RECOMBINANT MICROORGANISM METABOLIZING 3,6-ANHYDRIDE-L-GALACTOSE AND A USE THEREOF |
|||||||
| 申请号 | EP14794024.1 | 申请日 | 2014-05-07 | 公开(公告)号 | EP2995684A1 | 公开(公告)日 | 2016-03-16 |
| 申请人 | Korea University Research and Business Foundation; | 发明人 | KIM, Kyoung Heon; CHOI, In-Geol; YUN, Eun-Ju; LEE, Sae Young; KIM, Hee Taek; | ||||
| 摘要 | The present invention relates to a recombinant microorganism metabolizing 3,6-anhydro-L-galactose and a use thereof, and, more particularly, can produce ethanol from a recombinant microorganism expressing an enzyme group involved in a metabolic pathway of 3,6-AHG. | ||||||
| 权利要求 | |||||||
| 说明书全文 | The present invention relates to a recombinant microorganism metabolizing a non-fermentable sugar such as 3,6-anhydro-L-galactose and a use thereof. With an energy crisis due to the depletion of petroleum resources, efforts are being made to develop energy resources replacing fossil fuels all around the world. As a part of such efforts, research for developing biofuels and biochemical materials which can replace fossil fuels with biomass to turn into a sustainable carbon economy and change a conventional chemical process into an environmentally-friendly bioprocess. The bioprocess is a new industry sector that can shift paradigm for upstream & downstream industries, and reduce a green house gas and a waste product. As biomass for producing biofuels, the first-generation sugar-based biomass such as corn and sugarcane was changed into the second-generation lignocellulosic biomass, and recently the third-generation algae-based biomass is in the spotlight. Among the algae-based biomass, red algae such as Gelidium amansii is known to have a higher carbohydrate content than those of green and brown algae, and agarose, which is the main polysaccharide constituting the red algae, is a polymer of 3,6-anhydro-L-galactose and D-galactose. The D-galactose is a fermentable monosaccharide that can be easily used by a microorganism, and has been widely studied to produce bioethanol by fermenting the D-galactose produced with a microorganism by hydrolyzing red algae biomass by a chemical or enzymatic treatment. Recently, an enzyme converting 3,6-anhydro-L-galactose was identified from microorganisms degrading agarose such as Saccharophagus degradans 2-40 and Pseudoalteromonas atlantica T6c ( Research on a method of producing 3,6-anhydro-L-galactose and its function ( However, the 3,6-anhydro-L-galactose is known as a non-fermentable monosaccharide that cannot be generally used by a microorganism, and, even though about 60% of red algae biomass consists of carbohydrates, it serves as the main reason of a low yield of biofuels from the of red algae biomass. The present invention is directed to providing a recombinant vector having enzyme family involved in a metabolic pathway of 3,6-anhydro-L-galactose, a recombinant microorganism transformed with the recombinant vector, and a method of producing ethanol from the recombinant microorganism. In one aspect, the present invention provides a recombinant vector for producing ethanol, which includes a gene encoding 3,6-anhydro-L-galactose dehydrogenase, a gene encoding 3,6-anhydrogalactonic acid cycloisomerase, a gene encoding 2-keto-3-deoxy-galactonic acid kinase, and a gene encoding 2-keto-3-deoxy-phosphogalactonic acid aldolase. In another aspect, the present invention provides a recombinant microorganism for producing ethanol, which is transformed by a gene encoding 3,6-anhydro-L-galactose dehydrogenase, a gene encoding 3,6-anhydrogalactonic acid cycloisomerase, a gene encoding 2-keto-3-deoxy-galactonic acid kinase, and a gene encoding 2-keto-3-deoxy-phosphogalactonic acid aldolase. In still another aspect, the present invention provides a method of producing ethanol, which includes fermenting the recombinant microorganism according to the present invention with one or more sugars selected from the group consisting of galactose and 3,6-anhydro-L-galactose as a carbon source. In yet another aspect, the present invention provides a method of producing ethanol, which includes producing pyruvate by a reaction of a cell culture or cell extract of the recombinant microorganism according to the present invention with one or more substrates selected from the group consisting of galactose and 3,6-anhydro-L-galactose, and performing alcohol fermentation with the pyruvate. According to the present invention, a method of producing ethanol in a recombinant microorganism expressing enzyme family involved in a metabolic pathway of 3,6-anhydro-L-galactose can be provided. Therefore, when a high value material is produced using red algae biomass, the method can be provided as the key technique that can increase a yield.
Hereinafter, the constitution of the present invention will be described in detail. The present invention relates to a recombinant vector for producing ethanol, which includes a gene encoding 3,6-anhydro-L-galactose dehydrogenase, a gene encoding 3,6-anhydrogalactonic acid cycloisomerase, a gene encoding 2-keto-3-deoxy-galactonic acid kinase, and a gene encoding 2-keto-3-deoxy-phosphogalactonic acid aldolase. The recombinant vector for producing ethanol of the present invention may produce ethanol as a final product using galactose and/or 3,6-anhydro-L-galactose (hereinafter, "3,6-AHG") as a substrate. More specifically, the recombinant vector includes a gene family encoding 3,6-anhydro- L -galactose dehydrogenase metabolizing 3,6-AHG, 3,6-anhydrogalactonic acid cycloisomerase responsible for the opening and isomerization of the ring structure of 3,6-anhydrogalactonic acid produced by the 3,6-anhydro-L-galactose dehydrogenase so as to convert to 2-keto-3-deoxy-galactonic acid, 2-keto-3-deoxy-galactonic acid kinase responsible for the phosphorylation of the 2-keto-3-deoxy-galactonic acid to 2-keto-3-deoxy-phosphogalactonic acid, and 2-keto-3-deoxy-phosphogalactonic acid aldolase responsible for the degradation of the 2-keto-3-deoxy-phosphogalactonic acid to pyruvate. The pyruvate is used as a starting material for alcohol fermentation, and ethanol is finally produced from the pyruvate through fermentation. The 3,6-anhydro-L-galactose dehydrogenase is an enzyme responsible for the conversion of 3,6-AHG to 3,6-anhydrogalactonic acid and may originate from Vibrio sp. EJY3, Saccharophagus degradans 2-40 or Pseudoalteromonas atlantica T6c, and may be represented by, for example, a Vibrio sp. EJY3-derived base sequence set forth in SEQ ID NO: 1 and the amino acid sequence set forth in SEQ ID NO: 2. The 3,6-anhydrogalactonic acid cycloisomerase is an enzyme responsible for the opening and isomerization of the ring structure of the 3,6-anhydrogalactonic acid so as to convert the 3,6-anhydrogalactonic acid to 2-keto-3-deoxy-galactonic acid and may originate from Vibrio sp. EJY3, Saccharophagus degradans 2-40 or Pseudoalteromonas atlantica T6c, and more specifically may be represented by any one of a Saccharophagus degradans 2-40-derived base sequence set forth in SEQ ID NO: 3 (the amino acid sequence: SEQ ID NO: 4), a Pseudoalteromonas atlantica T6c-derived base sequence set forth in SEQ ID NO: 5 (the amino acid sequence: SEQ ID NO: 6), and a Vibrio sp. EJY3-derived base sequence set forth in SEQ ID NO: 7 (the amino acid sequence: SEQ ID NO: 8). The inventors first identified 3,6-anhydrogalactonic acid cycloisomerase producing linear 2-keto-3-deoxy-galactonic acid from 3,6-anhydrogalactonic acid (hereinafter, referred to as "AHGA") without a stoichiometric change as the result of an enzymatic reaction of proteins respectively obtained from genes forming a cluster with 3,6-anhydro-L-galactose dehydrogenase, which is one of the AHG metabolic enzymes, by genetic engineering techniques. Therefore, the present invention also provides a composition for producing 2-keto-3-deoxy-galactonic acid, which includes 3,6-anhydrogalactonic acid cycloisomerase represented by any one of the amino acid sequences of SEQ ID NOs: 4, 6 and 8. The present invention also provides 3,6-anhydrogalactonic acid cycloisomerase represented by any one of the amino acid sequences of SEQ ID NOs: 4, 6 and 8, a microorganism producing the 3,6-anhydrogalactonic acid cycloisomerase, or a method of producing 2-keto-3-deoxy-galactonic acid by a reaction of a culture of the microorganism with the AHGA. The 2-keto-3-deoxy-galactonic acid kinase is an enzyme responsible for the phosphorylation of 2-keto-3-deoxy-galactonic acid to 2-keto-3-deoxy-phosphogalactonic acid and may originate from Vibrio sp. EJY3, Saccharophagus degradans 2-40 or Pseudoalteromonas atlantica T6c, and may be represented by the base sequence set forth in SEQ ID NO: 9 and the amino acid sequence set forth in SEQ ID NO: 10. The 2-keto-3-deoxy-phosphogalactonic acid aldolase is an enzyme responsible for the degradation of 2-keto-3-deoxy-phosphogalactonic acid to pyruvate and may originate from Vibrio sp. EJY3, Saccharophagus degradans 2-40 or Pseudoalteromonas atlantica T6c, and may be represented by the base sequence set forth in SEQ ID NO: 11 and the amino acid sequence set forth in SEQ ID NO: 12. The above-described genes include a polynucleotide encoding a protein which has a physiochemical activity of an enzyme and in which one or more amino acids are deleted, substituted, inserted and/or added. For example, the genes also include a polynucleotide having a nucleotide represented by any one of SEQ ID NOs: 1, 3, 5, 7, 9 and 11, and hybridized with the polynucleotide encoding the protein having the physiochemical property of the enzyme under severe conditions. The expression "polynucleotide hybridized under strict conditions" refers to a polynucleotide hybridized with one or more probe DNAs including a sequence of at least 20, and preferably at least 30 continuous residues (for example, 40, 60 or 100 continuous residues) arbitrarily selected from an enzyme protein, for example, under the conditions described in protocols (wash with primary washing buffer having 0.5×SSC at 42 °C) using an ECL direct nucleic acid labeling and detection system (Amersham Pharmacia Biotech). The polynucleotide of the present invention includes a isolated polynucleotide. The "isolated polynucleotide" refers to a polynucleotide existing in a different state from a naturally generated polynucleotide. For example, the isolated nucleotide includes a vector and a polynucleotide integrated into the genome of a different organism. Also, the isolated polynucleotide includes a polynucleotide obtained as cDNA, a PCR product, or a restriction fragment. Moreover, a polynucleotide used as a part of a polynucleotide encoding a fusion protein is included in the isolated polynucleotide. The polynucleotides encoding the above-described enzymes of the present invention may be isolated, for example, by the following method: designing a PCR primer based on each of the nucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9 and 11, and performing PCR using an enzyme-producing strain-derived chromosomal DNA or cDNA library as a template, and thereby DNA of the present invention is obtained. Also, the polynucleotide of the present invention may be produced by screening (a) the library obtained by introducing a restriction fragment of the enzyme-producing strain-derived chromosomal DNA into a phage or plasmid and transforming E. coli cells with the phage or vector, or (b) the cDNA library through colony hybridization or plaque hybridization using a DNA fragment obtained as a probe. Optionally, the polynucleotide of the present invention may be obtained by performing inverse PCR including analysis of a nucleotide sequence of the DNA fragment obtained by PCR, design of a PCR primer based on the sequence analyzed to elongate a strand in an external environment of a known DNA sequence, and digestion of the chromosomal DNA of the enzyme-producing strain with a suitable restriction enzyme and a self-cyclizing reaction using the DNA as a template ( In addition to the genomic DNA and cDNA cloned by the above-described method, the polynucleotide of the present invention includes synthesized DNAs. The term "recombinant vector" used herein is a vector which can express a target protein in suitable host cells, and refers to a gene construct having essential regulatory factors operably linked to express a gene insert. The vector may include, but is not limited to, a plasmid vector, a cosmid vector, a bacteriophage, or a virus vector. A suitable expression vector includes a signal sequence or leader sequence for membrane targeting or secretion as well as expression regulatory elements such as a promoter, an operator, a start codon, a termination codon, a polyadenylation signal, and an enhancer, and may be constructed in various forms depending on a purpose. The promoter of a vector may be constitutive or inducible. Also, the expression vector includes a selective marker for selecting host cells containing a vector, and if it is a replicable expression vector, includes the origin of replication. The recombinant vector of the present invention is preferably constructed by inserting each or all of the above-described enzyme-coding nucleic acids into an expression vector for E. coli strains. The expression vector for E. coli strains may be any of the generally used expression vectors for E. coli strains without limitation. The present invention also relates to a recombinant microorganism for producing ethanol transformed by a gene encoding 3,6-anhydro-L-galactose dehydrogenase, a gene encoding 3,6-anhydrogalactonic acid cycloisomerase, a gene encoding 2-keto-3-deoxy-galactonic acid kinase, and a gene encoding 2-keto-3-deoxy-phosphogalactonic acid aldolase. The transformation includes any method for introducing a nucleic acid into an organism, cell, tissue or organ, and may be carried out by selecting suitable standard technique depending on host cells as known in the art. Such a method may be, but is not limited to, electroporation, protoplast fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, stirring with silicon carbide fibers, Agrobacterium-mediated transformation, PEG, dextrane sulfate, or lipofectamine. Also, since an expression level and modification of a protein may vary depending on host cells, most suitable host cells may be selected depending on a purpose. The host cells may be derived from, but are not limited to, a prokaryote such as Escherichia coli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mirabilis, or Staphylococcus. The host cells may also be derived from a eukaryote such as a fungi (for example, Aspergillus) or a yeast (for example, Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces, and Neurospora crassa), but the present invention is not limited thereto. The transformant may be easily formed by introducing a recombinant vector having the genes into any host cells. More specifically, the recombinant microorganism may be transformed with a recombinant vector having a gene encoding 3,6-anhydro-L-galactose dehydrogenase, a recombinant vector having a gene encoding 3,6-anhydrogalactonic acid cycloisomerase, a recombinant vector having a gene encoding 2-keto-3-deoxy-galactonic acid kinase, and a recombinant vector having a gene encoding 2-keto-3-deoxy-phosphogalactonic acid aldolase. Alternatively, the recombinant microorganism may be transformed with a recombinant vector having a gene encoding 3,6-anhydro-L-galactose dehydrogenase and a gene encoding 3,6-anhydrogalactonic acid cycloisomerase, a recombinant vector having a gene encoding 2-keto-3-deoxy-galactonic acid kinase, and a recombinant vector having a gene encoding 2-keto-3-deoxy-phosphogalactonic acid aldolase. Alternatively, the recombinant microorganism may be transformed with a recombinant vector having a gene encoding 3,6-anhydro-L-galactose dehydrogenase, a gene encoding 3,6-anhydrogalactonic acid cycloisomerase, a gene encoding 2-keto-3-deoxy-galactonic acid kinase, and a gene encoding 2-keto-3-deoxy-phosphogalactonic acid aldolase. The recombinant microorganism according to the present invention may be a fermentation strain. The present invention also relates to a method of producing ethanol, which includes fermenting the recombinant microorganism according to the present invention with one or more sugars selected from the group consisting of galactose and 3,6-AHG as a carbon source. The recombinant microorganism according to the present invention may produce pyruvate, which is a starting material for alcohol fermentation, and thus produce ethanol using galactose and/or 3,6-AHG as a carbon source by enzymes capable of metabolizing the 3,6-AHG under fermentation conditions. During the fermentation, as an induction material, arabinose may be used. The present invention also relates to a method of producing ethanol, which includes producing pyruvate by a reaction of a cell culture or cell extract of the recombinant microorganism according to the present invention with one or more substrates selected from the group consisting of galactose and 3,6-AHG, and performing alcohol fermentation with the pyruvate. The recombinant microorganism according to the present invention may express a enzyme family capable of metabolizing 3,6-AHG, and since the cell culture or cell extract of the recombinant microorganism has the enzyme family, when reacting with galactose and/or 3,6-AHG as a substrate, pyruvate may be produced. The pyruvate may be a starting material for the alcohol fermentation, and ethanol may be produced from the pyruvate under fermentation conditions. Hereinafter, the present invention will be described in detail. The following examples merely demonstrate the present invention, but the scope of the present invention is not limited to the following examples. Vibrio sp. EJY3-derived 3,6-anhydro-L-galactose dehydrogenase was cloned. To this end, the following set of primers were prepared based on information of the base sequence of a 3,6-anhydro-L-galactose dehydrogenase-encoding gene (ORF Names: VEJY3_09240). Forward primer 1: 5'-gaaggagatataaggatgaaacgttaccaaatgtacgttg-3'(SEQ ID NO: 13) Reverse primer 2: 5'-atgatggtgatggtggtcgaaattcacatagaatgtcttc-3'(SEQ ID NO: 14) Each enzyme gene amplified by a PCR was cloned in a modified pET21a (hereinafter, referred to as "pJL") vector to which six histidine residues were added to a pBAD vector (Invitrogen, Product no. V440-01) and an N-terminus, and used to transform an expression E. coli BL21 (DB3) to express the enzyme. PCR conditions used herein were as follows: 1) the initial denaturation: 97 °C, 30 sec, 2) the annealing: 35 cycles: 97 °C, 10 sec - 57 °C, 1 min - 72 °C, 2 min, and 3) the final extension: 72 °C, 5 min. 3,6-anhydro-L-galactose dehydrogenase cloned in the pBAD vector induced expression using 0.2% (w/v) arabinose as an inducer at 16 °C and 200 rpm for 18 hours. The enzyme overexpressed in E. coli BL21 was purified using a His-trap column. 200 µg of the purified 3,6-anhydro-L-galactose dehydrogenase reacted with 10 mM 3,6-AHG and a 1.5 mM NADP cofactor in 20 mM Tris-HCl (pH 7.4) at 30 °C for 1 hour, a reaction product was analyzed by gas chromatography-time of flight mass spectrometry (GC-TOF MS), and a chemical structure was identified by two dimensional (2D) nuclear magnetic resonance (NMR). A derivatization reaction was carried out on an enzymatic reaction product dried for the GC-TOF MS analysis. 5 µl of the resultant derivative was added to a solution prepared by dissolving 40 mg/mL of methoxyamine hydrochloride in pyridine (Sigma-Aldrich, St. Louis, MO) and allowed to react at 30 °C for 90 minutes. Afterward, 45 µl of N-methyl-N-trimethylsilyltrifluoroacetamide (Fluka, Buchs, Switzerland) was added and allowed to react at 37 °C for 30 minutes. The derivatized sample was analyzed using an Agilent 7890 A GC (Agilent Technologies, Wilmington, DE) coupled to a Pegasus HT TOF MS (LECO, St. Joseph, MI). An RTX-5Sil MS column (30 m×0.25 mm, 0.25-µm film thickness; Restek, Bellefonte, PA) was used, and 1 µl of the sample was injected in a splitless mode. An oven temperature was first 50 °C, and a retention time was given for 1 minute, and the temperature was elevated to 330 °C at a rate of 20 °C/min, and then a retention time given for 5 minutes. An ion source temperature was 250 °C, and a temperature of a transfer line was 280 °C. A scanning range of mass spectra was 85 to 500 m/z. A reaction product was purified using a Sephadex G-10 column. That is, a chemical structure was identified with 2 mg of each of the purified reaction products using a Bruker Avance II 900 MHz NMR spectrometer through 13C NMR, 1H-13C HSQC NMR and 1H-13C HMBC NMR analyses. Here, an internal standard was 3-(trimethylsylyl)-propionic-2,2,3,3-d4acid. Therefore, it was identified that the enzymatic reaction product of the 3,6-anhydro-L-galactose dehydrogenase was AHGA. Saccharophagus degradans 2-40, Pseudoalteromonas atlantica T6c, and Vibrio EJY3-derived 3,6-anhydro-L-galactose dehydrogenase were cloned. To this end, based on the information on ACI gene sequences (European Molecular Biology Laboratory (EMBL) base sequence database accession nos.: CP000282, 1152nt, CP000388, 1137nt and CP003241, 1089nt) obtained from genomic sequences of Saccharophagus degradans 2-40, Pseudoalteromonas atlantica T6c and Vibrio EJY3, the following set of primers was prepared. Forward primer 1: 5'- gaaggagatataaggatgaaaattcataacatgaaaaattttatcaa-3' (47mer: SEQ ID NO: 15) Reverse primer 2: 5'- atgatggtgatggtgtcattcagcaaaatacactgtcttc -3' (40mer: SEQ ID NO: 16) Forward primer 1: 5'- gaaggagatataaggatgatgagtgtcattaccaaactagaca-3' (43mer: SEQ ID NO: 17) Reverse primer 2: 5'- atgatggtgatggtgagaatgtttaactaaatagggaagaag-3' (42mer: SEQ ID NO: 18) Forward primer 1: 5'- gaaggagatataaggatgaaaacaacaatcaaagacatcaaaa-3' (43mer: SEQ ID NO: 19) Reverse primer 2: 5'- atgatggtgatggtgcacttcgtactgagcaattttgt-3' (38mer: SEQ ID NO: 20) Each gene was amplified by PCR using corresponding genomic DNA as a template. To purify all N-terminal parts of the amplified sdeACI, patlACI, and vejy3ACI DNAs, they were cloned in a modified pET21a (hereinafter, pJL) vector including a gene sequence encoding six histidine residues by ligation independent cloning (LIC), and transformed into an expression E. coli BL21 (DE3) strain. Conditions for the PCR used herein are as follows: 1) initial denaturation: 97 °C, 30 sec, 2) annealing condition: 35 cycles: 97 °C, 10 sec - 57 °C, 1 min - 72 °C, 2 min, and 3) final extension: 72 °C, 5 min. E. coli prepared by transforming E. coli BL21 (DE3) with a recombinant plasmid including each of the sdeACI, patlACI, and vejy3ACI genes was inoculated into a Luria-bertani medium containing 50 mg/L of ampicillin, and cultured by shaking at 37 °C until OD600 approached 0.5 to 1.0. Afterward, expression was induced with 0.5 mM/L of isopropyl-β-D-thiogalactopranoside (IPTG) at 16 °C for 24 hours. A cell culture was centrifuged at 4000 rpm for 15 minutes, and a cell pellet suspended in 20 mM Tris-HCl buffer (pH 8.0) was disrupted using an ultrasonicator, thereby producing a crude extract. The crude extract was centrifuged at 4 °C and 15000 rpm for 40 to 60 minutes to separate a crude enzyme extract and a precipitate. After the crude enzyme extract was filtered with a 0.45 µm filter, a protein was purified by affinity chromatography, ion exchange chromatography, and gel filtration chromatography, in that order. As the result of 10% SDS-PAGE analysis, an enzyme having a size of about 42 kDa may be obtained (not shown). 25 µg of the purified 3,6-anhydrogalactonic acid cycloisomerase (vejy3ACI) reacted with the reaction product obtained in Example 1 at 30 °C for 1 hour. The reaction product was analyzed by GC-TOF MS, and analyzed by two dimensional (2D) NMR analysis to identify a chemical structure thereof, and purified using a Sephadex G-10 column. The anaylses and purification methods are the same as described in Example 1. As a standard material, 2-keto-3-deoxy-gluconic acid (Sigma, Product no. 12271) was used. As shown in For the growth experiment for recombinant E. coli, genes encoding enzymes such as Vibrio sp. EJY3-derived 3,6-anhydro-L-galactose dehydrogenase, and 3,6-anhydrogalactonic acid cycloisomerase were individually or simultaneously cloned into a pBAD vector, and transformed into E. coli K12 MG1655. Information on primers used herein is as follows:
Each enzyme produced by cloning the enzyme-encoding gene into the pBAD vector and transforming E. coli K12 MG1655 with the vector was expressed with 0.01% (w/v) arabinose. The E. coli K12 MG1655 strain having each enzyme-encoding gene was cultured in a modified M9 medium. A method of preparing the M9 medium is as follows. In order to prepare a 5-fold concentrated M9 salt solution, 2.5 g of NaCl, 5 g of NH4Cl and 250 mM of a Tris-HCl buffer (pH 7.4) were dissolved in 1L water and sterilized. 2 mL of 1M MgSO4, 0.1 mL of 1M CaCl2, 20 mL of 20% (w/v) 3,6-AHG, and 20 mL of a 5% (w/v) yeast nitrogen base (YNB) were added to 200 mL of the 5-fold concentrated M9 salt solution, and distilled water was added to a total volume of 1L. Culture conditions for the recombinant E. coli K12 MG1655 were 30 °C and 200 rpm. As the result of culturing the recombinant microorganism using 1% (w/v) 3,6-AHG as a carbon source and 0.01%(w/v) arabinose, as shown in The recombinant microorganism was cultured in an M9 medium under an aerobic condition at 30 °C for 96 hours, and the absorbance was measured at 600 nm. Here, as a carbon source, an agarose hydrolysate predominantly containing 20 mL of 20% (w/v) 3,6-AHG, 3,6-AHG and galactose was used. Here, as a carbon source, an agarose hydrolysate predominantly containing 3,6-AHG, 3,6-AHG and galactose was used. As a result, when the recombinant E. coli was cultured with an AHG as carbon source, it was confirmed that the E. coli was grown only under the condition of the recombination of the 3,6-anhydro-L-galactose dehydrogenase gene and the 3,6-anhydrogalactonic acid cycloisomerase gene ( Also, the recombinant microorganism was subjected to an ethanol fermentation experiment under a microaerobic condition. Ethanol produced by fermenting the recombinant microorganism was analyzed by GC-FID depending on a concentration of an ethanol standard material to draw a calibration curve. A cell culture was centrifuged (16,000 rpm, 4 °C, 5 minutes), a supernatant obtained thereby was analyzed, and analysis conditions are as follows: the inlet temperature: 250 °C, the split ratio: 20:1, the pressure: 11.567 psi, the total flow: 24 mL/min, and the septum purge flow: 3 mL/min. 1 µl of a sample was injected. An oven flow was 1 mL/min, and an oven temperature was 40 °C, maintained for 3.5 minutes, and elevated to 150 °C at a rate of 50 °C/min, and a retention time of 1 minute was given. Afterward, the temperature was elevated to 180 °C at a rate of 20 °C/min, a retention time was given for 2 minutes, and a total analysis time was 10.2 minutes. An FID temperature was 300 °C, a hydrogen gas flow was 40 mL/min, an air flow was 350 mL/min, and a helium gas flow was 15 mL/min. According to the calibration curve of A cell density under the microaerobic condition was similar to that under the conditions of the empty vector and two enzyme genes ( 3,6-AHG metabolism-associated enzyme family, that is, 3,6-anhydro-L-galactose dehydrogenase, 3,6-anhydrogalactonic acid cycloisomerase, 2-keto-3-deoxy-galactonic acid kinase, and 2-keto-3-deoxy-phosphogalactonic acid aldolase were introduced into E. coli KO11 FL strain for fermentation. Information on primers used herein is as follows:
When the 3,6-anhydro-L-galactose dehydrogenase-encoding gene (ORF Names: VEJY3_09240)and the 2-keto-3-deoxy-galactonic acid kinase-encoding gene + 2-keto-3-deoxy-phosphogalactonic acid aldolase-encoding gene + 3,6-anhydrogalactonic acid cycloisomerase-encoding gene (VEJY3_09380 + VEJY3_09375 + VEJY3_09370, respectively) were simultaneously cloned into pBAD, an XbaI restriction site of VEJY3_09240 primer 2 and an XbaI restriction site of VEJY3_09380 + VEJY3_09375 + VEJY3_09370 primer 1 were designed to be joined to each other by ligation, and XhoI and SnabI restriction sites at the ends of the VEJY3_09240 and VEJY3_09380 + VEJY3_09375 + VEJY3_09370, which were joined to each other, were designed to be joined to the pBAD vector. Methods of enzyme expression and culture of the recombinant E. coli KO11 FL strain were the same as used for the recombinant E. coli K12 MG1655 produced in Examples 1 and 2. Here, as a carbon source for the medium, 1% galactose or 1% galactose + 1% 3,6-AHG was used. A growth experiment was carried out by culturing the recombinant microorganism. As a medium, the modified M9 medium described above was used, and the recombinant microorganism was cultured under a carbon source-free condition (control), a condition in which only 1% (w/v) 3,6-AHG was added without an inducing material, a condition in which only 0.01% (w/v) arabinose was present as an inducing material, and a condition in which 0.01 % (w/v) arabinose was added to 1% (w/v) 3,6-AHG. As shown in The recombinant microorganism was fermented under the condition of a mixed sugar of an agarose degradation product, which is galactase, and 3,6-AHG. Here, fermentation was carried out under the conditions of 1% (w/v) galactose and the mixed sugar (1% (w/v) galactose + 1% (w/v) 3,6-AHG), which were used as a carbon source of the medium, and 0.01% (w/v) arabinose was used as an inducing material. As shown in The recombinant microorganism was subjected to an alcohol fermentation experiment under a microaerobic condition by the same method as described in Example 3. As shown in The present invention may be used in the field of producing bioethanol. |
||||||
