveying participants between the at least two water stations. In addition, the water transportation system may include conveyor belt systems and water locks configured to convey participants from a first source of water to a second source of water which may or may not be at a different elevation.
US08197348B2	Telescopic shaft A telescopic shaft for vehicles comprising an inner shaft axially movable in an outer shaft. The telescopic shaft comprises at least two rows of balls with at least one ball per row between the inner shaft and the outer shaft. A row of balls is arranged on at least one ball race arranged against the inner shaft. The ball race is wedge shaped on its against the inner shaft facing surface. The telescopic shaft comprises a prestress mechanism which pushes the ball race along a wedge unit axially in relation to and radially in the direction against the outer shaft. whereby the telescopic shaft is prestressed. The prestress mechanism is arranged to release the prestress when the alteration in length of the telescopic shaft exceeds a predetermined length.
US08197346B2	Shuttle vent valve A vent valve for a constant velocity joint is disclosed. The vent valve may generally include a body disposed in a bore of the cover which is axially movable in the bore and allows fluid flow through the bore, a first umbrella portion associated with a side of the body which defines a first gap between a first surface of the cover and the first umbrella portion, and a second umbrella portion associated with an opposite side of the body which defines a second gap between a second surface of the cover and the second umbrella portion.
US08197345B2	Methods, systems, and products for centralized control of gaming applications Methods, systems, and products provide centralized control of gaming applications. A request is received from a destination to store a status of a gaming application associated with a username. A bookmark is received that identifies a logical location in the gaming application. The bookmark is associated to the username and to the gaming application. A request is received for the status of the gaming application associated with the username. A query is made for the bookmark associated with the gaming application and with the username. The bookmark is sent to the destination, such that the destination may resume the gaming application from the bookmark.
US08197344B2	Gaming terminal data monitoring network A method of storing data serially transmitted between a gaming terminal and a computer on one or more servers in a network. The gaming terminal and computer are typically linked in gaming establishments by a serial communication link utilizing serial communication protocols. Although this data is stored on the gaming establishment's computers, it is also highly desirable to make this data accessible on a secure server. Data is monitored and captured directly at the gaming terminal with a communication interface. The communication interface converts the captured data from a serial communication protocol into a network communication protocol for storage on a server in a network.
US08197335B2	Gaming system, gaming device, and method for enabling a current bet to be placed on a future play of a wagering game The gaming system, gaming device, and gaming method disclosed herein provide an opportunity for a player to place a replay wager for a group or set of a plurality of plays of a wagering game. In one embodiment, the replay wager activates a replay feature which the player can use a designated number of times (such as one time) over the plurality of plays of the wagering game. The player's use of the replay feature causes the gaming system to redisplay the previous play of the wagering game, and provide any awards associated with the previous play of the wagering game. After the player uses the replay feature over each of the designated number (such as one) of the plurality of plays of the wagering game, the player cannot use the replay feature for any of the remaining plays of the plurality of plays of the wagering game.
US08197326B2	Multi-player bingo game with multiple alternate outcome displays The invention is directed to methods and gaming units for conducting a multi-player wagering game, such as a Bingo game, in which at least one of the players may win the occurrence of the wagering game by matching a predetermined game-winning pattern of game indicia on one or more game arrays having unique combinations of game indicia based on matching the game indicia on the game arrays to game indicia randomly selected for the occurrence of the wagering game. The outcome of the multi-player wagering game may be displayed to the player at the gaming unit, along with an alternate outcome display at two or more alternate outcome display devices at the gaming unit. In one embodiment, an outcome of a Bingo game may be mapped to an outcome of a slot machine having a bonus feature such as a wheel. Outcomes of the Bingo game may then be displayed on the plurality of alternate display devices as outcomes of the slot game and accompanying bonus feature.
US08197324B2	Content determinative game systems and methods for keno and lottery games Methods, systems and apparatus are described for producing wagering products and conducting wagering games. In one embodiment, a method for producing a lottery product comprises producing a play slip that includes an indication of at least one event that potentially occurs in a corresponding content (e.g., audio/video content) component of the lottery product. In one embodiment, a unit of the corresponding content is provided to a player along with a play slip.
US08197323B2	System and method for implementing an additional game to players of a lottery game A system and method for providing an additional or end-of-game drawing to players of a lottery game is provided. In one embodiment, unique validation codes provided on lottery tickets can be encrypted using an algorithm and used to create a record of such encrypted codes. A player then participates in the lottery and subsequently submits the validation code from the ticket to a lottery provider. The lottery provider applies the algorithm to the submitted validation code to create another encryption code for comparison with the record of encrypted codes. In the event a match is found, the player is entered into a second-chance or end of game drawing. Upon entry, the player is no longer required to maintain possession of the ticket for subsequent validation.
US08197321B2	Multi-play poker gaming system with predetermined game outcomes A gaming system which provides the player a plurality of playing cards to form an initial primary poker hand and also displays one or more other poker hands. The player selects one or more of the initially dealt cards in the primary poker hand to hold or to discard. The held cards are also held in one, more or each of the other simultaneously displayed hands. The gaming device evaluates the held cards and determines which poker game outcomes are possible based on the held cards and the remaining cards in the deck. The gaming device utilizes a stored table of different distributions of poker game outcomes which would result in each payout amount and a table regarding which poker game outcomes are possible based on the player's held cards to determine a distribution of outcomes that provides a total payout equal to the payout of the predetermined game outcome.
US08197317B2	Methods and contests for estimating events or conditions The methods and contests feature contest grids for each sub-contest, with the grids having a second row of spaces for entry of multiple estimations on an event or a condition, a third row of spaces for entry of points per estimation, and a first row of spaces that indicates if any estimation matches historical data. Contest points may be partially or completely allocated between sub-contests in sub-contest fields. The user may select a state and county applicable to the contest. Distribution options of uniform, triangular (peaked), increasing or decreasing may be selected for the points per estimation. Applications for the methods and contests include agricultural crop events or conditions.
US08197316B2	Systems and user interactive screens for estimating events or conditions The systems generate and provide user interactive screens which include contest grids for each sub-contest, with the grids having a second row of spaces for entry of multiple estimations of an event or a condition, a third row of spaces for entry of points per estimation, and a first row of spaces that indicates if any estimation matches historical data. Contest points may be partially or completely allocated between sub-contests in sub-contest fields. The user may select a state and county applicable to the contest. Distribution options of uniform, triangular (peaked), increasing or decreasing may be selected for the points per estimation. The user interactive screens are useful for estimating future agricultural crop events or conditions.
US08197315B2	Device for interactive practice of soccer using a joystick comprising a couple of control units The present disclosure relates to a device for the virtual and interactive practicing of soccer, complementing the joysticks comprising a pair of control units, comprising an attachment system joining one of the control units to a balloon in which the player can stamp his foot and a connection system interlinking the two control units over a distance that can be greater than the length of their connecting lead.
US08197310B2	Dust box and electric tool with the dust box A dust box includes: an attachment portion configured to be attached to a dust-discharging nozzle extending from a housing of an electric tool; and a dust-collecting portion connected to the attachment portion and configured to store dust particles to be discharged from the nozzle. The dust-collecting portion mainly consists of a box which is made of synthetic resin and configured to be detachably connected to the attachment portion, and a paper bag received in the box and configured to store the dust particles to be discharged from the nozzle.
US08197307B1	Surface polishing system A surface polishing system leaving a surface free from streaks and swirls after the application of a polishing composition into a painted metallic surface includes a polish applicator having a vibrating motion attached to a pad assembly covered with a supersoft 100% polyester material and a polishing composition of 15-30% by weight of high purity aluminum oxide having a particle size of no greater than 0.3 micron or 300 nanometer and 3-20% by weight of calcined alumina comprising at least 70% α-aluminum oxide (Al2O3) with a low calcination degree and a primary crystal size of less than 1 micron, the combined high purity aluminum oxide and calcined alumina having a total concentration of 30-40% by weight of the polishing composition.
US08197306B2	Method and device for the injection of CMP slurry The present invention comprises an apparatus for injecting slurry between the wafer and the pad in chemical mechanical polishing of semiconductor wafers comprising a solid crescent shaped injector the concave trailing edge of which is fitted to the size and shape of the leading edge of the polishing head with a gap of up to 1 inch, the bottom surface of which faces the pad and rests on it with a light load, and through which CMP slurry or components thereof are introduced through one or more openings in the top of the injector and travel through a channel or reservoir the length of the device to the bottom where it or they exit multiple openings in the bottom of the injector, are spread into a thin film, and are introduced between the surface of the polishing pad and the wafer along the leading edge of the wafer in quantities such that all or most of the slurry is introduced between the wafer and the polishing pad and a method of use therefor.
US08197304B2	Method and apparatus for sharpening a tool blade A device for sharpening a tool blade has a pair of spaced guide rails and a bracket for mounting a sharpening stone on the guide rails. A carriage is slidably supported on the guide rails and has a pair of spaced slide plates adjustably supporting a blade angle plate thereon. A clamp mechanism secures the tool blade on the angle plate which is secured in an adjusted position for forming a primary angle on the blade cutting edge by reciprocal movement of the carriage along the guide rails. The angle plate and attached tool blade are readjusted on the carriage for subsequently forming a secondary angle on the cutting edge of the tool blade. Printed indicia adjacent a plurality of adjustment holes formed in the slide plates set the primary and secondary angles of the cutting edge. Mating surfaces on the carriage and guide rails set the amount of material to be removed from the blade during reciprocal movement along an abrasive sharpening material.
US08197298B2	Transformable toy vehicle A toy vehicle includes a central housing having first and second oppositely disposed sides. A first wheel is rotatably mounted on the first side of the housing and a second wheel is rotatably mounted on the second side of the housing. Each of the first and second wheels has a central hub. Each hub has a center disposed along a common first axis of rotation. A plurality of vanes are attached to the hub and form the first and second wheels. An end of each vane distal to the hub forms a circumferential surface portion of one of the first and second wheels. Each vane is individually and separately manually angularly repositionable about a second axis of rotation extending transversely with respect to the first axis of rotation.
US08197292B2	Propulsion system for marine vessel The invention concerns a marine vessel propulsion system that can be set into an opening of a boat's hull and which comprises a propulsion and steering unit (9) that can be rotated or swivelled about a vertical axis (z) and which is fixed to the hull by a securing mechanism (12) having a predetermined fracture point or level. It is proposed that a protective plate (13) is arranged on the boat's hull in the aft direction (opposite to the direction of travel F) and behind the propulsion and steering unit (9).
US08197287B2	Axially adjustable coaxial coupling A coaxial connector having an outer conductor with first and second plug-side ends axially opposite, and an inner conductor with first and second plug-side ends axially opposite. The outer conductor has two separate outer conductor parts arranged and configured such that they are mobile relative to each other in the axial direction, the outer conductor being configured as an outer conductor bellows between the two outer conductor parts. An elastic spring element is provided on the outer conductor and acts upon the two outer conductor parts, driving them away from each other. A change in length of the outer conductor bellows changes capacitance of the outer conductor bellows and is compensated by a correspondingly changing opposite inductance such that the characteristic impedance of the coaxial connector remains substantially constant.
US08197283B2	Coaxial cable connector with RFI sealing A coaxial cable connector and method that will direct the electromagnetic field carrying the electrical signal in a coaxial cable to the inner surface of a conductive layer of the foil of the cable, as opposed to the outer surface. With the electrical signals traveling on the inner surface of the foil conductive layer, the foil conductive layer serves as a contiguous gap-free shield to prevent the ingress and/or egress of RFI.
US08197278B2	Locking cord connector assembly A locking cord connector assembly may include a male housing and a female housing. The male housing defines a male interior chamber configured to house one of a plug or outlet portion of an extension cord. The male housing includes male threads outwardly extending from an outer surface, and at least one tab. The female housing defines a female interior chamber configured to house the other of the plug or outlet portion of an extension cord. The female housing includes female threads inwardly extending from an interior surface. The at least one tab cooperates with a portion of the female housing to provide a ratcheting mechanism configured to maintain a secure connection between the male and female housings.
US08197276B2	Low profile connector system A low-profile electrical connector includes a housing having exterior perimeter sides and top and bottom surfaces, where the bottom surface is configured to extend along a user's body site and the top surface is spaced above the bottom surface. The connector also includes a side-entry guide channel disposed along the bottom surface. The channel includes an opening along the exterior perimeter side that is configured to receive an electrically conductive element. The channel is also configured to guide the electrically conductive element within the housing. The connector includes a receptacle positioned within the housing and forms an electrically conductive interface with the electrically conductive element.
US08197273B1	German/French style plug with multiple pin arrangements A German/French style plug with multiple pin arrangements includes an outer enclosure, an inner housing, a stop plate, a constraint plate, and multiple plugging units. The plugging units are received in the outer enclosure and the inner housing. To move the plugging units, the constraint plate is first displaced to free the plugging units. The plugging units have operation pegs that are operable to have pins of the plugging units projecting out of through holes defined in the outer enclosure or through openings defined in the inner housing. The second plugging unit has a constraint section that is movably received in a constraint slot defined in the inner housing, whereby the movement of the second plugging may cause extension of the inner housing to form a stepped configuration to provide an additional plug structure for different socket specifications.
US08197269B2	Electrical protection An electrical protection for mounting on a wire connector housing, wherein the wire connector housing comprises a fixed hole and a plurality of wire-lock apertures exposed on a top surface of the wire connector housing, and the electrical protection comprise an insulating body and an insulating protrusion located at bottom surface of the insulating body. The insulating body is used to cover the wire-lock apertures at the top surface of the wire connector housing, and the insulating protrusion is designed and constructed to fit into the fixed hole of the wire connector housing. The wire-lock apertures of the wire connector housing are all covered and insulated to prevent electrical shock from the electrical leakage through the exposed apertures.
US08197265B1	Ground-integrated electrical adaptor The electrical adaptor contains a casing having a receiving indentation. Two corresponding positioning notches are provided, respectively, along two opposing lateral side walls of the receiving indentation. Inside the receiving indentation, there are two prong holes, each having an electrical contact inside. A first ground piece is tightly embedded into a front notch along a front wall of the receiving indentation. An additional second ground piece is provided along a back wall of the receiving indentation, opposing the first ground piece. When a German- or French-style plug is plugged, its two positioning ribs on the lateral sides are received by the positioning notches, respectively, and its ground pieces in the front and back are received by the ground notches. In the mean time, its prongs are received by the prong holes and contacted by the electrical contacts, respectively.
US08197263B2	Electric connection receptable for a solar cell module An electric receptacle and junction box for a solar cell module includes an enclosure base and an enclosure cover. The base has a first connector element for electrically contacting a strip conductor of a solar cell module, and a first conductor rail electrically connected to the first connector element. The cover has a second connector element for electrically contacting an output line, and a second conductor rail electrically connected to the second connector element. The first connector element and the first conductor rail are rigidly mechanically connected to the base. The second connector element and the second conductor rail are rigidly mechanically connected to the cover. Electrical contact is made between the first connector element and the first conductor rail and the second connector element and the second conductor rail in response to the enclosure cover and the enclosure base being joined together.
US08197261B2	Telecommunication connector having a flexible circuit board wound across a support member and ends being bent into fixing plates coupled to two rows of terminals A telecommunication connector includes a front holder having a plug port at the front and a press plate at the rear, a rear holder coupled to the rear of the front holder, a support member disposed at the front of the rear holder and extended to the top of the plug port, two rows of terminals installed at the rear holder, a flexible circuit board bent into the electric connecting plate and the extension plate, a curved portion wound across the front of the support member of the rear holder, such that the electric connecting plate is passed through the bottom of the support member and entered into the top of the plug port, and a fixing plate separately bent at rear ends of the electric connecting plate and the extension plate and pushed to the front of the rear holder by the press plate and coupled to the terminals.
US08197260B2	Electrical connector and method of manufacturing same In one embodiment, an apparatus for providing electrical power comprises a housing, at least two electrical outlets, a rotation coupler at the housing and coupled to the at least two electrical outlets, and a prong adapter rotatable relative to the rotation coupler when secured thereto. The rotation coupler comprises a central contact, a first contact set, and a second contact set. The prong adapter comprises a first prong to couple with the first contact set, a second prong to couple with the second contact set, and a third prong to couple with the central contact. The first contact set comprises two or more first contact flanges to couple with the first prong at a rear of the prong adapter. The second contact set comprises two or more second contact flanges to couple with the second prong at the rear of the prong adapter. Other examples herein described.
US08197259B2	Obstructed delivery simulation system Maternal and fetal birthing simulators are disclosed. The maternal simulator has a rotatable pelvis, legs articulated at the hip and knee joints, and a deformable covering that simulates the feel of the skin and underlying tissues. The fetal simulator has an extensible neck, a movable head, movable clavicles, and arms articulated at the shoulder and elbow joints, and may include sensors to measure spinal extension, head rotation, applied traction force, and brachial plexus displacement.
US08197256B2	Fiber optics dental post A fiber optics dental post includes a resin body and plural fiber optics center shafts; wherein the resin body includes an outer peripheral face, a receiving irradiation portion, and a bottom; each of the fiber optics center shafts pierces through and is fixed in the resin body, and has a receiving irradiation end and a light-guide irradiation end; each receiving irradiation end placed on the receiving irradiation portion of the resin body is used to receive the light irradiating on the receiving irradiation portion, and each light-guide irradiation end is respectively placed on the outer peripheral face and at the bottom of the resin body, thus the light received by each receiving irradiation end is propagated to the outer peripheral face and the bottom of the resin body through the light-guide irradiation end for irradiation, so as to effectively enhance the adhesion strength of the dental post.
US08197254B2	Set of artificial teeth having convex adjustment surface A set of artificial teeth allows for easy occlusion adjustment without high precision in arrangement. One of a pair of occluding upper and lower artificial molar teeth has convex adjustment surfaces which are formed of a spherical surface, a cylindrical surface or a conical surface on an occlusal surface thereof, and the other of the pair of artificial molar teeth has opposing surfaces which are formed of a flat surface, a spherical surface, a cylindrical surface or a conical surface in point contact or line contact with the adjustment surfaces on an occlusal surface thereof.
US08197252B1	Dental composite delivery system A packaged unit of composite for performing an aesthetic restoration. The unit is mounted on a polymeric film carrier material and is covered and sealed with the same or otherwise suitable covering film. The carrier film may be an elongated strip containing serially placed units of composite, each readily separable from the strip for individual usage. This packaging is in light restrictive outer packaging since the preferred unit of composite is of a light-cured material such as bis-GMA. In preferred packaging, the unit dose is singular and applicable to the tooth surface with the film carrier which is adapted with tabs to facilitate handling and the draping or damming of the subject tooth from adjacent teeth to facilitate application of the composite. The composite is then worked, i.e., formed on the tooth with the film intermediate the composite and the customary forming tools. In preferred embodiments, the single unit packaging of composite is mounted on a clear carrier film which includes embrasure tabs for selective insertion in the embrasure between the teeth, and in a further preferred embodiment, the carrier film includes an incisal tab to cover the incisal edge of the tooth. The clear carrier is contained in further outer packaging which limits actinic radiation from reaching the composite.
US08197251B2	Premix burner The present invention provides a gas burner, preferably a premix burner, comprising a support having a central gas inlet port for supply of gas into a gas supply chamber. The gas supply chamber is enclosed by a first metal burner membrane at its side and an end cap opposite to said gas inlet port. The end cap is connected to the top of the first burner membrane. The burner membrane is connected at the bottom to the support through its base section. The end cap is formed by a second burner membrane. The exterior surface of the first burner membrane and the end cap is made of perforated heat-resistant sheet metal plate.
US08197248B2	Method for the selective safety-related monitoring of entrained-flow gasification reactors While ensuring technical safety and a short start-up time the invention permits the operation of autothermic partial oxidation of fuels processed into pulverized fuel such as lignite and bituminous coals, petroleum cokes, solid grindable carbon-containing residues, as well as solid-liquid suspensions or slurries, with a gasification agent containing oxygen at operating pressures of up to 8 MPa (80 bar). The selective configuration of the fail-safe monitoring of the gasification process only the supply of the main fuel is cut off. Through the continued operation of the pilot and ignition burner the reactor is kept at operating pressure and after the fault has been rectified fuel gasification can be restarted with the pilot and ignition burner without a complicated placement and pulling of a starter burner and subsequent pressurization of the reactors.
US08197247B2	Injection mold plate module having switchable sub-runners A mold plate module includes a mold plate and an inserting block. The mold plate includes a first surface, a blind hole defined in the first surface, a through hole defined in a bottom surface of the mold plate in the blind hole, two mold cavities, and two first sub-runners. The two first sub-runners are defined in the first surface, and connect the corresponding mold cavities to the blind hole. The inserting block includes a second surface, a lateral surface, a block through hole defined in the second surface, and at least one second sub-runner defined in the second surface. The at least one second sub-runner communicates with the block through hole and extends toward and terminating at the lateral surface. The inserting block is detachably received in the blind hole and rotatable relative to the mold plate to switchingly couple the at least one second sub-runner with the first sub-runners.
US08197245B2	Apparatus for molding containers obtained from parisons Molding apparatus (1) comprising:a molding station (3) equipped with a machine (4) for molding containers (2) obtained from parisons of plastic material and drive components (5) of said machine (4);an isolation device (6) for the molding machine (4), suitable for defining a controlled-contamination environment (7) for housing the machine (4), said drive components (5) being situated outside said environment (7);at least one service section (19) having one or more points of access (19a) with seal-tight protection to enable adjustment, maintenance or size change operations to be performed inside the controlled-contamination environment (7);molds (11) fixed to said machine (4);tubular bodies (13) disposed partly inside and partly outside said environment (7), said tubular bodies (13) defining tubular cavities suitable for the passage of the drive components (5), in particular of drive members (12) for opening and closing the molds (11).
US08197244B2	Multilayer, flexible planar material A multilayer, flexible planar material for delimiting a matrix supply chamber during the production of fiber-reinforced plastic components made of fiber composite semifinished products includes a multifunction laminate, which has a diaphragm, a textile layer, which is laminated on the diaphragm, and a spacer layer, which is disposed on the textile layer.
US08197242B2	Device and method for sheathing a ply of threads A device for continuously sheathing a ply of threads, said ply being formed by an array of approximately mutually parallel threads. The device includes a thread guide, a coating chamber into which a first feed channel and a second feed channel run, which are independent of each other, connected to a first feed device and to a second feed device respectively and capable of delivering a first material and a second material under pressure and with a defined flow rate, and the outlets of which channels are placed above and below the plane of the ply of threads, and an output die. Pressure-measuring device, connected to a controller for controlling the pressure of each of the feed devices, are placed in the coating chamber facing and in line with each other, on either side of the plane of the ply and in the immediate vicinity of the outlet for the feed channels.
US08197241B2	Nanocomposite Moineau device A Moineau device includes a stator that interfaces to a rotor whereby fluid flows through cavities between the stator and rotor that progress axially as the rotor is rotated relative to the stator. At least one of the stator and the rotor is realized from a nanocomposite that includes a polymeric matrix with carbon nanotubes dispersed therein.
US08197238B2	Pump apparatus A pump apparatus includes a drive shaft supported rotatably in a pump body; a power transmission member attached to the drive shaft, and configured to transmit power to the drive shaft; a pump element configured to pressurize and discharge working fluid; a discharge passage formed in the pump body, and configured to introduce the pressurized working fluid-discharged from the pump element to an external of the pump body; a control valve configured to control an amount of working fluid to be discharged through the discharge passage to the external, by controlling a movement of a valving element of the control valve on the basis of the pressurized working fluid; and an electromagnetic valve provided between the power transmission member and the control valve, and configured to control the control valve or a fluid pressure acting on the valving element of the control valve based on the pressurized working fluid.
US08197233B2	Diaphragm pump A pump is provided including a housing and a plurality of diaphragm assemblies radially disposed within the housing, each diaphragm assembly of the plurality of diaphragm assemblies including a diaphragm. A drive element is configured to be eccentrically coupled to a rotating shaft motor to actuate the diaphragm for each of the plurality of diaphragm assemblies to draw fluid into or expel fluid from the diaphragm assembly. The drive element includes a first member and a plurality of second members, each second member of the plurality of second members being movably secured to the first member and disposed between the first member and the diaphragm of each of the plurality of diaphragm assemblies. During actuation of each diaphragm of the plurality of diaphragm assemblies, the corresponding first member and second member provide a continuously rigid radial coupling with the diaphragm.
US08197232B2	Bracketless magnetic pump A fluid pump kit is provided. The kit includes a magnetic driven member for coupling with and rotating a propeller, and a magnetic driver for magnetically coupling to and driving the magnetic driven member by a magnetic attraction force establishable between the magnetic driver and the magnetic driven member. A motor of the kit operates the magnetic driver. First and second casings are provided for housing the magnetic driver and the magnetic driven member, respectively. The first and second casings with housed magnetic driver and magnetic driven member, respectively, are detachably securable to opposite sides of a non-magnetic spacer solely by the magnetic attraction force establishable between the magnetic driver and the magnetic driven member sufficient to support the second casing and the housed magnetic driven member in a particular position without the use of mechanical aids.
US08197225B2	Jet pump slip joint clamps and methods of using the same Slip joint clamps are installed against guide ears of diffusers at jet pump slip joints. Clamps may prevent vibration and/or movement in the slip joint while not being rigidly attached to the diffuser. Clamps include a compression flipper pressing against a guide ear of the diffuser in a substantially radial direction, a biasing member between the compression member and guide ear that presses the flipper against the guide ear, and supporting structures that hold the flipper and biasing member to the inlet mixer about the guide ear. Systems of slip joint clamps are installed against several guide ears of a single diffuser. Each clamp may radially stabilize the diffuser and inlet mixer while permitting upward relative movement of the inlet mixer. Placement and tensioning of clamps in such systems may be varied so as to prevent or reduce vibrations and/or oscillations between an inlet mixer and diffuser.
US08197224B2	Method of operating a fluid working machine To improve the fluid output flow characteristics (14) of a synthetically commutated hydraulic pump (1), it is suggested to use a plurality of different valve (10) actuation strategies. For every fluid flow demand region I to VI a certain actuation strategy is chosen.
US08197210B1	Turbine vane with leading edge insert A turbine stator vane, especially for use in the first stage of an industrial gas turbine engine, the vane including an inner endwall and an outer endwall each with an endwall overhang extending there from, and second and third cooling supply cavities formed between the endwalls and the pressure and suction side walls of the airfoil. The outer endwall includes an end cap with an opening to secure a nose piece therein, and the inner endwall includes an opening to insert the nose piece therein. A nose piece having the shape of the airfoil leading edge is inserted into the openings of the endwall and secured therein by welding. The nose piece includes a showerhead of film cooling holes with shallow angles of discharge. A leading edge impingement tube is secured within the nose piece to provide impingement cooling for the nose piece. Second and third impingement tubes are secured within the second and third cavities to provide impingement cooling therein. Receded gaps are formed in the endwalls between the nose piece, and streamwise film cooling holes in the ends of the nose piece and aligned with the gaps in the endwalls eject cooling air from the nose piece into the gaps for cooling. Because of the separated nose piece from the main vane assembly, film cooling holes of a shallow angle can be formed for providing a better film cooling layer to the vane leading edge and therefore allow for exposure to higher gas flow temperatures.
US08197208B2	Floating underwater support structure A floating underwater support structure is disclosed. The underwater support structure includes a joint capable of rotation and angular movement along two or three axes coupled to a truss. The truss is capable of sustaining loads in tension, compression, and bending, and comprises one or more elongate, rigid members. The elongate, rigid members are capable of sustaining loads in at least tension and compression. A buoyant member positioned between or around the members of the truss at a predetermined distance below the water provides a buoyant force that typically exceeds the weight of the entire structure. In deeper water, cross bracing may be provided between the members of the truss, and in particularly deep water, a single tendon may connect between the joint, typically anchored to the floor of the body of water, and the truss. The support structure may be used to support wind turbines and other structures.
US08197207B2	Individual blade noise measurement system and method for wind turbines A method for configuring blades of a wind turbine for low noise generation. The method includes providing at least one noise measuring device. The noise measuring device is arranged and disposed in a position to measure noise of the blades during rotation. The wind turbine is configured to include a rotational trigger, the rotational trigger being arranged to provide a signal at a predetermined rotational position of the wind turbine blades. One or more of the blades is configured with an aerodynamic modifying device. Noise level is measured with the noise measuring device during wind turbine operation. The noise produced by each of the blades is determined. The blades are configured in response to the noise determined for each of the blades. A method for measuring the noise level generated by an individual blade and a wind turbine configured for desired noise level are also disclosed.
US08197204B2	Fan system, heat exchanger module, method for manufacturing a fan system and/or a heat exchanger module Fan system, in particular for a heat exchanger, which fan system has at least one receptacle for a fan drive unit, at least one housing wall, and at least one strut, in particular a number of struts which connect the receptacle to the housing wall, wherein the struts are arranged between at least one heat exchanger and at least one fan wheel, wherein at least one strut has a strut end section which is configured as a flow guiding face and has an angle α with respect to a fan-wheel axis direction.
US08197202B2	Precast grooves for a stator blade assembly A stator, including a blade assembly with an inner circumferential surface and a plurality of pre-formed grooves in the inner circumferential surface and an outer race with an outer circumferential surface and a plurality of protrusions at least partially engaged with the plurality of pre-formed grooves. The plurality of protrusions is frictionally engaged with the plurality of pre-formed grooves. In one embodiment, the inner circumferential surface includes an area circumferentially disposed between first and second protrusions from the plurality of protrusions and a portion of the area is displaced radially inward by the engagement of the pluralities of grooves and protrusions.
US08197200B2	High speed air compression system A moving-air energy recovery system including an air horn having serially disposed segments of differing flare rates, which intercepts a large area of moving air to channel and transform the flow of moving air into a more concentrated, higher velocity of air flow. This higher velocity air flow is applied to turbine vanes which are connected to an armature that provides a mechanical energy output from the incident air flow on a rotating shaft. In one embodiment, the shaft is connected to a electric generator to generate electric power, which may be applied to stationary applications such as emergency home power, and to mobile applications such as augmenting automobile propulsion.
US08197199B2	Turbocharger housing with a conversion coating and methods of making the conversion coating A turbocharger includes a center housing having a bearing surface configured to contact an inner surface of a unison ring. A conversion coating is impregnated onto at least the bearing surface of the center housing.
US08197197B2	Method of matching thermal response rates between a stator and a rotor and fluidic thermal switch for use therewith A turbine power generation system with thermal response rate matching provided by one or more fluidic thermal switches and a method for mitigating restart pinch during a hot restart. The turbine power generating system includes a stator and a rotor situated within the casing of the stator. Auxiliary heat is provided to the stator casing during shutdown operations from a heat source via one or more fluidic thermal switch which are configured to provide localized heating to portions of the stator casing subject to restart pinch. The fluidic thermal switch includes two solid, thermal conductors having fluid contacting elements spatially separated within an insulated vessel. A highly conductive and capacitive fluid is provided to the insulated vessel when localized heating is needed.
US08197192B2	Pump for pumping contaminated liquid including solid matter The invention relates to a pump for pumping contaminated liquid including solid matter, comprising an impeller (1), which is rotatable in a pump chamber of said pump, the impeller (1) being movable in the axial direction in relation to a seal housing cover (3) between a first position adjacent to an impeller seat (2) and a second position spaced apart from said impeller seat (2), said pump also comprising a cavity (17) defined by the seal housing cover (3) and the impeller (1), and at least one opening gap (20) connecting said cavity and said pump chamber. Furthermore, said opening gap (20) has a first flow area when the impeller (1) is in the first position, and a second flow area bigger than said first flow area when the impeller (1) is' spaced apart from said first position.
US08197190B2	Lever for rotating a turbomachine variable-pitch stator vane about its pivot A lever for rotating about its pivot a turbomachine variable-pitch stator vane: including a first zone for attachment to a lever drive member, a second zone for attachment to the variable-pitch stator vane, and a third zone of elongate shape between the first zone and the second zone is disclosed. A vibration-damping laminate is applied to at least one surface portion of at least one of the zones of the lever. The laminate includes at least one layer of viscoelastic material in contact with the surface portion and a backing layer of rigid material.
US08197189B2	Vibration damping of a static part using a retaining ring A retaining ring is mounted in frictional engagement with a static gas turbine engine part, such as a compressor shroud, in order to provide frictional damping.
US08197187B2	Inspection hole plug with a ball swivel A plug for an inspection hole of a gas turbine engine is disclosed. The plug may have a stem including a first shaft, wherein a first seal is located circumferentially about the first shaft. The plug may have a swivel seal including a second seal spaced from a ball by a second shaft, and the swivel seal may be rotatably connected to the stem by the ball. The ball and the second seal may be fixed to the second shaft.
US08197183B2	Spherical thrust bearing system for turbochargers A turbocharger thrust bearing assembly, which maintains a constant relationship between the thrust faces, for example by use of gimbal or spherical segment geometry. Spherical geometry, while more difficult to manufacture than that of a flat thrust bearing, provides a more constant relationship between the thrust pads and thrust washers than is possible with a typical flat thrust bearing. As a consequence of this more constant relationship the thrust bearing operates with less oil flow, which ultimately may reduce vehicle emissions.
US08197182B2	Opposed flow high pressure-low pressure steam turbine An opposed flow high pressure-low pressure steam turbine balances thrust of the high pressure steam turbine with the thrust of the low pressure steam turbine allowing a reduction in size of thrust bearings. Higher stage reactions in both turbines may be incorporated since they are offset with the opposed flow, allowing a higher steam path efficiency. Opposed flow may be established through a cross-over pipe or utilizing a double high pressure shell.
US08197181B2	Cross-flow fan and air conditioner A cross-flow fan that variably maintains a distance between a blade and a fluid flow guide by varying a height of an outer edge and an air conditioner having the cross-flow fan are provided. Therefore, a noise and a peak value of a spectrum between the blade and the outer edge can be reduced.
US08197173B2	Concertina-wire barrier rapid deployment apparatus and method Methods and devices for loading, deploying, and receiving concertina-wire barriers along paths with varying travel or paths located at a distance to the access track of a transport vehicle. The first method includes loading a concertina-wire coil arrangement directly into carry tines and adjusting the tine tilt during deployment to reflect the changing gradient. An anchored portion of the wire stretches each coil longitudinally into its operative configuration and position as the transport vehicle advances. A second method involves a generally analogous process in order to deploy the barrier at distance from the access route. Retrieval for both methods is accomplished by inserting the carry tines in the space circumscribed by the deployed coils so that as the transport vehicle advances the coil arrangement is removed from its deployment location and pressed together onto the tines thereby being disposed for the next deployment.
US08197165B2	Fastening device for fastening a movable element A fastening device for fastening a movable element to a structure includes a support member and at least one belt retractor having a retractable belt and a fitting. The belt retractor may be fastened to a support member. The belt retractor is arranged in such a way that, if the fitting couples the structure and the movable element, the retractor prevents unrolling of the belt by more than a predefinable range if an external force, such as sudden mid-air turbulence acts on the movable element. Thus, the movable element is secured.
US08197163B2	Indexable insert and drill using the same An indexable insert for a drill includes a chip breaker for disposing chips, provided at an upper face thereof along a cutting edge. The chip breaker has at least one recess. The recess is retracted from an end of the chip breaker near the cutting edge toward the center of the insert by 0.2 mm or greater, or an end of the recess near a center hole of the insert communicates with the center hole.
US08197156B2	Shallow mounted fixed vehicle barrier device A shallow mounted fixed vehicle barrier device for prohibiting vehicular access to a facility or area. The shallow mounted fixed vehicle barrier device includes a barrier system having a passive position and a support system adapted to maintain the barrier system in the passive position. In the passive position, the barrier system prevents vehicles from passing by or through to the protected facility or area. The shallow mounted fixed vehicle barrier device always remains in the passive position and, therefore, never allows vehicles access to the secured facility or area, after installation. The barrier system includes a bollard and, optionally, a bollard sleeve. The support system includes a base frame attached to the bollard, such that the base frame is adapted to secure the bollard during vehicular attack. The shallow mounted fixed vehicle barrier device can be installed in a foundation having a depth of less than twelve inches.
US08197145B2	Revolving joint A revolving joint comprising at least one anti-friction bearing and an electromotive drive unit. The anti-friction bearing is in contact with at least one row of rolling bodies arranged in a row rotating the joint around the rotational axis of the anti-friction bearing. The rolling bodies are in contact with at least one race that can be driven to rotate by the drive unit.
US08197142B2	Bearing apparatus A bearing apparatus includes: two split outer ring halves which includes outer ring raceway surfaces and are disposed within a supporting hole of the housing, respectively; and a plurality of rollers which are disposed on respective inner surfaces of the both split outer ring halves and supports a shaft. Each of the two split outer ring halves includes an oil hole penetrating the split outer ring half in a radial direction thereof and an oil groove formed on an outer diameter surface of the split outer ring half along a circumferential direction thereof to allow the oiling passage and the oil holes to communicate with each other. Each of the oil holes is disposed at a position located at an angle of within 45° from the joint surface of the split outer ring halves in an opposite direction to a rotating direction of the shaft.
US08197141B2	Fluid dynamic bearing device A lid member (10) is formed in a cup-like shape while having a plate portion (10a) and a cylindrical fixed portion (10b) axially protruding from an outer peripheral end of the plate portion (10a). An outer peripheral surface (10b1) of the fixed portion (10b), which serves as a fixation surface (B), is fixed to an inner peripheral surface (7a) of a housing (7) as an outer member (A). An axial dimension of the fixation surface (B) is larger than a thickness of the plate portion (10a), and hence it is possible to thinly-form the plate portion (10a) and to increase a fixing force between the lid member (10) and the housing (7). As a result, an axial dimension of a fluid dynamic bearing device can be reduced and durability thereof can be simultaneously increased.
US08197136B2	Tomography apparatus with an annular airflow channel with an air-diverting ventilation element A tomography apparatus has an annular channel and at least one ventilation element for the purpose of drawing off an air current flowing through the annular channel. The ventilation element contains an intake window that is located in the annular channel for the purpose of drawing off at least a portion of the air current. In order to obtain an even flow profile at an output window of the ventilation element, the intake window has a greater effective intake cross-section at both sides than at the middle. By such evening the flow profile at the output window, turbulence and air current interruptions of the air can be generally avoided, such that when operating the tomography apparatus, disrupting acoustic emissions may be reduced, or a higher air flow and thereby a greater cooling effect may be obtained.
US08197135B2	Sensor system for determining a physical, measured variable A sensor system for determining a physical, measured variable, and includes a sensor and a control/evaluation unit, which are spatially separated from one another and electrically conductively connected via a cable having at least two conductors, wherein provided in the sensor are a temperature measuring element for determining temperature and a sensor identifier for sensor identification. The control/evaluation unit drives the temperature measuring element and the sensor identifier via a shared conductor with a positive voltage or a negative voltage, and, depending on the applied voltage, reads a temperature measured value of the temperature element or an identifying value of the sensor identifier.
US08197128B2	Method and device for temperature prediction A method and a device for temperature prediction or measurement are disclosed. The method comprises: acquiring temperature data outputted from a thermometer probe; selecting some temperature data within a valid time period from the acquired data; determining a first specific time point according to the slope change rate of the temperature curve within the valid time period and an initial temperature within the valid time period; determining a second specific time point according to the slope at or before the first specific time point; calculating a value of temperature y according to an hyperbolic formula; determining a final temperature of the object according to the maximum slope of the temperature curve in the valid time period, the initial temperature of the temperature curve in the valid time period, and the value of temperature y.
US08197127B2	Ultra low current consumption comparator for thermal shutdown An embodiment of the invention relates to a temperature-sensing device and a related method. In an embodiment, the device senses a temperature with a first sensing circuit configured to assert a signal when temperature is above a first temperature threshold level, and a second sensing circuit configured to substantially disable a bias current that powers the first sensing circuit when a sensed level of temperature is below a second, lower temperature threshold level. Accordingly, the device is able to draw substantially reduced current from a power source when the sensed temperature level is less than the second threshold level. Other physical parameters such as strain or pressure may also be sensed using the same technique.
US08197126B2	Stirring determining device, stirring determining method, and analyzer A stirring determining device that determines whether stirring by a stirrer, which stirs liquid contained in a vessel using sound wave generated by a sound-wave generating unit that is attached to the vessel, is successful or unsuccessful. The stirring determining device includes a temperature sensor that measures a temperature of the liquid; and a determining unit that determines whether stirring of the liquid contained in the vessel is successful or unsuccessful depending on the temperature of the liquid measured at least before and after the stirring by the temperature sensor.
US08197124B2	Heat flow measurement tool for a rack mounted assembly of electronic equipment A rack mount assembly measurement tool, for determining physical values including air flow and heat loads, includes a front assembly and a rear duct assembly that are non-intrusively and releasably mounted on the front and rear of such rack mount enclosure. Physical values are sensed at multiple vertical locations to enable a determination of overall and localized heat loads within the enclosure. Front sensor values are collected and wirelessly transmitted from the front assembly to a receiver/processor supported on the rear duct, which generates computed values that are displayed in addition to the sensed values.
US08197120B2	Device for automatically shaking an inhaler The invention is concerned with testing of inhalers used for medicament delivery. Such devices are often intended to be first shaken by a user to prepare them, and then fired by operation of some mechanical mechanism. In order to automate testing, the invention provides a shake device having a carriage 14 for receiving and releasably mounting one or more inhalers. The carriage is mounted upon a guideway for linear movement upon it. A linear motor 26 is operatively coupled to the carriage to reciprocally drive it to shake the mounted inhaler(s). A system embodying the invention may further comprise a fire device having a movable firing member 54, 56 for engaging with an inhaler mounted in the carriage and actuating its firing mechanism.
US08197119B2	Method and apparatus for manufacturing polarizable electrode for electric double layer capacitor There are provided method and apparatus for manufacturing a polarizable electrode for electric double layer capacitor is provided which is capable of preventing porosities, cracks, or breakage of a sheet as much as possible when molding materials are formed into a sheet form and improving the yield of the molding materials. The manufacturing apparatus is used before granulated molding materials that are finely divided and crushed are moved to a calendar molding machine 3. The apparatus includes a mixing machine 1, a vibrating sieve 2, and a vibrating feeder 4. In the mixing machine 1, when the granulated molding materials are mixed with IPA as a binding assistant in a hermetically sealed mixing container 9, they are agitated by agitating blades 11. With this, even when during the mixing, the granulated molding materials adhere with each other to form lumps, the lumps are crushed by the agitation of the agitating blades 11 so that the molding materials are disintegrated into smaller particles. The molding materials mixed with IPA are sieved by the vibrating sieve 2 and conveyed to the calendar molding machine 3 along a conveyance path 30 of the vibrating feeder 4, whereby the molding materials are formed into a sheet form.
US08197117B2	Method for agitating pouched products A system and method for agitating pouched products traveling along a conveyor belt to facilitate heat transfer, blending, mixing and/or stirring of the contents thereof. An agitation station is located along the conveyor belt, and includes an agitator secured to one end of an arm, the arm being pivotally secured to the frame supporting the conveyor belt.
US08197109B2	Lamp for vehicle The present invention relates to a lamp for vehicle which can obtains an ideal light distribution pattern using one light unit. The lamp for vehicle according to the present invention comprises: a first reflecting surface (11) in ellipse shape; a semiconductor light source (3) at a first focus (F11) or its vicinity of the first reflecting surface; and reflecting surfaces (12, 13, 14) in parabola shape controlling the reflected light (L2) from the first reflecting surface (11) to be reflected on the road as predetermined light distribution patterns (LP, HP, SP, WP). The second reflecting surface (12) forms light distribution pattern for high light degree (HP). The third reflecting surface 13 forms light distribution pattern for collection (SP) having the light distribution pattern for high light degree (HP). The fourth reflecting surface 14 forms light distribution pattern for diffusion (WP) overlapping the light distribution pattern for high light degree (HP) and the light distribution pattern for collection (SP). As a result, ideal light distribution patterns can be obtained using one light unit, and thus the traffic safety is greatly improved.
US08197107B2	Housing structure of door mirror The present invention provides a housing structure of a door mirror in which a fixed-side housing portion is reliably crimped to a fixing-side housing portion on the surface side of a housing. In the housing structure of a door mirror, a boss portion and a contact piece are located on the deeper side than first and second butting portions located on the surface side, and a projection portion is located farther than a screwing portion in a positional relationship in the vertical direction (an arrow Y direction) with respect to a horizontal plane passing through the first butting portion. Therefore, when the boss portion (first mounting portion) of an upper housing (fixing-side housing portion) and the contact piece (second mounting portion) of a lamp assy (fixed-side housing portion) are fixed by a screw, a screw tightening force can be concentrated on the projection portion as shown by an arrow A, and this force can be made to act on the first and second butting portions as shown by an arrow B.
US08197106B2	Hot-melt glass pillar lamp and multi-channel heat dissipation method thereof A hot-melt glass pillar lamp and a multi-channel heat dissipation method thereof; the pillar lamp comprises a base, a hollow steel frame which is mounted on the middle of the base, several sections of pillar-shaped hot-melt glass lamp which surround the steel frame and are sequentially arranged on the base from down to up in an overlapping manner, and a lamp cover with air outlets, wherein, each section of the pillar-shaped hot-melt glass lamp comprises a fixing framework which is composed of a plurality of supporting bars and a supporting board; each surface of the fixing framework is separately provided with a hot-melt glass lamp plate; an LED lamp plate is arranged at a certain distance from the inner side of each hot-melt glass lamp plate, and on the corresponding surface of the steel frame. The present invention integrates the semiconductor lighting and the crystal optical refraction technologies, has ideal lighting effect and landscape ornament effect; and the pillar lamp is internally provided with at least one air convection channel from down to up, thereby being greatly convenient for the air convection heat dissipation of the power part and the luminous body in the pillar lamp, ensuring a long-term safe use, and meeting the decorative lighting demands of modern high grade buildings.
US08197101B2	Reflector for use in light emitting device and light emitting device using the same A concave reflecting surface of a reflector for use in a light emitting device has micro reflector segments protruded therefrom in multiple stages and in multiple radial columns, the micro reflector segments each having a convex curved surface which is defined by a locus of a circular arc moved in parallel in a radial direction of the concave reflecting surface, and a radius of the convex curved surface, in each of the reflection regions, is set to be smaller when the convex curved surface is positioned closer to a point on which light emitted from each of the directional light sources and traveling on the light axis is incident, and is set to be larger when the convex curved surface is positioned more distant from the point.
US08197096B2	Light source device having wavelength conversion and separation means, and projector A light source device includes a light source unit emitting light of a first wavelength and a wavelength converting element converting light of the first wavelength into light of a second wavelength. An external mirror transmits light of the second wavelength toward an emission destination and reflects light of the first wavelength to resonate between the light source unit and the external mirror. A wavelength separating section transmits light converted from the first wavelength to the second wavelength while traveling from the external mirror to the light source unit and reflects light of the first wavelength in order to separate the different wavelength light. A turnback section reflects light of the second wavelength separated by the wavelength separating section toward the emission destination. In addition, the wavelength separating section reflects light of the first wavelength from the light source unit to travel toward the wavelength converting element.
US08197095B2	Ultraviolet infrared filter A two-dimensional wedge shaped UV and IR filter is formed by or substantially same size pieces of glass forming a two-dimensional wedge. The wedge reflects radiation in four different directions.
US08197090B2	LED package and backlight unit using the same The invention relates to an LED package having a large beam angle of light emitted from an LED, simplifying a shape of a lens and an assembly process, and to a backlight unit using the same. The LED package includes a housing with a seating recess formed therein and at least one LED seated in the seating recess. The LED package also includes a lens having a predetermined sag on an upper side thereof, covering an upper part of the LED. The LED package and the backlight unit using the same can emit light uniformly without bright spots formed in an output screen, uses a simpler shaped lens with an increased beam angle, and minimizes a color mixing region to achieve miniaturization.
US08197088B2	Vertical handling apparatus for a display A light-emitting display system has interlocking tiles. In an implementation, each tile has a portion of a clamp that joins with another portion of the clamp on another tile. A tile is removed from the display by unlocking the clamp portions. The tile is removed without affecting the position of the other tiles in the display.
US08197084B2	Mobile illuminating device comprising a tubular housing A mobile illuminating device includes a generally cylindrical housing including: illuminating elements in the form of light-emitting diodes (LED) fixed on a support plate, electrical/electronic control and/or connectors between the illuminating elements and a battery. An axially extending section of the housing forms an interior space divided into a plurality of receptacles occupying respective circumferentially adjacent portions of the axial section. A first of the receptacles contains the diodes and a second of the receptacles contains batteries.
US08197082B2	Light source block assembly and backlight unit and liquid crystal display having the same The present invention relates to a backlight unit with a light emitting diode block assembly connected thereto, and a liquid crystal display having the backlight unit. In one embodiment, the backlight unit includes a plurality of light source blocks each of which includes a substrate having a light source and an electrode portion formed thereon; a connector electrically connecting the light source blocks to each other, coupled to the light source blocks in contact with one side of the connector, and fastening the light source blocks to each other by cross-coupling the light source blocks; and a supporter disposed on the other side of the connector. In this manner, LED blocks can be simultaneously both electrically and mechanically coupled, using a relatively small and simple number of connectors, facilitating reliability and ease of manufacture.
US08197081B2	Backlight assembly, display device having the same, and method of manufacturing the display device A backlight assembly includes a light guide plate, a light source assembly disposed adjacent to at least one side of the light guide plate and supplies light to the light guide plate, a container receiving the light guide plate and the light source assembly and including a bottom portion and a first sidewall extended from edges of the bottom portion to form a receiving space, and a coupling member disposed inside the receiving space of the container, and overlapping an upper surface of the light source assembly. The light source assembly is disposed adjacent to the first sidewall, the bottom portion, the coupling member and the light guide plate. The insertion direction of the coupling member is substantially perpendicular to the bottom portion of the container.
US08197076B2	Magnetic membrane mirror Described is a magnetic membrane mirror having a flexible membrane comprising a magnetic material and having a high reflectance. The flexible membrane is secured over a frame to enclose a volume between the frame and membrane. A transmembrane pressure is established to achieve a desired mirror shape or curvature. Curvature can be changed by modifying the transmembrane pressure by increasing or decreasing the pressure in the enclosed volume. An array of electromagnetic actuators generates individually-controlled magnetic fields to cause localized displacements of the mirror surface. The magnetic membrane mirror can be constructed with inexpensive components and can be used as a dynamic component in an adaptive optical system.
US08197075B2	Rear view mirror with facet containing selective acceptance layer A rear view mirror assembly is disclosed in which the mirror has a viewing section and an alignment section meeting to form a reflex angle. The alignment section is etched with a targeting image: a cross-hair or the side surface of the vehicle. When the targeting image is aligned with appropriate feature on the side of the vehicle, the reflex angle is such that the mirror is properly aligned. Also disclosed is a mirror assembly having viewing section and an alignment section with a clear protective outer layer a selective acceptance layer below the clear protective outer layer, and a colored substrate below the selective layer. When the vehicle operator can see the colored substrate through the selective acceptance layer, which transmits only normal light, the mirror is properly aligned.
US08197073B2	Mirror apparatus for use in the presence of steam A mirror hangs from a transparent enclosure which may surround a shower, a bathtub, or other bathing area. The mirror may be in a position that avoids condensation on the surface of the mirror from steam emitted from the transparent enclosure. The mirror may also be in a position so that the mirror reflects light into the enclosure. An individual in the bathing area may use the mirror from inside the transparent enclosure without the mirror fogging, which is a common problem associated with using mirrors in a bathing area. The mirror may hang from the outside of the transparent enclosure and optionally includes a sealing element or a frame surrounding the reflective element to further avoid contact with steam.
US08197072B2	Light emitting device for portable communication device having digital light processing projector and liquid crystal display Provided is a light emitting device of an electronic device, provided with a DLP (Digital Light Processing) projector and a display unit, which is configured in such a manner that the light generated by the operation of the DLP projector can be re-used as a backlight light of the display unit. The disclosed light emitting device includes a first mirror for projecting a light of the DLP projector on a flat area provided ahead of the first mirror in an intermediate operation state of the first mirror; a light concentration mirror for converging the light projected on the flat area, the light concentration mirror being provided at a position adjacent to the flat area; and an optical fiber for transferring the light converged by the light concentration mirror to the display unit and enabling re-use of the transferred light as a light for a backlight of the display unit.
US08197071B2	Light source device and image display apparatus A light source device includes: a light source section adapted to emit a light beam; a first optical element provided with a first entrance surface to which the light beam emitted from the light source section is input, and adapted to transmit the light beam; and a second optical element provided with a second entrance surface to which the light beam transmitted through the first optical element is input, and adapted to transmit the light beam, wherein the first entrance surface is tilted towards a direction rotated around a primary axis with respect to a principal ray of the light beam input to the first entrance surface, and the second entrance surface is tilted towards a direction rotated around a secondary axis substantially perpendicular to the primary axis with respect to the principal ray of the light beam input to the second entrance surface.
US08197068B2	Speckle pattern scrambling in laser projection systems A laser projection system is provided comprising a light source, a phase retarding element, and a beam scanning element. The light source comprises at least one frequency-converted laser source comprising a wavelength-tunable laser diode and a wavelength conversion device. The phase retarding element is configured to resolve the polarization of a frequency-converted laser beam into two orthogonal linearly polarized components such that one component of polarization is phase delayed relative to the other. Frequency-converted laser beam polarization in the 2D image frame is a function of the degree to which the respective components of polarization are delayed relative to each other and varies with wavelength variations in the output of the wavelength-tunable laser diode. Polarization variations of the frequency-converted laser beam in the 2D image frame are sufficient to scramble image speckle patterns across the 2D image frame. In another embodiment of the present disclosure a laser projection system is provided where the system comprises a wavelength-tunable laser diode comprising a phase control section. The laser projection system is programmed to apply a dither signal to the phase control section and the dither signal introduces wavelength variations in the output of the wavelength-tunable laser diode. The wavelength variations in the output of the wavelength-tunable laser diode reside within a FWHM conversion bandwidth of the wavelength conversion device and are at a rate that is sufficient to scramble pixel-specific polarizations and image speckle patterns across the 2D image frame. Methods of operating laser projection systems are also provided.
US08197061B2	Ear shades The present invention relates to a device used to protect the ears from the sun Exemplary embodiments of the invention include ear shades for use with a pair of glasses The temple arm of the glasses generally comprises an anterior end, a posterior end, an ear support portion, and a shading portion The anterior end of the temple arm may be configured to be operatively connected to a lens holding portion of the glasses and the ear support portion rests on the ear The shading portion may be operatively connected to the ear support portion and cooperates with the ear support portion to create a downward-opening cavity into which the top of the user's ear extends to shade at least the top of the user's ear.
US08197057B2	Printing apparatus and printing method A printing apparatus includes a rotating drum that holds a recording medium on a cylindrical outer peripheral surface thereof and rotates around a rotating shaft, and a printing head that is disposed opposite to the outer peripheral surface of the rotating drum and ejects ink onto the recording medium held on the rotating drum to perform a printing operation. The rotating drum holds a first recording medium and a second recording medium arranged in a rotating direction. A distance between a rotating direction downstream end of the first recording medium and a rotating direction upstream end of the second recording medium is larger than a distance between a rotating direction downstream end of the second recording medium and a rotating direction upstream end of the first recording medium.
US08197055B2	Patterning method, droplet discharging device and circuit board A method for producing a pattern on a substrate includes discharging a droplet on a top surface of a breathable substrate being heated, the droplet being formed with a functional fluid containing a functional material, so as to produce the pattern on the top surface of the breathable substrate.
US08197054B2	Image fixing method, method for producing record product using such method, and image recording apparatus To provide a method for fixing an image, wherein the image has a high fastness even immediately after being recorded, and is free from inconveniences such as thermal influence or unfavorable curing inherent to the conventional fixing device, as well as safety problems. To achieve such an object, in a method for fixing an image recorded on a recording medium with a recording material containing a component curable by a plasma processing, the image is fixed on the recording medium by the plasma processing at a normal pressure.
US08197049B2	Inkjet recording ink, ink cartridge, inkjet recording method, inkjet recording apparatus, and ink recorded matter The present invention provides an inkjet recording ink containing at least a pigment dispersion liquid A containing at least a first carbon black, a dispersant, and water, and a self-dispersible pigment dispersion liquid B which contains a second carbon black having a surface functional group, wherein a mass ratio (Ac:Bc) of the amount of the first carbon black (Ac) in the pigment dispersion liquid A to the amount of the second carbon black (Bc) having a surface functional group in the self-dispersible pigment dispersion liquid B is 98:2 to 50:50.
US08197046B2	Ink-jet printer In an ink-jet printer of the present invention, an ink circulation path 4 is formed by an ink head 2, a first tank 31, a second tank 32, and a pump 33. The ink-jet printer switches between an ink-circulation state and a no ink-circulation state during a printing operation, and is capable of performing printing in either of the states.
US08197045B2	Ink container comprising an ink pack and image forming apparatus incorporating the ink container An ink container incorporatable in an image forming apparatus includes an ink pack formed by adhering perimeters of multiple flexible films together to contain ink therein, the ink pack having at least one hole formed in a perimeter thereof and a case to hold the ink pack therein, formed by fitting together multiple members. A first member of the multiple members has a projecting portion insertable into the at least one hole formed in the ink pack. A second member of the multiple members has a recessed portion with a slot shape arranged to which the projecting portion of the first member corresponds. The multiple member are fit together by slidably moving the projecting portion of the first member to the recessed portion of the second member in a longitudinal direction of the case.
US08197043B2	Ink jet printing apparatus and method for filling ink into ink tank in ink jet printing apparatus An ink jet printing apparatus having reduced manufacture costs is provided. The ink jet manufacturing apparatus includes a diaphragm section configured to be able to change the volume of a subtank, and an atmosphere communication port configured to allow the interior of the subtank to communicate with the atmosphere. The ink jet printing apparatus further includes an atmosphere communication valve configured to be able to close the atmosphere communication port, and a driving mechanism configured to drive the diaphragm section and the atmosphere communication valve. The driving mechanism opens the atmosphere communication port and then reduces the volume of the diaphragm section. The driving mechanism subsequently allows the atmosphere communication valve to close the atmosphere communication port and then increases the volume of the diaphragm section. The driving mechanism thus supplies the ink accommodated in a main tank to the subtank.
US08197041B2	Image forming apparatus using liquid for forming images An image forming apparatus includes a recording head, a sub-tank, a main tank, a supply unit, a memory, and a controller. The sub-tank includes an ink storage container, a flexible member, an elastic member, and an atmosphere-communicable unit. The ink storage container has an opening sealed by the flexible member biased by the elastic member. The main tank stores ink to be supplied to the sub-tank. The controller controls an ink dispensing operation depending on image forming conditions. The controller determines whether a gas bubble intrudes in the sub-tank. The controller executes the ink dispensing operation from the recording head using a dispensable ink volume when an ink supply from the main tank to the sub-tank is unable to be continued. The controller variably sets the dispensable ink volume. The controller determines that an ink end condition occurs when the recording head dispenses the dispensable ink volume from the sub-tank.
US08197039B2	Liquid ejecting device, printing apparatus and liquid supplying method A liquid ejecting device is provided. A main tank stores liquid. A sub-tank includes a variable volume liquid chamber that stores the liquid supplied from the main tank. A head ejects the liquid supplied from the sub-tank. A carriage is movable to reciprocate the sub-tank and the head. A first engagement member is provided in the sub-tank and is movable to expand the volume of the liquid chamber. A second engagement member engages with the first engagement member and moves the first engagement member. The liquid is supplied from the main tank to the sub-tank when the first engagement member is moved by the second engagement member to expand the volume of the liquid chamber.
US08197038B2	Printhead jetstack alignment and assembly verification features An apparatus has a first plate having a first array of holes, with a first plate alignment hole having a smaller size than the other holes in the array, a second plate having a second array of holes to be alignable to the first array of holes, a second plate alignment hole having a smaller size than the other holes in the array, and the first plate alignment hole and the second plate alignment hole having different positions. A method of aligning plates provides a first plate having a top and bottom and first array of holes including a first plate alignment hole having a size smaller than the other holes in the first array, places a second plate having a second array of holes on the top of the first plate such that the first array of holes and the second array of holes align, directs light at the bottom of the first plate, locates a profile of the first plate alignment hole in the second array of holes to verify alignment.
US08197035B2	Actuator device and liquid ejecting head including the same An actuator device includes a piezoelectric element including a lower electrode, a piezoelectric layer, and an upper electrode that are displaceably provided in sequence on a substrate. The lower electrode includes a flat center portion and an inclined end portion that descends toward the substrate. The piezoelectric layer is disposed above the lower electrode and the substrate, and includes a first, second, and third piezoelectric layer portion constituted by a plurality of columnar crystals. The columnar crystals of the first and second piezoelectric layer portions are orthogonal to the flat portion of the lower electrode and surface of the substrate, while the columnar crystals of the third piezoelectric layer portion extend orthogonally from a surface of the inclined portion and bend to be orthogonal to the surface of the upper electrode, giving the grains of the columnar crystals of the third piezoelectric layer portion larger widths and increased stress resistance.
US08197032B2	Thermal inkjet printhead A thermal inkjet printhead that includes a substrate, a chamber layer stacked on the substrate, an ink chamber formed in the chamber layer, a heater to heat ink filled in the ink chamber to generate bubbles, and a nozzle layer stacked on the chamber layer, and including a nozzle formed in the nozzle layer, wherein a ratio of the volume of ink ejected through the nozzle with respect to the sum of the volumes of the ink chamber and the nozzle is in the range of approximately 40 to 60%.
US08197031B2	Fluid dispensing subassembly with polymer layer A fluid dispensing subassembly has a diaphragm arranged to be operated on by a transducer, a body pressure chamber arranged to be operated on by the diaphragm, and an adhesive attachment layer arranged between the diaphragm and the body pressure chamber. A fluid dispensing subassembly has a body pressure chamber formed of either a single plate or set of plates, a diaphragm arranged to operate on the body pressure chamber, and an adhesive layer arranged between the body pressure chamber and the diaphragm. A method of manufacturing a fluid dispensing subassembly includes forming a body pressure chamber from a body plate or a set of plates including a body plate, and adhesively bonding a diaphragm plate to at least the body plate of the fluid dispensing subassembly.
US08197030B1	Fluid ejector structure In one embodiment, a fluid ejector structure includes an array of fluid ejector elements; an array of fluid ejection orifices, each orifice in the array positioned adjacent to a corresponding one of the fluid ejector elements; and a three dimensional array of interconnected conductors within the orifice and ejector element arrays. In another embodiment an orifice sub-structure for a fluid ejector structure includes: a substrate; an array of orifices in the substrate arranged in rows in an x direction and in columns in a y direction; and a first thin film structure that includes first conductive elements within the orifice array extending in the x direction and in the y direction.
US08197029B2	Forming nozzles Fluid ejection nozzles having a tapered section leading to a straight walled bore are described. Both the tapered section of the nozzle and the straight walled bore are formed from a single side of semiconductor layer so that the tapered section and the bore are aligned with one another, even when an array of nozzles are formed across a die and multiple dies are formed on a semiconductor substrate.
US08197024B2	Cooler for a printer An inkjet printer has been developed that reduces the effects of show-through by depositing ink onto a cooled print medium. The inkjet printer includes a printhead and a cooler. The printhead is configured to eject ink onto an ink receiving member as the ink receiving member is transported along a portion of a media path through the inkjet printer. The cooler is positioned proximate the media path to cool the ink receiving member prior to the printhead ejecting ink onto the ink receiving member.
US08197019B2	Refrigerator body and method of manufacturing the same The present invention relates to a refrigerator body and a method of manufacturing the same. The refrigerator body of the present invention includes an outer case for defining an external appearance and an inner case for defining the interior of a refrigerator and has a foam insulation material filled into a space between the outer and inner cases. The refrigerator body also comprises recessed portions depressed at the inside of the inner case and protruding outside thereof in a direction of thickness of the inner case so as to fix a part to be installed and mounted on the inside of the inner case, and reinforcement members installed to be tightly coupled to the recessed portions at the outside of the inner case so as to reinforce the recessed portions. Accordingly, a foaming preparation operation can be rapidly and easily performed, and the foam insulation material can be prevented from leaking into the interior of the refrigerator.
US08197018B2	Computer enclosure A computer enclosure includes a housing, a cover, a lock rod and an operating member. The housing includes an upper plate and a bottom plate opposite to the upper plate, with two protruding bars respectively formed on opposite inner surfaces of the upper plate and the bottom plate. Each protruding bar forms a latch hook and defines a notch. The cover forms a limiting portion defining a receiving groove. The lock rod is moveably received in the receiving groove. The operating member is slidably assembled onto the cover and fixed to the lock rod. The operating member is capable of moving the lock rod to pass through the notch and latch to or detach from the latch hook, such that the cover can be assembled onto or disassembled from the housing.
US08197017B2	Rotating multi-latch release mechanism A drawer that includes a container and an activation member is disclosed. The container includes a receptacle and a lid. The lid moves between an open position allowing access to the receptacle and a closed position restricting access to the receptacle. The container further includes a fastener, coupled to the lid, to fasten the lid to the receptacle when the lid is in the closed position. The activation member moves radially around a longest axis of the activation member, and includes an actuator. When the activation member is rotated in a first direction, the actuator is placed into a first orientation relative to the fastener. When the activation member is rotated in a second direction opposite the first direction, the actuator is placed into a second orientation relative to the fastener such that the actuator actuates the fastener to cause the lid to move into the open position.
US08197012B2	Device for supplying a hydraulic brake circuit comprising a particle filter A device for supplying a downstream hydraulic brake fluid to a hydraulic brake circuit of a motor vehicle equipped with a clutch includes an enclosure intended to contain the hydraulic fluid, the enclosure being provided with at least one outlet nozzle and with an inlet orifice. The enclosure forms a downstream portion of a reservoir, the reservoir comprising an upstream portion forming an upstream enclosure intended to collect an upstream hydraulic fluid from the clutch of the vehicle. The upstream enclosure 4 includes at least one inlet nozzle serving to transfer the upstream hydraulic fluid toward the upstream enclosure 4. The inlet orifice is an intermediate orifice whereby the upstream enclosure opens into the downstream enclosure, the intermediate orifice being equipped with a means for filtering the upstream hydraulic fluid.
US08197009B2	Wheelchair seatback with two-point mounting hardware Wheelchair seat back mounting hardware permits the seat back to be mounted on various wheelchairs. The mounting hardware may be in the form of two-point mounting hardware that connects the seat back to the wheelchair and permits the seat back height to be adjusted independently of the mounting hardware location on the wheelchair.
US08197008B2	Reconfigurable furniture piece A reconfigurable piece of furniture having a two-dimensional pattern for storage and multiple three-dimensional functional patterns. The furniture piece includes a central base portion of circular, oval or polygonal shape, pivoting members disposed at discrete locations along an edge of the central base portion; plural radiating members that are bi-directionally pivotally or foldably attached to a corresponding pivoting member; and fastening members disposed on corresponding portions of radiating members. After pivoting or rotating the radiating members, adjacent radiating members are releasably secured to each other to provide structure to adjacent radiating members, forming a three-dimensional furniture piece.
US08197005B2	Infant care apparatus An infant care apparatus includes a base; a drive mechanism disposed on the base; a controller electronically coupled to the drive mechanism; and a support device coupled to the drive mechanism. The support device is configured to be moved in both a horizontal and vertical direction relative to the base by the drive mechanism. The drive mechanism is controlled by the controller to move the support device in a plurality of motion profiles relative to the base.
US08197004B2	Adjustable vehicle seat suspension An adjustable seat suspension for a vehicle seat that includes a linkage arrangement disposed between a seat frame and seat base whose collapse is opposed by a spring lever arm linkage arrangement supported on a fluid powered spring actuator carried by the base that has a plurality of pivotable spring lever arms that are each coupled to a portion of the frame. In a preferred embodiment, the fluid powered spring actuator is an air spring whose pressure is adjustable and which is powered by an air compressor to tailor suspension characteristics and provide a desired preload. The base includes an upright to which the spring lever arm linkage arrangement is pivotally mounted with its spring lever arms supported by a saddle carried by the air spring at a location disposed between the upright and where the spring lever arms couple with the seat suspension.
US08197002B2	Seat adjustment device for bike A seat adjustment device for a bike includes a holding base adapted to be engaged on a top of a support tube for a seat. First and second clamp blocks are received in the holding base. The second clamp block is moveable relative to the first clamp block. A bar-clamping space is formed between the first and second clamp blocks to clamp a support rod for the seat. An resilient member is provided between the first and second clamp blocks to bias the first and second clamp blocks towards an inner wall of the holding base. The first and second clamp blocks may be free to pivot around in the holding base, allowing the seat to be adjusted at a significantly increasing angle.
US08197001B2	Pivoting headrest for use in a rear row seat and incorporating trigger release with cable slack pickup during seatback rotation to a forward dump position A pivoting headrest assembly incorporated into a rear row vehicle seat including a base and a pivotally supported seatback. A first bracket is fixedly supported atop the seatback and exhibits a striker. A second bracket is pivotally supported to the first bracket in a biased direction away from the striker and includes a headrest bun support. A hook is supported upon the second bracket in a first biased direction engaging the striker. A release element associated with the second bracket is biased direction and which, upon being actuated in a second counter-biased direction, engages a projecting portion associated with the hook. A cable is secured at a first end to a fixed location associated with the seat and extends through a redirection location an offset distance from a pivot location of the seatback, the cable securing at a second end to the release element.
US08196999B2	Method of mounting a roof element as well as a mounting arrangement of a roof element The invention relates to a method and apparatus for mounting a roof element on a vehicle body, particularly of a passenger car. Relative to a roof frame element, the roof element is moved from a prefixing position into a final mounting position. In the prefixing position, the roof element is held by a prefixing pairing of at least one roof-element-side and at least one roof-frame-element-side prefixing element.
US08196994B2	Rotationally supporting structure of vehicle's drag-reducing apparatus A vehicle's drag-reducing apparatus, adapted to be arranged at the tail end of a vehicle, includes a diversion body positioned at the lateral surface of the vehicle and a rotary piece. The airflow flowing across the lateral surface of the vehicle body is guided to the tail end of the vehicle by the diversion body. One end of the rotary piece is pivoted to the vehicle body, while another end is fixed to the diversion body. Rotating the rotary piece will bring along the diversion body to be abutted against the tail end of the vehicle body or to be moved to the position far away from the tail end of the vehicle body. Thereby, the opening of the rear door at the tail end of the vehicle won't be hindered, even where there is an arrangement of the diversion body.
US08196992B2	Retracting seal surface enabling independent action of opposing hinged vehicle doors A seal module for sealing between a first door and a second door of opposing-hinged doors includes a base defining a channel and a retractable seal moveably disposed within the channel. The retractable seal moves between an extended position for sealing between the first door and the second door, and a retracted position spaced from one of the first door and the second door to allow independent pivotable movement of either the first door or the second door.
US08196990B2	Vehicular seat assembly and vehicles including same A vehicle includes a body structure and a rear vehicular seat assembly that includes a seat back and a cover panel. The seat back is movably coupled with the body structure and is movable between upright and cargo support positions. The cover panel is associated with the seat back and includes a flap, a base portion, and a perforated living hinge. The base portion is fixedly coupled with the body structure. The perforated living hinge includes a plurality of arms. Each arm of the plurality of arms extends between the flap and the base portion to facilitate pivoting of the flap with respect to the base portion about a hinge axis between stowed and bridging positions. The plurality of arms are spaced from each other and cooperate to at least partially define a plurality of perforations. At least one of the perforations is intersected by the hinge axis.
US08196988B1	Toolbox camper A portable multi-functional sleeping system comprising a sleeping platform for one (1) to two (2) people for use while camping or performing a similar activity is herein disclosed. The sleeping system is provided with a trailer for movement or for towing behind a smaller vehicle or motorcycle. A lid folds open and exposes a mattress capable of holding up to two (2) people. The lower portion of the system provides three (3) storage compartments. A first compartment is provided with insulated sidewalls to serve as a cooler to keep food cool. A second compartment is for general storage for clothing and similar items. A third compartment is provided with collapsible poles and hooks for attaching a shower curtain and water bag thereto shower. A cooking grill section is also provided on the back portion of the system that folds up for compact storage.
US08196979B2	Energy absorber with lobes providing uniform pedestrian impact A bumper system includes an injection molded energy absorber of polymeric material having hollow longitudinally-spaced lobes configured to crush and absorb energy during a pedestrian impact, and straps interconnecting adjacent lobes. The lobes are particularly sized and dimensioned, including potentially external ribs and/or apertures in corners, to provide a relatively uniform impact energy absorption during an impact stroke during crush of the shear walls of the lobes, such as within +/−30% or more preferably within +/−20% of a desired amount regardless of a specific location of impact, along a selected center portion of the energy absorber. A reason for the uniformity is to promote pedestrian safety regardless of the specific location where a pedestrian's leg strikes the energy absorber.
US08196978B2	Carrier and front end module system A carrier for a front end module as a front structure of a vehicle, and a front end module system, comprises a sub frame formed to extend horizontally across an opening of a quadrangular main frame in which a radiator is to be arranged, and air guides are formed on the main frame and the sub frame to project forward.
US08196975B2	Safety device for vehicle door latch systems A motion restriction device is provided for selectively preventing movement of a structural member. The motion restriction device includes a container abutting against the structural member. The container is at least partially filled with a velocity-dependent material that transitions between a fluid-like state when the structural member moves at a velocity below a predetermined threshold to permit movement thereof and a solid-like state when the structural member moves at a velocity above a predetermined threshold to block movement thereof.
US08196972B2	Latching device for a spring-type drive A latching device has a resetting device, a triggering device for producing a triggering force which acts in a first direction, a compression element, and an upper and a lower supporting element which, in the latched state, are arranged one above the other in a housing and are connected to each other by at least one coupler such that they are at a distance from each other, and which, in the latched state, are acted upon, to provide a spring-type drive, by a compressive force applied along a line of action via the compression element. The lower supporting element, loaded by the compressive force in the latched state, is deflected against a stop and is held in that position. The paths of movement of the upper and of the lower supporting element are defined by the housing by way of guides. The path of movement for the lower supporting element runs substantially perpendicular to the path of movement of the upper supporting element.
US08196971B2	Clamp connector for clamping together connecting pieces on pipelines A clamp connector for pipeline connecting pieces (5) has two clamping ring parts (1, 3) pivotably connected at one end between spread positions and clamping positions. A clamping device is situated at the opposite end of the clamping ring parts (1, 3) from the pivot connection (11). The clamping device has a clamping screw (19) pivotable from an active position with the clamping screw (19) interacting with the clamping ring parts (1, 3) to generate a clamping force pressing the clamping ring parts (1, 3) into the clamping positions, and a release position with the clamping screw (19) pivoted away from the clamping positions to release the clamping ring parts (1, 3). The clamping device has a locking device (25, 27) which, in its active state prevents the clamping screw (19) from being pivoted into the release position and which, as a function of the spread of the clamping ring parts (1, 3), passes through an opening angle from the active state into a release state in which the clamping screw (19) can be pivoted out.
US08196968B2	Lateral pipe connection assembly An improved lateral pipe connection assembly that effects proper alignment of the lateral connection and restricts to the desired amount the penetration of the hub into the cored hole of the mainline pipe to which it is connected.
US08196964B2	Sticky note pad A sticky note pad includes at least two stacks of sticky note sheets. Each sticky note sheet has a note-writing region, an index tab region projecting from a right lateral edge thereof, and a removable pressure sensitive adhesive layer provided on a bottom face thereof in proximity to a left lateral edge thereof. The index tab regions of the sticky note sheets of one of the stacks are staggered with respect to the index tab regions of the sticky note sheets of the other stack in a top-to-bottom direction, and are aligned to the same in a direction parallel to the lateral edges of the sticky note sheets. A glue layer binds the left lateral edges of the sticky note sheets of all the stacks. A partition sheet is adhered to the bottom face of a lowermost sticky note sheet of an upper stack.
US08196962B2	Pretensioner In the present pretensioner, press contact portions are formed further to a side of an open end of a packing housing section than central portions of opposing faces along a depth direction of the packing housing section. Accordingly, when a packing is being fitted into the packing housing section, no great resistance is imparted to a curved face side of the packing from a press contact wall of a housing section body and the opposing face, and the packing is fitted comparatively smoothly therein. Consequently, even when fitting the packing into the packing housing section, a packing main body is largely resilient-deformed, such that a large collapse in a through hole can be prevented, and the sealing ability of the seal due to deformation of the packing main body can be effectively enhanced.
US08196961B2	Stamped housing linear pretensioner A linear pretensioner device for motor vehicle belt restraint systems. In one embodiment, the linear pretensioner is formed by a pair of stamped sheet metal housing components joined along a plane which is parallel to the longitudinal axis of the internal piston bore. After the sheet metal housing half members are formed, assembly proceeds by loading the elements of a cable assembly into one of the housing half members, placing the second housing half member over the first and fastening them together by spot welds or other fastening processes. Alternate embodiments include a one-piece housing component deformed to form the housing, and a variety of means for connecting together the housing members or sections. The invention is also related to methods of assembling various designs of pretensioners.
US08196957B2	Airbag and airbag device An airbag for protecting an occupant includes a panel forming the airbag and having an occupant counter surface with a head counter portion to face a head of the occupant when the airbag is inflated. A recess portion is formed in the head counter portion when the airbag is inflated. The airbag also includes a regulation member for regulating inflation of the head counter portion toward the occupant. The regulation member forms the recess portion by regulating inflation of the head counter portion toward the occupant upon inflation of the airbag. The regulation member is configured to release regulation after a predetermined time from a moment when the airbag starts inflation.
US08196949B1	Protective cover for weight distribution type towing hitch assembly A protective cover for use in connection with a weight distribution type towing hitch assembly includes means for encasing a weight distribution type towing hitch assembly, having both means for preventing contact injury to passersby and means for containing grease associated with the weight distribution type towing assembly; and means for securing the protective cover to the weight distribution type towing assembly. The cover is formed as a laminate of an outer layer, a grease barrier and a cushion located between the outer layer and the grease barrier. The outer layer forms a number of attachment flaps, which are provided and arranged such that in addition to providing a means for securing the protective cover to the hitch assembly also at least in part provide the means for containing grease.
US08196948B2	Elevating device for seat cushion of bicycle An elevating device for seat cushion of bicycle includes a cylinder having at least one level to expand or contract inside a frame tube of a bicycle frame, a stick for operating the cylinder, and a driving device for driving the stick. By the driving device, the stick below the seat cushion will press the cylinder so as to make an adjustment of the height of the seat cushion. Therefore, the elevating operation for seat cushion of bicycle is easy and convenient to adjust a proper height of the seat cushion for getting on/off the bicycle and also for comfortable riding.
US08196947B2	Suspension fork for a bicycle A suspension fork for a bicycle includes at least one stanchion tube and at least one slider tube interacting therewith and a wheel receiving space adjacent thereto. The suspension fork includes a damper system with a damper chamber divided into a first chamber and a second chamber by a movable piston. The suspension fork further includes a damping device for the rebound stage and a damping device for the compression stage are provided. A shut-off valve is provided for selectively locking the rebound stage. The damper chamber comprises a connecting duct with a flow damper that connects the second chamber with the first chamber when the stanchion tube and the slider tube interacting therewith are compressed more than a predefined distance such that in the case of a forceful compression and with the shut-off valve of the rebound stage activated, slow decompression is allowed up to a damper position as defined by the predetermined distance.
US08196945B2	Bicycle pedal with integrated cable lock A locking bicycle pedal includes coiled cables on spools with locking mechanisms attached to free ends. The cables may be extended from the spools. The locking mechanism may comprise a key or combination lock. The locking mechanisms attach to the pedal when not in use for locking the bicycle. A bicycle may be equipped with one or more locking pedals. Where two locking pedals are provided, the locking mechanisms of one pedal may interlock with each other and/or the locking mechanisms of the other pedal. The coil and locking mechanisms do not interfere with normal use of the bicycle.
US08196940B2	Suspension arm A suspension arm may include a metal ball housing, a metal bushing housing, a metal connecting portion including a ball housing annulus at an end portion thereof, wherein the metal ball housing is inserted and mounted in the ball housing annulus, and wherein the other end portion of the metal connecting portion is connected to the metal bushing housing, and a reinforcement member wrapping the metal ball housing, the metal bushing housing and the metal connecting portion.
US08196939B2	Medical cart and drawer assembly and lock The drawer assembly comprises a cabinet defining an internal space. A shelf is supported in the cabinet. The shelf supports a latch that is movable between a first position and a second position. A drawer is supported on the shelf where the drawer has a latch receiving structure formed thereon. The latch receiving structure includes a first surface engageable with the latch when the latch is in the first position and a second surface also engageable with the latch when the latch is in the first position such that the drawer can be locked relative to the cabinet in one of two positions. In one embodiment the drawer is supported on a mobile medical cart. The cart may also include a computer such as a PC, wireless communications systems to communicate with a wider network system, a system controller and/or other systems.
US08196933B2	Seal with plastic inner cup A heavy duty composite oil seal with an outer cup and a plastic inner cup. The outer cup includes a major diameter mounting flange portion terminating in a curl, a minor diameter wear sleeve portion, and a transition portion joining the major and minor diameter portions. There is an elastomeric seal body and an embedded stiffener, with the elastomeric seal body having a sealing lip contacting the inner axial surface of the wear sleeve portion. There is a plastic inner cup member with an axial flange substantially co-extensive with the mounting flange and entrapped along the major diameter flange portion between the curl portion and the transition portion of the outer cup. The inner cup also has a radially extending flange that engages a radial portion of the elastomeric seal body. The plastic inner cup member has plural, evenly spaced diagonal braces extending between and joining the axial flange and the radial flange of the inner cup.
US08196927B2	Gambling game A game, similar to craps, is described, where two marbles may be thrown by the players into a spinning machine. The spinning machine may include a funnel at the top of the machine into which the players may throw the marbles, a cylinder through which the marbles may pass, and a spinner to spin 12 slots that may receive the marbles from the cylinder. Two marbles may be thrown into the funnel and may exit into a first set of six slots, which may be numbered from 1-6 (or A, 2, 3, 4, 5 and 6) of one suit (such as hearts), and a second set of six slots, similarly numbered, or a different suit (such as spades). The two slots into which the marbles fall may equate to two dice being rolled in certain traditional craps games. A table may be designed specifically for the game, wherein up to eight players may play at the same time.
US08196922B2	Sheet finishing apparatus and image forming apparatus There is provided a sheet finishing apparatus according to an embodiment that includes an external wall with a discharge port of sheets, a movable tray on which the sheets discharged from the discharge port are stacked and which moves up and down along the external wall according to the number of stacked sheets, and a lubricant supply unit which moves up and down together with the movable tray and applies a lubricant to the external wall.
US08196916B2	Banknote depositing unit and insert/return unit attachable to and detachable from banknote depositing unit A banknote depositing unit can be made with a smaller width than those made previously. The unit includes: a first conveying section for conveying banknotes or a bundle of banknotes deposited into a temporary holding section from an inlet through a first route; a second conveying section for conveying each banknote from the bundle of banknotes held in the temporary holding section to a return outlet through a second route; and a third conveying section for conveying each bundle of banknotes held in the temporary holding section to a cassette section where the banknotes are to be stored in each bundle through a third route. The second route and the third route commonly have the temporary holding section as a starting point and three-dimensionally intersect each other.
US08196911B2	Adjustable rate subframe mount A subframe mount capable of having its rate adjusted is disclosed. Subframe mount is configured with damping regions configured to removably receive inserts that would modify rate upon insertion. In this configuration, subframe mount may have its rate adjusted without removal from the motor vehicle. In certain configurations, the subframe mount provides the ability to tune the rate in multiple directions, providing an enhanced motor vehicle development tool.
US08196901B2	System and method for converting an engine to an alternate fuel An engine conversion kit for converting an engine that combusts gasoline to an engine that combusts a fuel other than gasoline, such as E85 which is 85 percent ethanol and 15 percent gasoline includes a carburetor having a vent passageway that defines a vent size, and an automatic choke system. The kit includes a second carburetor including a primer passageway and a second vent passageway having a second vent size that is smaller than the vent size. The second carburetor is adapted to attach to the engine and replace the carburetor. A primer bulb is configured to connect to the engine and is operable to force air into the primer passageway.
US08196898B1	Water-stop plug of flush valve The present invention relates to a water-stop plug of the flush valve including a connecting sheet, a fixing component and a casing body. The connecting sheet includes a ring part and a pair of hook-hanging parts, and users are capable of choosing the ring part or the pair of hook-hanging parts to fix the water-stop plug to the overflow tube according to the original overflow tube structure, and thereby being able to replace different types of water-stop plugs of flush valves.
US08196897B2	Device for distributing gas to a cooking appliance A gas tap for controlling the flow of a gas to a cooking appliance. In one embodiment, the gas tap includes a body and a rotatable regulation member positioned within the valve body, the valve body having a stationary groove for the inlet of gas from an exterior wall surface to an interior wall surface of the body, the regulation member having a passage opening for the inlet of gas from an exterior surface to an interior cavity of the regulation member, the passage opening moving with an angular rotation of the regulation member. The groove and passage opening are shaped, dimensioned and positioned relative to one another such that the regulation of an intermediate gas flow Qgra (a flow between Qmax and Qmin) is proportional to the angular displacement of the rotatable regulation member.
US08196895B2	Actuation device, valve means and operating method The present invention relates to an actuation device (5) for shifting an actuation member (4) between two end positions, in particular for controlling a gas flow in an internal combustion engine, with an armature (13) which is mounted in a stator (14) such that it can move between two end positions in a pivoting manner about a pivot axis (7) and which is connected or can be connected in a rotationally fixed manner to the actuation member (4), with at least one electromagnet (10), which is arranged on or in the stator (14), for generating electromagnetic attractive forces, with at least one first stator-side bearing face (18), against which a first contact face (20) of the armature (13) bears when the armature (13) is in the first end position, and with at least one second stator-side bearing face (19), against which a second contact face (21) of the armature (13) bears when the armature (13) is in the second end position.Increased reliability can be achieved for the operation of the actuation device (5) by a sensor system (12) for measuring at least one parameter of a magnetic field, which is produced by the at least one electromagnet (10) during operation of the actuation device (5), which parameter is dependent on the armature movement and/or armature position.
US08196890B1	Hanging merchandise display system There is provided a display system that may be hung and that holds one or more pouches or bags containing an item to be used. The display is made from a blank having upper, middle and lower panels and an upper edge. There is a tab arrangement on the upper panel for holding the merchandise to be displayed. The bags are inserted from the back of the blank between the upper and middle panels and attached to the tab arrangement. After the bags are attached to the tab arrangement, the upper edge of the upper panel is inserted between the lower and middle panels and the lower panel is folded over the upper panel in order to hold the bags relatively firmly on the tab arrangement. The display may then be hung by the use of slots or hooks in the upper panel.
US08196886B2	Saw blade gripper A mechanism for gripping an article including a housing, a piston slidably housed within the housing, a plunger slidably housed within the housing, wherein the plunger is at least partially extendable out from the housing, the plunger including a gripping surface, at least one spring operatively arranged between the piston and the plunger for relating a change of a position of the piston to the plunger, and a cam eccentrically rotatable about an axis and operatively engaged with the piston for setting the position of the piston.
US08196882B2	Movable pole support A movable pole support includes an upper block and a lower block, each formed with a pole-receiving bore. The blocks are separated by a number of extension posts that maintain the blocks in a parallel position and spaced-apart to define a gap. The gap is sized to accept the edge of a table or counter, and the lower block is equipped with a locking screw that may be threaded into the lower block to secure the movable pole support onto a table or counter. The upper and lower blocks may be formed with a receiving groove shaped to receive a raised table rim, or a lower lip edge. A damage-resistant pad may be provided on any table-contacting surface to avoid damage to the table or counter being used. The movable pole support may also have a pole set screw insertable into the upper block to secure a pole securely within the pole-receiving bore.
US08196881B1	Countertop cut-out retainer and method of use thereof A system designed to retain a countertop cut-out portion is herein disclosed. A plurality of retainers are intended to be installed at selected locations within initial saw cuts to prevent the cut-out portion from falling and causing damage or injury following the subsequent final saw cuts. The system is intended to be inserted into the saw cut in a longitudinal orientation and rotated into a transversal orientation thereby causing the foot to engage and support the bottom edge of the portion to be removed. Wedge shaped shims are used to compensate for countertop depth variations and to secure the location of the systems. Upon completion of the sawing process, the system allows the cut-out portion to be removed in a safe and controlled manner. The system is intended to accommodate all types of countertop thicknesses and materials, including laminate, granite, imitation or natural stone or marble, and the like.
US08196879B2	Cake support tube A support tube (1) for use as an internal support for multi-tiered cakes (9). The support tube has a raised internal profile (7) comprised of raised ridges (8) located on an inner surface (5) of a perimeter wall (4). The raised internal profile strengthens the perimeter wall of the support tube, thereby allowing the support tube to support large weights of multi-tiered cakes when placed in a vertical position inside a multi-tiered cake.
US08196874B2	Storable intravenous stands The present invention is directed to a base member for a portable intravenous stand. The base member includes a plurality of segments configured to facilitate the close nesting or alignment of multiple portable intravenous stands; and thus reducing the amount of space required for storing the portable intravenous stands when not in use.
US08196871B2	Control of shockwave-boundarylayer-interaction using MEMS plasma devices A micro-electromechanical system (MEMS) dielectric barrier discharge (DBD) based aerodynamic actuator is configured to modify a shockwave boundary layer interaction and limit incident boundary layer growth caused by a reflected shockwave.
US08196866B2	Extendible sway brace for an airborne payload rack and a rack containing same An extendable sway brace for a rack for an airborne payload. The sway brace is extendable. A mechanism for extending the sway brace includes means for preventing extension of the sway brace when the pressure exerted by the brace on a payload reaches a predetermined pressure. The means for preventing extension of the brace may include, for example, one or more pre-loaded springs. In this case, extension of the brace is prevented when the springs are compressed by a predetermined amount. The invention also provides a rack for an airborne payload comprising a sway brace of the invention.
US08196865B2	Foldable step for a vehicle, and a vehicle provided with such a step unit The present invention relates to a foldable step unit (10) for a rotorcraft, the step unit being provided with a bottom step (16) and a stationary support (11) that is secured to the structure of the rotorcraft (2). The step unit (10) comprises a left side beam (14) and a right beam (15) hinged on said stationary support (11), said bottom step (16) being arranged on a left free end (14′) and a right free end (15′) respectively of the left and right side beams (14, 15) via a pivot pin (16′), drive means (18) for said step unit (10) and connected via at least one control means (21, 22) to at least one side beam (14, 15) enable said step unit (10) to be retracted into and extended from a housing (2) formed in the rotorcraft (1).
US08196864B2	Seating arrangements particularly for passenger aircraft Seating arrangements for passenger aircraft or other vehicles are detailed. Some arrangements position seats at offsets from a longitudinal axis of a vehicle cabin in either “V” shapes or herringbone patterns. Other arrangements include seats that are staggered within the cabin. Further arrangements include pairs of seat that are both parallel and offset from the longitudinal axis, but are placed so that feet of the port and starboard passengers point away from the fuselage. All embodiments contemplate providing seats that are convertible to beds, although this conversion is not required.
US08196862B2	Cold fuel cooling of intercooler and aftercooler A high-altitude aircraft powerplant including an engine, a two-stage turbocharger having an intercooler and an aftercooler, a cryogenic hydrogen fuel source, and a cooling system including a hydrogen heat exchanger. Aided by a ram-air cooler that cools a coolant to a near-ambient temperature, the heat exchanger is configured to heat the hydrogen using the coolant, and to cool the coolant to a temperature well below the ambient temperature during high-altitude flight. The intercooler and aftercooler use the sub-ambient temperature coolant, as does a separate sensor. The ram-air cooler includes a front portion and a rear portion. The cooling system includes three cooling loops which respectively incorporate only the front portion, only the rear portion, and both portions of the ram-air cooler.
US08196861B2	Rear propulsion system with lateral air inlets for an aircraft with such system A propulsive system for an aircraft including an auxiliary jet engine is integrated within a tail cone of a fuselage. Lateral air intakes include each one a scoop movable between a closed position and an opened position are associated with aerodynamic channels to supply with air the auxiliary jet engine. The aerodynamic channels meet at a common channel including a movable flap to balance air flows coming from the air intakes when the operation is not symmetrical.
US08196859B2	System for attaching an engine to the structure of an aircraft, such as a sail wing aircraft A system for attaching an engine to the structure of an aircraft, such as a sail wing aircraft is disclosed. The system includes an upper beam which is firmly fixed at its front end to a first frame mounted on the aircraft structure, and firmly fixed at its median part to a second frame located to the rear of the first frame. The engine is hooked beneath the upper beam. The system is orientated in relation to a longitudinal axis X, a transverse axis Y and a vertical axis Z. Two front engine attachment points are arranged symmetrically on either side of the vertical median plane of the engine. The front attachment points include a shaft which is inclined relative to the Y-direction and to the Z-direction so that they bear the forces along the longitudinal direction and forces which are inclined relative to the Z-direction and Y-direction.
US08196855B2	Helicopter auxiliary anti-torque system A helicopter auxilary anti-torque system for efficiently supplying thrust and control at the tail of a helicopter during failure of the helicopter tail rotor. The helicopter auxilary anti-torque system generally includes a fluid thrust assembly selectively engageable onboard the helicopter, an auxiliary tail rotor selectively engageable onboard the helicopter, and at least one controller to operate the fluid thrust assembly and the auxiliary tail rotor to effect a controlled anti-torque force of the tail boom during failure of the conventional helicopter tail rotor. The fluid thrust assembly projects a non flammable fluid from the tail boom of the helicopter. The auxiliary tail rotor is collapsible within the tail boom of the helicopter when not in use. The fluid thrust assembly and the auxiliary tail rotor may be automatically activated in the case of the primary tail rotor failure, or activated by the pilot of the helicopter via one or more switches.
US08196853B2	Aerodynamically stabilized instrument platform A suspension apparatus for suspending instrumentation from an airborne platform may include a generally longitudinal boom having a payload end and a tail end. Yaw and pitch stabilizers may be disposed at the tail end of the boom. A mast that may be selectively translatable on the boom may connect the boom to a tether line of the airborne platform. The payload may be attached to the payload end of the boom. The mast may be positioned axially along the boom at the center of gravity of the combination of the payload, boom, pitch stabilizer, and yaw stabilizer.
US08196850B2	Self-clearing rasp system for automatic milling apparatus Two self-clearing radial rasp systems for automatic milling material disclosed. In addition, as examples two automatic apparatuses utilizing said rasp systems for milling material disclosed. The rasp system may include a rasp and a trimming member. The radial rasp may include a base surface that may include cutting teeth with apertures of predetermined sizes disposed adjacent the cutting teeth. The revolving radial trimming member may include radial channels which may independently partitioned for confining and directing material toward the base surface of the rasp as the material move by centrifugal force in a radial direction. The rasp may have different sizes of cutting teeth associating with the individual radial channels of the radial trimming member.
US08196846B2	Manifold for automated sprayer Disclosed are manifold assemblies for use in automated sprayers. The manifold assemblies provide passageways for cleaning fluid, venting air if venting is needed, and drainage fluid. They also provide a mount for a motor and a pump chamber. There are also check valves retained in the manifold assemblies to ensure that the flows are in the proper direction.
US08196845B2	Flexure seal for fuel injection nozzle A nozzle includes an inlet at an upstream end of the nozzle, a discharge outlet at a downstream end of the nozzle, and a fluid delivery passage extending between the inlet and the discharge outlet. Exterior and interior walls of the nozzle have downstream tip ends that are relatively longitudinally movable at one or more interfaces. An internal insulating gap is interposed between the interior and exterior walls to insulate fuel from ambient temperature conditions exterior to the nozzle. One or more flexible seal structures internal to the nozzle isolate a portion of the insulating gap from any ambient fluid entering into the gap through the one or more interfaces while providing relative movement between interior and exterior walls of the nozzle.
US08196844B2	Three-way valves and fuel injectors using the same Three-way valves having reduced leakage and fuel injectors using the same. Three-way spool poppet valves are disclosed having a spool with a poppet valve thereon cooperating with a seat on the valve housing to provide a substantially leak free valve closing in one direction characteristic of a poppet valve while preserving the advantages of a spool valve. Three-way ball valves are also disclosed having substantially leak free valves closing in both directions, but further including reduced short circuit losses due to direct flow from a high pressure supply to a low pressure vent during transition of the ball from one position to the opposite position. Fuel injectors with direct needle control using the three-way valves of the present invention are also disclosed.
US08196843B2	Multi-layer piezoelectric element, injection apparatus using the same and method of multi-layer piezoelectric element A multi-layer piezoelectric element having higher durability which experience less decrease in the amount of displacement even when operated continuously over a long period of time under a high pressure and a high voltage is provided. The multi-layer piezoelectric element comprises a plurality of piezoelectric layers and a plurality of internal electrode layers, wherein the piezoelectric layers and the internal electrode layers are stacked alternately one on another, and at least one of the plurality of internal electrode layers contains at least one nitride, titanium nitride or zirconium nitride.
US08196838B2	Bar code reading device for reading 1D or 2D bar code symbols The present invention relates to a bar code reading device for reading 1D or 2D bar code symbols. The bar code reading device, in one embodiment, can receive a command to disable symbology reading. In another embodiment, a bar code reading device can have a timercount and an image memory. In one embodiment, a bar code reading device can be configured to read bar code symbols of more than one bar code symbology.
US08196836B2	Image processing apparatus, image processing method and computer-readable medium An image processing apparatus includes a first detecting unit and a second detecting unit. The first detecting unit detects a leading end portion of an information image based on a first criterion and a ratio of a width of a certain white image area in the information image to a width of a black image area being detected prior to the certain white image area. The second detecting unit takes one of the black image areas and white image areas as an image area of interest and detects a portion, other than the leading end portion, of the information image based on a second criterion and at least one of ratios of a width of the image area of interest to widths of black and white image areas being detected prior to the image area of interest.
US08196834B2	Scan engine with integrated object sensor in electro-optical readers A scan module in a reader for, and a method of, electro-optically reading symbols, include a light source for directing light at a symbol during reading, a light detector for detecting return light from the symbol during reading and for generating an electrical signal indicative of the detected return light, and an object sensor for sensing an object bearing the symbol and for generating a trigger signal for initiating the reading. The light source, the light detector and the object sensor are all supported by a common chassis.
US08196833B2	Hybrid synthetic barcode and RFID system and method A management system utilizes compact, reliable, adaptable, and cost effective article identifying synthetic barcode modules, which obviate printed barcodes. The modules are programmable, detect the presence of a conventional laser barcode scanner and communicate information optically in a form readable by a detected conventional laser barcode scanner. The system is compatible with network communication, allowing real-time monitoring and updating. Additionally, the system optionally includes radio frequency identification capability. An exemplary synthetic barcode module employs a single LED as a photodiode to sense the presence of a barcode scanner and as a light source to emit light that emulates light reflected from a scanned barcode. The LED enables bidirectional half-duplex optical communication.
US08196832B2	Reprogramming system and method for devices including programming symbol A system and method is provided wherein a device can be reprogrammed utilizing one or more programming symbols. A device subject to reprogramming can be a portable device. In one embodiment a device subject to reprogramming can be a portable symbol reading device capable of reading programming symbols.
US08196831B2	Systems and methods for power supply synchronization in radio frequency identification (RFID) readers A system for power supply synchronization in an Radio Frequency Identification (RFID) reader is shown and described. In one embodiment, the system includes one or more switched mode power supply devices and a signal generator. Each of the switched mode power supply devices provides power to at least one component of the RFID reader. The signal generator transmits a synchronization signal of a controlling frequency to each of the one or more power supply devices. In one embodiment, the system includes a signal processing unit that is configured to reject one or more spectral components from the output of the RFID reader.
US08196828B2	Assisted sighting system for snipers A spotter scope including an illuminator that generates a ranging signal is disclosed. The spotter scope further includes an imaging device with a focal plane array which detects backscatter radiation created by the ranging signal, and a controller which calculates a distance to a target. The controller also creates a wind profile between the spotter scope and the target based on scintillation statistics of backscatter detected by the focal plane array and provides corrective aiming instructions based on the wind profile.
US08196823B2	Optical lock systems and methods In one embodiment, the optical lock system may include an electronic control unit, a lock housing including a lock chamber, and an optical key including a multilayer photonic structure. The multilayer photonic structure may produce a unique intensity profile and includes a plurality of coating layers of high index dielectric material and a plurality of coating layers of low index dielectric. A light source may transmit a reference light to the multilayer photonic structure when the optical key is disposed within the lock chamber. A photo detector may receive an interaction light from the multilayer photonic structure and may transmit the unique intensity profile to the electronic control unit which may execute machine readable instructions to: compare the unique intensity profile to an electronic master; and cause the lock actuator to transition from a first state to a second state when the unique intensity profile corresponds to the electronic master.
US08196818B2	Apparatus and method for integrated payment and electronic merchandise transfer Interrogation of an electronic device by a first terminal is facilitated, to obtain an account number associated with the electronic device. The electronic device is configured according to a payment specification. The first terminal has a first terminal payment module configured according to the payment specification and a first terminal electronic merchandise module configured according to the electronic merchandise infrastructure and coupled to the first terminal payment module to permit transfer of non-payment e-merchandise related information from the first terminal electronic merchandise module to the first terminal payment module. The interrogation of the electronic device is performed by the first terminal payment module. Generation of non-payment e-merchandise related information by the first terminal electronic merchandise module is facilitated. Transfer of the non-payment e-merchandise related information from the first terminal electronic merchandise module to the electronic device via the first terminal payment module, within a transaction between the electronic device and the first terminal payment module that is conducted in accordance with the payment specification, is also facilitated. The non-payment e-merchandise related information is stored on the electronic device in accordance with the payment specification. The electronic device and the first terminal independently calculate a summary data item. The first terminal calculates a first message authentication code based on the non-payment e-merchandise related information and a terminal-calculated value of the summary data item. The non-payment e-merchandise related information is stored on the electronic device together with an electronic device-calculated value of the summary data item and the first message authentication code.
US08196808B2	System and method for preserving historical information for viewing by posterity A system and method that will enable individuals or organizations to store any digital information they wish to preserve for posterity. According to typical methodology, the individual may establish an account with a service provider through which information may be collected for posterity. For example, the service provider may maintain a website to which the information can be uploaded in digital format. The account holder may access the account at any time to manipulate, edit or annotate the information.
US08196803B2	Method of manufacturing semiconductor device and wire bonding apparatus A terminal of a compact wire loop with a great strength of bonding is formed by a method including: a first folding step in which a tip end of a capillary is raised by a height of H1 from a point 86a where the center of the capillary is positioned during second bonding on a lead 74 to a point “p”, and then moved horizontally by a first distance of L1 toward a pad 73, and lowered to a point “r”; a second folding step in which the tip end of the capillary is raised from the point “r” to a height of H2 and then moved horizontally toward the lead 74 by a second distance of L2; and a third bonding step in which the center of the capillary is aligned with and then lowered to a point 87a on the lead 74 adjacent to the point 86a.
US08196802B2	Seal device and method for assembling a guide block in a gland of the seal device A seal device for a rotary shaft includes a sleeve, a gland, a ring, a guide block, and a fixing member. The guide block has an outer block surface extending circumferentially and abutting against a portion of an inner gland surface of the gland, and an inner block surface extending circumferentially and opposite to the outer block surface. The outer block surface has two circumferentially opposite outer ends. The inner block surface has two circumferentially opposite inner ends. The guide block further has two opposite end faces each of which connects one of the outer ends to one of the inner ends. The inner ends subtend an angle of not larger than 90° at a center line of the gland. At least one of the end faces lies in a plane line that is substantially tangent to an outer peripheral face of the ring.
US08196798B2	Solar substrate ribbon bonding system An ultrasonic solar substrate bonding system is provided. The system includes a first ribbon bonder including a first bonding tool, and a first ribbon feeding system configured to continuously supply a first ribbon material to the first bonding tool during bonding of the first ribbon material to a backside of each of a plurality of solar substrates. The system also includes a mechanism configured to manipulate each of the plurality of solar substrates after bonding by the first ribbon bonder to expose an opposite, frontside of each of the plurality of solar substrates for bonding. The system also includes a second ribbon bonder including a second bonding tool, and a second ribbon feeding system configured to continuously supply a second ribbon material to the second bonding tool during bonding of the second ribbon material to the frontside of each of the plurality of solar substrates.

1 2 3 4 5 6 7 8 9 10