最新美国发明专利第2011-01-04期 - 专利汇|PatentHub专利检索|专利查询网|发明专利查询分析

Document	Document Title
US07863213B2	Supported polymerization catalysts A supported catalyst for olefin polymerization comprises a selected ionic activator, a selected organometallic catalyst and a support material. The selected activator must contain an active hydrogen moeity. The organometallic catalyst is characterized by having a phosphinimine ligand and a substituted cyclopentadienyl ligand (which contains from 7 to 30 carbon atoms). The supported catalyst exhibits excellent activity in gas phase olefin polymerizations and may be used under substantially “non-fouling” polymerization conditions.
US07863211B2	Epoxidation catalyst, its use and epoxidation process in the presence of this catalyst Epoxidation catalyst based on titanium zeolite in the form of extruded granules. Use of this catalyst in the synthesis of epoxides, preferably 1,2-epoxy-3-chloropropane or 1,2-epoxypropane, by reacting an olefinic compound, preferably allyl chloride or propylene, with a peroxide compound, preferably hydrogen peroxide. Process for the preparation of an epoxide, preferably 1,2-epoxy-3-chloropropane or 1,2-epoxypropane, by reacting an olefinic compound, preferably allyl chloride or propylene, with a peroxide compound, preferably hydrogen peroxide, in the presence of the aforementioned catalyst.
US07863210B2	Nano-linked metallocene catalyst compositions and their polymer products The present invention provides polymerization catalyst compositions employing novel dinuclear metallocene compounds. Methods for making these new dinuclear metallocene compounds and for using such compounds in catalyst compositions for the polymerization and copolymerization of olefins are also provided.
US07863204B2	Substrate processing apparatus, heating apparatus for use in the same, method of manufacturing semiconductors with those apparatuses, and heating element supporting structure A substrate treating device comprising a treatment chamber for storing and treating substrates and a heating device having a heating element and a heat insulator and heating the substrates in the treatment chamber by the heating element. The heating element is so formed that only its one end is held by a holding part, and a projection projected to the treatment chamber side at the intermediate part of the heating element and positioned in proximity to or in contact with the heating element is formed on the heat insulator. A pin with an enlarged part is passed through the heating element and the heat insulator at the intermediate part of the heating element and the enlarged part is positioned in proximity to or in contact with the heating element. The plurality of projections may be formed on the heat insulator and the pins may be disposed between these plurality of projections.
US07863202B2	High dielectric constant materials An integrated circuit can be formed with a high-k dielectric layer. A first titanium oxide layer is deposited over a substrate using a first ALD process. A first metal oxide layer is also deposited over the substrate using a second ALD process. A second titanium oxide layer is deposited over the substrate using a third ALD process and a second metal oxide layer is deposited over the substrate using a fourth ALD process. The first and second metal oxides are preferably strontium oxide and/or aluminum oxide.
US07863200B2	Process of vapor depositing glass layers for wafer-level hermetic encapsulation of electronic modules A process to encapsulate electronic modules in a manner which is substantially resistant to water diffusion yet is carried out at moderate temperatures below 300° C., preferably below 150° C. is provided. The process forms a housing for electronic modules, in particular sensors, integrated circuits and optoelectronic components. The process includes the steps of: providing a substrate, of which at least a first substrate side is to be encapsulated; providing a vapor-deposition glass source; arranging the first substrate side in such a manner with respect to the vapor-deposition glass source that the first substrate side can be vapor-coated; and vapor-coating the first substrate side with a glass layer.
US07863197B2	Method of forming a cross-section hourglass shaped channel region for charge carrier mobility modification A method for fabricating the semiconductor structure include a semiconductor substrate having a cross-section hourglass shaped channel region. A stress imparting layer is located adjacent the channel region. The hourglass shape may provide for enhanced vertical tensile stress within the channel region when it is longitudinally compressive stressed by the stress imparting layer.
US07863194B2	Implantation of multiple species to address copper reliability A first species and a second species are implanted into a conductor of a substrate, which may be copper. The first species and second species may be implanted sequentially or at least partly simultaneously. Diffusion of the first species within the conductor of the substrate is prevented by the presence of the second species. In one particular example, the first species is silicon and the second species is nitrogen, although other combinations are possible.
US07863192B2	Methods for full gate silicidation of metal gate structures One embodiment relates to a method of fabricating an integrated circuit. In the method, p-type polysilicon is provided over a semiconductor body, where the p-type polysilicon has a first depth as measured from a top surface of the p-type polysilicon. An n-type dopant is implanted into the p-type polysilicon to form a counter-doped layer at the top-surface of the p-type polysilicon, where the counter-doped layer has a second depth that is less than the first depth. A catalyst metal is provided that associates with the counter-doped layer to form a catalytic surface. A metal is deposited over the catalytic surface. A thermal process is performed that reacts the metal with the p-type polysilicon in the presence of the catalytic surface to form a metal silicide. Other methods and devices are also disclosed.
US07863186B2	Fully and uniformly silicided gate structure and method for forming same Fully and uniformly silicided gate conductors are produced by deeply “perforating” silicide gate conductors with sub-lithographic, sub-critical dimension, nanometer-scale openings. A silicide-forming metal (e.g. cobalt, tungsten, etc.) is then deposited, polysilicon gates, covering them and filling the perforations. An anneal step converts the polysilicon to silicide. Because of the deep perforations, the surface area of polysilicon in contact with the silicide-forming metal is greatly increased over conventional silicidation techniques, causing the polysilicon gate to be fully converted to a uniform silicide composition. A self-assembling diblock copolymer is used to form a regular sub-lithographic nanometer-scale pattern that is used as an etching “template” for forming the perforations.
US07863184B1	System and method for reducing corrosion of an integrated circuit through its bond pads A bond pad structure has a first conductive layer and an anti-reflective coating layer disposed on the first conductive layer. The first conductive layer includes first and second portions (which could be formed by etching). Part of the first portion is exposed within a bond pad opening, and the second portion is electrically connected to an integrated circuit. The anti-reflective coating layer also includes first and second portions (which could be formed by etching). The first portion may be located near the bond pad opening, and the second portion may be located farther away from the bond pad opening. A second conductive layer electrically connects the first and second portions of the first conductive layer. In this way, the first portion of the anti-reflective coating layer may undergo oxidation without leading to oxidation of the second portion of the anti-reflective coating layer.
US07863182B2	Dicing die-bonding film The invention relates to a dicing die-bonding film having a pressure-sensitive adhesive layer (2) on a substrate material (1) and a die-bonding adhesive layer (3) on the pressure-sensitive adhesive layer (2), wherein the adhesion of the pressure-sensitive adhesive layer (2) to the die-bonding adhesive layer (3), as determined under the conditions of a peel angle of 15° and a peel point moving rate of 2.5 mm/sec. at 23° C., is different between a region (2a) corresponding to a work attachment region (3a) and a region (2b) corresponding to a part or the whole of the other region (3b), in the die-bonding adhesive layer (3), and satisfies the following relationship: adhesion of the pressure-sensitive adhesive layer (2a)
US07863180B2	Through substrate via including variable sidewall profile A microelectronic structure, such as a semiconductor structure, and a method for fabricating the microelectronic structure, include an aperture within a substrate. Into the aperture is located and formed a via. The via may include a through substrate via. The aperture includes, progressing sequentially contiguously at least partially through the substrate: (1) a first comparatively wide region at a surface of the substrate; (2) a constricted region contiguous with the first comparatively wide region; (3) a second comparatively wide region contiguous with the constricted region; and (4) a tapered region contiguous with the second comparatively wide region. The structure of the aperture provides for ease in filling the aperture, as well as void isolation within the via that is filled into the aperture.
US07863175B2	Zero interface polysilicon to polysilicon gate for flash memory A system and method are disclosed for processing a zero angstrom oxide interface dual poly gate structure for a flash memory device. An exemplary method can include removing an oxide on a surface of a first poly layer and forming a second poly layer on the first poly layer in a same processing chamber. A transfer of the structure is not needed from an oxide removal tool to, for example, a poly layer formation tool, an implant tool, and the like. As a result, impurities containing a silicon oxide caused by exposure of the first poly layer to an oxygen-containing atmosphere do not form at the interface of the first and second poly layers.
US07863174B2	Vertical pillar transistor A vertical pillar transistor may include a plurality of lower pillars, a plurality of upper pillars, a first insulation part, a second insulation part and a word line. The plurality of lower pillars protrudes substantially perpendicular to a substrate and is defined by a plurality of trenches. The plurality of lower pillars extends along a second direction and may be separated from each other along a first direction substantially perpendicular to the second direction. The plurality of upper pillars may be formed on the plurality of lower pillars. The plurality of upper pillars has a width substantially smaller than that of the plurality of lower pillars. The first insulation part has a substantially uniform thickness on a sidewall of each of the plurality of lower pillars. The second insulation part may be formed on the first insulation part to fill a gap between the adjacent upper pillars. The word line may be formed on the second insulation part and may extend between facing sidewalls of the adjacent pair of upper pillars along the first direction.
US07863162B2	Semiconductor device and manufacturing method thereof A manufacturing method of a semiconductor device in which the oxygen and carbon concentrations are reduced at the interface of each layer making up the semiconductor multilayer film. A first semiconductor layer is formed on a single-crystal substrate in a first reactor; the substrate is transferred from the first reactor to a second reactor through a transfer chamber; and a second semiconductor layer is formed on the first semiconductor layer in the second reactor. During substrate transfer, hydrogen is supplied when the number of hydrogen atoms bonding with the surface atoms of the first semiconductor layer is less than the number of surface atoms of the first semiconductor layer, and the supply of hydrogen is stopped when the number of hydrogen atoms bonding with the surface atoms of the first semiconductor layer is greater than the number of surface atoms of the first semiconductor layer.
US07863159B2	Semiconductor die separation method According to the invention, die shift is reduced or substantially eliminated, by cutting the wafer in two stages. In some embodiments a first wafer cutting procedure is carried out prior to thinning the wafer to the prescribed die thickness; and in other embodiments the wafer is thinned to the prescribed die thickness prior to carrying out a first wafer cutting procedure. The first wafer cutting procedure includes cutting along a first set of streets to a depth greater than the prescribed die thickness and optionally along a second set of streets to a depth less than the die thickness. The result of the first cutting procedure is an array of strips or blocks of die, each including a plurality of connected die, that are less subject to shift than are individual singulated die. In a second wafer cutting procedure the die are singulated by cutting through along the second set of streets. Subsequent to the first cutting procedure, and prior to the second cutting procedure, additional die preparation procedures that are sensitive to die shift may be carried out.
US07863157B2	Method and structure for fabricating solar cells using a layer transfer process A photovoltaic cell device, e.g., solar cell, solar panel, and method of manufacture. The device has an optically transparent substrate comprises a first surface and a second surface. A first thickness of material (e.g., semiconductor material, single crystal material) having a first surface region and a second surface region is included. In a preferred embodiment, the surface region is overlying the first surface of the optically transparent substrate. The device has an optical coupling material provided between the first surface region of the thickness of material and the first surface of the optically transparent material. A second thickness of semiconductor material is overlying the second surface region to form a resulting thickness of semiconductor material.
US07863149B2	Method for fabricating a capacitor In a method for fabricating a capacitor that includes an electrode structure (80), an auxiliary layer (40) is formed over a substrate (10). A recess (60), which determines the shape of the electrode structure (80), is etched into the auxiliary layer (40), and the electrode structure of the capacitor is formed in the recess. As an example, the auxiliary layer can be a semiconductor layer (40).
US07863148B2	Method for integrating SiGe NPN and vertical PNP devices According to one exemplary embodiment, a method for forming an NPN and a vertical PNP device on a substrate comprises forming an insulating layer over an NPN region and a PNP region of the substrate. The method further comprises forming a buffer layer on the insulating layer and forming an opening in the buffer layer and the insulating layer in the NPN region, where the opening exposes the substrate. The method further comprises forming a semiconductor layer on the buffer layer and in the opening in the NPN region, where the semiconductor layer has a first portion situated in the opening and a second portion situated on the buffer layer in the PNP region. The first portion of the semiconductor layer forms a single crystal base of the NPN device and the second portion of the semiconductor layer forms a polycrystalline emitter of the vertical PNP device.
US07863141B2	Integration for buried epitaxial stressor Structures and methods of fabricating isolation regions for a semiconductor device. An example method comprises the following. We form one or more buried doped regions in a substrate. We form a stressor layer over the substrate. We form a strained layer over the stressor layer. We form STI trenches down through the strained layer and the stressor layer to as least partially expose the buried doped regions. We etch the buried doped regions to form at least a buried cavity in communication with the STI trenches. In the first and second embodiments, we fill only the STI trenches with insulation material to form isolation regions and form voids in the cavities. In the third and fourth embodiments, we fill both the STI trenches and the cavities with insulation material.
US07863139B2	Double gate FET and fabrication process A method of fabricating a double gate FET on a silicon substrate includes the steps of sequentially epitaxially growing a lower gate layer of crystalline rare earth silicide material on the substrate, a lower gate insulating layer of crystalline rare earth insulating material, an active layer of crystalline semiconductor material, an upper gate insulating layer of crystalline rare earth insulating material, and an upper gate layer of crystalline rare earth conductive material. The upper gate layer and the upper gate electrically insulating layer are etched and a contact is deposited on the upper gate layer to define an upper gate structure. An impurity is implanted into the lower gate layer to define a lower gate area aligned with the upper gate structure. A source and drain are formed in the active layer and contacts are deposited on the source and drain, respectively.
US07863138B2	Methods of forming nano line structures in microelectronic devices A method of forming a microelectronic device includes forming a groove structure having opposing sidewalls and a surface therebetween on a substrate to define a nano line arrangement region. The nano line arrangement region has a predetermined width and a predetermined length greater than the width. At least one nano line is formed in the nano line arrangement region extending substantially along the length thereof and coupled to the surface of the groove structure to define a nano line structure. Related devices are also discussed.
US07863136B2	Method of manufacturing integrated circuits including a FET with a gate spacer and a fin A method of manufacturing integrated circuits including a FET with a gate spacer. One embodiment provides forming a lamella of a semiconductor material and two insulator structures on opposing sides of the lamella. The lamella is recessed. A fin is formed from a central portion of the lamella. The fin is thinner than a first and a second portion of the lamella which face each other on opposing sides of the fin. A first spacer structure is formed which encompasses a first portion of the fin, the first portion adjoining to the first lamella portion. A gate electrode is disposed adjacent to the first spacer structure and encompasses a further portion of the fin on a top side and on two opposing lateral sides.
US07863135B2	Method of manufacturing a nonvolatile semiconductor memory device, and a nonvolatile semiconductor memory device For enhancing the high performance of a non-volatile semiconductor memory device having an MONOS type transistor, a non-volatile semiconductor memory device is provided with MONOS type transistors having improved performance in which the memory cell of an MONOS non-volatile memory comprises a control transistor and a memory transistor. A control gate of the control transistor comprises an n-type polycrystal silicon film and is formed over a gate insulative film comprising a silicon oxide film. A memory gate of the memory transistor comprises an n-type polycrystal silicon film and is disposed on one of the side walls of the control gate. The memory gate comprises a doped polycrystal silicon film with a sheet resistance lower than that of the control gate comprising a polycrystal silicon film formed by ion implantation of impurities to the undoped silicon film.
US07863131B2	Semiconductor device and manufacturing method for semiconductor device to reduce the lithography masks Semiconductor device and manufacturing method for reducing the number of required lithography masks added to the nonvolatile memory in the standard CMOS process to shorten the production period and reduce costs. In a split-gate memory cell with silicided gate electrodes utilizing a sidewall structure, a separate auxiliary pattern is formed adjoining the selected gate electrodes. A contact is set on a wiring layer self-aligned by filling side-wall gates of polysilicon in the gap between the electrodes and auxiliary pattern. The contact may overlap onto the auxiliary pattern and device isolation region, in an optimal design considering the size of the occupied surface area. If the distance to the selected gate electrode is x, the ONO film deposit thickness is t, and the polysilicon film deposit thickness is d, then the auxiliary pattern may be separated just by a distance x such that x<2×(t+d).
US07863130B2	Tunable stressed polycrystalline silicon on dielectrics in an integrated circuit System and method for creating stressed polycrystalline silicon in an integrated circuit. A preferred embodiment includes manufacturing an integrated circuit, including forming a trench in an integrated circuit substrate, forming a cavity within the integrated circuit substrate, wherein the cavity is linked to the trench, depositing a dielectric layer within the cavity, and depositing polycrystalline silicon over the dielectric layer, wherein an inherent stress is induced in the polycrystalline silicon that grows on the dielectric layer. The dielectric layer may be, for example, silicon aluminum oxynitride (SiAlON), mullite (3Al2O3.2SiO2), and alumina (Al2O3).
US07863129B2	Method for manufacturing semiconductor device A method for manufacturing a semiconductor device includes forming an oxide film uniformly in a trench in the device isolation by, for example, a radical oxidation process. The method also includes increasing the thickness of the oxide film positioned at recess sidewalls by forming a gate oxide film. Manufacturing the device according to this method will prevent junction leakage and maintain a gate oxidation intensity characteristic that will improve the refresh characteristic of the device.
US07863126B2	Fabrication of a CMOS structure with a high-k dielectric layer oxidizing an aluminum layer in PFET region A method for fabricating a CMOS structure is disclosed. The method includes the blanket disposition of a high-k gate insulator layer in an NFET device and in a PFET device, and the implementation of a gate metal layer over the NFET device. This is followed by a blanket disposition of an Al layer over both the NFET device and the PFET device. The method further involves a blanket disposition of a shared gate metal layer over the Al layer. When the PFET device is exposed to a thermal annealing, the high-k dielectric oxidizes the Al layer, thereby turning the Al layer into a PFET interfacial control layer, while in the NFET device the Al becomes a region of the metal gate.
US07863125B2	Manufacturing method of CMOS type semiconductor device, and CMOS type semiconductor device The manufacturing method of the CMOS type semiconductor device which can suppress the boron penetration from the gate electrode of the pMOS transistors to the semiconductor substrate in the case that boron is contained in the gate electrodes, while enabling the improvement in the NBTI lifetime of the pMOS transistors, without degrading the performance of the nMOS transistors, is offered. The manufacturing method of the CMOS type semiconductor device concerning the present invention has the following process steps. Halogen is introduced to the semiconductor substrate of pMOS transistor formation areas. Next, a gate insulating film is formed on the semiconductor substrate of the pMOS transistor formation areas. Next, nitrogen is introduced to the gate insulating film.
US07863123B2	Direct contact between high-κ/metal gate and wiring process flow A low resistance contact is formed to a metal gate or a transistor including a High-κ gate dielectric in a high integration density integrated circuit by applying a liner over a gate stack, applying a fill material between the gate stacks, planarizing the fill material to support high-resolution lithography, etching the fill material and the liner selectively to each other to form vias and filling the vias with a metal, metal alloy or conductive metal compound such as titanium nitride.
US07863121B2	Method for fabricating Schottky barrier tunnel transistor A Schottky barrier tunnel transistor includes a gate electrode, and source and drain regions. The gate electrode is formed over a channel region of a substrate to form a Schottky junction with the substrate. The source and drain regions are formed in the substrate exposed on both sides of the gate electrode.
US07863115B2	Flat-panel display semiconductor process for efficient manufacturing An embodiment is a method and apparatus to fabricate a flat panel display. A poly-last structure is formed for a display panel using an amorphous silicon or amorphous silicon compatible process. The poly-last structure has a channel silicon precursor. The display panel is formed from the poly-last structure using a polysilicon specific or polysilicon compatible process.
US07863114B2	Manufacturing method of semiconductor device The present invention provides a method for removing a metal element effectively from a crystalline semiconductor film obtained with the use of the metal element, without increasing the number of processes. In the present invention, an amorphous semiconductor film is formed on an insulating surface, a metal element for promoting crystallization is added to the amorphous semiconductor film, the amorphous semiconductor film is heated to form a crystallized semiconductor film, a continuous wave laser beam is irradiated to the crystallized semiconductor film, and an upper portion of the crystallized semiconductor film is removed.
US07863108B2	Integrated circuit packaging system with etched ring and die paddle and method of manufacture thereof A method of manufacture of an integrated circuit packaging system is provided including: forming a D-ring includes half etching a paddle, etching a ring, and etching a tie bar. The tie bar is between the paddle and the ring. The system further includes mounting an integrated circuit die on a central portion of the D-ring, connecting the integrated circuit die and the D-ring, and encapsulating the integrated circuit die and a portion of the D-ring.
US07863101B2	Stacking semiconductor device and production method thereof In a stacking semiconductor device in which a first-layer and a second-layer semiconductor devices are stacked and bonded with a solder, warpage occurs due to a difference in thermal expansion coefficient of constituent members or a difference in elastic modulus of individual members. Therefore, between the first-layer and the second-layer semiconductor devices are provided an external connection terminal of solder and a thermosetting resin, and the stacking semiconductor device is heated at 150 to 180° C., which are the temperatures of preheating for reflow of the solder, for 30 to 90 seconds. Thereby the warpage of the first-layer semiconductor device is reduced and the thermosetting resin is cured completely in this state. Then, the temperature is raised to a reflow temperature of the solder and solder bonding using the external connection terminal is performed. Thereby, the bonding reliability of a solder-bonded portion of the stacking semiconductor device is considerably improved.
US07863100B2	Integrated circuit packaging system with layered packaging and method of manufacture thereof A method of manufacture of an integrated circuit packaging system includes: forming a base package having a base interposer; forming an intermediate package having an intermediate interposer and an intermediate package embedded link trace, the intermediate package embedded link trace being encapsulated in an intermediate package mold compound; forming a cap package having a cap interposer; and connecting the intermediate package to the cap package and the base package using the intermediate package embedded link trace.
US07863097B2	Method of preparing detectors for oxide bonding to readout integrated chips In one embodiment, a method of preparing detectors for oxide bonding to an integrated chip, e.g., a readout integrated chip, includes providing a wafer having a plurality of detector elements with bumps thereon. A floating oxide layer is formed surrounding each of the bumps at a top portion thereof. An oxide-to-oxide bond is formed between the floating oxide layer and an oxide layer of the integrated chip which is provided in between corresponding bumps of the integrated chip. The oxide-to-oxide bond enables the bumps on the detector elements and the bumps on the integrated chip to be intimately contacted with each other, and removes essentially all mechanical stresses on and between the bumps. In another embodiment, a device has an interconnect interface that includes the oxide-to-oxide bond and an electrical connection between the bumps on the detector elements and the bumps on the integrated chip.
US07863096B2	Embedded die package and process flow using a pre-molded carrier An embedded die package includes a carrier with an electrical device in the cavity of the carrier, a first dielectric layer covering the sides and top of the electrical device except for vias over selected bonding pads of the electrical device, a plurality of metal conductors, each of which is in contact with at least one of the vias, one or more additional dielectric layers lying over the metal conductors and the first dielectric layer, wherein a top layer of the one or more dielectric layers has openings with metalization underneath coupled to at least one of the metal conductors, and solder bumps protruding from each of the openings.
US07863095B2	Method of manufacturing layered chip package A layered chip package includes a plurality of layer portions stacked, each layer portion including a semiconductor chip having a first surface with a device formed thereon and a second surface opposite thereto. The plurality of layer portions include at least a pair of layer portions disposed such that the first surfaces of the respective semiconductor chips face toward each other. A manufacturing method for the layered chip package includes the steps of: fabricating a layered substructure by stacking a plurality of substructures each including a plurality of layer portions corresponding to the plurality of layer portions of the layered chip package; and fabricating a plurality of layered chip packages by using the layered substructure. The step of fabricating the layered substructure includes: fabricating a first and a second pre-polishing substructure each having a first surface and a second surface; bonding the pre-polishing substructures to each other such that their respective first surfaces face toward each other; and forming a first and a second substructure by polishing the second surfaces.
US07863088B2	Semiconductor device including covering a semiconductor with a molding compound and forming a through hole in the molding compound A semiconductor device and method is disclosed. In one embodiment, the method includes placing a first semiconductor over an electrically conductive carrier. The first semiconductor is covered with a molding compound. A through hole is formed in the molding compound. A first material is deposited in the through hole.
US07863086B2	Thin film transistor substrate and method for fabricating the same A thin film transistor substrate includes an insulating substrate, a gate electrode formed on the insulating substrate, a first gate insulating film formed on the gate electrode and having an opening for exposing at least part of the gate electrode, a second gate insulating film covering the gate electrode exposed by the opening and having a larger dielectric constant than the first gate insulating film, a source electrode and a drain electrode disposed apart from each other in a central area of the second gate insulating film and defining a channel region there between, and an organic semiconductor layer formed in the channel region. A method for forming the TFT substrate is also provided. Thus, the present invention provides a TFT substrate in which a characteristic of a TFT is improved.
US07863084B2	Contact fabrication of emitter wrap-through back contact silicon solar cells Back contact solar cells including rear surface structures and methods for making same. The rear surface has small contact areas through at least one dielectric layer, including but not limited to a passivation layer, a nitride layer, a diffusion barrier, and/or a metallization barrier. The dielectric layer is preferably screen printed. Large grid areas overlay the dielectric layer. The methods provide for increasing efficiency by minimizing p-type contact areas and maximizing n-type doped regions on the rear surface of a p-type substrate.
US07863081B2	Field effect transistor and method of manufacturing the same Provided is a field effect transistor having an organic semiconductor layer, in which crystal grains having a maximum diameter of 10 μm or more account for 25% or more of the surface area of the organic semiconductor layer. The organic semiconductor layer preferably contains 7 to 200 crystal grains having a maximum diameter of 10 μm or more per 0.01 mm2. The organic semiconductor layer preferably contains a porphyrin crystal.
US07863078B2	Method for making an anti-reflection film of a solar cell A method is disclosed for making an anti-reflection film of a solar cell. The method includes the step of providing a laminate. The laminate includes a ceramic substrate, a titanium-based compound film, a p+ type poly-silicon back surface field, a p− type poly-silicon light-soaking film and an n+ type poly-silicon emitter. The laminate is passivated with SiCNO:Ar plasma in a plasma-enhanced vapor deposition device, thus filling the dangling bonds of the silicon atoms at the surface of the n+ type poly-silicon emitter, the dangling bonds of the silicon grains at the grain boundaries of the p− type poly-silicon light-soaking film and the dangling bonds of the silicon atoms in the p+ type poly-silicon back surface field. Finally, the n+ type poly-silicon emitter is coated with an anti-reflection film of SiCN/SiO2.
US07863076B2	Solid-state image pickup device, method for making same, and image pickup apparatus Disclosed herein is a solid-state image pickup device which includes: a light-receiving unit for photoelectric conversion of incident light; and a charge transfer unit of an n-channel insulating gate type configured to transfer a signal charge photoelectrically converted in the light-receiving unit; wherein the charge transfer unit has an insulating film formed on a transfer electrode and having a negative fixed charge.
US07863074B2	Patterning electrode materials free from berm structures for thin film photovoltaic cells A method for forming a thin film photovoltaic device having patterned electrode films includes providing a soda lime glass substrate with an overlying lower electrode layer comprising a molybdenum material. The method further includes subjecting the lower electrode layer with one or more pulses of electromagnetic radiation from a laser source to ablate one or more patterns associated with one or more berm structures from the lower electrode layer. Furthermore, the method includes processing the lower electrode layer comprising the one or more patterns using a mechanical brush device to remove the one or more berm structures followed by treating the lower electrode layer comprising the one or more patterns free from the one or more berm structures. The method further includes forming a layer of photovoltaic material overlying the lower electrode layer and forming a first zinc oxide layer overlying the layer of photovoltaic material.
US07863072B2	Micromechanical diaphragm sensor having a double diaphragm A method for producing a micromechanical diaphragm sensor, and a micromechanical diaphragm sensor produced with the method. The micromechanical diaphragm sensor has at least one first diaphragm as well as a second diaphragm, which is disposed essentially on top of the first diaphragm. Furthermore, the micromechanical diaphragm sensor has a first cavity and a second cavity, which is essentially disposed above the first cavity.
US07863068B2	Method for making a light emitting diode having a P-N junction doped with one or more luminescent activator ions A light emitting diode (LED) includes a p-n junction containing luminescent activator ions. The visible emission from the activator ions preferably complementing the band edge emission of the LED in order to produce an overall white emission from the LED. In a preferred embodiment, the LED has double heterojunction structure having a semiconductor active layer between two confinement layers. The semiconductor active layer includes activator ions preferably selected from among Eu3+, Tb3+, Dy3+, Pr3+, Tm3+, and Mn2+. The electron-hole pairs trapped within the active layer sensitize the activator ions, causing the activator ions to emit light.
US07863066B2	Method for making a multiple-wavelength opto-electronic device including a superlattice A method for making a multiple-wavelength opto-electronic device which may include providing a substrates and forming a plurality of active optical devices to be carried by the substrate and operating at different respective wavelengths. Moreover, each optical device may include a superlattice comprising a plurality of stacked groups of layers, and each group of layers may include a plurality of stacked semiconductor monolayers defining a base semiconductor portion and at least one non-semiconductor monolayer thereon.
US07863065B2	Display substrate and method for manufacturing the same A method of forming a display substrate includes forming an array layer on a substrate, forming a passivation layer on the array layer, forming a photoresist pattern on the passivation layer corresponding to a gate line, a source line and a thin-film transistor of the array layer, etching the passivation layer using the photoresist pattern as a mask Non-uniformly surface treating a surface of the photoresist pattern, forming a transparent electrode layer on the substrate having the surface-treated photoresist pattern formed thereon and forming a pixel electrode. The forming a pixel electrode includes removing the photoresist pattern and the transparent electrode layer, such as by infiltrating a strip solution into the surface-treated photoresist pattern.
US07863064B2	Method of manufacturing organic light emitting display and organic light emitting display A method of manufacturing an organic light emitting display includes: forming a transistor on a substrate; forming a cathode electrode on the transistor to be connected to a source or a drain of the transistor; forming a bank layer having an opening on the cathode electrode; allowing a natural oxide layer to form on the cathode electrode; removing the natural oxide layer from the cathode electrode; forming an insulating buffer layer on the cathode electrode; forming an organic light emitting layer on the insulating buffer layer; and forming an anode electrode on the organic light emitting layer.
US07863062B2	Semiconductor device with a shielding section to prevent condensation and optical device module having the semiconductor device In a solid-state imaging device 1 in which a hollow section 9 is formed between a solid-state imaging element 2 and a covering section 4 and an air path 7 extending from the hollow section 9 to the outside is formed in an adhesive section 5, a shielding section 11 for shielding the air path 7 is formed on the air path 7 so as to be positioned on a portion exposed from the covering section 4. This makes it possible to reduce noises occurring in a signal processing section of a semiconductor element while preventing condensation in the covering section for covering the semiconductor element.
US07863061B2	Surface emitting laser manufacturing method, surface emitting laser array manufacturing method, surface emitting laser, surface emitting laser array, and optical apparatus including surface emitting laser array Provided is a surface emitting laser manufacturing method, etc., which reduces process damage occurring to a surface relief structure, enabling stable provision of a single transverse mode characteristic. Provided is a method including a surface relief structure for controlling a reflectance in a light emitting portion of an upper mirror, the surface relief structure including a stepped structure, includes: forming a resist pattern including a pattern for forming a mesa structure and a pattern for forming a stepped structure, on or above the upper mirror, and performing first-phase etching for etching the surface layer of the upper mirror to determine the horizontal position of the stepped structure; forming a current confining structure after the performing first-phase etching; and performing second-phase etching for further etching the area that the first-phase etching has been performed, to determine the depth position of the stepped structure, after the forming a current confining structure.
US07863058B2	Methods of attaching biological compounds to solid supports using triazine Disclosed are methods of attaching biologically active compounds to a solid surface, comprising modifying the solid surface using triazine chloride and attaching the biologically active compound to the triazine moiety.
US07863057B2	Method and assay for detection of residues Embodiments described herein include methods and assays for detecting an analyte in a sample using a plurality of control zone capture agents. Some embodiments include detection of multiple analytes in a sample utilizing a plurality of analyte binders and a control zone containing multiple control zone capture agents. In some embodiments, the multiple control zone capture agents capture a plurality of binders within one control zone. Test results are determined by comparison of the control zone signal to a test zone signal.
US07863055B2	Sampling system for introduction of high boiling point streams at low temperature The present invention is a method and apparatus for sampling a high-temperature gaseous process stream containing components with high boiling points. The sampling system is especially suited for instruments having extremely low pressure chambers, such as mass spectrometers. The invention reduces the condensation of high boiling point components of the sample in the sampling system without the necessity of maintaining extremely high temperatures. The gaseous sample is passed through an orifice from the high temperature stream into a lower-temperature zone of the sampling system where a low pressure is maintained by a vacuum pump. The low pressure reduces the boiling point of the sample components so they may be maintained in a gas phase without excessive heating. The low pressure sample is then introduced into an instrument chamber through a sample introduction valve.
US07863054B2	Microfluidic system, sample analysis device, and target substance detection/measurement method A microfluidic system includes a plate-shaped microfluidic chip having a flow path, a liquid introduction tube for supplying liquid to the flow path, the liquid introduction tube having an end communicating with an end of the flow path and its other end that can be soaked in the liquid that is to be supplied to the flow path, and a liquid discharge head communicating with the other end of the flow path for discharging liquid that has passed through the flow path.
US07863052B2	Grating-based sensor combining label-free binding detection and fluorescence amplification and readout system for sensor A grating-based sensor is disclosed that has a grating structure constructed and designed for both evanescent resonance (ER) fluorescence detection and label-free detection applications. Some embodiments are disclosed which are optimized for ER detection in an air mode, in which the sample is dry. Other embodiments are optimized for ER detection in liquid mode, in which the sample is suspended in liquid medium such as water. One and two-dimensional gratings are also disclosed, including gratings characterized by unit cells with central posts, central holes, and two-level, two-dimensional gratings. A readout system for such sensors is also disclosed. One embodiment includes a first light source optimized for collecting label-free detection data, a second light source optimized for collecting ER fluorescence amplification data, and at least one detector. In one embodiment, the detector is an imaging system and includes a CCD camera for collecting both ER and label-free data. In other embodiments, the at least one detector takes the form of a spectrometer for collection of label-free data and a photomultiplier for collecting ER data. In other embodiments, a single light source such as a tunable laser or broad band light source is used.
US07863050B2	Methods and compositions for purification of nucleic acid from a host cell Methods and compositions are provided for gently lysing and solubilizing cells. Methods and compositions are further provided for quickly purifying high quality low molecular weight nucleic acid from host cells. Target cells are treated with a pre-chilled lysis solution having a zwitterionic detergent, for example n-Dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, and a brief room-temperature incubation. Where nucleic acid purification is required, the lysis solution-treated cells are contacted with a nucleic acid capture matrix having an average pore size of at least about 1 μm.
US07863049B2	Noninvasive blood sugar level measuring method A noninvasive blood sugar level measurement method includes a process of changing a blood sugar level of a biological body, a process of noninvasively measuring biological feature amounts at plural measurement points that are timewise shifted from each other, a process of invasively measuring blood sugar levels of the biological body by the number of times that is lesser than the measurement points of the biological feature amount, a process of obtaining an approximate curve indicating temporal change in the actually measured blood sugar level that is obtained by the invasive measurement, a process of obtaining, using the obtained approximate curve, blood sugar levels (interpolation blood sugar levels) that would be obtained by the invasive measurement at the measurement times when the biological feature amounts are noninvasively measured, and a process of associating the values of the biological feature amounts at the times corresponding to the respective measurement points of the biological feature amounts with the interpolation blood sugar levels at the respective times, thereby forming a correlation table having plural sets of the biological feature amounts and the interpolation blood sugar levels. Therefore, even when the change in the biological feature amount relative to the blood sugar level is not monotonous, it is possible to form a precise correlation table without increasing the number of times of the invasive blood sugar level measurement.
US07863043B2	Stem cell populations and methods of use Populations of stem cells and methods for their isolation and use are provided. These stem cell populations comprise aldehyde dehydrogenase positive (ALDHbr) cells isolated from bone marrow, and ALDHbr CD105+ cells derived from any stem cell source. These populations may also comprise cells expressing such surface markers as CD34, CD38, CD41, CD45, CD105, CD133, CD135, CD117, and HLA-DR, and/or are substantially free from such cell surface markers as CD3, CD7, CD 10, CD 13, CD 14, C1319, CD33, CD35, CD56, CD 127, CD 138, and glycophorin A. The population may also comprise cells expressing CD90. The stem cell populations of the invention are isolated from a stem cell source such as bone marrow, peripheral blood, umbilical cord blood, and fetal liver. Methods of the invention comprise isolating and purifying stem cell populations from stem cell sources, and methods of using these cells to reconstitute, repair, and regenerate tissues.
US07863039B2	Organic waste treatment apparatus A composting system including a vertically-orientated vessel with mechanisms attached to a vertically oriented central mounted rotating shaft, including rotatable size reduction blade(s), agitation mechanism(s), and discharge blade/mechanism(s). The composting system includes internal size reduction mechanism for reducing the size of material introduced to the vessel. The composting system includes a loading hatch, a discharge hatch, and a source of air to maintain aerobic conditions within the vessel. In use, material introduced moves from the upper region of the vessel gravitationally and via agitation through a zone of size reduction to the lower region of the vessel. Process conditions within the vessel are controlled by an operator and via electronic control mechanism, which can monitor operating conditions such as temperature and loading rate (for example), to manage air injection, mechanical agitation and size reduction such that composting proceeds efficiently and at an optimal rate.
US07863035B2	Fluidics devices The invention relates to fluidics as used in medical and diagnostic equipment and relates further to means for purifying, abstracting, filtering, detecting and/or measuring analytes in liquid samples.
US07863034B2	Microbial streaking device A streaker device for streaking a microbial inoculum for single colonies on the surface of a solid growth medium. The streaking device has a row of spaced apart contact surfaces for contact with the surface of the solid growth medium. The spaced apart contact surfaces are resiliently flexibly supported by a common support member so as to accommodate variations in depth of growth medium. The spaced apart contact surfaces may be provided on lowermost part of axially curved portions of plastics straps, that are angled backwardly. It is found that formation of a single band can give separation into single colonies. Also provided is an automatic streaking apparatus.
US07863033B2	Lactobacillus living body activating Lactobacillus preparation and preventive or therapeutic agent for living body infection There has been effort to develop a lactobacillus that would be useful as a probiotic, and to develop a lactobacillus which would colonize and proliferate in lesions of infection, eliminating the causal bacteria.This problem was resolved by developing a Lactobacillus casei species having the following key properties. (1) The species can be grown in the presence of any of one to four amino acids as a nitrogen source necessary for growth. (2) When a growth-promoting culture medium is inoculated with the species and Escherichia coli in the same count and subjected to anaerobic mixed culturing at 37° C., the final count of lactobacilli is 50% or more of the coliform count. (3) Upon cultivation in an appropriate culture medium, the final pH value is 4.0 or below, and the highest acidity is 1.5% or more. (4) The species is resistant to 5% bile salts. (5) The species produces an antibiotic.
US07863031B2	Phytases and methods of making and using them The invention provides a purified, isolated, synthetic or recombinant phytase enzyme (e.g., SEQ ID NO:2) initially derived from Escherichia coli B. The enzyme has a molecular weight of about 47.1 kilodaltons and has phytase activity (SEQ ID NO:2). The enzyme can be produced from native or recombinant host cells and can be used to aid in the digestion of phytate where desired. In particular, the phytase of the present invention can be used in foodstuffs to improve the feeding value of phytate rich ingredients.
US07863027B2	Process for enzymatically converting glycolonitrile to glycolic acid A process is provided to improve the specific activity of an enzyme catalyst having nitrilase activity when converting glycolonitrile to glycolic acid under aqueous reaction conditions. Inclusion of an effective amount of at least one amine protectant improves the specific activity and catalytic productivity of the enzyme catalyst.
US07863021B2	Genetic polymorphisms associated with rheumatoid arthritis, methods of detection and uses thereof The present invention provides compositions and methods based on genetic polymorphisms that are associated with autoimmune disease, particularly rheumatoid arthritis. For example, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by these nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and variant proteins, and methods of using the nucleic acid molecules and proteins as well as methods of using reagents for their detection.
US07863020B2	Production of sialylated N-glycans in lower eukaryotes The present invention relates to eukaryotic host cells which have been modified to produce sialylated glycoproteins by the heterologous expression of a set of glycosyltransferases, including sialyltransferase and/or trans-sialidase, to become host-strains for the production of mammalian, e.g., human therapeutic glycoproteins. Novel eukaryotic host cells expressing a CMP-sialic acid biosynthetic pathway for the production of sialylated glycoproteins are also provided. The invention provides nucleic acid molecules and combinatorial libraries which can be used to successfully target and express mammalian enzymatic activities (such as those involved in sialylation) to intracellular compartments in a eukaryotic host cell. The process provides an engineered host cell which can be used to express and target any desirable gene(s) involved in glycosylation.
US07863019B2	Interleukin-15 receptors There are disclosed Interleukin-15 Receptor (IL-15R) proteins, DNAs and expression vectors encoding IL-15R, and processes for producing IL-15R as products of recombinant cell cultures.
US07863015B2	Method and device for carrying out biochemical reactions with a high throughput Device, method and kit for carrying out biochemical reactions, in particular for cell-free polypeptide biosynthesis composed of an external housing which encloses an inner housing with incorporated wells and a supply chamber, wherein the wells of the inner housing each contain a producing system during the biochemical reaction, the supply chamber contains a supply liquid during the biochemical reaction and the wells of the inner housing and the supply chamber are separated by a semipermeable membrane characterized in that the inner housing has at least two wells the lower ends of which are closed by a semipermeable membrane and the upper ends of which protrude from the supply liquid contained in the supply chamber, and is connected to means for moving and incubating the producing systems and to the supply liquid.
US07863009B2	Mutants of the factor VII-activating protease and detection methods using specific antibodies Mutants of the DNA sequence coding for the protease (FSAP) which activates blood clotting factor VII and single-chain plasminogen activators, the mutants comprising a G/C base exchange at nucleotide position 1177 and/or a G/A base exchange at nucleotide position 1601, are described. The corresponding protease has a Glu/Gln exchange at amino acid position 393 and/or a Gly/Glu exchange at amino acid position 534. Diagnostic methods which are used for detecting FSAP in body fluids or tissue cells and also for identifying patients with genetic heterozygous or homozygous FSAP expression are also described. In addition, antibodies against FSAP and its mutants are disclosed and diagnostic methods which can be used to detect antibodies against FSAP and its mutants are specified.
US07863008B2	Method for detecting NANBV associated seroconversion The present invention relates to recombinant expression vectors which express segments of deoxyribonucleic acid that encode recombinant HIV and HCV antigens. These recombinant expression vectors are transformed into host cells and used in a method to express large quantities of these antigens. The invention also provides compositions containing certain of the isolated antigens, diagnostic systems containing these antigens and methods of assaying body fluids to detect the presence of antibodies against the antigens of the invention.
US07863007B2	Marker for prolonged rupture of membranes The present invention relates to amniotic fluid specific polypeptide and a method for detecting rupture of the amniotic membranes. In particular the invention provides a marker for prolonged rupture of the membranes (PROM), which marker consists essentially of polypeptides of approximately 75 kDa, 20 kDa and 50 kDa as determined by 4-15% gradient SDS-PAGE under reducing conditions.
US07863006B2	Antibodies for specifically detecting pathogenic prions of human origin, and detection methods carried out using these antibodies This application includes description of antibodies for specifically detecting prions of human origin and methods for detecting pathogenic prions. In some embodiments, the antibodies bind to an epitope characteristic of a human prion protein which is not found in the prion proteins of other species. In some embodiments, the antibodies are not cross-reactive with cow, Syrian Gold hamster, mouse, or rat prions. The application also includes a conformation-dependent immunoassay method for detecting pathogenic prions in a sample containing a prion (PrP) protein. The PrP protein may be present in a first conformation and a second conformation, such as PrPc and PrPSc in which the two conformations have different binding affinity for the antibody used to detect them.
US07863005B2	Method for detecting perilymphatic fistula It is an object of the present invention to provide a simple, reliable and low-invasive method to detect perilymph fistulas. The present invention provides a method for detecting a perilymph fistula, which comprises detecting the existence of Cochlin in body fluid existing in the middle ear.
US07863003B2	Apparatus for implementing non-destructive quality control of substrates and printed biological microarrays Apparatus implements non-destructive quality control of substrates and printed biological microarrays. A method and apparatus are provided for implementing quality control of gel-based microarrays prepared by dispensing a gel-forming composition on a solid substrate. The method utilizes the difference between the wettability properties of a supporting substrate and a gel, where the gel is hydrophilic. Condensation of vapor of a chemically inert water-soluble liquid, such as water or glycerol, on the surface of a substrate under inspection creates a layer of tiny droplets that affect both transmission and scattering of light on the surface. A pattern of condensation, characterized by spatial distribution, average size of the droplets and spacing between the droplets, reflects variation in wetting properties of the substrate. The pattern of condensation circumscribes printed microarray features to be non-destructively imaged and analyzed.
US07863002B2	Breeding and milking cows for milk free of β-casein A1 A milk or other dairy product, capable of minimising the onset of disease such as coronary heart disease or enhancing the immune response is derived from animals which are substantially free of the β-casein A allele. Bulk milk can be produced by testing for and culling cows who test positive for the β-casein A allele, or by producing immunoglobulins and other immune response proteins, in cow's milk from animals not possessing the β-casein A1 allele, or other commercial milk producing animals, to this allele, to counteract the immunosuppressant substances present that are produced from it, in commercial milking cows such as Holsteins, together with its blending with non-treated milk or the recovery of such immunoproteins.
US07863000B2	Probe, probe set and probe carrier for detecting Candida lusitaniae A probe, a set of probes, and a probe carrier on which the probe or the set of probes is immobilized, are provided for classification of fungus species. The probe or the set of probes is capable of collectively detecting fungus of the same species and distinguishingly detecting those fungus from fungus of other species. The probe is an oligonucleotide probe for detecting a pathogenic fungus DNA and includes at least one of base sequences of SEQ ID NOS. 1 to 2 and mutated sequences thereof.
US07862997B2	Primer and primer set for amplification of CEA nucleic acid, and method for assisting cancer diagnosis The present invention provides a nucleic acid amplification primer which can detect CEA mRNA. Also provided are nucleic acid amplification primer sets, methods to amplify nucleic acid for detecting mRNA of the gene that encodes CEA, and a method for assisting cancer diagnosis.
US07862995B2	Methods and materials for predicting responsiveness to treatment with dual tyrosine kinase inhibitor The present invention relates to a panel of targeted therapy markers that can be used in assessing a particular subject's sensitivity to various therapeutic agents and cancer treatments as a means of prognosticating whether a treatment or use of a particular therapeutic agent will result in a clinically positive outcome. Cellular receptors, ligands to those receptors and molecules involved in the programmed cell death pathway are examples of targeted therapy markers that might be used in the present invention.
US07862993B2	Methods for identifying agents for preventing or treating proliferative diseases, and for inhibiting extracellular matrix or α1 type IV collagen A method of detecting proliferative diseases causing sclerosis, comprising measuring the expression of at least one substance selected from the group consisting of STAT3, phosphorylated STAT3, Smad1, phosphorylated Smad1, activin receptor-like kinase 1, activin receptor-like kinase 3 and bone morphogenetic proteins in a biological sample. A kit therefor. A prophylactic and/or therapeutic agent for proliferative diseases causing sclerosis, comprising as an active ingredient a substance having an inhibitory effect on the expression of at least one substance selected from the group consisting of STAT3, phosphorylated STAT3, Smad1 and phosphorylated Smad1. A method of identifying substances effective in preventing and/or treating proliferative diseases causing sclerosis, comprising judging whether or not a test substance inhibits the expression of at least one substance selected from the group consisting of STAT3, phosphorylated STAT3, Smad1 and phosphorylated Smad1. A kit therefor.
US07862992B2	Dynamic fermentation controller One or more set point values are generated by a dynamic fermentation controller for one or more of temperature, pH, and enzyme dosage for a fermentation system. The one or more set point values are output to one or more controllers of the fermentation system. The generation of the one or more set point values and the outputting of the one or more set point values is repeated until a change in conditions in the fermentation system is detected.
US07862991B2	Method for fabricating recess pattern in semiconductor device A method for fabricating a recess pattern in a semiconductor device includes forming a photoresist layer over a substrate including active regions, performing a first photo-exposure process on the photoresist layer using a photo mask including repeatedly formed line structures and spaces, performing a second photo-exposure process on the photoresist layer using a photo mask exposing the active regions, performing a developing process on regions of the photoresist layer whereon both the first and second photo-exposure processes are performed, and etching the substrate to form recess patterns using the remaining photoresist layer.
US07862990B2	Polymer having antireflective properties and high carbon content, hardmask composition including the same, and process for forming a patterned material layer An antireflective hardmask composition includes an organic solvent, an initiator, and at least one polymer represented by Formulae A, B, or C as set forth in the specification.
US07862989B2	Method for fabricating dual damascene structures using photo-imprint lithography, methods for fabricating imprint lithography molds for dual damascene structures, materials for imprintable dielectrics and equipment for photo-imprint lithography used in dual damascene patterning The process of producing a dual damascene structure used for the interconnect architecture of semiconductor chips. More specifically the use of imprint lithography to fabricate dual damascene structures in a dielectric and the fabrication of dual damascene structured molds.
US07862985B2	Method for double patterning a developable anti-reflective coating A method for double patterning a thin film on a substrate is described. The method includes forming the thin film to be patterned on the substrate, forming a developable anti-reflective coating (ARC) layer on the thin film, and forming a layer of photo-resist on the ARC layer. Thereafter, the layer of photo-resist and the ARC layer are imaged with a first image pattern, and developed, thus forming the first image pattern in the ARC layer. The photo-resist is removed and another layer of photo-resist is formed on the ARC layer. Thereafter, the other layer of photo-resist and the ARC layer are imaged with a second image pattern, and developed, thus forming the second image pattern in the ARC layer. The other photo-resist layer is removed and a double patterned ARC layer remains for etching the underlying thin film.
US07862981B2	Compound, positive resist composition and method of forming resist pattern A compound including a polyhydric phenol compound represented by general formula (I) shown below (wherein R11 to R17 each independently represents an alkyl group of 1 to 10 carbon atoms or aromatic hydrocarbon group which may contain a hetero atom in the structure thereof, and X represents an aliphatic cyclic group) and having a molecular weight of 300 to 2,500, in which some or all of the hydrogen atoms of the phenolic hydroxyl groups are substituted with acid dissociable, dissolution inhibiting groups; a positive resist composition containing the compound; and a method of forming a resist pattern using the positive resist composition.
US07862978B2	Toner and manufacturing process therefor The invention provides a process for the manufacture of a toner which comprises the steps of: a) providing a latex dispersion containing primary resin particles and surfactant; b) providing a colorant dispersion containing primary colorant particles and surfactant; c) optionally providing a wax dispersion containing primary wax particles and surfactant; d) providing at least one carboxy functional compound of Formula (1), which may be in acid, salt and/or complex form: wherein R is a carbocyclic or heterocyclic radical which may be optionally substituted and Z1 is a bond or linker group and wherein the amount of carboxy functional compound of Formula (1) provided is greater than 3% by weight, the amount of carboxy functional compound being calculated according to the following equation: amount ⁢ ⁢ of ⁢ ⁢ carboxy ⁢ ⁢ functional ⁢ ⁢ ⁢ compound ⁢ ⁢ ( % ⁢ ⁢ weight ) = 100 × weight ⁢ ⁢ ⁢ of ⁢ ⁢ carboxy ⁢ ⁢ functional ⁢ ⁢ compound ( weight ⁢ ⁢ of ⁢ ⁢ carboxy ⁢ ⁢ functional ⁢ ⁢ compound + weight ⁢ ⁢ of ⁢ ⁢ solids ⁢ ⁢ content ⁢ ⁢ of ⁢ ⁢ latex , colorant ⁢ ⁢ and ⁢ ⁢ optional ⁢ ⁢ wax ⁢ ⁢ dispersions + weight ⁢ ⁢ of ⁢ ⁢ ⁢ any ⁢ ⁢ additional ⁢ ⁢ surfactant ) e) mixing the latex dispersion, colorant dispersion, optional wax dispersion and said carboxy functional compound; and f) causing the particles in the mixture to associate. The process advantageously may produce a toner of small size and narrow particle size distribution. The present invention also provides a toner manufactured by the process.
US07862972B2	Toner binder and toner Disclosed herein is a polyester resin-based toner binder which can impart both excellent anti-blocking property under high temperature and humidity conditions and low-temperature fixing properties to a toner. The toner binder for developing electrostatic images includes a polycondensation polyester resin produced in the presence of at least one titanium-containing catalyst (a) represented by the following general formula (I) or (II): Ti(—X)m(—OH)n (I) O═Ti(—X)p(—OR)q (II) wherein X is a residue formed by removing H of one OH group from a (poly)alkanolamine having 2 to 12 carbon atoms; R is H or a C1 to C8 alkyl group which may have 1 to 3 ether bonds; m is 1 to 4, n is 0 to 3, and the sum of m and n is 4; and p is 1 to 2, q is 0 to 1, and the sum of p and q is 2 (m, n, p, and q are each an integer).
US07862969B2	Image bearing member and image forming method using thereof, and image forming apparatus and process cartridge The present invention provides an image bearing member that includes: a photoconductor; and a heating unit which heats the photoconductor, wherein the photoconductor includes: a support; a charge generating layer on the support, a charge transport layer, and a crosslinked charge transport layer in this order, wherein the crosslinked charge transport layer includes a reaction product of a radically polymerizable compound with three or more functional groups which does not have a charge transporting structure, and a radically polymerizable compound with one functional group, which compound has a charge transporting structure.
US07862953B2	Compound, solid polymer electrolyte membrane, electrolyte membrane-electrode assembly, and solid polymer fuel cell An unsaturated compound including a urethane bond in a main chain and a sulfonic acid group, a phosphoric acid group, an alkylsulfonic acid group, or an alkylphosphoric acid group on a benzene ring in a side chain is provided. In addition, a solid polymer electrolyte membrane containing a compound prepared by polymerizing the above-mentioned compound and an electrolyte membrane-electrode assembly including diffusion layers adhered on both surfaces of the electrolyte membrane are provided. Furthermore, a solid polymer fuel cell using the electrolyte membrane-electrode assembly is provided.
US07862952B2	Membrane electrode composite module, fuel cell and electronic equipment, and method of manufacturing the membrane electrode composite module According to the present invention, there is provided a membrane electrode composite module including a membrane electrode composite formed by sandwiching both surfaces of an electrolyte membrane between gas diffusion electrodes, an anode current collecting plate having fuel flow holes through which fuel flows, and a cathode current collecting plate having oxygen flow holes through which oxygen flows, wherein both surfaces of the membrane electrode composite are sandwiched between the anode current collecting plate and the cathode current collecting plate, the membrane electrode composite module further including films made of a synthetic resin (a first film and a second film) which are a base of the anode current collecting plate and a base of the cathode current collecting plate.
US07862951B2	Fuel cell and fuel cell connector A connecter comprises a housing having a first projection formed on an upper half of a first lateral surface over the entire width thereof between the front surface and the rear surface, and a second projection formed on a lower half of a second lateral surface opposed to the first lateral surface; a single detection terminal mounted inside the first projection, capable of connection to an electrode of a single cell contained in a fuel cell; and a detection terminal mounted in the lower half of the housing, capable of connection to the electrode of the single cell contained in the fuel cell. The detection terminals are all arranged at equal intervals.
US07862949B2	Fuel cell reliability improvement by using stack end plate temperature sensors A system and method for determining whether a fuel cell stack is overheating. The system measures the temperature of end cells in the stack using end cell temperature sensors, and calculates an average end cell temperature based on the end cell temperature measurements. The system also measures the temperature of a cooling fluid being output from the fuel cell stack. The system determines if any of the measured end cell temperatures are outlying by comparing each end cell temperature measurement to the average. The system determines that the cooling fluid outlet temperature sensor has possibly failed if the cooling fluid outlet temperature is greater than the average end cell temperature and the cooling fluid outlet temperature minus the average end cell temperature is greater than a predetermined temperature value. The system also determines that the fuel cell stack may be overheating if the average end cell temperature is greater than the cooling fluid outlet temperature and the average end cell temperature minus the cooling fluid outlet temperature is greater than a predetermined temperature value.
US07862948B2	Control of nitrogen fraction in a flow shifting fuel cell system A device and method to predict and regulate nitrogen concentration in a flow shifting system. In one aspect of the system, a bleed valve fluidly coupled to multiple fuel cell stacks is used to reduce the presence of nitrogen in an anode flowpath. One or more sensors can be used to measure voltage within one or both of the fuel cell stacks. By assessing fuel cell voltage changes within the anode flowpath and equating such changes with nitrogen fraction buildup, the system can manipulate the bleed valve at appropriate times to improve system operability. In one form of equating the sensed voltage changes with the nitrogen fraction buildup, a predictive algorithm can be used by a logic device in a controller to compare the sensed voltage so that the controller instructs the bleed valve when to open and close. In a variation, the controller can compare the sensed voltages against stored data rather than rely on a formula or related algorithm.
US07862945B2	Fuel cell system A fuel cell system according to the present invention has a movement drive device (load) (2), a fuel cell (10) for supplying electric power to the drive device, an electric power storing device (31) consuming electric power equivalent to the consumption power of the drive device, and an electronic control unit (connection control unit) (4) for controlling the connection of the fuel cell to the drive device. Before the fuel cell is connected to the drive device by the control of the electronic control unit, the fuel cell is made to generate electric power equivalent to the consumption power of the drive device, and the generated power is supplied to the electric power storing device. When a fuel cell voltage at the time of supply of the electric power to the electric power storing device is not less than a specified value, the connection between the fuel cell and the drive device is permitted.
US07862944B2	Method for detection and diagnosis of isolation faults in fuel cell hybrid vehicles An isolation fault detection system for detecting isolation faults in a fuel cell system associated with a fuel cell hybrid vehicle. The isolation fault detection system measures a stack voltage potential, a positive fuel cell voltage potential, a negative fuel cell voltage potential, a positive battery voltage potential, and an overall battery voltage potential. The isolation fault detection system then uses these voltage potentials in mesh equations to compare the measured voltage potentials to voltage potentials that would occur during a loss of isolation. In one embodiment, the isolation fault detection system uses these five measured voltage potentials to determine whether an isolation fault has occurred at four separate locations in the fuel cell hybrid vehicle. The system also can detect the location of the isolation fault.
US07862942B2	Strategies for mitigating cell degradation during start-up and shutdown with H2/N2 storage A system and method for reducing cathode carbon corrosion during start-up of a fuel cell stack. If a long enough period of time has gone by since the last system shutdown, then both the anode side and the cathode side of the stack will be filled with air. If the system includes split sub-stacks, then a start-up sequence uses a fast hydrogen purge through each sub-stack separately so as to minimize the time of the hydrogen/air front flowing through the anode side of the stacks. The start-up sequence then employs a slow hydrogen purge through the sub-stacks at the same time. If the time from the last shutdown is short enough where a significant amount of hydrogen still exists in the cathode side and the anode side of the sub-stacks, then the fast hydrogen purge can be eliminated, and the start-up sequence proceeds directly to the slow hydrogen purge.
US07862941B2	Hydrogen emissions control during up-transients and cathode pulsing A fuel cell system that controls an anode exhaust gas bleed during power up-transients. The fuel cell system includes a by-pass valve that allows compressor air to by-pass the fuel cell stack and be directly emitted into the cathode exhaust gas stream. The system detects a power up-transient by monitoring the rate of closing of the by-pass valve and the rate of change of an increase in the compressor airflow set-point. If these parameters pass a certain threshold, then the system determines that a power up-transient is occurring, and prevents an anode exhaust gas bleed for a predetermined period of time. If cathode pulsing is occurring where power up-transients come one after another, then the system will continuously reset the time period for preventing the anode exhaust gas bleed until a second time limit is reached, where the bleed is then forced.
US07862940B2	Managing MEA hydration cycling life In accordance with one embodiment of the present invention, a method of operating an electrochemical conversion cell is provided wherein the method comprises the steps of (i) initiating a membrane dehydration sequence when the membrane is characterized by an initial membrane hydration λWET and (ii) maintaining the membrane dehydration sequence until the membrane is characterized by a target membrane hydration λDRY. According to the method, the membrane dehydration sequence is characterized by a drying rate that varies in a manner that substantially corresponds to a fatigue life contour map of the membrane. Additional methods and corresponding systems are contemplated.
US07862937B2	Anode effluent control in fuel cell power plant A fuel cell stack (1) performs power generation using an anode gas having hydrogen as its main component, and after a power generation reaction, the anode gas is discharged as anode effluent. The anode effluent is re-circulated into the anode gas through a return passage (5). The return passage (5) comprises a purge valve (8) which discharges the anode effluent to the outside of the passage. In this invention, calculation of a first energy loss caused by an increase in non-hydrogen components in the anode gas while the purge valve (8) is closed (S7, S28), and calculation of a second energy loss which corresponds to the amount of hydrogen lost from the anode gas by opening the purge valve (8) (S8, S29) are performed. By opening the purge valve (8) when the second energy loss equals or falls below the first energy loss, the start timing of purging is optimized.
US07862936B2	Water removal channel for PEM fuel cell stack headers A bipolar plate for a fuel cell is disclosed including a first unipolar plate having an active surface with a plurality of flowfield channels formed therein. The first unipolar plate further includes an inlet header disposed at a first end of the unipolar plate that is in communication with the active surface, and an outlet header disposed at a second end of the unipolar plate having an exhaust opening formed therethrough. A peripheral edge of the exhaust opening is chamfered and is also in communication with the active surface. The chamfered exhaust opening forms a water removal channel in the bipolar plate. A fuel cell stack including the bipolar plate is also disclosed.
US07862932B2	Catalyst, electrode, membrane electrode assembly and fuel cell Disclosed is a catalyst, including a catalyst particle containing at least one component selected from the group consisting of gold, platinum and an gold alloy, the gold alloy containing gold and at least one element selected from transition metal elements of the fourth period, fifth period and sixth period of the Periodic Table, and a catalyst carrier carrying the catalyst particle and containing a perovskite type oxide represented by general formula (1) given below: A(1-x)BxTiOy (1) where the element A is at least one element selected from the group consisting of Ca, Sr and Ba, the element B is at least one element selected from the group consisting of La, Nd, Sm, Eu, Gd, Dy, Ho, Er, Tm, Yb, and Lu, the molar ratio x satisfies 0
US07862929B2	Constitution of the dispersant in the preparation of the electrode active material slurry and the use of the dispersant Disclosed are anode active material slurry for a lithium secondary cell having improved dispersibility of an anode active material and a conductive agent, and a lithium secondary cell comprising the same. Particularly, the present invention is characterized by adding a dispersant comprising a polymer backbone capable of surface-adsorption and a side-chain having non-ionic surfactant properties in a small amount, to the anode active material slurry comprising a carbon-based anode active material that is capable of lithium ion intercalation/deintercalation, a conductive agent, a binder comprising a styrene-butadiene-based polymer resin, a thickener comprising a cellulose-based or an acrylate-based resin, and water.
US07862923B2	Polymers for proton exchange membranes, proton exchange membranes, and their fabrication methods The present invention relates to a proton exchange membrane having a polymer comprising of a main chain and a branch chain connected to said main chain wherein the chemical formula for said branch chain is and where n is an integer. Said main chain is a polymer selected from the group that includes: aliphatic polymers, aliphatic block polymers, and aliphatic random copolymers. The fabrication method for said polymers comprises the steps of: reacting a polymer having a benzene ring in its branch chain with a sulfo-alkylated chemical reagent and a catalyst in an anhydrous solvent in an inert atmosphere; separating the resulting sulfo-alkylated polymer; and acidifying to obtain said fabricated polymer. Proton exchange membranes made with these polymers are pliant, do not expand much during wet conditions, and, are chemically, hydrolytically, dimensionally and thermally stable.
US07862922B2	Polymer electrolyte membrane for fuel cell and fuel cell system comprising same The polymer electrolyte membrane according to the present invention includes a proton-conducting polymer including metal ions bound to polyalkylene oxide. The polymer electrolyte membrane can save manufacturing cost of a fuel cell and improve proton conductivity and mechanical strength.
US07862921B2	Process for continuously producing polymer electrolyte membrane and producing apparatus therefor The present invention provides a process for producing a polymerelectrolyte membrane comprising the steps of coating a solution of a polymerelectrolyte on at least one surface of a porous substrate and laminating the coated porous substrate and a supporting material while applying a tension F (kg/cm) in a range of the following expression (A) 0.01≦F≦10 (A) to the coated porous substrate. According to the present invention, a polymerelectrolyte composite membrane in which wrinkling and the like are suppressed and whose appearance is excellent can be continuously produced.
US07862920B1	Charged arrays of micro and nanoscale electrochemical cells and batteries for computer and nanodevice memory and power supply A sequence or array of electrochemical cells storing both digital and analog data. Both binary code and codes having a higher base may be stored in the memory device to increase information density. Such battery arrays could also provide power for the micro or nanodevice. Devices are microscale and nanoscale in size and utilize electrically conductive atomic force microscopy tips to record and read data stored in the device.
US07862918B2	Recording medium and sheet A recording medium includes a magnetic material and a pulp-fiber, a minimum value of shortest distances between the magnetic material and an edge of the recording medium substantially parallel to the pulp-fiber orientation direction being about 1 mm or more.
US07862916B2	Perpendicular magnetic recording medium and magnetic storage device The perpendicular magnetic recording medium includes a non-magnetic underlayer composed of Ru or an Ru alloy having a columnar structure in which crystalline particles are isolated from each other by a space, a non-magnetic granular layer provided on the non-magnetic underlayer and composed of crystalline particles and a non-soluble phase and a granular magnetic layer provided on the non-magnetic granular layer and composed of CoCrPt alloy crystalline particles and the non-soluble phase, wherein when a lattice constant in an in-plane direction of the non-magnetic underlayer is a1, the lattice constant in the in-plane direction of the non-magnetic granular layer is a2, and the lattice constant in the in-plane direction of the granular magnetic layer is a3, the relation a1>a2>a3 is satisfied.
US07862915B2	Magnetic recording medium and magnetic recording/reproducing apparatus According to one embodiment, a multilayered underlayer including a first underlayer containing Cu aligned in a (111) plane and a second underlayer formed on the Cu underlayer and containing Cu and nitrogen as main components is formed.
US07862913B2	Oxide magnetic recording layers for perpendicular recording media An improved structure for the construction of perpendicular recording media is disclosed. The structure includes a perpendicular recording layer with at least two oxide sublayers or a lower sublayer of a non-oxide. One structure includes an upper sublayer comprised of a Silicon-oxide, while a lower sublayer is comprised of a Tantalum-oxide. The structures provide for increased coercivity and corrosion resistance.
US07862909B2	Organic electroluminescent element, illuminator and display An organic electroluminescent element comprising an anode and a cathode having therebetween an emission layer containing a phosphorescent compound and an layer adjacent to the emission layer, the layer adjacent to the emission layer being provided between the emission layer and the cathode, wherein the layer adjacent to the emission layer comprises a compound having an electron withdrawing group; and the compound exhibits a HOMO level of −5.7 to −7.0 eV and a LUMO level of −1.3 to −2.3 eV.
US07862908B2	Conjugated compounds containing hydroindoloacridine structural elements, and their use The present invention discloses a conjugated compound containing a hydroindoloacridine structural element and its applications as a host material or a hole transport material in an organic electronic device. The general structure of the conjugated compound containing a hydroindoloacridine structural element is as follows: where R1˜R5 can be identical or different.
US07862904B2	Organic electroluminescent element The present invention relates to the improvement of phosphorescent organic electroluminescent devices by using materials of the formula in the hole blocking layer.
US07862902B2	Multi-layered bearing The invention describes a multi-layered bearing with a supporting metal layer, optionally a bearing metal layer disposed on top of it, an anti-friction layer on top of the latter as well as a wearing layer on top of it. The wearing layer is made from bismuth or a bismuth alloy and the anti-friction layer is made from a copper-bismuth or silver-bismuth alloy or silver.
US07862896B2	Core-shell resin particle having low content of volatile components, and resin dispersion The present invention relates to core-shell resin particles (C2) each comprising one or more film-like shell layers (P) comprising a first resin (a) and a core layer (Q) comprising a second resin (b). The core-shell resin particle (C2) is characterized in that the weight ratio between (P) and (Q) is from 0.1:99.9 to 70:30, the volatile content in the resin particle (C2) is not more than 2 weight %, and the resin (a) has an initial softening temperature of 40 to 270° C., a Tg of 20 to 250° C., a flow temperature of 60 to 300° C., and the difference of the Tg and the flow temperature in a range of 0 to 120° C. The resin particles are excellent in electrostatic property, thermal storage stability and thermal properties, and exhibit a narrow particle diameter distribution.
US07862890B2	Biomedia apparatus and method of use A biomedia apparatus comprising an elongated central core and a plurality of loops positioned along the central core adapted to collect organisms from water. The biomedia apparatus may further comprise at least one reinforcing member associated with the central core. In one embodiment, the biomedia apparatus is utilized in a trickle tower to treat wastewater. In another embodiment, the biomedia apparatus is utilized outside a power plant to minimize spat that is drawn into the plant through water intake valves.
US07862885B2	Method of room temperature covalent bonding A method of bonding includes using a bonding layer having a fluorinated oxide. Fluorine may be introduced into the bonding layer by exposure to a fluorine-containing solution, vapor or gas or by implantation. The bonding layer may also be formed using a method where fluorine is introduced into the layer during its formation. The surface of the bonding layer is terminated with a desired species, preferably an NH2 species. This may be accomplished by exposing the bonding layer to an NH4OH solution. High bonding strength is obtained at room temperature. The method may also include bonding two bonding layers together and creating a fluorine distribution having a peak in the vicinity of the interface between the bonding layers. One of the bonding layers may include two oxide layers formed on each other. The fluorine concentration may also have a second peak at the interface between the two oxide layers.
US07862884B2	Electrophotographic film and recorded material using the same An electrophotographic film with excellent water resistance, which is more reduced in heat curling than before when used as a recording paper for thermal fixing-type electrophotographic printers or a copying machines and prevents stains of the toner-fixing unit if it jams in the printer or copying machine and which can provide continuous printing of a large number of sheets, is provided by an electrophotographic film comprising a resin film (A) formed of a resin composition containing an inorganic fine powder and/or an organic filler, the resin composition having a melt tension of 5 g or more at 210° C., a crystallization temperature of 120° C. or more and a crystallization heat of 60 J/cm3 or less.
US07862882B1	Re-positionable magnetic art apparatus A re-positionable magnetic art apparatus which is provided in a variety of shapes and sizes. Characters of the apparatus are attracted to a sheet which underlies a picture within a frame, the frames provided in a variety of shapes. A clear laminate covering the picture separates the removably positionable characters from the picture, thereby providing for picture clarity throughout the life of the apparatus. Pictures are provided with characters which match both picture theme and picture scale, ensuring realistic artistic expression. Accessory character material is available which is printable on an inkjet printer.
US07862872B2	Multilayer structure based on polyamides and graft copolymers having polyamide blocks The present invention relates to a multilayer structure based on polyamides and graft copolymers having polyamide blocks, comprising, in this order: a) a first layer (1) formed from a polyamide (A) or else a polyamide (A)/polyolefin (B) blend having a polyamide matrix; b) optionally, a tie layer (2a); c) a layer (2) based on a graft copolymer having polyamide blocks, formed from a polyolefin backbone and from at least one polyamide graft in which: the grafts are attached to the backbone by the residues of an unsaturated monomer (X) having a functional group capable of reacting with a polyamide having an amine end group; the residues of the unsaturated monomer (X) are attached to the backbone by grafting or copolymerization via its double bond; the layers (1), (2a) and (2) being successive and adhering to one another in their respective contact region. One particularly useful application relates to tubes for cooling circuits of internal combustion engines, such as the engines of cars or lorries.
US07862871B2	Plastic receptacle for domestic washing machines A plastic container for domestic washing machines comprising a bearing shell (1) that accommodates a plastic member (3) in an injection moulding process, said plastic member being more solid and of better quality than the plastic forming the container (5). The metal bearing shell (1) and the plastic member (3) that is injection-moulded thereinto form a structural unit onto which the corresponding plastic container (5) is injection-moulded.
US07862870B2	Films for inflatable cushions Films for inflatable cushions are disclosed. Generally, each of the disclosed films includes a pair of web layers that are aligned to be generally coextensive and that are sealed together by longitudinal and/or transverse seals that cooperatively define the boundaries of inflatable chambers.
US07862869B2	Tear initiation and directional tear films and packages made therefrom The present invention provides a flexible multilayer packaging film and packages formed therefrom wherein the films include a first film layer comprising a first biaxially-oriented polymer selected from the group consisting of a polyester, a polyolefin, a polyamide, and a blend thereof and a surface-roughened portion, a second film layer comprising an adhesive, a third film layer comprising a barrier material, a fourth film layer comprising a second biaxially-oriented polymer selected from the group consisting of a polyester, a polyolefin, a polyamide, and a blend thereof and at least one score-line; wherein the packages comprise a tear-initiation area and a directional tear zone.
US07862865B2	Ultraviolet-resistant fabrics and methods for making them Embodiments of the invention can provide a protective fabric includes a plurality of inherently flame resistant fibers, and at least one ultraviolet-resistant additive incorporated into the inherently flame resistant fibers through a dye process using a carrier, wherein the ultraviolet-resistant additive significantly increases at least one of the strength retention and the colorfastness of the fabric when exposed to ultraviolet radiation.
US07862861B2	Method of manufacturing information recording materials, and information recording materials Normal simultaneous multi-layer coating can be accomplished without allowing the coating liquids to increase in viscosity before and during their application, and inter-layer mixing can be prevented by increasing the viscosity after the application. In a method of manufacturing an information recording material in which at least one out of a plurality of layers formed by simultaneous multi-layer application of a plurality of coating liquids over a running supporting base 14 with a slide bead coating device 16 is an information recording layer, and the multi-layer coats so formed are dried by a drying device 20, at least one of the plurality of coating liquids contains PVA and boric acid whose mutual contact or mixing causes the coating liquids to increase in viscosity.
US07862860B2	Materials and methods for immobilization of catalysts on surfaces and for selective electroless metallization A method of immobilizing a catalyst on a substrate surface involves providing novel ligating copolymers comprising functional groups capable of binding to a substrate surface and functional groups capable of ligating to catalysts such as metal ions, metal complexes, nanoparticles, or colloids; applying the ligating copolymer to a substrate surface to cause the ligating copolymer to bind thereto, and contacting the modified substrate surface with a solution of a catalyst, causing the catalyst to be ligated by the ligating copolymer and thus immobilized on the substrate surface. The ligating copolymer may be patterned on the substrate surface using a method such as microcontact printing. A method of selectively metallizing a substrate in a desired pattern involves using a ligating chemical agent comprising functional groups capable of binding to a substrate surface and functional groups capable of ligating to electroless plating catalysts; applying the ligating chemical agent to a substrate in a desired pattern using microcontact printing to cause the ligating chemical agent to bind thereto; contacting the modified substrate surface with a solution of an electroless plating catalyst, causing the catalyst to be ligated by the ligating chemical agent and thus bound to the surface; and metallizing the catalyzed regions of the substrate surface using electroless plating.
US07862856B1	Method for making high temperature polymer dielectric compositions incorporating diamond-like hydrocarbon units for capactive energy storage applications The present invention provides a method for making a polymer dielectric composition incorporating diamondoids or diamond-like hydrocarbon units. The method includes forming a polymer solution from the cardo-diol 9,9-bis(4-hydroxyphenyl)fluorene and a diacid chloride, casting a freestanding thin polyester film from the polymer solution, and metallizing the polyester film with an evaporated Al layer to form the dielectric composition. The diacid chloride may be derived from trans-1,4-cyclohexanedicarboxylic acid; 1,3-adamantanedicarboxylic acid; or 4,9-diamantanedicarboxylic acid.
US07862853B2	Method for manufacturing magnetic recording medium A method for manufacturing a magnetic recording medium with high reliability is provided, which can form a thin magnetic layer having a dry film thickness of, for example, 60 nm or less while the occurrence of defects on the surface is suppressed. In this method, a magnetic paint having a solid concentration NV (mass %) of 3≦NV≦8 is applied to a non-magnetic underlayer formed over a non-magnetic support to a wet film thickness Tw in a range of ≦2300 (nm).
US07862851B2	Process for coating electrically conductive substrates A process for coating electrically conductive substrates by (1) applying an electrocoat film to an electrically conductive substrate and curing it to give an electrocoat and then (2) applying a layer of a pulverulent coating material to the electrocoat and curing it to give a powder coat or alternatively (1) applying an electrocoat film to an electrically conductive substrate and drying it without fully curing it, (2) applying a layer of a pulverulent coating material to the dried electrocoat film(s) and (3) jointly curing the dried electrocoat film and the layer of the pulverulent coating material to give the electrocoat and the powder coat wherein the pulverulent coating material comprises (A) at least one epoxy resin having a melting point, melting range or glass transition temperature>30° C., (B) at least one carboxyl-containing polyester resin having a melting point, melting range or glass transition temperature>30° C., and (C) at least one polycarboxylic acid having a melting point of between 80 and 160° C.
US07862850B2	Painting method A panel (9) is conveyed by using a conveyer (3), and the coating surface of the panel (9) is divided into two coating areas (CAa, CAb). Further, the coating areas (CAa, CAb) are coated by reciprocating sprayer units (6, 7) parallel to a conveying direction. At this time, at a boundary between the coating areas (CAa, CAb), the positions of turning paths (Ta0, Tb0) of the reciprocation of a coating machine are shifted sequentially from the front side to the rear side in the conveying direction, so that coating trajectories (Ta, Tb) like a series of steps are formed. Thus, at the boundary between the coating areas (CAa, CAb), the turning paths (Ta0, Tb0) can be spread and located, and the occurrence of color shading can be prevented.
US07862847B2	Packaged beverages containing β-cyclodextrin Packaged beverages contain the following ingredients: (A) from 0.07 to 0.45 wt. % of non-polymer catechins, (B) from 0.06 to 0.5 wt. % of ascorbic acid or a metal salt thereof, and (C) non-polymer catechingallates. A content weight ratio (C/A) of the non-polymer catechingallates (C) to the non-polymer catechins (A) is from 0.8 to 1.0, and the packaged beverages have a pH of from 4.5 to 7. Another type of packaged beverages contain the following ingredients: (A) from 0.05 to 0.45 wt. % of non-polymer catechins, and (D) from 0.07 to 0.49 wt. % of β-cyclodextrin. The non-polymer catechins (A) contain (C) non-polymer catechingallates at a weight ratio (C/A) of from 0.7 to 1.0 relative to the non-polymer catechins (A).
US07862845B2	Process for manufacturing a sweetener and use thereof Highly purified Stevioside and Rebaudioside A were prepared from sweet glycoside extracts obtained from Stevia rebaudiana Bertoni leaves. The resulting sweeteners are suitable as non-calorie, non-cariogenic, non-bitter, non-lingering sweeteners, which may be advantageously applied in foods, beverages, and milk products.
US07862844B2	Taste improving substances The present invention in a first aspect relates to taste improvement of foodstuffs, beverages, pharmaceutics, tobacco products and oral care products, using extremely small amounts of a substance according to formula (I), or edible salts thereof: R1—CR2(OR3)—CO—X (I). It was found that at very low concentrations, substances represented by formula (I) are capable of modifying and complementing, the sensory impact of taste imparting substances. Thus, the present taste improving substances are advantageously applied in flavour compositions, foodstuffs, pharmaceutics, tobacco products and oral care products. Typical examples of taste improving substances according to the present invention include N-lactoyl GMP, N-lactoyl AMP, N-lactoyl CMP, N-lactoyl IMP, N-gluconyl GMP, N-gluconyl AMP, N-gluconyl CMP, N-gluconyl IMP, O-lactoyl-GMP, O-lactoyl AMP, O-lactoyl CMP, O-lactoyl IMP, O-gluconyl GMP, O-gluconyl AMP, O-gluconyl CMP and O-gluconyl IMP and mixtures thereof.
US07862843B2	Method of sanitizing a biological tissue A method for treating biological tissue, particularly meats for human consumption, so as to sanitize the tissue, is described. The method inactivates microorganisms and pathogenic prions (proteins) in the tissue.
US07862839B2	Functional food composition for treating allergy, natural tea using the same and the manufacturing method thereof A functional food composition for treating allergy, comprising Saururus chinensis, Plantago asiatica, Poncirus trifoliata and Schisandra chinensis extracts, as active ingredients, a tea composition comprising the same and a manufacturing method thereof. The functional food and tea compositions for treatment of allergy in accordance with the present invention are therapeutically effective for any type of allergic diseases, irrespective of allergic causes. In particular, the tea composition advantageously enables easy and regular administration at need, which can achieve anti-allergic effects without particular efforts for treatment of diseases.
US07862838B1	Composition and regimen for the treatment of herpes simplex and herpes zoster primarily by eliminating their pathogenetic conditions and taking into account both pathogenesis and etiology A composition and regimen for the treatment of herpes simplex and herpes zoster, primarily through elimination of the pathogenetic conditions by taking into account both pathogenesis and etiology thereof are disclosed. Administration of 1) repeated large dosages of vitamin B2 to eliminate severe vitamin B2 deficiency inherent in herpes simplex and herpes zoster; 2) Strobilanthes cusia and Berberine to ameliorate febrile illness and to clear “hot” condition; 3) Zizyphus semen to relieve psychological stress; and 4) L-lysine to antagonize arginine and alleviate anxiety-all these hereof are for eliminating the pathogenetic conditions. These, in combination with antiviral agents if necessary, constitute the scope and the spirit of the present invention.
US07862834B2	Pharmaceutical formulation comprising a water-insoluble active agent A method of preparing a pharmaceutical formulation comprises providing a solution comprising a first solvent, a second solvent, an active agent, and an excipient. The second solvent is less polar than the first solvent and the excipient is more soluble in water than the active agent. The first and second solvents are removed from the solution to produce particles comprising the active agent and the excipient. In one version, the excipient comprises an amino acid and/or a phospholipid. A pharmaceutical formulation made by a version of the invention comprises particles comprising an active agent and an excipient which at least partially encapsulates the active agent, wherein the excipient is more soluble in water than the active agent.
US07862832B2	Generally linear effervescent oral fentanyl dosage form and methods of administering Fentanyl containing dosage forms and methods using same are described. These dosage forms include substantially less fentanyl by weight than know oral formulation and have advantages in terms of cost and side effects. These dosage forms are intended for oral administration of fentanyl across the oral mucosa.
US07862831B2	Method and material for enhanced tissue-biomaterial integration The present invention relates to the covalent binding of a hydrogel to an extracellular matrix (ECM). The integration of the hydrogel with the tissue is superior to that in previous techniques. Moreover, unlike previous techniques, the present invention does not require a photoinitiator. Potential therapeutic applications include tissue repair and delivery of drugs or cells. The ECM is first exposed, then treated with a priming agent. Then a polymerizable agent is added and crosslinked to the ECM. Two primary embodiments of methods are disclosed. In the first, the priming agent is an oxidizer which creates tyrosyl radicals in the ECM, which are then bound by acrylate groups in the polymerizable agent. In the second, the priming agent contains aldehydes which bind amino groups in the ECM.
US07862829B2	Viral adjuvants The present invention provides viral adjuvants for enhancing an immune response to an immunogen. In particular embodiments, the viral adjuvant is an alphavirus adjuvant or a Venezuelan Equine Encephalitis viral adjuvant. Also provided are compositions comprising the viral adjuvant and an immunogen, and pharmaceutical formulations comprising the viral adjuvant or compositions of the invention in a pharmaceutically acceptable carrier. Further provided are methods of producing an immune response against an immunogen in a subject comprising administering the immunogen and a viral adjuvant of the invention to the subject.
US07862828B2	Allergy vaccines containing hybrid polypeptides Hybrid polypeptides comprising at least two different allergenic proteins or fragments thereof wherein each fragment consists of at least eight consecutive amino acids of the respective allergenic protein are disclosed. The hybrid polypeptides and polynucleotides coding therefor can be used as pharmaceutical compositions, in particular as vaccines.
US07862823B1	Multivalent vaccine composition with mixed carrier The invention concerns a pharmaceutical composition for treating or preventing a certain number of infections caused by pathogenic agents such as bacteria, comprising as immunogen, one or several polyosides derived from one or several pathogenic agents. The polyosides are in the form of conjugates, coupled with a carrier protein. The composition contains at least two types of conjugates, each being at least characterised by a different protein carrier.
US07862821B2	Recombinant vaccine against bluetongue virus The present invention relates to an immunogenic or vaccine composition to induce an immune response or protective immune response against Orbiviruses, more specifically bluetongue virus (BTV) in an animal susceptible to BTV infection. The composition may include a pharmaceutically or veterinarily acceptable vehicle or excipient, and a vector. The vector may contain heterologous nucleic acid molecule(s), expresses in vivo in the animal BTV antigen, immunogen or epitope thereof, e.g., BTV VP2; BTV VP2 and VP5; BTV VP2 and VP5 and VP3 and/or VP7. The composition can contain an adjuvant, such as carbomer. Methods for making and using such a composition, including prime-boost regimes and including as to differential diagnosis, are also contemplated. AGACAGTGGTCAATTCCAATGGTACTGTTTGACGATAC
US07862815B2	Methods for inhibiting angiogenesis with inhibitors of proadrenomedullin N-terminal 20 peptide (PAMP) The present disclosure concerns the use of peptides and compositions, such as pharmaceutical compositions, to influence angiogenesis. Particular methods are useful for promoting angiogenesis, while others are particularly useful for inhibiting angiogenesis.
US07862810B2	Methods and compositions for the repair and/or regeneration of damaged myocardium Methods, compositions, and kits for repairing damaged myocardium and/or myocardial cells including the administration cytokines are disclosed and claimed. Methods and compositions for the development of large arteries and vessels are also disclosed and claimed. The present application also discloses and claims methods and media for the growth, expansion, and activation of human cardiac stem cells.
US07862807B2	Dendrimers as molecular translocators Transport molecules include a dendrimer and a biologically active molecule. The dendrimer of such transport molecules includes at least one guanidine group, at least one protonated guanidine group, at least one protected guanidine group, at least one amidine group, at least one protonated amidine group, at least one protected amidine group, at least one ureido group, at least one protonated ureido group, at least one protected ureido group, at least one thioureido group, at least one protonated thioureido group, or at least one protected thioureido group. The biologically active molecule is bonded to the dendrimer. A method of increasing the bioavailability of a drug includes bonding the drug to a dendrimer of the invention.
US07862797B2	Mixed oxide powder comprising alkali metal oxide, and silicone rubber comprising this powder Alkali metal oxide-metal oxide mixed oxide powder in the form of aggregates of pore-free primary particles, comprising from 0.005 to 5% by weight of at least one alkali metal oxide, which has a BET surface area of from 100 to 350 m2/g, has a specific DBP number, expressed as DBP number per square meter of specific surface area, greater than or equal to that of a powder which has only the metal oxide component, has the alkali metal oxide distributed in the core and on the surface of the primary particles. Silicone rubber comprising the alkali metal oxide-metal oxide mixed oxide powder.
US07862788B2	Promoter enhanced chilled ammonia based system and method for removal of CO2 from flue gas stream A chilled ammonia based CO2 capture system and method is provided. A promoter is used to help accelerate certain capture reactions that occur substantially coincident to and/or as a result of contacting a chilled ammonia based ionic solution with a gas stream that contains CO2.
US07862779B2	Visual spill indicating Composition has an indicating dye encapsulated by an encapsulating material. An encapsulated indicating dye can be combined with an organic substance absorbent and/or adsorbent. The composition, combination and/or a device having one or both of them can be used to indicate the presence of an organic substance by contacting the same with a sample, and, ascertaining whether an appropriate color release occurs to indicate the presence of the organic substance by contact of the organic substance with the composition, combination and/or device.
US07862778B2	Fluid system comprising a safety device A fluid system that includes a flow system for a liquid having an inlet, an outlet, at least one fluid line extending from the inlet to the outlet and an electrically activatable melting device, wherein activation of the melting device causes melting, which interruptes, stops or diverts a flow of the fluid through the flow system. In one embodiment, the fluid system may be used in a device for measuring blood sugar.
US07862773B2	Purification apparatus A purification apparatus, kit and method for purifying DNA, RNA, proteins, antigens, antibodies and cells. The apparatus has a wand and a reservoir tube. The wand is made of a cap, a sample collection assembly and an elongated shaft connecting the cap to the sample collection assembly. The sample collection assembly has a series of microstructures on its surface, or microparticles enclosed within it for increasing the surface area of the sample collection assembly. The increased surface area permits maximum exposure to and binding of target molecules thereto. The reservoir tube associated with the wand has one end defining an opening and a second end that is closed and preferably cone or cylindrical shaped. The cap of the wand securely and sealingly fastens to the open end of the reservoir tube with the shaft and the sample collection assembly fitting easily inside the reservoir tube. The apparatus, kit and methods can be used for protein and nucleic acids detection by colorimetric, luminescent, fluorescent or electrochemical means through attachments for detecting such signals. The apparatus, kit and methods can also be used in conjunction with an attachment for thermal regulation to perform nucleic acids amplification. The apparatus, kit and methods can further be configured for integrated, high throughput purification and detection of proteins and nucleic acids.
US07862769B2	Testing body, particularly for verifying the penetration properties of a sterilizing agent in sterilization processes A testing body (1) that is provided for verifying the penetration properties of a sterilization agent has, with a compact design, a particularly high detection sensitivity and is thus particularly well-suited or use in the sterilization of minimally invasive surgical instruments that are known to be difficult to remove air therefrom thereby rendering the sterilization thereof problematic. For this purpose, the testing body (1) has a detector volume (24), which is provided for accommodating an indicator (26) and which can be connected to a sterilization chamber via a gas collecting space (4). According to the invention, the gas collecting space (4) has a multistage design, and the cross-section and the volume of each stage (14, 16) decrease between adjacent stages (14, 16) in the direction of the detector volume (24).
US07862767B2	Method and apparatus for tensioning composite material An apparatus and method for tensioning material (12) over a mold (14), such as a cure tool, comprises a tensioning fork (10) consisting of two substantially parallel tapered legs (18,20) between which material (12) is disposed. A tensioning fork (10) is positioned at a first side edge (42) and proximate a first end edge (38) of the material (12). A first leg (18) of the tensioning fork (10) is disposed under the material (12), and a second leg (20) of the tensioning fork (10) is disposed over the material (12). When force is applied to the second leg (20), it pivots about the first leg (18) along the length of the legs, remaining parallel to the first leg (18), thereby pressing a portion of the material (12) against the mold (14).
US07862762B2	Moulding of mouldable materials A method of moulding and a moulding installation is disclosed. The installation comprises a compounder (16), a flow path (26) from the compounder to a vessel (34) in which the mouldable material emerging from the compounder is accumulated, and further flow paths (28) from the vessel (34) to a number of moulders (30) each of which is associated with a mould (32). The moulders take charges of mouldable material on a cyclical basis.
US07862760B2	Co-injection nozzle, method of its use, and resulting golf ball A nozzle for an injection molding machine is disclosed. The nozzle includes a nozzle body, an inner nozzle, and an outer nozzle. The nozzle defines two independent flow paths therethrough. The nozzle can simultaneously discharge two materials. A method of using the nozzle and a resulting golf ball product are also disclosed.
US07862757B2	Manufacturing method for seamless manmade leather ball A manufacturing method for seamless manmade leather ball, wherein composites such as soft bioplastic resin or manmade leather, etc are injected, extruded or hot compressed to form upper and lower half bowl type thin covers to completely matchingly sleeve and sphere the corresponding ball bladder, next it is pressingly combined in the one step or two steps curing molds to fusionly paste with the reinforcement layer on said ball bladder to become an initial blank with waterproof layer which is further pressingly combined and cooled down to a fixed form in another set of forming molds with its outside surface formed with pre-formed lines and is further treated with a surface cortex layer and put in forming molds once again allowing surface decorative lines to be pressingly combined at second time, thereby allowing the ball to appear a better simulated leather ball outlook.
US07862754B2	Casted concrete stone with opposed molded textured surfaces and method of manufacture A casted concrete stone having opposed parallel surfaces formed in a mold and wherein the opposed parallel surfaces have a molded textured surface. The concrete stone is fabricated by a dry-cast concrete mold wherein a profiling plate is provided with mold bottom wall formations each having a textured outer surface. A bond release film or spray or permanent coating is provided on the textured outer surface of the mold bottom wall formations. Mold forming side walls are disposed about the mold bottom wall formations. After the mold is filled with a dry-cast concrete mixture a top plate, having mold top wall formations, is disposed over the mold forming side walls with the mold top wall formations disposed inside respective ones of the molds to close the molds. Pressure and vibration is applied to compact the dry-cast concrete whereby to form a dry-cast concrete stone with opposed molded textured surfaces.
US07862752B2	Apparatus and method for checking mold vent condition Apparatus and method for checking the venting of a mold having one or more vents, the apparatus comprising a vacuum source, a flow connection between the source and the mold, and a vacuum gauge connected to the flow connection, whereby vacuum measurement by the gauge correlates with total effective venting area of the mold.
US07862747B2	Arylsulfonic acid compound and use thereof as electron-acceptor material An excellent EL device having low driving voltage, high luminous efficiency and long life can be obtained by using a charge-transporting thin film composed of a charge-transporting varnish which contains an arylsulfonic acid compound represented by the formula (1) or (2) below as an electron-acceptor material especially in an OLED device or a PLED device. [In the formulae, X represents O, S or NH; A represents a naphthalene ring or anthracene ring having a substituent other than X and n SO3H groups; B represents a substituted or unsubstituted hydrocarbon group, 1,3,5-triazine group or a substituted of unsubstituted group represented by the following formula (3) or (4): (wherein W1 and W2 each independently represents O, S, an S(O) group, an S(O2) group, or a substituted or unsubstituted N, Si, P or P(O) group); n indicates the number of sulfonic acid groups bonded to A which is an integer satisfying 1≦n≦4; q indicates the number of B—X bonds which is an integer satisfying 1≦q; and r indicates the number of recurring units which is an integer satisfying 1≦r.].
US07862744B2	Methods and systems for preparing materials for sucralose production The present invention provides a method for preparing DMF for sucralose production, including, e.g., isolating DMF from a composition comprising DMF, water, and methanol, using a single-tower rectification system. In various embodiments of the present invention, the composition, after the removal of water and methanol, may be further dried/dehydrated, such as, by using a dehydration agent and/or filtration. The resulting substantially pure DMF may comprise at least about 98-99% DMF. The present invention further provides a method of preparing a composition comprising anhydrous sucrose for sucralose production, which may comprise mixing regular sucrose with a water-containing DMF composition, and drying the resulting sucrose-DMF composition. Also provided is a single-tower separation system for isolating DMF from a composition comprising DMF, water, and methanol.
US07862740B2	Compositions comprising a fluoroolefin The present invention relates to compositions for use in refrigeration, air-conditioning, and heat pump systems wherein the composition comprises a fluoroolefin and at least one other component. The compositions of the present invention are useful in processes for producing cooling or heat, as heat transfer fluids, foam blowing agents, aerosol propellants, and fire suppression and fire extinguishing agents.
US07862738B2	Luminous body The present invention relates to an inorganic composition mainly containing a compound semiconductor, wherein the inorganic composition contains iridium element. The invention also relates to a method of producing an inorganic composite for producing an luminescent material, wherein the method comprises subjecting an inorganic composition mainly containing a compound semiconductor to an explosion by gunpowder and/or explosive in a sealed vessel.An inorganic composite for producing a luminescent material can be prepared by subjecting an inorganic composition to a doping treatment such as explosive treatment or heat-treatment. The inorganic composite can further be heat-treated to produce a luminescent material. The resulting luminescent material can be formed into a layer as a light emitter layer of an inorganic EL device.
US07862736B2	Method of cleaning plasma etching apparatus, and thus-cleanable plasma etching apparatus Method of cleaning a plasma etching apparatus capable of suppressing variation in line width among wafers in a single lot, and improving throughput in the cleaning process, includes steps of supplying a cleaning gas into a chamber of a plasma etching apparatus; igniting a plasma of the cleaning gas in the chamber; and allowing plasma cleaning to proceed in the chamber, by bringing the cleaning gas in plasma form into contact with a deposit adhered on the inner wall of the chamber so as to etch off the deposit, wherein in the step of plasma cleaning in the chamber, intensity of plasma emission ascribable to the deposit adhered on the inner wall of the chamber is detected in a time-dependent manner, and the plasma cleaning in the chamber is terminated based on changes in the intensity of the plasma emission.
US07862730B2	Systems and methods for separating hydrocarbons from water A system for separating hydrocarbons from water, the system including an inlet for receiving a fluid, the fluid including a water phase and a hydrocarbon phase, and a separation tank having a first partition and a second partition, wherein the first partition is configured to receive the fluid from the inlet. Furthermore, the system includes a first outlet configured to receive the water phase from the first partition, a second outlet configured to receive the hydrocarbon phase from the second partition, and a support structure configured to receive the water phase from the first outlet and the hydrocarbon phase from the second outlet. Also, a method of separating a fluid into a water phase and a hydrocarbon phase, the method including injecting the fluid containing the water phase and the hydrocarbon phase into a separation tank. The method further includes separating the water phase from the hydrocarbon phase, wherein the separating includes transmitting the fluid through a plurality of baffles, collecting the water phase, and collecting the hydrocarbon phase.
US07862727B2	Desalination scale inhibitors A method and composition for processing natural water such as seawater, brackish, and estuarine water wherein the water is concentrated with or without heating comprising adding to the water (I) a water-soluble polymeric phosphonate and (II) a water-soluble polycarboxylate to control scale formation and deposition. Optionally a water -soluble poly[isopropenylphosphonic acid] can also be utilized as component (I) without the addition of component (II).
US07862724B2	Preparative liquid chromatograph system and preparative separation/purification method using the same A technique for extracting an objective component from a sample solution and obtaining the component in the form of equally separated powder aliquots is provided. A peak detector 12 detects the start point of the peak of the objective component on a chromatogram created from detection signals produced by a detector 5. Then, a controller 14 immediately changes a valve 6 so that the eluate will flow to a trap column 7a. A peak area processor 13 calculates the peak area of the objective component in real time. When the calculated area has exceeded a threshold, the controller 14 changes the valve 6 so that the eluate will flow to the next trap column 7b. Thus, the trap columns 7a to 7d are sequentially selected to divide the peak into one or more portions with the same area so that the objective component in the eluate will be sequentially captured by the trap columns 7a to 7d. Subsequently, the objective component is eluted from each trap column, and then the solvent is vaporized, to obtain powder of the objective component.
US07862721B2	Method for producing hydrogen sulphide and the use thereof, in particular, for depolluting heavy metal-containing flows A process for the decontamination of an effluent containing one or more dissolved metals is provided. The process includes producing hydrogen sulphide in an aqueous medium by culturing alkaliphilic sulphate-reducing or thio-sulphate reducing bacteria in the presence of an organic compound serving as an electron donor and in the presence of a sulphurous compound serving as an electron acceptor. The effluent is contacted with the hydrogen sulphide and the dissolved metals are reduced and/or precipitated in the form of metal sulphides.
US07862719B2	Square membrane manifold system A membrane module (3) comprising a plurality of porous hollow membranes (8). The membranes (8) extend between and are fixed at each end in a header (5, 6). One header (6) has one or more of openings (12) formed therein. The openings (12) are in fluid communication with a source of gas and/or liquid (13, 14, 15). The other of the headers (5) is sealingly connected to and in fluid communication with a head-piece (9). The head-piece (9) is adapted to couple to an associated head-piece of a further module to form a rack of modules (17). A potting head (6) for use in mounting porous hollow membranes (8) is also disclosed comprising a preformed potting element (29). The potting element (29) includes one or more cavities (30) for receiving curate potting material which, in use, supports said membranes (8).
US07862717B2	Oil filter arrangement An oil filter arrangement comprises a housing, which has a receiving chamber for a filter element which can be cross-flowed in a radial manner by oil and which can be inserted into the housing, a support tube which supports the filter element when it is inserted, a housing cover which closes the receiving chamber, and a drainage channel which is provided in the base area of the receiving chamber. The support tube is fixed to the housing and it remains therein when the filter element is replaced and that a drainage plate, which comprises closing means for closing the drainage channel and which is arranged in an axially displaceable manner, to a limited extent, on the support tube, is arranged in the base area of the receiving chamber.
US07862716B2	HPLC schematic with integrated sample cleaning system The disclosed HPLC flow schematic back-flushes the guard column with mobile phase once every operating cycle, the regular cleaning maintaining its effectiveness and useful life. This mobile phase flow reversal is accomplished by imposing a two position multiple port switching valve between the guard and separation columns. In one valve position, the mobile phase is pumped in one flow direction through both the separation and guard columns, but the switched valve maintains the same flow direction only through the separation column and reverses the mobile phase flow direction through the guard column, for effectively cleaning the guard column. Moreover, the mobile phase back flow is directed over the emptied sample drawing needle for cleaning it to reduce possible sample cross contamination. The improved flow circuits use basically only the typical HPLC system components, except for some insignificant modifications from existing injector designs.
US07862713B2	Reservoir water filtration system A system for reuse of water stored in a reservoir by transfer of initially filtered water from the reservoir to a vertically stacked filtration system located onshore. A flexible filter screened, porous feeder line housed within a perforated carrier pipe extends into the reservoir and is supported above the bottom of the reservoir for transfer of filtered water to the vertically stacked filtration system. The flexible filter screened, porous feeder line includes a conveyance system for retraction and extension of the porous feeder line by two cables. The feeder line is movable from the perforated carrier pipe for cleaning or replacement of the porous feeder line.
US07862702B2	Methods and apparatus for electrosmear analysis Methods and apparatus for preparing a smear for cytopathology or other analysis. In a representative embodiment, cells of a sample are subjected to a dielectrophoretic force to segregate the cells into two or more zones of a surface. The particles are attached to the surface, thereby defining a “segregated smear.” The segregated smear is then fixed and stained for cytopathology analysis.
US07862701B2	Electro-dipcoating apparatus An electro-dipcoating apparatus is described in which, in conventional manner, a work-piece to be lacquered is dipped into a lacquer bath, moved through the latter, and lifted out again in a continuous process. Along the path of motion of the work-piece in the lacquer bath there are arranged electrodes which are connected to a first pole of at least one voltage source. Several contact rails extend parallel to one another without electrical interruption along the entire path of motion of the work-piece leading through the lacquer bath and are each connected to the second pole of varying voltage sources. To each work-piece a contact device is assigned which can be brought into communication with a respective one of the several contact rails and in this way applies the potential of the second pole of the corresponding voltage source to the work-piece. In this way, cuts in the contact rails are avoided that would result in wear of the contact devices and in increased control effort.
US07862700B2	Water treatment system and method A method and apparatus for producing purified water. Treated water may be provided for domestic use wherein the water may be treated by removing selected dissolved species while retaining properties that may improve the properties or aesthetics of the water.
US07862693B2	Apparatus for plating semiconductor wafers An electroplating apparatus for electroplating a surface of a wafer is provided. The wafer is capable of being electrically charged as a cathode. The electroplating apparatus includes a plating head capable of being positioned either over or under the surface of a wafer and capable of being electrically charged as an anode. The plating head is capable of enabling metallic plating between the surface of the wafer and the plating head when the wafer and plating head are charged. The plating head further comprises a voltage sensor pair capable of sensing a voltage present between the plating head and the surface of the wafer, and a controller capable of receiving data from the voltage sensor pair. The data received from the voltage sensor pair is used by the controller to maintain a substantially constant voltage to be applied by the anode when the plating head is placed in positions over the surface of the wafer. A method of electroplating a wafer is also provided.
US07862690B2	Apparatus and method for manufacturing a multi-layer web product An apparatus and method for manufacturing a multi-layer web product. A long fiber stream is directed around a rotating carding cylinder. Two combing cylinders are disposed adjacent the carding cylinder to comb a first web of long fiber and a second web of long fiber, respectively, from the carding cylinder. A first conveyor receives the first web from the first combing cylinder and transports the first web toward a layering point. Similarly, a second conveyor receives the second web from the second combing cylinder and transports the second web toward the layering point. A short fiber deposition unit is disposed adjacent the second conveyor and deposits short fibers onto the second web. At the layering point, the first conveyor deposits the first web onto the second web, with the short fibers sandwiched therebetween, to form a layered web product.
US07862689B2	Water content estimation apparatus, sheet material processing apparatus, water content estimation method, and sheet material processing method Information (particularly, water content) of a sheet material which changes during progression of processing is estimated with higher accuracy and information output or (image formation) processing is performed. The water content estimation method of the present invention includes: detecting a first information regarding moisture contained in a sheet material; detecting a second information regarding a factor affecting information regarding the moisture contained in the sheet material; predicatively computing an estimation of a water content of the sheet material based on the first information and the second information; and adjusting processing conditions for image formation based on the estimation of the water content which is computed.
US07862688B2	Methods to control organic contaminants in fibers Methods to control organic contaminants in fibers are described. One method involves contacting the fibers with a composition containing water-soluble cellulose derivative and ester hydrolyzing enzyme, for a sufficient time and in a sufficient amount to control the organic contaminants present in the fibers. This method is effective to reduce stickies in paper mill furnish formed with recycled fibers. A method for pitch control in paper mill furnish formed with virgin fibers is also provided by the additional inclusion of lipoxygenase in the composition. Resulting paper products formed from the processed fibers are also described as well as methods to make them.
US07862686B2	Enhanced multi-ply tissue products Tissues are provided as multi-ply tissue products having greater tactile sensation and resiliency in hand. Improved tissues may have a thickened and reduced density middle layer. The tissues may serve as applicators for chemical agents to be released during use of the tissue. A tissue having an improved tactile impression to the consumer, with enhanced resilience and high external bulk is disclosed. In one embodiment, a multi-ply structure having at least three plies is desirable. A middle or intermediate ply is comprised an increased thickness and a greater bulk is employed. In general, the exterior plies of the tissue are smooth and desirable to the consumer.
US07862685B2	Method for deinking pulp using premixed hydrophobically modified calcium carbonate particles The present invention provides methods for deinking printed waste paper—particularly methods that use a deinking composition that includes a hydrophobically-modified inorganic particle (“MIP”) to improve ink collection efficiency under traditional alkaline, reduced alkali, and true neutral deinking conditions. Deinking compositions are provided that include a hydrophobically-MIP substrate, a nonionic surfactant, and a fatty acid, or mixtures thereof. The improved ink collection of the present invention can result in deinked pulp of high quality and/or yields that has excellent brightness and effective residual ink concentrations (“ERIC”) values.
US07862682B2	Showerhead electrode assemblies for plasma processing apparatuses Showerhead electrode assemblies are disclosed, which include a showerhead electrode adapted to be mounted in an interior of a vacuum chamber; an optional backing plate attached to the showerhead electrode; a thermal control plate attached to the backing plate or to the showerhead electrode at multiple contact points across the backing plate; and at least one thermally and electrically conductive gasket separating the backing plate and the thermal control plate, or the backing plate and showerhead electrode, at the contact points. Methods of processing semiconductor substrates using the showerhead electrode assemblies are also disclosed.
US07862679B2	Integral double bag for vacuum bagging a composite part and method of using the same Composite parts such as plastic laminates are formed using a pre-assembled, integral double bag to vacuum bag the part. The double bag is formed of two sheets of bag material that are cut to pre-determined width dimensions, with the width of one sheet being less than that of the other. The bag sheets are prealigned and then attached to each other by spaced apart bonds between the sheets which hold the bag sheets in registered relationship to each other when the double bag is placed over the part and sealed to a tool base. The attachment bonds may be formed by ultrasonic welding, heat sealing or an adhesive.
US07862675B1	Slip method for prestressing beams with bonded tendons A method for manufacturing a reinforced beam having a bonded tensile reinforcement member includes assembling a tensile reinforcement member to a beam, wherein adhesive is disposed between the tensile reinforcement member and the beam. A load is applied to the tensile reinforcement member to define a pre-tensioned tensile reinforcement member. A force is applied to urge the beam and the pre-tensioned tensile reinforcement member together. The load is released on the pre-tensioned tensile reinforcement member prior to the adhesive becoming cured, allowing longitudinal ends of the tensile reinforcement member to slide relative to the beam at longitudinal ends of the beam, and thereby forming a reinforced beam having a bonded tensile reinforcement member.
US07862673B2	System and method for sealing a telephone handset A system and method for sealing around openings in a telephone handset casing in which externally facing components are positioned. An exemplary method comprises applying a bead of liquid sealant around the opening in a telephone handset casing, allowing the bead to partially cure to form a skin yet still having a malleable consistency, and placing the externally facing component against the bead to deform the bead in conformance with the surface of the component, to provide a close seal between the casing and the component.
US07862672B2	Method for manufacturing honeycomb structure and extrusion-molding method for forming coupled honeycomb molded body A method is provided that includes extrusion-molding a raw material composition containing ceramic powder and a binder to manufacture a coupled honeycomb molded body having a shape in which a plurality of pillar-shaped honeycomb molded bodies, each having a number of cells disposed in parallel with one another in a longitudinal direction with a cell wall therebetween, are integrated with one another by interposing a coupling portion. The method includes firing the coupled honeycomb molded body to manufacture a coupled honeycomb fired body, cutting the coupling portion to manufacture coupling-portion-cut honeycomb fired bodies, and binding a plurality of honeycomb fired bodies by interposing an adhesive layer, where at least one of the bound honeycomb fired bodies is a coupling-portion-cut honeycomb fired body.
US07862670B2	Process for the manufacturing of a decorative laminate provided with an aligned surface A process for the manufacture of a decorative board, which board includes at least one thermosetting resin impregnated paper layer. A decor paper in the form of a web or a sheet, provided with a plurality of decor sections, each decor section being intended to constitute a decor of a decorative panels, is placed as a surface layer on a base layer and bonded thereto by pressing under elevated pressure. A plurality of press plates or press foils, each press plate or press foil being provided with a surface structure intended to match at least one decor section of the decor paper, are accurately positioned on top of the thermosetting impregnated paper layer before the pressing and is after the pressing separated from the laminate achieved. The laminate will hereby be provided with a decor surface with a matching surface structure which is in register with the decor of the decor paper.
US07862668B1	Single-base propellant composition using BuNena as energetic plasticizer A gun propellant formulation comprising: a nitrocellulose component comprising from about sixty-five percent (65.0%) to about ninety-five (95.0%) of the gun propellant by weight, having a nitrogen proportion of substantially twelve and six-tenths percent (12.6%) nitrogen; an energetic plasticizer component comprising from about 5.0 percent (5.0%) to about 35 percent (35.0%) of the gun propellant by weight, and comprising N-Butyl-2Nitratoethyl Nitramine (BuNena); a burning rate moderator and stabilizer component comprising from about one-half of one percent (0.5%) to about five percent (5.0%) of the gun propellant by weight, and comprising Sym-Diethyl Diphenyl Urea, N,N′-Diethyl Carbanilide (Ethyl Centralite, Centralite I); and a stabilizer component comprising about one-half of one percent (0.5%) to about five percent (5.0) of the gun propellant by weight, and comprising Acetyl triethyl citrate (ATEC). Additional components comprising less than 5% of the gun propellant may optionally include Graphite, carbon black, and candelilla wax.
US07862666B2	Highly anticorrosive high strength stainless steel pipe for linepipe and method for manufacturing same A highly corrosion resistant high strength stainless steel pipe for linepipe, having a composition containing about 0.001 to about 0.015% C, about 0.01 to about 0.5% Si, about 0.1 to about 1.8% Mn, about 0.03% or less P, about 0.005% or less S, about 15 to about 18% Cr, about 0.5% or more and less than about 5.5% Ni, about 0.5 to about 3.5% Mo, about 0.02 to about 0.2% V, about 0.001 to about 0.015% N, and about 0.006% or less O, by mass, so as to satisfy (Cr+0.65 Ni +0.6Mo+0.55Cu−20C≧18.5), (Cr+Mo+0.3Si−43.5C−0.4Mn−Ni−0.3Cu−9 N≧11.5) and (C+N≦0.025). Preferably quenching and tempering treatment is applied to the pipe. The composition may further contain about 0.002 to about 0.05% Al, and may further contain one or more of Nb, Ti, Zr, B, and W, and/or Cu and Ca. The microstructure preferably contains martensite, ferrite, and residual γ.
US07862663B2	Methods for processing a substrate with a flow controlled meniscus A method for processing a substrate is provided which includes applying fluid onto a surface of the substrate from a portion of a plurality of inlets and removing at least the fluid from the surface of the substrate where the removing being processed as the fluid is applied to the surface. The applying the fluid and the removing the fluid forms a segment of a fluid meniscus on the surface of the substrate.
US07862661B2	Device and method for treating the surfaces of substrates The invention relates to a device for treating the surfaces of silicon wafers, comprising transport rollers for transporting the silicon wafer, and at least one conveyor device which wets the surface of the silicon wafer with an aqueous medium on a transport plane which is determined by the transport rollers. The conveyor device is configured such that it can apply the process medium to the surface of the silicon wafer, which is oriented in a downward manner and which is arranged on the transport plane. Several suction pipes for suctioning gaseous or mist-like distributed process mediums from the area surrounding the conveyor device are provided. The suction pipes are arranged in the vertical direction below the transport plane.
US07862655B2	Subterranean cementing methods and compositions comprising oil suspensions of water soluble polymers Of the many methods and compositions provided herein, one method comprises providing a cement composition, wherein the cement composition comprises a cementitious component and an additive comprising a polymer, a phosphorus component, a polyvalent metal ion, an oil-based liquid, and a surfactant; introducing the cement composition into at least a portion of the subterranean formation; and allowing the cement composition to at least partially set therein. Another method provided herein comprises providing a cement composition that comprises a cementitious component and an additive comprising a polymer, a phosphorus component, a polyvalent metal ion, an oil-based liquid, and a surfactant; introducing the cement composition into a void located in a pipe string; and allowing the cement composition to at least partially set therein. A cement composition provided herein comprises a cementitious component; and an additive comprising a polymer; a phosphorus component; a polyvalent metal ion; and an oil-based liquid; and a surfactant.
US07862654B2	Treating agent for forming a fluoride coating film and method for forming a fluoride coating film A fluoride coating film formed with a fluoride-containing solution wherein a rare earth fluoride or an alkaline earth metal fluoride, in particular, fluoride of Pr, Nd, Dy, Tb and Ho, is swollen in a solvent comprising a major amount of an alcohol, and the solution is a colloidal solution in which the rare earth fluoride or the alkaline earth metal fluoride is dispersed homogeneously in the solvent comprising a major amount of an alcohol improves magnetic properties of NdFeB rare earth magnets including not only sintered magnets but also bonded magnets.
US07862652B2	Directional self-assembly of biological electrical interconnects Microtubules are excellent candidates for the fabrication of nanostructures, including nanowires. A method for controlled nucleation and growth of microtubules on substrates (e.g., gold on a silicon wafer) is provided. The substrate is functionalized with a nucleating agent for microtubule growth. The method can be employed to generate nanoscale structures on substrates or between substrates by additional attachment of MT capture agents which function to capture the ends of growing MT to form connecting MT structures. The method can be used to form 2- and 3-D structures on or between substrates and can function to establish interconnects between nanoscale devices or molecular electronic devices and electrodes. A specific method for metallization of biological macromolecules and structures in provides which can be beneficially applied to metallized the MT formed by the growth and capture method. The metallization method is biologically benign and is particularly useful for copper metallization of MTs.
US07862651B2	Apparatus and method for superheated vapor contacting and vaporization of feedstocks containing high boiling point and unvaporizable foulants in an olefins furnace A contactor/separator is formed from a vessel; an inlet for receiving a vapor/liquid mixture; an inlet for receiving a superheated vapor; a hub located within the vessel, the hub including a plurality of vanes for imparting a centrifugal motion to the vapor/liquid mixture or the superheated vapor; an outlet in a bottom of the vessel for removing liquid; and an outlet for removing vapor from the vessel. A method is also provided for heating and separating liquid and vapor from a hydrocarbon feedstock comprising introducing a hydrocarbon feedstock into a contactor/separator: introducing a superheated vapor into the contactor/separator such that it contacts and vaporizes a portion of the feedstock within the contactor/separator; separating unvaporized feedstock from vaporized feedstock in the contactor/separator; removing the vaporized feedstock and the superheated vapor through a first outlet; and removing the unvaporized feedstock through a second outlet.
US07862647B2	Gas adsorption and gas mixture separations using mixed-ligand MOF material A method of separating a mixture of carbon dioxiode and hydrocarbon gas using a mixed-ligand, metal-organic framework (MOF) material having metal ions coordinated to carboxylate ligands and pyridyl ligands.
US07862646B2	Nanoporous articles and methods of making same An adsorbent having porosity expanded by contact with a first agent effecting such expansion and a pressurized second agent effecting transport of the first agent into the porosity, wherein the adsorbent subsequent to removal of the first and second agents retains expanded porosity. The adsorbent can be made by an associated method in which materials such as water, ethers, alcohols, organic solvent media, or inorganic solvent media can be utilized as the first agent for swelling of the porosity, and helium, argon, krypton, xenon, neon, or other inert gases can be employed as the pressurized second agent for transport of both agents into the porosity of the adsorbent, subsequent to which the agents can be removed to yield an adsorbent of increased capacity for sorbable fluids, e.g., organometallic compounds, hydrides, halides and acid gases. Also described is a nanoporous carbon composite having porosity that is at least partially filled with material imparting to the composite an enhanced character with respect to characteristics selected from the group consisting of hardness, wear-resistance and toughness, as compared with the nanoporous carbon alone.
US07862643B2	Hydrogen separation membrane and fuel cell, and manufacturing method therefor A method of manufacturing a hydrogen separation membrane comprises the steps of forming an intermediate layer suitable for controlling oxidation of a hydrogen permeable metal layer on the surface of the hydrogen permeable metal layer on the surface of the hydrogen permeable metal used as a substrate; and attaching a catalytic metal in a granular form on the surface of the intermediate layer. This method can be used to manufacture a hydrogen separation membrane in which the quantity of catalytic metal used is controlled.
US07862634B2	Polycrystalline composites reinforced with elongated nanostructures A sintered polycrystalline composite for cutting tools that includes a plurality of diamond or cubic boron nitride particles; a plurality of nanotube materials; and a refractory or binder material is disclosed. Methods of forming such polycrystalline composites that include integrating or mixing a plurality of nanotube materials with diamond or cubic boron nitride particle and/or refractory or binder particles are also disclosed.
US07862633B2	Method and system for introducing fuel oil into a steam reformer with reduced carbon deposition A system and method for creating reformate with decreased carbon deposition. The system is made up of a steam source, a superheater, a fuel injection device, a prereformer, and a reformer with catalyst linings. The system functions to superheat steam while maintaining the fuel at a lower temperature prior to injection and mixing with the steam. After injection and mixing, the steam and fuel mixture is then passed through a prereformer where catalysts treat a portion of the fuel and steam mixture. After these portions are treated with a catalyst, the mixture is passed through to a reformer where further treatment of the material by catalyst takes place.
US07862631B2	Fuel processor primary reactor and combustor startup via electrically-heated catalyst A primary reactor for a fuel processor system that employs steam and air to convert a liquid hydrocarbon fuel into a hydrogen-rich gas stream. The liquid fuel and an air-steam mixture are mixed in a mixing region within the reactor. The fuel mixture is then directed through an electrically heated catalyst region that heats the mixture to the operation temperature of a light-off catalyst at system start-up. The heated fuel mixture is then directed through a light-off catalyst monolith where the hydrocarbon fuel is dissociated. Once the fuel mixture is heated to the operating temperature of the light-off catalyst, the electrically heated catalyst region is turned off because the exothermic reaction in the light-off catalyst monolith generates the heat necessary to sustain the catalytic reaction.
US07862630B2	Chemical change agent The present invention relates to an improved chemical change reagent which is used as an additive to coal to enhance the complete combustion of the coal after turning it into a synthetic fuel. The composition is a chemical change agent in that it converts the coal/composition mix into a different material which, when burned, results in lower NOx emissions. The composition includes a wax, a base for ph adjustment and water and is mixed with the coal prior to combustion.
US07862628B2	Mixed metal catalyst additive and method for use in hydrocarbonaceous fuel combustion system A hydrocarbonaceous fuel additive, fuel composition, and method all lower both carbon particulate emissions and improve slag properties in combustion systems including, for instance, utility furnaces and boiler systems. The mixed metal catalyst may include a transition metal-containing compound, an alkali metal compound, and a magnesium-containing compound.
US07862627B2	Thin film battery substrate cutting and fabrication process A method of fabricating a battery comprises selecting a battery substrate having cleavage planes, and cutting the battery substrate with pulsed laser bursts from a pulsed laser beam to control or limit fracture along the cleavage planes. The pulsed laser beam was also found to work well on thin substrates which are sized less than 100 microns. Before or after the cutting step, a plurality of battery component films can be deposited on the battery substrate. The battery component films include at least a pair of electrodes about an electrolyte which cooperate to form a battery.
US07862620B2	Sensing systems and methods for monitoring gait dynamics Systems and method for monitoring gait dynamics are disclosed. The performance of an orthotic or prosthetic device or other device associated with a limb may be measured based on the resistance of a bending sensor. Data from the sensors is gathered or processed, particularly for purposes of alignment, safety, failure, usage, selection, and artificial proprioception. Information relating to the device may be outputted visually or auditorily to an individual.
US07862617B2	Spinal disc prosthesis apparatus and placement method A spinal disc prosthesis and method of placing a spinal disc prosthesis between adjacent vertebrae are provided. The inventive spinal disc prosthesis can comprise one or more solid, compressible prosthesis elements that are formed prior to the method of placing the prosthesis, or one or more solid prosthesis elements that are formed in situ. The inventive method of placing a spinal disc prosthesis between adjacent vertebrae of a patient is based on a posterior approach. The invention also includes a spinal disc prosthesis insertion apparatus and specially constructed surgical instruments for use in carrying out the method.
US07862605B2	Coated implantable medical device A coated implantable medical device 10 includes a structure 12 adapted for introduction into the vascular system, esophagus, trachea, colon, biliary tract, or urinary tract, and at least one layer 18 of a bioactive agent posited over at least one surface of the structure 12. Optionally, the device 10 can include at least one porous, preferably polymeric layer 20 posited over the layer 18 of bioactive agent, and can alternatively or additionally include at least one coating layer 16 posited on one surface of the structure 12, the at least one layer 18 of bioactive agent being posited in turn on at least a portion of the coating layer 16. The porous layer 20 and the coating layer 16 each provide for the controlled release of the bioactive material from the device 10. The structure 12 is preferably configured as a stent graft. The polymer of the porous layer 20 is preferably applied by vapor or plasma deposition. It is particularly preferred that the polymer is a polyamide, parylene or a parylene derivative which is deposited without solvents, heat or catalysts, but rather by condensation of a monomer vapor.
US07862602B2	Indirect-release electrolytic implant delivery systems Medical devices and methods for delivery or implantation of prostheses within hollow body organs and vessels or other luminal anatomy are disclosed. The subject technologies may be used in the treatment of atherosclerosis in stenting procedures or be used in variety of other procedures. The systems may employ a self expanding stent restrained by one or more members released by an electrolytically erodable latch. Such release means do not connect directly to the implant, though one or more portions may contact it.
US07862601B2	Apparatus and methods for delivering a stent into an ostium Apparatus and methods are provided for delivering a stent into an ostium. The apparatus includes a catheter including a proximal end, a distal end, and proximal and distal balloons disposed adjacent one another on the distal end. The balloons are expandable independently of one another, and a stent is provided surrounding the balloons. During use, the distal end of the catheter is introduced into a main lumen, and the proximal balloon is inflated to flare a proximal portion of the stent. The distal end is then advanced into the ostium until the flared proximal portion contacts a wall of the main lumen surrounding the ostium. The distal balloon is inflated to expand a distal portion of the stent, e.g., to dilate a lesion within the branch and/or ostium. Thereafter, the balloons are collapsed, and the apparatus is withdrawn, leaving the stent within the ostium.
US07862598B2	Devices and systems that deliver nitric oxide The present disclosure relates to dressings, such as patches and bandages, and other devices and systems that deliver nitric oxide.
US07862593B2	Vertebral osteosynthesis equipment This equipment includes: bony anchoring members whereof at least one includes a proximal threaded stud for receiving a nut and a base portion for anchoring to a vertebra; one or two linking rods to be connected to the anchoring members and be attached to the vertebrae thereby parts for connecting the linking rod(s) to the anchoring members, and extension pieces for engaging on the proximal stud(s) of the anchoring member(s) for running down connecting parts on the stud(s) until they rest on the proximal zone(s) of the base portion(s) of the anchoring members. The stud of at least one anchoring member and the extension piece used therewith include positioning elements.
US07862590B2	Interspinous process spacer Embodiments of an interspinous spacer that maintains spacing between a superior vertebra and inferior vertebra following a laminectomy. The interspinous spacer may include a superior arch engaging the spinous process of a superior vertebra and an inferior arch engaging the spinous process of an inferior vertebra. The superior arch and inferior arch may define a central opening in the interspinous spacer.
US07862589B2	Facet replacement Facet replacement device is provided. The facet replacement device comprises a superior seating device coupled to a superior vertebral body and an inferior seating device coupled to an inferior vertebral body. The seating devices provide a joint to replace the facet. Another device comprises a superior vertebral body anchor with a first extension terminating in a joint connection, such as, a socket. An inferior vertebral body anchor has a second extension terminating in a corresponding joint connection, such as, a ball.
US07862581B2	Tissue conveyor for use in gastric reduction surgery and associated method for use A tissue conveyor includes a conveyor body having a proximal end and a distal end. The proximal end includes a handle allowing for operator control of an end effector located at the distal end. The end effector includes a grasper assembly composed of a first jaw bar and a second jaw bar connected by a support base to define a cavity into which tissue is drawn. A first conveyor member is positioned upon the first jaw bar for movement along an internal surface of the first jaw bar and a second conveyor member is positioned upon the second jaw bar for movement along an internal surface of the second jaw bar. The method for creating a tissue fold includes positioning a tissue conveyor adjacent tissue, pushing the respective first jaw bar and the second jaw bar into the tissue in the area where a fold is desired, and pulling the first conveyor member and the second conveyor member proximally to draw the first and second conveyor members and tissue into a cavity defined by the first jaw bar and the second jaw bar to create a tissue fold.
US07862580B2	Flexible wrist for surgical tool The present invention is directed to a tool having a wrist mechanism that provides pitch and yaw rotation in such a way that the tool has no singularity in roll, pitch, and yaw. In one embodiment, a minimally invasive surgical instrument comprises an elongate shaft having a working end, a proximal end, and a shaft axis between the working end and the proximal end; and an end effector. A wrist member has a flexible tube including an axis extending through an interior surrounded by a wall. The wall of the flexible tube includes a plurality of lumens oriented generally parallel to the axis of the flexible tube. The wrist member has a proximal portion connected to the working end of the elongate shaft and a distal portion connected to the end effector. A plurality of actuation cables have distal portions connected to the end effector and extend from the distal portion through the lumens of the wall of the wrist member toward the elongate shaft to proximal portions which are actuatable to bend the wrist member in pitch rotation and yaw rotation.
US07862578B2	Guided filter with support wire and methods of use A guided filter system for temporary placement of a filter in an artery or vein is disclosed. The system includes a guidewire slideable through a wire guide included in a distal region of a support wire. The support wire has an expandable filter, which is operable between a collapsed or enlarged condition. A variety of endovascular devices, including angioplasty, atherectomy, and stent-deployment catheters, are insertable over the guidewire and/or the support wire. Methods of using the guided filter system to direct and exchange endovascular devices to a region of interest, and to entrap and remove embolic material from the vessel are also disclosed.
US07862576B2	Angioplasty balloon with therapeutic/aspiration channel An angioplasty balloon catheter with an added channel for delivering medication or removing body fluids distal to the site of angioplasty is disclosed. The balloons are especially useful in the treatment of occlusions in saphenous vein grafts, the coronary and carotid arteries, arteries arising from the aorta and branches thereof and in veins flowing to the heart or their tributaries and sub tributaries thereof.
US07862575B2	Vascular ablation apparatus and method An apparatus for the treatment of venous stasis includes an elongated intraluminal member shaped and dimensioned for passage through vessels of a subject. The intraluminal member includes a proximal end and a distal end. A conduit extends from proximate the proximal end of the intraluminal member to proximate the distal end of the intraluminal member. The conduit is shaped and dimensioned for fluid communication between the proximal end of the intraluminal member and the distal end of the intraluminal member. The distal end of the intraluminal member includes disruption means proximate thereto for ablating a predetermined vessel wall. A method is also provided for the treatment of venous stasis. The method is achieved by advancing an elongated intraluminal member through a vein to a treatment site, activating the intraluminal member for ablation of the treatment site and injecting sclerosant into the vein at the treatment site.
US07862571B2	Occlusion clip and method of applying same An occlusion clip is disclosed that comprises an upper occlusion member having substantially parallel first and second upper occlusion arms each having proximal and distal upper occlusion arm ends. The first and second upper occlusion arms define an upper main body width dimension. An upper arcuate portion connects the first and second upper occlusion arms at their distal ends. The occlusion clip also comprises a lower occlusion member having substantially parallel first and second lower occlusion arms each having proximal and distal lower occlusion arm ends. The first and second lower occlusion arms define a lower main body width dimension. A lower arcuate portion connects the first and second lower occlusion arms at their distal ends. The occlusion clip further comprises a torsion spring connecting the proximal end of the first lower occlusion arm to the proximal end of the second upper occlusion arm. The torsion spring biases the upper and lower occlusion members toward a closed position wherein the upper occlusion member is in contact with the lower occlusion member.
US07862568B2	Fixing device The present invention relates to a fixing device comprising at least one guide for a securing element, a fixing system comprising such a fixing device and at least one securing element, as well as a positioning system comprising such a fixing system, and a positioning element.
US07862567B2	Retrodrill technique for insertion of autograft, allograft or synthetic osteochondral implants Osteochondral sockets are formed using a retrograde drill assembly. The retrograde drill assembly includes a guide pin having a fluted tip and an externally threaded portion. A removable cutter head has internal threads that engage the threads of the guide pin. The guide pin is drilled through bone, exposing the external threads in a joint space requiring repair. The cutter is threaded onto the guide pin, and the assembly is retrograded with rotation to form a socket in the bone. The cutter is disengaged from the guide pin for disassembly and removal from the bone, making way for an implant to be installed in the pocket. The implant can be drawn into the socket using an attached strand threaded through the bone socket and out of the bone.
US07862563B1	Integral high frequency electrode A method and apparatus for the application of an electrical signal to neural tissue and other target tissue in the living body.
US07862561B2	Clamp based lesion formation apparatus with variable spacing structures Apparatus including includes first and second energy transmission surfaces with a predetermined spacing and a device that allows the spacing to increase when the energy transmission surfaces are brought into contact with a tissue structure that is thicker than the predetermined spacing.
US07862560B2	Ablation apparatus having reduced nerve stimulation and related methods Apparatus and methods for reducing nerve stimulation in electrosurgical instruments utilizing electrically isolated pairs of electrodes are disclosed. At least two pairs of electrodes may be configured to create at least two opposing currents which effectively cancel one another such that a net current flow is inhibited from developing within surrounding tissue structures to mitigate or eliminate undesired electrical stimulation of the tissue.
US07862558B2	Subdermal cryogenic remodeling of muscles, nerves, connective tissue, and/or adipose tissue (fat) Devices, systems, and methods treat cosmetic defects, and often apply cooling with at least one tissue-penetrating probe inserted through of the skin of a patient. The cooling may remodel one or more target tissue so as to effect a desired change in a composition of the target tissue and/or a change in its behavior. Exemplary embodiments of the cooling treatments will interfere with the nerve/muscle contractile function chain so as to mitigate wrinkles of the skin. Related treatments may be used therapeutically for treatment of back and other muscle spasms, chronic pain, and the like. Some embodiments may remodel subcutaneous adipose tissue so as to alter a shape or appearance of the skin surface.
US07862555B2	Apparatus and method for adjustable fractional optical dermatological treatment In a fractional treatment system, an adjustable mechanism can be used to adjust the beam shape, beam numerical aperture, beam focus depth, and/or beam size to affect the treatment depth and or the character of the resulting lesions. Adjustment of these parameters can improve the efficiency and efficacy of treatment. Illustrative examples of adjustable mechanisms include a set of spacers of different lengths, a rotatable turret with lens elements of different focal distances, an optical zoom lens, and a mechanical adjustment apparatus for adjusting the spacing between two optical lens elements. In one aspect, the fractional treatment is configured with a laser wavelength that is selected such that absorption of the laser wavelength within the tissue decreases as the tissue is heated by the laser (e.g., 1480-1640 nm). Desirably, the laser wavelength is primarily absorbed within a treated region of skin by water and has a thermally adjusted absorption coefficient within the range of about 7 cm−1 to about 26 cm−1.
US07862549B2	Variable stretch composites and methods of making the composite Variable stretch composites having one or more first elastomeric members disposed on a first region of an extensible substrate, and one or more second elastomeric members disposed on a second region of the extensible substrate which different from the first elastomeric members to provide variable properties to said regions of the composite. The composite has been incrementally stretched to at least partially break up the structure of the substrate in order to reduce its resistance to stretch. The variable stretch composites are useful for disposable and durable articles, such as disposable absorbent articles including diapers, pull-on diapers, training pants, incontinence briefs, catamenial garments, baby bibs, and the like, and durable articles like garments including sportswear, outerwear and the like. The present invention also relates to methods of forming such variable stretch composites.
US07862545B2	Pivoting joint infusion system with steal An infusion system for delivery of therapeutic fluids from a remote source into a patient's body. The system has an infusion assembly, a rotating pivot joint member, a fluid connector assembly, and a sealing assembly retained within the infusion assembly between the housing of the infusion assembly and the rotating pivot joint member. The seal reduces leakage of fluids. The rotating joint may be pivoted to three distinct positions to allow for emplacement on the patient, delivery of the therapeutic fluid to the patient, and protected, sealed closure of the fluid channels to avoid patient fluid backflow.
US07862536B2	Combined nasal spray and aspirator device A combined nasal spray and aspirator device includes an air pump disposed within a housing and comprises a spray and aspirator assembly. The air pump, at which an air suction connector and an air discharge connector are disposed, is driven by a driving component to perform air suction and discharge actions. The spray and aspirator assembly, mounted to the air suction connector and the air discharge connector, comprises a spray conduit and a first aspiration conduit; the spray conduit connects to an atomizer which is provided with liquids from a liquid storage container, and the first aspiration conduit connects to a mucus collector so that when some air carrying mucus enters the mucus collector, the mucus is left behind and the air enters the air pump through a second aspiration conduit. The device of the present invention integrates the operations of a nasal spray and a nasal aspirator, sucking the mucus away right after it sprays and liquefies the mucus, with said actions occurring almost simultaneously. The present invention is physically more favorable for users.
US07862533B2	Multiple-component tampon applicator There is provided a multiple-component tampon applicator formed from at least three separate components. A fingergrip having a reduced cross-section as compared to that of the barrel may be formed such that it is a separate component or is integrally formed with a barrel component. The reduced cross-section fingergrip provides exceptional grippability to the user. The multiple components may be formed from materials including, for example, biopolymer including starches and proteins, cardboard, heat shrink plastic, paper slurry, plastic, plastic tubing, pulp slurry, pulp-molded paper, or any combinations thereof. Prior to assembly of the applicator and prior to loading the barrel component with an absorbent pledget, petals may be formed on the insertion end of the barrel using existing processes and equipment. Alternatively, a separate insertion tip component having petals may be formed. This separate component may then be connected to the barrel component either before or after an absorbent pledget is loaded into the barrel component.
US07862530B2	High citrate dialysate and uses thereof The dose of dialysis in terms of urea clearance is marginal in many hemodialysis patients, and metabolic acidosis as determined by the pre-dialysis serum HCO3 level is common. A dialysate that included citric acid rather than acetic acid as acidifying agent provides superior performance properties. Citrate-containing dialysate was used exclusively in 22 hemodialysis patients. Initially, only 8 of the 22 patients had a pre-dialysis serum HCO3>23 mEq/L (lower limit of normal), however, after 12 weeks of dialysis using the citrate-containing dialysate, the serum HCO3 normalized in 15 patients (p=0.0001, Chi-square). Dialysis variables were kept constant in 19 of the patients, who also used and reused the same dialyzer model throughout. In these patients, the initial average urea reduction ratio (URR) was 68.5±5.9%, and after treatment with the citrate dialysate disclosed herein, this ratio had increased to 73±5.3% (p<0.03). SpKt/V, calculated using the Daugirdas II formula, also increased from 1.23±0.19 to 1.34±0.2 (p=0.01). This increased urea clearance may be the result of the anticoagulant property of citrate maintaining patency of the dialyzer membrane. The increase in pre-dialysis serum HCO3 may represent increased delivery from the dialysate and production from citric acid.
US07862528B2	Patella stabilizing method and system A unitary knee patella stabilizer for a user's leg, the stabilizer including a patella stabilizer sleeve having an open-upper end and an open-lower end adapted to slidably receive the leg portion of the user and an upper fastener assembly having a first strap, connected at its proximal end to an upper end of the patella stabilizer sleeve, the first strap having a fastener at a distal end of the first strap. The apparatus further includes a lower fastener assembly having a second strap, connected at its proximal end to a lower end of the patella stabilizer sleeve, the second strap having a fastener at a distal end of the second strap and a buttress comprising a plurality of straps adapted to be adjustably positioned on an inside surface of the patella stabilizer sleeve around a location on a circumferential edge of a patella opening.
US07862524B2	Portable arm exoskeleton for shoulder rehabilitation The present invention relates to an exoskeleton interface apparatus that parallels human arm motion and is comprised of a serial assemblage of five powered linkages and joints based at a rigid support structure worn on the torso of the human subject. Such apparatus generates shoulder rotation using three orthogonal revolute joints mounted on serial linkages encompassing and intersecting at the anatomical glenohumeral joint. Elevation of the shoulder joint is articulated using a link member driven by a single revolute joint mounted in the torso structure. Passive adjustable linkages are used to match variation in anatomical forearm length, upper arm length, and scapula-to-glenohumeral radius. A plurality of integrated dc motor/harmonic drive transmission modules is co-located on adjoining linkages to power the joints. Force is exchanged with the human at the handgrip and elbow brace, and reacted to the torso structure via the base attachment. The present invention is applicable in particular to rehabilitation of the shoulder.
US07862522B1	Sensor glove A Sensor glove is an instrument, in the same way that a piano is an instrument. The Sensor glove is purchased and the owner then learns to use it and the sensors therein to develop the performance of a sound, character or model, or to “conduct” or “play” the sensor movements and experience the response of the model in real time. Several performers with a number of the Sensor glove can control over 200 motors or hundreds of control points on a character at one time, manipulate audio data, or computer images etc. The characteristics of the sensors on the gloves can be adjusted to the needs and demands of the wearer or the many performer and wearers in those venues where multiple performers are used with many gloves to control or produce the motions and sounds of many distinct characters in a screen play.
US07862521B1	Uterine contraction sensing system and method The present invention provides a system for enabling the sensing of changes in pressure in response to uterine muscle tone changes relating to contractions, and for enabling the evaluation of contractions based thereon. The system enables a portion thereof to effectively and efficiently project at least partially below the non-compressed abdominal surface, and provides electrical isolation of the system elements. It enables ease of use and enhanced patient comfort. It also enables maximized sensitivity and minimized system loading retention pressure.
US07862519B1	Easy-to-use multi-use body fluid specimen collection and analyte sensing assembly A multiple use analyte sensing assembly that includes a long, thin conductor. A plurality of sensing sites are spaced along the conductor and each sensing site includes a membrane system adapted to create a current when placed into contact with body fluid containing the analyte. The assembly also includes a housing, having an aperture, an uptake spool and a payout spool, the conductor being wrapped about the payout spool before the sensing assembly is used. A sensor positioning actuator turns the uptake spool to move each sensing site, in sequence, to the housing aperture and then to the uptake spool. The assembly also includes a skin broaching assembly, having a multiplicity of lancets and a lancet positioning actuator adapted to move each lancet to the aperture. In addition, a lancet use actuator is adapted to move each lancet at least partially through the aperture and then back again.
US07862517B2	MRI biopsy device A localization mechanism, or fixture, is used in conjunction with a breast coil for breast compression and for guiding a core biopsy instrument during prone biopsy procedures in both open and closed Magnetic Resonance Imaging (MRI) machines. The localization fixture includes a three-dimensional Cartesian positionable guide for supporting and orienting an MRI-compatible biopsy instrument, and in particular a sleeve, to a biopsy site of suspicious tissues or lesions. A depth stop enhances accurate insertion, and prevents over-insertion or inadvertent retraction of the sleeve. The sleeve receives a probe of the MRI-compatible biopsy instrument and may contain various features to enhance its imagability, to enhance vacuum and pressure assist therethrough, and marker deployment etc.
US07862506B2	Diabetes management system A diabetes management system, comprising a glucose meter measuring blood glucose level data and a portable microprocessor-based unit in communication with the blood glucose meter such as to be capable of accessing the blood glucose level data. Input data corresponding to the blood glucose level data is used in a program of instructions running on the portable microprocessor-based unit or the glucose meter, or both. The program of instructions includes instructions to communicate a signal to inject insulin based upon the blood glucose level data.
US07862503B2	Rotational, translational and torqueing control members for an endoscopic instrument A flexible endoscopic clip applier includes a flexible coil with a manual actuator coupled to one end and a jaw assembly coupled to the other end. A store of clips is arranged adjacent to the jaw assembly and a clip pusher is arranged adjacent to the store of clips. The actuator includes a lever for opening and closing the jaws, a knob for rotating the jaw assembly, and a crank for dispensing clips. The knob and the lever are coupled to a single control member which extends through the coil to a joiner where it is joined to a pair of pull wires coupled to the jaws. The crank is coupled to a second control member which is threaded along a distal portion. The threaded portion engages a threaded member near the pusher and is coupled to the pusher such that rotation of the threaded control member by the crank causes the pusher to be moved distally.
US07862502B2	Method and apparatus for adjusting a gastrointestinal restriction device A gastrointestinal implant system includes an adjustable restriction device having a contact surface configured for at least partially engaging a surface of a gastrointestinal tract of a mammal. The implant system further includes an implantable interface including a first driving element, the first driving element being moveable and operatively coupled to the adjustable restriction device by an actuator configured to change the dimension or configuration of the contact surface in response to movement of the first driving element. The system also includes an external adjustment device having a second driving element configured to non-invasively engage the first driving element of the implantable interface from a location external to the mammal. In the system, actuation of the second driving element of the external adjustment device produces movement in the first driving element of the implantable interface and results in a change in the dimension or configuration of the contact surface.
US07862499B2	Blood vessel wrap A wrap (20) for securing about a blood vessel (36) by encasing a section of the vessel. The wrap (20) being of thin flexible construction having two ends (22, 24) and two sides (26, 28). The wrap (20) is more elastic or stretchable at, near, or along at least some of its sides (22, 24) compared to at, near, or along its center, to provide strain relief from wrapped to unwrapped aorta. The wrap (20) is not inelastic, so that loss of aortic compliance is minimized or enhanced. The wrap (20) is adapted to apply, in use, less compressive force at, near, or along at least some of its sides (22, 24) compared to at, near, or along its center.
US07862491B1	Resistance arrangement of a waist-twisting machine A resistance arrangement of a waist-twisting machine, wherein the waist-twisting machine having a bottom base, a foot-rotating disc, and a handrail frame. The operation of the foot-rotating disc imparts a motion to a lateral post coupled with the handrail frame such that the hands and the feet rotate in opposite direction. Two driven arms are pivotally attached to the bottom base, and a plurality of elastic elements are interposed between the driven arms. Moreover, a bumping post is positioned between the driven arms for limiting the driven arms to a proper return position. One of the driven arms corresponding to the exercise direction will be extended outwards by a contact roller at the bottom of the lateral post when the lateral post is moved by an external force. At that time, another driven arm that is not moved will stay there to act as a fixing end. Accordingly, the elastic elements may be pulled to produce an expected exercise resistance.
US07862490B2	Exercise machine force application apparatus An exercise machine has a reactant force generating mechanism and a force application device. The force application device is coupled to the force input structure of the reactant force generating mechanism and is configured for transmitting force generated by a user to the force input structure. At least a portion of the force application device protrudes from within an opening in the force input structure. The force application device includes a non-compliant base portion, a compliant outer shell coupled to the base portion and pressure displaceable material contained within an interior space of the compliant outer shell. The force application device allows the user-generate force to be transmitted through the pressure displaceable material and exerted on the reactant force generating mechanism of the exercise machine so as to cause the force input structure to exert a proportional reactant force on the force application device.
US07862478B2	System and methods for controlling the operation of one or more exercise devices and providing motivational programming The present invention is directed to systems and methods for providing exercise devices with motivational programming. The programming includes motivational content and control signals, synchronized with the motivational content, for controlling operation of the exercise device. The motivational content includes audio and/or video designed to simulate a group exercise setting and optionally instructional and educational content for the benefit of a user. The control signals can be carried in wireless carrier signals and can include bytes of data that define changes to the value of one or more operating parameters of an exercise device. The control signals can control one or more operating parameters of one or more exercise devices, whether at once, or device specific.
US07862469B2	Method for controlling a drivetrain of a motor vehicle A method for controlling a drivetrain of a motor vehicle is provided. The drivetrain includes, as components, at least an internal combustion engine, an electric drive machine, a clutch and a transmission that can be connected to drive wheels. A control device initiates gear shifts at the transmission based on a wide variety of sensor signals by using a characteristic diagram. In order to ensure an excellent shift quality over long operating periods, a drive torque value MV of the internal combustion engine, which is determined by the control device, can be checked and if necessary corrected in dependence of given conditions by determining the drive torque value ME of the electric drive machine.
US07862465B2	Automatic transmission An automatic transmission that includes two clutches that are provided in mutually different positions in a radial direction while overlapping each other in an axial direction. The two clutches each include a clutch drum; a piston that structures a operating oil chamber while using a part of the clutch drum as a cylinder; a plurality of friction plates that engage the clutch drum; and a cancel oil chamber that is disposed on a back face side of the piston and that cancels a centrifugal hydraulic pressure acting on the operating oil chamber.
US07862463B2	Multi-speed transmission A transmission is provided having an input member, an output member, three planetary gear sets, a plurality of coupling members and a plurality of torque transmitting devices. Each of the planetary gear sets includes a sun gear member, a planet carrier member, and a ring gear member. The torque transmitting devices include clutches and a brake arranged within a transmission housing.
US07862440B2	Nut assembly and method for the production thereof The invention relates to both nut assemblies and methods for producing the same. Said nut assemblies consist of a nut body (1a) and a pressure disk (2a). The nut body has a drive portion, such as a polygonal portion, for engaging with a tool and an abutment region that can be brought into contact with the supporting surface of the pressure disk arranged on the nut body in a captive manner. The pressure disk has a central opening into which a neck formed on the nut extends axially at least in part. The neck has a projection for forming a captive connection. This projection radially overlaps or engages the thrust ring.
US07862437B2	Spring-mass damper system for vehicle transmission A damper assembly for absorbing and attenuating torsionals and vibrations transmitted from an engine to a transmission is provided. The damper assembly includes a damper flange with a plurality of spring-mass damper systems operatively attached thereto and elongated circumferentially about its outer periphery. Each spring-mass damper systems include an inner spring nestably positioned inside an outer spring, a first spring retainer having a base portion defining a first interface surface with a first pilot portion extending therefrom to define a second interface surface with a second pilot portion extending therefrom, and a second spring retainer having a base portion defining an interface surface with a pilot portion extending therefrom to define a fourth interface surface. The first and third pilot portions engage with and thereby restrict axial and radial movement of the outer spring. The second pilot portion is attached to the inner spring thereby restricting relative movement therebetween.
US07862436B2	Custom configurable gaming machine and gaming machine components A configurable gaming machine includes a door defining a component area. The component area is configured to accept multiple components, such as displays and player tracking elements, in multiple arrangements, permitting the gaming machine to be constructed in multiple configurations. Other aspects of the invention include an internal component mounting configuration, a door biasing mechanism, a venting configuration, a backlight enclosure, a speaker mount, and a gaming machine stand with integrated footrest.
US07862434B2	Multi-sensor system for counting and identifying objects in close proximity A system for counting and identifying a plurality of gaming chips having a programmable RFID device embedded therein. The programmable RFID device having unique authentication data disposed therein. The system includes a tray structure defining a plurality of predetermined chip positions within a multi-dimensional grid. The tray structure is configured to carry the plurality of gaming chips such that each of the plurality of gaming chips are substantially disposed in a corresponding one of the plurality of predetermined chip positions within the multi-dimensional grid. An optical sensing assembly is configured to optically scan each of the plurality of predetermined chip positions to detect the presence of a gaming chip in each of the plurality of predetermined chip positions if present therein and generate a count corresponding to a number of detected gaming chips. An RFID reader assembly is configured to interrogate the plurality of gaming chips disposed in the tray structure and generate a list of authenticated gaming chips, the RFID reader assembly further generating a system status based on a comparison of the list of authenticated gaming chips relative to the number of detected gaming chips counted by the optical sensing assembly.
US07862433B2	Communication game program and communication game system A game device receives from another game device through a network calculation data. The calculation data includes, at least, position data which represents a position of an object operated by using the other game device, and time data which represents time in which the object is at the position. The game device calculates, based on the position data and the time data included in the received calculation data, a calculated position of the object as of when the calculation data is received. Further, the game device determines, based on the calculated position, a position of the object in a game space as of when the calculation data is received.
US07862431B2	Storage medium storing a game program, game apparatus, and game control method A video game apparatus includes a CPU, and the CPU allows a game to proceed according to input data transmitted from a controller performed a swing operation by a player. When a ball hit by a player character according to a swing operation performed by the player collides with a target object, a collision location thereof is detected. For example, a normal target image and several different types of broken target images are prepared and one of the broken target images is selected according to the collision location. In addition, a determinant is calculated for placing the broken target image in a virtual three-dimensional space such that a direction oriented toward the collision location from a center of a target object matches a reference direction of the broken target image. Then, the broken target image is placed and thereafter display is provided in such a manner that the target object is breaking.
US07862430B2	Server based gaming system having system triggered loyalty award sequences A gaming system including a central server linked to a plurality of gaming machines. In one embodiment, the gaming system provides players with one or more loyalty incentives, such as one or more loyalty awards, utilizing one or more loyalty incentive award sequences. In one embodiment, the gaming system determines a loyalty award to provide to a player and then determines an appropriate loyalty award sequence to utilize to provide the player the determined loyalty award, wherein the loyalty award sequence is determined based on the individual gaming device that the player is currently playing.
US07862424B2	Methods and apparatus for facilitating a flat rate play session and for extending same The present invention is directed generally to a method and apparatus for operating a gaming device having a flat rate play session costing a flat rate price. The flat rate play session spans multiple plays on the gaming device over a pre-established duration. The gaming device identifies price parameters and determines the flat rate price of playing the gaming device based on those price parameters. In one embodiment, identifying price parameters includes receiving player selected price parameters. In another embodiment, price parameters further incorporate operator selected price parameters. Should the player decide to pay the flat rate price, the player simply deposits the necessary funds into the gaming device or makes a credit account available for the gaming device to debit. Once the player initiates play, the gaming device tracks the duration remaining in the flat rate play session and stops the play when the given period has elapsed. During the play, payouts are made either directly to the player in the form of coins or indirectly in the form of credits to the player's credit account.
US07862421B2	Gaming device and method having increasing payline wager amounts A gaming device which includes a variety of methods to enhance payline awards by increasing one or more payline wager amounts. In one embodiment, a predetermined symbol appearing on a payline increases the wager amount of that payline by a random amount.
US07862420B2	Gaming device having a symbol accumulation game with a physical prize A gaming device including a free spins game having a plurality of reels with a plurality of symbols. The symbols include at least one prize symbol, where a physical prize is associated with the prize symbol. In one embodiment, the gaming device activates or spins the reels for a designated number of spins in a game. The gaming device spins the reels in the game and accumulates any prize symbols indicated on the reels. If the accumulated number of prize symbols reaches a designated number of prize symbols necessary to win the physical prize, the gaming device awards the physical prize to the player.
US07862419B2	Gaming device having outcomes which replicate the laws of physics A processor controlled gaming device that randomly generates and displays a pachinko-type game and outcome on a screen connected to the processor. The gaming device initially provides a preliminary game that yields the number of attempts or objects that the player has in the pachinko-type game. Next, the game displays the pachinko-type game screen having a player selectable starting area. The starting area is large enough so that when the player picks a certain position of the area, the object falls from the selected position, hits a plurality of pegs and lands in an award position. The selected start position affects which award position that object eventually falls in accordance with the probability distribution predicted by the laws of physics. The player's award, however, is not affected by which start position the player selects.
US07862417B2	Card game enabling separate evaluations for multiple game outcome combinations A card game and method of playing the card game is disclosed. The card game involves placing cards into pre-defined card positions in the form of grids or matrices. For example, a 3×3 grid is filled with nine cards. Game outcome combinations are defined by three horizontal, three vertical and two diagonal pay lines. Another grid arrangement includes a 3×3 grid with each row and column having an extra card position at each end thereof. Accordingly, after the 3×3 grid is filled with random cards, a player may select one or more pay lines after which the two extra card positions are filled. The player is paid for any winning hands formed of the five card defined by the selected pay lines. Countless grid arrangements and pay lines are conceivable. In other versions, the player may replace one or more initially dealt, displayed or otherwise provided cards. The card game and method disclosed herein may be played through an electronic gaming device, over the Internet or at a live gaming table with a dealer.
US07862415B1	Method and apparatus for electronic puzzle device An electronic game, method and apparatus, is disclosed which includes a playfield that is subdivided into a plurality of sectors. Each sector includes one or a plurality of playing positions, and each playing position has an indicator. The device incorporates a plurality of rotation patterns, each of which maps a plurality of indicators on the playfield. The device further incorporates a plurality of indicating states that correspond to a plurality of visual indications. In addition, the device includes a plurality of input control mechanisms to enable a player to activate the rotation patterns. The object of the game is for the player to manipulate the switches in order to transform an initial pattern of visual indications to a desired pattern of visual indications. The device functions by rotating the indicating states between the various sectors on the playfield using predefined rotation patterns. As an indicating state is shifted, or rotated, from one sector to another, it provides a different visual indication. The device employs a microprocessor to control the progress of the game, monitor the activation of the input switches, rotate the indicating states between indicators defined by a rotation pattern, and generate visual indications based on the configuration of indicating states and sectors. The microprocessor also controls the generation of audio/visual effects to enhance the enjoyment of play. Further, the device employs means to generate a plurality of puzzles, and games, and provisions to vary the level of difficulty of play.
US07862414B2	Golf course communication system and method A golf course (10) having a plurality of wireless access points (18) disposed within or near the outer periphery (11) of that golf course can offer communications regarding golf course infrastructure information as well as supporting subscriber communications of various kinds. Such communications can comprise, for example, data packet communications. Pursuant to one embodiment the subscriber communications can include Internet access.
US07862411B1	Raised or lowered corn cob collection device with stowable conveyor system having positive de-husking capability A cob collection device for use with a corn harvester, includes a conveyor system including a portion for positively removing or cleaning attached husks from the cobs after removal of corn therefrom by the harvester, the conveyor system including an upwardly inclined conveyor portion operably movable in cooperation with the collection device for distributing delivery of cobs thereto, the cob collection device having a wall portion including an aperture for receiving the inclined conveyor portion, and a door for closing the aperture when the conveyor is removed, allowing unloading of the collection device, and stowage of the conveyor in a compacted manner to facilitate travel under bridges, utility wires, doorways and the like.
US07862409B1	Motorized height-adjustable table apparatus A motorized height-adjustable table apparatus including a table having a meat-cheese slicer mounted on a work surface thereof and having telescopic legs connected by a pair of perpendicular crossbars which are raised and lowered by a motor having a threaded shaft extending downwardly from a motor center axis, the shaft rotationally engaging an aperture in the center of the crossbars. The motor may be controlled by a hand-operated or a foot-operated control device.
US07862403B2	Surface grinder for ball of ball valve A surface grinder for a ball of a ball valve comprises a ball positioning device at an X axis for driving the ball to rotate about the X axis and a grinding device at a Z axis for driving a grindstone set to rotate about the Z axis, wherein the grindstone set grinds a spherical surface of the ball.
US07862401B2	Moulded textile lingerie item, particularly a bra with support region made from silicone An article made of elastic textile material comprising at least one zone intended to be shaped by thermal molding is provided. The at least one zone has at least over one part a support region in which the textile material is coated, prior to thermal molding, with a non-moldable material with shape-memory. The article is, in particular, a brassiere coated with silicone in the zone of the cups of the brassiere.
US07862400B2	Toy vehicle A toy vehicle includes a plurality of wheels and an electric motor operably coupled to rotate at least one of the wheels. At least the one wheel and preferably each rotated wheel includes a hub and a tire mounted on the hub. The tire has an interior sufficiently hollow to make the wheel buoyant in water and the wheel is sufficiently sealed to prevent water penetration of the interior of the tire with the wheel immersed in water. The tire has a central portion surrounding the hub and a plurality of hollow lobes spaced from one another about the central portion. Each lobe has a pair of opposing outer sides at least one outer side being at least partially inwardly cupped to improve thrust caused by rotation of the wheel in water.
US07862398B2	Robot toy A robot toy including one block to which a servo is installed, another block joined to the one block by fitting an output shaft of the servo to a shaft hole, and a shaft hole diameter adjustment member to change a diameter of the shaft hole so as to be in a condition where the shaft hole is loosely fitted to the output shaft or a condition where the shaft hole is tightly fitted to the output shaft.
US07862397B1	Mechanical apparatus operated by a slight lateral force A toy or game apparatus that includes a base in the shape of a cupcake, a simulated flame structure movable between an exposed-to-view position and a hidden-to-view position within a simulated candle structure, a support structure mounted to the base with a top edge in contact with a bottom edge of the flame structure to support the flame structure in the exposed position, a reset structure having a slanted top surface to enable the flame structure to move to the support structure and have the top edge of the support structure engage the bottom edge of the flame structure, the candle structure being depressible for moving the support structure relative to the reset structure, and a spring for raising the flame structure and the support structure so that the flame structure is again exposed, is disclosed and described.
US07862390B2	Power utility connector with a plurality of conductor receiving channels An electrical connector assembly includes a main conductive member and a tap conductive member separately fabricated from one another. Each of the main and tap conductive members including at least one conductor receiving channel, wherein the main and tap conductive members together include at least three channels configured to receive conductors therein and extending along three different channel axes. The channel(s) of the main conductive member is configured to receive a main power line conductor, and the channel(s) of the tap conductive member is configured to receive a tap power line conductor. The main and tap conductive members are joined to one another such that the main conductive member and the tap conductive member cooperate to capture the main power line conductor therebetween when the main and tap conductive members are joined, and the tap conductive member and the main conductive member cooperate to capture the tap power line conductor therebetween when the main and tap conductive members are joined.
US07862388B2	Connector block with cable manager The invention relates to a connector block for separating a plurality of insulated conductors of an electronic data cable, said connector block containing: a plurality of slits arranged in a row along a common side of the connector block; a plurality of insulation displacement contacts comprising forked contact sections which at least partially extend into respective individual slits in order to electrically separate the insulated conductors; and a cable manager which is coupled to another side of the connector block and extends outwardly therefrom. The cable manager is embodied in such a way as to secure the conductors in substantially fixed positions between one end of the sheath of the data cable and the insulation displacement contacts.
US07862376B2	Compliant pin for retaining and electrically connecting a shield with a connector assembly A compliant pin is configured to be press-fit into a cavity of at least one of a connector assembly and a substrate to retain the pin in the cavity. The pin includes a neck, a plurality of compliant beams, and an insertion tip. The neck interconnects the pin with the connector assembly. The beams are configured to engage an inner surface of the cavity to retain the pin in the cavity. The beams are arranged side-to-side and project along a longitudinal plane in a loading direction. The beams have arcuate portions that are arched in different directions transverse to the longitudinal plane. The arcuate portions are shaped to deflect toward the longitudinal plane without substantially engaging one another. The insertion tip interconnects the ends of the beams.
US07862373B2	Low profile seal for floating connector interface An electrical connector has a flexible boot to create a flexible, sealed interface. A connector body has a plurality of pin receivers positioned within a tubular sleeve. The flexible boot is received in the connector body and includes a tubular body of elastically flexible material. The tubular body has a body diameter dimensionally controlled to provide an interference fit when received in the tubular sleeve. A boot flexible sleeve is positioned outward of the tubular body. A boot joining wall homogenously joins the tubular body to the flexible sleeve. A flange extends from a free end of the flexible sleeve defining a circular ring oriented transverse to and encircling the flexible sleeve. A boot ring fixes the flange to a panel. The connector body is thereafter elastically displaceable with respect to the panel when the tubular body deflects with respect to the flexible sleeve and the flange.
US07862369B2	Backshell coupling for an electrical component The invention relates to a backshell coupling for connecting an electrical cable to an electrical component, the coupling comprising a first part having a cylindrical sleeve suitable for passing the cable, the sleeve having an end provided with a first pair of arms; and a second part having guide means for said cable and a second pair of arms, the free ends of the first arms facing the ends of the second arms, with one of the pairs of ends being disposed between the other pair of ends; means defining a pivot axis between the pairs of arms, the facing faces of said ends being provided with portions in relief for defining a plurality of relative angular positions between the two parts, the arms having their ends disposed between the ends of the other arms being elastically deformable; and means for temporarily deforming the arms.
US07862368B1	Socket assembly A socket assembly includes a socket, a connection terminal, and a snap-fit member. The connection terminal is plugged into the socket. The snap-fit member includes a main body, a positioning portion, and a snap-fit portion. The positioning portion and the snap-fit portion are connected to the main body. The positioning portion is locked with the socket. The main body is pivotable between a first position and a second position about the portioning portion. The snap-fit portion is snappingly engaged with the connection terminal when the snap-fit portion is in the first position. The snap-fit portion is disengaged from the connection terminal when the snap-fit portion is in the second position.
US07862366B2	Electrical connector with locking clip An electrical connector assembly includes first male and second female connectors having respectively a generally annular locking spring with inwardly directed flexible tines and an outer cylindrical coupling member. The tines are deflected outwardly by the outer coupling member when the second connector is inserted into the first connector for coupling the connectors. A locking clip having a pair of identical, semi-cylindrical mating sections adapted for mutual engagement and manual assembly about the coupled first and second connectors locks the two connectors together to prevent inadvertent disconnection. An uncoupling tool adapted for insertion in respective opposed slots in the two connected mating sections of the lock clip engages and axially displaces a release sleeve in one of the connectors, which, in turn, engages and outwardly deflects the locking clip's tines permitting the non-destructive separation of the two connectors.
US07862362B2	Test holder for microchip The invention relates to a test holder for fixing the position of a microchip in a microchip contactor, having a base frame and a pressing unit, which is connected to the base frame such that it can be pivoted open or shut and which comprises a pressure body designed to interact with the microchip. In order to press the microchip all over with a uniform pressure onto the contactor, even if the microchip is inclined with respect to the pressing means when it is contacted with the contactor, the invention provides that the pressure body may be tilted about a first and a second tilting axis.
US07862361B2	Electrical flex connector for mounting on a printed circuit board An electrical flex connector device for a printed circuit board, comprising a female member having a fixation portion for affixing the female member to an associated printed circuit board, a tab member extending from the fixation portion and configured to guide a male member of the flex connector device and to hold the male member between the tab member and the printed circuit board and a least one fastening member arranged on the female member for securely holding the male member in a predetermined position.
US07862360B2	Antenna connector assembly Provided is an antenna connector assembly which eliminates adverse effects to a window glass when being fitted on a manufacture line, and is easily and surely attached and removed even in a small space. The antenna connector assembly for connecting an antenna element and a cable is composed of a plug section (10) and a socket section (20). A cable (11) is connected to the plug section (10). The antenna element is connected to the socket section (20), and the plug section (10) fits in the socket section. The socket section (20) has an inserting port (201) from which the plug section (10) can be inserted by being slid in the longitudinal direction of the socket section (20). The plug section (10) has an inclined surface (101) on a portion which abuts to the socket section (20) when the plug section is started to be inserted into the inserting port (201) in a diagonal direction.
US07862354B2	Separable loadbreak connector and system for reducing damage due to fault closure Separable loadbreak connectors include an interference element spaced about the contact tube that is configured to engage a portion of a connector piston.
US07862352B2	Stackable electrical panel modules An electrical panel assembly comprised of individual electrical panel modules. The electrical panel modules comprise a first receptacle comprising transmitting electrical contacts to interface with a first connector comprising receiving electrical contacts and a first rotation ring for facilitating contact between the transmitting electrical contacts and the receiving electrical contacts, where the first rotation ring rotates between an open position permitting connection or disconnection of the first connector from the receptacle and a closed position preventing connection or disconnection of the first connector from the first receptacle. The first electrical panel module interacts with a second electrical panel module in a manner that the absence of the first connector in the first receptacle prevents the second electrical panel module from accepting a second connector.
US07862349B1	Connector A connector has a conductive elastic member, an inner frame configured to hold the conductive elastic member so that the conductive elastic member is connectable with connection targets in a vertical direction, and an outer frame configured to hold the inner frame so that the inner frame is movable along a movable direction perpendicular to the vertical direction. An inner frame engagement portion is provided on an outside surface of the inner frame. An outer frame engagement portion is provided on an inside surface of the outer frame. The inner frame engagement portion and the outer frame engagement portion are engaged with each other so as to regulate a relative movement of the inner frame in the vertical direction and to permit a relative movement of the inner frame in the movable direction.
US07862348B2	Connector for an electrical circuit embedded in a composite structure According to one embodiment, a connector for a composite structure includes at least one conducting element that is coupled to a node of an electrical circuit embedded in a composite structure. The composite structure has two opposing surfaces in which the conducting element is disposed essentially between the surfaces of the composite structure.
US07862346B1	Socket connector A socket connector has an insulative housing, multiple first terminals, multiple second terminals, a positioning bracket and a shell. The first and second terminals are mounted through the insulative housing, and each of the first and second terminals has a mounting section, a soldering section and a contacting section. The soldering sections of all terminals are arranged in a transverse row relative to the insulative housing. The positioning bracket is mounted under the insulative housing and holds the soldering sections. The shell covers the insulative housing, first and second terminals and positioning bracket. The soldering sections arranged in one row makes the socket connector compact.
US07862345B2	Electrical connector An electrical connector consists of a plug connector and a receptacle connector to be fitted. An insulator is supported only by plug contacts each provided between second and third fixed portions with an elastic portion having at least one snaked portion so as to be floating in a housing. The shape of the second contact portion of each of the plug contacts is substantially in the form of a plate-shaped piece so that the second contact portion of the plug contact and the first contact portion of a receptacle contact are caused to contact each other in line contact at one location, and the elastic portion is arranged within a range from a position below the second contact portion to a position below the insulator. The electrical connector thus constructed is superior in resistance to vibration, and achieves space-saving and floating of the insulator.
US07862344B2	Electrical connector having reversed differential pairs A contact module is provided for an electrical connector. The contact module includes a body having a mating edge portion and a mounting edge portion. A lead frame is held by the body. The lead frame includes a differential pair of terminals extending between the mating edge portion and the mounting edge portion. The differential pair includes a positive terminal and a negative terminal having positive and negative mating contacts, respectively, and positive and negative mounting contacts, respectively. The positive and negative mating contacts extend from the mating edge portion in a first orientation. The positive and negative mounting contacts extend from the mounting edge portion in a second orientation. The first orientation at the mating edge portion is inverted relative to the second orientation at the mounting edge portion.
US07862342B2	Electrical interfaces including a nano-particle layer An electrical interface includes a nano-particle layer. The electrical interface also includes a first conductor and a second conductor. The nano-particle layer and the first and second conductors are electrically coupled together.
US07862339B2	Negative wound pressure therapy test system A system for testing a negative pressure wound dressing, includes a simulated wound having a housing and a wound cavity within the housing, and having a shape and dimension representative of an actual wound type, a wound dressing positionable at least over the simulated wound, a negative pressure source in fluid communication with the wound cavity, at least one sensor adapted to record at least one parameter within the simulated wound, an air leak model including a valve in fluid communication with the wound cavity whereby opening of the valve simulates an air leak within the wound cavity, a fluid source in fluid communication with the wound cavity for delivering fluid to the wound cavity to simulate presence of exudates and a computer coupled to the at least one sensor for recording and analyzing data recorded by the at least one sensor to thereby providing an indication of functioning of the system.
US07862334B2	Heat treatment apparatus and heat treatment method using the same A heat treatment apparatus and a heat treatment method using the same are disclosed. In the method, a support plate on which a device substrate is mounted is loaded into the heat treatment apparatus using a transfer unit in an in-line manner, and the device substrate mounted on the support plate is heat-treated using the heat treatment apparatus.
US07862331B2	Catalytic microcombustors for compact power or heat generation The present invention comprises a device which utilizes catalytic microcombustion for the production of heat or power and which exhibits a low pressure drop and has a high catalytic surface area. The catalytic microcombustor includes catalyst inserts in the reaction chamber separated by a sub millimeter distance. Thermal spreaders ensure temperature uniformity and maximum thermal efficiency. A mixing zone is prior to the combustion zone. Thermally conductive and/or insulating inserts are in the vicinity of the reaction zone.
US07862330B2	Angled fill ports and seal-off arrangement for patty-forming apparatus A food patty molding machine has a reciprocating mold plate. A moldable food product is pumped through a fill passage into cavities of the mold plate when the mold plate is in its fill position. A fill plate, interposed in the fill passage immediately adjacent the mold plate, has a multiplicity of fill orifices distributed in a predetermined pattern throughout an area aligned with the mold cavity when the mold plate is in its fill position. The fill orifices define paths through the fill plate, wherein the paths each have an inlet portion that is perpendicular to a fill side face of the mold plate that is connected to an outlet portion that is obliquely angled to a fill side face of the mold plate. A seal-off stripper plate is interposed in the fill passage immediately adjacent the face of the fill plate opposite the mold plate. The stripper plate is movable along a path transverse to the mold plate path between a fill location and a discharge location. The stripper plate has a multiplicity of fill openings aligned one-for-one with the fill orifices as extensions thereof when the stripper plate is in its fill location.
US07862329B2	Easily removable valve pin bushing The invention provides a replaceable bushing in the base of a nozzle of a hot runner assembly and provides access through a manifold and a rear plate for removal and replacement of the bushing without having to disassemble the hot runner assembly. According to one embodiment of the invention, an actuator access port is provided for removing the valve pin actuator and a bushing access port is provided for accessing the bushing upon removal of the valve pin actuator, both of which may be removed from a second or rear plate of the injection molding assembly.
US07862323B2	Press and method for forming a composite article A press includes a pressure chamber filled with a substantially incompressible medium that at least partially encloses an elastomeric vessel filled with a substantially incompressible fluid that is in fluid communication with a pressurized source of the same fluid. Method and systems employing the press are also disclosed.
US07862321B2	Modular injection mold and manifold arrangement A molding arrangement is provided for multi-level stack molds wherein mold sets and runners are made up of modular sections interchangeable individually or as larger assemblies for exchanging molds for one part for those for different parts or exchanging runners between hot tip and valve gate designs to accommodate different molding arrangements. The arrangement has discrete melt paths for each mold level, at least some of which extend around rather than through the mold levels and which incorporate readily separable connectors. This enables one set of molds and possibly as well the runners for one mold level to be interchanged without interfering with the mold and runner arrangement for an adjacent level.
US07862319B2	Adjustment method, particularly a laser adjustment method, and an actuator suitable for the same The invention relates to an adjustment method, especially for the adjustment of optical or fiber optical components, whereby a partial region of an actuator is locally heated in such a defined manner that compressive stresses are created therein as a result of the restricted thermal expansion of said heated partial region, caused by at least one other partial region of the actuator. If the yielding point σ of the material of the partial region is exceeded, said compressive stresses lead to the plastic compression of the heated partial region. Furthermore, said heated partial region is contracted during cooling and leads to a defined modification of the geometry of the actuator following the cooling process. Tensile stresses are created as a result of a restriction of said contraction by means of at least one other partial region in the previously heated partial region, and compressive stresses are frozen in the at least one other region. During the adjustment process, essential regions of the actuator, in which the tensile stresses or compressive stresses are frozen after cooling, are brought to a critical temperature in relation to the operating temperature of the actuator, at least until flow processes of the material are ended at the critical temperature.
US07862313B2	Compressor and oil separating device therefor A compressor and an oil separating device therefor are provided which are capable of always maintaining a predetermined amount of oil in the compressor without additionally providing an oil separating device along a refrigerating cycle system. This results in the refrigerating cycle system having simplified piping and the refrigerant discharged from the compressor having a constant pressure, thereby preventing a function of the refrigerating cycle system from being reduced. The compressor includes a casing, a compression device having a compression chamber disposed within the casing and configured to receive, compress, and output a refrigerant, and an oil separating device disposed within the casing. The oil separating device includes a separation chamber configured to circulate the refrigerant to separate oil therefrom, a guide member configured to direct the refrigerant discharged from the compression device, and a circulation member configured to receive the refrigerant from the guide member and direct the refrigerant into the separation chamber in a direction of circulation.
US07862310B2	Fuel pump The invention relates to a pump module (2) comprising a housing part (4) with precisely determined force introduction points (25) in relation to adjacent components. Supporting elements (24, 27) and a groove (26) are located between the force introduction points (25) and a disc element (20) that comprises a partially annular channel (10). Forces that are introduced into the housing parts (4) thus lead to negligible deformations in the areas of said housing parts (4) that are adjacent to the impeller.
US07862309B2	Thin fan structure A thin fan structure is composed of a driving unit and a rotating unit. The driving unit has a base, a coil circuit board and a shaft, in which the coil circuit board is disposed at the base. The rotating unit has a bearing, a fan blade, an iron-containing metal sheet and a magnet, in which the bearing has an outer ring and an inner ring. The fan blade, the iron-containing metal sheet and the magnet are fixed at the outer ring of the bearing, the inner ring of the bearing is fixed at the shaft of the driving unit and the coil circuit board of the driving unit is able to drive the rotating unit turning around.
US07862306B2	Pressure regulating variable displacement vane pump A variable displacement engine oil vane pump includes a displacement control for controlling displacement of the pump. The control includes a cam ring in a housing pivotally connected to a wall of the housing by a pivot. The cam ring is internally engaged by slide vanes. A control chamber is defined by the cam ring and the housing wall. A control orifice provides for communication of control oil from a pressurized source to the control chamber. A vent chamber is generally opposite the control chamber and is defined by the cam ring and the housing wall. A dump chamber is defined by the cam ring and the housing wall and is generally disposed between the control chamber and the vent chamber. A dump orifice provides for communication between the control chamber and the dump chamber. A vent orifice provides for communication between the vent chamber and the dump chamber.
US07862305B2	Variable displacement vane pump A variable displacement vane pump, including a pump body, a driving shaft, a rotor, a cam ring swingable around a swing fulcrum, first and second support members on opposite axial sides of the cam ring, a suction port and a discharge port disposed on at least one of the support members, a seal dividing a space on an outer circumferential side of the cam ring into a first fluid pressure chamber defined in a direction in which the cam ring is swung to cause increase in a flow rate of a working fluid discharged, and a second fluid pressure chamber defined in a direction in which the cam ring is swung to cause decrease in the flow rate of the working fluid discharged, and a plunger biasing the cam ring from a side of the second fluid pressure chamber toward a side of the first fluid pressure chamber.
US07862304B2	Compressor turbine blade airfoil profile A single stage high pressure turbine blade includes an airfoil having a profile substantially in accordance with at least an intermediate portion of the Cartesian coordinate values of X, Y and Z set forth in Table 2. The X and Y values are distances, which when smoothly connected by an appropriate continuing curve, define airfoil profile sections at each distance Z. The profile sections at each distance Z are joined smoothly to one another to form a complete airfoil shape.
US07862301B2	Laminated impeller The present invention relates generally to impeller of aerators, and more particularly to a laminated impeller of paddlewheel aerator. To solve the shortcoming of existing impeller of aerator: single-body structure, large volume, complicated manufacturing technique and high production cost, fixed blade quantity and axial length, narrow application range and inferior universal use, the present invention provides a laminated impeller that is characterized by simple structure, easy installation and better universal use. The technical scheme of the present invention comprises single impeller body consisting of impeller seat and blade connecting on the seat, a plurality of single impeller body connected in succession to form a laminated impeller, connecting mechanism provided on impeller seat to connect neighboring single impeller, axial impeller length adjusted according to the power needed actually and blade quantity changed to meet wider application.
US07862298B2	Centrifugal compressor housing A housing for a radial flow compressor, particularly for a turbocharger, comprises a first housing part and a second housing part joined together to form at least part of the housing, each of the housing parts comprising at least one cavity, said cavities in fluid communication, when the housing parts are juxtaposed, forming a cavity system into which a fluid joining compound, such as an adhesive, thermoplastic material, etc., is introduced to form a solid joint of said both housing parts, wherein the housing parts are dimensioned such that a gap for introducing the fluid joining compound extends from a free housing surface of the housing parts when juxtaposed, along facing joining surface sections of the housing parts, and ports into the cavity system.
US07862297B2	Holding device for holding cooling fan A holding device for holding a cooling fan comprising: a duct having a hollow in which a cooling fan is to be fitted; a stopper portion which keeps one operative end of the cooling fan from further moving to hold the cooling fan at a fitting position; and a plurality of elastic wall segments formed in a cooling fan insertion end of a wall of the duct; wherein each of some of the plurality of elastic wall segments is formed with a locking claw for keeping the other operative end of the cooling fan from moving. With this construction, the cooling fan 31 can be more surely mounted in a duct. Consequently, vibration reduction effect and sound reduction effect with respect to the cooling fan is improved.
US07862296B2	Turbine vane securing mechanism A turbine vane attachment system configured to eliminate movement of a turbine vane relative to a turbine vane carrier. The turbine vane attachment system may include a base attached to a turbine airfoil. The base may be configured to contact a wedge support along a plane that is generally nonparallel and nonorthogonal with a longitudinal axis of the airfoil. A bolt may connect the base with the wedge support. The bolt may change a distance between a channel in the base and an outer bearing surface. The turbine vane may be positioned in a vane carrier such that tongues extending from the vane carrier are positioned in the channels. As the bolt is advanced, the wedge support is moved laterally along the support surface of the base and the channels engage the tongues, thereby preventing movement of the turbine vane.
US07862294B2	Labyrinth seal in a stationary gas turbine The invention relates to a segmented inner ring for holding guide blades. According to the invention, a lateral wall opposing the front side of the inner ring and pertaining to a shaft shoulder formed on the rotor shaft extends radially, and respectively one half of a labyrinth seal is formed on the front side of the inner ring and on the shaft shoulder. The aim of the invention is to apply an arrangement of stacked labyrinth seals, known from aeroplane turbines, to a stationary gas turbine having a separation plane. To this end, a method is used to mount an inner ring of a gas turbine. The invention also relates to a stationary gas turbine comprising a segmented inner ring.
US07862292B2	Horizontal motion wave power generator A paddle wheel-driven horizontal wave generator system which is situated on the ocean shore for converting shore waves to unidirectional rotational force for generating power. By the use of a pair of one-way clutches on a single power shaft the incoming and outgoing motion of ocean waves is converted into continuous unidirectional rotational force to drive an electric generator. The generator system is attached to a base having troughs. The lower portions of the paddle wheels are positioned in the troughs, and engage incoming and outgoing shore waves which rotate the axle of the paddle wheels in a clockwise and counterclockwise direction. The one-way clutches convert the bi-directional rotation of the paddle wheel axle to unidirectional rotation of the power shaft.
US07862285B1	Compressor trolley Disclosed is a hoist trolley having a pair of jacking plates with apertures for attaching the plates to a compressor. Fixed to the opposing ends of the jack-plates are telescopic legs with extendable retractable wheels and a screw jack that is used to elevate the load, once the plates are attached, enabling the wheels to be extended. Once extended, the jack base plate is raised with the wheels supporting the load. Transporting the load is accomplished by providing a pair of rails cantilevered from a stand. Also provides are additional elements to enhance the range of applications for the compressor trolley including a pry bar incorporating a motive member whereby the bar can be used in the similar function of supporting some part of the load while moving to a workspace and a depending pivot arm having one element of a fastener, with the other incorporated into an opposing jacking plate. Furthermore, the spaced apart trolley rails can include integral rollers.
US07862284B2	Pallet transfer system A pallet transfer system capable of smoothly transferring a pallet between a machine tool and a pallet conveying device is provided. The pallet transfer system includes an intermediated station to temporally place a pallet between a front ward position of a pallet stand-by position and the pallet stand by position. The pallet on a conveying plate at a stand-by position is carried to a temporary placing position by horizontally moving the conveying plate. Then the pallet is transferred to the intermediate position by being supported by lift arms which are raised from the conveying plate. Further, the pallet, supported by the lift arms, is transferred from the intermediate station to a stacker crane by advancing the stacker crane toward the intermediate station side and entered into an entering space below the pallet.
US07862280B2	Saw tooth screw A saw tooth screw provides a screw thread divided into a first and a second thread sections. A plurality of slots, inclined with respect to a shank axial line, are disposed on each thread of the first thread section for dividing the thread into a plurality of thread segments, wherein each of the thread segment has a first inclined surface and a second inclined surface on two ends thereof; the first inclined surface is parallel to the second inclined surface. The thread of the second thread section is formed of a saw-tooth-shape by having recesses extending from a shank to an outer edge of the thread for debris of object to exit through the slots, thereby reducing the screwing torsion and increasing the screwing rotation speed.
US07862278B2	Anti-tamper device An apparatus for preventing removal of, or tampering with, a construction fitting includes two construction element engaging components and a fastener for connecting the two construction element engaging components to one another. The fastener includes a bolt extending between the two construction element engaging components and a nut for tightening on the bolt rigidly connecting the two engaging components with a gap therebetween. A body portion, for at least partially covering a nut, prevents access thereto by an unfastening tool with the body portion extending from the nut to a position alongside the bolt within the gap. A locking device is able to be moved relative to the body portion between a first position, in which the apparatus is removable from the construction fitting, and a second position in which the apparatus is prevented from being removed from the construction fitting with the locking device extending, in the second position, from the body portion in a direction toward the bolt with the gap.
US07862277B2	Component interlocking There is disclosed a pair of components which, in the embodiment described, are a tooth (2) and adaptor (3) for earth-moving apparatus (1). The adaptor is for mounting the tooth on an earth-moving bucket, this mounting being releasable to allow replacement of the tooth when worn. The components define aligned passages (11) through which a locking pin (12) extends to retain the components together. The locking pin has formations (22) for engaging formations (20) on the first component when the pin is rotated from a free position into a locked position. The pin has an insertion recess (27) which is aligned with the formations (20) allowing the pin, in the free position, to be inserted into, or removed from, the aligned passages. The formations (20) are resiliently movable to stably engage the pin when in the locked position.
US07862271B2	Friction stir rivet method of joining A method of joining workpieces includes rotating a friction stir rivet via a mandrel and driving the rivet into the workpieces causing frictional heating between the rivet and the workpieces and causing the materials of the workpieces to soften, thereby providing a fiction stirred displaceable path for the rivet to traverse, and driving the rivet along the displaceable path until the rivet mandrel pierces through the workpieces and a cap of the rivet is seated against the workpieces. Subsequent to seating the cap, further rotation of the mandrel is stopped and the workpieces are allowed to cool and harden. An axial load is then applied to the mandrel sufficient to provide mechanical loading between the rivet body and the workpieces. A resultant volume of displaced material from the workpieces is fixedly attached to the workpieces, thereby avoiding the creation of a potentially detachable slug of the displaced material.
US07862266B2	Cutting tool for machining a hole A recess and an attachment seat are formed in a front end of a tool body. A panel-shaped insert attached to the attachment seat where the thickness direction is matched with the diameter direction of the tool body and a surface of the insert facing the rear in a tool rotation direction becomes a pressed surface. A peripheral cutting edge is formed at a ridge of an inclined surface on the outside in the diameter direction of the tool body, a bevel edge is formed at a ridge on the front side of the tool body, and a back taper is attached to the peripheral cutting edge. A pressing member for pressing the pressed surface of the insert to adjust a position of the peripheral cutting edge in the diameter direction of the tool body is disposed on the rear side of the attachment seat in the tool rotation direction.
US07862265B1	Off-set drill guide assembly and method of drilling holes in a workpiece An off-set drill guide assembly useable with a conventional drill press or bench vice and portable power tool to drill holes in a workpiece has a body chucked to the drill press supporting a horizontal slide connected to the power tool with an adapter to locate the power tool off-set from the drill press beyond the normal range of the drill press. The body and power tool are moved downward to drill holes in a workpiece.
US07862263B2	Cutting tool with multiple flutes defining different profiles, and method A cutting tool having multiple cutting edges includes a tool body having a longitudinal axis, a first cutting edge including a first leading edge that defines a first profile when rotated about the longitudinal axis, and a second cutting edge including a second leading edge that defines a second profile when rotated about the longitudinal axis, the first and second profiles being different from each other and being adapted to cut a workpiece in succession. A method is also disclosed.
US07862261B2	Tool holder with resharpenable cutting tool inserts A tool holder for a resharpenable cutting tool insert has a body portion which includes a recess. A wedge member is positioned in the recess. A locking screw locks the wedge member such that the top surface of the wedge member is in engagement with the bottom surface of the insert and the locking screw is threadably connected to the body portion and to the wedge member so that the cutting tool insert may be removed for sharpening and re-inserted at the same location relative to the tool holder.
US07862260B2	High capacity particulate loader and transfer apparatus A high capacity particulate loader having an intake hose on one sidewall thereof which communicates with a source of negative pressure formed by a multi-stage suction mechanism, to create a high suction, high volume and high speed air stream that draws particulate materials through the hose and propels them into a separation chamber where they separate from the air stream and are directed into a discharge auger assembly on the opposite sidewall of the loader. The multi-stage suction mechanism communicates with a separation chamber and/or a settling chamber, the settling chamber providing an area where dust or fine chaff from the suctioned particulate materials, which may be present in the air stream, can settle, through gravity, on a bottom surface of the settling chamber, thus avoiding contact with the blowers so as to prevent clogging of the blowers and rotor wear thereof.
US07862258B2	Floating standoff assembly A standoff system for keeping a containment boom or other floating barrier device spaced at a desired standoff distance away from a structure. The system includes an inner side member, an outer side member, and a plurality of compression members disposed between the side members. The system has a collapsed configuration in which the distance between the inner and outer side members is less than the desired standoff distance, and a deployed configuration in which the distance between the side members is greater than or substantially equal to the desired standoff distance. Alternatively, the system can be collapsed longitudinally by moving the adjacent compression members into abutting relationship with each other. The system is towed into place in the collapsed configuration, and once in place, is transformed into the deployed configuration by applying tension to the side members. The system also may include one or more tension members attached diagonally between adjacent compression members to keep the system in the deployed configuration. The standoff system can be a separate, free-standing structure placed between a ship and a boom or it can be integrated with a containment boom.
US07862254B2	Underground root margin even irrigation apparatus Disclosed are an even-irrigation apparatus for an underground root zone and an even-irrigation method using the same for evenly supplying water into the root zone of a variety of crops. The even-irrigation apparatus includes a plurality of irrigators buried in the entire underground root zone, to directly and evenly supply water into the root zone. Once water is introduced into a pressure-reduction valve after passing through a main pipe, limb pipe and capillary pipe connected in sequence, the water is supplied to the irrigators by way of a plurality of diverged-capillary pipes. With this even-irrigation of water, unnecessary consumption of water due to adsorption of the water into the surrounding soil except for the root zone is minimized, enabling effective irrigation of water and even growth of roots of crops. Further, even nutrition throughout the roots enables balanced growth of crops.
US07862249B2	Ball-point pen tip and ink refill There is provided a ballpoint pen tip in which a shoulder of a bent portion does not touch a paper surface during writing and bleeding caused by deformation of an inner periphery of the bent portion can be prevented, and an ink refill using thereof. The ballpoint pen tip 20 comprises a first tapered surface 22 formed by tapering an outer periphery at a front end of a holder 21, a connecting surface 23 that is formed at a front end side of the first tapered surface 22 and has an outside angle larger than 180° with respect to the first tapered surface 22, a second tapered surface 24 that is formed at a front end side of the connecting surface 23 and has an outside angle smaller than 180° with respect to the connecting surface 23, and a bent portion 25 in which a front end portion of the second tapered surface 24 is bent inwardly so as to hold a writing ball 35 inserted into a ball house 29. A boundary between the first tapered surface 22 and the connecting surface 23 is referred to as a first shoulder portion 26, and a boundary between the second tapered surface 24 and the bent portion 25 a second shoulder portion 27. The second shoulder portion 27 is located inside a virtual tangent line 41 between the first shoulder portion 26 and the writing ball 35.
US07862246B2	Power supply controller for motor in feeding device A feeding device including: (a) a feed mechanism including a motor driven with supply of a power thereto, and a feeder operated by the motor for feeding an object; (b) a power supply controller for supplying the power to the motor until an actual operating position of the feeder coincides with a power-supply-stop operating position located before a target operating position of the feeder, and to stop the supply of the power to the motor when the actual operating position coincides with the power-supply-stop operating position, for causing the actual operating position to eventually coincide with the target operating position owing to an inertia of the feed mechanism; and (c) a power-supply-stop operating-position determiner for determining the power-supply-stop operating position, for reducing a positioning error of the object in presence of a torque fluctuation of the feed mechanism, based on the target operating position and a cyclic variation of an operating velocity of the feeder that is caused by the torque fluctuation.
US07862240B2	Bearing device Bearing device (1) with a first bearing part (2) and a second bearing part (3) which cooperate in bearing contact, wherein the first bearing part (2) and the second bearing part (3) is each provided with a surface layer (21, 31), wherein the hardness of the surface layer (21) of the first bearing part (2) is greater than the hardness of the surface layer (31) of the second bearing part (3).
US07862236B2	Circumrotating circulating guiding assembly of linear sliding rail A circumrotating circulating guiding assembly of a linear sliding rail includes a sliding base body, a plurality of guiding assembly and a plurality of rolling elements. The sliding base body has a plurality of engaging portions and a plurality of guiding holes. The sliding base body is provided longitudinally with engaging portions. The guiding assembly comprises two circumrotating guiding portions, a plurality of fixing portions, a spacer and a plurality of guiding tubes. The fixing piece is fixed to the engaging portion. The guiding portion is combined with the circumrotating guiding portion. The rolling element is provided on the circumrotating circulating path in a rolling manner. With the fixing pieces being fixed to the engaging portion, and the spacer being engaged in the recessed portion, the insufficient strength of the guiding assembly formed of plastic materials can be compensated, thereby avoiding the vibration, noise and excessive frictional resistance efficiently.
US07862235B2	Linear guide device In a linear guide device, a rolling element cage 24 holding balls interposed between a rail side rolling element rolling groove and a slider side rolling element rolling groove is formed of a synthetic resin material, and has two plate parts 244 facing to each other with a slider body being held therebetween. The rolling element cage 24 has a positioning part that makes contact with the inside surface of the slider body and is positioned on the slider body by the positioning part with respect to the slider.
US07862233B2	Self heating monitor for SiGe and SOI CMOS devices A structure, apparatus and method for deterring the temperature of an active region in semiconductor, particularly a FET is provided. A pair FETs are arranged on a silicon island a prescribed distance from one another where the silicon island is surrounded by a thermal insulator. One FET is heated by a current driven therethrough. The other FET functions as a temperature sensor by having a change in an electrical characteristic versus temperature monitored. By arranging multiple pairs of FETs separated by different known distances, the temperature of the active region of one of the FETs may be determined during operation at various driving currents.
US07862225B2	Apparatus and method for mixing a cleaning solution for a vehicle washing system An apparatus configured for mixing and distributing a cleaning solution for use in a vehicle washing system. A container includes a cavity configured to receive the cleaning solution. A supply device for providing an aqueous solution includes a control mechanism for determining the level of aqueous solution in the container. One or more conduits in fluid communication with the supply device supply the aqueous solution to the container. A distribution device in communication with the cavity of the container is configured to remove the aqueous solution from the container for distribution to the vehicle washing system. The one or more conduits include one or more injection inlets for supplying the aqueous solution under pressure to dilute an additive placed in the container with the aqueous solution to create the cleaning solution.
US07862222B2	Backlight module and light guide plate A backlight module includes a light guide plate and two light emitting elements for emitting light beams. The light guide plate includes first and second light guide portions and a connecting portion interconnecting the first and second light guide portions. The first light guide portion has two opposite first light incident surfaces at opposite sides thereof, and a first light output surface. The second light guide portion has a second light incident surface facing first light output surface of the first light guide portion. Each of the light emitting elements faces one of the first light incident surfaces of the first guide portion. The first guide portion receives the light beams via the first light incident surfaces and output them via the first light output surface. The second light guide portion receives the light beams from the first light output surface via the second light incident surface.
US07862211B2	Configuration of multiple LED modules A configuration of multiple LED modules comprising a plurality of LED modules that each contain a carrier that has a first main area, a second main area and at least one semiconductor layer, wherein the first main area has a planar configuration. The LED modules also include a plurality of LED semiconductor bodies that applied on the first main area of the carrier. In addition, the multiple LED modules include a common heat sink, where the carrier of the LED modules in each case are connected to the common heat sink on the second main area.
US07862207B2	Optimizing use and performance of optical systems implemented with telecentric on-axis dark field illumination Systems and methods are provided for imaging a planar specular object such as a semiconductor wafer. In one embodiment, an imaging system for imaging a defect on a planar specular object includes a telecentric lens having a sufficiently aspherical surface such that the telecentric lens is substantially corrected for an optical aberration. The imaging system also includes a telecentric stop including an aperture therein to block light reflected from the planar specular object while allowing light reflected from the defect to pass through the aperture. The imaging system further includes a lens group having a system stop positioned between the telecentric stop and the lens group. The lens group is substantially corrected for the optical aberration independent of the telecentric lens.
US07862205B2	Lighting unit and lamp A lighting unit has at least two submounts, wherein each submount has multiple light sources. Furthermore, a lamp may have such a lighting unit.
US07862202B2	Method and apparatus for installing a motion sensor in a luminaire A method and apparatus for motion sensor installation includes an apparatus for installing a lighting accessory to a first luminaire having a luminaire housing. The bracket includes a coupling member operative to couple the bracket to one of the luminaire housings. A support member extends from the coupling member, and is operative to support the lighting accessory a first distance from the luminaire housing. An attachment member that is operative to attach the lighting accessory to the lighting accessory extends from the support member. The bracket couples the lighting accessory to the luminaire housing without extending the length of the luminaire or creating a substantial gap between two luminaires in a linear configuration. In one aspect, the lighting accessory can be a motion sensor that is operative to control the power to one or more of the luminaires.
US07862200B2	Lamp arrangement A lamp arrangement is disclosed, with at least one low-pressure discharge lamp, in particular, a compact fluorescent lamp to generate a main illumination with at least one discharge bulb, fitted in a socket and at least one alternative light source, in particular, a light diode arrangement with at least one light diode (LED) for generation of an alternative illumination. According to the invention, the light diode arrangement is at least partly arranged in the vicinity of cold spots on the low pressure discharge lamp.
US07862195B2	Multiple positioned light source to achieve uniform or graded illumination An integrated and modular lighting system is disclosed. The lighting system includes a plurality of modules, each module including at least two echelons of light emitting diodes and a power supply on a common substrate. The modular lighting system is used to provide uniform illumination of an enclosed display stand.
US07862192B2	Lighting device A lighting device includes a housing, a plurality of LEDs arranged on a base of the housing, and a first optical plate positioned above the LEDs. The first optical plate includes a light input surface, a light output surface opposite to the light input surface, and a plurality of V-shaped ridges aligned in at least two different directions formed on the light output surface. The V-shaped ridges aligned in different directions intersect with one another. The lighting device may be used as a backlight module.
US07862191B2	Lamp socket, backlight assembly having the same, and display device having the same A lamp socket includes a socket housing and a power supply member. The socket housing has a connecting hole. The power supply member includes a first lamp and a second lamp connecting terminal. The first lamp connecting terminal is inserted into the connecting hole, and includes a securing member for preventing a lamp from secession from the lamp socket. The second lamp connecting terminal is inserted into the connecting hole, and includes securing member opening inserted by the securing member. Therefore, the number of elements may be decreased and the stability of lamp socket may be increased.
US07862190B2	Surface light source for emitting light from two surfaces and double-sided display device using the same A surface light source device includes a light-emitting element which generates light, and a light guide plate which causes light emitted from the light-emitting element to be incident from an end face, causes the light to be reflected between opposite plate surfaces to guide the light along the plate surfaces and make the light emerge from the plate surfaces, and transmits light incident from one plate surface toward the other plate surface. A first optical element is placed on one plate surface side of the light guide plate, transmits part of light emerging from one plate surface of the light guide plate toward a front side, and returns the remaining light to a rear side. A second optical element is placed on the other plate surface side and transmits at least part of light emerging from the other plate surface side.
US07862189B1	Adjustable mirror attachment A mirror device for observing an infant in a rear-facing child safety car seat secured to the rear seat of a vehicle including a front seating area, a rear seating area, and a rear seat within the rear seating area, the rear seat having an upwardly-extending headrest. The mirror device includes a mirror and backing assembly having a rear surface, and an attachment connected to the rear surface for attaching the mirror device to the headrest. The attachment in turn includes a swivel device having a concavity element including a first bowl-like structure having a concave working surface; and a corresponding convexity element including a second bowl-like structure having a convex working surface configured to engage the concave working surface. The concavity and convexity elements are frictionally maintained in a desired adjusted position with reference to each other, while at the same time permitting manual adjustment.
US07862188B2	Image detection improvement via compensatory high frequency motions of an undedicated mirror Imaging systems in which an undedicated optical component—i.e., a component that would be present in the system even in the absence of image stabilization—is configured to undergo corrective motion and/or other correction of image data, and thus to function as a stabilization component. The stabilization component may be a mirror and/or a lens, and a positioner may be provided to tilt, rotate, and/or otherwise precisely adjust the position and orientation of the stabilization component to improve image resolution, compensate for platform motions, and/or improve image tracking. Because an undedicated optical component functions as the stabilization component, the stabilization occurs upstream, rather than downstream, from separation (if any) of the incoming image data into two or more beams. As a result, only one stabilization component is required regardless of whether the system is configured to split the image data into multiple data channels, and imaging systems as described herein therefore may be particularly well-suited for integration into a shared-aperture imaging system.
US07862186B2	Projector This projector comprises a source lamp, a lamp storage portion, storing the source lamp therein, including an air discharge opening for discharging internal air from the lamp storage portion and a netlike member so arranged as to cover the outer side of the air discharge opening of the lamp storage portion for inhibiting fragments of the source lamp from being discharged outward from the lamp storage portion through the air discharge opening when the source lamp is broken. The lamp storage portion further includes a protrusion provided on the outer side surface close to the air discharge opening to protrude in a direction intersecting with the extensional direction of the netlike member with a function of inhibiting the fragments of the source lamp from passing through a clearance between the lamp storage portion and the netlike member.
US07862180B2	Optical system for image projection and image projection apparatus The invention provides an optical system for image projection, wherein when used in an image projection apparatus, a screen-continuing portion (e.g., screen-underlying portion) of the apparatus can be reduced to a small size, or can be removed, and thereby the apparatus can be so compacted, and provides an image projection apparatus mounting such optical system. An optical system 10 for image projection including a lighting optical system 1 leading light from a light source 11 for lighting a display element 4 (or 4′), and a projecting optical system 3 for projecting projection light containing image information from the display element 4 (or 4′). The lighting optical system 1 is arranged such that a straight optical axis α from the light source 11 in the lighting optical system 1 is positioned in an area deviated from a luminous flux β of the projection light incident into the projecting optical system 3 toward an area where the projection light γ from the projecting optical system 3 passes. The image projection apparatus A (or B or C) mounting such optical system 10.
US07862173B1	Digital imaging ophthalmoscope An opthalmoscope. Implementations include a handle coupled to a head where the head includes a front section coupled with a diopter wheel and the front section includes a view window. A back section fixedly attached to the front section includes a diopter number viewer, a trigger button, and a digital imaging section. The digital imaging section may include a liquid crystal display (LCD) screen. The trigger button may be adjacent to the handle and may be positioned opposite the front section between the handle and the LCD screen. The back section may include a rounded projection rotatably coupled with a central hole in the diopter wheel extending from a diopter surface substantially parallel with and in close proximity to the diopter wheel. The diopter number viewer may extend from the diopter surface away from the diopter wheel and may include an opening configured to expose a diopter number.
US07862170B2	Compound modulation transfer function for laser surgery and other optical applications Methods, devices, and systems establish an optical surface shape that mitigates or treats a vision condition in a patient. An optical surface shape for a particular patient can be determined using a set of patient parameters for the specific patient by using a compound modulation transfer function (CMTF). The compound modulation transfer function can include a combination of modulation transfer functions (MTF's) at a plurality of distinct frequencies.
US07862169B2	Contact lenses and methods for their design The invention provides methods for designing contact lenses in which method the lens flexure is taken into account. The method of the invention is insensitive to the lens' back surface design and does not require complex back surface designs. Additionally, the lens design can be optimized virtually, eliminating the need for iterative design-test on-eye-re-design cycles.
US07862168B1	Eyeglass holding device Left and right curved discs may be attached to distal end portions of the left and right temple frames of an eyeglass. The left and right curved discs are positionable at a slight depression covered by skin above a mastoid process of the wearer's head and behind the wearer's ears for securing the eyeglass to the wearer. When not in use, the left and right curved discs may be hooked onto the wearer's ears for temporarily storing the eyeglass.
US07862167B2	Linear element, especially a spectacle side, and method of producing it A linear element, especially a spectacle side, of the type comprising a flexible metal core coated with a flexible elastomer for comfort and/or appearance. Its structure is composed of a plurality of rigid plastic rings placed in fixed positions around predetermined areas of the flexible metal core so that each can serve as a point of intermediate mechanical attachment of the flexible elastomer with respect to the core. The cross section of the rings are inscribed within that of the elastomer surrounding it.
US07862163B2	Image forming method and image forming apparatus The image forming method for forming a desired image on a recording medium, includes the steps of: applying a first liquid on the recording medium, the first liquid containing no coloring material and having a dynamic surface tension at a surface age of 0.1 seconds measured at 25° C. of γ1(0.1 s); and then depositing droplets of a second liquid on a region of the recording medium where the first liquid has a form of a liquid film, the second liquid containing coloring material and having a dynamic surface tension at a surface age of 0.1 seconds measured at 25° C. of γ2(0.1 s) that is greater than γ1(0.1 s).
US07862161B2	Ink detector viewable with the human eye An ink cartridge configured to hold an ink includes a substantially hollow body including an inner space and a substantially continuous inner wall. The cartridge further includes an optical prism in the inner space, disposed at a predetermined distance from the continuous inner wall such that an ink pocket is defined by a prism wall and the continuous inner wall. The prism includes at least one reflection site formed at an angle configured to reflect light from a light source through the prism at a predetermined height relative to a bottom of the body. If ink is present in the ink pocket at a level below at least a portion of the reflection site, the ink does not block the light reflected off of the portion of the reflection site from traveling across the ink pocket at the predetermined height, such that the reflected light is externally viewable.
US07862156B2	Heating element Embodiments of a heating element of a fluid ejection device are disclosed.
US07862153B2	Electrical wiring structure, liquid ejection head, liquid ejection apparatus and image forming apparatus The electrical wiring structure includes an electrical connection section where a first electrode and a second electrode are connected, wherein: the electrical connection section is formed by a first alloy containing at least gallium metal; and the first alloy has a melting point lower than 30° C.
US07862148B2	Method of priming picolitre inkjet printhead A method of priming an inkjet printhead having ink ejection nozzles. The method includes: providing an ink bag containing ink for distribution to the nozzles via a fluid path between the ink bag and the nozzles; applying inwardly directed force on at least one exterior wall of the ink bag so as to reduce an available fluid volume of the ink bag, thereby causing ink to flow from the ink bag to the nozzles along the fluid path; and arranging a biasing member in the ink bag so that the biasing member applies outwardly directed force on at least one interior wall of the ink bag to restrain the reduction of available fluid volume of the ink bag only once the available fluid volume has been reduced to a predetermined volume. Each nozzle is configured to eject an ink drop having a volume of about 1.2 picolitres.
US07862145B2	Printing apparatus and method of controlling the same An object of this invention is to properly prevent clogging of each nozzle in order to stably discharge ink without increasing a circuit scale even when the number of nozzles increases. For this purpose, the number of ink discharges from each printing element is stored in a memory. The number of ink discharges from each printing element that is measured from input printing data is subtracted from that stored in the memory, and the subtraction result is rewritten into the memory. The subtraction result is checked in a predetermined period, and if the number of ink discharges from each printing element is equal to or larger than a predetermined count, preliminary discharge to be performed periodically is suppressed.
US07862144B2	Printhead assembly with a print media guide and a wicking element Provided is a printhead assembly that includes a printhead mounted on a support structure, said printhead having an ink ejection face, and a print media guide mounted on the support structure for guiding print media past the printhead for printing. The assembly also includes a wicking element mounted on the support structure between the support structure and the print media guide, as well as a pad with an angled contact surface to operatively facilitate the transferal of ink from the printhead to the wicking element. The wicking element is formed from an absorbent material and is positioned in a cavity defined between the print media guide and the support structure.
US07862142B2	Ink jet head Pressure fluctuations that occur inside an ink jet head will be controlled. The ink jet head has a body. A common ink storage chamber is formed inside the body. A plurality of nozzles and a plurality of pressure chambers are formed in the surface of the body. One nozzle corresponds to one pressure chamber, and one pressure chamber corresponds to one nozzle. A plurality of individual ink storage chambers are formed inside the body. Each individual ink path extends from the common ink storage chamber, through one corresponding pressure chamber, and to one corresponding nozzle. The ink jet head is provided with an adjustor that allows the volume of the common ink storage space to increase or decrease. When the pressure of the ink that is stored in the ink jet head fluctuates, the volume of the common ink storage space will increase or decrease, and the pressure fluctuations will be smoothed.
US07862139B2	Method of adjusting output signal level, and liquid ejecting apparatus operable to execute the same In order to adjust a level of a detection signal output from an optical sensor in accordance with a state of a target object in a liquid ejecting apparatus, the optical sensor includes a light emitting element operable to irradiate the detected object and a light receiving element operable to detect a light amount which varies in accordance with the state of the target object. The detection signal is output from the optical sensor, based on the detected light amount. Luminance of the light emitting element is adjusted based on the detection signal, so that the level of the detection signal falls within a prescribed range.
US07862137B2	Method and system for avoiding bottom of page printing artifacts Method and devices for reducing printing artifacts. In one embodiment, a method includes directing ink onto a medium, the medium having a trailing edge; tracking the position of the medium in relation to a nip roller; adjusting the direction of ink onto the medium a first time when the trailing edge of the medium is in close proximity to the nip roller; and adjusting the direction of ink onto the medium a second time.
US07862135B2	Method of driving liquid ejecting head and liquid ejecting apparatus A method of driving a liquid ejecting head is provided. The liquid ejecting head varies pressure of a liquid in a pressure-generating chamber as a result of operating a pressure-generating element by supplying an ejection pulse, to eject liquid drops from a nozzle opening due to the pressure variation. The method includes performing a first contraction and performing a second contraction. In the first contraction, the liquid drops are ejected from the nozzle opening as a result of contracting the pressure-generating chamber. In the second contraction, the pressure-generating chamber is contracted so as to reduce withdrawal towards the pressure-generating chamber, of a meniscus after the ejection of the liquid drops A time from a start of the first contraction to a start of the second contraction is between ¼ to ¾ of a Helmholtz vibration period Tc of the pressure-generating chamber. A time of the first contraction is less than or equal to a natural vibration period Ta of the pressure-generating element.
US07862128B2	Vehicle wheel spoke connection A vehicle wheel, including an outer rim, a central hub with a central axle and an outer flange, a plurality of spokes extending between the rim and hub, a bracing element connected to one of the spokes, and a clamping element connected to the bracing element. The spokes have a span portion between the rim and hub. The spoke has a tensile axis of applied tensile load along the span portion, a sidewall surface, and a longitudinal axis along its length. The bracing element includes a portion of one of the rim and hub. The spoke is anchored to the clamping element in a clamped connection where the clamping element is clamped to one of the spokes by a clamping force. At least one of a first portion and a second portion of one of the spokes is joined to the clamping element by a deformed engagement.
US07862126B2	Method of providing a degradation drum In one aspect of the invention a degradation drum comprises a generally cylindrical body comprising inner and outer diameters. At least one degradation assembly is disposed on the outer diameter and it comprises a holder and a pick shank secured within a bore of the holder. At least one lubricant reservoir is disposed within the inner diameter and is in fluid communication with the bore of the holder through a fluid pathway. In some embodiments, the lubricant reservoir maintains a fluid pressure on the pick shank.
US07862123B2	Articulated chair having universal reclining armrest system A universal reclining armrest system for use with an articulated examination chair. The system includes an armrest adapter having a universal aperture for receiving a post portion of an armrest assembly. The armrest adapter further includes a splined peg for coupling to a pivoting mechanism of an articulated chair. The pivoting mechanism enables the chair to move throughout an operable range of motion while maintaining a fixed rotational position of an attached armrest adapter. The armrest assembly further includes an adjustable joint to provide 360° of rotational adjustment to the armrest relative to the fixed position of the armrest adapter.
US07862120B2	Chair The invention achieves a chair in which a shape of a backrest surface can be three-dimensionally changed while following a motion such as a sitting person looks around while sitting or the like. In a chair provided with a backrest in which an upper portion of a backrest surface is supported by a plurality of frame elements arranged so as to be spaced with each other in a width direction, the respective frame elements are independently movable backward and forward.
US07862119B2	Vehicle seat with lordosis support The invention relates to a vehicle seat with a back rest having a frame (2) and a lordosis support (6), with the following additional configuration: The lordosis support (6) comprises a pressure plate (9) that is essentially bend resistant in at least the transverse direction of the seat or the Y-direction, forms a supporting surface in the lordosis region of the back rest and is arranged between two side frame parts (3) of the frame (2); there is at least one holding element (5a, 5b) that extends between the side frame parts (3) with a length-variable adjustment section (21), which runs in the Y-direction and connects to the pressure plate (9), and is affixed there at fixing points (30) arranged opposite each other; in an inoperative position, the pressure plate (9) is arranged with a horizontal clearance (11) or a clearance in the X-direction behind the fixing points (30); there is a driving device with which the length of the adjustment section can be shortened as the horizontal clearance is reduced.
US07862118B2	Infant seat rocker An infant seat rocker includes a base member having a pair of rails that protrude generally vertically from the base member and extend a length of the base member, a front wall that protrudes at an angle from the front of the base member, at least one rear wall that protrudes at an angle from the rear of the base member, a motor that is positioned on the base member and a spring that attaches the motor to the infant seat. The infant seat is positioned on the base member and the rails, the front wall and at least one rear wall are capable of locating the infant seat on the base member while the motor is energized to produce and maintain a rocking motion in the infant seat.
US07862114B2	Seat restraining device The embodiments described herein provide a vehicle seat assembly that is coupled to a floor of a vehicle. The assembly comprises a seat back frame, a seat cushion frame, at least one leg and at least one blocking member. The seat cushion frame is pivotally coupled to the seat back frame. The leg is pivotally coupled to the seat cushion frame and pivotally coupled to the floor of the vehicle. The blocking member is coupled to the seat cushion frame and capable of moving into engagement with the leg as the assembly moves from the folded position to the upright seating position. The blocking member is adapted to block movement of the leg and to stabilize the seat assembly in the event of a vehicle collision.
US07862110B2	Headrest for recliner chair A reclining seating unit includes: a seat; a backrest, the backrest including a frame having a top edge; a reclining mechanism attached to the seat and backrest that moves the seat and backrest between upright and reclined positions; a headrest including a headrest panel; and a headrest mechanism attached to the backrest and the headrest. The headrest mechanism comprises a plurality of pivotally interconnected links and is configured to move the headrest between a retracted position, in which the headrest panel is generally horizontally disposed and overlies the top edge of the backrest frame, and an extended position, in which the headrest panel is vertically disposed and is separated from the top edge of the backrest frame. Movement of the seating unit from the upright position to a reclined position moves the headrest from the retracted position to the extended position. The headrest mechanism comprises: a connecting link pivotally connected to the reclining mechanism; a rear extension link pivotally connected to the connecting link; a front extension link pivotally and slidably connected to the connecting link; a headrest mounting bracket mounted to the headrest panel, the headrest mounting bracket being pivotally interconnected to the front and rear extension links; and a control link pivotally interconnected with the backrest frame, the front extension link and the connecting link. In this configuration, the seating unit can include a headrest that can be employed with chair styles that have a relatively low and narrow backrest.
US07862107B2	Cover for vehicle An intake system cover for a vehicle is mounted in an engine compartment to cover a reservoir tank that stores coolant for an engine. The intake system cover for the vehicle is formed with a light introduction opening for introducing light to be directed toward a liquid level gauge at a side of the reservoir tank. The visibility of the liquid level of the reservoir tank at the liquid level gauge is improved.
US07862106B2	Utility vehicles with an armoured cab of special design Utility vehicle, in particular for military purposes, with a chassis and a cab arranged on it frame so that it can be tilted, and guarded in certain places by affixed armor plating. The cab has a front module and a rear module, whereby the front module has a front wall, two side walls, a rear wall, a floor and a roof forming a cabin for the driver and co-driver. The rear module has a bearer frame enclosed at least in part by walls that form a hood-like protective and stowage space for the power aggregate and other vehicle parts and accessories. The rear module is releaseably attached to the rear of the front module and supported by it. Rear armoring of the cab is implemented by armor plating fitted between its front module and rear module.
US07862104B2	Impack absorbing member for vehicle The present invention relates to an impact absorbing member (14L, 14R) for vehicle which has a hollow cylindrical shape and is disposed in a vehicle between a side member (12L, 12R) and a bumper beam (10), and which is axially crushed along an axis of the impact absorbing member by receiving a compressive force into a bellows shape to absorb an impact energy upon deformation, wherein (a) the impact absorbing member includes a main body (20; 80; 90) of a hollow cylindrical shape, and a pair of attaching plates (54, 56) to which both axial ends of the main body are fixedly welded respectively; (b) the main body has, at least one axial end thereof, a flange (68, 70) protruding at least axially and being integrally formed with the main body; (c) the attaching plate has an adhered supporting portion (76) formed in parallel to the flange to be surface contacted therewith; and (d) the main body is fixedly welded to the attaching plate with the flange being surface contacted with the adhered supporting portion.
US07862100B1	Motorcycle seat covering system A motorcycle seat covering system includes a motorcycle having a frame, handlebars, seat and rack extending rearward of the seat. A housing has a pair of end walls and a perimeter wall extending between the end walls. The housing has an elongated opening therein. A coupling assembly couples the housing to the handlebars. A spindle is mounted within the housing and extends through a sleeve. A biasing member biases rotation of the sleeve in a first direction with respect to the spindle. A flexible panel is attached to the sleeve and has a free end extending outwardly of the housing through the slot. The panel is rolled up onto the sleeve when the sleeve is rotated in the first direction. A fastener is attached to the free end and is releasably attached to the rack when the panel is pulled outwardly from the housing to cover the seat.
US07862099B2	Roof opening/closing apparatus A roof opening/closing apparatus for operating a roof of a vehicle to move between first and second positions includes a panel member for covering an upper portion of an accommodating space and a panel moving mechanism. The panel member includes a first panel and a second panel which are aligned in a longitudinal direction of the vehicle. The panel moving mechanism is provided under the panel member to movably support the first and second panels. The panel moving mechanism includes a sliding mechanism slidably moving the second panel relative to the first panel so that the first and second panels are overlapped when the roof is located in the first position and a length of the panel member in a longitudinal direction of the vehicle is reduced to be smaller than the length of the panel member when the roof is located in the second position.
US07862095B2	Sandwiches 'n more toddler utensil Disclosed are methods and apparatus for empowering a toddler or person with a disability to eat whole foods, such as sandwiches, pizza, waffles, burritos, etc. more efficiently than without the aid of the apparatus, which apparatus has two body units, each having surfaces capable of holding a food product between them, and a compression component operationally connected to the two body units that controls the amount of force exerted by the surfaces on the food product when the food product is between the surfaces, at least two handles on the device, which handles project from the body unit, and are adapted to be held by a pair of hands, and an area on each body unit, which permit compression of these areas to move apart the surfaces.
US07862088B2	Swivel A swivel includes two coaxial, mutually rotatable members and is provided with flexible hoses or cables connected between the rotatable members for transferring operating and/or controlling media or the like between the rotatable members. The flexible hoses or cables are connected to the rotatable members by use of quick-couplings.
US07862086B2	Tongue storage device and seat belt apparatus having the same In a tongue storage device according to the present invention, a pickup portion (4c) is picked up and an anchor tongue (5) is then rotated, which causes the anchor tongue (5) to abut on an occupant restraint tongue (6). The tongue (6) is then rotated together with the tongue (5) clockwise with a pivot rib (12f) as a pivot. The rotation of the two tongues (5), (6) is stopped when the tongue (6) abuts on a tongue support portion (12h). Under this condition, a lock tab (5a) of the tongue (5) is inserted through a tongue insertion hole (12g) and locked in tongue lock-and-hold means (13), thereby storing the tongue (5). At this time, the other tongue (6) is stored by being clamped between a seat belt (4) and the pivot rib (12f), and between the tongue (5) and the tongue support portion (12h). A single action for storing the tongue (5) allows both tongues (5), (6) to be stored.
US07862079B2	Steering column device with knee airbag device A steering column device with a knee airbag device includes a steering column provided with a telescopic mechanism; a column cover that covers the rear end portion of the steering column; an airbag module, provided inside the column cover, which includes a gas generation device that generates gas, and a knee airbag that is inflated and deployed by the gas; an airbag door that is provided in the column cover, and that is opened when the airbag door receives the inflation pressure of the knee airbag; a collision prediction device that predicts that a vehicle will have a collision with a collision object; and a control device that operates the telescopic mechanism so that each of the column cover and the airbag module is moved rearward to a predetermined position, when the collision prediction device predicts that the vehicle will have a collision with the collision object.
US07862077B2	Side-impact airbag and side-impact airbag apparatus A side-impact airbag is disposed in a space between a side wall portion of a vehicle and a seat. The side-impact airbag includes a plurality of chambers partitioned in the airbag, a communication passageway formed in a front region of the airbag in a front-and-back direction of the vehicle, and a tether disposed between two of the plurality of chambers located at a rear region of the airbag in the front-and-back direction. The communication passageway allows at least two of the plurality of chambers to communicate with each other at the front region. An inflator supplies the gas to expand the side-impact airbag. The gas from the inflator is lead toward the communication passage through one of the partitioned chambers.
US07862065B2	Adjustable length bicycle mountable hand pump An adjustable length bicycle mountable hand pump. The pump includes a barrel having an internal cylinder within which a piston is reciprocatingly moveable. A piston rod connects to a piston at a proximal end and to a handle at a distal end. The handle is selectively, longitudinally, adjustably lockable relative to the barrel. The end of the handle is contoured to mate with a bicycle frame member. A head having a contoured portion mates with an opposing spaced bicycle frame member.
US07862062B2	Non-motorized vehicle A non-motorized foot board scooter including a frame, a front wheel and a rear wheel, a steering assembly, and a drive train. The drive train includes a kick arm that rotates the rear wheel when the kick arm is pushed backwards by the rider. The kick arm is centered with the rear wheel and a kick guard is located between the rear wheel and the kick arm. A first sprocket is mounted to the arm. The rear wheel has an associated second sprocket that is connected to the rear wheel via a clutch. A chain is mounted to the frame and extends around the first and second sprockets. The chain is routed such that as the arm is rotated the chain is drawn across the second sprocket thereby rotating the drive wheel.
US07862060B2	Front suspension apparatus for vehicle A front suspension apparatus includes a plurality of links suspending an axle member. First and second lower link members are arranged to dispose the second lower link member at a more rearward position than the first lower link member, to cause an imaginary line connecting both attaching points of the second lower link member to have a smaller angle than that of an imaginary line connecting both attaching points of the first lower link member relative to a line extending right in the vehicle-width direction as viewed from above of the vehicle, to cause the imaginary line of the second lower link member to overlap with a shaft portion of the axle member as viewed from the above, to locate the axle-member-side attaching point of the second lower link member at a more downward position than the axle-member-side attaching point of the first lower link member, and to locate the axle-member-side attaching point of the first lower link member more inwardly in the vehicle-width direction than the axle-member-side attaching point of the second lower link member.
US07862059B2	Torsion beam axle having connecting tube between torsion beam and trailing arm A torsion beam axle includes a torsion beam, a plurality of trailing arms made of a material different from that of the torsion beam, and connecting tubes made of a material better than that of the trailing arms with respect to weldability with the torsion beam, and integrally coupled to the trailing arms at one end part thereof, and welded to the torsion beam at the other end part thereof. Thereby, the coupling force between the trailing arms and the torsion beam made of different materials can be improved.
US07862057B2	Wheel suspension of a steerable wheel The invention relates to a wheel suspension of a steerable wheel, which wheel suspension has at least one wheel carrier to which are connected at least one steering rod and at least one lower transverse link. The wheel carrier is designed in at least three parts with a first wheel carrier part, a second wheel carrier part and a third wheel carrier part, which wheel carrier parts can be connected to one another by means of connecting elements in such a way that the at least three wheel carrier parts are moveable relative to one another.
US07862052B2	Vehicle roll control system A roll control system comprising a front torsion bar; a front first hydraulic actuator attached to the front torsion bar; a rear torsion bar; a rear first hydraulic actuator attached to the rear torsion bar; and control means connected to the hydraulic actuators and controlling the operation thereof on detection of a predetermined vehicle condition; wherein each hydraulic actuator comprises a first fluid chamber and a second fluid chamber; wherein the control means comprises a source of fluid pressure, a fluid reservoir, a pressure control valve fluidly connected between the pressure source and the reservoir, two pressure relief valves each having two positions to selectively fluidly connect the fluid chambers of the hydraulic actuators either to the pressure source or to the fluid reservoir, and a directional valve fluidly connected between the pressure relief valves and the fluid chambers of the hydraulic actuators; wherein the pressure relief valves and the directional valve are positioned on detection of the predetermined vehicle condition to apply a fluid pressure to the first fluid chamber of the first front and rear hydraulic actuators, and/or to apply a fluid pressure to the second fluid chamber of the first front and rear hydraulic actuators.
US07862051B2	Diaphragm chuck A diaphragm chuck assembly having clamping jaws disposed in a chuck body and in driven connection with a diaphragm deformable by an axially adjustable actuator, the clamping jaws having contact pieces, in which counterweights are disposed in recesses of the chuck body and the clamping jaws are clamped against the diaphragm by means of quick-clamping devices engaging in the contact pieces, the contact pieces being arranged in the diaphragm and in the counterweights with radial play. The clamping jaws are supported against a first surface extending axially in parallel to the chuck body in the clamping position and against a second reference surface extending at right angles to the first reference surface and into the diaphragm. The clamping jaws can be changed in a short time and the clamping jaws can be replaced without having to be reground.
US07862050B2	Centering process in chucking work and apparatus therefor A process and apparatus for centering accurately and speedy a workpiece on a magnet chuck mounted on a work spindle. A pair of action pads spaced away from one another comes into engagement with the workpiece attracted to the work spindle, thereby performing the centering operation. The action pads are mounted on a support plate that can freely turn on a fulcrum. As the fulcrum makes head towards a rotational center of the magnet chuck, the action pads comes into abutment in a rocking manner against the workpiece that is held at off-center relation in the chuck, thereby compensating the off-center relation to keep a center of the workpiece in alignment with the rotational center of the chuck.
US07862049B2	Gasket and method of forming a seal therewith A gasket and method of forming a seal between opposite surfaces of a pair of bodies. The gasket has a body with one portion having a plurality of perforations adapted for receipt between the opposite surfaces. The method of forming the seal includes disposing the portion of the body with the perforations between the opposite surfaces and fastening the pair of bodies to one another to compress the perforate portion of the body therebetween.
US07862046B2	Mechanical seal assembly A mechanical seal assembly including at least one pair of co-operating seal rings, one of which is provided for common rotation with a rotating component and the other of which is provided rotationally fixed at a stationary component. One of the seal rings is axially movable and axially biased with a biasing force against the other seal ring, the biasing force being transmittable through a force transmitting ring to the respective seal ring, in order to bias facing sliding surfaces of the seal rings, between which a sealing gap is formed during operation, in a mutual sealing engagement, and a secondary sealing assembly provided at the force transmitting ring for sealing the axially movable seal ring with respect to at least one circumferential guiding surface of a guiding component guiding the movement of the seal ring and the force transmitting ring.
US07862034B2	Paper feeding device and image forming apparatus A paper feeding device including: a paper feeding device body; a paper feeding cassette which is contained in the paper feeding device body so as to be freely drawn out; a guide part for guiding the paper feeding cassette with respect to the paper feeding device body along a substantially rectilinear line; a stopper for locking the paper feeding cassette on the way of drawing out the paper feeding cassette from the paper feeding device body; and a stopper releasing part which is integrally formed with the guide part and adapted to be flexed according to operation of drawing out the paper feeding cassette, thereby to release the lock of the stopper.
US07862032B2	Feeding device and recording apparatus A feeding device includes a feeding unit configured to be driven while being in contact with a recording sheet to feed the recording sheet, and a stacking unit configured to stack a plurality of the recording sheets and to press or release the stacked recording sheets to or from the feeding unit. Also, the feeding device includes a separating unit configured to separate the plurality of recording sheets fed by the feeding unit, one by one, a detecting unit configured to detect the recording sheet in an area downstream of the separating unit, and a control unit configured to control each of the units. The control unit switches a feeding operation between at least two feeding operations in accordance with a drive time of the feeding unit from when the feeding unit is started to be driven to when the detecting unit detects the recording sheet.
US07862030B2	Recording medium conveying device, image forming apparatus and cartridge A first guide member includes a concave-shaped guide surface. A recording medium such as a sheet fed by register rollers takes a curved position while being fed in a sheet feeding direction such that the leading edge of the sheet slides on the guide surface. A space is defined between the sheet and the guide surface due to the stiffness of the sheet. Thus, the sheet smoothly curves. When a speed of conveying the sheet by the register rollers is faster than a speed of conveying the sheet by a conveying belt, slack in the sheet is allowed in the space defined between the sheet and the guide surface. Therefore, the sheet can be stably conveyed without applying excessive load to the sheet or a sheet conveying device.
US07862029B2	Image forming system, image forming device, post-processor, and program An image forming system includes an input unit for input of setting information, an image forming unit, a conveying unit, a control unit, and a jam detecting unit, wherein a set of a plurality of different kinds of special sheets disposed in a predetermined order is used. When occurrence of a jam is detected by the jam detecting unit, the control unit recognizes whether a special sheet having been fed is present in the image forming system, and if it is recognized that a special sheet is present in the image forming system, the control unit controls the conveying unit, after the jam being released, to eject a special sheet or sheets as unnecessary up to one that is disposed preceding a special sheet that is of the same kind as a most front one that was present in the image forming system at the time of the occurrence of the jam.
US07862027B2	Sheet loader, sheet folding apparatus, and sheet finishing system A sheet loader for loading a folded sheet bundle provided from a sheet bundle provider with a folded edge of the folded sheet bundle in the lead, including: a folded edge support configured to support the folded edge of the folded sheet bundle provided from the sheet bundle provider, the folded edge support movable back and forth in a direction declined from a side near the sheet bundle provider, and an undersurface support configured to support an undersurface of the folded sheet bundle so that the folded edge is lower than a trailing edge of the folded sheet bundle.
US07862023B2	Sheet processing device and image forming apparatus A sheet processing device includes a stapling tray, a rear-end clamp, and a stapler that staples sheets while the rear-end clamp is clamping the sheets. In response to a start signal, the stapler moves to a position where the stapler does not interfere the rear-end clamp while being closest to a stapling position. When the last sheet of a sheet bundle to be stapled is conveyed into the stapling tray, timing at which the stapler moves to the stapling position is determined according to a preset condition.
US07862021B2	Gathering device with variable static charging of books A gathering device for gathering books is provided including a gathering conveyor for transporting a book, a variable static charging unit having a voltage output providing a static charge to the book on the gathering conveyor and a controller connected to the variable static charging unit, the controller controlling the voltage output of the variable static charging unit.
US07862017B2	Sheet processing apparatus and sheet processing method There is provided a technique in which while the occurrence of a sheet jam is avoided, a pair of folding rollers for a folding process and a stapler for a staple process can be disposed to be close to each other, and a contribution can be made to the improvement of productivity. A staple unit is provided which performs a staple process to a bundle of sheets transported to a specified staple position in a sheet transport path, and staples the bundle of sheets by causing a press unit that presses a sheet surface of the bundle of sheets when the staple process is performed to cooperate with a reception unit that is disposed to face an inside of the sheet transport path through a hole provided in an inner wall of the sheet transport path and receives the bundle of sheets pressed by the press unit, and a vicinity of an upstream side edge of the reception unit in a sheet transport direction on the sheet transport path is covered by an elastic member supported by one of a wall surface of the sheet transport path and the reception unit.
US07862008B2	Winch with tension indicator A winch has a color area or other indicium that indicates whether an elongate member extending from winch spool is or is not tensioned. The winch includes a biasing member between a winch drive system and the spool that allows only limited rotation of the spool relative to the drive system. Movement of the drive system relative to the winch spool causes the indicium to signal that the elongate member is under tension.
US07862007B2	Lightweight valve A lightweight valve (1), in particular for internal combustion engines, is provided, with a valve stem (3), with a hollow valve cone (5) and with a valve disk (7) closing the valve cone hollow space on one side, a valve cone support being provided in the hollow space. The valve cone support is provided at a distance from the valve disk (7).
US07861999B2	Lens molding apparatus An adjustable mold includes a distortable boundary, a flexible membrane, and a pressurizer, and method of use thereof. Pressure is applied to the flexible membrane, which causes the membrane to distort over the boundary. The shape of the boundary and the distortion of the flexible membrane control the optical characteristics of a lens resulting from the application and curing of a molding composition placed on the flexible membrane or to cast other items having variable shapes determined in part by the flexible membrane. In addition, a mold edge is used to allow casting in predetermined shapes, reducing need for grinding or edging. Visual and emission device calibration features used in conjunction with calibration reference images allow uniform selective distortion of the flexible membrane.
US07861998B2	Adjustable supporting device for a display panel An adjustable supporting device for a display panel includes: a coupling seat connected pivotally to a supporting seat mounted on a supporting surface; a mounting frame coupled to the display panel and connected pivotally to the coupling seat; a torsion spring having a first end engaging the mounting frame, and a second end opposite to the first end and engaging movably the coupling seat, and operable to provide a torsional force for supporting an assembly of the mounting frame and the display panel at a desired orientation relative to the coupling seat; and an adjusting member disposed movably in the coupling seat, abutting against the second end of the torsion spring, and operable so as to adjust the torsional force provided by the torsion spring.
US07861994B2	Seat adjustment apparatus of vehicle A seat adjustment apparatus of a vehicle that prevents a torque rod from falling off. A torque rod is rotatably supported by through holes, which are provided in a left base frame. The torque rod pivots with respect to base frames through pivoting of rear lifter links. A metal hook member is secured to the torque rod. The metal hook member includes a first engagement portion, second engagement portions, and a third engagement portion. The first engagement portion is passed through the torque rod and engaged with a torsion bar. The second engagement portions are engaged with the torque rod. The third engagement portion is provided at a position radially outward from the second engagement portions and engaged with the left base frame. The torsion bar is fixed to the torque rod through the metal hook member.
US07861993B2	Heated/cooled cup holder and sealing unit A cup holder, wherein the cup holder comprises a well adapted to receive a beverage container through an open top of the well. The cup holder also includes a sealing unit having a ring seal secured to the well adjacent to the open top of the well. The ring seal engages the container when the container is disposed in the well to cooperate with the well in providing a substantially closed and sealed chamber resistant to heat transfer to or from the chamber.
US07861989B2	Drapery rod bracket The bracket comprises a support arm that can be mounted to either a vertical surface such as a wall or a horizontal surface such as a ceiling. A rod supporting member such as a ring or hook is removably attached to the arm and is adapted to receive and support a drapery rod. The rod supporting member can be removed from the support arm and attached directly to a surface to provide an inside mount for the rod. A separate mounting clip may be used to mount the rod supporting member to the surface. the mounting clip may be provided with a rod engaging element for centering the rod and a surface engaging element for fixing the position of the rod supporting member on the surface.
US07861983B2	Cold-insulated fixed-point support The invention relates to a cold-insulated fixed-point pipe support for a low-temperature pipeline which includes an insulating system arranged between an outer shell and a supportable low-temperature pipeline having solid thermal insulating material which thermally insulates the pipeline from the low-temperature environment. A rotation-preventing and displacement-preventing device prevents rotation and displacement of the thermal insulating material with respect to the pipeline and an outer shell. A fixed-point pipe support is adapted to be fitted and removed in a substantially radial direction over the pipeline, and has at least one division with respect to shape with a division plane thereof extending perpendicular to a cross-sectional plane, and having a connecting device for releasable connecting and fixing shaped parts formed by the division.
US07861982B1	Subsea clamp for hoses and control lines A clamp for a tubular hose or cable is disclosed. The clamp comprises a first clamp half, a second clamp half, and a hinge pin. The first clamp half has a first end and a second end and defines a first concave semi-cylindrical face. The first end of the first clamp half carries means for mounting the clamp. The second clamp half has a first end and a second end and defines a second concave semi-cylindrical face. The first clamp half and the second clamp half come together along a parting line and are retained together by a hinge pin. The clamp halves are provided with snap-in liners for easy use. Alternative mounts for mounting the clamp on subsea wire line or tubulars is also disclosed.
US07861981B2	Protective saddle mount for cable tie A method and apparatus for providing a mounting system for an elongated item such as a cable, tube or wire, or an assembly of multiple cables, tube and/or wires. The mounting system includes an apparatus for mounting to a supporting structure, and an apparatus for receiving the elongated item. Also included is an apparatus for receiving a tying member such as a cable tie. Also included is an apparatus for permitting the tying member to be cut to release the elongate item from the mount without damage to the elongate item.
US07861979B2	Dragging equipment detector Disclosed systems, methods, and apparatti generally define inventions that detect and alert train crews of a potentially unsafe condition caused by equipment hanging below any portion of the train. It is emphasized that this abstract is provided to comply with the rules requiring an abstract that will allow a searcher or other reader to quickly ascertain the subject matter of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims.
US07861970B2	Fuselage structure including an integrated fuselage stanchion A fuselage structure for an aircraft or similar vehicle may include an upper fuselage portion and a lower fuselage portion. A floor may be disposed between the upper fuselage portion and the lower fuselage portion. At least one unitized stanchion may be disposed between the floor and the lower fuselage portion. The at least one unitized stanchion may form the only structural support between the floor and the lower fuselage portion without any vertical beams.
US07861966B2	Supersonic aircraft footprint spreading control system and method A method and system to optimize the process a spreading the weight of supersonic aircraft downstream over a large area to reduce the pressure and intensity on the ground as function of air flow velocity, temperature, and/or pressure is provided.
US07861955B2	Wet-grinding gypsum with polycarboxylates The process of the present invention includes obtaining a feed material having an initial median particle size. A solution of a polycarboxylate dispersant in water is formed, then the feed material is added to the solution to form a slurry. The slurry is wet-ground to reduce the median particle size of the feed material. Optionally, the total amount of polycarboxylate dispersant is divided into a plurality of doses that are added periodically over the total grinding time.
US07861953B2	Dispersing apparatus, ceramic slurry preparation method, and monolithic ceramic electronic component and manufacturing method thereof A dispersing apparatus that can efficiently disperse agglomerated particles in a slurry at a lower energy, a method for preparing a ceramic slurry containing ceramic particles that have been dispersed with the dispersing apparatus, a reliable monolithic ceramic electronic component manufactured using ceramic green sheets formed of the ceramic slurry, and a method for manufacturing the monolithic ceramic electronic component. A slurry containing agglomerated particles is passed through a dispersing section to produce a tensile stress, and the tensile stress is applied to the agglomerated particles in the slurry, thereby dispersing the agglomerated particles. The dispersing section includes a nozzle, a first channel thorough which a jet generated through the nozzle passes, and a cylindrical second channel through which the jet coming through the first channel passes to produce a tensile stress. The nozzle, the first channel, and the second channel are disposed in that order from the upstream side to the downstream side.
US07861950B2	Texture sprayer noise reducer A hand-held apparatus for spraying texture material including a body, a pressurized air source mounted on the body, a texture material hopper mounted on the body, and a texture delivery nozzle for selectively spraying texture material from the hopper onto a surface to be coated by propelling the texture material using pressurized air from the pressurized air source wherein each of the air source and the hopper can be disconnected from the body without the use of tools. An air directing plunger has a plurality of discontinuities at an outlet thereof, which may be radially outwardly directed recesses or radially inwardly directed teeth for reducing the noise generated by the pressurized air during operation.
US07861947B1	Wall-mounted lawn sprinkler system A wall-mounted lawn sprinkler system disposed along an exterior wall of a building for watering a lawn or garden area adjacent to the building. The system includes at least one sprinkler water supply conduit connected with the existing pressurized water supply line associated with the building, at least one housing mounted on the exterior wall of the building, and a water sprinkler device housed within each housing. The sprinkler device has a body with an interior chamber connected with the water supply conduit, a retractable member slidably mounted at a first end in the chamber having a sprinkler head at a second end exterior of the chamber, and a spring engaged with the retractable member to bias it into a normally retracted position. The retractable member and sprinkler head are extended outwardly of the housing when water under pressure is supplied to the chamber.
US07861938B2	RFID thread and sheet-shaped material using it The present invention provides a sheet-shaped material containing an RFID thread. The RFID thread comprises a strip-shaped film onto one side of which a semiconductor chip containing plural bits of memory and provided with an antenna wire is bonded. The strip-shaped film has plural openings formed therethrough except where the semiconductor chip is bonded. Since intertwining occurs between paper fibers via the openings, the RFID thread is strongly fixed in the paper.
US07861936B2	digital image capturing and processing system allowing third-parties to extend the features and functions of said system, and modify the standard behavior thereof without permanently modifying the standard features and functions thereof A digital image capture and processing system having a set of standard features and functions, and a set of custom features and functionalities said external host computer system, which can be extended by third parties to modify the standard behavior of the digital image capture and processing system into a custom behavior for the system, without permanently modifying the standard features and functions thereof.
US07861935B2	Label sheet out-feeding detection device for barcode printer A label sheet out-feeding detection device is provided for a barcode printer and includes a guide member coupled to a front enclosure of the barcode printer. The guide member forms at least one pair of opposing rails. Two casing members are combined to each other to form a combined casing movably received between the rails of the guide member for conducting up and down movement. The combined casing has a top portion forming a detection channel. A guide rail is formed inside the casing. A least a pair of photo-electric detection elements is respectively mounted on wall portions of the casing respectively above and below the detection channel for detecting out-feeding of a label sheet passing through the detection channel. At least one resilient device has an end coupled to the guide member and an oppose end engaging a bottom portion of the casing. At least one positioning bar has an end pivotally jointed to the guide member and an opposite end forming a positioner fit into and movably received in the guide rail of the casing. When the casing is depressed, the location of the positioner of the positioning bar within the guide rail is changed. The casing is selectively and resiliently raised up for conducting detection or depressed down for being concealed inside the casing. Thus, a label sheet out-feeding detection device that is switchable between an operation condition and a concealed and stowed condition by means of depression is realized.
US07861934B1	Devices and method for recording sales leads A sales lead recorder and a method of operation are described. The sales lead recorder may be used at an exhibition (or similar venue) to capture, compile, and output sales lead data associates with attendees of the exhibition. When an attendee provides a badge, the sales lead recorder captures embedded sales lead data within the badge. The presented recorder includes an imager that may capture a variety of embedded codes positioned at a variety of locations with a badge. In addition, the sales recorder is optimized for configuring the sales recorder according to an exhibitor's preferences. Furthermore, a variety of downloading and output options for sales lead data are available.
US07861933B2	Methods and systems for network configuration Network and device configuration systems and methods are described. In an embodiment, a first user interface configured to receive from a user configuration information regarding a first network provided. Program code stored in computer accessible memory is configured to generate a barcode that includes information related to the first network configuration information, wherein the barcode can be scanned by a device having a barcode scanner and a network interface to configure the network interface to access the first network.
US07861930B2	System and method for managing wireless point-of-sale transactions A system that enables a wireless point-of-sale transaction. In one embodiment the system comprises an account module, an account selection module, a display, an input interface, and a wireless transmitter. The account module stores account information corresponding to a plurality of payment accounts. The account selection module selects a payment account from the plurality of payment accounts as a default payment account for a wireless point-of-sale transaction based on one or more predetermined criteria. The display displays the default payment account to a user. The input interface enables the user to accept the default payment account by the account selection module. The wireless transmitter that wirelessly transmits payment information to a point-of-sale device, wherein the payment information comprises account information associated with the default account when the default payment account is accepted via the input interface.
US07861928B2	Electronic fund transfer or transaction system A fuel dispenser control system is provided which includes a biometric device. The biometric device is configured to acquire instances of biometric information in connection with respective fueling transactions. The fuel dispenser control system further includes a control subsystem. The control subsystem is configured to receive at least first biometric information in connection with at least a first fueling transaction, request comparison of the first biometric information with second biometric information associated with corresponding financial information, and determine whether to effect payment of the fueling transaction on the account, based on the comparison.
US07861926B2	Transaction card with movable member A transaction card includes a housing, a first roller, a second roller and a machine readable link. The first roller is rotatably coupled to and at least partially stored within the housing and has a first rotational axis. The second roller is rotatably coupled to and at least partially stored within the housing and has a second rotational axis. The second rotational axis differs from the first rotational axis. The machine readable link to an account or record is coupled with the housing. The account or record is configured to track an associated value available for application toward one of a purchase and a use of one or more of goods and services. Other cards, products, assemblies and methods of using such cards, products and assemblies are also disclosed.
US07861924B1	Banking system controlled responsive to data bearing records An automated banking machine operates to cause financial transfers responsive to data read from data bearing records. The automated banking machine includes a card reader that is operative to read card data corresponding to a user financial account. The card data is linked in at least one data store to an indication that the card data corresponds to an authorized financial account to enable operation of the automated banking machine. The card data is also linked in the at least one data store to a mobile communication device (i.e., cell phone of an owner associated with the financial account). In response to receipt of card data and a transaction request from an automated banking machine, contact data for the owner's cell phone is determined and a message notifying the owner of the requested transaction is sent. The transaction is completed only if the owner provides a responsive message granting permission for the transaction to proceed. Alternatively or in addition transaction authorization may be based on the then current location of the owner's cell phone adjacent to the automated banking machine, and/or other criteria.
US07861923B2	Negotiable instruments and systems and processing same There is provided a check with additional data capture capability that in conjunction with a linked transaction card provides substantially complete coverage for card holders to conduct transactions with merchants for the payment of goods and services. The additional data capture capability enabling generation of a card statement with detailed information regarding purchases and expenditures of both check transactions and card transactions to thereby permit a card holder to accurately track, monitor, describe, and reconcile all transactions in a statement period. The check comprises first and second data entry location for identification and descriptive information about a financial transaction, account holder name adjacent to a drawer signature field and check limit adjacent to a written check amount field, as well as other check information and entry fields, including routing, account and check reference number, date, payee designation, numeric check amount and account holder and financial institution information.
US07861914B2	Self-assembly of components A method is provided for the production of a bond between a first element having at least one first metal coating and at least one further element having a second metal coating, the at least one further element being freely moveable in a medium and the at least one first metal coating of the first element and the second metal coating of the at least one further element being in a solid state, a liquid phase being formed upon contact of the at least one first metal coating with the second metal coating.
US07861905B2	Hand-held fastener driving tool A hand-held drive-in tool (10) has a trigger switch (19) for triggering a drive-in process by drive unit (30) that drives a drive-in ram (13), a press-on feeler (18) which is arranged so as to be displaceable at a muzzle (16), which can detect that the drive-in tool pressed against a workpiece, and which prevents the actuation of a drive-in process in its initial position (41) and enables actuation of its drive-in process in its switching position (43), a component feeler (17) displaceably arranged at the muzzle (16) and capable of being actuated independently from the press-on feeler (18) and preventing actuation of a drive-in process in its initial position (42) and enabling the actuation of the drive-in process in its switching position (44), the component feeler (17) detecting fitting of an auxiliary constructional component (110) to the muzzle (16), with a drive-in process being initiated by the trigger switch (19) only when the component feeler (17) and the press-on feeler (18) are both in their respective switching positions (43, 44).
US07861903B2	Display apparatus for a vehicle having a receiver hitch A display apparatus for use with a truck having a receiver hitch includes a mounting bracket having oppositely disposed first and second ends, the first end being configured to be received in the receiver hitch. The apparatus includes a main support member coupled to the second end of the bracket, the main support member being height adjustable. The main support member defines an elongate channel. At least one fastener is coupled to the main support member for movement along the elongate channel, the fastener being selectively securable at a desired position along the channel. The fastener includes an eyelet to which a flag or banner may be secured. The apparatus may also include at least one auxiliary support member pivotally coupled to the main support member for displaying another flag.
US07861901B2	Pants hanger system A pants hanging system with a vertically disposed hanger strip, a plurality of elongate hanger receiving members and a plurality elongate semi rigid pants hanging members. The hanger receiving members are attached to the hanger strip in an equal spacing one above the other. The hanger receiving members are formed into a U shaped profile. The pants hanging members have a teardrop shaped profile. The bottom most portion of the teardrop shape includes a gap capable of removably retaining the cuff portion of a pair of pants. The rear, wall facing side of each the pants hanging member includes a horizontally disposed inverted U shaped profile. The U shaped portion of the hanger receiving member can slidably engage with the inverted U shaped portion of the pants hanging member to removably retain the pair of pants.
US07861897B2	Applicator device An applicator device for a free-flowing substance includes a carrier body provided with an application device at one end and a pin at an opposing end. A transverse channel penetrates the pin, and an axial channel branching off from the transverse channel leads to the application device. A reservoir device having a ring-shaped edge seal sealingly engages the pin, whereby the applicator device is activated by displacing the reservoir device on the pin toward the application device to open a flow connection between the reservoir device and the transverse channel. The reservoir device has a receptacle segment that is elastically deformable at least in portions so that, when the applicator device is activated and a flow connection between the transverse channel and the receptacle segment exists, the free-flowing substance is discharged via the application device by manual compression of the elastically deformable area of the receptacle segment.
US07861893B2	Adhesive dispenser for surgery A number of surgical devices for the mixing and dispensement of a dual component surgical adhesive onto tissue are described. The surgical devices can provide adhesive storage chambers for the adhesive components within the surgical device and can have removable cartridges that draw and mix and apply the adhesive onto tissue. The removable cartridges can be easily replaced when clogged with set adhesive. Alternately, an adhesive dispensing device can comprise an adhesive dispensing gun containing the dual components of the adhesive and a plurality of rotatable orifices that can dispense the adhesive. One orifice can be selected and aligned with the adhesive dispensing gun to mix and apply the adhesive onto tissue. A fresh orifice can be rotated into alignment with the gun should a prior orifice become blocked.
US07861890B2	Dispensing apparatus and method for semi-solid product Dispensing apparatus is primarily intended for dispensing product from product containers by extrusion. In controlling discharge of product a flexible tube is connected to the container outlet and the tube is engageable with drive means for deforming the tube and controlling product discharged along the tube to an outlet nozzle. Usually there will be valves towards the entry and exit of the flexible tube and the drive means engages the tube between the spaced positions.
US07861884B2	Fuel tank assembly A fuel tank assembly are provided which may limit the damage otherwise occasioned by the impact of a ballistic projectile. The fuel tank assembly may include a bladder defined between exterior and interior bladder walls, with the interior bladder wall defining a volume for storing fuel. The exterior bladder wall is at least as or more rigid than the interior bladder wall. The fuel tank assembly can also include connectors between the exterior and interior bladder walls to at least partially limit expansion of the bladder. The fuel tank assembly can also include an inlet opening into the bladder to permit a pressurized gas to be introduced into the bladder. The fuel tank assembly may also include a valve through the interior bladder wall into the volume for storing fuel to permit at least some of the pressurized gas to be introduced therein.
US07861883B2	Article baskets for a dishwasher Article baskets are adapted to support articles within a dishwashing machine. The article baskets can include an article support wall with a plurality of openings defined by an edge extending along a path circumscribing substantially the entire opening. If provided, the edge of each of the openings can be concave in a direction facing the opening along substantially the entire path. In addition, or alternatively, the article basket can further include a divider. The divider can include a portion configured to be selectively inserted into a elongated slot of a sidewall to divide the interior area into a first interior area portion and a second interior area portion. In addition, or alternatively, the divider can include a plurality of article receiving openings with at least one protrusion extending partially across the article receiving opening to divide a plurality of articles.
US07861880B2	Portable and/or collapsible containers having pliable surfaces Containers provide for portability and ease of handling by being constructed of pliable materials such as various polymers and having additional features. The containers may have biasing members such as tension poles to hold the containers in an upright and open top position and/or may have sleeves that can be engaged by a forklift for dumping of the container by a conventional forklift equipped garbage truck. The containers may include additional features such as loops along a top edge to allow grasping of the loops by a lift and loops along a bottom edge to allow dragging of the container such as onto a flatbed hauler. Additional features may include a top cover that can be pulled over the open top and secured such as by a fastener.
US07861878B2	Fastening device for folding boxes A fastening device for folding boxes, the folding boxes including a bottom and four lateral walls coupled in jointed fashion to the edges of that bottom, two opposite walls having each fastening devices for ensuring the unfolding of the box, the device in general including a vertically displaceable central piece and some lateral bolts with horizontal displacement for fastening the lateral walls via their adjacent edges. The folding device includes elastic spring elements which link the central control piece with the pairs of bolts, at the same time, the spring elements, in the rest position, maintain the bolts in the engagement and fastening position of the bolts, while for the release position of the bolts the spring elements pull the bolts towards the release position against the resistance of the elastic elements.
US07861871B2	Hand tool rack A hand tool rack has an elongated base bracket, multiple clamping elements, two hangers and a lock. The base bracket has a baseboard and a rail bracket. The rail bracket is detachably mounted on the baseboard. The clamping elements are movably mounted on the rail bracket of the base bracket. The hangers are movably mounted on the base bracket and each hanger has two mounting arms and a hanging arm. The mounting arms of the each hanger are clamped on the baseboard. The hanging arm is formed with the mounting arms of the hanger for hanging on a tool cart. The lock is detachably connected to the base bracket to provide a burglarproof effect and has a display clamp and a container clamp. The display clamp has a display panel and a catching bracket. The container clamp has a container panel and a container casing.
US07861869B2	Reinforced capillary membranes and process for manufacturing thereof A process for manufacturing asymmetric braid reinforced capillary ultra- or micro-filtration membranes (1), including the subsequent steps of pulling a tubular braid (5) through a spinneret (7) and coating the braid with a dope. Prior to the coating step, the braid is impregnated with a non-coagulation liquid, being a liquid which does not cause coagulation of the dope, when brought in contact with the dope. The result is a membrane with an outer skin, i.e. smaller pores near the outside diameter than near the inside diameter, and a coating which is closely arranged around the outside diameter of the braid, without any substantial penetration of the coating into the braid.
US07861868B2	Chip sorting and stacking devices Chip sorting devices include a rotatable disc having a plurality of wells for receiving chips therein, a plurality of channels for holding stacks of chips, at least one ejector for ejecting chips from the wells of the disc into the channels, and at least one removal lever associated with at least one of the channels. The removal lever has an arm configured to extend adjacent at least a portion of a stack of chips when the stack of chips is in a channel. Other chip sorting devices include a plurality of wells for receiving chips therein, a plurality of channels for holding stacks of chips, at least one ejector for ejecting chips from the wells of the disc into the channels, and at least one spring member configured to bias the ejector to a position.
US07861867B1	Material screening systems A reconfigurable grizzly-type system providing improved field processing of ore, rock, and soil. The system provides reconfigurable screening of rocks, rubble, gravel, and debris from soil based on material size. The system also provides improvements related to efficient storage and transportation.
US07861866B1	Screening system with knocking device A screening system with knocking devices includes a screen panel support, connector bars, knocking devices, and screen panels. The knocking devices are generally spherical-shaped balls held by elastic arms connected to the connector bars. When the screening system is activated by moving material onto the screen panels and vibrating the screen panel support, the knocking devices bounce around the undersurface of the screen panels and prevent the build-up or jamming of material blocking the openings in the screen panels. The knocking device and screen panels are separate so that when one of those elements becomes defective, the screening system can be fixed without replacing both elements.
US07861861B2	Container for holding elastic loops therein A container for holding elastic loops is described. The container includes a foldable and substantially planar card. A foldable, substantially planar sheet is included for holding elastic loops. The sheet is formed such that it can be contained within the card. A separator is pivotally attached with the card. When an elastic loop is placed upon the sheet and the sheet is positioned upon the card, the separator covers a portion of the sheet such that it holds elastic loops against the sheet to allow the loops and sheet to be concealed within the card. For ease of storage and concealment, the card has a shape and size such that when folded, the card is of a substantially similar shape and size as a credit card for placement within a wallet.
US07861857B2	Carry-on luggage with garment hanging feature An advantageous carry-on bag is now disclosed which accommodates hanging garments, folded garments and accessories. The bag comprises a bottom portion comprising a first bottom area and a flap area. The flap area which zips or otherwise removably secures to the top edge of each of two ends and the front side of the bag. The first bottom areas secured to the bottom edge of the two ends and the front side. When the flap is in a first position extending outwardly from said end bottom edges, it forms an area adapted to receive hanging garments. Upright flaps attached to the side edges of the end sections removably secure to one another to form a wall parallel to the front side section and define a packing area which may receive for example folded garments.
US07861856B2	Disposable tissue package with reflective surface and reflective element for use with tissue packages A portable or disposable package of tissues includes a reflective surface. The surface may be directly associated with the package. In another embodiment, the reflective surface is associated with another body which is connected to the package. That body may be removable from the package, so that it may be used with successive packages after the tissues in prior packages have been exhausted and the package disposed of.
US07861855B2	System and method for storing and mixing two or more substances A container system for separately storing and mixing two or more substances. The container system is comprised of a main container for holding at least one first substance and a cup for holding at least one second substance, the cup being removably mounted on the neck of the main container such that at least a portion of the cup is suspended within the main container. The cup has an upper portion, a lower portion and one or more arms for connecting the upper and lower portions. Apertures are formed between the upper and lower portions of the cup such that the contents of the cup may mix with the contents of the main container following removal of an inner cap attached to the cup, and agitation of the main container. The cup and neck are sized to provide a void therebetween, thereby also permitting the substances to mix.
US07861849B2	Merge conveyor including high-friction rollers A merge conveyor comprising a timing conveyor feeding a singulating conveyor characterized by a transverse-roller conveyor belt having rollers with a high-friction peripheral surface. The timing conveyor delivers articles to the singulating conveyor one article at a time at precise intervals. The rollers in the transverse-roller belt rotate freely transverse to the conveying direction. A plow guides the timed articles received on the singulating belt into a single file. The high-friction rollers inhibit the rollers from sliding along the rollers in the conveying direction to maintain the precise timing established by the timing conveyor.
US07861844B2	Method and apparatus for sorting items A method and apparatus are provided for sorting items to a plurality of sort destinations. The items are loaded onto one of a plurality of independently controlled delivery vehicles. The delivery vehicles follow a track that guides the delivery vehicles to the sort destinations, which are positioned along the track. Once at the appropriate sort destination, the delivery vehicle ejects the item to the sort destination and returns to receive another item to be delivered.
US07861840B1	Anti-back drive system An anti-back drive system preferably includes a drive housing, a drive ring, a lock ring and an output pinion. The drive housing includes a drive counterbore. The drive housing is secured to an electric motor. The drive ring preferably includes a base member and a plurality of drive projections. The drive ring is secured to a drive shaft of the electric motor. The lock ring includes a plurality of inward facing cam surfaces and a plurality of inward facing loop projections. The output pinion includes a drive gear and a plurality of drive fingers, which extend radially outward from the output pinion. The plurality of inward facing cam surfaces are sized to receive an end perimeter of said plurality of drive fingers. A push on clip is secured to the drive shaft to retain the drive ring, the lock ring and the output pinion on the drive shaft.
US07861839B2	Transmission lock A lock arrangement for a transmission, in particular in the form of a parking-lock arrangement for an automated transmission. The lock arrangement is prestressed by a first spring accumulator into a locking position in which the transmission is locked. The lock arrangement is capable of being shifted by means of an actuator from the locking position into a release position in which the transmission is released. The lock arrangement has an electronically activatable blocking device which is designed for blocking the lock arrangement mechanically in the locking position.
US07861838B2	Automatic transmission control apparatus An automatic transmission control apparatus is provided with a brake switch, a brake fluid pressure detecting section, a range position detecting section, a neutral control section and a prohibiting section. The brake switch is configured to output an on-signal when a brake pedal is depressed and otherwise output an off-signal. The brake fluid pressure detecting section is configured to detect a brake fluid pressure corresponding to a brake pedal depression force. The range position detecting section is configured to detect if a traveling range of an automatic transmission is selected. The neutral control section is configured to start a neutral control that puts the automatic transmission into a neutral state when the brake fluid pressure detected by the brake fluid detecting section exceeds a start threshold value while the range position detecting section detects that the traveling range is selected, and to end the neutral control when the brake fluid pressure falls below an end threshold value while the neutral control is being executed, with the start and end threshold values being set to values that are higher than the brake fluid pressure occurring when the brake switch starts outputting the on-signal. The prohibiting section is configured to prohibit the neutral control from being subsequently started again, after the neutral control has been started by the neutral control section, regardless of the brake fluid pressure detected by the brake fluid pressure detecting section until the brake switch outputs the off-signal.
US07861836B2	Roller-type one-way clutch The present invention provides a roller-type one-way clutch comprising an annular outer race provided at its inner periphery with a cam surface, an inner race spaced apart from the outer race in a radially inner diameter side and disposed coaxially with the outer race for a relative movement therewith and having an annular outer peripheral track surface, a plurality of rollers disposed between the outer race and the inner race and adapted to transmit torque between the outer peripheral track surface and the cam surface, a cage for holding the plurality of rollers, and a C-shaped annular spring for biasing the rollers, through the cage, toward engagement with the cam surface.
US07861835B2	Disposable luggage wrap A disposable strip of non-elastic, tear resistant luggage wrap material is provided that extends around the outer periphery of a piece of luggage and adhesively secures to itself. A plurality of disposable strips may be coupled end-to-end to accommodate large luggage pieces. The disposable strip may be removed by tearing along a plurality of spaced, inline apertures. The disposable strip includes several features, such as indicia that identify luggage as belonging to a group, organization or commercial carrier. The disposable strip also may include a security portion having an area for receiving the user's signature or initials to inhibit unauthorized tampering. A pocket may be provided on the disposable strip to receive user identification, a travel itinerary or other document. Furthermore, the disposable strip may be configured to receive an R.F.I.D. tag for electronic tracking.
US07861831B2	Front wheel brake device for forklifts A front wheel brake device for forklifts is used in applying brake to a front wheel attached to opposite lateral bottom sides of a mast assembly. The device includes a support bracket provided at the bottom sides of the mast assembly, a brake housing fixed to the support bracket and received within the front wheel, a wheel hub fixedly secured to the front wheel, an axle shaft rotatably provided within the brake housing and engaged with a shaft portion of the wheel hub for unitary rotation with the front wheel, brake discs axially movably fitted to the axle shaft for unitary rotation therewith, friction plates alternately arranged between the brake discs and fitted to the brake housing for movement in an axial direction of the axle shaft, and a piston provided within the brake housing for, when operated, pressing the friction plates against the brake discs.
US07861827B2	Oil manifold for lubricating bearings A bearing oil supply assembly includes (a) a plate member with opposed first and second sides, the plate member having a first bore formed in the first side which is adapted to receive a first bearing; (b) an annular manifold attached to the plate member such that the plate member and the manifold cooperatively define an annular oil gallery; and (c) a plurality of passages formed in the manifold, the passages cooperating with the plate member to define a plurality of generally axially-directed pathways in fluid communication with the first bore and the oil gallery. The passages are substantially evenly spaced around the circumference of the manifold. The oil supply assembly may be used to supply oil to two bearings carrying separate shafts running at different speeds.
US07861825B2	Method and apparatus for a loudspeaker assembly A method and apparatus for providing a loudspeaker assembly is provided. In accordance with at least one embodiment, a method is provided which comprises forming a loudspeaker frame so as to define a driver housing portion, a horn portion, and a conformal portion. A driver aperture is defined for the driver housing portion, and a port aperture is defined for the horn portion. A driver is attached to the loudspeaker frame proximate to the driver aperture. A rear baffle is applied to a first conformal portion surface of the conformal portion of the loudspeaker frame. The rear baffle defines a horn cavity wall of a horn cavity of the horn portion. The horn cavity has an increasing cross sectional area as the distance from the driver housing portion increases. A grille is applied to a second conformal portion surface of the conformal portion of the loudspeaker frame.
US07861824B2	Sound absorber for an exhaust system The invention relates to a sound absorber for an exhaust system having a Y-shaped feed piece arranged upstream from the sound absorber, combining two exhaust gas-carrying lines to form a single line entering into the sound absorber whereby the Y-shaped feed piece and the sound absorber are assembled from a common bottom shell and a common top shell. The invention also relates to an exhaust system equipped with the sound absorber.
US07861823B2	Duct for reducing shock related noise A duct 26 has circumferentially distributed features capable of scattering acoustic energy associated with fluid dynamic shocks 34 extending in a shock orientation direction D. Each feature is oriented, over at least a portion of its length, substantially perpendicular to the shock orientation direction. The features may be splices 42 used to connect segments of an acoustic liner 30, partitions 56 in a stability enhancing casing treatment 32, or other features capable of scattering acoustic energy associated with shocks.
US07861822B2	Engine noise reduction apparatus A vehicle including an enclosure and a separator wall is disclosed. The enclosure defines an engine compartment and the engine compartment encloses an internal combustion engine. The separator wall extends from a forward portion of the engine compartment to a rear portion of the engine compartment. The engine compartment is at least partially separated into an upper portion and a lower portion by the separator wall.
US07861821B2	Acoustically transmissive blanket system A blanket system, which can include a blanket, quilt, or similar bed-covering can include one or more localized sound-emitting areas, one or more separately-located sound-processing devices, and one or more acoustically transmissive communication channels coupled between the sound-processing devices and the sound-emitting areas. A control can be provided to adjust the sound characteristics provided at the sound-emitting areas. The system can be used to mask unwanted sounds.
US07861817B2	Occupant protection apparatus for vehicle An occupant protection apparatus for a vehicle includes: a plurality of communication devices for communicating an external device; and a controller for determining a collision of the vehicle based on information transmitted from the external device via the plurality of communication devices and for activating an occupant protection device corresponding to the collision. The controller prohibits activation of the occupant protection device when the controller detects communication anomaly occurred at more than one communication device.
US07861815B2	Motorcycle A motorcycle is provided in which the size of the body frame is restricted from increasing in a vehicle-width direction while enhancing the frame rigidity. The body frame includes a head pipe and left and right front frame sections which extending from the head pipe. The left and right front frame sections have left and right side wall sections which extend in a longitudinal and vertical directions of the vehicle. Left and right side wall sections are disposed on the left and right sides of the engine unit. The engine unit is supported by the left and right side wall sections which have relatively high rigidity, thereby enhancing the supporting rigidity of the engine unit. This type of engine unit support ensures body frame rigidity without widening the space between the left and right body frame sections in a vehicle-width direction.
US07861813B2	Vehicle ground connection comprising a wheel and a suspension integrated therein A ground contact system for a vehicle. The ground contact system comprises a wheel, a hub carrier, means for driving the wheel using at least one rotary motor secured to the hub carrier, reduction means comprising at least one gearwheel connected to the wheel and at least one pinion connected to the rotary motor, a sliding-bar suspension suspending the wheel from a support connected to the vehicle, and braking means. The braking means comprises a brake disc connected by its periphery to the wheel, and a brake calliper positioned inside the brake disc.
US07861808B2	Cutter for maintaining edge sharpness A cutter comprising a base portion, an ultrahard layer disposed on said base portion, and at least one recessed region on an outer surface of the cutter. A start of the recessed region disposed a selected distance behind a cutting face.
US07861807B2	Drill bit including one piece cutting head A cutting head for a drill bit has a body with an overall cruciform shape. One pair of opposing arms defines a main cutting edge. The other pair of opposing arms defines an auxiliary edge. The main cutting edge is defined by rake surfaces and relief surfaces. Each rake surface and relief surface is defined by a plurality of facets. The main cutting edge includes a chisel edge. A first pair of planar rake facets, one on each end of said chisel edge, and a first pair of planar relief facets, adjacent said chisel edge, defines a portion of the cutting edge. A remaining portion of the main cutting edge is defined at the apex of a plurality of curved rake facets and curved relief facets. The auxiliary edge is defined by a plurality of curved surfaces.
US07861806B2	Shank structure for rotary drill bits A shank configuration for rotary drill bits is disclosed for positioning of the shank in relation to a bit body. A tapered surface or feature of the shank may be configured and sized to matingly engage a complementarily shaped surface or feature of the drill bit body and thereby become centered or positioned in relation thereto. A deformable element may be disposed between the shank and bit body. Also, the shank may comprise a material having a carbon equivalent of less than about 0.35%. A multi-pass weld procedure may be employed to affix the shank and bit body to one another wherein welds may be formed so that one weld originates at a circumferential position that differs from the origination circumferential position of its immediately preceding weld by at least about 90°. Further, a stress state may be developed within the multi-pass weld. A method of manufacture is also disclosed.
US07861805B2	Conformal bearing for rock drill bit A rock drilling bit having PDC radial bearings has journal and cone bearing surfaces with increased contact area to increase load support. The radius of curvature of the bearing pin journal and cone bearing surfaces are matched or conformed on the bearing pressure side. The conformal journal surfaces may be formed on the main journal bearing, the pilot pin radial bearing, or both surfaces. In addition, diamond inlays may be located on the bearing surfaces of the cone, the bearing pin, or both components.
US07861804B2	Sleeve arrangement Sleeve arrangement for a drill rig, especially adapted for damping sound and sealing to the ground, said drill rig comprising a feed beam (4) having a drill end (41) and a rear end (42), said feed beam (4) comprising a first and a second part (411, 412) near the drill end (41), the first part (411) being fixed in relation to the feed beam (4,) and the second part (412) being movable in relation to the feed beam (4) in a longitudinal direction. The invention is characterized in that said sleeve arrangement comprises a first flexible element (100) attached to the first part (411), and a second flexible element (200) attached to the movable second part (412), such that said first and second flexible elements (100, 200) are movable in relation to each other, wherein said second flexible element (200) is capable of taking an upper and a lower position, as well as all positions there between.
US07861800B2	Combining belief networks to generate expected outcomes A method is described for determining an oilfield parameter for a drilling operation in an oilfield, the oilfield having a well site with a drilling tool advanced into a subterranean formation with geological structures and reservoirs therein. A first set of decision factors and a second set of decision factors about the drilling operation are identified. Each of the first set of decision factors is contained within a first set of nodes, and each of the second set of decision factors is contained within a second set of nodes. Both the first set of nodes and the second set of nodes contain a set of common nodes, which are common to both the first and second sets. The first set of nodes is associated to create a first belief network and the second set of nodes is associated to create a second belief network. Then, the set of common nodes of the first belief network is associated with the set of common nodes of the second belief network to form a multinet belief network. Oilfield parameter can be generated from the multinet belief network.
US07861799B2	Impact tool It is an object of the invention to provide a technique which is effective in improving the durability of an angular positioning device of a tool bit and in reducing weight of a tool body in an impact tool. A representative impact tool includes a tool body, a lubricant sealed in the housing space, a driving mechanism, a tool holder, an angular positioning device disposed on a tip end side of the tool body and serves to fix a position of the tool bit around the axis with respect to the tool body. The angular positioning device includes first and second locking members. The first locking member is disposed between the tool body and the tool holder. The second locking member is disposed opposite to the first locking member. One end of the first locking member in the axial direction of the tool bit extends into the housing space of the tool body and is connected to the tool body within the housing space.
US07861796B2	Method of operating drill with solid state speed control A method of operating a hand power tool in one embodiment includes generating a variable speed control signal with a solid state switch that corresponds to a selected speed for a motor, generating a pulse width modulated (PWM) signal corresponding to the variable speed control signal, generating H-bridge driving signals for an H-bridge circuit in correspondence with the PWM signal, and selectively coupling a motor to a power source using the H-bridge circuit in accordance with the H-bridge driving signals.
US07861794B2	Three-point implement mounting for an agricultural or industrial utility vehicle A three-point implement mounting for an agricultural or industrial utility vehicle includes an upper member and two lower members. A working implement is coupled to the three-point implement mounting in order to couple the working implement to the utility vehicle. In order to provide an interface between the utility vehicle and the working implement which is versatile and can adapted to the physical application, the three-point implement mounting is of modular design and has a coupling interface for coupling the three-point implement mounting to the utility vehicle.
US07861792B2	Fire suppression system A system for discharging inert gas for extinguishing or suppressing a fire is disclosed. A fluid discharge control arrangement is positioned in a fluid flow path between a pressurised gas supply 10A,10B,10C and the target fire suppression zone 20. The fluid discharge control arrangement reduces the pressure in the fluid flow path downstream thereof. This may allow the downstream pipework to be selected to withstand a lower pressure than in a conventional system in which the fluid discharge control device was not provided, thereby reducing costs. The fluid discharge control device may comprise a first valve 30 and first restrictor 26 in the first flow path 22 and a second valve 32 and a second restrictor 28 provided in the second flow path 24. Fluid from the containers 10A,10B,10C flows initially through flow path 24 and restrictor 26. Subsequently flow path 22 may be closed by optional valve 30, and flow path 24 is opened by valve 32. Fluid flow then passes through restrictor 28. This reduces the peak pressure in the downstream pipework 34. In another embodiment the discharge of inert gas from the containers 10A,10B and 10C is staggered to reduce the peak pressure in pipeline 34. A further embodiment provides a restrictor in the inlet 14A,14B,14C from each of the containers 10A,10B,10C to the manifold 16, thereby also reducing the peak pressure in the pipeline 34.
US07861790B2	Injection valve and method The present invention generally relates to controlling the flow of fluids in a wellbore. In one aspect, a valve for selectively closing a flow path through a wellbore in a first direction is provided. The valve includes a body and a piston surface formable across the flow path in the first direction. The piston surface is formed at an end of a shiftable member annularly disposed in the body. The valve further includes a flapper member, the flapper member closable to seal the flow path when the shiftable member moves from a first position to a second position due to fluid flow acting on the piston surface. In another aspect, a valve for selectively closing a flow path through a wellbore in a single direction is provided. In yet another aspect, a method for selectively closing a flow path through a wellbore in a first direction is provided.
US07861788B2	Casing valves system for selective well stimulation and control Casing valves for selective well stimulation and control. A well system includes at least one valve interconnected in a casing string operable via at least one line external to the casing string to selectively control fluid flow between an exterior and interior of the casing string, and the casing string, valve and line being cemented in a wellbore. A method of selectively stimulating a subterranean formation includes: positioning a casing string in a wellbore, the casing string including spaced apart valves operable via a line to selectively control fluid flow between an interior and exterior of the casing string; and for each of multiple intervals of the formation in sequence, stimulating the interval by opening a corresponding one of the valves, closing the remainder of the valves, and flowing a stimulation fluid from the casing string into the interval.
US07861786B2	Method and apparatus for fluid bypass of a well tool Apparatuses and methods to inject chemical stimulants (284) to a production zone (102, 202) through a string of production tubing (110, 210) around a downhole obstruction are disclosed. The apparatuses and methods include deploying an anchor seal assembly (200) to a landing profile (120, 220) located within a string of production tubing (110, 210). The anchor seal assembly (200) is in communication with a surface station through an injection conduit (260, 264) and includes a bypass pathway (262) to inject various fluids to a zone below.
US07861782B2	Foamed cement compositions, additives, and associated methods A variety of methods and compositions are disclosed, including, in one embodiment, a cement composition comprising: cement; a surfactant composition comprising: an ethoxylated alcohol ether sulfate in an amount in the range of about 60 to about 64 parts by weight, a first alkyl or alkene amidopropyl betaine in an amount in the range of about 30 to about 33 parts by weight, and a second alkyl or alkene amidopropyl betaine in an amount in the range of about 1 to about 5 parts by weight; a gas; and water.
US07861780B2	Method of treating subterranean formations with porous particulate materials Methods and compositions useful for subterranean formation treatments, such as hydraulic fracturing treatments and sand control that include porous materials. Such porous materials may be selectively configured porous material particles manufactured and/or treated with selected glazing materials, coating materials and/or penetrating materials to have desired strength and/or apparent density to fit particular downhole conditions for well treating such as hydraulic fracturing treatments and sand control treatments. Porous materials may also be employed in selected combinations to optimize fracture or sand control performance, and/or may be employed as relatively lightweight materials in liquid carbon dioxide-based well treatment systems.
US07861775B2	Casing patch A casing patch includes a deformable seal configurable to a deformed and undeformed position for sealing and unsealing respectively with a target stub and a pressure based subsystem in operable communication with the deformable seal. The patch may also contain a stop ring to prevent overcompression of the seal.
US07861771B2	Rod pump stuffing box A stuffing box for sealing around a polished rod in a well including a cylindrical connector for receiving the polished rod, a packing member having top and lateral surfaces and wherein the packing member is concentrically disposed around the polished rod, a body concentrically disposed around the packing member and sealing engaging the cylindrical connector, and wherein the body may be selectively moved to expose the top and lateral surface of the packing members is disclosed. A method of repairing, redressing, or replacing packing members of a stuffing box including providing a stuffing box at a wellhead, manipulating the stuffing box such that top and lateral surfaces of the packing members are exposed, removing the packing members, and redressing the stuffing box with new packing members is also disclosed.
US07861770B2	System for cyclic injection and production from a well A system is provided for injecting an injection fluid into an earth formation via a wellbore formed in the earth formation and for producing hydrocarbon fluid from the earth formation via the wellbore. The system comprises an injection conduit extending into the wellbore and being in fluid communication with a plurality of outlet ports for injection fluid, and a production conduit extending into the wellbore and being in fluid communication with at least one inlet section for hydrocarbon fluid. The injection conduit is arranged to prevent fluid communication between the injection conduit and each said inlet section.
US07861766B2	Method for firing a ceramic and refractory metal casting core In an investment casting process, a composite core is formed as a combination of ceramic casting core element and a non-ceramic casting core element. The core is heated in an oxidative atmosphere and then heated in a non-oxidative atmosphere.
US07861765B2	Method of making a multi-element mold assembly for, e.g., footwear components A mold assembly for footwear components is cast as a collection of mold elements having integral attachment members. Attachment members of separate mold elements may then be joined by, e.g., welding. Handles may also be formed into one or more mold elements as part of the casting process. Outsole negatives are juxtaposed with templates for attachment tabs and/or handles and used to form ceramic casting molds. The ceramic casting molds can then be used to cast individual mold elements.
US07861764B1	System for suspending quilts and the like A sleeve is provided which is attachable to a back of a quilt or other object to be suspended from a rod or other elongate object. The sleeve is of generally tubular form including a front panel extending from a bottom up to a top pleat. The forward panel is coupled to the back of the quilt through top stitching adjacent the top pleat and bottom stitching adjacent the bottom. Preferably, a rear panel similar in form to the forward panel extends up from the bottom to an upper pleat. A gusset is also preferably provided between the forward panel and the rear panel with the gusset itself formed of a first panel and second panel spaced from each other by a center pleat. The forward panel has a length between the top pleat and the bottom which is less than half of an entire circumferential length of the sleeve.
US07861757B2	Flashless welding method and apparatus A method and apparatus for welding two separate ends of an extrusion or two separate extrusion ends to form a flashless extrudate or gasket by having a first and a second mold for supporting and clamping the extrusion ends, and a spacer bar for positioning the extrusion ends to a location within the mold. A heating element elevates the temperature of the extrusion ends to a welding condition, and a clamping device is used for securing the extrusion ends. A flashless welding operation results by inserting and clamping at least one heated extrusion end into a welding mold until an acceptable contact pressure is obtained against the opposing heated extrusion end.
US07861755B2	Pneumatic tire with tread having middle rib, middle lateral grooves, assistant grooves and lateral narrow grooves A pneumatic tire includes a tread surface having a middle rib defined by a first circumferential groove and a second circumferential groove in its center region. Middle lateral grooves, that obliquely extend in the widthwise direction of the tire, are disposed at predetermined intervals in the tire circumferential direction in the middle rib; only one terminal end of each middle lateral groove communicates with one circumferential groove of the first and second circumferential grooves. An assistant groove is provided between each of adjacent middle lateral grooves; the assistant groove extends in such an inclined manner that the inclination direction thereof with respect to the tire circumferential direction is opposite to that of the middle lateral grooves; a block is defined by the assistant groove, middle lateral grooves and one circumferential groove. The middle lateral grooves each include a first inclined groove portion having an inclination angle a ranging from 35 degrees to 60 degrees and a second inclined groove portion having an inclination angle β ranging from 0 degree to 30 degrees.
US07861747B2	Forming fabric having exchanging and/or binding warp yarns Forming fabric that includes a top layer having top weft yarns and a bottom layer having bottom weft yarns. At least one pair of binding warp yarns and at least two adjacent pairs of top and bottom warp yarns are utilized.
US07861746B2	Motor vehicle hose A motor vehicle hose consisting of plastic material, where the interior surface of the hose consists at least in segments of an electrically conducting plastic material. The invention provides for a section of electrically conducting plastic material that extends at least over a portion of the circumference of the hose and which is connected to the electrically conducting interior surface of the hose. The section extends in a radial direction into a layer of non-conducting plastic material. The section extends at least in segments in the longitudinal direction of the hose.
US07861734B2	Umbrella hub with cord lock feature An umbrella hub is provided that is operative to engage an umbrella cord for maintaining an umbrella in an open position. The hub can comprise a hub body, a channel, a passage section, and an engagement section. The hub body can comprise a series of projections extending outwardly from the hub body. The channel can be formed in one of the projections of the hub body. The channel can be configured to allow the cord to pass therethrough. Further, the passage section can be configured to allow the cord to pass freely therethrough. Finally, the engagement section can be configured to engage the cord to prevent upward movement of the cord relative to the hub body.
US07861733B2	Device for treating pieces of a substrate at high pressure with a supercritical or near-critical treatment medium, piece by piece or in batches A device for treating pieces of a substrate at high pressure, piece by piece or in batches, with a treatment medium in the supercritical or near-critical state, includes a first pressure chamber, a pipe system for supplying and discharging the treatment medium, to and from the pressure chamber under high pressure and an electric motor, which is fixed to the housing in the first pressure chamber or in a second pressure chamber coupled to the first pressure chamber under the high pressure, for driving an actuator to carry out a mechanical action in the treatment medium. The electric motor is in this case open to the treatment medium and is disposed and designed to be accessible to the treatment medium, in such a manner that during the treatment of a substrate the treatment medium flows through and around the electric motor.
US07861732B2	Immersion cleaner for print rollers What is contemplated is a printing cylinder washer having a removable or portable drive assembly, or a series of portable drive assemblies of different lengths to accommodate different sizes of print rollers. The drive assemblies have a drive mechanism enabled by a dynamic flow of cleaning solution within the washer reservoir. What is also contemplated is the use of an elevation system, an agitation platform, under-immersion spray bars, an ultrasonic wave cleaning system, and a hatch or door equipped with a thermal breaker in conjunction with the hydro-driven portable drive assembly. What is also contemplated is a method of washing printing rollers within the above-described printing cylinder washer by aligning a nozzle with the drive assembly.
US07861729B2	Hair weave foundations and methods of use A hair piece to be attached to the head of a user, the hair piece having a cloth-based foundation having a top edge, a bottom edge, a left edge and a right edge, with the foundation including a middle slit provided at about the center of the foundation, a bottom slit provided adjacent the bottom edge, a first set of side slits provided along the left edge, a second set of side slits provided along the right edge, a first set of rubber bands provided along the left edge, a second set of rubber bands provided along the right edge, a third set of rubber bands provided along the top edge, a fourth set of rubber bands provided along the bottom edge, a fifth set of rubber bands provided about the middle slit, and a plurality of wefts of hair attached to the foundation.
US07861722B2	Sleep appliance A dental oral appliance to reduce or eliminate snoring or obstructive sleep apnea and to open the airway for a sleeping patient. The appliance covers the inside (lingual) of the upper or lower teeth and has an open palate. Retention for the appliance is provided by an occlusal coverge of the upper or lower teeth. A raised incisor ramp that extends from the incisal tip of the incisors toward the lingual, or posterior ramps, separate the posterior teeth to open the airway. A transpalatal bar, which extends from the inside (lingual) of the right molars to the inside of the left molars, inhibits the upward and backward movement of the tongue. An anterior tongue restrainer which is attached to the transpalatal bar at one end and the front of the appliance at the other end, aids in inhibiting and restraining the upward and backward movement of the tongue.
US07861721B2	Appliance, system and method for preventing snoring An appliance, a system and a method prevent snoring of a patient. The appliance opens an airway of the patient by advancing a lower jaw of the patient. A slot is formed on an upper shell and/or a lower shell of the appliance to receive teeth of the patient for wearing the appliance. A hinge connects the upper shell to the lower shell and resists the closing of the mouth of the patient to maintain the open airway of the patient. Wedges protrude from the hinge between the upper shell and the lower shell to further resist the closing of the mouth of the patient. Stiffer material of the hinge and/or the wedges relative to material of the upper shell and the lower shell requires more force to close the mouth of the patient and maintains the open airway of the patient during sleep. Extended margins may receive liner material to secure the appliance to the dentition. Lingual extensions on the lower arch help to maintain the lower jaw in a forward position relative to the upper jaw.
US07861717B1	Controlled gas-supply system The invention relates to a gas-supply system for patients receiving artificial respiration or breathing spontaneously, in which one or several gases (for example NO, oxygen) are added to the respiration gas at varying proportions (continuously or intermittently) by means of a control device (program control, sensor control or combined program/sensor control). This gas-supply system allows for adaptive dosing of the gas to suit individual patients.
US07861716B2	Closed loop control system for a high frequency oscillation ventilator A control system for a high frequency oscillating ventilator (HFOV) includes and oscillator controller and a mean airway pressure (MAP) controller. The HFOV includes a reciprocating piston which is adapted to generate positive and negative pressure waves for delivery to a patient airway. The oscillator controller comprises a pair of closed loop control circuits including an oscillator pressure loop and a centering loop which are collectively adapted to regulate frequency and amplitude of piston reciprocations and centering of the piston. The MAP controller comprises a closed loop control circuit that is adapted for regulating MAP at the patient utilizing feedback in the form of patient circuit pressure. Likewise, the oscillator controller utilizes patient circuit pressure as well as piston displacement feedback in order to regulate movement of the piston.
US07861713B2	Adapter for use in an aerosol delivery system According to one aspect of the present invention, an aerosol inhalation system includes a first conduit member for delivering medication in the form of aerosol particles to a patient. The system also includes a first device in fluid communication with the first holding chamber for producing the aerosol particles and being sealingly yet releasably received within an adapter that forms an entrance into a first holding chamber. The adapter has a compressible material disposed thereon which is at least partially compressed by insertion of the first device to form the seal between the first device and the adapter, thereby creating a closed system that is therefore capable of delivering a fixed concentration of the medication to the patient due to a valve of the valve mechanism being closed when the patient inhales and the medication is delivered to the patient.
US07861708B1	Draft inducer blower mounting feature which reduces overall system vibration A draft inducer blower for high efficiency furnaces, including a blower housing which provides enhanced contact between the blower housing and the furnace collector box to reduce the flexing and vibration between the blower housing and the collector box. The blower housing includes contact structure which provides a direct abutting contact relationship between the blower housing and the collector box at least along a substantial periphery of the blower housing and/or at one or more rigid transition points on the collector box. In one embodiment, the contact structure can be part of the blower housing body and/or the blower housing cover. In another embodiment, the contact structure can be part of the collector box or furnace to which the blower housing is mounted. When fasteners secure the blower housing to the collector box, the contact structure provides a substantially integral rigid construct between the blower housing and the collector box.
US07861707B2	Gravity feed natural draft pellet stove A pellet stove utilizing gravity feed and natural draft more effectively and efficiently burns pellet fuel while producing less air pollution and ash. In one embodiment, the pellet stove has a primary combustion area comprising a burn unit removably disposed in the vent tube, a feed tube defining a fuel chamber above the burn unit and a secondary combustion area, comprising a burn box defining a secondary burn chamber, below the burn unit. The burn unit has a removable receptacle which defines a primary burn chamber that receives pellet fuel from the fuel chamber and discharges substantially burned fuel to the secondary burn chamber for additional burning. Openings in the burn box, pellet receptacle and vent tube draw air into the burn chambers. A control mechanism controls the air flow to regulate the heat generated by the pellet stove. The pellet stove can be manufactured in various aesthetically pleasing designs.
US07861703B2	Paintball gun A paintball gun includes an air valve and a body portion, in which the body portion includes a paintball hole, a communicator, a piston, an axle and a bolt. By the pneumatic control of the air valve, the piston is pushed between the first and second positions, and the movement of the bolt is controlled between the third and fourth positions, so as to control the pneumatic air to flow out of the projection passage to project the paintball.
US07861701B1	Shooting device for air guns and paintball guns An improved shooting device for air guns and paintball guns comprises a gun barrel sheathed into a sliding base of a breech of a gun, a tension spring installed at the front end, a bullet supplying device installed at the rear end, an opener connected to the rear of the bullet supplying device, and a bullet supplying hole formed at the bottom of the bullet supplying device and interconnected with the bullet feeding hole of a handle type magazine. The gun barrel includes an elastic turning base pivotally connected thereon, a pushing groove formed at the rear edge of the turning base, a sliding surface formed at the bottom of the turning base, and the pushing groove and a pushing protrusion disposed at the top of a trigger are engaged, so that when the trigger is pulled, the pushing protrusion at the top of the trigger pushes the pushing groove of the turning base, such that the turning base drives the gun barrel to compress the tension spring and produce a forward displacement. In the meantime, the rear end of the gun barrel moves forward along the bullet supplying device to open the bullet supplying hole, such that the bullets will be supplied automatically from the bullet feeding hole of the cartridge magazine by the pushing force, until the pushing protrusion is separated from the pushing groove, and then the resilience of the tension spring drives the gun barrel to shift backward, and the rear end of the gun barrel will be loaded with a bullet and the bullet feeding hole will be shut, and the opener is pushed to open a valve. The high-pressure gas in a pressurized cylinder forces to shoot the bullet. The invention can reduce the volume of the automatic bullet loading device and avoid the leak of pressurized gas, and further improve the shooting force.
US07861697B2	Carbureted natural gas turbo charged engine A control system for a turbo charged natural gas engine. A butterfly valve used for fuel control upstream of a carburetor provides non-linear flow response during opening and closing and a flow compensator compensates for the non-linear response. A throttle valve position sensor acts in association with a controller which compares the throttle valve position signal with a predetermined set point and thereby opens or closes the waste gate of the turbo charger which affects oxygen content in the exhaust. A compensator for a throttle valve used with electronic engine controllers is also provided.
US07861691B2	Controller for accumulator fuel injection system A common-rail fuel injection system is equipped with a common-rail, a fuel pump 11, and an injector. The fuel pump has a plurality of fuel pumping systems. A pressure sensor is provided at a fuel inlet of the injector. When the fuel pump supplies fuel to each of the fuel pumping systems, an ECU detects a variation in fuel pressure in a fuel passage between the fuel pump and the injector. Based on the detected fuel pressure variation, the ECU computes a pumping characteristic with respect to each of the fuel pumping systems.
US07861690B2	Device and method for controlling internal combustion engine The internal combustion engine has a valve driving mechanism (VM) capable of changing the valve-opening characteristic of at least one of an intake valve (Vi) and an exhaust valve (Ve), an in-cylinder pressure sensor for detecting the in-cylinder pressure in a combustion chamber and ECU. ECU calculates the variation amount of the in-cylinder pressure caused by the valve-overlap of the intake valve (Vi) and the exhaust valve (Ve), and based on this variation amount of the in-cylinder pressure and the in-cylinder pressure detected at a predetermined timing in the compression stroke, calculates an amount of air sucked in the combustion chamber, as well as, based on this calculated intake air amount, determines the ignition timing. The amount of air sucked in the combustion chamber is accurately and costlessly calculated, and the ignition timing is optimally determined by using the calculated air amount.

1 2 3 4 5 6 7 8 9 10