| Document | Document Title |
|---|---|
| US07804783B2 |
Automatic detection and testing of new networking connections
A new connection wizard automatically detects available networking hardware, as well as networks that are available. The wizard then presents the user with a list of choices, i.e., different connection types that they can set up. This list of options is based on the hardware and networks that were detected initially. Thus, the wizard will only present the user with the connection types that can actually be utilized. Once the user has selected a connection type and completed the configuration through the wizard, the wizard will automatically test the connection and report success or failure to the user. |
| US07804780B2 |
Receiving and transmitting devices for providing fragmentation at a transport level along a transmission path
The present invention provides receiving and transmitting devices for providing fragmentation at a transport level along a transmission path. The transmitting device comprises an interface and a control unit coupled to the interface. The control unit is adapted to negotiate a packet size with a remote device. The control unit is also adapted to transmit a data packet of up to the negotiated size. The control unit is further adapted to receive acknowledgments from the remote device associated with one or more fragments, fragmented at the transport-level, of the transmitted data packet. The receiving device comprises an interface and a control unit coupled to the interface. The control unit is adapted to receive two or more fragments of a data packet transmitted by a remote device. The control unit is also adapted to transmit one or more acknowledgments to the remote device based on the received fragments. |
| US07804779B2 |
Method and device for remotely controlling the congestion of meshed flow in a packet mode telecommunication network
The invention relates to a method for remotely controlling the congestion of meshed flow exchanged in a packet mode telecommunication network between a number N of central sites Ci provided with flow management devices and a number M of remote sites Dm devoid of such devices. According to the invention, said active devices of central sites Ci exchange between them information intended specifically for the management of flows exchanged between each of the central sites Ci and each of the remote sites Dm. |
| US07804777B2 |
Upstream data rate estimation
In one embodiment, a device includes: a transceiver operable to transmit packets to and receive packets from a modem; and a logic engine configured to transmit first packets at a rate through an upstream path for a modem to an Internet node such that no throttling is triggered in the modem, the logic engine being further configured to transmit second packets through the upstream path for the modem to the Internet node at a rate sufficient to trigger throttling in the modem if the modem implements throttling, the logic engine being further configured to compare an average transmission time for first packets to an average transmission time for the second packets to determine whether the modem implements throttling. |
| US07804774B2 |
Scalable filtering and policing mechanism for protecting user traffic in a network
Described are computer-based methods and apparatuses, including computer program products, for scalable filtering and policing mechanism for protecting user traffic in a network. A data packet is filtered by a multi-tiered filtering and transmission system. Data packets matching the first tier filter are discarded. Data packets matching the second tier filter are transmitted to an output module based on a criterion. Data packets in the third tier filter are hashed into bins and data packets matching an entry in the bin are transmitted to the output module based on a criterion for the bin. Data packets in the fourth tier transmission system are transmitted to the output module based on a criterion. Data packets that do not meet the criterion for transmission to the output module are transmitted to an attack identification module which analyzes the data packets to identify attacks. |
| US07804763B2 |
Power line communication device and method
A power line communication device for communicating data signals over a power line is provided. One example embodiment comprises a conditioning circuit configured to be coupled to the power line and a modem communicatively coupled to the conditioning circuitry to transmit and receive data signals over the power line via the conditioning circuitry. The modem may be configured to transmit and receive orthogonal frequency division multiplexed data signals that comprise a plurality of sub-carriers, wherein the modem is adapted to vary the transmit power for each of a plurality of subsets of the plurality of sub-carriers from substantially zero power to a plurality of increments above zero power. The modem also may be adapted to transmit and receive data signals with the transmit power for each of a plurality of subsets of the plurality of sub-carriers being different and to transmit and receive using a different modulation scheme at different sub-carriers. |
| US07804758B2 |
Holographic information recording/reproducing apparatus
An information recording/reproducing apparatus can suppress generation of stray light and prevent aggravation of the SN (signal to noise) ratio at the time of reproduction. If the angle of incidence of reference beam relative to the information recording medium (transmission-type disk 119 or reflection-type disk 213) at the time of recording is θ1, the angle of incidence of reference beam relative to the information recording medium at the time of reproduction is θ2 and the angle of incidence of reference beam reentering the information recording medium relative to the information recording medium at the time of reproduction is θ3, the angle of the galvano mirror for changing the angle of incidence of reference beam and the angle of the galvano mirror for reentering reference beam into the information recording medium are controlled so as to establish relationships of θ1≠θ2 and θ1=θ3. |
| US07804757B2 |
Hologram recording and reproducing apparatus
A hologram recorder/player includes recording beam modulation controller which causes a spatial light modulator to modulate the recording beam in such a way that a hologram is recorded in a plurality of blocks in a unit recording region and that each of the blocks includes recording information (DATA) and error correction code, at a time of recording. The hologram recorder/player includes incident angle variable controller which varies a reference beam incident angle to a plurality of predetermined angles with respect to the unit recording region. The recording beam modulation controller causes the modulation of the recording beam in such a way that a different hologram is generated for a page each time the reference beam incident angle is varied and that the hologram in each page is recorded in a plurality of the blocks. |
| US07804751B2 |
Method of distinguishing optical recording medium and apparatus of the same
One inventive aspect relates to a method which easily distinguishes copycat products that are difficult to distinguish by identifying only a media ID. A media ID and other attribute data are read out of a reference optical recording medium, and then a media ID and other attribute data are read out of an optical recording medium that is a target for separation. They are compared with each other in a data record processing section to determine whether data is data matched or not matched, and the result is displayed on a display section. |
| US07804750B2 |
Test disc and drive verification method
In a test disc, data (test data) is recorded in such a manner as to fill an entirety of a data region and, next to this test data, border-out data is recorded which contains information indicating that recording is prohibited. By determining whether the data can be played back appropriately from a position in the vicinity of an outer periphery of the disc where playback characteristics are apt to be unstable, whether the data can be played back appropriately from all of the regions is verified. Also, by determining whether it is possible to recognize that test disc is capable of recording, it is verified whether the border-out data can be smoothly acquired from the position in the vicinity of the outer periphery of the disc where playback characteristics are apt to be unstable. |
| US07804746B2 |
Land/groove track and pickup head movement direction detection
A detector is scanned across an optical storage medium having groove tracks and land tracks, each track having a wobble structure, to detect light reflected from the optical storage medium. A wobble signal and a tracking error signal are generated based on an output of the detector, and the wobble signal is sampled according to the tracking error signal. A determination about whether the detector is at the groove track or the land track is made based on the tracking error signal and a comparison of sampled values of the wobble signal. |
| US07804738B2 |
Active steering systems and methods for marine seismic sources
Systems and methods for automatic steering of marine seismic sources are described. One system comprises a marine seismic spread comprising a towing vessel and a seismic source, the seismic source comprising one or more source arrays each having a center of source array, each source array having one or more source strings; a seismic source deployment sub-system on the towing vessel, the sub-system controlled by a controller including a software module, the software module and the deployment sub-system adapted to control an inline distance between one of the centers of source array and a target coordinate. It is emphasized that this abstract is provided to comply with the rules requiring an abstract, allowing a searcher or other reader to quickly ascertain the subject matter of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims. |
| US07804736B2 |
Delay controller for ultrasound receive beamformer
An ultrasound system includes an ultrasound transducer having an array of elements and a beam origin located between two adjacent elements, each of the elements for converting received energy into an echo signal; and a beamformer that includes an initialization controller having initialization controller circuitry for calculating initialization parameters according to a process for calculating initialization parameters from a reduced table; at least one channel having a delay circuit and a delay controller; and a summer for summing phase-aligned signals to form a beamformed signal. |
| US07804733B2 |
System and method for memory phase shedding
Embodiments of the invention supply power to DRAM or other memory devices with a multi-phase voltage regulator. A power controller coupled to the multi-phase voltage regulator causes one or more phases of the multi-phase voltage regulator to be activated or deactivated (shed) according to predetermined criteria. Embodiments of the invention thus improve power management by providing one or more reduced power states for the memory devices. Other embodiments are described. |
| US07804728B2 |
Information handling system with SRAM precharge power conservation
An information handling system (IHS) includes a processor with on-chip or off-chip SRAM array. After a read operation, a control circuit may instruct the SRAM array to conduct a precharge operation, or alternatively, instruct the SRAM array to conduct an equalize bitline voltage operation. A read operation may follow the precharge operation or the equalize bitline voltage operation. The control circuit may instruct the SRAM array to conduct an equalize bitline voltage operation if an equalized voltage of a bitline pair exhibits more that a predetermined amount of voltage. Otherwise, the control circuit instructs the SRAM array to conduct a precharge operation before the next read operation. |
| US07804725B2 |
Write driving circuit and semiconductor memory apparatus using the same
A write driving circuit includes a plurality of driving units that write data corresponding to detection signals on memory banks, and at least one detecting unit that detects data input from the outside, and outputs the detection signals to two or more driving units among the plurality of driving units. |
| US07804724B2 |
Method and apparatus for boundary scan programming of memory devices
In accordance with at least one embodiment, a method, apparatus, and article of manufacture are provided for configuring a virtual boundary register in a programmable logic device (PLD), transmitting a first user-definable-command operation code (opcode) to the PLD to effect programming of a memory device coupled to the PLD, and preferably transmitting a second user-definable-command opcode to the PLD, the second user-definable-command opcode causing the physical boundary scan circuitry to load the virtual boundary register. The foregoing is preferably achieved in accordance with a boundary scan standard (e.g., Institute of Electrical and Electronics Engineers, Inc. (IEEE) 1149.1, dated 2001). |
| US07804717B2 |
Semiconductor device
A dummy cell includes a plurality of first memory cells MC for storing “1” or “0”, arranged at points of intersection between a plurality of word lines WR0 to WR7 and a plurality of first data lines D0 to D7, a plurality of first dummy cells MCH for storing “1” or “0”, arranged at points of intersection between the word lines WR0 to WR7 and a first dummy data line, and a plurality of second dummy cells MCL for storing “0”, arranged at points of intersection between the word lines WR0 to WR7 and a second dummy data line DD1. |
| US07804716B2 |
Flash memory device having improved bit-line layout and layout method for the flash memory device
Provided are a flash memory device having an improved bit-line layout and a layout method for the flash memory device. The flash memory device in which bit lines are disposed based on double patterning technology (DPT), may include at least one main bit line connected to a cell string including a memory cell storing data, at least one dummy bit line disposed parallel to the at least one main bit line, and a common source line transferring a common source voltage, and disposed on a different layer from a layer on which the at least one main bit line and the at least one dummy bit line are disposed, wherein the at least one dummy bit line may include a first dummy bit line transferring a first voltage and a second dummy bit line transferring a second voltage. |
| US07804714B1 |
System and method for providing an EPROM with different gate oxide thicknesses
A system and method are disclosed for providing an electrically programmable read only memory (EPROM) in which each memory cell comprises an NMOS select transistor with a thick gate oxide and a PMOS breakdown transistor with a thin gate oxide. The source of the NMOS transistor and the source, drain and N well of the PMOS transistor are connected. The gate of the PMOS transistor is grounded. Under the control of the NMOS transistor, a programming voltage pulse is passed to the N well of the PMOS transistor of a selected memory cell. The magnitude of the voltage is sufficient to break the thin gate oxide of the PMOS transistor without damaging the NMOS transistor. Because the memory state of the memory cell depends on the breakdown status of the PMOS transistor, the data may be retained in the memory cell for an unlimited period of time. |
| US07804713B2 |
EEPROM emulation in flash device
Flash memory systems and methodologies are provided herein for providing byte alterability in a flash device. Logical cell mapping is changed from using a single physical memory cell to using two adjacent physical cells as a logical cell for emulating byte alterability. By mapping two adjacent physical cells as a single logical cell, the logical cell is a combination of neighboring drain/source regions, thereby creating a single program and erase entity. The single program and erase entities can allow for logical cell erase and program in either direction of a low voltage state or a high voltage state on a single bit or variable bit length basis. By employing the single program and erase entity, the subject innovation can provide a cost-effective approach to emulating electrically EEPROM in a flash device. |
| US07804712B2 |
Flash memory device and program recovery method thereof
A method of programming a flash memory includes programming memory cells connected to a selected word line by applying a first voltage to the selected word line and a second voltage to non-selected word lines, the second voltage being lower than the first voltage, lowering the first voltage of the selected word line to a third voltage after programming the memory cells connected to the selected word line, the third voltage being lower than the first voltage, and recovering a fourth voltage of the selected word line and the non-selected word lines, the fourth voltage being lower than the second and third voltages. |
| US07804706B2 |
Bottom electrode mask design for ultra-thin interlayer dielectric approach in MRAM device fabrication
A bottom electrode (BE) layout is disclosed that has four distinct sections repeated in a plurality of device blocks and is used to pattern a BE layer in a MRAM. A device section includes BE shapes and dummy BE shapes with essentially the same shape and size and covering a substantial portion of substrate. There is a via in a plurality of dummy BE shapes where each via will be aligned over a WL pad. A second bonding pad section comprises an opaque region having a plurality of vias. The remaining two sections relate to open field regions in the MRAM. The third section has a plurality of dummy BE shapes with a first area size. The fourth section has a plurality of dummy BE shapes with a second area size greater than the first area size to provide more complete BE coverage of an underlying etch stop ILD layer. |
| US07804699B2 |
Segmented ternary content addressable memory search architecture
A segmented ternary content addressable memory (TCAM) search architecture is disclosed. In one embodiment, a TCAM device with a row of TCAM cells includes a first segment of the TCAM cells for determining a match of corresponding search bits of a search string with a first portion of a stored string in the first segment of the TCAM cells, an evaluation module for generating a search enable signal if the match of the corresponding search bits with the first portion of the stored string is determined, and a second segment of the TCAM cells for determining a match of remaining search bits of the search string with a remaining portion of the stored string in response to the search enable signal. |
| US07804696B2 |
Electromagnetic radiation containment in an electronic module
Electromagnetic radiation containment in an electronic module. In one example, an electronic module includes a housing, a printed circuit board, and an electrically conductive sealing element. The printed circuit board is partially positioned within the housing and defines an edge connector extending from the housing. The electrically conductive sealing element radially surrounds 360 degrees of one end of the housing and the printed circuit board proximate the edge connector such that when the edge connector is fully received in a host board connector mounted to a host board, the electrically conductive sealing element cooperates with a corresponding structure of the host board to at least partially define a Faraday cage substantially enclosing the edge connector and the host board connector. The housing defines a radial groove which aids in the retention of the sealing element. |
| US07804694B2 |
Reference layer openings
A component having reference layer openings to contribute towards achieving a differential impedance in a circuit, is described herein. |
| US07804690B2 |
Server device
The present invention relates to a server device which comprises a case having two symmetric slots disposed on the top and a first handle disposed in each of the slots to make it easier to lift up the server device, a horizontal partition disposed in the case and dividing the inner space of the case into upper and lower parts, wherein the upper part is a first holding space capable of holding at least an electronic device, a first heat dissipation unit is disposed at the front of the electronic, the lower part of the case is a second holding space capable of holding at least a server, and a second heat dissipation unit may be disposed at one side of the second holding space, such that a plurality of servers, electronic devices and heat dissipation units may be integrated into the server device for easily and conveniently being moved. |
| US07804688B2 |
Apparatus including processor
An apparatus is disclosed. The apparatus includes a processor having a major surface, where the processor generates heat when energized. It also includes a heat dissipation plate comprising a thermally conductive material, and includes a first portion with flat opposing surfaces and a second portion substantially perpendicular to the first portion. The heat dissipation plate is adapted to dissipate heat from the processor. It also includes an array of pins, where the pins in the array of pins are substantially perpendicular to the flat opposing surfaces of the heat dissipation plate, and a heat dissipating material contacting the heat dissipation plate and the major surface of the processor. The heat dissipating material does not contact the second portion of the heat dissipating plate, and the pins are configured to be received in a socket assembly on a circuit board. |
| US07804685B2 |
Ducted exhaust equipment enclosure
An electronic equipment enclosure includes a frame structure at least partially enclosed by a plurality of panels defining a compartment in which one or more electronic components are mounted and an exhaust air duct that is adapted to segregate hot air being exhausted from the compartment from cool air entering the compartment, thereby improving thermal management of the enclosure. The exhaust duct includes a lower duct section extending upward from the top panel of the compartment and an upper duct section telescoping upward from an upper end of the lower duct section. Each duct section includes four panels connected together by hinged corner fittings such that the section is collapsible. The upper duct section includes an outwardly flared portion. |
| US07804681B2 |
Display device and collection device
A display device includes a circuit board, a pocket-shaped structure, a holder, and a display panel. The pocket-shaped structure includes a first side wall, a second side wall, a third side wall, a fourth side wall, and two support plates. The third side wall and the fourth side wall each has a hole. The two support plates are located beside the third side wall and the fourth side wall and form an empty space with the four side walls. The holder includes a first panel, a second panel, and two engaging slides. The two engaging slides are located at two extension arms of the first panel. When the holder is stored in the empty space, the first panel is supported on the two support plates and the two engaging slides are clamped within the holes of the third side wall and the fourth side wall. |
| US07804674B2 |
Position recognition in an electromagnetic actuator without sensors
An electromagnetic actuator and a method for controlling the actuator comprising at least one armature (3) and two coils (1, 2). The voltage gradient at the two coils (1, 2) is measured during a sudden increase in voltage. From this measured data, a subtractor (16) computes a third voltage gradient (25) from which a logic unit (17) determines the position of the armature (3) without the use of an additional sensor. |
| US07804665B2 |
Head support device, disk device having the head support device, and portable electronic device having the disk device
A head support device that is resistant to shock due to external impact, a disk device including the head support device, and a portable electronic device including the disk device are disclosed. In the head support device, a head support arm on which a head slider with a head is disposed through a flexible and elastic gimbal mechanism is formed rotatably about a rotary shaft as a horizontal rotating axis in parallel with a disk surface. The head support arm is formed such that it pivots, about a straight line drawn between apexes of a pair of pivots as a vertical pivot axis, vertically (generally perpendicularly) with respect to the disk surface. A gravity center position of a total mass of members, other than the head slider, pivoting about the vertical pivot axis is positioned near the vertical pivot axis. |
| US07804662B2 |
Perpendicular magnetic recording head including wrap around shield with notched top write gap and method of fabricating the same
In a perpendicular recording head, a notch is formed in the top write gap at a location on top of the main pole. A perpendicular head with this notched top write gap structure has less transition curvature and better writability while reducing the adjacent track interference (ATI). Also, the process used to fabricate the head ensures that the trailing edge (writing edge) of the main pole is extremely flat with no corner rounding. |
| US07804660B2 |
Method for unloading head without calibration in hard disk drives
A hard disk drive with a voice coil motor coupled to a head. The disk drive includes a circuit that provides a drive current with a sinusoidal waveform to the voice coil motor during an unload routine. The back emf of the voice coil motor can be determined during a sample period when the current is essentially zero. There is no need to perform a resistance calibration. This reduces the time needed to unload the head. |
| US07804656B2 |
Light delivery technique for heat assisted magnetic recording head
An apparatus includes a load beam, a slider coupled to the load beam by a gimbal assembly and including an optical transducer, an optical fiber for transmitting light directly toward the transducer, and a mounting structure for adjusting the position of an end of the optical fiber. Data storage devices that include the apparatus are also included. |
| US07804653B2 |
Imaging optical system for cameras
An imaging optical system for cameras comprising a stop, a first lens, a second lens, and a third lens in order from object side to image side. The first lens is convex at the object side, and has positive refractive power and both surfaces of which are aspherical. The second lens is convex at the image side and has negative refractive power. The third lens has a concave surface at its central portion facing the image side and a convex surface at its peripheral portions facing the image side. The imaging optical system satisfies the conditions of the following Inequalities: 0.8 < L 2 Y < 1 0.5 < fl f < 0.86 where L denotes the distance from the stop to the image focal point, 2Y denotes the diagonal length of the effective image surface, f denotes the overall focal distance of the imaging optical system, and f1 denotes the focal distance of the first lens. |
| US07804650B2 |
Lens sheet for use in backlight, backlight and display device using the same
A lens sheet according to the invention includes a base film, a lenticular lens resin layer, a prism resin layer, and a filling resin layer. The lenticular lens resin layer includes a plurality of cylindrical lenses formed on one surface of the base film and arranged. The prism resin layer includes a plurality of prisms formed on the other surface of the base film and arranged, and has a lower refractive index than the refractive index of the base film. The filling resin layer is filled on a surface of the prism resin layer provided with the arranged prisms and has a higher refractive index than the refractive index of the prism resin layer. Therefore, the lens sheet according to the invention can restrain side lobe light emitted obliquely to the front surface. |
| US07804649B2 |
Microreplicated achromatic lens
A microreplicated achromatic lens is disclosed. The article includes a web including first and second opposed surfaces. The first surface includes a first microreplicated structure having a plurality of first features. The second surface includes a second microreplicated structure having a plurality of second features. Opposing first and second features are registered to within 10 micrometers. Corresponding opposed first and second features cooperate to form an achromatic microlens element. |
| US07804637B2 |
Stable induced alignment of mini mirrors for solar energy concentration and other optical functions
It is becoming increasingly imperative to harness solar energy due to the ever growing shortage of conventional energy sources. The instant invention is concerned with method and apparatus for the stable alignment of mirrors inside transparent micro balls with the plane of the mirror perpendicular to the aligning electric field for solar energy concentration and related applications such as optical switches, etc. Coupling of an applied perpendicular electric field with the induced dipole in a mirrored ball results in an unstable orientation. The instant invention circumvents this problem so that a stable orientation is accomplished, resulting in an increase in the percentage of incident light that is reflected to the receiver. Broadly, this invention deals with novel concepts used for alignment in the focusing of light wherever mirrors are used for focusing such as for solar propulsion assist, illumination and projection of light, optical switching, etc. A particularly important objective is the focusing of sunlight for solar power conversion and production. |
| US07804632B2 |
Display device using 1 dimensional hologram
An image display device using a one-dimensional hologram is disclosed. The image display device includes a light deflection unit which deflects a parallel light ray and adjusts the incident angle of a reconstructing light in sequence, and a one-dimensional hologram optical modulator which reproduces the entire picture by updating each lineal picture in sequence. A one-dimensional hologram is capable of expressing one lineal picture at one time with single axes data. The one-dimensional hologram is updated in synchronization with the incident reproducing light. The input data for a one-dimensional hologram may be computed by an optical calculation method. |
| US07804624B2 |
Image capture device
A device and method for scanning an image of an object are disclosed. The device includes a controlled transparency film (5) and a set of light detectors (80). A backlight (50) may be used for scanning the object. The controlled transparency film is modulated to apply a series of filters on the backlight as it bounces off the object, back toward the detectors. The light detectors are sampled while each filter is being applied. The resultant measurements correspond to coefficients of a two-dimensional image transform. These coefficients may be collected as a bitstream to be inserted into an image file. This allows the image data to be compressed as it is being captured, thereby reducing processor overhead. |
| US07804622B2 |
Image reading apparatus
Disclosed is an image reading apparatus including: an original transporting device for transporting an original; an image reader for reading an image of the original in a first reading region or a second reading region while transporting the original by the original transporting device; and a correcting device for correcting image data read in the second reading region by the image reader so as to give the image data the same white level as image data read in the first reading region based on the ratio of the white level of the second reading region to that of the first reading region. |
| US07804620B2 |
Method and arrangement for generating a dot matrix imprint with control using random output and probability
In a method and arrangement for generation of an imprint with a printing device operating according to a dot matrix principle (in particular an inkjet principle), a dot pattern is provided for the imprint, with which the printing device image points corresponding to the provided dot pattern on a substrate. For at least one first image point a probability with which the image point is generated is provided. Whether this image point is actually generated on the substrate is determined in a decision step using a random generator and the probability. The image point is generated (or not) in a subsequent step dependent on the result of the decision step. |
| US07804619B2 |
Adjustment of print position in print controller
The CD-R print system 10 has a shape identical to the CD-R and the like, and the scale marks are printed on the adjustment medium AM with the base line BL previously printed thereon. The user inputs portions of the scales overlapping with the base line BL to the CD-R print system 10 via the user interface. Then, the CD-R print system 10 determines an amount of misalignment of print position based on the input information. The CD-R print system 10 reflects this amount of misalignment to generate print data. Such CD-R print system 10 enables the print position to be readily adjusted with accuracy without using a rule or the like. |
| US07804618B2 |
Image forming apparatus having removable external memory and its control method
Memory interface means which can be easily removed by a user is included, use of a generally-available general-purpose memory is made possible and increase of the capacity of a memory which can be used by an image forming apparatus, image electronic data stored in a memory in the image forming apparatus, management information for managing the image electronic data, management information in the apparatus such as a telephone book used by facsimile means are can be bidirectionally copied or moved with the external memory in accordance with the user's operation or automatically. |
| US07804615B2 |
Method for limiting bit rate in IP facsimile and method for limiting bit rate in IP facsimile in gateway
A method for limiting bit rate in IP facsimile, in this method the highest bit rate that the called gateway allows is determined, after the call connection is set up, the called fax machine transmits the digital identification containing the highest facsimile bit rate that the called fax machine provides, the called gateway compares the highest facsimile bit rate that the called fax machine provides with the determined highest bit rate that the called gateway allows, then selects the lower and inserts in the frame and transmits to the calling fax machine, the calling fax machine compares the bit rate with the highest bit rate that the calling fax machine itself provides, the lowest will be the highest bit rate at which message is transmitted, then the message is transmitted, confirmed, then the call connection is released. In this method, when the network becomes bad, the highest facsimile bit rate is limited through gateway to improve quality of pictures. A method for achieving limiting bit rate in IP facsimile by a gateway is also proposed in the present invention. |
| US07804613B2 |
Method and system for facilitating paper to electronic communications
A method for a computer system includes receiving a fax from a user comprising a digitized document and a billing telephone number associated with the user, wherein the digitized document includes a digitized transmission page including a digitized recipient e-mail address, and wherein a receiving number over which the fax is received is associated with a pay-per-use service, optically recognizing characters of the recipient e-mail address from the digitized e-mail address, determining an attachment in a format suitable for attachment to an e-mail message from the digitized document, sending an e-mail message comprising an e-mail attachment portion including the attachment, an e-mail TO portion including the recipient e-mail address, and an e-mail body portion including a service provider identifier, and submitting a service charge associated with the pay-per-use service against the billing telephone number. |
| US07804612B2 |
Network printing with driverless clients
A method and mechanism for a client causing an electronic document to be printed without using a printer driver installed on the client is provided. A client discovers one or more printing devices on a network. The client communicates with a discovered printing device to identify the printing features supported by the discovered printing device. When the client receives a request to print an electronic document to a selected printing device, the client sends the electronic document and print configuration data to the selected printing device. As the client has been informed of the printing features supported by the selected printing device, the client can send the electronic document and the print configuration data to the selected printing device in a form readable by the selected printing device. The selected printing device processes the electronic document and the print configuration data to produce a printed copy of the electronic document. |
| US07804604B2 |
In-flight drop location verification system
A system measures a location of a drop delivered by, for example, an ink-jet type applicator. An image of the drop is captured from two directions, resulting in two drop images. Only one image capturing apparatus is needed to capture the drop images. The location in three-dimensional space is determined by using the two images but only one image capturing device. The position or location information can then be used to calibrate a coating apparatus. |
| US07804603B2 |
Measurement apparatus and method
A measurement apparatus disclosed that has a radiation source configured to provide a measurement beam of radiation such that an individually controllable element of an array of individually controllable elements capable of modulating a beam of radiation, is illuminated by the measurement beam and redirects the measurement beam, and a detector arranged to receive the redirected measurement beam and determine the position at which the redirected measurement beam is incident upon the detector, the position at which the redirected measurement beam is incident upon the detector being indicative of a characteristic of the individually controllable element. |
| US07804602B2 |
Apparatus and method for relocating an articulating-arm coordinate measuring machine
A measurement apparatus, system and method for measuring objects which is easily relocatable about the object is described. The system uses an articulated-arm coordinate measuring machine (CMM) and a laser tracker. A retroreflector for use with the laser tracker is located on the arm of the articulated-arm (CMM). A common coordinate frame of reference can be determined for the CMM and the laser tracker so that the CMM can be moved. Also, points hidden from the laser tracker can be measured for example with the CMM. |
| US07804601B2 |
Methods for making holographic reticles for characterizing optical systems
Characterization of an optical system is quickly and easily obtained in a single acquisition step by obtaining image data within a volume of image space. A reticle and image plane are positioned obliquely with respect to each other such that a reticle having a plurality of feature sets thereon, including periodic patterns or gratings, is imaged in a volume of space, including the depth of focus. Metrology tools are used to analyze the detected or recorded image in the volume of space through the depth of focus in a single step or exposure to determine the imaging characteristics of an optical system. Focus, field curvature, astigmatism, spherical, coma, and/or focal plane deviations can be determined. The present invention is particularly applicable to semiconductor manufacturing and photolithographic techniques used therein, and is able to quickly characterize an optical system in a single exposure with dramatically increased data quality and continuous coverage of the full parameter space. In embodiments, the test reticle is holographically generated by interfering two or more beams of optical radiation. The resulting interference pattern is recorded on a reticle and used for testing the optical system. The geometry of the holographic interference pattern is tightly controlled by the properties of the interfering beams and is therefore more accurate than conventional reticle writing techniques. |
| US07804599B2 |
Fluid volume verification system
This invention describes a fluid transfer device which has a fluid handling system and a fluid detection system controlled by a central processing system which allows the device to accurately determine both the verification of fluid dispensed and the liquid level position in the reaction vessel. |
| US07804596B2 |
Overlay key, method of forming the overlay key and method of measuring overlay accuracy using the overlay key
In an overlay key used for measuring overlay accuracy between first and second layers on a substrate, a first mark may be formed in the first layer, and a second mark may be formed on the second layer. The first mark may include first patterns having a first pitch and extending in a first direction. The second mark may include second patterns extending in substantially the same direction as the first direction and having a second pitch substantially equal to the first pitch. First and second images may be acquired from the first and second marks. The overlay accuracy may be produced from position information of first and second interference fringes formed by overlaying a test image having a third pitch onto the first and second images. |
| US07804590B2 |
Multi mode inspection method and apparatus
An inspection system for inspecting an object, the system comprising an illuminator including at least one pulsed light source, a detector assembly, and a relative motion provider operative to provide motion of the object relative to the detector assembly, along an axis of motion, the detector assembly comprising a plurality of 2-dimensional detector units whose active areas are arranged at intervals. |
| US07804588B2 |
Measuring device for optical and spectroscopic examination of a sample
A measuring device for optical and spectroscopic examination of a sample includes a housing, a first light source, a window, an optical spectrometer with a dispersive element and a number of detector elements and which can record light from the first light source which is indirectly reflected by the sample and reenters the housing through the window, an electronic camera whose incidence opening is directed onto the sample, through the window, and an electronic evaluation device which is connected to an image sensor of the camera and to the detector elements. The camera may be assigned a second light source. |
| US07804586B2 |
Method and system for image processing for profiling with uncoded structured light
A 3D scanning apparatus configured to image a physical entity comprises a radiation projector for projecting a plurality of radiation stripes onto the physical entity, a detector for detecting striped radiation received from the physical entity; and a data storage device for storing the received radiation as a pixellated bitmap image, the apparatus characterised in that the physical entity, the radiation projector and the detector are geometrically arranged to constrain the number of times that each received stripe is permitted to occur in a given pixel row of the bitmap, the geometrica) constraint determining a stored occlusion classification comprising a plurality of types of occlusions and the apparatus additionally comprising an occlusion type processing means configured to utilise the classification for detecting the various types of occlusions in said received image data. |
| US07804584B2 |
Integrated circuit manufacturing methods with patterning device position determination
Methods of manufacturing an integrated circuit by a lithographic apparatus are disclosed. The methods include patterning a radiation beam with a patterning device, projecting the patterned beam onto a substrate using a projection system, and determining the position of the patterning device. In one example, the patterning device's position relative to the projection system is determined by measuring the position of the patterning device's support structure. In another example, the position can be determined by measuring a position of the patterning device relative to its support and by measuring a position of the support. In another example, a Z-position of the patterning device is determined by directing at least one beam of radiation onto a part of the patterning device located outside a pattern area. This can be done by directing a pair of laser beams from sensors on the projection system to reflecting strips on the patterning device. |
| US07804582B2 |
Lithographic apparatus, method of calibrating a lithographic apparatus and device manufacturing method
A lithographic apparatus includes a system to compensate for the effect of thermal distortion of the substrate table on position measurements of the substrate table using lateral mirrors in the substrate table. Methods of calibrating a lithographic apparatus using various substrate table scan trajectories and measurements of the localized position and rotation of lateral mirrors in the substrate table are presented. A dual stage lithographic apparatus with alignment marks defining the geometry of a lateral mirror used only at the exposure station to measure the geometry of the lateral mirror when the substrate table is at the measurement station. |
| US07804580B2 |
Immersion exposure apparatus and method of manufacturing a semiconductor device
An immersion exposure apparatus includes a placement unit on which a substrate is to be placed, the substrate including a body to be processed and a resist film on the body, a projection optical system including a projection lens, a liquid supply unit including an immersion nozzle, a measurement unit for measuring positions of alignment marks Mi (i=1, 2, . . . ) on the substrate, and a control unit for controlling a position of the placement unit on which the substrate is placed so that a pattern image of the photo mask is projected onto a predetermined position on the substrate when immersion exposure to the substrate is performed based on a measurement value acquired by the measurement unit and a correction value for correcting a measurement error resulting from a change of a measurement environment caused during measurement of alignment marks Mi. |
| US07804578B2 |
Exposure apparatus and device manufacturing method
An exposure apparatus that exposes a substrate to a pattern of an original. An illumination optical system illuminates the original. A projection optical system projects the pattern that is illuminated by the illumination optical system onto the substrate. A vacuum chamber houses at least one of the illumination optical system and the projection optical system. A heat absorber, arranged in the vacuum chamber, absorbs heat in the vacuum chamber. A heat conductor includes a metal member and connects the heat absorber and a wall of the vacuum chamber. The metal member is softer than the heat absorber and the wall, and fills a space between the heat absorber and the wall, and a cooler, arranged outside the vacuum chamber, cools the wall. |
| US07804577B2 |
Lithographic apparatus
A barrier member is provided for use in immersion lithography. The barrier member includes an extractor assembly on a bottom surface configured to face the substrate. The extractor assembly includes a plate configured to split the space between a liquid removal device and the substrate in two such that a meniscus is formed in an upper channel between the liquid removal device and the plate and below the plate between the plate and the substrate. |
| US07804575B2 |
Lithographic apparatus and device manufacturing method having liquid evaporation control
A lithographic apparatus is described having a liquid supply system configured to at least partly fill a space between a projection system of the lithographic apparatus and a substrate with liquid, a barrier member arranged to substantially contain the liquid within the space, and one or more elements to control and/or compensate for evaporation of liquid from the substrate. |
| US07804573B2 |
Liquid crystal display device, method for fabricating the same, and portable telephone using the same
A liquid crystal display device comprises a liquid crystal display panel and a semiconductor integrated circuit for driving and controlling the liquid crystal display panel. The number of input/output wires connected to I/O terminals (bonding pads) of the semiconductor integrated circuit is reduced so as to simplify wiring patterns of the I/O wires, whereby degrees of freedom in arranging the I/O wiring patterns are enhanced. The panel has a pair of insulating substrate, and the semiconductor integrated circuit is mounted on one of the paired substrates. The semiconductor integrated circuit has a mode terminal which is fixed to a power supply potential or to a reference potential during operation of the integrated circuit, and power supply dummy terminals connected to the power supply potential or reference potential inside the semiconductor integrated circuit. The wiring patterns formed on the paired insulating substrates connect the mode terminal to the power supply dummy terminals. |
| US07804570B2 |
Liquid crystal display device including superposition of pixel electrodes and signal lines
A liquid crystal display device includes an array substrate and an opposing substrate that are disposed face to face at a prescribed interval. The array substrate includes a scan line, signal lines, switching devices disposed at intersections between the scan line and the signal lines, pixel electrodes disposed in a matrix manner and driven by the switching devices and auxiliary capacitance lines for retaining applied voltage for the pixel electrodes. The pixel electrodes have side edges superposed on the signal lines or black matrices formed on the opposing substrate to achieve shielding of light, and the side edges have parts superposed on shield electrodes disposed on the auxiliary capacitance lines to make an amount of superposition between the pixel electrodes and the signal lines or the black matrices in a region corresponding to positions where the shield electrodes are disposed smaller than that in other regions. |
| US07804563B2 |
Substrate for liquid crystal display device, liquid crystal display element, and liquid crystal display device
A substrate for liquid crystal display includes at least: at least two substrates (a glass substrate and a TFT substrate); a liquid crystal layer disposed between the substrates; an ITO film that applies an electric field to the liquid crystal layer; a photospacer that regulates cell thickness (a thickness of a liquid crystal layer) between the substrates; a light-shielding film; and a colored layer, in which at least a part of the photospacer is formed on the light-shielding film or at a portion where the light-shielding film and the colored layer overlap; and the light-shielding film includes at least one of a resin and a precursor thereof and also includes metal particles having a silver-tin alloy portion. |
| US07804561B2 |
Colored composition for color filters, color filter and liquid crystal display device
A cyan-colored composition for a color filter contains a phthalocyanine blue pigment comprising either of C.I. Pigment Blue 15:3 and C.I. Pigment Blue 15:4, or both, a phthalocyanine green pigment comprising C.I. Pigment Green 7, and a pigment carrier consisting of a transparent resin, a precursor of the resin or a mixture thereof. A color filter includes a red-colored filter segment, a green-colored filter segment, a blue-colored filter segment, and a cyan-colored filter segment or a yellow-colored filter segment. |
| US07804560B2 |
Display device
An object of the invention is to provide a display device having a high contrast ratio by a simple and easy method. Another object of the invention is to manufacture such a high-performance display device at low cost. In a display device having a display element between a pair of light-transmissive substrates, polarizing plates each having an extinction coefficient of an absorption axis which is different from that of an absorption axis of another polarizing plate are stacked to be provided. At that time, the stacked polarizing plates are arranged so as to be in a parallel nicol state. A wave plate and a retardation film may be provided between the stacked polarizing plates and the substrates. |
| US07804556B2 |
Backlight unit and liquid crystal display device having the same
Disclosed are a backlight unit and a liquid crystal display device having the same, capable of reducing tube current variation between light sources. The backlight unit includes a plurality of lamps provided at both ends thereof with electrodes and having a tubular shape, a plurality of lamp holders for fixing the both ends of the lamps, at least one substrate on which the lamp holders are mounted, and at least two conductors formed on the substrate in opposition to each other to generate capacitance for uniformly maintaining tube current of the lamps. |
| US07804548B2 |
Electro-optical device, method of driving the same, and electronic apparatus
An electro-optical device includes: a plurality of scanning lines; a plurality of data lines which are divided into blocks each composed of m data lines (m is an integer equal to or larger than 2); pixels which are provided at intersections of the plurality of scanning lines and the plurality of data lines and each of which emits light at a gray-scale level designated by a data signal sampled to the data line when the scanning line is selected; a scanning line driving circuit which selects at least one of the scanning lines in a horizontal scanning period; a sampling signal output circuit which outputs sampling signals for sequentially selecting the blocks in the horizontal scanning period; a rotation circuit which inputs the data signals to m pixels corresponding to the selected scanning line and the data lines belonging to the selected block and distributes the input data signals corresponding to the m pixels to m image signal lines according to a correspondence prescribed by one or more predetermined control signals; and sampling switches each of which is provided to the data line and samples the data signals distributed to the m image signal lines to the m data lines belonging to one block on the basis of the sampling signal. |
| US07804547B2 |
Liquid crystal display device
A liquid crystal display device includes a liquid crystal display panel, a backlight which illuminates the liquid crystal display panel, and a display control circuit which controls the liquid crystal display panel and the illumination light source. The display control circuit includes a panel driving section which drives the liquid crystal display panel after supply of power, a state detecting section which detects a display driving state that the panel driving section drives the liquid crystal display panel for display of a stable image corresponding to a video signal, and a light source driving section which drives the backlight in accordance with an illumination request signal, after detection of the display driving state by the state detecting section. |
| US07804546B2 |
Antenna system and television receiver
An antenna system including an antenna capable of responding to a horizontally-polarized-wave and a vertically-polarized-wave and receives digital television broadcasting signals. The system further includes: a memory section to store an outdoor reception program and an indoor reception program; an acquisition section to configure in the antenna a horizontally-polarized-wave reception mode or a vertically-polarized-wave reception mode, and to acquire reception information of the television broadcasting signals; a determination section to determine whether the antenna is installed outdoors or indoors; a configuration section to control the outdoor reception program stored in the memory section when the determination section determines that the antenna is installed outdoors, and the indoor reception program stored in the memory section when the determination section determines that the antenna is installed indoors; and a control section to control the reception of the television broadcasting signals by the antenna system through the program configured. |
| US07804545B2 |
Switched input video device
A switched input video device has a switched input, video improvement circuitry and/or transcoder circuitry, and a switch for communicating a switched input to at least one of the video improvement circuitry and the transcoder circuitry. |
| US07804541B2 |
Image pickup apparatus
An image pickup apparatus of the present invention includes a main body 1 incorporating an image pickup element, an operation part that is placed on the main body 1 and can be operated by a user, and a seventh surface 107 provided on the main body 1, on which, when the user takes a picture while holding the main body 1, the thumb of the hand holding the main body 1 can be left in a stand-by state. The operation part includes rotation operation parts that are placed in the vicinity of the seventh surface 107 and are rotatable, and the rotation operation parts are arranged so that at least a part of the same faces the seventh surface 107. With this, a movement amount of the fingers of the user is reduced, whereby the operability is improved. |
| US07804539B2 |
Solid-state imaging device and method of driving same
A method of driving a solid-state imaging device is provided. The solid-state imaging device includes: a semiconductor substrate; a plurality of photoelectric converting elements arranged in a two-dimensional array on a light-receiving surface of the semiconductor substrate; and a charge transfer path disposed along each of columns of photoelectric converting elements, the charge transfer path reading out charges detected at each of photoelectric converting elements in a column of the photoelectric converting elements and transferring the charges, the photoelectric converting elements in the column thereof comprising two groups, each containing every other photoelectric converting element. Charges are read out from the two groups into the charge transfer path at a time difference between the two groups. |
| US07804534B2 |
Solid-state imaging device, driving method thereof, and imaging apparatus
A solid-state imaging device comprises: a semiconductor substrate; a plurality of photoelectric conversion elements formed in a surface portion of the semiconductor substrate in the form of a two-dimensional array so as to comprise a plurality of sets, each comprising a subset of the photoelectric conversion elements arranged in one direction; charge transfer paths each formed at a side portion of the subset of the photoelectric conversion elements to cause a signal charge of the photoelectric conversion elements be read out when a readout pulse is applied and cause the signal charge which has been read out to be transferred when a transfer pulse is applied; and an electrically conductive light shielding film which is laminated on a surface of the semiconductor substrate through an insulating layer and has openings immediately above each of the photoelectric conversion elements. |
| US07804532B2 |
Noise reducing device, electronic camera, and image processing program for reducing image noise by using blackout image
A noise reducing device captures image data obtained by capturing a field with an image capturing part and a plurality of blackout image data obtained by capturing the field with the image capturing part under a light shielded state. This device reduces non-correlative random noise in the plural blackout image data. With random noise reduced, fixed pattern noise appears more accurately in resultant as blackout image data B. This device reduces the fixed pattern noise in the image data by using this blackout image data B. |
| US07804522B2 |
Image analysis for smoke detection
A smoke detection method for identifying, in a current input image, an area indicative of the presence of smoke, there being a sequence of two or more input images, the method comprising the steps of: storing a background estimation for a current input image; and comparing the current input image with the background estimation to detect a partial obscuring of the background estimation indicative of the presence of smoke in the current input image. |
| US07804521B2 |
Image manipulation camera
A handheld camera comprising a sensor adapted to sense an image, a camera manager for controlling the sensing of the image, an image processing manager for manipulating the image, a print manager for controlling printing of the manipulated image, and a guillotine adapted to cut a print media on which the manipulated image is printed from a print roll. The print manager is operable to activate the guillotine upon receipt of a signal indicative of a manual attempt to pull the print media from the camera. |
| US07804519B2 |
Method of refining a plurality of tracks
One embodiment of a method of refining a plurality of primary tracks of a plurality of targets can be broadly summarized by the following steps: receiving a plurality of primary tracks, wherein each primary track includes ordered sequences of observation events having similarities in their visual signatures; dividing the primary tracks into separate refinement packages; allocating the refinement packages to different ones of a plurality of processors; and receiving one or more refined tracks from the plurality of processors. Other methods and systems are also provided. |
| US07804513B2 |
Optical writing unit, image forming apparatus, process cartridge, and method of adjusting light intensity
An optical writing unit includes a light-emitting-element array in which a plurality of light emitting elements is arranged and an optical system that guides light flux emitted from the light emitting elements as a light spot. A result of comparison of a property value of the light emitting elements at a predetermined threshold in an exposure intensity distribution of the light emitting elements is within a preset range over an entire effective image area. An emission condition of the light emitting elements is set such that a fluctuation of amounts of exposure of the light emitting elements or a result of comparison of the amounts of exposure does not exceed a preset range over the entire effective image area. |
| US07804512B2 |
Method and apparatus for producing an image
A method of producing an image that can eliminate an fθ lens is provided. This method of producing an image includes producing the image from a plurality of dots with varying intervals that are to be formed by linearly scanning an image forming surface with light that has been modulated using image data for producing by a polygon mirror that rotates at a constant angular velocity, and generating, before the producing the image, the image data for producing to form the image with the plurality of dots with varying intervals from original image data that forms a target output image with a plurality of dots with constant intervals. The step of generating the image data for producing includes setting a state of a first dot included in the plurality of dots with varying intervals at a state of a second dot that is included in the plurality of dots with constant intervals obtained from the original data and is at a position that is close to a position of the first dot. |
| US07804508B2 |
Viewing digital images on a display using a virtual loupe
A method and apparatus for viewing digital images is provided. A digital image may be viewed using a digital image system that employs a virtual loupe. A virtual loupe comprises a lens region and a target region. The lens region and the target region may each be a bounded area displayed on a display. A user may position the target region over a digital image displayed on the display to cause a depiction of visual information associated with the target region to be displayed in the lens region. The user can configure the virtual loupe to display visual information in the lens region at different levels of magnification. The lens may automatically move and change in orientation with respect to the target region as the target region moves on the display to ensure that the display of the lens region on the display is always unobscured. |
| US07804507B2 |
Face-mounted display apparatus for mixed reality environment
A display apparatus for a mixed reality environment includes an image processor for mixing an actual image of an object around a user and a artificial stereo images to produce multiple external image signals, a user information extractor for extracting the user's sight line information including the user's position his/her eye position, direction of a sight line and focal distance; an image creator for creating a stereo image signal based on the extracted user's sight line information; an image mixer for synchronously mixing the multiple external image signals and the stereo image signal; and an image output unit for outputting the mixed image signal to the user. |
| US07804504B1 |
Managing yield for a parallel processing integrated circuit
A method for manufacturing an integrated circuit is described. The integrated circuit comprises a plurality of tiles, each tile comprising a processor and a switch coupled to neighboring tiles to form a network of tiles. The method includes identifying at least one tile that includes a fault, and forming data paths through one or more tiles to preserve communication in the network. |
| US07804502B2 |
Method of causing first object to take motion according to positional relationship with second object
When a direction is input through a direction indicating switch of an operation switch unit, a player character of a game, such as, but not limited to, for example a basketball game, moves in the inputted direction while dribbling a ball. When a direction directed toward the position of the ball from the position of the player character matches with the inputted direction, the moving speed of the player character becomes V. When the direction directed toward the position of the ball from the position of the player character does not match with the input direction, the moving speed of the player character becomes Vcos(θ/2) where θ is an angle defined by the direction directed toward the position of the ball from the position of the player character and the inputted direction. |
| US07804501B2 |
Object loading and unloading system
An object loading and unloading system for loading and unloading objects in a graphically simulated virtual environment, or virtual world, is described. A world object manager manages multiple object loaders to load and unload objects as geographic cells move within and out of a loading radius of each loader based on a position of a camera or view within the virtual world. Each object loader has an associated priority level, and the world object manager notifies a loader to load its corresponding objects in a cell only after all loaders having higher priority levels, which also have that cell in their respective loading radii, have already loaded their corresponding objects in that cell. The world object manager may expose various programming interfaces to provide an extensible object loading system whereby third parties can define new loaders to be incorporated into the hierarchical spatial object loading system. |
| US07804495B2 |
User interface system, user interface apparatus, and method of controlling electronic device
The present invention provides a user interface apparatus capable of determining both control content and a control amount without increasing the number of buttons.A remote controller RC is provided with a ring pad 121 as a ring-shaped operating element. The total range of the ring pad 121 is divided into a predetermined number of regions, and control content and a region number are defined for each of the regions. In the case of controlling a DVD/HD recorder DHR by using the remote controller RC, control content is specified on the basis of a region in the ring pad 121 touched by the user for the first time. In the case where the user performs an input operation of continuously tracing the ring pad 121, a control of a control amount according to the number of regions traced by the operation is performed. |
| US07804490B2 |
Method for multiple gesture detection and verification on a touchpad
In a gesture detection method for a touchpad, various gestures such as tap, drag and double tap are determined by operating an object to touch on the touchpad, leave from the touchpad, and move on the touchpad. |
| US07804485B2 |
Hand held control device with dual mode joystick for pointing and scrolling
Control device (computer mouse) for moving a visual pointer on a display constituting part of a user interface for computer equipment. The control device is designed to be used hand held free of support from any surface, as the movement of the pointer in two dimensions takes place by means of a guide pin, a so-called joy-stick. The guide pin preferably has a double function so that it may also be used for scrolling the display. The control device may include an attachment for the user's hand or wrist, and may be integrated with a telephone receiver or with a remote control for a television set or the like. |
| US07804476B2 |
Active matrix display device
A display device comprising an array of pixels, with gates of thin film transistors of the pixels in a row connected to a row conductor. Row driver circuitry provides row address signals for controlling the switching of the transistors of the pixels of the row including an ON gate voltage and an OFF gate voltage. Control circuitry shifts the ON gate voltage and the OFF gate voltage in dependence on drive and/or environmental conditions such as temperature and/or refresh rate. The control circuitry maintains a constant difference between the ON gate voltage and the OFF gate voltage. This allows the gap between the on and off voltages to be reduced, which results in power savings. The kickback voltage is kept constant so that kickback compensation is kept simple. |
| US07804475B2 |
Systems for displaying images utilizing two clock signals
Systems for displaying images are provided. In this regard, a representative system incorporates a signal driving circuit that includes a plurality of PMOS shift registers connected in series and controlled only by a first clock signal and a second clock signal, wherein the PMOS shift registers are operative to output corresponding driving pulses in turn after receiving a start pulse. |
| US07804474B2 |
Overdriving circuit and method for source drivers
The present invention provides an overdriving circuit for source drivers to overdrive a LCD module. The overdriving circuit includes a first threshold detection logic unit, a second threshold detection logic unit, and a selection logic unit. The first threshold detection logic unit receives gray scale data from an overdriving timing controller, compares the gray scale data to a first predetermined gray scale value, and outputs a first control signal. The second threshold detection logic unit receives the gray scale data, compare the gray scale data to a second and a third predetermined gray scale values, and outputs a second control signal. The selection logic unit receives the gray scale data, receives a plurality of gray scale compensation data, and outputs one of the received data according to the first control signal, the second control signal and a third control signal. |
| US07804473B2 |
LCD panel drive adopting time-division and inversion drive
A method of operating a liquid crystal display device includes: (A) time-divisionally driving pixels in a certain line of an LCD panel so that pixels adjacent in a horizontal direction are driven with data signals of opposite polarities. The (A) step includes: (A1) generating a first data signal of a first polarity on a first output terminal of a driver, and then driving a first pixel out of said pixels in the certain line through electrically connecting the first output terminal to the first pixel; and (A2) generating a second data signal of the first polarity on the first output terminal and then driving a second pixel out of said pixels in the certain line through electrically connecting the first output terminal to the second pixel, in succession to the drive of the first pixel. |
| US07804468B2 |
Data driver system and method, for use with a display device, having improved performance characteristics
A data driver and a method of driving the same. The data driver includes a shift register for generating sampling signals; sampling latches for sampling digital data applied to output channels, respectively, in accordance with the sampling signals; holding latch units for receiving the sampled digital data of the channels from the sampling latches to hold the digital data for a first period; first digital-to-analog converters for receiving the held digital data of the channels from the holding latch units to generate currents corresponding to the digital data; a second digital-to-analog converter commonly connected to the channels and the first digital-to-analog converters to receive the digital data provided from the holding latch units for a second period and to generate correction currents for the data currents; and output stages for sampling, correcting, and driving final currents using the data currents and the correction currents. |
| US07804467B2 |
Display device and electronic equipment using the same
In an active matrix EL display device, pixels which are suitable for a constant current drive are structured. The pixel includes a first switch which has one end connected to a source signal line and the other end connected to a current-voltage conversion element, a second switch which has one end connected to the current-voltage conversion element and the other end connected to a voltage holding capacitor and to a voltage-current conversion element, and a pixel electrode connected to the current-voltage conversion element and to the voltage-current conversion element. |
| US07804456B2 |
Ultra wideband loop antenna
The wideband L-loop antenna is presented in this invention. It has excellent performance for lower band of UWB system and has the attractive features of small size, inexpensive, and easy to design. The antenna composed of a single metallic layer is printed on the top of a substrate and a coupled tapered transmission line is printed on the top of the same substrate. A L shape portion is formed by widening partially or wholly the width of a part of antenna elements in comparison with the other part. |
| US07804453B2 |
Antennas for wireless electronic devices
Antenna window structures and antennas are provided for electronic devices. The electronic devices may be laptop computers or other devices that have conductive housings. Antenna windows can be formed from dielectric members. The dielectric members can have elastomeric properties. An antenna may be mounted inside a conductive housing beneath a dielectric member. The antenna can be formed from a parallel plate waveguide structure. The parallel plate waveguide structure may have a ground plate and a radiator plate and may have dielectric material between the ground and radiator plates. The ground plate can have a primary ground plate portion and a ground strip. The ground strip may reflect radio-frequency signals so that they travel through the dielectric member. The antenna may handle radio-frequency antenna signals in one or more communications bands. The radio-frequency antenna signals pass through the dielectric member. |
| US07804452B2 |
Safety mast
The safety mast and the double safety mast both distance the transmitter from its controls and operator thus reducing radiation to both. The transmitter must be separated from its controls prior to installation. |
| US07804448B2 |
Portable, iterative geolocation of RF emitters
Iterative geolocation of a stationary RF emitter through the use of TDOA may include the use of a single portable geolocation (e.g., TDOA) sensor, a pair of portable geolocation sensors and three of more portable geolocation sensors. Adding portable geolocation sensors to the iterative process reduces the constraints on the signals to be located as well as providing a reduction in the number of iterations required to obtain improved location accuracy. |
| US07804447B2 |
Method for determining positions of contacts
A method for determining the positions of contacts through a global positioning system (GPS) is disclosed. The method includes sending position requests to the contacts, feeding back the current position information of the contacts to a GPS receiver of a user after receiving position requests, searching the contacts located within a same geographical region as the user according to the feedback information and displaying a list of the contacts to the user in the same geographical region. |
| US07804445B1 |
Method and apparatus for determination of range and direction for a multiple tone phased array radar in a multipath environment
A system and method combine multiple data streams in an efficient and optimal manner, based on new techniques, to determine range, relative angle and velocity with respect to a point of reference. Embodiments of the present invention take advantage of the multiple data streams to provide improved performance when the data is contaminated with environmental and system noise. Embodiments of the present invention may be applied to data output from different target estimation systems, including radar, sonar, ultrasonic and laser systems. In addition, embodiments of the present invention may be implemented in systems with multiple tones and multiple antennas, and generally work in multipath environments. |
| US07804438B2 |
Image sensors and dual ramp analog-to-digital converters and methods
Dual ramp analog-to-digital converters and methods allow for performing analog-to-digital conversion of an analog signal. Various dual ramp analog-to-digital converters and methods allow for applying the analog signal and a coarse ramp to a same input of a comparator, and applying a fine ramp to another input of the comparator. Some dual ramp analog-to-digital converters and methods allow for applying the analog signal, a coarse ramp, and a fine ramp to a same input of a comparator. Various dual ramp analog-to-digital converters and methods allow for applying the analog signal to an input of a first comparator, applying a coarse ramp to the input of the first comparator through a coarse ramp switch, applying the analog signal to an input of a second comparator, and applying a fine ramp to another input of the second comparator. |
| US07804430B2 |
Methods and apparatus for processing variable length coded data
An apparatus for processing variable length coded data includes a coefficient buffer unit and several lookup tables. The coefficient buffer unit includes a coefficient memory and an index register for storing an indication of a non-zero nature of coefficients stored in the coefficient memory. Advantageously, the lookup tables may be altered to adapt the apparatus for processing variable length coded data to handle encoding or decoding video adhering to a specific standard. Furthermore, the lookup tables may be adapted to accelerate the determination of the presence of escape codes and the subsequent handling of the escape codes. |
| US07804429B2 |
Multiple stream multiple rate resampling
A method of resampling a digital signal involves serially receiving a plurality of samples of said digital signal and applying a plurality of filter coefficients to a first subset of the plurality of samples to generate a first plurality of intermediate results and to a second subset of the samples to generate a second plurality of intermediate results. The first plurality of intermediate results is accumulated to generate a first resampled value, and the second plurality of intermediate results is accumulated to generate a second resampled value. Upon receipt, each signal sample may be used to update each of a plurality of running accumulation values and then discarded before receipt of a next signal sample. Furthermore, multiple signals may be resampled concurrently using a single filter path by multiplexing circuit components, such as memory blocks. |
| US07804428B2 |
System and method for compressing a stream of integer-valued data
A method and system are provided to minimize the size and complexity of bitstreams associated with encoded data by using a new compression scheme. An entropy encoder receives a list of run/data value pairs and entropy encodes separately the runs and data values, selecting their codewords according to length and magnitude, respectively, and catenates the resulting codeword pairs—run codeword first—in an encoded bitstream. |
| US07804423B2 |
Real time traffic aide
A system and method for providing real-time traffic information using a wireless vehicle-to-vehicle communications network. A vehicle includes a plurality of sensors that detect other vehicles around the vehicle. The wireless communications system on the vehicle uses the sensor signals to calculate a traffic condition index that identifies traffic information around the vehicle. The vehicle broadcasts the traffic condition index to other vehicles and/or road side infrastructure units that can present the information to the vehicle driver, such as in a navigation system, and/or rebroadcast the traffic information to other vehicles. The traffic condition index can be calculated using the speed of the surrounding vehicles, posted speed limits, the distance between the surrounding vehicles and the traffic density of the surrounding vehicles. |
| US07804418B2 |
Vehicle light assembly and manufacturing method
A lens for a vehicle light assembly includes at least one ink marking provided thereon. At least a portion of the ink marking is configured such that it appears generally opaque to a viewer when a light source in the light assembly is not illuminated and does not appear opaque when the light source is illuminated. The ink marking includes an ink composition that includes a transparent ink and a pigmented ink. |
| US07804417B2 |
Interactive lighting system
A lighting system and method for providing a particular lighting pattern from a predetermined set of lighting patterns are disclosed. The system comprises a presence detector for detecting a presence of a person in an area, a timer for measuring a duration of the presence, a pattern selector for selecting the particular lighting pattern from the predetermined set of lighting patterns based on the presence and the duration, and a plurality of adjustable light sources for applying the particular lighting pattern. |
| US07804414B2 |
Collision-detecting device for automotive vehicle
A device for detecting a collision of a vehicle with an obstacle includes an enclosed space positioned behind a front bumper cover. Deformation or displacement of the bumper cover due to a collision is transmitted to the enclosed space. Air pressure in the enclosed space and its temperature are measured by sensors and electrical signals representing the pressure and the temperature are fed to an electronic control unit that determines whether the enclosed space is hermetically closed or not based on the pressure and the temperature of the air in the enclosed space. If the enclosed space becomes non-hermetical due to a collision impact, the air therein leaks and the pressure therein becomes atmospheric pressure irrespective of the temperature of the air in the enclosed space. Therefore, the hermetical condition of the enclosed space is surely detected. |
| US07804412B2 |
Remote tracking and communication device
A remote tracking and communication device comprising a housing which encloses a processor, a memory, a position locator, a first transmitter, and a second transmitter. Each of the latter components are electronically coupled to the processor. Both the first and second transmitters are adapted to send and receive wireless voice and data signals in a digital format. The device further comprises a first battery, which is removably affixed to the housing and electronically coupled to each component within the housing, a speaker and a microphone electronically coupled to the first transmitter, and a button electronically coupled to the processor. When pressed, the button is adapted to activate voice communications with a call center using the first transmitter. |
| US07804411B2 |
Combination EAS and RFID label or tag using a hybrid RFID antenna
A security tag includes an EAS component having a defined surface area, and an RFID component having a defined surface area. The EAS component surface area is configured to at least partially overlap the RFID component surface area. The RFID component includes an antenna which at least partially overlaps the first surface. A substantially planar spacer having a thickness is at least partially disposed between the defined surface areas of the EAS and RFID components. The RFID element read range is affected and controlled by the spacing between the RFID element and the EAS element. The RFID reader is capable of activating the RFID component when the RFID component is within the read range. The antenna includes a magnetic loop antenna in electrical contact with a spiral antenna to increase near field read response. |
| US07804409B2 |
RF controlled devices to increase compliance with handwashing protocols
A system for monitoring compliance with handwashing protocols by a plurality of workers, each worker carrying a wireless tag having a worker identifier, the monitoring being performed in a facility having a plurality of areas, the system comprising a plurality of wireless tag reader/transmitters each having an area identifier, at least one wireless tag reader/transmitter being positioned in each of the areas and each wireless tag reader/transmitter being capable of reading the worker identifier stored in the wireless tag when the worker is within range of the wireless tag reader/transmitter and further capable of transmitting the worker and area identifiers to at least one computing device; and at least one of said wireless tag reader/transmitters being disposed at a handwashing station; wherein the at least one wireless tag reader/transmitter reads the worker identifier when the worker manipulates a device at the handwashing station dispensing a washing substance and transmits the worker and area identifiers to the at least one computing device. |
| US07804408B2 |
Electronic tag housing having shrink wrap support
The present invention provides for an electronic tag housing used to support electronic tags to an article with a shrink wrap tube. The present invention provides an electronic tag assembly, including a housing, having a base and a cover attachable to the base. The housing includes a cavity for supporting an electronic tag. A heat shrinkable tube is supported by the housing between the cover and attachable base. |
| US07804406B2 |
Quality control system of concrete and cement products using wireless IC tag
A quality control system of concrete and cement products is provided in which the manufacturing information on cement products of mortar or concrete can be checked at any time, the reliability is such that there is no possibility of the recorded information being lost or falsified, there is no possibility of damage in concrete, and the directivity of the sensitivity of an antenna can be broadened. |
| US07804403B2 |
Security system control module
A security system control module with a portable housing including a wireless receiver, control circuitry, nonvolatile memory, and a data connector. The receiver receives data transmissions from at least one wireless security device that monitors a condition of a premises in which the wireless security device is installed. The data connector exchanges data between the control circuitry and an external host device, and it also accepts from the external host device primary operating power for operating the wireless receiver, the control circuitry, and the nonvolatile memory. The control circuitry is adapted to process signals in accordance with a preprogrammed configuration file stored in the nonvolatile memory, the signals received via the wireless receiver from a wireless security device, and to communicate with an external computer located remotely from the external host device via the data connector using a first communications protocol. |
| US07804402B2 |
Fire detectors with environmental data input
Regional physical information can be entered along with automatically sensed ambient condition information into regional monitoring system. Alarm decision processing can be adjusted in accordance therewith. |
| US07804401B2 |
Apparatus and method for recognizing surrounding state
An apparatus and method of recognizing a surrounding state are provided. The apparatus for recognizing a surrounding state includes: a unique information obtaining unit which obtains, from a peripheral device, unique information of the peripheral device; and a surrounding state determining unit which determines a surrounding state, based on the unique information. |
| US07804398B2 |
Valve-integrated transponder
A valve-integrated transponder includes an air valve and a casing that are integrated with each other, and is disposed within a tire. The casing houses a substrate having a detecting element mounted thereon, an inverse F antenna element, and a supporting member. The antenna element has a substantially line symmetrical shape where a pair of radiation conductors extend away from each other. A longitudinal direction of the substrate is substantially perpendicular to an axial direction of the air valve, and a lateral direction of the substrate is inclined relative to a well of a wheel rim. The two radiation conductors of the antenna element disposed on the substrate are inclined at a predetermined angle with respect to the substrate, so as to be disposed substantially in parallel to the well that extends at the inner side of the transponder as viewed in the radial direction of the tire. |
| US07804395B2 |
Mobile radio communication system
A mobile radio communication system estimates the positional relationship between an own moving terminal and another moving terminal around a view obstruction. If the absolute value of the difference between detected reception power levels is lower than a first power threshold value, the own moving terminal determines that the other moving terminal is positioned within the visual range of the own moving terminal, the distance from the own moving terminal to the other moving terminal being shorter than a predetermined distance BP, or that the other moving terminal is positioned outside thereof, the distance to the visual range of the own moving terminal being shorter than the predetermined distance BP. Also if the absolute value is higher than or equal to the first power threshold value, the own moving terminal determines in a similar manner. |
| US07804387B2 |
System and method for manufacturing field emission structures using a ferromagnetic material
An improved field emission system and method is provided that involves field emission structures having electric or magnetic field sources. The magnitudes, polarities, and positions of the magnetic or electric field sources are configured to have desirable correlation properties, which may be in accordance with a code. The correlation properties correspond to a desired spatial force function where spatial forces between field emission structures correspond to relative alignment, separation distance, and the spatial force function. |
| US07804384B2 |
Acoustic wave filter device utilizing filters having different acoustic wave propagation directions
An acoustic wave filter device having a balanced-to-unbalanced conversion function, in which the signal balance between a pair of balanced terminals is improved, has, on a piezoelectric substrate, one end of at least one longitudinally coupled resonator type acoustic wave filter and one end of at least one second longitudinally coupled resonator type acoustic wave filter among the rest of acoustic wave filters are commonly connected and connected to an unbalanced terminal, and the other ends of the longitudinally coupled resonator type acoustic wave filters are electrically connected to first and second balanced terminals, respectively, and in which a propagation direction of an acoustic wave in the longitudinally coupled resonator type acoustic wave filter and a propagation direction of an acoustic wave in the second longitudinally coupled resonator type acoustic filter are different from each other. |
| US07804383B2 |
Coupled lamb wave resonators filter
A coupled Lamb wave resonator filter includes first and second Lamb wave resonators. The first Lamb wave resonator includes a first resonant layer, and first and second electrodes on opposite sides of the first resonant layer. The second Lamb wave resonator includes a second resonant layer, and third and fourth electrodes on opposite sides of the second resonant layer. One of the sides of the first resonant layer belongs to a plane parallel to a plane corresponding to one of the sides of the second resonant layer. Both planes pass through the third and fourth electrodes of the second Lamb wave resonator. A periodic lattice acoustically couples the first and second resonant layers. |
| US07804380B2 |
Acoustic wave duplexer
An acoustic wave duplexer has a satisfactory isolation characteristic between a reception acoustic wave filter chip and a transmission acoustic wave filter chip, and includes a reception surface acoustic wave filter chip and a transmission surface acoustic wave filter chip mounted on a substrate. The substrate includes first and second balanced terminals and a common terminal. At least one of the transmission surface acoustic wave filter chip and the reception surface acoustic wave filter chip is a balanced filter unit that includes, as an input terminal or an output terminal, a first balanced signal terminal and a second balanced signal terminal. The acoustic wave duplexer further includes a first interconnection arranged to connect the balanced filter unit and the first balanced terminal and a second interconnection arranged to connect the balanced filter unit and the second balanced terminal. The first and second interconnections intersect with each other while being insulated from each other. |
| US07804379B2 |
Pulse width modulation dead time compensation method and apparatus
Dead time compensated complementary pulse width modulation (PWM) signals are derived from a PWM generator by first applying time period compensation to the PWM generator signal based upon the direction of current flow in an inductive load being controlled by the PWM generator. Dead time is then applied to the compensated PWM generator signal for producing complementary dead time compensated PWM signals for controlling power switching circuits driving the inductive load. |
| US07804378B2 |
Method and apparatus for pulse width modulation
There is described a method and an apparatus for pulse width modulation with a predefined switching period having an adjustable ratio of the switch-on duration to the switch-off duration, in which a quantized signal is converted into a pulse-width-modulated signal and is generated in the form of a discrete pulse sequence of switch-on operations and switch-off operations with the predefined switching period, the switching edge for the switch-on duration and/or the switch-off duration being determined on the basis of the ratio of the switch-on duration to the switch-off duration. |
| US07804376B2 |
Continuous phase modulation processing for wireless networks
Various example embodiments are disclosed herein. According to an example embodiment, a method may include receiving a plurality of data symbols, generating a continuous phase modulated waveform based on the data symbols, generating a plurality of coefficients which represent the continuous phase modulated waveform, and wirelessly transmitting the plurality of coefficients via a plurality of subcarriers. |
| US07804375B2 |
Modulation circuit
A modulation circuit is provided that generates an output signal obtained by modulating an input signal with a local signal and includes a local input section that receives the local signal and generates the local signal and an inverted local signal obtained by inverting the local signal, a signal input section that receives the input signal and generates the input signal and an inverted input signal obtained by inverting the input signal, a first multiplying section that outputs from a terminal that receives the input signal a first multiplied signal obtained by multiplying the local signal with the input signal, a second multiplying section that outputs from a terminal that receives the inverted input signal a second multiplied signal obtained by multiplying the inverted local signal with the inverted input signal, an output section that adds the first multiplied signal to the second multiplied signal and generates the output signal, and a transmission line that sends to the output section the first multiplied signal output by the first multiplying section and the second multiplied signal output by the second multiplying section and has an electrical length according to a predetermined frequency as the frequency of the input signal. |
| US07804374B1 |
Feedthrough capacitance compensation for resonant devices
A device has a resonator coupled to input and output nodes, the resonator being characterized by a transducer to drive the output node, and further characterized by a feedthrough capacitance such that portions of the input signal bypass the transducer to allow a spurious signal to reach the output node. The device includes a compensation capacitor coupled to the output node to define a compensation capacitance in accordance with the feedthrough capacitance. A phase inversion circuit is coupled to the compensation capacitance to generate a compensation signal and coupled to the output node such that the spurious signal is offset by the compensation signal. In some cases, a differential amplifier of the phase inversion circuit has the compensation capacitance in a feedback path to offset the feedthrough capacitance. In these and other cases, the compensation capacitance and the feedthrough capacitance may be unmatched to avoid overcompensation. |
| US07804373B2 |
Method of fabricating hermetic terminal and hermetic terminal, method of fabricating piezoelectric oscillator and piezoelectric oscillator, oscillator, electronic appliance, and radio clock
A method of fabricating a hermetic terminal includes: joining and firing wherein a bar-shaped member to be a lead is inserted into a ring, and they are fired to form a hermetic terminal intermediate having the bar-shaped member fixed in the ring; flattening wherein an end part of the bar-shaped member to be the inner lead portion of the lead is flattened to form a stair portion; and shaping wherein an end part of the stair portion is cut to shape the stair portion into a predetermined shape, wherein in the joining and firing step, a solid round bar longer than the lead is used as the bar-shaped member, and one end side of the bar-shaped member to be the inner lead portion is inserted into the ring so that the one end side is longer than the inner lead portion in the hermetic terminal as a completed product. |
| US07804370B2 |
Frequency generator
There is provided a feedback circuit including: an oscillator generating an oscillation frequency signal; a mixer unit having an input terminal, a feedback terminal, and an output terminal and outputting a frequency signal through the output terminal, the frequency signal obtained by adding or subtracting frequency of a feedback signal, input through the feedback terminal, to or from frequency of the oscillation frequency signal input through the input terminal from the oscillator; a first frequency divider dividing the frequency signal output from the mixer unit at a division ratio of N (N is a multiple of 2) to generate an output signal; and a feedback circuit adjusting the output signal of the first frequency divider for the first frequency divider to output a frequency signal in a desired band and feeding back the adjusted signal to the feedback terminal of the mixer unit. |
| US07804369B2 |
Integrated frequency calibration architecture
In an exemplary embodiment, a free running VCO has two modes: a normal operating mode and a calibration mode. In the calibration mode, the free running VCO is phase lock looped with itself instead of a calibration VCO. Furthermore, in an exemplary embodiment, a tuning voltage for the free running VCO is adjusted to offset any tuning error. In addition, in various embodiments a reference crystal oscillator used in the phase lock loop is located on a DSP module instead of on the RF module. In yet another exemplary embodiment, the free running VCO is the only high frequency VCO on a radio frequency module. |
| US07804365B2 |
Multilayer amplifier module
An amplifier module includes an integrated circuit device including a first amplifier circuit electrically connected to a first input terminal. The amplifier circuit includes a number of x first amplifier branches electrically connected to the first input terminal. The amplifier module also includes a number y of first output terminals each assigned to a respective TX frequency band, a first switching unit that electrically connects one or more of the first amplifier branches to one of the first output terminals, and a multilayer substrate, on top of which the integrated circuit device and the switching unit are mounted. The substrate includes integrated passive matching elements that are part of matching circuits where x≧1 and y≧2. Each of the first amplifier branches is adapted to deliver a different power level at its output and is matched to a load at the first output terminals by one of the matching circuits. |
| US07804363B2 |
Open loop DC control for a transimpedance feedback amplifier
A transimpedance amplifier having open-loop DC control is provided. The open-loop feedback control may provide a DC bias that is configurable based on the characteristics of an input device, such as, a photodiode or a magnetoresistor. The open-loop feedback control may provide quick recovery from voltage level variations and may provide stability for the amplifier. |
| US07804361B2 |
Low noise amplifier
A low noise amplifier is provided. The low noise amplifier includes: a low noise amplifying unit amplifying an input signal; a harmonic and noise generating unit disposed in an input terminal of the low noise amplifying unit, for generating a compensating signal for compensating for an intermodulation distortion signal and a thermal noise signal of the input signal to the low noise amplifying unit; and a load unit outputting the amplified input signal generated by the low noise amplifying unit. |
| US07804359B1 |
Linearization with memory compensation
A polynomial generator and memory compensator module is provided that includes: a first bank of delay filters for generating current and delayed versions of the envelope for an RF input signal and for the square of the envelope, a polynomial generator for generating polynomials using the current and delayed versions of the envelope, each polynomial being weighted according to pre-distortion weights; an adder for adding the polynomials to provide a pre-distortion signal for pre-distorting the RF input signal to provide a pre-distorted RF input signal such that a power amplifier amplifying the pre-distorted RF input signal provides an amplified RF output signal that reduces a non-linearity of the power amplifier; and a second bank of delay filters for generating delayed versions of the output signal, wherein the adder further adds the delayed versions of the output signal to the polynomials to provide the pre-distortion signal. |
| US07804350B1 |
Level shifting using cross-coupled cascode transistors
A level-shifter circuit capable of operating at low voltages. Two complementary current paths are provided between each of two intermediate nodes (at least one of which being an output node) and one of the supply voltages. A network of field-effect transistors are coupled between the other voltage supply and the intermediate nodes. The transistors include a pull-up (or pull-down as the case may be) transistor pair coupled to the high (or low as the case may be) voltage supply. There are two cascode transistor pairs coupled between the pull-up (or down) transistors and the corresponding intermediate node. One cascode pair couples the respective intermediate node to the drain terminal of the respective pull-up (or down) transistor. The other cascoded pair cross-couples the intermediate node to the gate terminal of the opposite pull-up (or down) transistor. |
| US07804347B2 |
Pulse generator circuit and communication apparatus
A pulse generator circuit that outputs pulses having a predetermined shape from an output terminal based on a start signal includes a timing generator circuit that generates (n) signals (n is an integer greater than or equal to 2), a pulse width signal generator circuit that generates a first pulse width signal and a second pulse width signal a first filter circuit limiting the band of the first pulse width signal, a second filter circuit limiting the band of the second pulse width signal, first and second power supplies, a first variable impedance circuit controlled by the first filter circuit, a second variable impedance circuit controlled by the second filter circuit, and a switching circuit that alternately connects the output terminal to the first power supply using a logic function value based on at least part of the n signals. |
| US07804345B2 |
Hybrid on-chip regulator for limited output high voltage
A driver circuit provides fast settling times, slew rate control, and power efficiency, while reducing the need for large external capacitors. A voltage reference circuit generates a voltage reference signal. A comparator compares the voltage reference signal and a driver output signal and generates an output high voltage control signal. An output driver includes a first and a second switch that are coupled together. The first and second switches are further coupled to generate the driver output signal in response to coupling the output high voltage control signal to the control terminal of the first switch and coupling an input signal to the control terminal of the second switch. |
| US07804328B2 |
Source/emitter follower buffer driving a switching load and having improved linearity
A source follower or emitter follower buffer provided according to an aspect of the present invention includes a capacitor connected between the input path and a node formed by the junction of a pair of transistors forming a cascoded current source connected to the output of the buffer. The capacitor passes input signal current directly to a switching load connected to the output of the buffer, and very little signal-dependant current flows through the transistor receiving the input signal. As a result, input-output non-linearity due to signal-dependant modulation (variation) of transconductance of the transistor receiving the input signal is minimized. When incorporated in switched-capacitor analog to digital converters, the buffer facilitates generation of digital codes that represent an input signal more accurately. |
| US07804325B1 |
Dedicated function block interfacing with general purpose function blocks on integrated circuits
To improve interfacing between a block of dedicated function circuitry and blocks of more general purpose circuitry on an integrated circuit (“IC”), signals that are to be output by the dedicated function block are routed internally in that block so that they go into interconnection circuitry on the IC for more efficient application by that interconnection circuitry to the general purpose circuitry. Some of this routing internal to the dedicated function block may be controllably variable. The routing internal to the dedicated function block may also be arranged to take advantage of “sneak” connections that may exist between the dedicated function block and the general purpose blocks. |
| US07804321B2 |
Circuits and methods for testing FPGA routing switches
An FPGA architecture includes multiplexers having non-volatile switches having control gates coupled to word lines W, each word line associated with a row, the switches connecting to wiring tracks through buffers having a controllable ground connection NGND, at least some of the switches being a tie-off switch coupleable to one of a plurality of bitlines B, each bitline associated with column. |
| US07804309B2 |
Systems and methods for soil moisture estimation
Embodiments of the present invention provide estimates of soil moisture by measuring the change in electrical conductivity near the surface of the earth using surface-propagated electromagnetic fields. A method is provided for estimating near-surface soil moisture, including measuring signals from an electromagnetic ground wave propagating between one or more receiving element locations, determining a transfer characteristic proportional to an average electrical conductivity between pairs of locations; and determining estimated soil moisture in one or more regions derived from analyzing the determined electrical conductivity between pairs of locations and a predetermined regional relationship between electrical conductivity and soil moisture. |
| US07804307B1 |
Capacitance measurement systems and methods
A first capacitor and a second capacitor are charged until voltage at the second capacitor settles to a settling voltage. While charging, the first capacitor is alternately switched between a current source and ground. When the settling voltage is reached, charging of the first capacitor is halted. The second capacitor continues to be charged until voltage at the second capacitor reaches a reference voltage. The amount of time it takes for the settling voltage to reach the reference voltage corresponds to a measure of capacitance on the first capacitor. |
| US07804302B2 |
Method and apparatus for enhancing formation resistivity images obtained with downhole galvanic tools
The average current at a plurality of measure electrodes of a resistivity imaging tool is determined and subtracted from the individual measure currents to give a resistivity image with improved dynamic range. |
| US07804299B2 |
Diffusion weighted preparatory sequence for magnetic resonance imaging pulse sequence
A preparatory pulse sequence is applied prior to an imaging pulse sequence during a diffusion-weighted MRI scan. The preparatory pulse sequence diffusion weights the longitudinal magnetization using a gradient waveform that is first moment nulled to reduce image artifacts caused by patient motion. |
| US07804295B2 |
Apparatus and method for detection of defects using flux leakage techniques
An apparatus for the detection of defects utilizing non-destructive flux leakage techniques in ferrous materials includes rare earth magnets which are supported at an angle in the order of 45 degrees with the surface of the test specimen to induce a magnetic field within the material. The angled arrangement draws the field into the specimen over a larger surface area, reducing reluctance and ensuring that the field does not shallow within the material. The device provides real-time, three dimensional, visual feedback to the user and includes built-in means for data storage and retrieval without the need for an external computer interface. A distance sensor is used to correct the signal from the sensor array for distance from the surface. A position analyzing device utilizes the magnetic field to determine the position of the apparatus along the surface of the test material, increasing the accuracy in position measurement during testing. |
| US07804293B2 |
Power supply and stabilizer
Provided is a power supply apparatus including a low pass filter that receives an output voltage of a current output section and allows a low frequency component with a frequency lower than a preset cutoff frequency to pass through; an excess voltage restricting load section that consumes an excess voltage restricting current, which is at least a portion of the output current from the current output section, when a load is turned on; and an excess voltage restricting control section that keeps the excess voltage restricting load section turned off when the output voltage of the current output section is less than an upper reference voltage, which is obtained by adding together a voltage output by the low pass filter and a preset upper offset voltage. |
| US07804292B2 |
Method for testing integrated circuits mounted on a carrier
A method for testing integrated circuits mounted on a carrier includes the step of securing the carrier. The carrier is displaced into an operative position in which the integrated circuits are in physical and electrical communication with a diagnostic probe. Test signals are generated in test circuitry in electrical communication with the diagnostic probe and communicated to the integrated circuits with the diagnostic probe. The test signals are received at the test circuitry via the diagnostic probe. The test signals are made available to a controller via a communications link and an automated server and displayed with the controller. |
| US07804287B2 |
Low heat dissipation I/O module using direct drive buck converter
A current-loop output circuit for an industrial controller provides for low power dissipation and reduced part count by driving current loads of different resistances directly from a switched voltage source. Proper filtering and design of a feedback loop allows the necessary transient response times to be obtained. |
| US07804286B2 |
Multiple output amplifiers and comparators
An amplifier/comparator includes a multitude of output stages all sharing the same input stage. One or more of the output stages are amplification stages and have compensated output signals. A number of other output stages are not compensated and provide comparison signals. Each uncompensated output stage is adapted to switch to a first state if it detects a first input signal as being greater than a second signal, and further to switch to a second state if it detects the first input signal as being smaller than the second signal. By varying the channel-width (W) to channel-length (L) ratio (W/L) of the transistors disposed in the output stages, the trip points of the comparators and/or the electrical characteristics of the amplifiers are selectively varied. |
| US07804284B1 |
PSRR regulator with output powered reference
The invention relates to a regulator with a reference generator circuit (e.g., a band-gap reference) and a reference generator power selector. The reference generator power selector selectively powers the reference generator circuit from an input power signal during start-up and from a regulated power signal during steady-state operation. The reference generator power selector may also select from multiple regulated power signals during steady-state operation. |
| US07804282B2 |
Buck converter with inductor pre-energizing
Circuits and methods to achieve a buck-boost converter, capable to achieve a constant output voltage by pre-charging of an inductor if the input voltage is close to the output voltage has been achieved. The prior art problem of output voltage variations occurring while the input voltage is close to the output voltage is avoided. In case the input voltage is lower than a defined threshold voltage or the duty cycle exceeds a defined maximum allowable level, the inductor of the converter is pre-charged followed by boosting of the energy of the inductor to the output of the converter. In both modes the control loops of the buck converter can be used for buck duty cycle control. The duration of the pre-charge depends upon the level of the input voltage, the lower the input level is the longer is the pre-charge performed. |
| US07804281B2 |
Reducing common mode noise of power factor correction converters using general balance concept
Common mode (CM) noise is substantially canceled in a switching power supply circuit such as a boost converter by providing a split inductor and analyzing the switching power supply circuit as a bridge circuit formed of the switch, portions of the split inductor and parasitic capacitances of respective portions of the power supply circuit. The bridge can then be balanced by addition of capacitance in parallel with the parasitic capacitance of a respective portion of the power supply circuit or dividing the split inductor such that a ratio of inductances of respective portions of the split inductor approximates a ratio of parasitic capacitances of the respective power supply circuit portions which may be measured or otherwise empirically determined. CM noise reduction of up to 40 db can be achieved without symmetric circuit design, addition of circuit elements or complex filtering having added cost, space requirements and power losses. Further, such a reduction in common mode noise allows simple EMI filtering arrangements to be employed further reducing cost and space requirements for the power supply circuit. |
| US07804277B2 |
Apparatus for estimating state of charge of secondary battery
An apparatus for estimating a state of charge (SOC) of a secondary battery. A control section of a battery controller (ECU) computes a total amount of electric discharge of a secondary battery and compares the total amount of electric discharge with a predetermined threshold value. The threshold value is set so as to fall within a range of; for instance, 400 Ah to 1600 Ah. When the total amount of electric discharge is equal to or greater than the predetermined threshold value, an open-circuit-voltage (OCV)-SOC map is replaced with a map achieved in a state where a memory effect is saturated. When the total amount of electric discharge is smaller than the predetermined threshold value, a correction is made to the map so as to achieve a map that is a mixture consisting of the OCV-SOC map achieved in an initial state and the OCV-SOC map achieved in the saturated state at a predetermined ratio. The SOC is estimated by use of the corrected map. |
| US07804275B2 |
Battery power supply
A battery power supply for use with an electronic device, such as a computer, uses a multi-cell battery, and a recharging circuit. Cells of the battery are serially interconnected to produce positive output voltages of 3.6, 4.8 and 12 volts DC and negative voltages of 4.8 and 12 volts DC. The power supply includes output terminals for delivering the DC voltages to power inlets of the device nominally rated at 12, 5 and 3.3 volts DC. The recharging circuit includes an AC voltage input terminal and outputs corresponding to the battery output terminals. |
| US07804274B2 |
Vehicle charging station having a dual position locking door
A vehicle charging station including a compartment having a door, a receptacle disposed within the interior of the compartment for receiving a charging cord from a vehicle, and a door mechanism. The door mechanism includes a first latch for locking and unlocking the door from a closed position. The first latch locks the door in the closed position without drawing power and keeps the door locked in the closed position if power is lost to the vehicle charging station. The door mechanism also includes a second latch for locking and unlocking the door in a second position such that the door is ajar allowing the cord to pass from the vehicle to the interior of the compartment. The second latch allows the door to open beyond its ajar position to allow the cord to be removed if power is lost to the vehicle charging station while the door is locked in the second position. |
| US07804273B2 |
Selector circuit for power management in multiple battery systems
A selector circuit configured to select among a DC power source and a plurality of batteries for an electronic device. The selector circuit includes a first comparator configured to compare a first input signal representative of a voltage level of the DC power source with a first threshold level and provide a first output signal representative of a difference between the first input signal and the first threshold level, and a selector output circuit. The selector output circuit is configured to provide selector output signals that control selection among the DC power source and the plurality of batteries. The selector output circuit providing said selector output signals to select the DC source and deselect the plurality of batteries if the first output signal is representative of the voltage level of said DC power source being greater than the first threshold level. |
| US07804272B2 |
Non-contact type power feeder system for mobile object and protecting apparatus thereof
A noncontact type power feeder system for feeding a power to a mobile object, in which a power feeding portion and a power receiving portion can be easily manufactured at low costs and which can transmit a high power. The noncontact type power feeder system for a mobile object, comprises a power feeding portion provided in a surface on which the mobile object runs, and a power receiving portion provided in the lower part of the mobile object at a position facing to the power supply portion, the each of the power feeding portion and the power receiving portion is composed of windings formed in an oval shape, and a magnetic planar core formed therein with a recess in which the windings are accommodated so that the longitudinal direction of the oval shape of the windings is extended along the travel direction of the mobile object, the planer core is composed of several planar blocks each having a rectangular surface, several blocks being laid so that long sides of the rectangular surfaces are extended in the travel direction of the mobile object, in which several blocks are also laid in the direction orthogonal to the travel direction, and several blocks being superposed one upon another, the recess of the planar core is defined by thick wall parts in which the planar cores are superposed on the surface of the planar core, outside and inside of the oval shape part of the windings. |
| US07804262B2 |
Non-intrusive electronic control circuitry to detect an open protector in a hermetically sealed compressor
An electronic apparatus externally detects open protector contacts inside of a compressor. The compressor includes a compressor motor having a run winding and a start winding. The compressor motor also includes internal protector contacts that open the electrical circuit to the “C” terminal in a protection condition. A compressor running indicator circuit is electrically connected between the “S” and the “R” terminals to indicate a compressor running condition. Also, a protection indicator circuit is electrically connected between the “C” and the “S” terminals to indicate a voltage present across the “C” and the “S” terminals. The protection indicator circuit is also coupled to the compressor running indicator circuit such that the protection indicator circuit is disabled when the compressor is running normally and the protection indicator is enabled and indicates when protector contacts open inside of the compressor. |
| US07804259B2 |
Discharge lamp ballast apparatus
A discharge lamp ballast apparatus includes a fault detecting section 9b of a discharge lamp 6; a first storing section 10 for storing a fault detected; a lighting delay detecting section 9c-3 for detecting lighting delay time from beginning of starting operation to lighting of the discharge lamp; a reigniting voltage measuring section 9c-5 for measuring a discharge lamp voltage immediately after switching of polarity applied to the discharge lamp according to AC lighting; a measuring section 9c-6 for measuring a period of time during which a current does not flow by detecting a discharge lamp current immediately after switching the polarity applied to the discharge lamp according to the AC lighting; a going out counting section 9c-4 for counting a number of times of going out by detecting going out during lighting of the discharge lamp; and a second storing section 9c for storing the lighting delay, reigniting voltage, period of time during which the current does not flow, and number of times of going out as operation records. |
| US07804255B2 |
Dimming system powered by two current sources and having an operation indicator module
A dimming system and method of operating the same are provided. The dimming system includes a first terminal configured to operatively connect to a first conductive line, a second terminal configured to operatively connect to a second conductive line, and a third terminal configured to operatively connect to a third conductive line. The first conductive line is configured to connect to a load, the second conductive line is configured to supply an alternating current, and the third conductive line is configured to connect to a current path. The dimming system further includes a controller operatively connected to at least one of the first, second and third terminals for controlling operation of the dimming system. The first and second terminals are configured for electrically connecting to a primary power supply and the first and third terminals are configured for electrically connecting to a secondary power supply. The primary power supply is powered through connection to neutral, and wherein the secondary power supply is powered through connection to an earth ground. |
| US07804251B2 |
LED signaling apparatus with infrared emission
An infrared signaling apparatus is disclosed, which utilizes high intensity solid state lighting elements, such as light emitting diodes (LEDs) to provide signaling for navigational as well as search/rescue applications employing night vision equipments. |
| US07804242B2 |
Top-emission active matrix electroluminescence device and method for fabricating the same
A top-emission active matrix electroluminescence device and a method for fabricating the same are disclosed, wherein a counter common electrode is formed in an area outside of a pixel area, when forming a pixel electrode, so as to simultaneously enhance an emission efficiency and an electrical function of the device. Herein, the counter common electrode is electrically connected to a common electrode, thereby preventing an overload and a short-circuit of the common electrode, even though the common electrode is formed in a thin layer. |
| US07804240B2 |
Organic electro luminescence device and method of fabricating the same
An organic electro luminescence device includes a light emission unit disposed on a substrate and a passivation film including a plurality of organic films and a plurality of inorganic films, the plurality of organic films and the plurality of inorganic films are alternately stacked to cover the light emission unit on the substrate, wherein a side of the passivation film disposed between an edge of the substrate and an edge of the light emission unit is gradually thinner from the edge of the light emission unit towards the edge of the substrate. |
| US07804239B2 |
White light emitting diode
Provided is a white light emitting diode (LED) including a blue LED chip; and yellow, green, and red light emitting phosphors that are coated on the blue LED chip at a predetermined mixing ratio and converts light, emitted from the blue LED chip, into white light. |
| US07804237B2 |
Luminescence conversion of LED including two phosphors
A luminescence conversion of LED, which uses a blue emitting chip and two illuminating substances, whereby one emits a red and the other a yellow to green. Both illuminating substances are separated upstream from the chip. |
| US07804236B2 |
Flat panel display incorporating control frame
A flat panel display including: a plurality of electrically addressable pixels; a plurality of thin-film transistor driver circuits each being electrically coupled to an associated at least one of the pixels, respectively; a passivating layer on the thin-film transistor driver circuits and at least partially around the pixels; a conductive frame on the passivating layer; and, a plurality of nanostructures on the conductive frame; wherein, exciting the conductive frame and addressing one of the pixels using the associated driver circuit causes the nanostructures to emit electrons that induce the one of the pixels to emit light. |
| US07804234B2 |
Self-ballasted compact fluorescent lamp and method for manufacturing
A compact fluorescent lamp comprises a discharge tube arrangement with at least one discharge tube. The tube is formed of glass, encloses a discharge volume filled with a discharge gas and has a fluorescent phosphor coating disposed on the inner surface of the tube. The tube forms a continuous arc path and has electrodes disposed at each end of the arc path. The lamp also comprises a ballast circuit connected to the electrodes by lead-in wires and to a supply voltage by lead-out wires for controlling the current in the tube. A bulb shaped outer envelope comprises a substantially spherical portion, which encloses the tube arrangement and an elongated end portion, which encloses the ballast circuit. The end portion of the outer envelope has a neck portion with an open end on a base side for receiving a base shell. The open end of the neck portion is closed and terminated by a closing and neck reinforcing means of a material compatible with the material of the outer envelope, which has a substantially circular opening. The lead-out wires are led through the substantially circular opening to a base shell for connecting said lamp to said supply voltage through a socket.A method for manufacturing a compact fluorescent lamp as described above is also disclosed. In the proposed method the open end of the elongated portion of the outer envelope is closed and terminated with a closing and neck reinforcing means comprising a substantially circular opening for leading through the lead-out wires. |
| US07804230B2 |
Piezoelectric actuator
A piezoelectric actuator for use in a fuel injector, the actuator comprising a stack of one or more piezoelectric elements for receipt within an accumulator chamber of the injector, distribution electrode means for generating an electric field within the stack and an electrical connector arrangement including a body member defining an external boundary and including a base portion and a stem portion projecting from the base portion. The base portion defines a base end face for abutment with an adjacent end face associated with the stack. Terminal means are provided for connection with an external power supply. The terminal means includes first and second terminal members disposed internal to the external boundary of the body member. The first and second terminal members are arranged side by side and disposed internal to the external boundary of the body member. The actuator further comprises first and second contact plates, each of which is connected electrically to a first end of a respective one of the first and second terminal members. The first and second terminal members are further connectable with an external power supply, in use, so as enable voltage supply to the distribution electrode means. The base portion of the body member defines a sealing surface for abutment with an internal surface defined by the accumulator chamber. |
| US07804229B2 |
Magnetostrictive / piezo remote power generation, battery and method
A power generation device generates power by subjecting a composite of magnetostrictive material and piezo material to a magnetic field. The composite of magnetostrictive material and piezo material may be incorporated in a battery or other storage device. |
| US07804228B2 |
Composite passive materials for ultrasound transducers
Provided herein are composite passive layers for ultrasound transducers having acoustic properties that can be easily tailored to the needs of the transducer application using current microfabrication techniques. In an embodiment, a passive layer comprises metal posts embedded in a polymer matrix or other material. The acoustic properties of the passive layer depend on the metal/polymer volume fraction of the passive layer, which can be easily controlled using current microfabrication techniques, e.g., integrated circuit (IC) fabrication techniques. Further, the embedded metal posts provide electrical conduction through the passive layer allowing electrical connections to be made to an active element, e.g., piezoelectric element, of the transducer through the passive layer. Because the embedded metal posts conduct along one line of direction, they can be used to provide separate electrical connections to different active elements in a transducer array through the passive layer. |
| US07804227B2 |
Tear resistant electroactive polymer transducers
Described herein are several solutions that increase transducer lifetime by reducing or preventing tear propagation in a compliant electroactive polymer. One solution couples a compliant tear resistant treatment to a transducer proximate to an edge portion of the electroactive polymer. Another solution uses a tear resistant layer that couples to and covers a large surface area of the transducer. Another suitable tear resistant solution provides added material outside an active area; the added material reduces stress or strain variations in polymer material outside the active area when the electroactive polymer transducer is deflected or pre-strained. |
| US07804226B2 |
Polymer actuator
In a polymer actuator provided with a first polymer structural member having a conductive property, an electrolyte retention layer electrically connected to the first polymer structural member, and a second polymer structural member electrically connected to the first polymer structural member through the electrolyte retention layer interposed therebetween and having a conductive property, and by applying a potential difference between the first polymer structural member and the second polymer structural member, the first polymer structural member and the second polymer structural member are allowed to expand and contract, by displacement of the second polymer structural member, the potential difference between the first polymer structural member and the second polymer structural member is changed. |
| US07804225B2 |
Droplet discharging head, image forming apparatus, and film forming apparatus
A droplet discharging head, includes a diaphragm, a fixing plate, and a piezoelectric element. The piezoelectric element includes a first electrode, a second electrode, a piezoelectric body layer interposed between the first and second electrodes, a first internal electrode extending from the first electrode between the first, and second electrodes, and a second internal electrode extending from the second electrode between the first and second electrodes. At least a part of a first end face of the piezoelectric element is in contact with the diaphragm. The first end face includes a first end of the first electrode, a first end of the second electrode, and a first end of the piezoelectric Body. The piezoelectric body layer includes an active layer that overlaps both the first and second internal electrodes, a first inactive layer that overlaps only the first internal electrode, and a second inactive layer that overlaps only the second internal electrode. A thickness of the second inactive layer between the second electrode and the active layer is larger than a thickness of the first inactive layer between the first electrode and the active layer. |
| US07804221B2 |
Surface acoustic wave device
A surface acoustic wave device has high power withstanding performance and is able to effectively suppress an undesirable spurious response. The surface acoustic wave device includes an LiNbO3 substrate having Euler angles (0°±5°, θ±5°, 0°±10°), an electrode that is disposed on the LiNbO3 substrate and that has an IDT electrode made mainly from Cu, a first silicon oxide film that is disposed in an area other than an area in which the electrode is disposed to have a thickness equal to that of the electrode, and a second silicon oxide film that is disposed so as to cover the electrode and the first silicon oxide film, wherein the surface acoustic wave device utilizes an SH wave, wherein a duty D of the IDT electrode is less than or equal to about 0.49, and θ of the Euler angles (0°±5°, θ±5°, 0°±10°) is set to fall within a range that satisfies the following inequality: −10×D+92.5−100×C≦θ≦37.5×D2−57.75×D+104.075+5710×C2−1105.7×C+45.729 D: duty C: thickness of the IDT electrode normalized using a wavelength λ. |
| US07804217B2 |
Rotary electric machine with coil member and method of manufacturing coil member
In a rotary electric machine, a field coil member includes a first edgewise coil composed of a plurality of coaxially layered convolutions. The coaxially layered convolutions are wound around the outer periphery of the first pole core. The field coil member includes a second edgewise coil composed of a plurality of coaxially layered convolutions. The coaxially layered convolutions are wound around the outer periphery of the second pole core. The field coil member includes a link portion connecting between the first edgewise coil and the second edgewise coil in series. One of the first and second edgewise coils has one coil end extending therefrom to cross over the link portion at a crossover portion thereof. The crossover portion between the one coil end and the link portion is arranged to be non-overlapped with the convolutions of the one of the first and second edgewise coils. |
| US07804216B2 |
Permanent-magnet reluctance electrical rotary machine
For an electrical reluctance rotary machine, a stator has a winding as an armature, and a rotor has permanent magnet implanting slots provided in a rotor core at lateral sides magnetic poles configured to produce reluctance torque along directions of magnetic flux passing through the magnetic poles to produce reluctance torque, and permanent magnets inserted in the permanent magnet implanting slots so as to cancel magnetic flux of the armature intersecting that magnetic flux, to control a magnetic field leaking at ends of the magnetic poles, having circumferential magnetic unevenness. The electrical reluctance rotary machine is configured to meet a relationship, such that 1.6 ≤ P × W pm R ≤ 1.9 where Wpm [mm] is a width of permanent magnet, R [mm] is a radius of the rotor, and P is the number of poles. |
| US07804213B2 |
Low profile d.c. brushless motor for an impeller mechanism or the like
An impeller and at least a portion of a cooperating peripheral volute may be integrated into, and preferably are integrally injection molded with, concentric outer rotor and inner stator assemblies, respectively, to achieve a low profile precision impeller mechanism based on an improved brushless d.c. motor with low length (L) to diameter (D) ratio and suitable for use in a variety of other applications. In one practical embodiment of such a motor, a rotating cap has an inner circumference which is molded about an outer ferromagnetic back ring that in turn supports a permanently magnetized ring shaped rotor magnet having a number of poles of alternating polarity defined about its inner circumference and separated by a relatively small cylindrical air gap from the outwardly projecting radially oriented selectively magnetized poles of a fixed stator assembly. In one exemplary embodiment, the rotor may have 8 poles and the stator may have 9 poles. The fixed stator assembly is preferably integrally molded into a base housing that also includes a precision fixed bearing support that extends upwardly through the center of the stator assembly and that is rotatably coupled to a rotating shaft that extends downwardly from (and preferably is integral with) the center of the rotating cap. A coaxial pair of preloaded ball bearings is preferably supported between an inner cylindrical surface of the fixed bearing support and an outer cylindrical surface of the rotating shaft, to thereby permit the rotor to rotate precisely about the stator with minimal variation in the cylindrical air gap therebetween. |
| US07804208B2 |
Method and structure for cooling an electric motor
A high speed electric motor for use in a variety of applications. The electric motor an electric motor including a motor housing or stator, a rotor having a commutator and brushes for contacting the commutator at a predefined area known as the contact area. Additionally, the motor includes a forced air cooling assembly. The forced air cooling assembly includes a centrifugal fan for creating air flow, a manifold for accelerating the air flow. The manifold having exit ports and the exit ports being positioned directly over the contact area for directing the accelerated air flow at the contact area and the motor housing having at least one opening aligned with the contact area and at least a second opening defining an exit vent. Additionally, a method of cooling the motor in accordance with the invention is also disclosed. |
| US07804205B2 |
Electret device and electrostatic operating apparatus
An electret device includes an electret film capable of storing charges and a charge outflow inhibition film formed on an upper surface of a region having a high charge density in the electret film and inhibiting the charges stored in the electret film from flowing out. |
| US07804203B2 |
Wireless chip
The size of a wireless chip is often determined according to an antenna circuit thereof. Power source voltage or power supplied to the wireless chip can be more easily received with a larger antenna. On the other hand, there has been an increasing demand for a compact wireless chip, and it is thus necessary to downsize an antenna. In view of this, the invention provides a wireless chip capable of data communication with a small antenna, namely a compact wireless chip having an improved communicable distance. A power source circuit of an ID chip of the invention generates a higher power source voltage than a power source voltage generated in a conventional ID chip, by using a boosting power source circuit having a boosting circuit and a rectifier circuit. |
| US07804199B2 |
Fail-safe circuit for gas valves
A fail-safe circuit and fail-safe methods for controlling gas valves are provided. In one illustrative embodiment, a fail-safe circuit includes at least one input that can be connected to a control device and at least one output that can be connected to a gas valve. In some cases, the fail-safe circuit may only supply an output voltage for opening the gas valve if the input signal received from the control device includes at least two different successively applied frequency signals. Other methods and embodiments are also contemplated. |
| US07804196B2 |
Multiple input/output power converter and fuel cell vehicle with same
A multiple input/output power converter includes: at least two input/output circuits to be connected to electric units; a plurality of power converting circuits including switches and at least an inductor, a plurality of capacitors connected to the power converting circuits; and a control circuit for controlling the switches in a plurality of modes to selectively operate the inductor and the capacitors to operate the power converting circuits in either of stepping up, stepping down, or conducting operation. The capacitors are shared among the power converting circuits. |
| US07804194B2 |
Device, system and method for charger switch adaptor
A system to connect an electrical device to a switch which connects or disconnects the device to the power source, and providing power to the charger and/or another operational circuit of the device, for example, keep-alive circuit, with no dependency in the state of the switch. |
| US07804190B2 |
Method and apparatus for resistive power distribution
An electrical power distribution method and apparatus are disclosed, the apparatus comprising a first power distribution member section receiving electrical power from a power supply and a second high resistivity power distribution member section, electrically connected to the first section for supplying the electrical power to an electrical device in electrical communication with the high resistivity section. |
| US07804189B2 |
Efficient DC distribution system, topology, and methods
Embodiments of power distribution systems and methods are described generally herein. Other embodiments may be described and claimed. |
| US07804188B2 |
Termination circuit, vehicle-mounted control apparatus, and vehicle-mounted communication system
The termination circuit for use in a transmission line to transmit a differential signal includes a first series circuit of a resistive element and an inductive element connected between one of two signal wires of the transmission line and a reference potential, and a second series circuit of a resistive element and an inductive element connected between the other of the signal wires and the reference potential. The inductive elements of the first and second series circuits are magnetically coupled such that they generate magnetic fields having such directions as to reinforce each other when a common-mode signal flows along the transmission line, and generate magnetic fields having such directions as to weaken each other when a differential-mode signal flows along the transmission line. |
| US07804187B2 |
Electronically openable lock fitting for a motor vehicle
The invention relates to an electrically-openable lock fitting for a motor vehicle, connected to main electric supply means (3) and to emergency electric supply means for the lock fitting in the event of a malfunction of the main electric supply means. The emergency electric supply means comprise a power reserve component (6) and electric energy reserve means (9), and an identification element (4) ensuring the identification of a user. The identification element comprises at least one signal receiver (4) communicating with an element which can deliver a signal in order to identify the user. The connection of the electric energy reserve means (9) is controlled in such a way that the electric energy reserve means (9) supply the energy reserve component (6) once identification has been made and authorized. |
| US07804186B2 |
Modular array fluid flow energy conversion facility
In embodiments of the present invention improved capabilities are described for the efficiency with which fluid energy is converted into another form of energy, such as electrical energy, where an array of fluid energy conversion modules is contained in a scalable modular networked superstructure. In certain preferred embodiments, a plurality of turbines, such as for instance wind turbines, may be disposed in an array, where the plurality of arrays may be disposed in a suitable arrangement in proximity to each other and provided with geometry suitable for tight packing in an array with other parameters optimized to extract energy from the fluid flow. In addition, the turbines may be a more effective adaptation of a turbine, or an array of turbines, to varying conditions, including fluid conditions that may differ among different turbines in an array, or among different turbines in a set of arrays. |
| US07804185B1 |
Non-fuel combusting stand alone air turbine engine
The invention discloses a non-fuel combusting air turbine assembly suitable as a stand alone system for generating electricity. The systems include an air turbine engine powered by a compressor mechanism to increase the potential energy that can be harnessed by the turbines, having a noise reducing air intake section for delivering air to the compressor. Additionally, the systems include a turbine mechanism composed of plural sets of stationary vanes and rotating vanes, preferably arranged alternatively, and a battery rechargeable by a generator operable by the rotating turbine vanes. To initiate starting the turbine assembly, a secondary power source is included. |
| US07804183B2 |
Power generating system
Provided is a power generator, including a plurality of wind power generators generating electrical power using wind power energy, and variable-speed wind power generators (20a, 20b) connected between the power generator and an electrical power system. The variable-speed wind power generators (20a, 20b) equalize an output of the entire power generating system by outputting power for correcting for a drop in output of the power generator. |
| US07804177B2 |
Silicon-based thin substrate and packaging schemes
A silicon-based thin package substrate is used for packaging semiconductor chips. The silicon-based thin package substrate preferably has a thickness of less than about 200 μm. A plurality of through-hole vias are formed in the silicon-based thin package substrate, connecting BGA balls and solder bumps. The silicon-based thin package substrate may be used as a carrier of semiconductor chips. |
| US07804176B2 |
Semiconductor device
This invention is to provide a nonvolatile memory device that enhances a size reduction and mass productivity while ensuring reliability and signal transmission performance. A nonvolatile memory chip having a first side formed with no pads and a second side formed with pads is mounted on a mounting substrate. A control chip for controlling the nonvolatile memory chip is mounted on the nonvolatile memory chip. The control chip has a first pad row corresponding to the pads of the nonvolatile memory chip. The first pad row is mounted adjacent to the first side of the nonvolatile memory chip. The first pad row of the control chip and a first electrode row formed on the mounting substrate are connected via a first wire group. The pads of the nonvolatile memory chip and a second electrode row formed on the mounting substrate are connected via a second wire group. The first electrode row and the second electrode row are connected through wirings formed in the mounting substrate. |
| US07804174B2 |
TFT wiring comprising copper layer coated by metal and metal oxide
A gate electrode (wiring) (40) having a Cu layer (40a) surrounded by a coating film (40b) made of titanium or titanium oxide; a TFT substrate (31) comprising the gate electrode (wiring) (40) and a LCD comprising a pair of opposing substrates and a liquid crystal disposed between the opposing substrates, wherein one of the pair of opposing substrates is a TFT substrate (31), are disclosed. |
| US07804172B2 |
Electrical connections made with dissimilar metals
Electrical connections between different materials. An electrical connection system includes electrical components and an electrical connection between the electrical components. The electrical connection includes a functionally graded material. A method of making an electrical connection between different materials includes the steps of: providing an electrical component which includes a material; providing another electrical component which includes another material; and electrically connecting a functionally graded material between the electrical components. An electrical connection system includes an electrical component and a functionally graded material electrically connected to the electrical component. The functionally graded material provides a gradual transition between at least two dissimilar materials. |
| US07804162B2 |
Multi-wavelength white light-emitting structure
A multi-wavelength white light-emitting structure uses a UV light emitting diode chip and a blue light emitting diode chip to excite a red phosphor and a green phosphor and generates a white light-emitting structure having good color rendering. The multi-wavelength white light-emitting structure uses a UV light emitting diode chip that emits light having a wavelength of between 350˜430 nm to excite a red phosphor to emit red light having a wavelength of between 600˜700 nm. The present invention then uses a blue light emitting diode chip that emits light having a wavelength between of 400˜500 nm to emit blue light and uses the blue light emitting diode chip to excite a green phosphor to emit green light having a wavelength of between 490˜560 nm. Mixing the red light, the blue light and the green light forms a white light. |
| US07804161B2 |
Semiconductor device and dam for resin
The invention provides a semiconductor device including a rectangular chip provided on a mounting region of a substrate, a liquid resin layer provided under the rectangular chip and on a side surface of the chip, and a plurality of dams formed on the substrate so as to extend along the side surface of the rectangular chip. The configuration allows the semiconductor device to be provided with the substrate having a reduced size which is achieved by preventing a liquid resin from flowing out. |
| US07804160B2 |
Ultrasonic bonding equipment for manufacturing semiconductor device, semiconductor device and its manufacturing method
An ultrasonic bonding equipment for manufacturing a semiconductor device comprises a tip portion. The tip portion has a top surface which is faced to a member to be bonded, and propagates an ultrasonic vibration to the top surface. A plurality of protruding portions are provided on the top surface. Each of the protruding portions has: a first pair of opposite side surfaces inclined with respect to the top surface; and a second pair of opposite side surfaces substantially vertical to the top surface. A semiconductor device comprises: a semiconductor chip; a lead; and a bonding strap electrically connecting the semiconductor chip and the lead. A recess is formed on an upper surface of the bonding strap in at least one of a first region where the bonding strap and the semiconductor chip are connected and a second region where the bonding strap and the lead is connected. A first pair of opposite side surfaces of the recess are inclined with respect to the upper surface of the bonding strap, and a second pair of opposite side surfaces of the recess are substantially vertical to the upper surface of the bonding strap. |
| US07804158B2 |
Electronic device with shielding structure and method of manufacturing the same
An electronic device includes a substrate, an active circuit, and a shielding structure. The active circuit is formed on the substrate. The shielding structure is disposed surrounding the active circuit, and includes a first heavy ion-doped region, first metal stack, second heavy ion-doped region, second metal stack and top metal. The first heavy ion-doped is formed in the substrate and located at a first side of the active circuit. The first metal stack is formed on the first heavy ion-doped region of the substrate, wherein the first metal stack is connected to a ground voltage. The second heavy ion-doped region is formed in the substrate and located at a second side of the active circuit. The second metal stack is formed on the second heavy ion-doped region of the substrate. The top metal is formed on the first metal stack and second metal stack and passing over the active circuit. |
| US07804157B2 |
Device configured to have a nanowire formed laterally between two electrodes and methods for forming the same
A device configured to have a nanowire formed laterally between two electrodes includes a substrate and an insulator layer established on at least a portion of the substrate. An electrode of a first conductivity type and an electrode of a second conductivity type different than the first conductivity type are established at least on the insulator layer. The electrodes are electrically isolated from each other. The electrode of the first conductivity type has a vertical sidewall that faces a vertical sidewall of the electrode of the second conductivity type, whereby a gap is located between the two vertical sidewalls. Methods are also disclosed for forming the device. |
| US07804152B2 |
Recessed shallow trench isolation
In some embodiments, a memory integrated circuit has different shallow trench isolation structures in the memory circuitry of the memory integrated circuit and the control circuitry of the memory integrated circuit. The isolation dielectric fills the trenches of the shallow trench isolation structures to different degrees.In some embodiments, a memory integrated circuit has memory circuitry with shallow trench isolation structures and intermediate regions. The memory circuitry supports a channel between neighboring nonvolatile memory devices supporting multiple current components with different orientations.In some embodiments, recessed shallow trench isolation structures are formed. |
| US07804150B2 |
Lateral trench gate FET with direct source-drain current path
A field effect transistor includes a trench gate extending into a semiconductor region. The trench gate has a front wall facing a drain region and a side wall perpendicular to the front wall. A channel region extends along the side wall of the trench gate, and a drift region extends at least between the drain region and the trench gate. The drift region includes a stack of alternating conductivity type silicon layers. |
| US07804149B2 |
Nanostructured ZnO electrodes for efficient dye sensitized solar cells
The present invention provides methods of forming metal oxide semiconductor nanostructures and, in particular, zinc oxide (ZnO) semiconductor nanostructures, possessing high surface area, plant-like morphologies on a variety of substrates. Optoelectronic devices, such as photovoltaic cells, incorporating the nanostructures are also provided. |
| US07804141B2 |
Semiconductor element structure and method for making the same
A semiconductor element structure includes a first MOS having a first high-K material and a first metal for use in a first gate, a second MOS having a second high-K material and a second metal for use in a second gate and a bridge channel disposed in a recess connecting the first gate and the second gate for electrically connecting the first gate and the second gate, wherein the bridge channel is embedded in at least one of the first gate and the second gate. |
| US07804138B2 |
Buried guard ring and radiation hardened isolation structures and fabrication methods
Semiconductor devices can be fabricated using conventional designs and process but including specialized structures to reduce or eliminate detrimental effects caused by various forms of radiation. Such semiconductor devices can include the one or more parasitic isolation devices and/or buried guard ring structures disclosed in the present application. The introduction of design and/or process steps to accommodate these novel structures is compatible with conventional CMOS fabrication processes, and can therefore be accomplished at relatively low cost and with relative simplicity. |
| US07804136B2 |
Method of forming nitride films with high compressive stress for improved PFET device performance
A method is provided for making a FET device in which a nitride layer overlies the PFET gate structure, where the nitride layer has a compressive stress with a magnitude greater than about 2.8 GPa. This compressive stress permits improved device performance in the PFET. The nitride layer is deposited using a high-density plasma (HDP) process, wherein the substrate is disposed on an electrode to which a bias power in the range of about 50 W to about 500 W is supplied. The bias power is characterized as high-frequency power (supplied by an RF generator at 13.56 MHz). The FET device may also include NFET gate structures. A blocking layer is deposited over the NFET gate structures so that the nitride layer overlies the blocking layer; after the blocking layer is removed, the nitride layer is not in contact with the NFET gate structures. The nitride layer has a thickness in the range of about 300-2000 Å. |
| US07804132B2 |
Semiconductor device
A gate electrode is provided such that both ends thereof in a gate width direction are projected from an active region in plane view. Partial trench isolation insulation films are provided in a surface of an SOI substrate corresponding to lower parts of the both ends, and body contact regions are provided in the surface of the SOI substrate outside the both ends of the gate electrode in the gate width direction so as to be adjacent to the respective partial trench isolation insulation films. The body contact region and a body region are electrically connected through an SOI layer (well region) under the partial trench isolation insulation film. In addition, a source tie region in which P type impurity is doped in a relatively high concentration is provided in the surface of a source region in the vicinity of the center of the gate electrode in the gate width direction. |
| US07804131B2 |
Multi-chip module
A multi-chip module that includes a conductive element connecting at least two semiconductor devices, the conductive element including enhancements for improving the mechanical coupling between the conductive element and the molded housing of the MCM. |
| US07804129B2 |
Recessed gate electrode MOS transistor and method for fabricating the same
Disclosed are a transistor and a method for fabricating the same capable of increasing a threshold voltage and a driving current of the transistor. The method includes the steps of forming a first etch mask on a silicon substrate, forming a trench by etching the exposed isolation area, forming a first insulation layer in the trench and the first etch mask, forming a second insulation layer on the first insulation layer, removing the second insulation layer and the first insulation layer until the first etch mask is exposed, forming a trench type isolation layer on the isolation area, forming a second etch mask on an entire surface of the silicon substrate, etching the exposed channel area, performing an etching process with respect to a resultant substrate structure, and forming a gate in the recess. |
| US07804128B2 |
Nonvolatile semiconductor memory device
A nonvolatile semiconductor memory device according to an example of the present invention includes a semiconductor region, source/drain areas arranged separately in the semiconductor region, a tunnel insulating film arranged on a channel region between the source/drain areas, a floating gate electrode arranged on the tunnel insulating film, an inter-electrode insulating film arranged on the floating gate electrode, and a control gate electrode arranged on the inter-electrode insulating film. The inter-electrode insulating film includes La, Al and Si. |
| US07804127B2 |
Semiconductor non-volatile memory having semiconductor non-volatile memory cell with electric charge accumulation layer, and method of producing the same
A semiconductor non-volatile memory cell includes an Si (silicon) layer containing substrate including an activation region having a ridge portion; an element separation region embedded in both sides of the activation region; a gate electrode with a gate insulation film inbetween formed over the ridge portion for covering a part of both side surfaces of the ridge portion and an upper surface of the element separation region; a channel forming region formed in a surface layer region of the ridge portion; an extension region formed on both sides of the channel forming region in the longitudinal direction; and an electric charge accumulation layer capable of accumulating electric charges and a sidewall formed on the extension region and one or both of side surfaces of the gate electrode facing with each other in the longitudinal direction. |
| US07804126B2 |
Dense non-volatile memory array and method of fabrication
A non-volatile memory array has word lines spaced a sub-F (sub-minimum feature size F) width apart and bit lines generally perpendicular to the word lines. The present invention also includes a method for word-line patterning of a non-volatile memory array which includes generating sub-F word lines from mask generated elements with widths of at least a minimum feature size F. |
| US07804124B2 |
Device structures for a memory cell of a non-volatile random access memory and design structures for a non-volatile random access memory
Device and design structures for memory cells in a non-volatile random access memory (NVRAM). The device structure includes a semiconductor body in direct contact with the insulating layer, a control gate electrode, and a floating gate electrode in direct contact with the insulating layer. The semiconductor body includes a source, a drain, and a channel between the source and the drain. The floating gate electrode is juxtaposed with the channel of the semiconductor body and is disposed between the control gate electrode and the insulating layer. A first dielectric layer is disposed between the channel of the semiconductor body and the floating gate electrode. A second dielectric layer is disposed between the control gate electrode and the floating gate electrode. |
| US07804121B2 |
Flash memory device and programming and erasing methods therewith
A flash memory device and programming and erasing methods therewith is disclosed, to secure the programming and erasing characteristics by changing a structure of a floating gate, in which the flash memory device includes a first conductive type semiconductor substrate defined as a field area and an active area; a tunnel oxide layer on the active area of the first conductive type semiconductor substrate; a floating gate on the tunnel oxide layer, having at least first and second floating gates having different levels of energy band gap; a dielectric layer on the floating gate; a control gate on the dielectric layer; and second conductive type source/drain regions in the active area of the first conductive type semiconductor substrate at both sides of the floating gate. |
| US07804117B2 |
Capacitor over red pixel
A red pixel having a capacitor formed over the photo-conversion region of the pixel. The capacitor can be used by other pixels as a common capacitor. The capacitor is coupled to floating diffusion region shared by a plurality of pixels. The plurality of pixels also share readout circuitry. |
| US07804116B2 |
Solid-state imaging device
A solid-state imaging device having an arrangement in which well contact is achieved for each pixel is provided. In the solid-state imaging device, a well contact part is formed in an activation region of a photoelectric conversion portion. The well contact part fixes a well in which the photoelectric conversion portion and transistors of the pixel are provided at a predetermined potential. |
| US07804112B2 |
Semiconductor device
The semiconductor device according to the present invention includes an SJMOSFET having a plurality of base regions formed at an interval from each other and an SBD (Schottky Barrier Diode) having a Schottky junction between the plurality of base regions. The SBD is provided in parallel with a parasitic diode of the SJMOSFET. |
| US07804111B2 |
Semiconductor device and method for adjusting characteristics thereof
The object of the invention is to provide a semiconductor device including signal-transmission interconnections preferable for transmitting high frequency signal and capability to adjust characteristics of the above signal-transmission interconnections. A semiconductor device according to the present invention consists of a signal-transmission interconnection 20 for transmission of signals, a MOS capacitance element 10 having a gate electrode connected to the signal-transmission interconnection 20, a first voltage-applying interconnection 30 connected to a source and a drain of the MOS capacitance element 10 and applying a voltage to the source and the drain of the MOS capacitance element 10, a second voltage-applying interconnection 40 connected to a well of the MOS capacitance element 10, and applying a voltage to the well of said first MOS capacitance element 10. Jitters occurring in the signal-transmission interconnection 20 can be adjusted by adjusting each of voltages of the first voltage-applying interconnection 30 and the second voltage-applying interconnection 40. |
| US07804109B2 |
Heterojunction bipolar transistor and method for manufacturing the same, and power amplifier using the same
A heterojunction bipolar transistor with InGaP as the emitter layer and capable of both reliable electrical conduction and thermal stability wherein a GaAs layer is inserted between the InGaP emitter layer and AlGaAs ballast resistance layer, to prevent holes reverse-injected from the base layer from diffusing and reaching the AlGaAs ballast resistance layer. |
| US07804106B2 |
P-type nitride semiconductor structure and bipolar transistor
A nitride semiconductor structure is provided which greatly improves ohmic characteristics by repairing process damage by regrowing an indium-containing p-type nitride semiconductor on a p-type nitride semiconductor having the process damage. In addition, a nitride semiconductor bipolar transistor is provided which can greatly improve its current gain and offset voltage. The structure includes an indium-containing p-type nitride semiconductor layer on a p-type nitride semiconductor processed by etching. The bipolar transistor, which has a base layer composed of a p-type nitride semiconductor, has an indium-containing p-type InGaN base layer regrown on a surface of a p-type InGaN base layer exposed by etching an emitter layer. |
| US07804103B1 |
White lighting device having short wavelength semiconductor die and trichromatic wavelength conversion layers
A high color rendering index (CRI) white light emitting device from a short wavelength semiconductor die is encapsulated with nanoparticle-loaded resin. Trichromatic wavelength conversion micro-particles are dispersed layer by layer in a converting sequence from a long emission spectrum to a short emission spectrum. The refractive index of wavelength conversion micro-particles matches that of the nanoparticle-loaded encapsulants. |
| US07804099B2 |
Solid-state light source
A solid-state light source includes at least one stack of light emitting elements. The elements are an inorganic light emitting diode chip and at least one wavelength conversion chip or the elements are a plurality of light emitting diode chips and one or more optional wavelength conversion chips. The wavelength conversion chip may include an electrical interconnection means. The light emitting diode chip may include at least one GaN-based semiconductor layer that is at least ten microns thick and that is fabricated by hydride vapor phase epitaxy. A method is described for fabricating the solid-state light source. |
| US07804090B2 |
Patterned-print thin-film transistors with top gate geometry
A self-aligned, thin-film, top-gate transistor and method of manufacturing same are disclosed. A first print-patterned mask is formed over a metal layer by digital lithography, for example by printing with a phase change material using a droplet ejector. The metal layer is then etched using the first print-patterned mask to form source and drain electrodes. A semiconductive layer and an insulative layer are formed thereover. A layer of photosensitive material is then deposited and exposed through the substrate, with the source and drain electrodes acting as masks for the exposure. Following development of the photosensitive material, a gate metal layer is deposited. A second print-patterned mask is then formed over the device, again by digital lithography. Etching and removal of the photosensitive material leaves the self-aligned top-gate electrode. |
| US07804083B2 |
Phase change memory cell including a thermal protect bottom electrode and manufacturing methods
Memory devices are described along with manufacturing methods. An embodiment of a memory device as described herein includes a bottom electrode, a thermal protect structure on the bottom electrode, and a multi-layer stack on the thermal protect structure. The thermal protect structure comprises a layer of thermal protect material, the thermal protect material having a thermal conductivity less than that of the bottom electrode material. |
| US07804075B2 |
Method and system for tomographic imaging using fluorescent proteins
A system for optical tomography includes an apparent light source adapted to project excitation light toward a specimen having fluorescent proteins therein, wherein the excitation light enters the specimen becoming intrinsic light within the specimen, wherein the intrinsic light is adapted to excite fluorescent light from the fluorescent proteins, and wherein the intrinsic light and the fluorescent light are diffuse. A method of optical tomography includes generating the excitation light with the apparent light source, wherein the intrinsic light and the fluorescent light are diffuse. |
| US07804074B2 |
Lightray treatment device for hardening fingernail modeling compounds
A lightray treatment device (1) for hardening fingernail modeling compounds has a lightray treatment chamber (3) enclosed in a housing (2) and can be comfortably reached by both the left and right hands of a user of the device (1). The housing (2) has two oppositely located wall openings (6, 7) and a hand support surface (8, 9) with a thumb support (12, 13) assigned to each wall opening (6, 7) in the lightray treatment chamber (3). At least two light sources (10, 11) are arranged in the lightray treatment chamber (3), of which the first light source (10) is used for treating the thumb with light and is arranged in front of the thumb supports (12, 13) of the hand support surfaces (8, 9), and the second light source (11) is arranged in the ceiling of the lightray treatment chamber (3). |
| US07804072B2 |
Heterogeneous capture-gated neutron spectrometer
A system and method for a heterogeneous capture-gated neutron detector are disclosed. The system includes an inorganic hydrogenous scintillating layer configured to emit at least one collision photon when contacted with a neutron having an energy greater than a predetermined value. A neutron capture layer is located adjacent the inorganic or organic hydrogenous scintillating layer and configured to capture the neutron and emit at least one gamma ray. The inorganic or organic hydrogenous scintillating layer is further configured to emit at least one capture photon in response to the at least one gamma ray from the neutron capture layer. Detection of the collision photon and capture photon designate a detected and captured neutron. |
| US07804066B2 |
Charged-particle beam apparatus
Provided is a charged-particle beam apparatus capable of preventing a small amount of dust from being attached to an electrostatic lens serving as an objective lens to apply a high voltage to the electrostatic lens.The charged-particle beam apparatus 1 includes a chamber 2 which has an interior 2a evacuated by an intra-chamber evacuating means 4, and a lens-barrel 3 which emits a charged-particle beam B1 onto a sample S put in the interior 2a of the chamber 2. The lens-barrel 3 includes a cylindrical body 5 which includes an emission outlet 6 for emission of the charged-particle beam B1, a charged-particle supply part 7 which is housed at a side of a proximal end 5b in an interior 5a of the cylindrical body 5 and releases the charged-particle beam B1, and an objective lens 11 which is housed at a side of a distal end 5b in the interior 5b of the cylindrical body 5 and has an electrostatic lens for generating an electric field and converging the charged-particle beam B1 released from the charged-particle supply part 7. The cylindrical body 5 of the lens-barrel 3 is provided with a gas supplying means 12 capable of supplying a gas G to the interior 5b of the cylindrical body 5, and the gas supplying means 12 is provided at a side of a proximal end of the objective lens 11. |
| US07804065B2 |
Methods of calibrating and operating an ion trap mass analyzer to optimize mass spectral peak characteristics
A method for calibrating an ion trap mass spectrometer is disclosed. The method includes steps of identifying a phase (defined by the RF trapping and resonant ejection voltages) that optimizes peak characteristics, and then determining, for each of a plurality of calibrant ions, an optimal resonant ejection voltage amplitude when the ion trap is operated at the identified phase. The resonant ejection voltage applied to the electrodes of the ion trap may then be controlled during analytical scans in accordance with the established relationship between m/z and resonant ejection voltage amplitude. |
| US07804063B2 |
Methods for detecting dihydrotestosterone by mass spectrometry
Provided are methods for determining the amount of dihydrotestosterone (DHT) in a sample using mass spectrometry. The methods generally involve ionizing DHT in a sample and detecting and quantifying the amount of the ion to determine the amount of DHT in the sample. |
| US07804059B2 |
Method and apparatus for accurate calibration of VUV reflectometer
A calibration technique is provided that utilizes a standard sample that allows for calibration in the wavelengths of interest even when the standard sample may exhibit significant reflectance variations at those wavelengths for subtle variations in the properties of the standard sample. A second sample, a reference sample may have a relatively featureless reflectance spectrum over the same spectral region and is used in combination with the calibration sample to achieve the calibration. In one embodiment the spectral region may include the VUV spectral region. |
| US07804052B2 |
Methods and apparatuses for pixel testing
Methods and apparatuses for non-optical testing of imaging devices having an array of pixels are provided. One or more pixels are tested by setting the photoconversion device and/or a floating diffusion region to a known voltage level that is different from that used to operate the pixel during non-test operation. The pixel is then sampled and compared to an expected value. |
| US07804051B2 |
Geodetic target object and surveying system with a structural integration of transmitting channels and receiving channels into a common unit with a reflector component
Disclosed is a geodetic target object comprising at least one reflector surface, a receive channel with a detector (18) for receiving electromagnetic radiation (ES) transmitted by a measuring unit (2″), and a transmit channel with a radiation source (13′). The associated transmission port and/or reception port is/are integrated into the reflector surface or is/are embodied so as to adjoin the reflector surface such that radiation (RS) that is modulated for transmitting data can be transmitted in the direction of the measuring unit (2″) within the cross section (5″) of the radiation (ES) generated by the measuring unit (2″). |
| US07804048B2 |
Structure for cooling a surface
An apparatus for cooling a surface having a metal structure made of a material with high thermal conductivity, and designed to provide efficient cooling of the surface while minimizing mechanical stress between the metal structure and the surface. |
| US07804046B2 |
Acoustic heater and acoustic heating system
In order that an object can be warmed through the use of thermoacoustic effect, the acoustic heating apparatus includes a first stack 3a sandwiched between a high-temperature-side heat exchanger 4 and a low-temperature input-side heat exchanger 5 in a first tube portion 2a and a second stack 3b sandwiched between a low-temperature-side heat exchanger 6 and a high-temperature output-side heat exchanger 7 in a second tube portion 2b. A standing wave and a traveling wave are generated through self excitation in the first tube portion 2a by cooling the low-temperature input-side heat exchanger 5 to minus 20° C. to 60° C. A temperature gradient is generated in the second stack 3b by propagating the resulting standing wave and the traveling wave to the second tube portion 2b, and high-temperature heat is output due to this temperature gradient from the high-temperature output-side heat exchanger 7 disposed on the second stack 3b side. |
| US07804044B2 |
Heating device and method for the production thereof and heatable object and method for producing same
A heating device having a layer containing electrically conductive plastic. The layer exhibits adhesive characteristics at least in some sections on at least one side. A heatable object equipped with a heating device of this type. The layer containing electrically conductive plastic is connected to at least one component of an object. A. radiant heating system including a support and a heating layer containing electrically conductive plastic, whereby the heating layer is formed by a flexible film and the support is also flexible. Methods to produce such products and apparatus. |
| US07804039B2 |
Liquid phase diffusion bonding method of metal machine part and such metal machine part
A liquid phase diffusion bonding method for a metal machine part superior in the quality of the joint and the productivity enabling the bonding time to be shortened, achieving homogenization of the bonding structure and improving the tensile strength, fatigue strength, and joint quality and reliability. This liquid phase diffusion bonding method of a metal machine part is characterized interposing an amorphous alloy foil for liquid phase diffusion bonding at bevel faces of metal materials, performing primary bonding by melt bonding said amorphous alloy foil and said metal material by resistance welding to form a joint, then performing secondary bonding by liquid phase diffusion bonding by reheating said joint to at least the melting point of said amorphous alloy foil, then holding it there to complete the solidification process of said joint. |
| US07804037B2 |
Push button assembly
A push button assembly comprises a button (1) with an actuating structure (5) movably mounted within a housing (2) for operation of a switch (20). The housing (2) provides a frame (18) comprising side wall structures (16), with a flange structure (15) mounted at a top open end thereof, The axial length of the housing (2) is shorter than the horizontal length of the side wall structures (16), resulting in a short push button assembly. The button (1) is illuminable via a lamp (25) which is provided on a carrier strip (22), the switch (20) being mounted on a body (19), both of which can be removably mounted substantially within the confines of the housing (2), with respective connection terminals (23, 21) projecting outward thereof, the assembly therefore occupying minimal space behind a panel when mounted on such a panel of an amusement or gaming machine where space may be restricted. |
| US07804035B1 |
Switch mechanism, and associated method, for light assembly or other electrical device
An apparatus designed to suspend an electrical device such as a light bulb and to turn the light bulb on or off by exerting a force on the bulb itself, an encasing around the bulb, the conductive leads, or an extension thereof. When force is exerted, tension causes a tension bar actuator to actuate an electrical switch, thus turning the bulb on or off. |
| US07804032B2 |
Section for a window or facade and electric cable for a section for a window, door or facade
A frame section for a window or a door or a façade. The frame section includes an external shell and an internal shell. Each shell has hollow chambers. At least one of the shells includes a first groove and a second groove. The first groove is configured to accommodate hardware fittings. The second groove is configured to accommodate a cable. |
| US07804029B1 |
Electromagnetic wrap
A device and method for altering the line reactance of a transmission line having a transmission line, a first floating conductor and a grounding (shielding) conductor. The first floating conductor is positioned between and electrically insulated from the transmission line and the grounding conductor. A source and a load are connected at opposite ends of the transmission line. |
| US07804008B2 |
Plants and seeds of corn variety CV609128
According to the invention, there is provided seed and plants of the corn variety designated CV609128. The invention thus relates to the plants, seeds and tissue cultures of the variety CV609128, and to methods for producing a corn plant produced by crossing a corn plant of variety CV609128 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV609128 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV609128. |
| US07804004B2 |
Plants and seeds of corn variety CV906975
According to the invention, there is provided seed and plants of the corn variety designated CV906975. The invention thus relates to the plants, seeds and tissue cultures of the variety CV906975, and to methods for producing a corn plant produced by crossing a corn plant of variety CV906975 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV906975 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV906975. |
| US07804003B2 |
Plants and seeds of corn variety CV603860
According to the invention, there is provided seed and plants of the corn variety designated CV603860. The invention thus relates to the plants, seeds and tissue cultures of the variety CV603860, and to methods for producing a corn plant produced by crossing a corn plant of variety CV603860 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV603860 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV603860. |
| US07804001B2 |
Plants and seeds of corn variety CV476579
According to the invention, there is provided seed and plants of the corn variety designated CV476579. The invention thus relates to the plants, seeds and tissue cultures of the variety CV476579, and to methods for producing a corn plant produced by crossing a corn plant of variety CV476579 with itself or with another corn plant, such as a plant of another variety. The invention further relates to corn seeds and plants produced by crossing plants of variety CV476579 with plants of another variety, such as another inbred line. The invention further relates to the inbred and hybrid genetic complements of plants of variety CV476579. |
| US07803995B1 |
Soybean cultivar S07-03RM886409
The present invention is in the field of soybean cultivar S07-03RM886409 breeding and development. The present invention particularly relates to the soybean cultivar S07-03RM886409 and its progeny, and methods of making S07-03RM886409. |
| US07803985B2 |
Gene cluster involved in biosynthesis of isopentenyl diphosphate in the non-mevalonate pathway of Hevea brasiliensis
According to this invention, a gene cluster involved in the non-mevalonate pathway of Hevea brasiliensis was obtained and nucleotide sequences of these genes were determined. The gene cluster according to this invention involved in the IPP biosynthesis in the non-mevalonate pathway is involved in the biosynthesis of vitamin E and carotenoids. Therefore, the Hevea brasiliensis obtained by introducing the gene cluster of the present invention can be expected to produce high-quality rubber with improved permanence. |
| US07803984B2 |
Compositions and methods for controlling plant parasitic nematodes
The present invention relates to compositions and methods for controlling nematode infestation of plants. In particular, the present invention provides vectors comprising sequences designed to control nematodes by RNA interference (RNAi) and transgenic plants transformed with such vectors. |
| US07803982B2 |
T1R3 transgenic animals, cells and related methods
The present invention relates to the discovery, identification and characterization of a receptor protein, referred to herein as T1R3, which is expressed in taste receptor cells and associated with the perception of bitter and sweet taste. The invention encompasses transgenic animals and cells that do not express functional T1R3 protein, particularly knock-out animals and cells, and transgenic animals and cells that express a non-native T1R3 protein. Experimental model systems based on these animals and cells can be used to study T1R3-mediated taste transduction and responses of the components of the T1R3 signal transduction pathway to various tastants, furthering our understanding of the molecular biology and biochemistry of taste. Such model systems would also be useful for screening for novel tastants and taste modulators, such as enhancers of desirable flavors, and blockers of undesirable flavors. |
| US07803981B2 |
Transgenic ungulates capable of human antibody production
The invention features novel methods for the production of large quantities of xenogenous antibodies, such as human antibodies. Preferably, this result is effected by inactivation of IgM heavy chain expression and, optionally, by inactivation of Ig light chain expression, and by the further introduction of an artificial chromosome which results in the expression of xenogenous antibodies (e.g., non-bovine antibodies), preferably human antibodies. |
| US07803979B2 |
Method for removing water from an alkylation process system
A method is disclosed for removing water from an alkylation process system using a water removal column to remove water from a re-run column (catalyst regeneration column) overhead stream. |
| US07803976B2 |
Alkylaromatics production
A process for alkylation of an alkylatable aromatic compound to produce a monoalkylated aromatic compound, comprising the steps of: (a) providing at least one reaction zone having a water content with at least one alkylation catalyst having an activity and a selectivity for said monoalkylated benzene, said alkylation catalyst comprising a porous crystalline molecular sieve of a MCM-22 family material, said MCM-22 family material is characterized by having an X-ray diffraction pattern including d-spacing maxima at 12.4±0.25, 3.57±0.07 and 3.42±0.07 Angstroms; (b) supplying the reaction zone with at least one alkylatable aromatic compound and at least one alkylating agent; (c) operating the reaction zone under suitable alkylation or transalkylation conditions, to produce at least one effluent which comprises a monoalkylated aromatic compound and a polyalkylated aromatic compound(s); (d) monitoring the amount of the monoalkylated aromatic compound or the amount of the polyalkylated aromatic compound(s) in the effluent; (e) adjusting the water content in the reaction zone to secure a desired amount of the monalkylated aromatic compound or the polyalkylated aromatic compound(s) in the effluent, the water content in the reaction zone being in a range from about 1 wppm to about 900 wppm; and wherein the polyalkylated aromatic compound(s) produced is reduced as compared to the reaction zone having a water content of about 0 wppm when the reaction zone is operated under equivalent conditions. |
| US07803973B2 |
Process for producing fluoropropenes
Dehydrohalogenation processes for the preparation of fluoropropenes from corresponding halopropanes, in which the fluoropropenes have the formula CF3CY═CXNHP, wherein X and Y are independently hydrogen or a halogen selected from fluorine, chlorine, bromine and iodine; and N and P are independently integers equal to 0, 1 or 2, provided that (N+P)=2. |
| US07803972B2 |
Shell catalyst, in particular for oxidation of methanol to formaldehyde, and also method for production thereof
The invention relates to a coated catalyst, especially for oxidation of methanol to formaldehyde, which, on an inert, preferably essentially nonporous, support body, has at least one coating which comprises, before the removal of the organic fractions of components b) and c): (a) oxides, or precursor compounds convertible to the corresponding oxides, of molybdenum and iron, where the molar ratio of Mo:Fe is between 1:1 and 5:1, and optionally further metallic components or metal oxide components or precursor compounds convertible to the corresponding oxides, (b) at least one organic binder, preferably an aqueous dispersion of copolymers, especially selected from vinyl acetate/vinyl laurate, vinyl acetate/ethylene, vinyl acetate/acrylate, vinyl acetate/maleate, styrene/acrylate or mixtures thereof, and (c) at least one further component selected from the group consisting of SiO2 sol or precursors thereof, Al2O3 sol or precursors thereof, ZrO2 sol or precursors thereof, TiO2 sol or precursors thereof, waterglass, MgO, cement, monomeric, oligomeric or polymeric silanes, alkoxysilanes, aryloxysilanes, acryloyloxysilanes, aminosilanes, siloxanes or silanols. Additionally described is a process for preparing the catalyst and its preferred use. |
| US07803970B2 |
Multi-substitued selective androgen receptor modulators and methods of use thereof
This invention provides a class of androgen receptor targeting agents (ARTA). The agents define a new subclass of compounds, which are selective androgen receptor modulators (SARM). Several of the SARM compounds have been found to have an unexpected androgenic and anabolic activity of a nonsteroidal ligand for the androgen receptor. Other SARM compounds have been found to have an unexpected antiandrogenic activity of a nonsteroidal ligand for the androgen receptor. The SARM compounds, either alone or as a composition, are useful for a) male contraception; b) treatment of a variety of hormone-related conditions, for example conditions associated with Androgen Decline in Aging Male (ADAM), such as fatigue, depression, decreased libido, sexual dysfunction, erectile dysfunction, hypogonadism, osteoporosis, hair loss, anemia, obesity, sarcopenia, osteopenia, osteoporosis, benign prostate hyperplasia, alterations in mood and cognition and prostate cancer; c) treatment of conditions associated with Androgen Decline in Female (ADIF), such as sexual dysfunction, decreased sexual libido, hypogonadism, sarcopenia, osteopenia, osteoporosis, alterations in cognition and mood, depression, anemia, hair loss, obesity, endometriosis, breast cancer, uterine cancer and ovarian cancer; d) treatment and/or prevention of acute and/or chronic muscular wasting conditions; e) preventing and/or treating dry eye conditions; f) oral androgen replacement therapy; and/or g) decreasing the incidence of, halting or causing a regression of prostate cancer. |
| US07803968B2 |
Method for making carboxylic acids
The present invention relates to a process for producing carboxylic acids. It relates more particularly to a process for producing carboxylic acids by oxidation of a hydrocarbon with oxygen or a gas containing oxygen, and even more particularly to the oxidation of cyclohexane to adipic acid. The invention relates to a process for producing carboxylic acids by oxidation with oxygen or a gas containing oxygen of a cycloaliphatic hydrocarbon in the presence of an oxidation catalyst and of a monocarboxylic oxidation solvent that is lipophilic in nature, comprising a step of extraction of the dicarboxylic acids formed in the oxidation step, consisting in carrying out, in liquid phase, an extraction of the diacids using water. |
| US07803967B2 |
4-alkoxy-cyclohexane-1-amino-carboxylic esters and processes for their preparation
The invention relates to novel 4-alkoxy-cyclohexane-1-amino-carboxylic esters of the formula (IV) in which R1 and R2 are as defined in the description, to intermediates and processes for their preparation and to their use as intermediates in the synthesis of insecticidal, acaricidal and herbicidal compounds or pharmaceutically active compounds. |
| US07803965B2 |
Method for recovery of ethylene in a recirculating gas process for the production of vinyl acetate
The efficiency of vinyl acetate production is increased by scrubbing of off gas followed by CO2 absorption. A portion of the off gas containing substantial quantities of ethylene is recycled to the process, whereas another portion is employed in another ethylene consuming reaction. Despite not removing non-reactive gases, selectivity and yield based on ethylene are both increased. |
| US07803962B2 |
Process for the resolution of racemic verapamil
A new process is described for the resolution of racemic verapamil, which allows the desired enantiomer to be obtained in high yields and with high enantiomeric purity. The process uses optically active 2,3-bis[(2-fluorobenzoyl)oxy]butanedioic acid as the resolving agent, and a water/dimethylformamide or water/acetonitrile or water/methanol mixture, as the reaction solvent. |
| US07803957B2 |
Ethylene oxide production using fixed moderator concentration
A method for controlling ethylene oxidation uses ethylene and oxygen, in conjunction with a silver based catalyst, a moderator and a co-moderator, to form ethylene oxide. When controlling the ethylene oxidation reaction, the moderator concentration is maintained constant within a comparatively narrow operative concentration range and the co-moderator concentration is varied within a comparatively wider operative concentration range, to optimize a catalyst property such as the catalyst activity and/or the catalyst selectivity. |
| US07803952B2 |
Manufacture of lactones
The present invention relates to a process for the manufacture of cyclic monocarboxylic esters (lactones) and related compounds by hydrogenation of cyclic dicarboxylic acid anhydrides in the presence of metal catalysts. |
| US07803951B2 |
Glucagon receptor antagonist compounds, compositions containing such compounds and methods of use
Substituted aryl and heteroaryl derivatives are disclosed. The compounds are useful for treating type 2 diabetes and related conditions. Pharmaceutical compositions and methods of treatment are also included. |
| US07803950B2 |
Method for the production of diarylcycloalkyl derivatives
The invention relates generally to a process for preparing diarylcycloalkyl derivatives of the formula (I). wherein the respective R-group substituents are defined herein. These compounds of formula (I) are activators for peroxisome proliferator-activated receptors (PPAR activators) which are useful in the therapeutic treatment of a number of diseases and disorders of the central nervous system such as multiple sclerosis, Parkinson's Disease, psychiatric disorders and the like. The present invention is a novel process for preparing PPAR activators of the formula (I) which do not have the disadvantages of the processes known in the prior art. In particular, a process is provided with which the PPAR activators of formula (I) can be prepared in a suitable enantiomeric excess, i.e. high enantioselectivity, without the need for subsequent chiral chromatography. |
| US07803948B2 |
Method for the isomerisation of transition metal complexes containing cyclometallated, carbene ligands
A process for converting a compound C1 of the formula I in a mer isomer form into an isomeric compound C2 of the formula I in a fac isomer form. |
| US07803947B2 |
Method for producing thiocarbamate derivative
An O-aryl N-(6-alkoxy-2-pyridyl)-N-alkylthiocarbamate represented by the following formula (I): (wherein R1, R2 and Ar are as defined below) is produced by treating a phenol represented by the following general formula (IV): Ar—OH (IV) (wherein Ar represents an aryl group) with a base in a solvent and then adding thereto an alkali metal salt of N-(6-alkoxy-2-pyridyl)-N-alkyldithiocarbamic acid represented by the following general formula (III): (wherein R1 and R2 independently represent a C1-C4 alkyl group and M represents an alkali metal) and a halomethane represented by the following general formula (V): CH2XmYn (V) (wherein X and Y represent different halogen atoms, m represents 0, 1 or 2, n represents 0, 1 or 2, and m+n equals 2) for causing a reaction. |
| US07803945B2 |
Tetrahydropyridothiophenes
Compounds of a certain formula (I), in which Ra and Rb have the meanings indicated in the description, are novel effective compounds with anti-proliferative and/or apoptosis inducing activity. |
| US07803942B2 |
Crystals of morphinan derivative and process for producing the same
The present invention is directed to provide 17-cyclopropylmethyl-3,14β-dihydroxy-4,5α-epoxy-6β-[N-methyl-trans-3-(3-furyl)acrylamido]morphinan hydrochloride consistent in quality after production and having high purity. A crystal of 17-cyclopropylmethyl-3,14β-dihydroxy-4,5α-epoxy-6β-[N-methyl-trans-3-(3-furyl)acrylamido]morphinan hydrochloride including a A-form, B-form or C-form crystal thereof, and a process for producing the same are provided. |
| US07803941B2 |
Process for preparing ring-fluorinated aromatics
The present invention relates to an improved process for preparing ring-fluorinated aromatics of the general formula (I) by a halogen exchange reaction (halex reaction) of a plurality of halogen substituents in one stage in the presence of a catalyst. |
| US07803940B2 |
Heteromonocyclic compound or a salt thereof having strong antihypertensive action, insulin sensitizing activity and the like production thereof and use thereof for prophylaxis or treatment of cardiovascular diseases, metabolic diseases and/or central nervous system diseases
A compound represented by the formula (I): wherein R1 is an oxo group, ═N—R or the like; a group represented by the formula: is a group represented by the formula: R2 is a group represented by the formula: R3 and R4 are each H, or C1-C6 alkyl, C3-C6 cycloalkyl, C1-C6 alkoxy, C1-C6 alkylamino, di(C1-C6)alkylamino or C1-C6 alkylthio, each of which is optionally substituted; and R5 is H, or C1-C6 alkyl, C2-C6 alkenyl, cyclic group, each of which is optionally substituted, —CO—R8 or —O—R8′, or a salt thereof. The compound of the present invention is useful as a drug for the prophylaxis or treatment of cardiovascular diseases, metabolic diseases and/or central nervous system diseases. |
| US07803939B2 |
2,4-pyrimidinediamine compounds and their uses
The present invention provides 2,4-pyrimidinediamine compounds that inhibit the IgE and/or IgG receptor signaling cascades that lead to the release of chemical mediators, intermediates and methods of synthesizing the compounds and methods of using the compounds in a variety of contexts, including in the treatment and prevention of diseases characterized by, caused by or associated with the release of chemical mediators via degranulation and other processes effected by activation of the IgE and/or IgG receptor signaling cascades. |
| US07803936B2 |
Compounds and methods for labeling oligonucleotides
The invention provides a novel method of labeling oligonucleotides, with reporter moieties, including but not limited to, quenchers, fluorophores, biotin, digoxigenin, peptides and proteins. In addition, this invention provides a method of detecting hybridization of oligonucleotides. This invention also provides novel azo quenchers having the general formula shown below. The invention further provides compositions comprising labeled oligonucleotides and solid supports. The invention also provides kits comprising at least one composition of the present invention. |
| US07803934B2 |
Parallel preparation of high fidelity probes in an array format
The present invention provides massively parallel oligonucleotide synthesis and purification for applications that utilize large collections of defined high-fidelity oligonucleotides (e.g., from about 101 to about 105 different sequences, generally between 25-160 bases in length). |
| US07803930B2 |
Antisense modulation of apolipoprotein B-expression
Antisense compounds, compositions and methods are provided for modulating the expression of apolipoprotein B. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding apolipoprotein B. Methods of using these compounds for modulation of apolipoprotein B expression and for treatment of diseases associated with expression of apolipoprotein B are provided. |
| US07803928B2 |
Methods and compositions for expression of transgenes in plants
Methods and compositions for the expression of transgenes in monocot plants including maize are disclosed. In the invention, gene silencing is avoided by use of monocot-homeologous sequences from plants of the genus Coix for transformation. Included in these transgene sequences are Coix promoters, enhancers, coding sequences and terminators. Suitable alternatives to maize-derived transgenes are desirable for expression in maize in that homology-based gene silencing can limit or effectively eliminate transgene expression. |
| US07803927B2 |
Methods and compositions for expression of transgenes in plants
Methods and compositions for the expression of transgenes in monocot plants including maize are disclosed. In the invention, gene silencing is avoided by use of monocot-homeologous sequences from plants of the genus Coix for transformation. Included in these transgene sequences are Coix promoters, enhancers, coding sequences and terminators. Suitable alternatives to maize-derived transgenes are desirable for expression in maize in that homology-based gene silencing can limit or effectively eliminate transgene expression. |
| US07803926B2 |
Postweaning multisystemic wasting syndrome and porcine circovirus from pigs
The cloning of a novel PCVII viral genome is described as is expression of proteins derived from the PCVII genome. These proteins can be used in vaccine compositions for the prevention and treatment of PCVII infections, as well as in diagnostic methods for determining the presence of PCVII infections in a vertebrate subject. Polynucleotides derived from the viral genome can be used as diagnostic primers and probes. |
| US07803925B2 |
AXMI-028 and AXMI-029, a family of novel delta-endotoxin genes and methods for their use
Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a delta-endotoxin polypeptide are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated delta-endotoxin nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:2, 4, 15, 17, or 19, or the nucleotide sequence set forth in SEQ ID NO:1, 3, 14, 16, or 18, as well as variants and fragments thereof. |
| US07803924B2 |
HSP60 from arthrobacter
The hsp60 gene from a strain of Arthrobacter has been isolated and sequenced. The encoded protein is believed to be highly immunogenic, especially in fish, and also has utility as a non-specific adjuvant, and as an adjuvanting carrier for heterologous antigens. |
| US07803921B2 |
Sulfotransferase 1E1 sequence variants
Isolated sulfotransferase nucleic acid molecules that include a nucleotide sequence variant and nucleotides flanking the sequence variant are described, as well as sulfotransferase allozymes. Methods for determining if a mammal is predisposed to cancer also are described. |
| US07803920B2 |
ECAT16 gene expressed specifically in ES cells and utilization of the same
The present invention relates to an ES cell detection marker containing a polynucleotide derived from any one of ECAT15-1 gene, ECAT15-2 gene, ECAT16 gene, Rnf17 gene and LOC380905(TDRD4) gene. |
| US07803911B2 |
Dried blood factor composition comprising trehalose
A method for preparing a stable dried composition of blood factor product containing a stabilizing amount of trehalose in the absence of a stabilizing amount of albumin is disclosed. |
| US07803906B2 |
Composition comprising an angiogenesis related protein
Nucleotide sequences and the corresponding polypeptide sequences implicated in the regulation of angiogenesis are identified. The nucleotide and polypeptide sequences, or pharmaceutical compositions made from such sequences, can be used in the clinical study of the angiogenesis process, the prognosis, diagnosis and treatment of pathologies linked to angiogenesis, and in the implementation of pharmacological, pharmacogenomic and drug identification trials. |
| US07803903B2 |
Protein-binding doxorubicin peptide derivatives
The invention relates to low-molecular doxorubicin peptide derivatives containing MMP-2 or MMP-9 divisible peptide sequences and a protein-binding group. |
| US07803899B2 |
Methods to reduce organic impurity levels in polymers and products made therefrom
Various methods are described for preparing dry water-soluble polymers with reduced organic impurity content by combining water-soluble polymer in water with at least one dry polar solvent to form a mixture that separates into a first layer comprising a majority of the solvent and water and a second layer comprising a majority of the polymer, then separating the layers and drying the second layer to obtain a solid comprising the water-soluble polymer. Further, or solid polymer products having reduced organic impurity levels and/or moisture content are also described. |
| US07803898B2 |
Aminoquinoxaline compound, polyaminoquinoxaline compound, and use thereof
An aminoquinoxaline compound represented by the following formula (1a), and a polyaminoquinoxaline compound obtained by polymerizing the aminoquinoxaline compound, wherein R1 and R2 independently represent a hydrogen atom, a hydroxyl group, a C1-C10 alkyl group, a C1-C10 alkoxy group, or the like, R3 and R4 independently represent a hydrogen atom, a halogen atom, a cyano group, a nitro group, an amino group, a C1-C10 alkyl group, a C1-C10 alkoxy group or the like, and X1 represents —NH—R5—NH2 or —NH—R6. |
| US07803897B2 |
Process for preparing polyketone
The present invention relates to a process for preparing polyketone with improved catalytic activity and intrinsic viscosity, and specifically a process for preparing polyketone, using a mixed solvent of 40 to 60 mol % acetic acid and 40 to 60 mol % water, as a liquid medium, and the precursor of palladium chloride-1,3-bis[di(methoxyphenyl)phosphino]propane, as a catalyst component. |
| US07803896B2 |
Polyimide-titania hybrid materials, their preparation, and film prepared from the materials
The present invention relates to polyimide-titania hybrid thin film, which possesses relatively good surface planarization, excellent thermal properties (400 |
| US07803895B2 |
Organosilicon polymer and method of manufacturing thereof
A novel organosilicon polymer, the main chain of which is composed of siloxane units and silalkylene units and to which are bonded organic groups with amide bonds linked to silicon atoms of the molecule. |
| US07803894B2 |
Coating compositions with perfluoropolyetherisocyanate derived silane and alkoxysilanes
Described are coating compositions for treating substrates such as hard and soft surfaces to render the surfaces oil and water repellent, as well as stain and dirt resistant. The compositions described include three component systems in an organic solvent, where the components include a hydrolyzable perfluoropolyetherisocyanate derived silane, and to non-fluorinated components such as alkoxy silanes, one optionally containing a reactive functional group. |
| US07803892B2 |
Aqueous emulsion composition
An aqueous emulsion composition comprising (A) an aqueous resin emulsion comprising a fluorine-containing polymer and (B) a surfactant of the formula: R1O—(CH2CH2O)p—(R2O)q—R3 (1) wherein R1 is an alkyl group or an alkenyl group, R2 is an alkylene group, R3 is a hydrogen atom, an alkyl group or an alkenyl group, p is the number of at least 2, q is the number of at least 1, and p and q are such numbers that the weight ratio of the polyoxyethylene block is from 5 to 80% by weight based on whole molecule, is excellent in stability against impurity and mechanical stability. |
| US07803886B2 |
Ligands and catalyst systems thereof for the catalytic oligomerization of olefinic monomers
The present invention relates to a ligand and its use in a catalyst for the oligomerization of olefinic monomers, the ligand having the general formula (I); P(R4)—P(R1)(R2)═N(R3) (I) wherein: the R1 group and R2 group are independently selected from a hydrocarbyl, substituted hydrocarbyl, heterohydrocarbyl and substituted heterohydrocarbyl group; the R3 is selected from hydrogen, a hydrocarbyl group, a substituted hydrocarbyl group, a heterohydrocarbyl group, a substituted heterohydrocarbyl group, a silyl group or derivative thereof; the R4 group is an optionally substituted alkylenedioxy, alkylenedimercapto or alkylenediamino structure which is bound to the phosphorus atom through the two oxygen, sulphur or nitrogen atoms of the alkylenedioxy, alkylenedimercapto or alkylenediamino structure or an optionally substituted arylenedioxy, arylenedimercapto or arylenediamino structure which is bound to the phosphorus atom through the two oxygen, sulphur or nitrogen atoms of the arylenedioxy, arylenedimercapto or arylenediamino structure. |
| US07803884B2 |
Block copolymers and use thereof
A block copolymer comprising at least one segment having an acid group and at least one segment substantially free from acid groups is provided wherein the segment substantially free from acid groups contains a structure of the following general formula (1): Ar1—Z—Ar2—O—Ar3—Om (1) (wherein, m represents an integer of 10 or more, Ar1, Ar2 and Ar3 represent mutually independently a divalent aromatic group which may be substituted by an alkyl group having 1 to 10 carbon atoms, an alkoxy group having 1 to 10 carbon atoms, an aryl group having 6 to 10 carbon atoms or an aryloxy group having 6 to 10 carbon atoms, and Z represents —CO— or —SO2—, each Z in the segments representing independently —CO— or —SO2—). The block copolymer exhibits more excellent performances as a polymer electrolyte for fuel cells or the like. |
| US07803881B2 |
Process for amination of acrylic macromonomers and products therefrom
Processes for forming adducts of amines with acrylic macromonomers are provided. Also provided are processes for using ring-closing reactions of the adducts to form lactams. The adducts are useful, for example, for making adhesives, surfactants, viscosity modifiers, processing aids, and other products. |
| US07803878B2 |
Process for preparing polymer emulsions and polymers formed therefrom
An aqueous polymer emulsion comprising water and swollen multi-stage polymer is provided. The swollen multi-stage polymer has low dry bulk density, as measured by centrifugation. To achieve the low dry bulk density, the polymer is highly swollen in such a way that it does not subsequently collapse. The polymer is useful in paint and paper coatings. |
| US07803877B2 |
Block polymers and cosmetic compositions and processes comprising them
The present invention relates to novel block polymers comprising at least one first block and at least one second block that are incompatible with each other, have different glass transition temperatures (Tg), and are linked together via an intermediate segment comprising at least one constituent monomer of the at least one first block and at least one constituent monomer of the at least one second block. The block polymer has a polydispersity index I of greater than 2. The invention also relates to cosmetic compositions comprising the block polymers and processes for their use. |
| US07803874B2 |
Golf ball material, golf ball and method for preparing golf ball material
The invention provides a golf ball material comprising components (A), (B) and (C): (A) a mixture of different masterbatches prepared by separately masterbatching two or more different metal ions (A1) or a masterbatch prepared by simultaneously masterbatching two or more different metal ions in itself (A2), (B) one or more polymer selected from the group consisting of diene polymers, thermoplastic polymers and thermoset polymers, and (C) one or more polymer having an acid content of from about 0.5 to about 30 wt % and selected from the group consisting of olefin-unsaturated carboxylic acid copolymers, olefin-unsaturated carboxylic acid-unsaturated carboxylic acid ester terpolymers, unsaturated carboxylic anhydride-containing polymers, unsaturated dicarboxylic acid-containing polymers and unsaturated dicarboxylic acid half ester-containing polymers. The invention also provides a method for preparing such a golf ball material, and a golf ball made of the material. The golf ball material has a good thermal stability, flow and processability, making it suitable for injection-molding. Moreover, this material is ideal for producing, without any loss of the rebound resilience of golf ball parts molded from the material, high-performance golf balls having excellent durability, scuff resistance and flexibility. |
| US07803869B2 |
Water based removable paint formulation and system
A weather resistant, easily removable paint composition for application over a surface or over another paint. The removable paint composition comprises from about 19 to about 34% by weight of a combination of two different acrylic polymers, from about 0.2 to 4% by weight of an aliphatic water-borne urethane polymer, from 0.06% to 0.6% by weight of an alkali, and water. The removable paint composition can be removed without damaging the underlying surface or paint. |
| US07803868B2 |
Addition-crosslinkable silicone compositions with low coefficients of friction
Addition-crosslinkable silicone compositions contain (A) 100 parts by weight of polydiorganosiloxane(s) which has alkenyl groups and whose viscosity is from 5000 to 50,000,000 mPas at 25° C., having at least 2 alkenyl groups per molecule, and at least 0.15 mol % of alkenylsiloxane units, based on all siloxane units, (B) from 1 to 50 parts by weight of polydiorganosiloxane(s) whose viscosity is at least 5,000,000 mPas at 25° C., and having no alkenyl groups, (C) SiH-functional crosslinking agent(s), (D) hydrosilylation catalyst(s), and (E) from 3 to 90 parts by weight of filler(s) whose BET specific surface area is at least 50 m2/g. Vulcanizates of the addition-crosslinkable silicone compositions have low coefficients of friction. |
| US07803865B2 |
Aqueous dispersion, its production method, and its use
Aqueous dispersions including at least one thermoplastic resin; at least one dispersing agent; and water; wherein the dispersion has a pH of less than 12 are disclosed along with dispersions including at least one thermoplastic resin; at least one dispersing agent; and water wherein the dispersion has a volume average particle size of less than about 5 μm. Some dispersions include less than about 4 percent by weight of the dispersing agent based on the weight of the thermoplastic resin. Other dispersions include at least one propylene-rich alpha-olefin interpolymer; at least one dispersing agent; and water. Methods of making such dispersions are also described. |
| US07803862B2 |
Composition for polyolefin resin foam, foam of the same, and process for producing foam
A composition for polyolefin resin foam, which comprises a polymer component comprising a polyolefin resin and a rubber and/or thermoplastic elastomer, and a powder particle, wherein the composition has an extensional viscosity as measured with a capillary rheometer (temperature, 200° C.; shear rate, 5,000 [1/s]) of from 20 to 100 kPa·s. |
| US07803857B2 |
Mono- or multilayer stabilized polyester film
Biaxially oriented mono- or multilayered polyester film containing at least one UV stabilizer according to formula (I): wherein R1 is —H, C1-C12-alkyl, -aryl, —S—(C1-C12)-alkyl or —O—R9 or —O—(C1-C5)-alkylene-C(O)O—R9, wherein R9 is -aryl or C1-C12-alkyl, R3 and R4 and R2, R5, R6, R7 and R8 independently from each other represent —H, —(C1-C12)-alkyl, —O—(C1-C12)-alkyl, -aryl or —O-aryl, wherein said alkyl radicals with more than two C-atoms and alkylene radicals with more than one C-atom can be linear or branched. |
| US07803855B2 |
Wood composites, methods of production, and methods of manufacture thereof
An adhesive binder comprising a phenol-formaldehyde resin, polyvinyl ester resin, and a protein is disclosed. The adhesive binder is useful for preparing wood composites. |
| US07803844B2 |
Composition for preventing and/or treating bone disease, physiologically functional or health food containing thereof, and pharmaceutical containing thereof as active ingredients
The present invention provides the pharmaceutical compositions, the pharmaceutical preparations thereof as an active ingredient, the health food, the food with health-promoting benefits and the like. The present invention provides the above-mentioned pharmaceutical preparations and the like comprising at least one of the compound shown in the following formula (I), physiologically acceptable salt thereof, or hydrate thereof. (wherein, R′1, R′2, and R′3 are independently a hydrogen atom, OH, or alkoxy group having C1 to C3, respectively. R1, R2, and R3 are independently a hydrogen atom or alkenyl group having C3 to C5, respectively). |
| US07803840B2 |
Utilization of dialkylfumarates
The present invention relates to the use of certain dialkyl fumarates for the preparation of pharmaceutical preparations for use in transplantation medicine or for the therapy of autoimmune diseases and said compositions in the form of micro-tablets or pellets. For this purpose, the dialkyl fumarates may also be used in combination with conventional preparations used in transplantation medicine and immunosuppressive agents, especially cyclosporines. |
| US07803835B2 |
Substituted acetic acid derivatives
The present invention relates generally to substituted acetic acid derivatives and methods of using them. |
| US07803832B2 |
N-(1-arylpyrazol-4L)sulfonamides and their use as parasiticides
The invention relates to a sulfonamide compound of formula (I) or a pharmaceutically, veterinarily or agriculturally acceptable salt or solvate thereof, where the groups R1-R5 are described in the description, to compositions comprising such compounds, processes for their synthesis and their use as parasiticides. |
| US07803829B2 |
Use of a kinase inhibitor for the treatment of particular resistant tumors
The invention provides low molecular weight compounds, namely 1H-thieno[2,3-c]pyrazoles, showing a high affinity for the ATP pocket of ABL tyrosine kinase. These compounds are thus ATP-competitive tyrosine kinase inhibitors displaying a significant inhibitory potency also, and in particular, towards BCR-ABL inhibitor-resistant T315I ABL mutants. The compounds of the invention find a useful application in the treatment of BCR-ABL inhibitor-resistant ABL-mediated diseases, such as Imatinib-resistant chronic myelogenous leukemia. Moreover, the invention provides a screening method for the identification of compounds capable of binding the ATP pocket of a kinase protein, in particular of the T315I mutant ABL kinase. |
| US07803821B2 |
Fungicide N-cycloalkyl-carboxamide, thiocarboxamide and N-substituted-carboximidamide derivatives
The present invention relates to N-cycloalkyl-carboxamide, N-cycloalkyl-thiocarboxamide and N-cycloalkyl-N-substituted carboximidamide derivatives of formula (I) wherein A represents carbo-linked, 5-membered heterocyclyl groups, T represents O, S, NRc, N—ORd, N—NRcRd or N—CN, Z1 represents cycloalkyl groups and Z2 and Z3, W1 to W5 represent various substituents; their process of preparation, their use as fungicide active agents, particularly in the form of fungicide compositions, and methods for the control of phytopathogenic fungi, notably of plants, using these compounds or compositions. |
| US07803819B2 |
DPP IV inhibitors
The present invention relates to compounds of formula (I) wherein R1, R2, and X are as defined in the description and claims, and pharmaceutically acceptable salts thereof. The compounds are useful for the treatment and/or prophylaxis of diseases which are associated with DPP IV, such as diabetes, particularly non-insulin dependent diabetes mellitus, and impaired glucose tolerance. |
| US07803811B2 |
1,2,3-substituted indolizine derivatives, inhibitors of FGFs, method for preparing them and pharmaceutical compositions containing them
The present invention relates to novel 1,2,3-substituted indolizine derivative which are inhibitors of fibroblast growth factors, to methods or preparing such derivatives, to pharmaceutical compositions comprising such derivatives, and to methods of treatment comprising such derivatives. |
| US07803810B2 |
Inhibitors
Compounds of formula (I), combinations and uses thereof for disease therapy, or a pharmaceutically acceptable salt or solvate thereof, including all tautomers, stereoisomers and polymorphs thereof wherein: R1 represents C2-8alkyl; C2-8alkenyl; —(C1-6alkyl)-aryl; —(C1-6alkyl)-heteroaryl; —(C1-6alkyl)-carbocyclyl; —(C1-6alkyl)-heterocyclyl; -aryl; -heteroaryl; -carbocyclyl or -heterocyclyl; wherein said aryl or heteroaryl groups may be optionally substituted by one or more substituents selected from, C1-4alkyl, C1-4-fluoroalkyl, C1-4alkoxy, C1-4-fluoroalkoxy, hydroxy, —SO2(C1-4alkyl), —SO2N(C1-4alkyl)(C1-4alkyl), —SOC1-4alkyl, —SOC3-6cycloalkyl —C(O)O(C1-4alkyl), benzyloxy and phenyl; and wherein said carbocyclyl and heterocyclyl groups may be optionally substituted by one or more substituents selected from —C1-4 alkyl, —C1-4 alkoxy, hydroxyl, halogen and oxo; R2 represents H; C1-4alkyl or halogen; R3 represents H; C1-4alkyl or halogen; and R4 represents H; C1-4alkyl or halogen. |
| US07803789B2 |
Vitamin D analog—RAK, methods and uses thereof
Compounds of formula IA or IB are provided where X1, X2 and X3 are independently selected from H or hydroxy protecting groups and R1 is selected from straight or branched chain alkyl groups having from 1 to 8 carbon atoms; straight or branched chain alkenyl groups having from 2 to 8 carbon atoms; straight or branched chain hydroxy-substituted alkyl groups having from 1 to 8 carbon atoms; straight and branched chain hydroxy-substituted alkenyl groups having from 2 to 8 carbon atoms. Such compounds are used in preparing pharmaceutical compositions and are useful in treating a variety of biological conditions. |
| US07803787B2 |
Composition and method for treating connective tissue damage by transmucosal administration
The present invention provides a composition, and a method of use thereof for treating connective tissue damage in man and in animals, which comprises a therapeutically effective amount of chondroitin sulfate, N-acetyl D-glucosamine, and hyaluronan (hyaluronic acid). Particularly, the present invention provides a composition, and a method of use thereof, for treating connective tissue damage including, but not limited to, arthritic disease, osteoarthritis, rheumatoid arthritis, osterochondrosis dessicans, cartilage damage, joint injury, joint inflammation, joint synovitis, degenerative joint disease (DJD), post surgical DJD, traumatic injury, fracture, tendon damage, ligament damage, skeletal damage, musculoskeletal damage, fiber damage, adipose tissue damage, blood cell damage, and plasma damage. Compositions for delivery of the present invention include those for parenteral, oral, and transmucosal delivery and for direct surgical placement onto the affected tissues. |
| US07803786B2 |
Pharmaceutical co-crystal compositions and related methods of use
The present invention comprises pharmaceutical compositions comprising a co-crystal of an API and a co-crystal former, and methods of making and using the same. |
| US07803785B2 |
Gemcitabine prodrugs, pharmaceutical compositions and uses thereof
The present invention provides gemcitabine prodrugs, methods of making gemcitabine prodrugs, pharmaceutical compositions of gemcitabine prodrugs and methods of using gemcitabine prodrugs and pharmaceutical compositions of using gemcitabine prodrugs to treat or prevent diseases or disorders such as cancer or viral infections. |
| US07803783B2 |
Use of WNT inhibitors to augment therapeutic index of chemotherapy
Methods and compositions are provided for the protection of normal cells from cytoreductive therapy that target proliferating cells, by administering an inhibitor of Wnt signaling pathways. Wnt signaling is critically important for homeostasis of the epithelial lining of the adult intestine and other proliferating normal adult tissues. |
| US07803781B2 |
Modulation of growth hormone receptor expression and insulin-like growth factor expression
Compounds, compositions and methods are provided for modulating the expression of growth hormone receptor and/or insulin like growth factor-I (IGF-I). The compositions comprise oligonucleotides, targeted to nucleic acid encoding growth hormone receptor. Methods of using these compounds for modulation of growth hormone receptor expression and for diagnosis and treatment of disease associated with expression of growth hormone receptor and/or insulin-like growth factor-I are provided. Diagnostic methods and kits are also provided. |
| US07803773B2 |
Controlled release formulations of octreotide
A formulation of octreotide or pharmaceutically acceptable salts thereof, which provides controlled release of a therapeutically effective amount of octreotide for a period of at least about two months. Methods of treating acromegaly, decreasing growth hormone, decreasing IGF-1, and treating conditions associated with carcinoid tumors and VIPomas by administering a controlled release formulation of octreotide are provided herein. |
| US07803769B2 |
OSK1 peptide analogs and pharmaceutical compositions
Disclosed is a composition of matter comprising an OSK1 peptide analog, and in some embodiments, a pharmaceutically acceptable salt thereof. A pharmaceutical composition comprises the composition and a pharmaceutically acceptable carrier. Also disclosed are DNAs encoding the inventive composition of matter, an expression vector comprising the DNA, and host cells comprising the expression vector. Methods of treating an autoimmune disorder and of preventing or mitigating a relapse of a symptom of multiple sclerosis are also disclosed. |
| US07803763B2 |
Method of purifying preproinsulin
The invention relates to a method for the chromatographic purification of preproinsulins, in which higher molecular weight substances are removed from an aqueous solution of preproinsulin by a first chromatography on an anion exchanger in flow-through mode and a subsequent second chromatography on a cation exchanger in adsorption mode, and to a method for preparing insulins, which includes the method for preparing preproinsulins. |
| US07803761B2 |
Viral capsid proteins and any peptides or compositions thereof for the treatment of pathologic disorders
The present invention relates to viral capsid proteins, as a medicament for the treatment of a pathologic disorder. More particularly, the invention relates to the viral capsid proteins VP1, VP2 and VP3, preferably, the SV40 VP1 or any peptide, fragment, mutant, derivative and mixtures thereof or of virus-like particles (VLP's) comprising the same, as the active ingredient in compositions for the treatment of pathologic disorders, preferably disorders associated with inactivation of cellular proteins involved with quality control processes, particularly, chaperones. The invention further provides methods for the treatment of such disorders and the use of the SV40 capsid proteins for the preparation of pharmaceutical compositions. |
| US07803759B2 |
S-nitrosoprotein preparation and production method therefor
A protein is efficiently nitrosylated with nitrogen monoxide by merely mixing S-nitrosoglutathione as a nitrogen monoxide donor with a protein solution containing a stabilizing agent comprising at least one compound or a combination of plural compounds selected from an N-acetylamino acid, a fatty acid, and a fatty acid salt. The method that enables efficient NO addition to a cysteine residue in un-nitrosylated protein without changing the structure of protein and hence provides NO to a living organism. |
| US07803758B2 |
I kappa B kinase complex as a target for the treatment of Huntington's disease
The present invention provides methods and compositions for protecting cells from the toxicity of mutant huntingtin (Htt) protein and for treatment of Huntington's disease (HD). The methods generally involve administering to cells or a patient an effective amount of an IKK inhibitor. In addition, methods are provided for identifying therapeutics for the treatment of HD. |
| US07803752B2 |
Method of inducing neuronal production in the caudate nucleus and putamen
The present invention relates to methods of inducing neuronal production in the brain, recruiting neurons to the brain, and treating a neurodegenerative condition by providing a nucleic acid construct encoding a neurotrophic factor, and injecting the nucleic acid construct intraventricularly into a subject's brain. |
| US07803751B2 |
Compositions and methods for detecting phosphomonoester
The invention provides a method of modifying a phosphomonoester moiety of a target compound. The method can include the steps of (a) providing a target compound having an electrophilic moiety and a phosphomonoester moiety; (b) contacting the target compound with a first carbodiimide compound under conditions for preferential addition of the first carbodiimide compound to the electrophilic moiety over the phosphomonoester moiety, thereby forming an electrophile-protected target compound; and (c) contacting the electrophile-protected target compound with a second carbodiimide compound and a nucleophilic compound under conditions for addition of the nucleophilic compound to the phosphomonoester. |
| US07803742B2 |
Thermoset nanocomposite particles, processing for their production, and their use in oil and natural gas drilling applications
Thermoset polymer particles are used in many applications requiring lightweight particles possessing high stiffness, strength, temperature resistance, and/or resistance to aggressive environments. The present invention relates to the use of two different methods, either each by itself or in combination, to enhance the stiffness, strength, maximum possible use temperature, and environmental resistance of such particles. One method is the application of post-polymerization process steps (and especially heat treatment) to advance the curing reaction and to thus obtain a more densely crosslinked polymer network. In general, its main benefits are the enhancement of the maximum possible use temperature and the environmental resistance. The other method is the incorporation of nanofillers, resulting in a heterogeneous “nanocomposite” morphology. In general, its main benefits are increased stiffness and strength. Nanofiller incorporation and post-polymerization heat treatment can also be combined to obtain the benefits of both methods simultaneously. The present invention relates to the development of thermoset nanocomposite particles. It also relates to the optional further improvement of the heat resistance and environmental resistance of said particles via post-polymerization heat treatment. Furthermore, it also relates to processes for the manufacture of said particles. Finally, it also relates to the use of said particles in the construction, drilling, completion and/or fracture stimulation of oil and natural gas wells; for example, as a proppant partial monolayer, a proppant pack, an integral component of a gravel pack completion, a ball bearing, a solid lubricant, a drilling mud constituent, and/or a cement additive. |
| US07803738B2 |
Concentrated herbicide formulation, non-volatile, stable at low temperatures and soluble in water of 2,4-D [(2,4-dichlorophenoxy)acetic] acid
Concentrated herbicide formulation, non-volatile, stable at low temperatures and soluble in water of 2,4-D acid ((2,4-dichlorophenoxy) acetic acid), characterized in that it includes: 45 to 75%, w/v of 2,4-D acid, in the form of a water soluble salt of a primary, secondary, or tertiary amine, or a primary, secondary, or tertiary alkanolamine, or a mixture of both; 1 to 40%, w/v of a humectant selected from a group made up of amine oxides, amide amine oxides, ethoxylated fatty amines, glycerin and its derivatives, sorbitol and its derivatives and polyethyleneglycol, and their mixtures; 0.1 to 20%, w/v of an antifreeze selected from a group made up of glycols; 0.01 to 0.5%, w/v of an antifoaming agent chosen from amongst silicon oil emulsions at 10-30%, surfactant agents based on hydrocarbons such as fatty acids and their salts in hydrocarbon, and alcohols with 8 or more carbon atoms, such as 2-ethylhexanol and isooctanol; optionally, 0.5-10%, w/v of a non-polar solvent; and the rest being water. |
| US07803736B2 |
Supported chromium catalyst and its use for preparing homopolymers and copolymers of ethylene
A process for preparing supported, titanized chromium catalysts is disclosed. The process comprises A) bringing a support material into contact with a protic medium comprising a titanium compound and a chromium compound; B) optionally removing the solvent; C) optionally calcining the precatalyst obtained after step B); and D) optionally activating the precatalyst obtained after step B) or C) in an oxygen-containing atmosphere at from 400° C. to 1100° C. |
| US07803734B2 |
Metal catalyst and method for production thereof
The present invention relates to a metal catalyst containing fine metal particles, characterized in that the fine metal particles have a particle diameter of 3 nm or less and also have a proportion of metallic bond state of 40% or more, which is ascribed by subjecting to waveform separation of a binding energy peak peculiar to the metal as measured by using an X-ray photoelectron spectrometer. The fine metal particles are preferably fine platinum particles. The fine metal particles are preferably supported on the surface of carrier particles by reducing ions of metal to be deposited through the action of a reducing agent in a reaction system of a liquid phase containing the carrier particles dispersed therein, thereby to deposit the metal on the surface of carrier particles in the form of fine particles. The proportion of metallic bond state of the fine metal particles is adjusted within the above range by reducing after deposition thereby to decrease the oxidation state. |
| US07803730B2 |
Method of manufacturing glass and compositions thereof
A solid state particle agglomerate and method for producing the solid state particle agglomerate are provided. The alkaline earth metal source material, aluminum source material and silicon source material that comprise the solid state particle agglomerate are uniformly distributed and in close proximity within the solid state particle agglomerate, enabling the solid state particle agglomerate to form glass in a more energy efficient manner when heated. |
| US07803726B2 |
Duster system for damp and dry dusting
A kit duster pad and a cleaning composition said duster pad comprising at least one layer comprising hydrophilic non-woven fibers capable of contacting a surface to be cleaned; and at least one non-woven layer capable of being attached to a handle, wherein the at least one layer comprises at least one free end; and wherein said cleaning composition comprises a solids content at least about 0.5% by weight of the cleaning composition. |
| US07803718B2 |
BiCMOS performance enhancement by mechanical uniaxial strain and methods of manufacture
A BiCMOS device with enhanced performance by mechanical uniaxial strain is provided. A first embodiment of the present invention includes an NMOS transistor, a PMOS transistor, and a bipolar transistor formed on different areas of the substrate. A first contact etch stop layer with tensile stress is formed over the NMOS transistor, and a second contact etch stop layer with compressive stress is formed over the PMOS transistor and the bipolar transistor, allowing for an enhancement of each device. Another embodiment has, in addition to the stressed contact etch stop layers, strained channel regions in the PMOS transistor and the NMOS transistor, and a strained base in the BJT. |
| US07803715B1 |
Lithographic patterning for sub-90nm with a multi-layered carbon-based hardmask
Multi-layered carbon-based hardmask and method to form the same. The multi-layered carbon-based hardmask includes at least top and bottom carbon-based hardmask layers having different refractive indexes. The top and bottom carbon-based hardmask layer thicknesses and refractive indexes are tuned so that the top carbon-based hardmask layer serves as an anti-reflective coating (ARC) layer. |
| US07803714B2 |
Semiconductor through silicon vias of variable size and method of formation
A through-silicon via structure is formed by providing a substrate having a first conductive catch pad and a second conductive catch pad formed thereon. The substrate is secured to a wafer carrier. A first etch of a first type is performed on the substrate underlying each of the first and second conductive catch pads to form a first partial through-substrate via of a first diameter underlying the first conductive catch pad and a second partial through-substrate via underlying the second conductive catch pad of a second diameter that differs from the first diameter. A second etch of a second type that differs from the first type is performed to continue etching the first partial through-substrate to form equal depth first and second through-substrate vias respectively to the first and second conductive catch pads. |
| US07803713B2 |
Method for fabricating air gap for semiconductor device
A method for fabricating an interconnect structure in a semiconductor device. A masking layer is formed on a dielectric layer formed on a substrate, having at least one opening. The opening is transferred into the dielectric layer. A Plasma stripping process is performed to remove the masking layer, such that a damaged sidewall portion of the dielectric layer surrounding the opening therein is formed. The opening in the dielectric layer is filled with a conductive element. The damaged sidewall portion of the dielectric layer is removed to form a gap between the dielectric layer and the conductive element, wherein substances from removal of the damaged sidewall portion of the dielectric layer are formed on the conductive element. The substances are removed using a citric acid solution. |
| US07803708B2 |
Method for reducing amine based contaminants
Method for reducing resist poisoning. The method includes the steps of forming a first structure in a dielectric on a substrate, reducing amine related contaminants from the dielectric and the substrate prior to a formation of a second structure on the substrate such that the amine related contaminates will not diffuse out from either the substrate or the dielectric, wherein the reducing utilizes a plasma treatment which one of chemically ties up the amine related contaminates and binds, traps, or consumes the amine related contaminates during subsequent processing steps, forming the second structure on the substrate, and after the forming of the first structure, preventing poisoning of a resist layer in subsequent processing by the reducing. |
| US07803707B2 |
Metal silicide nanowires and methods for their production
The present invention provides metal silicide nanowires, including metallic, semiconducting, and ferromagnetic semiconducting transition metal silicide nanowires. The nanowires are grown using either chemical vapor deposition (CVD) or chemical vapor transport (CVT) on silicon substrates covered with a thin silicon oxide film, the oxide film desirably having a thickness of no greater than about 5 nm and, desirably, no more than about 2 nm (e.g., about 1-2 nm). The metal silicide nanowires and heterostructures made from the nanowires are well-suited for use in CMOS compatible wire-like electronic, photonic, and spintronic devices. |
| US07803704B2 |
Reliable interconnects
A method for forming a semiconductor device is presented. The method includes providing a substrate prepared with a dielectric layer formed thereon. The dielectric layer having a conductive line disposed in an upper portion of the dielectric layer. The substrate is processed to produce a top surface of the dielectric layer that is not coplanar with a top surface of the conductive line to form a stepped topography. |
| US07803703B2 |
Metal-germanium physical vapor deposition for semiconductor device defect reduction
The present invention provides a method of manufacturing a metal silicide electrode (100) for a semiconductor device (110). The method comprises depositing by physical vapor deposition, germanium atoms (120) and transition metal atoms (130) to form a metal-germanium alloy layer (140) on a semiconductor substrate (150). The metal-germanium alloy layer and the semiconductor substrate are reacted to form a metal silicide electrode. Other aspects of the present invention include a method of manufacturing an integrated circuit (400). |
| US07803699B2 |
Polysilicon thin film transistor and method of fabricating the same
A polysilicon thin film transistor (TFT) may include a substrate, at least one insulating layer, a semiconductor layer, a gate electrode, a source electrode, a drain electrode, and a heat retaining layer formed to contact the semiconductor layer. The heat retaining layer may reduce and/or prevent a reduction in a melt duration time of amorphous silicon during a crystallization process for forming a polysilicon layer of the TFT. |
| US07803696B2 |
Wafer dividing method
A method of dividing a wafer which is partitioned by a plurality of first dividing lines extending in a predetermined direction and a plurality of second dividing, lines formed in a direction perpendicular to the plurality of first dividing lines, along the first dividing lines and the second dividing lines, comprising the step of forming a first continuous deteriorated layer in the inside of the wafer along the first dividing lines by applying a laser beam along the first dividing lines; the step of forming a second deteriorated layer in the inside of the wafer along the second dividing lines except for the intersections with the first dividing lines by applying a laser beam along the second dividing lines except for the intersections with the first dividing lines; the step of dividing the wafer along the first dividing lines where the first deteriorated layer has been formed by exerting external force to the wafer along the first dividing lines; and the step of dividing the wafer along the second dividing lines where the second deteriorated layer has been formed by exerting external force to the wafer along the second dividing lines. |
| US07803694B2 |
Process for transferring a layer of strained semiconductor material
Semiconductor wafers having a thin layer of strained semiconductor material. These structures include a substrate; an oxide layer upon the substrate; a silicon carbide (SiC) layer upon the oxide layer, and a strained layer of a semiconductor material in a strained state upon the silicon carbide layer, or a matching layer upon the donor substrate that is made from a material that induces strain in subsequent epitaxially grown layers thereon; a strained layer of a semiconductor material of defined thickness in a strained state; and an insulating or semi-insulating layer upon the strained layer in a thickness that retains the strained state of the strained layer. The insulating or semi-insulating layers are made of silicon carbide or oxides and act to retain strain in the strained layer. |
| US07803689B2 |
Semiconductor device manufactured with a double shallow trench isolation process
A method for manufacturing a semiconductor device includes forming a device isolation film by a double Shallow Trench Isolation (STI) process, forming a first active region having a negative slope and a second active region having a positive slope. Additionally, the method includes applying a recess region and a bulb-type recess region to the above-extended active region so as to prevent generation of horns in the active regions. This structure results in improvement in effective channel length and area. |
| US07803688B2 |
Capacitive substrate and method of making same
A capacitive substrate and method of making same in which first and second glass layers are used. A first conductor is formed on a first of the glass layers and a capacitive dielectric material is positioned over the conductor. The second conductor is then positioned on the capacitive dielectric and the second glass layer positioned over the second conductor. Conductive thru-holes are formed to couple to the first and second conductors, respectively, such that the conductors and capacitive dielectric material form a capacitor when the capacitive substrate is in operation. |
| US07803687B2 |
Method for forming a thin film resistor
A method for forming a thin film resistor includes providing a substrate having a transistor region and a thin film resistor region defined thereon, sequentially forming a dielectric layer, a metal layer and a first hard mask layer on the substrate, patterning the first hard mask layer to form at least a thin film resistor pattern in the thin film resistor region, sequentially forming a polysilicon layer and a second hard mask layer on the substrate, patterning the second hard mask layer to form at least a gate pattern in the transistor region, and performing an etching process to form a gate and a thin film resistor respectively in the transistor region and the thin film resistor region. |
| US07803686B2 |
Methods for etching doped oxides in the manufacture of microfeature devices
Methods for selectively etching doped oxides in the manufacture of microfeature devices are disclosed herein. An embodiment of one such method for etching material on a microfeature workpiece includes providing a microfeature workpiece including a doped oxide layer and a nitride layer adjacent to the doped oxide layer. The method include selectively etching the doped oxide layer with an etchant comprising DI:HF and an acid to provide a pH of the etchant such that the etchant includes (a) a selectivity of phosphosilicate glass (PSG) to nitride of greater than 250:1, and (b) an etch rate through PSG of greater than 9,000 Å/minute. |
| US07803685B2 |
Silicided base structure for high frequency transistors
High frequency performance of (e.g., silicon) bipolar devices (100, 100″) is improved by reducing the extrinsic base resistance Rbx. Emitter (160), base (161) and collector (190) are formed in or on a semiconductor substrate (110). The emitter contact (154) has a portion (154′) that overhangs a portion (1293, 293″) of the extrinsic base contact (129), thereby forming a cave-like cavity (181, 181″) between the overhanging portion (154′) of the emitter contact (154) and the underlying regions (1293, 1293″) of the extrinsic base contact (129). When the emitter contact and the extrinsic base contact are silicided, some of the metal atoms forming the silicide penetrate into the cavity (181, 181″) so that the highly conductive silicided extrinsic base contact extends under the edge of the emitter contact (154′) closer to the base (161, 163) itself, thereby reducing Rbx. Smaller Rbx provides transistors with higher fMAX. |
| US07803683B2 |
Method of fabricating a semiconductor device
A semiconductor device includes an insulating film formed above an upper surface of a semiconductor substrate and including a contact hole, the contact hole including an upper portion and a lower portion located on the upper portion via a boundary as a first lower end of the upper portion and a first upper end of the lower portion, the boundary including a second inner width same as the first inner width, the lower portion including a second lower end having a third inner width narrower than the second inner width, a first conductive plug made from polycrystalline silicon and formed in the lower portion of the contact hole so that the exposed upper surface of the substrate is in contact with the first conductive plug, and a second conductive plug formed on the first conductive plug and made from a conductive material different from the polycrystalline silicon. |
| US07803676B2 |
Semiconductor device and method of fabricating the same
Provided are a semiconductor device and a method of fabricating the semiconductor device. The semiconductor device using a DMOS device includes: a semiconductor substrate, in which a first conductive type well is formed; a first conductive type gate electrode formed on the semiconductor substrate with a gate insulating layer intervening between the gate electrode and the semiconductor substrate; a second conductive type body electrode formed on the semiconductor substrate and separated from the gate electrode; a first conductive type drain electrode formed on the semiconductor substrate and separated from the gate electrode and the body electrode; a second conductive type first body region formed in the well under the body electrode; a second conductive type second body region extending from the first body region to the gate insulating layer and formed in the well; a first conductive type source region formed in the second body region and extending from the first body region to the gate insulating layer; and a first conductive type source electrode extending from the source region to surround the gate electrode on the semiconductor substrate with an insulating layer intervening between the source electrode and gate electrode. |
| US07803674B2 |
Methods for fabricating SOI devices
Silicon on insulator (SOI) devices and methods for fabricating the same are provided. An exemplary embodiment of a SOI device comprises a substrate. A first insulating layer is formed over the substrate. A plurality of semiconductor islands is formed over the first insulating layer, wherein the semiconductor islands are isolated from each other. A second insulating layer is formed over the first insulating layer, protruding over the semiconductor islands and surrounding thereof. At least one recess is formed in a portion of the second insulating layer adjacent to a pair of the semiconductor islands. A first dielectric layer is formed on a portion of each of the semiconductor islands. A conductive layer is formed over the first dielectric layer and over the second insulating layer exposed by the recess. A pair of source/drain regions is oppositely formed in portions of each of the semiconductor islands not covered by the first dielectric layer and the conductive layer. |
| US07803666B2 |
Manufacturing process for a Quad Flat Non-leaded chip package structure
A manufacturing process for a Quad Flat Non-leaded (QFN) chip package structure is provided. First, a patterned conductive layer and a patterned solder resist layer on the patterned conductive layer are provided. A plurality of chips are bonded onto the patterned solder resist layer such that the patterned solder resist layer are between the chips and the patterned conductive layer. The chips are electrically connected to the patterned conductive layer by a plurality of bonding wires, wherein the chips and the bonding wires are at the same side of the patterned conductive layer. At least one molding compound is formed to encapsulate the patterned conductive layer, the patterned solder resist layer, the chips and the bonding wires. Then, the molding compound, the patterned conductive layer and the patterned solder resist layer are separated. |
| US07803663B2 |
Method for manufacturing a molded MMC multi media card package obtained with laser cutting
A method is provided for manufacturing a fully moulded Multi Media Card package obtained by laser cutting wherein at least some edges and the corners around the package have rounded profile and a sufficient smoothness for a safe handling. The method includes providing a rounded groove on a substrate back side of the package, all around the package profile, and cutting the edges of said package by a laser cutting line passing through said groove. This new technique allows the use of all the 24.0 mm width of the MMC package for the substrate 2, thus increasing the surface available for electronic components. |
| US07803661B2 |
Flip chip laser bonding process
An apparatus for heating a chip includes: a laser generator for emitting a laser beam to a semiconductor chip to heat the semiconductor chip; and a beam intensity adjuster disposed on a laser emission path between the semiconductor chip and the laser generator to equalize the intensity of the laser beam to be emitted to the semiconductor chip. A flip chip bonder having the chip heating apparatus, and a method for bonding a flip chip using the same are also provided. |
| US07803653B2 |
Method of manufacturing image sensor
A method of manufacturing an image sensor includes forming a device isolation region in an active pixel sensor area of a semiconductor substrate and alignment keys in a scribe lane area of the semiconductor substrate, such that the depth of the alignment keys is equal to or shallower than the depth of the device isolation region. The method further includes forming a photoelectric converter in the active pixel sensor area, polishing a rear surface of the semiconductor substrate and using the alignment keys to form a microlens at a position corresponding to the photoelectric converter on the polished rear surface of the semiconductor substrate. |
| US07803649B2 |
Angular rate sensor and method of manufacturing the same
An angular rate sensor 100 comprises a first structure 110 which includes a fixed portion 111 having an opening 114, a displacing portion 112 placed in the opening 114, and a connecting portion 113 adapted to connect the fixed portion 111 and the displacing portions 112; a second structure 130 which includes a weighting portion 132 joined to the displacing portion 112, and a pedestal portion 131 arranged to surround the weighting portions 132 and joined to the fixed portion 111, and is laminated in place on the first structure 110. A first body 140 formed by laminating a first metal layer 142 and a first insulating layer 141 thereon is joined to the fixed portion 111 such that the first insulating layer 141 faces the fixed portion 111. A second substrate 150 formed by laminating a second metal layer 152 and a second insulating layer 151 thereon is joined to the pedestal portion 131 such that the second insulating layer 151 faces the pedestal portion 131. |
| US07803647B2 |
Optical transmission improvement on multi-dielectric structure in advance CMOS imager
The present disclosure provides an image sensor semiconductor device. The semiconductor device includes a sensor element disposed in a semiconductor substrate; an inter-level dielectric (ILD) disposed on the semiconductor substrate; and a trench disposed in the ILD, overlying and enclosing the sensor element, and filled with a first dielectric material. |
| US07803644B2 |
Across reticle variation modeling and related reticle
Methods of modeling across reticle variations and a related reticle are disclosed. One embodiment of the method includes defining a test for determination across a multiple chip wafer; identifying a measurement structure for performing the test; implementing the measurement structure on the multiple chip wafer using a reticle including the measurement structure between copies of the multiple chips on the reticle, wherein no one of the multiple chips covers an entirety of the reticle; performing the test on the multiple chip wafer using the measurement structure to acquire data across the reticle; using data from the performing to establish an across reticle variation model; and using the across reticle variation model to predict across chip variation for at least one of the multiple chips. |
| US07803638B2 |
Fluorescent label
The present invention relates to a fluorescent label characterized by containing a hydrophilic polymer having an anionic group, a polyether derivative, and a phosphor, in which the phosphor is bound to the hydrophilic polymer via the polyether derivative, and also relates to a fluorescently labeled recognition substance labeled with the fluorescent label, and an immunoassay method using the recognition substance. |
| US07803633B2 |
Screening arrangement for screening immunoassay tests and agglutination tests
A screening device for performing an immunoassay test to detect the presence of a compound in a body fluid. The device includes a holder for removably receiving a membrane to which the fluid has been applied. Light is directed to the membrane. A photodetector measures the concentration of the light reflected back from the membrane. Specifically, the concentrations of reflected light from a control zone and a test zone are measured. Signals representative of the measured light concentrations are applied to a processor. If a specified concentration of predetermined light from a control zone on the membrane is detected, the processor considers the test to be successful. In the test is successful, the processor, based upon the measured concentration of reflected light from the test zone, generates data representative of the presence of the compound. |
| US07803631B2 |
Process and arrangement for determining water content
Process for determination of a water content material, in particular organic carbon content and/or nitrogen, in which an aqueous sample is evaporated and combusted in at least one heating vessel equipped with a heating facility and the combustion product is fed in a transport gas flow to a detector for determination of the concentration of a gaseous compound of the water content material, characterised in that calibration is performed with a predetermined volume of a calibration gas which contains a predetermined concentration of the element corresponding to the water content material, in particular carbon and/or nitrogen. |
| US07803630B2 |
Method for detecting target compounds containing sulfenic acids using new reagents
The present invention provides compounds of Formula I: wherein: R1 is a label (e.g., a detectable groups; an anti-tumor agent)s; L is present or absent and when present is a linking group; and x represents an integer from 1 to 10; or a pharmaceutically acceptable salt thereof. the compounds are useful for, among other things, identifying cysteine sulfenic acids in proteins and monitoring oxidative damage in proteins and cells. |
| US07803629B2 |
Method for employing SEC-FTIR data to predict mechanical properties of polyethylene
The present invention provides several methods of determining values of physical or chemical properties of polymers. In these methods, at least two polymer training samples are provided. Characteristics of the polymer microstructures of the training samples are correlated with values of physical or chemical properties of the training samples. These correlations are subsequently applied to the respective characteristics of polymer test samples in order to determine the values of physical or chemical properties of the test samples. |
| US07803628B2 |
Device for measuring pressure
In a device for measuring the pressure of a medium, in particular a liquid medium, the device including a measuring chamber through which the medium can flow and which has at least one elastically deformable wall, at least one wall that is more rigid by comparison to the elastically deformable wall, and an inlet and outlet for the medium, at least one excitation electrode is provided in or on the at least one more rigid wall of the measuring chamber, and at least one signal electrode is provided on the elastically deformable wall, for impedance measurement. |
| US07803622B2 |
Adeno-associated virus vectors
The invention provides an isolated and purified DNA molecule comprising at least one DNA segment, a biologically active subunit or variant thereof, of a circular intermediate of adeno-associated virus, which DNA segment confers increased episomal stability, persistence or abundance of the isolated DNA molecule in a host cell. The invention also provides a composition comprising at least two adeno-associated virus vectors. |
| US07803619B2 |
Embryoid body-based screen
Disclosed are embryoid bodies having a uniform size of approximately 415 nm and comprising genetically modified embryonic stem cells, and methods of making same. The genetically uniform embryoid bodies can be multiplexed as one embryoid body per well in a multiwell format, and used as a high to medium throughput screen for test agents that affect the development and homeostasis of animals, including humans. The genetic modification of the embryonic stem cells is a promoter-report-selection construct that enables the selection and detection of cells of a particular lineage in the EB, to determine the effects of a test agent. |
| US07803618B2 |
Recombinant tumor specific antibody and use thereof
The invention provides a family of antibodies that specifically bind the human epithelial cell adhesion molecule. The antibodies comprise modified variable regions, more specially, modified framework regions, which reduce their immunogenicity when administered to a human. The antibodies, when coupled to the appropriate moiety, may be used in the diagnosis, prognosis and treatment of cancer. |
| US07803616B2 |
Medium supplement and animal cell culture medium
An object of the present invention is to provide a medium supplement for animal cell culture and an animal cell culture medium. The present invention relates to a medium supplement for animal cell culture comprising sericin or a sericin derivative and an animal cell culture medium comprising at least said medium supplement and a basal medium composition. |
| US07803615B1 |
Death domain containing receptor 5
The present invention relates to novel Death Domain Containing Receptor-5 (DR5) proteins which are members of the tumor necrosis factor (TNF) receptor family, and have now been shown to bind TRAIL. In particular, isolated nucleic acid molecules are provided encoding the human DR5 proteins. DR5 polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying antagonists and antagonists of DR5 activity. |
| US07803614B2 |
Melanoma antigens and their use in diagnostic and therapeutic methods
The present invention provides a nucleic acid sequence encoding a melanoma antigen recognized by T lymphocytes, designated MART-1. This invention further relates to bioassays using the nucleic acid sequence, protein or antibodies of this invention to diagnose, assess or prognoses a mammal afflicted with melanoma or metastata melanoma. This invention also provides immunogenic peptides derived from the MRT-1 melanoma antigen and a second melanoma antigen designated gp100. This invention further provides immunogenic peptides derived from the MART-1 melanoma antigen or gp100 antigen which have been modified to enhance their immunogenicity. The proteins and peptides provided can serve as an immunogen or vaccine to prevent or treat melanoma. |
| US07803612B2 |
Nipah virus vaccines
The present invention relates to recombinant anti-Nipah virus vaccines and the administration of such vaccines to animals, advantageously pigs. Advantageously, the anti-Nipah virus vaccine may comprise a recombinant avipox virus containing a Nipah virus glycoprotein gene. The invention encompasses methods of vaccinating animals, advantageously pigs, by administration of anti-Nipah virus vaccines that may comprise a recombinant avipox virus that may contain a Nipah virus glycoprotein gene. |
| US07803610B2 |
Method, apparatus and system for separating eucaryotic or procaryotic cells or other particularly biological material from a suspension
A method for separating eucaryotic or procaryotic cells or other particularly biological material which is sensitive against high shearing forces from a suspension is provided using at least one hydrocyclone with an inlet and an outlet. The outlet of the hydrocyclone is essentially opposite to the inlet and the interior space of the hydrocyclone converges towards the outlet. The suspension is delivered to the inlet of the hydrocyclone, and the suspension enriched with the cells is drained off from the outlet. The enriched suspension is then guided from or through the outlet by a flow means in such a way, that a minimum of shearing stresses occurs and the kinetic energy of the enriched suspension at the outlet of the hydrocyclone is reduced that the viability of the cell material is influenced at a minimum. |
| US07803609B2 |
System, method, and product for generating patterned illumination
An embodiment of a method for generating an interference pattern at a probe array is described that comprises directing light at a first waveguide and second waveguide, wherein the first and second waveguides are positioned adjacent to each other and the output from the first and second waveguides produce an interference pattern; and directing the interference pattern at the probe array. |
| US07803606B2 |
Method for the production of flavor-active terpenes
Disclosed is a method for producing flavor-active terpenes from terpene hydrocarbons. According to said method, a lyophilized mycel which is first rehydrated and is then mixed with the substrate is used preferably in a submerged culture in the framework of selective biotransformation with the aid of microorganisms. The inventive method, which can be carried out especially in an enantioselective, stereoselective, and/or regioselective manner, makes it possible to obtain terpenoid alcohols, epoxides, aldehydes, ketones, polyalcohols, carbonyls, and carbonyl alcohols with the aid of fusarium, pleutorus, penicillium, and chaetomium species, the obtained substances being isolated particularly from cellular components. Said method should be carried out above all in a stirred tank, surface reactor, or fixed bed reactor while preferably taking place in a two-phase system with reduced carbon source moieties. The obtained flavor-active terpenes are used as flavors and fragrances preferably in the food, cosmetic, and pharmaceutical industry. |
| US07803601B2 |
Production and secretion of glucose in photosynthetic prokaryotes (cyanobacteria)
The present invention includes compositions and methods for making and using an isolated cyanobacterium that includes a portion of an exogenous bacterial cellulose operon sufficient to express bacterial cellulose, whereby the cyanobacterium produces extracellular glucose. The compositions and methods of the present invention may be used as a new global crop for the manufacture of cellulose, CO2 fixation, for the production of alternative sources of conventional cellulose as well as a biofuel and precursors thereof. |
| US07803598B2 |
Cyclodextrin glycosyltransferase (CGTase) polypeptides with modified hydrolysis activity
An enzyme is described which enzyme is derived from family 13 of α-amylases. The enzyme variant is obtainable by modifying a CGTase or a maltogenic α-amylase. The enzyme is useful in preparing a food or a food product such as bakery products. |
| US07803593B2 |
Acylglycerol acyltransferase-like protein MGAT-X1 and uses thereof
The present invention is directed to a polynucleotide sequence of a novel acylglycerol acyltransferase-like protein MGAT-X1. The invention also provides the human MGAT-X1 associated with the dermatological diseases, urological diseases, muscle-skeleton disorders, hematological diseases, cancer, reproduction disorders, neurological diseases, metabolic diseases, cardiovascular diseases or gastroenterological diseases. The invention also provides assays for the identification of compounds useful for the modulation of dermatological diseases, urological diseases, muscle-skeleton disorders, hematological diseases, cancer, reproduction disorders, neurological diseases, metabolic diseases, cardiovascular diseases or gastroenterological diseases for treating of such diseases associated with expression of the MGAT-X1. The invention also features compounds which bind to and/or activate or inhibit the activity of MGAT-X1 as well as pharmaceutical compositions comprising such compounds. |
| US07803591B2 |
Multimeric oxidoreductases
Described are multimeric oxidoreductase complexes which function in the enzymatic conversion of a carbon substrate. The complexes having a dehydrogenase subunit and a cytochrome C subunit. Also described are polynucleotides coding for the multimeric complexes and methods of use thereof. |
| US07803589B2 |
Methods and organisms for utilizing synthesis gas or other gaseous carbon sources and methanol
The invention provides a non-naturally occurring microbial organism having an acetyl-CoA pathway and the capability of utilizing syngas or syngas and methanol. In one embodiment, the invention provides a non-naturally occurring microorganism, comprising one or more exogenous proteins conferring to the microorganism a pathway to convert CO, CO2 and/or H2 to acetyl-coenzyme A (acetyl-CoA), methyl tetrahydrofolate (methyl-THF) or other desired products, wherein the microorganism lacks the ability to convert CO or CO2 and H2 to acetyl-CoA or methyl-THF in the absence of the one or more exogenous proteins. For example, the microbial organism can contain at least one exogenous nucleic acid encoding an enzyme or protein in an acetyl-CoA pathway. The microbial organism is capable of utilizing synthesis gases comprising CO, CO2 and/or H2, alone or in combination with methanol, to produce acetyl-CoA. The invention additionally provides a method for producing acetyl-CoA, for example, by culturing an acetyl-CoA producing microbial organism, where the microbial organism expresses at least one exogenous nucleic acid encoding an acetyl-CoA pathway enzyme or protein in a sufficient amount to produce acetyl-CoA, under conditions and for a sufficient period of time to produce acetyl-CoA. |
| US07803588B2 |
Method and device to probe a membrane by applying an in-plane electric field
The present invention disposes a membrane between two electrical conductive walls having a height at least as great as the thickness of the membrane. The conductive walls are fabricated on an electrically insulative chip base. The chip base has one or more through hole between the electrically conducting walls. The chip is placed inside a container having a well below the through hole of the electrically insulative base. At least one passageway extends from the well to the periphery of the container. This invention probes changes of the membrane as an in-plane electric field is applied between the conductive walls. The well may include various compounds while other compounds can be placed in contact with the top of the membrane. The passageways are used to introduce substances into and out of the well. |
| US07803584B2 |
Method for producing an L-amino acid using bacterium of the Enterobacteriaceae family with attenuated expression of a gene coding for small RNA
The present invention provides a method for producing an L-amino acid using a bacterium of the Enterobacteriaceae family, particularly a bacterium belonging to genus Escherichia or Pantoea, which has been modified to attenuate expression of a gene coding for sRNA. |
| US07803580B2 |
Amplification blocker comprising intercalating nucleic acids (INA) containing intercalating pseudonucleotides (IPN)
An amplification blocker comprising an intercalating nucleic acid (INA) containing two or more internal intercalating pseudonucleotides (IPNs) capable of blocking or reducing nucleic acid amplification. Use of the amplification blocker to block or reduce nucleic acid amplification. |
| US07803579B2 |
Process for amplifying nucleic acid
The present invention relates to a process for synthesizing or amplifying efficiently a nucleic acid comprising a target nucleic acid sequence. The process involves providing a primer comprising in its 3′-end portion a sequence (Ac′) which hybridizes a sequence (A) in the 3′-end portion of the target nucleic acid sequence, and in the 5′-side of the sequence (Ac′) a sequence (B′) which hybridizes the complementary sequence (Bc) of a sequence (B) positioned in the 5′-side of the sequence (A) on the target nucleic acid sequence, wherein {X−(Y−Y′)}/X is in the range of −1.00 to 1.00, in which X denotes the number of bases in the sequence (Ac′), Y denotes the number of bases in the region flanked by the sequences (A) and (B) in the target nucleic acid sequence, and Y′ denotes the number of bases in an intervening sequence between the sequences (Ac′) and (B′) (Y′ may be zero). |
| US07803577B2 |
Tropoelastin derivatives
The invention relates to derivatives of tropoelastin and variants of those derivatives. The invention further provides expression products and hybrid molecules of the derivatives and variants of the invention. The invention further provides methods for the production of the derivatives, variants, expression products and hybrid molecules. Further provided are formulations, cross-linked structures and implants comprising the derivatives, variants, expression products and hybrid molecules of the invention. Further provided are uses of the derivatives, variants, expression products and hybrid molecules of the invention. |
| US07803572B2 |
Protease detection assay
The invention provides methods and compounds for detecting protease activity in a sample solution comprising contacting the sample solution with a protease substrate labelled with an electrochemically active marker, providing conditions under which any protease which may be present in the sample may degrade the protease substrate and electrochemically determining information relating to the electrochemically active marker. |
| US07803567B2 |
Methods and compositions for detecting trichomonas in a sample contacted with fixative
The present invention provides methods and compositions for detecting a Trichomonas antigen in a fixed sample and for diagnosing Trichomonas infection by detecting a Trichomonas antigen in a fixed sample. |
| US07803566B2 |
Identification of gene sequences and proteins involved in vaccinia virus dominant T cell epitopes
The present invention relates to the identification of gene sequences and proteins involved in vaccinia virus dominant T cell epitopes. Two vaccinia virus CD8+ T cell epitopes restricted by the most common human MHC class I allele, HLA-A0201 have been identified. Both epitopes are highly conserved in vaccinia and variola viruses. The induction of the T cell responses following primary vaccination is demonstrated by the kinetics of epitope specific CD8+ T cells in 3 HLA-A0201 individuals. This information will be useful for the design and analyses of the immunogenicity of experimental vaccinia vaccines, and for basic studies of human T cell memory. |
| US07803558B2 |
Modulation of aqueous humor outflow by targeting vascular-endothelial-cadherin in Schlemm's canal cells
The present invention provides methods of inhibiting cadherins between Schlemm's canal cells, to a patient suffering from glaucoma as well as screening for substances that inhibit cadherins between the Schlemm's canal cells. |
| US07803551B2 |
AMPLICON melting analysis with saturation dyes
Methods are provided for nucleic acid analysis wherein a target nucleic acid that is at least partially double stranded is mixed with a dsDNA binding dye having a percent saturation of at least 50% to form a mixture. In one embodiment, the nucleic acid is amplified in the presence of the dsDNA binding dye, and in another embodiment a melting curve is generated for the target nucleic acid by measuring fluorescence from the dsDNA binding dye as the mixture is heated. Dyes for use in nucleic acid analysis and methods for making dyes are also provided. |
| US07803548B1 |
Methods for diagnosing cystic fibrosis
The present invention provides novel mutations of the CFTR gene related to cystic fibrosis or to conditions associated with cystic fibrosis. Also provided are probes for detecting the mutant sequences. Methods of identifying if an individual has a genotype containing one or more mutations in the CFTR gene are further provided. |
| US07803547B2 |
COT102 insecticidal cotton
The present application relates to an insect resistant transgenic cotton plant. In particular, it relates to a specific event, designated COT102. The application also relates to polynucleotides which are characteristic of the COT102 event, plants comprising said polynucleotides, and methods of detecting the COT102 event. The COT 102 event exhibits a novel genotype comprising two expression cassettes. The first cassette comprises a suitable promoter for expression in plants operably linked to a gene that encodes a VIP3A insecticidal toxin, useful in controlling a vide spectrum of lepidopteran insect pests, and a suitable polyadenylation signal. The second cassette comprises a gene which, when expressed, can be used as a selectable marker. |
| US07803546B2 |
Method of screening for sensitivity to kinase inhibitor therapy
Described herein are methods for treating cancer and other disease conditions in individuals who have either developed a resistance to conventional tyrosine kinase inhibitor (TKI) therapy or who are non-responsive ab initio to conventional TKI therapy. In various embodiments, the methods include administering to a patient a resistance-surmounting quantity of a TKI on a weekly or semi-weekly basis. Alternate embodiments of the present invention include a diagnostic method for assessing an individual's probability of being resistant to TKI therapy, based upon an expression level of epithelial membrane protein-1 (EMP-1); one of the genes believed to be responsible for TKI resistance. The methods of the present invention may be particularly useful in the treatment of lung, breast, prostate, ovarian, brain and colon cancers. The methods of the present invention may be effective in blocking the HER-2 kinase domain either in addition to or in lieu of blocking the EGFR kinase domain. |
| US07803534B2 |
Method of judging biological activity in bioremediation site and polynucleotide for detecting microorganism to be used therein
It is an object to provide a method whereby with respect to a microorganism present in an environment contaminated with tetrachloroethylene (PCE) and trichloroethylene (TCE), capability of the microorganism to degrade contaminants can be judged promptly.In order to achieve the above-described object, a biological activity judging method according to the present invention is a method of judging capability of a contaminated environment to eliminate an organochlorine compound, in which using a DNA probe that allows a bacterium to be detected specifically, which has a degradation activity with respect to the organochlorine compound and/or a dechlorinated product thereof, the bacterium in the environment is detected.The present invention also provides a new type of polynucleotide that can be used as a DNA probe in the biological activity judging method according to the present invention. |
| US07803526B2 |
Development of diagnostic kit for the detection of Chrysanthemum virus B
The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1: Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer: TTTATAATGTCTTATTATTCGCAT It also relates to a diagnostic kit useful for detection of coat protein of Chrysanthemum virus B in plants comprising: polyclonal antibodies against Chrysanthemum virus B coat protein in plants; conjugate labeled with alkaline phosphatase; coating buffer; extraction buffer; ECI buffer; PNP buffer. |
| US07803524B2 |
Antigenic HIV gp41 chimeric polypeptides comprising the MVP5180/91 epitope SKGKLIS
Immunologically active peptides which are derived from a novel immunodeficiency virus which has the designation MVP5180/91 are described. A diagnostic composition containing such a peptide and methods of detecting an antibody against a retrovirus that causes immune deficiency using such diagnostic composition are also described. A kit containing the immunologically active peptides is also described. An immunogen and method of immunizing a mammal against HIV infection using the immunologically active peptides is described. DNA encoding the peptides and methods of detecting nucleic acids encoding HIV viruses are also described. |
| US07803523B2 |
Whole blood preparation for cytometric analysis of cell signaling pathways
This invention is directed to a method for preparation of a biological sample for measurement of protein epitopes that allows for the preservation of intracellular protein epitopes and detection of signal transduction pathways based on the ability to capture transient activation states of the epitopes. The method provided by the invention allows for the rapid fixation of biological samples containing red blood cells, to ensure that epitopes of signal transduction molecules and other intracellular protein epitopes are preserved in the active state. The method of the invention further allows for lysis of red blood cells, thereby making it a useful method for cytometric analysis of biological samples, including, for example, whole blood, bone marrow aspirates, peritoneal fluids, and other red blood cell containing samples. The invention also provides a method to recover or “unmask” epitopes on intracellular antigens that have been made inaccessible by the cross linking fixative necessary to fix the sample. Significantly, the methods of the invention allow preservation and analysis of phospho-epitope levels in biological samples taken directly from patients to determine disease-specific characteristics. |
| US07803520B2 |
Crystallization apparatus, crystallization method, device and phase modulation element
The present invention comprises a light modulation optical system having a first element which forms a desired light intensity gradient distribution to an incident light beam and a second element which forms a desired light intensity minimum distribution with an inverse peak shape to the same, and an image formation optical system which is provided between the light modulation optical system and a substrate having a polycrystal semiconductor film or an amorphous semiconductor film, wherein the incident light beam to which the light intensity gradient distribution and the light intensity minimum distribution are formed is applied to the polycrystal semiconductor film or the amorphous semiconductor film through the image formation optical system, thereby crystallizing a non-crystal semiconductor film. The pattern of the first element is opposed to the pattern of the second element. |
| US07803519B2 |
Method for manufacturing a semiconductor device
A method for manufacturing a semiconductor device using a photoresist polymer comprising a fluorine component, a photoresist composition containing the photoresist polymer and an organic solvent to reduce surface tension, by forming a photoresist film uniformly on the whole surface of an underlying layer pattern to allow a subsequent ion-implanting process to be stably performed. |
| US07803513B2 |
Chemically amplified resist composition
A chemically amplified resist composition comprising:(A) a salt represented by the formula (I): wherein R21 represents a C1-C30 hydrocarbon group etc., Q1 and Q2 each independently represent a fluorine atom etc., and A+ represents at least one organic cation selected from a cation represented by the formula (Ia): wherein P1, P2 and P3 each independently represent a C1-C30 alkyl group etc., a cation represented by the formula (Ib): wherein P4 and P5 each independently represent a hydrogen atom etc., and a cation represented by the formula (Ic): wherein P10, P11, P12, P13, P14, P15, P16, P17, P18, P19, P20 and P21 each independently represent a hydrogen atom etc., B represents a sulfur or oxygen atom and m represents 0 or 1, (B) a salt represented by the formula (II): A′+−E (II) wherein A′+ represents at least one organic cation selected from cations represented by the above-mentioned formulae (Ia), (Ib) and (Ic), and E− represents at least one organic anion selected from an anion represented by the formula (II-1): −O3SQ3 (II-1) wherein Q3 represents a C1-C10 perfluoroalkyl group, and an anion represented by the formula (II-2): wherein Q4 represents a C1-C10 perfluoroalkyl group, and (C) a resin which contains a structural unit having an acid-labile group and which itself is insoluble or poorly soluble in an aqueous alkali solution but becomes soluble in an aqueous alkali solution by the action of an acid. |
| US07803512B2 |
Positive resist composition and method of forming resist pattern
A positive resist composition that includes a resin component (A) that exhibits increased alkali solubility under the action of acid, and an acid generator component (B) that generates acid on exposure to radiation, wherein the component (A) includes a structural unit (a1) represented by a general formula (a1-2) or (a1-4), a structural unit (a2) derived from an acrylate ester that contains a lactone-containing monocyclic or polycyclic group, and a structural unit (a3), which is different from the structural unit (a1) and the structural unit (a2), and is derived from an acrylate ester that contains an aliphatic cyclic group-containing non-acid-dissociable, dissolution-inhibiting group and contains no polar groups, and the component (B) includes an onium salt (B1) having an anion portion represented by a formula: R41—SO3−. |
| US07803509B2 |
Crystalline polyester for toner
The present invention relates to a crystalline polyester for toner, obtained by a process comprising the step of polymerizing raw material monomers in the presence of a wax, wherein the crystalline polyester has a number-average molecular weight of from 3000 to 10000 and a weight-average molecular weight of from 150000 to 8000000. The toner containing the crystalline polyester of the present invention can be used, for example, for developing electrostatic latent images formed in electrophotography, electrostatic recording method, electrostatic printing method, and the like. |
| US07803508B2 |
Toner as well as developer and image forming method using the same
A toner which combines excellent cleaning ability, image quality and durability, as well as a developer and an image forming method using the toner are provided.A toner comprising a toner base particle which comprises at least a binding resin and a colorant, and an external additive, wherein an external additive is a non-spherical amorphous silica particle and a major axis of the silica particle is 40 nm to 180 nm.An aspect wherein the non-spherical amorphous silica particle has a true specific gravity of 1.8 to 2.3 and the silica particle is hydrophobilized and a hydrophobilization degree is 40 or more, and an aspect wherein the non-spherical amorphous silica particle is produced by a dry system and a mass reduction rate is 5% by mass or less when the silica particle is heated from 30° C. up to 250° C. are preferable. |
| US07803504B2 |
Mask pattern of semiconductor device and manufacturing method thereof
Provided is a mask pattern of a semiconductor device. The mask pattern includes a plurality of main patterns and a plurality of assistance patterns. The main patterns are adjacent to one another. The assistance pattern is disposed on at least one of an end portion and a middle portion of each of the main patterns and has a line width greater than that of the main pattern. The assistance patterns are staggered. |
| US07803503B2 |
Halftone mask and method for making pattern substrate using the halftone mask
A halftone mask includes translucent film patterns for forming a middle gradation area and light blocking film patterns disposed to an entire periphery of the translucent film patterns. |
| US07803492B2 |
Fuel cell stack with positioning mechanism
A fuel cell stack has fuel cell units. Each of the fuel cell units includes first and second membrane electrode assemblies and first to third separators sandwiching the first and second membrane electrode assemblies. A positioning mechanism is used for positioning the first to third separators in alignment with each other. The positioning mechanism includes a first protruded portion and a second protruded portion. The first protruded portion protrudes from one surface of the second separator for positioning the first separator. The second protruded portion protrudes from the other surface of the second separator for positioning the third separator. |
| US07803491B2 |
Solid electrolyte fuel cell configuration
A solid electrolyte fuel cell configuration provided with a single sheet shaped solid electrolyte substrate formed with a plurality of fuel cells and thereby not having a sealed structure, achieving a reduction of the size and a reduction of the cost, and able to improve the durability and improve the power generation efficiency, a single sheet shaped solid electrolyte substrate, in particular a solid electrolyte fuel cell configuration provided with a single sheet shaped solid electrolyte substrate, a plurality of anode layers formed on one side of the solid electrolyte substrate, and a plurality of cathode layers formed on the side opposite to the one side of the solid electrolyte substrate at positions facing the anode layers, the anode layers and cathode layers facing each other across the solid electrolyte substrate forming a plurality of fuel cells, the anode layers and cathode layers being connected in series. |
| US07803489B2 |
Hydrogen mobile power plant that extracts hydrogen fuel from water
The apparatus contains a means to create superheated steam at a temperature of preferably 800° C. The superheated steam is delivered to a catalytic decomposition converter that contains ceramic membranes that function to decompose water H2O into its constituent elements of diatomic hydrogen and oxygen. In one embodiment, a cascade of catalytic cells, one set for hydrogen and one set for oxygen are arranged in a unique “Cascade and Recirculate” configuration that greatly improves the throughput of the catalytic process. Only enough hydrogen is produced and delivered to the fuel cell according to the real time demand. There is no hydrogen storage on board. An electrically heated boiler initializes the process, and thereafter the heat from the exothermic reaction of a high-temperature fuel cell, and a small hydrocarbon burner sustains the operational superheated steam temperature. By using the by-product heat of a high temperature fuel cell in conjunction with the efficient combustion of a small amount of conventional hydrocarbon fuel, a unique thermodynamic hybrid system is created. The electrical energy generated by the fuel cell is used to maintain the charged state of a traction battery. A plurality of pumps, valves, regulators and sensors under microprocessor control manage the processes. |
| US07803488B1 |
System for removal of inerts from fuel cell reactants
An electrical power plant that includes a fuel cell and at least one recycle system for recycling at least a first reactant, for reuse by the fuel cell. The fuel cell discharges a first exit stream that includes the first reactant and inerts. The recycle system comprises a separator that receives the first exit stream from the fuel cell and separates the first reactant contained in the first exit stream from inerts contained in the exit stream. The separated first reactant is directed back to the fuel cell for reuse. The remaining inerts and unseparated first reactant are discharged by the separator and then recirculated back into the separator, without progressing through the fuel cell, to separate additional first reactant from the inerts. |
| US07803484B2 |
High rate capability design of lithium ion secondary battery
A lithium ion secondary battery includes LiFePO4 as a major component of the positive electrode active material. In order to implement the high rate capability with 10C/1C rate larger than 80%, the invention designs a positive electrode on a current collector with a ratio (A/t) of coating area to coating thickness greater than 1.2×106 (mm) and uses more than one tab on the current collector. The design of the invention can be applied to other active materials with low conductivity as the positive electrode for lithium ion battery. |
| US07803481B2 |
Lithium-ion battery
A battery includes a positive electrode having a current collector and a first active material and a negative electrode having a current collector and a second active material. The battery also includes an auxiliary electrode having a current collector and a third active material. The auxiliary electrode is configured for selective electrical connection to one of the positive electrode and the negative electrode. The first active material, second active material, and third active material are configured to allow doping and undoping of lithium ions. The third active material exhibits charging and discharging capacity below a corrosion potential of the current collector of the negative electrode and above a decomposition potential of the first active material. |
| US07803480B2 |
Prismatic lithium ion rechargeable battery
The provided is a prismatic lithium ion battery including an electrode assembly having a wound structure of a stack of a positive electrode, a separator, and a negative electrode. The stack has a first side edge and a second side edge, and the wound structure of the stack is formed by winding the stack around the first side edge. The wound structure of the stack has a side surface that is substantially parallel to the first side edge, and a top surface and a bottom surface, each of which is substantially perpendicular to the first side edge. A first tape is coupled to the second side edge portion of the stack of the electrode assembly, and a second tape covers the bottom surface and part of the side surface of the wound structure of the stack in a manner that the second tape does not overlap the first tape. |
| US07803479B2 |
Prismatic lithium ion rechargeable battery
The provided is a prismatic lithium ion battery including an electrode assembly having a wound structure of a stack of a positive electrode, a separator, and a negative electrode. The stack has a first side edge and a second side edge, and the wound structure of the stack is formed by winding the stack around the first side edge. The wound structure of the stack has a side surface that is substantially parallel to the first side edge, and a top surface and a bottom surface, each of which is substantially perpendicular to the first side edge. A first tape is coupled to the second side edge portion of the stack of the electrode assembly, and a second tape covers a part of the bottom surface and a part of the side surface of the wound structure of the stack in a manner that the second tape does not overlap the first tape. |
| US07803478B2 |
Power output apparatus and method of setting secondary battery
In a power output apparatus of the invention, a battery 36 is constructed by a lithium ion battery satisfying a first requirement of Sb/Pm2max>0.09 (m2/kW) as a relation of a total electrode area Sb of the battery to a rated output (maximum output) Pm2max of a motor MG2 in power operation and a second requirement of Sb/(|Pm1min+Pm2min|)>0.04 (m2/kW) as a relation of the total electrode area Sb of the battery to a rated output Pm1min of a motor MG1 in regenerative operation and a rated output Pm2min of the motor in regenerative operation. The lithium ion battery satisfying the first requirement and the second requirement ensures sufficient exertion of the drive characteristics of the motor MG2 and the power generation characteristics of both the motors MG1 and MG2. |
| US07803475B2 |
Fuel cell stack having current flow across diffusion media
A fuel cell stack includes a plurality of adjacently stacked fuel cell modules each of which includes a plurality of adjacently aligned fuel cells that are connected in electrical series. The current flow between adjacent fuel cells is achieved across diffusion media of said adjacent fuel cells. |
| US07803472B2 |
Substrate glass for data storage medium and glass substrate
To provide a substrate glass for data storage medium which is excellent in weather resistance even when no additional treatment such as chemical reinforcement treatment is applied and less susceptible to a whitening phenomenon and which has a glass transition temperature of at least 680° C. and is excellent in acid resistance.A substrate glass for data storage medium, which comprises, as represented by mass %, from 47 to 60% of SiO2, from 8 to 20% of Al2O3, from 0 to 8% of MgO, from 0 to 6% of CaO, from 1 to 18% of SrO, from 0 to 13% of BaO, from 1 to 6% of TiO2, from 1 to 5% of ZrO2, from 2 to 8% of Na2O and from 1 to 15% of K2O and which has a glass transition temperature of at least 680° C. |
| US07803471B1 |
Magnetic tape, its cleaning method, and optical servotrack forming/cleaning apparatus
A magnetic tape which comprises a nonmagnetic support, a magnetic layer which is formed on one surface of the nonmagnetic support, and a backcoat layer which comprises a binder and nonmagnetic powder containing carbon black as a component and which is formed on the other surface of the nonmagnetic support, having pits for optical servo formed thereon, characterized in that the average of the reflectance on the flat portion of the backcoat layer is 8.5% or higher, and that the maximum rate of fluctuation of the reflectance on the flat portion, depending on a position of the magnetic tape: [Maximum of absolute value of (Reflectance−Average reflectance)]×100/(Average reflectance) is 10% or lower. This magnetic tape is high in the initial S/N of the servo signal, and also high in the S/N of the servo signal found after the magnetic tape is run twice. |
| US07803469B2 |
White organic light emitting diode and method for manufacturing the same
A white organic light emitting diode (OLED) includes an emission layer that includes a blue emission layer and an emission layer excluding blue. The emission layer excluding blue includes a phosphorescent material and a mixture of a hole transporting material and electron transporting material. |
| US07803465B2 |
Strand cladding of calcium wire
A cored reactive metal wire is formed by gathering at least three strands of continuously fed elongated reactive metal wires into a bundle and aligning the bundle of wires with a continuously fed sheet of metal sheath. The bundle of wires is then compacted into a generally cylindrical shape and clad with the sheet of metal sheath whereby the compacted bundle of reactive metal wires form a core of the cored wire in which the core has a substantially larger diameter than each of the strands of continuously fed elongated reactive metal wires. |
| US07803464B2 |
Surface-coated cutting tool
A surface-coated cutting tool comprising a substrate, and a coating formed thereon, characterized in that the coating includes a first coating containing TiCN and a second coating containing α-type Al2O3, the first coating is interposed between the substrate and the second coating, and the second coating has compressive stress S1 on the rake face and tensile stress S2 on the flank face, with the compressive stress S1 and the tensile stress S2 being defined by the following expression; 441 MPa≦|S1−S2|≦3500 MPa. |
| US07803460B2 |
Filament bundle type nano fiber and manufacturing method thereof
A filament type nano-sized lone fiber and a method of producing the same are disclosed. In the method, a spinning solution or a spinning melt is electro-spun in drops using a spinneret to which a critical voltage is applied, and the spun drops are continuously collected on a multi-collector. The spinning solution is produced dissolving a blend or copolymer consisting of two or more kinds of polymers in a solvent. The spinning melt is produced by melting the polymers. The multi-collector is selected from the group consisting of a plate type collector, a roll type collector, and a combination thereof. The filament type nano-sized long fiber is processed into a yarn through one step during the electrospinning process, and thus, mechanical properties are better than those of conventional nanofiber non-woven fabric. Consequently, the filament type nano-sized long fiber can be utilized for the extended application. |
| US07803458B2 |
Hybrid organic-inorganic polymer coatings with high refractive indices
Novel compositions and methods of using those compositions to form metal oxide films or coatings are provided. The compositions comprise an organometallic oligomer and an organic polymer or oligomer dispersed or dissolved in a solvent system. The compositions have long shelf lives and can be prepared by easy and reliable preparation procedures. The compositions can be cured to cause conversion of the composition into films of metal oxide interdispersed with organic polymer or oligomer. The cured films have high refractive indices, high optical clarities, and good mechanical stabilities at film thicknesses of greater than about 1 μm. |
| US07803456B2 |
Glass bonded ceramic structures
Glass-bonded ceramics made of non-microcracked non-oxide or oxide ceramic particles which are bound together by glass into a unitary non-microcracked structure are disclosed. Such ceramics are suitable for use in substrates and filters, such as a diesel particulate filter. |
| US07803455B2 |
Optical element and optical pickup apparatus
The present invention provides an optical element including: a substrate; and an antireflection film formed on a surface of the substrate. The antireflection film includes a plurality of lower refractive index layers, and a plurality of higher refractive index layers which are layered alternately. Each of at least two of the plurality of lower refractive index layers comprises a same main component each other and comprises a side component with a different content ratio independently. |
| US07803447B2 |
High strength honeycomb structure, method of molding the same, and honeycomb structure converter
There are provided a honeycomb structure capable of suppressing a decrease in isostatic strength attendant on the thinning of the honeycomb structure, a honeycomb structure converter thereof, and a method of manufacturing the honeycomb structure. There is provided a honeycomb structure 1 having a number of cells 3 partitioned by partition walls 2 and extending to a axial direction. There are the honeycomb structure wherein a thickness (TY) of a partition walls (2Y) whose longitudinal direction is one direction (Y-direction) in a section perpendicular to the axial direction of the honeycomb structure 1 is greater than that (TX) of a partition walls (2X) whose longitudinal direction is the other direction; and a honeycomb structure converter thereof. There is provided a method of molding the above-mentioned honeycomb structure, wherein the honeycomb structure is extrusion molded such that the Y-direction is a direction of gravity. |
| US07803446B2 |
Construction of carpet with breathable membrane for eliminating moisture from surface covered by the carpet
A carpet has a layer of tufting supported on a primary backing layer. A breathable membrane is disposed along an interface between the primary backing layer and a secondary backing layer. A breathable membrane is disposed along an interface between the tufting layer and the backing layer, and adhesively secures the layer of tufting to the backing layer. The breathable membrane is permeable to water vapor but impervious to liquid water, while both the tufting layer and the backing layer are permeable to water vapor. In an alternative embodiment of the invention, a laminated barrier which includes the membrane, may be made of fibers, yarns, cross-laid scrim, or plastic netting, and the breathable membrane may be protected from abrasion with a floor by means of an apertured film laminated to the membrane. |
| US07803443B2 |
Optical disk including a sulfuration suppressing dielectric film
A phase change optical disk includes a first dielectric film, a recording film, a second dielectric film and a reflecting film which are consecutively formed on a substrate. The second dielectric film includes therein a zinc sulfide at a rate of 10 to 40 mol % and a tantalum oxide at a rate of 20 to 50 mol %, for preventing sulfuration of Ag in the reflecting film. |
| US07803442B2 |
Reduced ply separation tail seal
Easy starting rolls of perforated tissue product which have a reduced tendency to ply separate are formed with an adhesively secured doubled over tail tab folded against the roll. The strength and location of the bonds are controlled by controlling the penetration of the adhesive into the tissue. The dry tensile strength of the projecting folded over tail tab exceeds 400 g/in and the caliper thereof exceeds one mil The adhesive bonds are spaced away from lines of perforation joining sheets in the initial sheets of the roll. |
| US07803436B2 |
Liquid crystal composition and liquid crystal display device
A liquid-crystal composition which satisfies at least one of properties including a high upper-limit temperature for the nematic phase, low lower-limit temperature for the nematic phase, low viscosity, high optical anisotropy, negatively high permittivity anisotropy, high specific resistance, high stability to ultraviolet, and high stability to heat or has a proper balance between at least two of those properties. The liquid-crystal composition comprises a first ingredient comprising at least one compound selected among compounds represented by the formulae (1-1) and (1-2) and a second ingredient comprising at least one compound selected among compounds represented by the formula (2) and has negative permittivity anisotropy. For example, R1, R2, R3, and R4 each is C1-12 alkyl; Z1, Z2, and Z3 each is a single bond or —(CH2)2—; and ring A is 1,4-cyclohexylene or 1,4-phenylene. |
| US07803435B2 |
Liquid crystal composition and liquid crystal display apparatus having the same
A liquid crystal composition includes about 1 to about 40% by weight of an alkoxyl naphthalene-base compound, about 5 to about 30% by weight of a dialkoxyl naphthalene-base compound, and about 5 to about 80% by weight of a low viscosity compound. |
| US07803434B2 |
Liquid-crystalline medium
Disclosed is a liquid-crystalline medium based on a mixture of polar compounds having negative dielectric anisotropy, which contains at least one compound of formula I and at least one compound of formula I*, and their use in an electro-optical display. |
| US07803431B2 |
Method for coating a yarn
A method for coating yarn is proposed, including steps in which the yarn is first placed in contact with a dispersion of the coating agent in a dispersing agent or with the coating agent in melted form, optionally excess dispersion or melt is scraped back off the yarn, and then the coating is formed on the yarn, where in the case of the dispersion this occurs by means of at least partially removing the dispersing agent by heating, and the yarn thus coated is then cooled down and wound, which is distinguished by the fact that the coated yarn undergoes additional cooling before winding. |
| US07803427B2 |
Method of making window unit
A method of making a window unit is provided which may result in improved yields. In certain example embodiments, the method involves coating a substrate with both (i) a solar control/management coating, and (ii) a protective layer (e.g., of or including diamond-like carbon (DLC)) over the solar control/management coating. The protective layer protects the coated substrate from scratches and/or the like during processing prior to heat treatment. Then, during heat treatment, the protective layer(s) is burned off in part or in whole. Following heat treatment, the coated article (substrate with solar control/management coating thereon) is coupled to another substrate in order to form the window unit. |
| US07803421B2 |
External electrode forming method
An element forming an electronic component has a first face and a second face facing each other, and a third face adjacent to each of the first face and the second face. A method of forming an external electrode of the electronic component involves a pre-formation step, first to third formation steps, and an electrode formation step. The pre-formation step is to apply a conductive paste onto the third face and to evaporate at least a part of a liquid contained in the applied conductive paste, to form a precoat portion expected to become a part of a third electrode portion. The first formation step is to apply the conductive paste from a direction opposite to the first face, onto the first face to form a first electrode portion. The second formation step is to apply the conductive paste from a direction opposite to the second face, onto the second face to form a second electrode portion. The third formation step is to apply the conductive paste onto the third face so as to cover the precoat portion, to form the third electrode portion. The electrode formation step is to dry the element to form the external electrode consisting of the first electrode portion, the second electrode portion, and the third electrode portion. The first electrode portion, the second electrode portion, and the third electrode portion are formed so as to connect with each other. |
| US07803420B2 |
Methods and apparatus for inkjetting spacers in a flat panel display
Method of and apparatus for depositing a spacer on a substrate is provided. The invention includes depositing a first ink including an adhesive agent on a first area of the substrate and depositing a second ink including supporting elements on a second area of the substrate, the second area greater than and encompassing the first area. A portion of the second ink evaporates such that the supporting elements within the second ink migrate into the first area and bond to the adhesive agent in the first ink, forming a spacer. Numerous other aspects are provided. |
| US07803416B2 |
Packaging process for fresh meat products, fresh meat package obtainable thereby and twin lidding film suitable therefor
A method of packaging a fresh meat product on a support member (6) lidded with a twin lidding film (3) including an inner oxygen permeable film (15) and an outer gas impermeable film (16), by providing the twin lidding film (3) as a composite wound up on a single supply roll and, following unwinding and before entering into a lidding station (4), briefly separating the two films (15) and (16) before superposing them again one over the other before the sealing step. |
| US07803411B2 |
Physiologically active substance NK13650P3, method of producing the same and use thereof
A physiologically active substance NK13650P3 having the following physicochemical properties or a pharmacologically acceptable salt thereof. 1) Appearance: pale yellow powder 2) Molecular formula: C29H37N7O15 3) Molecular weight: 723 4) Hydrogen nuclear magnetic resonance spectrum: spectrum measured at 600 MHz in heavy water contains the following signals: chemical shift value δ ppm: 7.05 (1H, 3), 7.00 (1H, d), 6.96 (1H, d), 6.83 (1H, s), etc. 5) Carbon nuclear magnetic resonance spectrum: spectrum measured at 150 MHz in heavy water contains the following signals: chemical shift value δ ppm: 181.5(s), 181.4(s), 179.9(s), 179.2(s), 174.5(s), 174.3(s), 171.5(s), 165.4(s), etc. 6) Ultraviolet light spectrum: spectrum measured in aqueous solution contains the following UV absorption bands: λmax (MeOH): 196.5 nm, 224.5 nm, 322.5 nm 7) Solubility: highly soluble in water but insoluble in methanol, acetone, ethyl acetate, chloroform and dimethyl sulfoxide. 8) Coloration reaction: positive to phosphomolybdic acid/sulfuric acid reaction and Rydon-Smith reaction. |
| US07803409B2 |
Use of naturally occurring epoxidised molecules from Vernonia galamensis
Epoxidised oil, epoxidised wax or epoxidised fatty acid ester recovered from Vernonia Galamensis seeds provide topical medicament preparations which are effective in preventing and treating various different forms of skin diseases, skin lesions and wounds. These epoxidised oil, epoxidised wax or epoxidised fatty acid ester recovered from Vernonia Galamensis seeds can also be bound to bio-available molecules, such as proteins, to modify the effect of the bio-available molecules when administered to the human body. |
| US07803404B2 |
Method of drug formulation based on increasing the affinity of active agents for crystalline microparticle surfaces
Methods are provided for promoting the adsorption of an active agent to microparticles by modifying the structural properties of the active agent in order to facilitate favorable association to the microparticle. |
| US07803401B2 |
Dosage form comprising liquid formulation
A sustained release dosage form includes a capsule made of a thermoplastic polymer having a softening point below 200° C. and an orifice formed or formable within the capsule, an emulsion formulation contained within the capsule, and an expandable composition within the capsule remote from the orifice. The emulsion formulation comprises a drug, an emulsifying surfactant, and an oil. The expandable composition is configured to expand and expel the emulsion formulation through the orifice. |
| US07803400B2 |
Artificial low-density lipoprotein carriers for transport of substances across the blood-brain barrier
This invention relates to a highly efficient artificial low-density lipoprotein (LDL) carrier system for the targeted delivery therapeutic agents across the blood-brain barrier (BBB). In particular, this invention relates to artificial LDL particles comprised of three lipid elements: phosphatidyl choline, fatty-acyl-cholesterol esters, and at least one apolipoprotein. The present invention further relates to compositions, methods and kits comprising artificial LDL particles for targeting drugs to and across the BBB for the prevention and treatment of brain diseases. |
| US07803394B2 |
Polycationic peptide hydrogel coatings for cardiovascular therapy
Coatings for implantable medical devices and methods for fabricating the same are disclosed. The coating includes a hydrogel including polycationic peptides, for example the R7. |
| US07803393B2 |
Preparing an implant by gas-plasma treatment of a substrate to couple cells
An implant for use in biological/biomedical applications may be prepared by subjecting a substrate to a gas-plasma treatment. The substrate may be a biocompatible material, including metals, ceramics, and polymers. More specifically, the substrate may be a bioresorbable polymer. The gas-plasma treatment may include subjecting the substrate to a plasma formed by a reactive gas. The gas-plasma treatment may be performed for a chosen duration at a radio frequency within a temperature range, a pressure range, and a supplied energy range. The substrate may be exposed to living cells, such that some of the living cells become coupled to the substrate. Gas-plasma treatment parameters may be chosen such that the living cells coupled to the treated substrate produce more of a cellular product than living cells coupled to an untreated substrate. |
| US07803392B2 |
pH-Sensitive mucoadhesive film-forming gels and wax-film composites suitable for topical and mucosal delivery of molecules
The present invention relates to pH-sensitive mucoadhesive film-forming gels and wax-film composites suitable for topical and mucosal delivery of molecules of interest, namely active pharmaceuticals. The gels comprise a pharmaceutically acceptable pH-sensitive polymer that responds to a lowering of pH by precipitating into films when in contact with the skin or mucosal surface. The films also comprise an adhesive polymer that allows the film to remain in contact with the tissue for an extended period of time. The wax-film composites comprise a bi-layer film having both the said pH-sensitive mucoadhesive layer to promote strong adherence to the skin and mucosal surfaces as well as a specially bonded wax layer intended to extend the adherence of the film to tissues for a prolonged period of time. The invention also relates to the use of said pH-sensitive film-forming gels and wax-film composites to deliver molecules of interest, such as small molecules, peptides, proteins, and nucleic acids either locally to act at the site of administration or for the absorption of said molecules of interest across biological membranes into the systemic circulation. |
| US07803391B2 |
AXMI-028 and AXMI-029, a family of novel delta-endotoxin genes and methods for their use
Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a delta-endotoxin polypeptide are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated delta-endotoxin nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:2, 4, 15, 17, or 19, or the nucleotide sequence set forth in SEQ ID NO:1, 3, 14, 16, or 18, as well as variants and fragments thereof. |
| US07803388B2 |
Chlamydia PMP proteins, gene sequences and uses thereof
The invention discloses the Chlamydia PMPE and PMPI polypeptide, polypeptides derived therefrom, (PMP-derived polypeptides), nucleotide sequences encoding said polypeptides, antibodies that specifically bind the PMP polypeptides and PMP-derived polypeptides and T-cells specific for PMP polypeptides and PMP-derived polypeptides. Also disclosed are prophylactic and therapeutic compositions, including immunogenic compositions, e.g., vaccines, comprising PMP polypeptides or PMP-derived polypeptides or antibodies thereto. The invention additionally discloses methods of inducing in animals an immune response to Chlamydia cells, Chlamydia elementary bodies, and/or cells expressing Chlamydial proteins, e.g., cell infected with Chlamydia. |
| US07803387B2 |
Heterologous expression of Neisserial proteins
Alternative and improved approaches to the heterologous expression of the proteins of Neisseria meningitidis and Neisseria gonorrhoeae. These approaches typically affect the level of expression, the ease of purification, the cellular localization, and/or the immunological properties of the expressed protein. |
| US07803384B2 |
Method to stimulate aquilaria resin formation by wounding on the aquilaria tree
A method for stimulating resin formation in all breeds of Aquilaria tree. The method including selecting an Aquilaria tree that is at least five years old, having a trunk diameter between 4 inches and 6 meters. The method also includes wounding the tree by removing section of an outer layer of the trunk and forming holes in the wounding. Finally, the resin which results from the holes in the wound is harvested. |
| US07803377B2 |
Anti-DLL4 antibodies and methods using same
The invention provides anti-DLL4 antibodies, and compositions comprising and methods of using these antibodies. |
| US07803364B2 |
Multipotent neural stem cells
An isolated multipotent neural stem cells has a phenotype identified by expression of the protein β-tubulin IV and Olig2 and the absence of the proteins NG2, PLP, and GFAP. |
| US07803361B2 |
Therapeutic use of interleukin-2 mutants
Interleukin-2 (IL-2) mutants having reduced toxicity, which include full-length IL-2, truncated forms of IL-2 and forms of IL-2 that are linked to another molecule are disclosed herein. Particular substitutions within IL-2, particularly within the permeability enhancing peptide region of IL-2 achieve substantial reduction of vasopermeability activity as compared to a wildytpe form of the mutant IL-2 while retaining many of the immune activating properties of IL-2. Invention IL-2 mutants can be used to stimulate the immune system of an animal and may be used in the treatment of various disorders and conditions. |
| US07803359B1 |
UV-absorbers for ophthalmic lens materials
UV absorbing compounds that are particularly useful in ophthalmic devices are disclosed. |
| US07803355B2 |
Anhydrous paste for bleaching human keratin fibers
Disclosed herein is an anhydrous paste for bleaching human keratin fibers, such as hair, comprising at least one peroxygenated salt, at least one alkaline agent, from 15% to 35% by weight of at least one polydecene of formula C10nH[(20n)+2] wherein n ranges from 3 to 9, such as from 3 to 7, relative to the total weight of the paste, and from 0.01% to 10% by weight of at least one gelling agent chosen from hydrophilic fumed silicas, hydrophobic fumed silicas and diblock, triblock, multiblock and radial-block copolymer comprising at least one segment of styrene monomers and at least one segment of monomers chosen from thermoplastic monomers and comonomers, relative to the total weight of the paste. |
| US07803352B2 |
Method for continuous visualization of a blood clot or plaque in body lumen
A method for visualizing a blood clot or plaque disposed within a body lumen comprising: binding a contrasting complex comprising a contrast material and a thrombolytic material or a clot dissolving agent to the blood clot or plaque; and visualizing the blood clot or plaque over a period time by a visualizing system. |
| US07803343B2 |
Silica gel manufacturing method and gels made thereby
New silica gel materials and novel methods of producing such are provided. The method itself entails a manner of mixing the reactants together in a one-pot process such that the time required for aging is reduced without compromising the ability to target pore size production. In such a way, the pH of the reaction drives pore size development, thereby permitting a more efficient process to be followed in terms of expensive drying/heating steps being reduced timewise, if not altogether. Furthermore, in one embodiment, the resultant gel materials exhibit a certain pore size minimum while simultaneously exhibiting a degree of softness heretofore unavailable. As such, not only is this novel method more efficient in silica gel manufacture, but the resultant materials are completely novel as well. The gel materials made therefrom may be utilized in a variety of different end uses, such as cooking oil filtration, soft skin cleansers, dental abrasives, and the like. Methods of production and use, as well as the novel gel materials themselves, particularly caustic and composite gels, are thus encompassed within this invention. |
| US07803337B1 |
Method for treating a fluid to be scrubbed
A method for treating a fluid to be scrubbed, comprising filling a scrubber with a volume of biodiesel or biomass adequate to cover a sintered permeable membrane in the reaction chamber and a bit more to create a reaction zone in not only a plurality of pores in the membrane with fluid but in a reaction zone above the membrane, then introducing fluid to be scrubbed to the membrane, building up pressure in the reaction chamber, and passing a scrubbed fluid from the reaction zone to an exit port at a rate equal to the rate the fluid to be scrubbed is introduced. |
| US07803336B2 |
Process for the recovery of titanium in mixed chloride media
A process for leaching a value metal from a titanium-bearing ore material comprising the step of leaching the ore material at atmospheric pressure with a lixiviant comprising a chloride and hydrochloric acid is disclosed. The leaching conditions are such that titanium is leached and remains in solution. The temperature is maintained at less that 85° C., and the concentration of hydrochloric acid is preferably less than 20% (mass ratio). The preferred chloride is magnesium chloride. The lixiviant may contain oxidant e.g. sodium chlorate or chlorine. |
| US07803335B1 |
Remote brine tank for commercial water softeners
A brine tank provides a supply of brine to a commercial water softening system that is located remotely from the brine tank. Fresh water is delivered into the brine tank through a central header pipe from which a plurality of perforated risers extends laterally to both sides of the central header pipe. The perforated risers are located beneath the inlet opening for the delivery of loose salt, yet spaced from the brine pump so that a uniform salt concentration will be attained in the brine before being pumped to the water softener. The inlet opening for the delivery of loose salt is provided with a double leaf hatch cover to provide a receiving opening that is larger than the inlet opening into the brine tank so that loose salt can be funneled into the brine tank without significant spillage on the ground. |
| US07803334B1 |
Apparatus for hydrocracking a hydrocarbon feedstock
A hydrocracking process and apparatus wherein the feedstock is hydrotreated and the liquid and gaseous effluent from the hydrotreater is directly introduced into the upper end of a hydrocracking vessel which provides a liquid seal to prevent the passage of the gaseous stream containing hydrogen sulfide and ammonia from the hydrotreater to enter the hydrocracking zone containing hydrocracking catalyst. Fresh hydrogen is then introduced into the hydrocracking zone. |
| US07803332B2 |
Reactor temperature control
The invention is directed to a reactor system comprising at least one reactor wherein makeup water for said system is preheated by water/steam exiting said reactor. In a preferred embodiment the system comprises plural reactors and the invention provides for each reactor to independently achieve isothermal operating conditions. |
| US07803331B2 |
Isothermal chemical reactor
The present invention concerns an isothermal reactor (1) comprising a substantially cylindrical shell (2), at least one catalytic bed (10) supported in the shell (2) and at least one heat exchange unit (13) supported in the bed (10), the heat exchange unit (13) comprising a plurality of exchangers (14) substantially box shaped, of essentially elongated rectangular and flattened structure, each of the exchangers (14) having opposite long sides (14a) parallel to the cylindrical shell (2) axis and opposite short sides (14b, 14c) extended perpendicularly with respect to the shell axis and comprising furthermore an inner chamber (18) through which a heat exchange operating fluid in intended to flow, wherein at least one exchanger (14) of such at least one heat exchange unit (13) is internally equipped with a plurality of separation baffles (19) extended from a short side (14b or 14c) of the exchanger to the opposite short side (14c or 14b) and in a predetermined spaced relationship with respect to the latter, defining in the inner chamber (18) a substantially zigzag fluid path having alternating ascending and descending portions. |
| US07803329B2 |
Apparatus and methods for the production of ammonia and fischer-tropsch liquids
A gasification plant and methods for producing ammonia, Fischer-Tropsch fuels, electrical power, and/or sulfur from carbon-bearing feedstocks including coal and/or petroleum coke. Methods for production of desired relative amounts of ammonia and Fischer-Tropsch liquid hydrocarbons by adjusting the amount of synthesis gas bypassing the Fischer-Tropsch reactor. The multi-product and integrated plants may be used to reduce the amount of CO2 vented into the atmosphere during the production of these products. |
| US07803328B2 |
Microreactor and method of producing the same
A microreactor is configured to have a metal substrate having a microchannel portion on one surface thereof, a heater provided on the other surface of the metal substrate via an insulating film, a catalyst supported on the microchannel portion, and a cover member having a feed material inlet and a gas outlet and joined to the metal substrate so as to cover the microchannel portion. Since the microreactor uses the metal substrate having a high thermal conductivity and a small heat capacity, the efficiency of heat conduction from the heater to the supported catalyst becomes high, and the processing of the metal substrate is easy to facilitate the production. |
| US07803325B2 |
Integrated reactors, methods of making same, and methods of conducting simultaneous exothermic and endothermic reactions
Integrated Combustion Reactors (ICRs) and methods of making ICRs are described in which combustion chambers (or channels) are in direct thermal contact to reaction chambers for an endothermic reaction. Superior results were achieved for combustion chambers which contained a gap for flee flow through the chamber. Particular reactor designs are also described. Processes of conducting reactions in integrated combustion reactors are described and results presented. Some of these processes are characterized by unexpected and superior results. |
| US07803323B2 |
System and method for cleaning in-process sensors
A cleaning system and method for in-process sensors wherein a scouring jet discharges process fluid as the cleaning agent to remove solids and other contaminants from the surface of the sensor. |
| US07803322B2 |
Universal optical imaging and processing system
The disclosure is directed to a test media reader module including a housing, a membrane, and an optical imager. The housing is configured to receive a test media adapter and has a barrier wall configured to separate the test media adapter from an interior of the housing. The barrier wall includes a window having an interior side and an exterior side. The membrane is transparent to a wavelength useful for imaging test media in the test media adapter. The membrane has a reactive region and overlies at least a portion of the exterior side of the window. The optical imager is located interior to the housing and is configured to image the test media located on the exterior side of the window along an optical path extending through the window and the membrane. |
| US07803320B2 |
Apparatus for quality control analysis of an on-site prepared pharmaceutical product
A quality control system for measuring parameters in a pharmaceutical product includes a receiver vessel to receive a pharmaceutical product therein. The quality control system also includes a sample tube having a first end attached to the receiver vessel to remove pharmaceutical product from the receiver vessel and an appendage connected to a second end of the sample tube. The appendage includes at least one chamber therein to receive a quantity of pharmaceutical product from the receiver vessel. A valve positioned within the sample tube controls flow of the pharmaceutical product to the appendage and prevents flow of the pharmaceutical product from the appendage back into the receiver vessel. The system also includes a quality control device configured to measure at least one parameter of the pharmaceutical product in at least one of the receiver vessel and the appendage. |
| US07803319B2 |
Metering technique for lateral flow assay devices
A diagnostic test kit for detecting an analyte residing in a test sample is provided. The kit employs a lateral flow device that contains a membrane. A metering channel is formed in the membrane that is capable of delivering a controlled volume of the test sample to a detection zone upon initiation of the assay. Such a metering channel is particularly effective for embodiments in which the test sample has a relatively low volume, such as less than about 100 microliters, in some embodiments less than about 25 microliters, and in some embodiments, less than about 10 microliters. For example, whole blood drops obtained from patients with a lancet from low-pain areas (due to reduced nerve endings than finger), such as the forearm, thigh, or other alternate sites, may have a volume of from about 0.1 to about 5 microliters. Despite their low volume, the present inventors have discovered that the blood drops may still be accurately analyzed for the presence of an analyte using lateral flow detection techniques. |
| US07803313B2 |
Method for bonding powder metallurgical parts
Method for forming a unitary component from a plurality of powder metallurgy compacts. The method in some embodiments includes fluidizing first and second surfaces, wherein a first powder metallurgy compact defines the first surface and a second powder metallurgy compact defines the second surface. The method also includes joining the fluidizing first and second surfaces to form a bonded structure and thermally treating the bonded structure to fuse the first and second compacts into a unitary component. |
| US07803310B2 |
Crosslinked polyethylene article
A method of manufacturing an article may include crosslinking a UHMWPE preform, shaping the crosslinked preform, heat-treating the shape in a temperature-controlled oven and low-oxygen environment, and inspecting the heat-treated shape for conformance to article specifications. |
| US07803309B2 |
Infusion monitoring system and method
The invention relates to systems and methods which may be used to determine when an uncured composite part is ready to be cured. In one embodiment, a system under the invention may comprise an infrared camera adapted to take infrared images of an uncured composite part, a heating device adapted to heat an uncured composite part, an image capture device adapted to capture infrared images taken by the infrared camera, and a computer adapted to analyze infrared images taken by the infrared camera in order to evaluate temperatures of an uncured composite part. The infrared images may be used to determine that the composite part is substantially covered, and/or completely covered, with resin and ready to be cured. |
| US07803306B2 |
Individual cavity shut-off valve for an injection molding apparatus
An injection molding apparatus includes a first nozzle having a first nozzle melt channel in fluid communication with a manifold melt channel, and a second nozzle having a second nozzle melt channel in fluid communication with the first nozzle melt channel. A nozzle link is provided between the first nozzle and the second nozzle and includes a nozzle link melt passage for fluidly coupling the first nozzle melt channel and the second nozzle melt channel. The second nozzle includes a plurality of outwardly extending melt passages in fluid communication with the second nozzle melt channel. The outwardly extending melt passages deliver melt to a plurality of mold cavities through a plurality of respective gate seals and mold gates. At least one shut-off valve is disposed within the second nozzle. The shut-off valve is associated with an outwardly extending melt passage and switchable between an open position and a closed position. |
| US07803301B2 |
Process for making a molded valve housing for a prosthesis or an orthosis
A process is provided for casting a mounting which is attachable to a human body and which takes the form of a prosthesis socket or of an orthosis part. The mounting includes a reinforcement in the shape of a grid or frame located in the core region of the mounting and is surrounded by a lower polyurethane sublayer and a superposed polyurethane sublayer. The process includes a) providing a first spacer material to be soaked with a incompletely reacted polyurethane, b) producing a reinforcement thereon, c) removing the reinforcement, d) casting the lower polyurethane sublayer by saturating the first spacer material with the incompletely reacted polyurethane, e) superimposing the reinforcement on the polyurethane surface of the lower polyurethane, f) applying a second spacer material to be soaked with a partially reacted polyurethane and g) casting the superposed polyurethane sublayer by saturating the second spacer material with the incompletely reacted polyurethane. The first spacer material is positioned at the lower polyurethane sublayer. The second spacer material takes the form of the superposed polyurethane sublayer. The polyurethane sublayers come into contact and both sublayers bond reactively and enclose the reinforcement. |
| US07803294B2 |
Method and measuring system for obtaining a reference for a powder press
Method for determining a reference for a powder press, which comprises a die plate for attaching a die and an upper adaptor plate which may be actuated by a drive which is hydraulic, mechanical, electric or the like for attaching an upper punch, a lower adaptor plate which may be actuated by a hydraulic drive for attaching a lower punch or the die plate and at least one distance measuring system for the upper and lower punch and/or the die plate with the following steps: a reference die and at least one reference punch are made, the reference die is attached to the die plate, by an optical measuring device usefully arranged on a base plate and/or die plate, the position of the upper edge of the reference die is measured and the position value stored, the reference die is removed, the adaptor plate with the reference punch previously attached therein, is moved in the direction of the die until the lower edge of the reference punch has reached the stored position of the upper edge of the reference die, the sum of the reference die measurement and the reference punch measurement is obtained as the distance of the adaptor plate from the die plate and stored. |
| US07803290B2 |
Electrode material for rechargeable lithium battery, electrode structural body comprising said electrode material, rechargeable lithium battery having said electrode structural body, process for the production of said electrode structural body, and process for the production of said rechargeable lithium battery
An electrode material for a rechargeable lithium battery, characterized in that said electrode material comprises a fine powder of a silicon-based material whose principal component is silicon element, said fine powder having an average particle size (R) in a range of 0.1 μm≦R<0.5 μm. An electrode structural body for a rechargeable lithium battery, having an electrode material layer comprising said silicon-based material fine powder. A rechargeable lithium battery whose anode comprising said electrode structural body. |
| US07803281B2 |
Selective bonding for forming a microvalve
A method for forming a micromachined device is disclosed that includes providing a first silicon layer and a second silicon layer. A coating is provided on a first portion of the first layer. The first layer and the second layer are bonded to each other to form a micromachined device, the coating being effective to prevent the coated first portion of the first layer from bonding to the second layer. |
| US07803276B2 |
Regeneration of sulfuric acid
This invention relates to a process for recycling acid used to remove nitrogen contaminants from hydrocarbons using polymeric membranes to separate spent acid from the acid extraction of hydrocarbons into acid for recycle and acid for regeneration. |
| US07803273B2 |
Filter with better performance by minimizing clogging
A filter comprises at least one filtration unit with a filtration passage having an inlet and an outlet, wherein the filtration unit includes at least one groove formed in an inlet side surface of the filtration unit, said at least one groove extending to the inlet and dimensioned to hold back substances which may clog the filtration passage, by means of upper edges of said at least one groove. According to the present invention, by forming at least one groove in an inlet side surface of the filtration unit, the filtration passages of the filter can be effectively prevented from being clogged. |
| US07803272B2 |
Water treatment system
A first treatment tank (1) to a fourth treatment tank are installed prior to ultrapure water production apparatus (5), dilute wastewater recovering apparatus (34), general service water recovering apparatus and wastewater treatment apparatus. The treatment tanks (1, 2, . . . ) each have a micro-nano bubble generation tank (6, 23, . . . ) and an anaerobic measuring tank (7, 24, . . . ). Accordingly, microbes within the respective anaerobic measuring tanks (7, 24, . . . ) are activated by micro-nano bubbles generated in each micro-nano bubble generation tank (6, 23, . . . ) to thereby enhance the treatment efficiency of low-concentration organic matter. Further, when the value measured by dissolved oxygen meter (13, 30, . . . ) or oxidation-reduction potentiometer (14, 31, . . . ) of each anaerobic measuring tank (7, 24, . . . ) exceeds an individually determined given range, the rotational speed of a circulating pump (9, 26, . . . ) is controlled to thereby decrease the generation of micro-nano bubbles. Thus, the micro-nano bubble content in water undergoing treatment is held appropriate. |
| US07803269B2 |
Hydroisomerization process
A process is provided for improving the cold flow properties of a hydrocarbon stream employing a substantially liquid-phase continuous hydroisomerization zone where the reaction zone has a substantially constant level of dissolved hydrogen throughout without the addition of additional hydrogen external to the reaction zone. |
| US07803266B2 |
Doped spherically-shaped supported catalyst and process for hydrotreating and hydroconverting metal-containing oil fractions
A catalyst and process for hydrotreating and/or hydroconverting heavy metal-containing hydrocarbon feeds, said catalyst comprising a support in the form of beads based on alumina, at least one catalytic metal or a compound of a catalytic metal from group VIB (column 6 in the new periodic table notation), optionally at least one catalytic metal or compound of a catalytic metal from group VIII (columns 8, 9 and 10 of the new periodic table notation), with a pore structure composed of a plurality of juxtaposed agglomerates, each formed by a plurality of acicular platelets, the platelets of each agglomerate being generally radially orientated with respect to each other and with respect to the center of the agglomerate. The catalyst also comprises at least one doping element selected from the group constituted by phosphorus, boron, silicon (or silica which does not belong to that which could be contained in the selected support) and halogens. |
| US07803263B2 |
Thin film support substrate for use in hydrogen production filter and production method of hydrogen production filter
In a through hole closing process, a metal plate is attached to one surface of a conductive base member having a plurality of through holes by the use of a magnet, in a copper plating process, a copper plating layer is formed on the conductive base member and the metal plate exposed within the through holes, from the side of the conductive base member where the metal plate is not attached, thereby to fill up the through holes, in a film forming process, a Pd alloy film is formed by plating on the surface of the conductive base member after removal of the metal plate, and in a removal process, the copper plating layer is removed by selective etching, thereby to produce a hydrogen production filter that is used in a reformer of a fuel cell so as to be capable of stably producing high purity hydrogen gas. |
| US07803262B2 |
Alignment of carbon nanotubes using magnetic particles
Methods are provided for aligning carbon nanotubes and for making a composite material comprising aligned carbon nanotubes. The method for aligning carbon nanotubes comprises adsorbing magnetic nanoparticles to carbon nanotubes dispersed in a fluid medium to form a magnetic particle-carbon nanotube composite in the fluid medium; and exposing the composite to a magnetic field effective to align the nanotubes in the fluid medium. The method for making a composite material comprising aligned carbon nanotubes comprises (1) adsorbing magnetic nanoparticles to carbon nanotubes to form a magnetic particle-carbon nanotube composite; (2) dispersing the magnetic particle-carbon nanotube composite in a fluid matrix material to form a mixture; (3) exposing the mixture to a magnetic field effective to align the nanotubes in the mixture; and (4) solidifying the fluid matrix material to form a nanotube/matrix material composite comprising the aligned nanotubes which remain aligned in the absence of said magnetic field. |
| US07803261B2 |
Method to deposit particles on charge storage apparatus with charge patterns and forming method for charge patterns
The present invention discloses a method to deposit particles on a charge storage apparatus with charge patterns and a forming method for charge patterns. The forming method for charge patterns includes providing the charge storage apparatus having an electrically conducting substrate and a charge storage media layer. The charge storage apparatus is disposed in a vacuum or an anhydrous environment. An electrode and the electrically conducting substrate are utilized to conduct a first voltage and a second voltage respectively to form an electric field. Charges are then stored into the charge storage media layer of the charge storage apparatus through the electric field and the charge patterns are then formed. Accordingly, particles are deposited on the charge pattern-defined areas. |
| US07803260B2 |
Oxygen evolution electrode
Disclosed is an oxygen evolution electrode for formation of only oxygen without formation of chlorine at anode in the performance and the durability of the anode is so high that they are, even in strong acid, at the same level as that in neutral solution. The electrode is prepared by anodic deposition of multiple oxide consisting of Mn—Mo—Sn, Mo—W—Sn or Mn—Mo—W—Sn on an IrO2-coated titanium substrate. The multiple oxide are composed of Mn as the main component, 0.1-3 cationic % of Sn and 0.2-20 cationic % of Mo and/or W. |
| US07803258B2 |
Machine for localized cleaning with an electrolytic cell, for pickling and/or polishing metal surfaces
A machine for localized cleaning, using pickling acid or a composition/mixture of chemical elements with the effect of pickling acid, applied by mechanical feed instruments (54, 55) to the surface to be treated (5), presenting: the acid kept in a limited quantity in the work position by a cell (1; 11); the volume of this cell (7; 17) is made to match with that of the acid used, i.e. by filling it completely with acid projected on the surface to be treated; the cell having a peripheral edge (6; 23) against the aforementioned surface; the pickling acid activated by an electrode (8; 18) that activates the acid's pickling action. A machine wherein near the cell is provided with an open collecting device for aspirating the returning air (A) and the fumes leaving the cell and the excess of pickling acid (G) that escape laterally from the cell; the open collecting device comprises a hood (12; 19) the bottom edge (20) of which surrounds the edge of the cell (1; 11); a separator (58; 59; 60; 61) is located between the cell and a fan (62) for aspirating the pickling acid and polluting fumes (G); the acid is separated from the air and fumes (F) in the aforementioned separator. |
| US07803257B2 |
Current-leveling electroplating/electropolishing electrode
A current-leveling electrode for improving electroplating and electrochemical polishing uniformity in the electrochemical plating or electropolishing of metals on a substrate is disclosed. The current-leveling electrode includes a base electrode and at least one sub-electrode carried by the base electrode. The at least one sub-electrode has a width which is less than a width of the base electrode to impart a generally tapered, stepped or convex configuration to the current-leveling electrode. |
| US07803256B2 |
Corrosion protection system
A system for corrosion protection is disclosed. The system includes at least one component subject to corrosion and forming a cathode element. An anode element is disposed proximate the at least one component. A reference element is provided proximate the at least one component and configured to provide a voltage signal. An engine control module is configured to control a marine engine, determine a real-time amount of current for protecting the at least one component from corrosion, and deliver the real-time amount of current to the anode element. |
| US07803255B2 |
Device for plasma-activated vapor coating of large surfaces
The invention relates to a device for the plasma activated vapor coating of large-surface moved substrates, comprising at least one vacuum recipient, one pump system, one evaporator, one device for holding and transporting the substrates to be coated and at least one arc discharge plasma source, whereby at least one device for generating a magnetic field is included, which device can generate a magnetic field between the evaporator and the substrate, the field lines of which magnetic field are aligned approximately perpendicular to the movement direction and parallel to the transport plane of the substrate, and at least one arc discharge plasma source is arranged such that the axis of the arc discharge plasma source is aligned approximately perpendicular to the field lines of the magnetic field. |
| US07803249B2 |
Wiping products with controlled lint properties
Wiping products, such as tissue products, are disclosed containing an additive composition. The additive composition, for instance, comprises an aqueous dispersion containing an alpha-olefin polymer, an ethylene-carboxylic acid copolymer, or mixtures thereof. The alpha-olefin polymer may comprise an interpolymer of ethylene and octene, while the ethylene-carboxylic acid copolymer may comprise ethylene-acrylic acid copolymer. The additive composition may also contain a dispersing agent, such as a fatty acid. The additive composition may be incorporated into the base web by being combined with the fibers that are used to form the web. Alternatively, the additive composition may be topically applied to the web after the web has been formed. The additive composition can improve various properties of the wiping product. For instance, in one embodiment, the additive composition can reduce lint and increase softness. |
| US07803248B2 |
Method of drying mat products
The invention includes a method and system for generating electricity using a drive for the electrical generator that is powered by an engine that uses high pressure hot gases produced by combustion of a fuel and an oxygen bearing gas, using at least a portion of the electricity generated to power manufacturing plant equipment and using the waste hot exhaust gases from the heat engine, such as a gas turbine, with or without a heat exchanger, in an oven in which the mat is carried through continuously on a belt, drum or with other conventional means to dry the wet fibrous mats. Optionally the fibrous mats can contain a binder and the hot waste gases can be optionally used to cure a binder. |
| US07803245B2 |
Pipeline lining method
In a pipeline lining method, a tubular lining material impregnated with a thermosetting resin is inserted in an everted state into a pipeline and expanded and pressed against an inner peripheral surface of the pipeline. A vapor mist and water at normal temperature are sprayed toward the tubular lining material and mixed together to cool the vapor mist. The cooled vapor mist is directed onto the tubular lining material to cure the thermosetting resin impregnated in the tubular lining material to line the pipeline with the tubular lining material. |
| US07803244B2 |
Nonwoven composite containing an apertured elastic film
An elastic nonwoven composite that contains an elastic film laminated to one or more nonwoven web materials is provided. The composite is formed by passing the film through a nip to bond the film to the nonwoven web material(s). Concurrent with bond formation, apertures are also formed in the elastic film. The apertures are of a size sufficient to provide a desired level of texture, softness, hand feel, and/or aesthetic appeal to the composite without having a significant adverse effect on its elastic properties. Aperture and bond formation are accomplished in the present invention by selectively controlling certain parameters of the lamination process, such as film content, bonding pattern, degree of film tension, bonding conditions, etc. |
| US07803243B2 |
Method for making disposable pants-type diaper
A disposable pants-type diaper includes a separator interposed between the inner surface of a pants-type skin-covering assembly and the wearer's skin so as to protect the wearer's skin from being soiled with feces. The separator comprises a separator extending from a bottom of a crotch region of the diaper toward a front waist region and a rear waist region and fixed to the crotch region along transversely opposite margins thereof. The separator has a front end and a rear end both extending in a transverse direction of the crotch region and elastically extensible and contractible. In a transversely middle of the crotch region, these front and rear end edges are spaced from the inner surface of the absorbent chassis and joined integrally with each other. |
| US07803239B2 |
Self-adhered roofing components, roofing system, and method
Self-adhering flashing cap strip and end lap connector cap sheet assemblies include a reinforcing layer encapsulated within self-adhering bitumen. The bottom major surfaces of the flashing cap strips and the connector end lap cap sheets are formed by the self-adhering bitumen and the top major surfaces of the flashing cap strips and the connector end lap cap sheets have lateral edge portions formed by the self-adhering bitumen and a coated central portion that extends between the lateral edge portions. The flashing cap strips are used to interconnect cap sheets at roof surface intersections in the formation of waterproof roofing layers and the connector end lap sheets are used to connect lengths of cap sheets at the job site. |
| US07803235B2 |
Passivation of tantalum and other metal powders using oxygen
A method to passivate a metal or metal oxide or metal suboxide powder, especially a valve metal powder such as tantalum or niobium and the passivated powders formed therefrom are described. The method includes passivating a starting powder with a gas having at least 25 wt. % oxygen present. Passivation is preferably achieved without performing any evacuation steps. Capacitors made from the passivated powders are also described. |
| US07803232B2 |
Multi-pass inverting bottle cleaner
A bottle cleaner that inverts the bottles to spray solutions into them. The cleaner sends the bottles through two inverting passes for multiple stages of liquid cleaning. Thus, on the first pass, the bottles invert and receive, for example, a spray of a cleaning solution of some sort. The cleaner then returns the bottles to the upright orientation. On the second pass, the bottles again turn upside down and then may receive a liquid rinse. After returning the bottles to the normal orientation, the cleaner may then pass the bottles off to another location for further operations. Each pass of the bottles utilizes two sets of linked grippers arranged as a chain. One chain contacts the bottles on one side while the second chain contacts them on the other side. The two chains squeeze the bottles between them to firmly hold them. A single adjustment accomplishes a multitude of tasks. |
| US07803229B2 |
Apparatus and method for compensating uniformity of film thickness
An apparatus and a method for compensating uniformity of film thickness are provided. A shielding plate is provided between a vapor deposition object and a evaporation source. During the vapor deposition process, a shielding plate is continuously moved according to film deposition rates, so as to selectively pass or block atoms emitted from the evaporation source to achieve purpose of adjustably depositing. |
| US07803226B2 |
Siloxane polymerization in wallboard
Polymerization of siloxane is improved using a gypsum-based slurry that includes stucco, Class C fly ash, magnesium oxide and an emulsion of siloxane and water. This slurry is used in a method of making water-resistant gypsum articles that includes making an emulsion of siloxane and water, then combining the slurry with a dry mixture of stucco, magnesium oxide and Class C fly ash. The slurry is then shaped as desired and the stucco is allowed to set and the siloxane polymerizes.The resulting product is useful for making a water-resistant gypsum panel having a core that includes interwoven matrices of calcium sulfate dihydrate crystals and a silicone resin, where the interwoven matrices have dispersed throughout them a catalyst comprising magnesium oxide and components from a Class C fly ash. |
| US07803224B2 |
Paper and coating medium for multifunctional printing
A paper coating includes a combination of a primary pigment and a secondary pigment. The primary pigment includes anionic particles having a particle size distribution where at least 96% of the particles by weight have a particle size less than 2 microns. The secondary pigment is a cationic, grit-free pigment having an average particle size of 3 microns or less. The coating also includes up to 17 weight % of a hydrophilic styrene-butadiene latex based on the weight of the dry pigments and a co-binder. Another embodiment of this invention is a coated base sheet that includes a base sheet to which the above coating has been applied. |
| US07803220B2 |
Color lead for a writing device, drawing device or painting device
An unburnt color lead for writing devices, drawing devices and painting devices, includes at least one coloring material, at least one binder, at least one organic lubricant which is solid at room temperature, and at least one filler material whose particles essentially have a disk-shaped configuration. The color lead contains 20 to 80 weight % of the at least one filler material, and the color lead contains at least 20 weight % hexagonal bornitride as a first filler material. |