Document | Document Title |
---|---|
US11944363B2 |
Surgical rod bending method
A method for bending a surgical rod using an automated bending system includes receiving an indication of a plurality of line segments defined on the rod and an indication of an angle measurement to be formed between at least two adjacent ones of the plurality of line segments. Bending parameters to perform on the rod to form the angle measurement between the at least two adjacent ones of the plurality of line segments are determined and operation of the automated bending system is controlled using the bending parameters to create an angle having the angle measurement between the at least two adjacent ones of the plurality of line segments. |
US11944357B2 |
Minimally invasive surgery add on screw system
A system, medical devices, and methods for use in surgical procedures, such as spinal surgeries. The system, medical devices, and methods are designed to provide a surgeon the ability to add a screw connector, or screw head such as a tulip, to pre-existing implanted bone, such as pedicle, facet, lateral mass, etc., screw system without having to remove the previously implanted screws and/or rods already existing in a patient. |
US11944354B2 |
Spinal implant system and method
A spinal construct includes a coupling member including a first mating surface engageable with an existing fastener implant. The existing fastener implant defines a cavity configured for disposal of an existing spinal rod implant. A connector is engageable with the existing fastener implant and has a rod extending therefrom. A locking member is engageable with a second mating surface of the coupling member. Systems, surgical instruments, implants and methods are disclosed. |
US11944353B2 |
Implants and instruments for enhancing vertebral alignment and sagittal balance
Spinal stabilization implant assemblies, as well as systems, instruments and methods are provided for implanting and stabilizing adjacent vertebra in connection with a surgical procedure, particularly a spinal surgery. The implant assemblies and instruments enable controlled spinal rod insertion and reduction, and controlled rotation or de-rotation of adjacent spinal bones for optimized compression to achieve enhanced sagittal balance in a treated spine. |
US11944349B2 |
Adjustable vascular closure device assembly
A vascular closure device assembly, comprises a sheath comprising: a sheath main body defining a channel therethrough, a sheath engagement portion, and a sheath mounting portion located at a proximal end of the sheath main body. The assembly comprises a housing within which the sheath mounting portion is secured such that the sheath is rotatable relative to the housing, and such that the housing inhibits axial displacement of the sheath relative to the housing. The assembly also includes a dilator comprising a dilator main body, and a dilator engagement portion extending from the dilator main body towards the sheath. The dilator engagement portion is configured to engage the sheath engagement portion such that axial displacement of the dilator relative to the sheath causes the sheath to rotate relative to the housing, and wherein the housing is configured to inhibit axial displacement of the sheath during rotation. |
US11944348B2 |
Surgical access device including an anchor having a suture retention mechanism
A surgical access device includes a cannula body, an anchor, and a first suture retention mechanism. The cannula body includes a housing and an elongated portion extending distally from the housing. The elongated portion defines a longitudinal axis and a channel extending therethrough. The anchor is disposed in mechanical cooperation with the elongated portion of the cannula body and is longitudinally translatable relative to the elongated portion. The first suture retention mechanism extends laterally from the anchor. A suture-receiving channel is defined between a portion of the suture retention mechanism and a portion of the anchor. |
US11944346B2 |
Optical trocar assembly
A cannula assembly configured to receive a surgical instrument therethrough includes an elongated body portion, a housing coupled to a proximal end portion of the elongated body portion, and an annular-shaped light member. The housing defines a longitudinally-extending channel therethrough dimensioned for passage of the surgical instrument. The light member is disposed within the housing and about the channel. |
US11944344B2 |
Guidance system, method and devices thereof
A guidance system, a method and a device for dynamically guiding a surgical needle catheter onto an organ to be surgically operated of a patient. In particular, the disclosure relates to a guidance system, a method and a device to aid in the percutaneous kidney puncture. |
US11944343B2 |
Aspiration catheter including mechanical cutter
In some examples, a catheter includes an elongated body defining an inner lumen and comprising an expandable member disposed at a distal portion of the elongated body, and a rotatable cutting tool located within an inner lumen of the elongated body, the rotatable cutting tool configured to segment a thrombus into smaller pieces while an aspiration force pulls the thrombus proximally into the inner lumen. In some examples, the catheter further comprises an intermediate structure oriented radially between the rotatable cutting tool and an interior surface of the elongated body, the intermediate structure configured to prevent the cutting tool from contacting the interior surface of the elongated body. In some examples, a stopper is configured to limit movement of the cutting tool distally past a distal end of the expandable member. |
US11944342B2 |
Identification of elastic lamina to guide interventional therapy
Described herein is a system and method for identifying elastic lamina during interventional procedures, such as atherectomy. Such identification can be used to avoid trauma to the external elastic lamina during the procedure. |
US11944341B2 |
Ultrasonic surgical instrument with a mid-shaft closure system and related methods
An ultrasonic surgical instrument comprises a shaft assembly including a waveguide, and an end effector arranged at a distal end of the shaft assembly and including an ultrasonic blade and a clamp arm. The instrument also comprises a base translatably coupled to shaft assembly. The base includes a first mechanical input and a second mechanical input. The instrument further comprises a closure actuation mechanism operatively connected between the first mechanical input and the clamp arm and configured to actuate the clamp arm from an open position toward a closed position upon selective drive of the first mechanical input. The instrument also includes an insertion actuation mechanism operatively connected between the second mechanical input and the shaft assembly and configured to actuate the shaft assembly from a proximal position toward a distal position upon selective drive of the second mechanical input for insertion of the end effector. |
US11944337B2 |
Surgical instrument with increased actuation force
A surgical instrument with improved end-effector gripping force. The instrument comprises a shaft, which may be inserted into a body of a patient. The articulated end-effector is mounted on the distal extremity of the instrument shaft and comprises a plurality of links interconnected by a plurality of joints, whose movements are remotely actuated by the surgeon's hands. This remote actuation is accomplished through mechanical transmission, mainly along flexible elements, which are able to deliver motion from a set of actuation elements, placed at a proximal extremity of the shaft, to the instrument's articulated end-effector. The articulated end-effector further comprises one or more cam-and-follower mechanisms that are able to amplify the force transmitted by the flexible elements so that the actuation force at the instrument jaws is maximized and the tension on the transmission elements minimized, thus increasing the fatigue resistance and life of the instrument. |
US11944336B2 |
Joint arrangements for multi-planar alignment and support of operational drive shafts in articulatable surgical instruments
Various shaft guide embodiments are disclosed and may comprise a shaft guide body that comprises a proximal end that may have an oval shape aligned on a proximal long axis and a distal end that may have a distal oval shape aligned on a distal long axis that is transverse to the proximal long axis. The shaft guide body may further comprise a first passage that defines a first passage proximal opening oriented in a first orientation and a second passage that defines a second passage distal opening that is oriented in a second orientation that differs from the first orientation. |
US11944329B2 |
Suction evacuation device
A method for removing a stone from a patient comprising the steps of: providing a suction evacuation assembly which includes a sheath and one or more side arms; inserting and positioning a distal end of the sheath into a lumen or cavity of a patient's body containing a stones; connecting a tube to one of the side arms and to a collection bottle; connecting another tube to the collection bottle and a negative pressure system; visualizing the stone or foreign body using a scope inserted through the assembly; activating the negative pressure system in order to remove the stone from the cavity if the diameter of the stone is narrower than an inside diameter of the sheath and the side arm, or performing a lithotripsy on the stone to create fragments with a decreased diameter which allow the passage through the assembly; and collecting the stone in the collection bottle. |
US11944328B2 |
Apparatus and methods for controlled clot aspiration
A vacuum aspiration control system for use with a vacuum source and an aspiration catheter includes a connecting tube configured to connect the vacuum source with a lumen of an aspiration catheter. An on-off valve is operatively coupled to the connecting tube, and a sensing unit is configured to detect flow within the connecting tube and provide a signal representative of flow. A controller receives the signal to decide whether to open or close the valve. The controller may automatically close the valve to stop flow when flow through the connecting tube is unrestricted, or according to a predetermined timing sequence. The controller can further periodically open a closed valve to determine whether flow has entered an acceptable range. The controller can still further engage pulsed aspiration with a pressure manipulation assembly when flow is restricted or occluded. |
US11944323B2 |
Surgical tool
A surgical tool for use in gaining access to the spine and including a part which is arranged to avoid other anatomical structures when the tool is in use; the tool comprising: a distal working end formation, a proximal end and intermediate said ends a formation displaced from a longitudinal axis and extending between said distal and proximal ends wherein the displaced formation is arranged to avoid said other anatomical structures anatomy during use of the working end of the tool. |
US11944318B2 |
Surgical clamp
A surgical clamp is disclosed. The surgical clamp comprises a two-piece body comprising atop jaw housing that inter-fits with a bottom jaw housing; the top jaw housing comprising a top jaw; the bottom jaw housing comprising a bottom jaw; the inter-fitting top jaw housing and bottom jaw housing disposed for movement relative to one another; a bias to the top jaw housing and bottom jaw housing apart; and a lever moveable between a lock position and an open position and the lever disposed to prevent opening movement of the top jaw housing relative to the bottom jaw housing and to allow graduated relative closing movement of the top jaw housing relative to the bottom jaw housing in the lock position and to allow opening and closing movement of the top jaw housing relative to the bottom jaw housing in the open position. The structure of the clamp is such that compressive force applied to one or more of the top jaw housing and the bottom jaw housing causes graduated closing movement of the top jaw housing and the bottom jaw housing to close the top jaw and the bottom jaw. The lever may comprise an axial arm and a lateral arm wherein the axial arm comprises one or more tooth or pawl disposed at a distal end of the axial arm and the lateral arm comprises a button disposed on a distal end of the lateral arm wherein pressing the button or the distal end pivots or moves the axial arm. The pivoting or movement may be oblique pivoting or movement and may disengage the one or more tooth from the rack. |
US11944315B2 |
Left atrial appendage occlusion devices
An occlusion device (210) is provided for occluding a left atrial appendage (LAA), including a compliant balloon (230) defining a fluid-tight balloon chamber (232), and an actuating shaft (234), which is disposed at least partially within the balloon chamber (232) for setting a distance between distal and proximal end portions (236, 238) of the balloon (230). A proximal LAA-orifice cover (70) includes a frame (72) and a covering (74) fixed to the frame (72). An orifice-support stent (290) is fixed to and extends distally from the proximal LAA-orifice cover (70), and is generally cylindrical when in a radially-expanded state. Other embodiments are also described. |
US11944312B2 |
Percutaneous catheter directed intravascular occlusion devices
Embodiments of the present invention provide an improved vascular occlusion device for occlusion of a passageway, cavity, or the like. According to one embodiment, a medical device for occluding a left atrial appendage is provided. The medical device includes a first portion having at least one plane of occlusion that is configured to be positioned outside of the left atrial appendage, and a second portion having at least one plane of occlusion that is configured to be at least partially positioned within a cavity defined by the left atrial appendage. |
US11944309B2 |
Powered circular stapler with reciprocating drive member to provide independent stapling and cutting of tissue
An apparatus includes a shaft assembly and an end effector. The shaft assembly includes an outer sheath and a staple driving mechanism. The end effector includes a staple deck, an anvil, a first staple driver, and a second staple driver. The staple deck defines a plurality of staple openings in at least one annular array. Each staple opening in the plurality of staple openings houses a staple. The anvil is configured to actuate relative to the staple deck to compress tissue between the staple deck and the anvil. The staple driving mechanism is configured to actuate the first staple driver to fire a first staple of the plurality of staples against the anvil. The staple driving mechanism is further configured to actuate the second staple driver independently of the first staple driver to fire a second staple of the plurality of staples against the anvil. |
US11944307B2 |
Surgical stapling system including jaw windows
A fastener cartridge can include, one, a cartridge body comprising a deck and a plurality of fastener cavities and, two, a plurality of fasteners positioned in the fastener cavities. The cartridge body can further comprise extensions extending from the deck having different sizes and/or configurations. The extensions can control the flow of tissue relative to the deck and/or support the fasteners as they are ejected from the fastener cavities. |
US11944303B2 |
Staple cartridge
A staple cartridge can comprise a plurality of staples positioned within a cartridge body, wherein the cartridge body can comprise a tissue-contacting deck and a plurality of ridges extending from the tissue-contacting deck. The ridges can be configured to prevent, or reduce the possibility of, tissue from moving relative to the staple cartridge during use. The staple cartridge can further comprise a plurality of staple cavities, wherein each staple cavity can comprise an opening in the deck which is at least partially surrounded by a ridge. The ridges can comprise a uniform height or a height which varies along the length thereof. The height can vary relative to a proximal end and a distal end of the cartridge body and/or between the center of the cartridge body and the side. |
US11944301B2 |
Surgical instruments having a reinforced staple cartridge
The present disclosure provides a surgical instrument, such as a tissue sealing instrument, with an elongate shaft and first and second jaws movably coupled to the shaft. The second jaw comprises a cavity for receiving a staple cartridge and a substantially longitudinal reinforcing wall extending through the cavity. The instrument further includes a drive member configured to translate through the end effector to close the jaws and to engage a plurality of staples within the staple cartridge to drive the staples into tissue. The reinforcing wall provides additional support for the staple cartridge to inhibit deformation of the staple cartridge during actuation, thereby improving the staple formation in the tissue. This improves the tissue seal provided by the staples without increasing the overall size of the end effector. |
US11944296B2 |
Powered surgical instruments with external connectors
A modular surgical instrument system, comprising a handle assembly, comprising a disposable outer housing configured to define a sterile barrier. The disposable outer housing comprises a first housing-portion and a second housing-portion movable relative to the first housing-portion between an open configuration and a closed configuration. The handle assembly further comprises a control inner core receivable inside the disposable outer housing in the open configuration. The disposable outer housing is configured to isolate the control inner core in the closed configuration. The modular surgical instrument system further comprises a primary wired interface configured to transmit data and power between the control inner core and at least one of modular components of the modular surgical instrument system, a secondary interface comprising a sensor located within the outer housing, and a control circuit configured to confirm a primary connection through the primary wired interface based on at least one sensor reading. |
US11944295B2 |
Surgical instrument comprising end effector with longitudinal sealing step
Disclosed is an electrosurgical instrument including an end effector with a cartridge having an asymmetric cartridge body. |
US11944292B2 |
Anvil layer attached to a proximal end of an end effector
An anvil-attachable layer for use with a surgical stapler, or fastening instrument, wherein a proximal end portion of the layer is attached to a staple cartridge assembly, for example. The layer may be attached to the staple cartridge assembly by an adhesive, weld, or a staple-cartridge-based clamp, wherein the attachment is weak enough to allow the layer to pull away from the staple cartridge assembly with stapled tissue. Alternatively, the layer can include two or more lateral slits that define a connector region that can be cut by a knife of a surgical stapler to release the layer. |
US11944291B2 |
Wound closure system
A wound closure system and a method of reducing the size of an open wound are disclosed. A suture line is sutured through body tissue adjacent an open wound, the suture line sutured so as to pass into the body tissue at an entry point and exit at an exit point, the suture line including a plurality of barbs extending outwardly at an acute angle with respect to a surface of the suture line. A biasing member applies a continuous pulling force on the suture line for stretching the body tissue toward the open wound, wherein the biasing member is configured to take up any slack of the suture line during stretching of the body tissue and keep the suture line taut. |
US11944289B2 |
Articulating surgical instruments
Articulating surgical instruments are disclosed. In one embodiment, a surgical instrument may include an elongated shaft assembly including an articulable portion moveable between a non-articulated configuration and an articulated configuration. First and second articulating shafts of the elongated shaft assembly may be coaxially arranged and axially fixed at an attachment point located distally from the articulable portion. Proximal portions of the first and second articulating shafts may be displaceable in opposing directions to articulate the articulable portion from the non-articulated configuration to the articulated configuration. In another embodiment, an articulation control may be movable from a first position to a second position to move an articulation lock from a locked configuration to an unlocked configuration to selectively permit articulation of a surgical instrument. The articulation lock also may be movable from the second position to a third position to articulate the surgical instrument. |
US11944287B2 |
System and method for retracting body tissue
A method for retracting body tissue providing a retractor system that includes a rail having two opposed widened rail portions separated by a narrowed portion, each widened portion engageable by a separate clamp. The clamps are configured to support the rail to a fixed surface, or to support a surgical device. Each clamp may independently be positioned or slid along the rail to a desired location without interference with a clamp on an opposing widened rail portion. A device clamp is formed of spherical mating portions which enable alignment of a surgical device along six degrees of freedom, and tightenable by securing a single fastener. A retractor blade mount enables an angular and tilting disposition of a retractor blade, as well as remote manipulation of the retractor blade. |
US11944283B2 |
Medical apparatus and adhesion promoting device using same
To reduce the risk of a ruptured suture after a surgery or the like, a medical apparatus includes a biodegradable sheet in which a plurality of through-holes are formed, a value of a ratio (D/P) of a hole diameter D to a pitch P of the through-hole is in a range of 0.25 or more and less than 40. Such a medical apparatus is useful as an adhesion promoting device for promoting adhesion of biological tissue. |
US11944282B2 |
Articulation mechanisms and methods of use
An accessory device for use with a medical device includes a first cuff secured to a distal end of the medical device, a second cuff secured to the medical device proximal of the first cuff, an actuator, and at least one actuation wire extending from the first cuff, through the second cuff, to the actuator. |
US11944280B2 |
Adapter, surgical instrument set, and method for connecting surgical instrument
An adapter for detachably connecting a surgical instrument to a robot arm of a robotic surgical system according to an embodiment may include: a base including a first surface to be attached to an attachment portion of the robot arm, a second surface, and a plurality of recesses formed in the first surface; an engagement member disposed in the base and movable between an advanced position where the engagement member is advanced into the plurality of recesses and a retracted position where the engagement member is retracted from inside the plurality of recesses; a biasing member which biases the engagement member in a direction from the retracted position to the advanced position; and an operating member to be operated to move the engagement member to the retracted position against a biasing force of the biasing member. |
US11944271B2 |
Endoscope tip part with improved optical properties
An endoscope tip part including a tip housing at least partially enclosing an interior cavity and including a window, and a vision assembly accommodated in the interior cavity and including an imaging subassembly including an image sensor viewing in an optical direction through the window of the tip housing, a light source comprising an illumination surface for emitting light, a separate frame component including a light shielding wall made of an opaque material and extending between the image sensor and the light source so as to at least partially shield the image sensor from light emitted from the light source. |
US11944270B1 |
Systems and methods of rotation compensation for brain optical imaging and stimulation
Embodiments of the present disclosure are directed to microendoscope instruments and methods that allows the imaging fiber to freely rotate with the animal while capturing images and projecting stimulation patterns with correct orientations. The microendoscope includes a first spatial light modulator for sourcing a first light source and generating a stimulated pattern to a fiber coupled to an imaging implant for attaching to the brain of the subject. A rotary joint is disposed between the microendoscope and the imaging implant to facilitate the movements and rotations of the imaging implant that is attached to the subject, thereby provides an essentially frictionless contact to brain of the subject so that the subject can freely moves and rotates without feeling the cumbersome imaging implant and fiber that are attached to the subject. A camera captures images obtained from the imaging implant with the specimen taken from the subject. |
US11944269B2 |
Endoscope connector and endoscope
An endoscope connector includes: a plug including an electric contact configured to be electrically connected to an external medical apparatus, the plug being provided with a first substrate; a first frame electrically connected to the plug; a second frame electrically connected to the first frame, the second frame being made of metal; a first electric connection member electrically connected to the first substrate; a second electric connection member connected to the first electric connection member; a substrate unit including a second substrate and an electromagnetic shield member covering the second substrate, the electromagnetic shield member being made of metal; and an urging member configured to urge the substrate unit in a direction of the second frame, and to put the electromagnetic shield member into an electric conduction state by causing the electromagnetic shield member to abut on the second frame. |
US11944265B2 |
Medical imaging systems and methods
An exemplary medical imaging system includes an imaging device that includes a visible light camera configured to obtain image data representative of a two-dimensional visible light image of a scene and a depth sensor separate from the visible light camera and configured to obtain depth data representative of a depth map of the scene. The medical imaging system further includes a image processing system communicatively coupled to the imaging device and configured to generate, based on the image data and the depth data, a right-side perspective image of the scene and a left-side perspective image of the scene that together form a stereoscopic image of the scene. |
US11944264B2 |
Confocal endoscope with fixing device
The present invention relates to the technical field of endoscopes, and discloses a confocal endoscope with a fixing device. The confocal endoscope includes an insertion tube, a flexible tube, a plurality of airbag assemblies, and a pressure supply assembly, where the flexible tube is slidably sleeved on the insertion tube, a plurality of containing units are formed in an outer wall of the flexible tube in an axial direction and are distributed in the axial direction of the flexible tube at intervals, each containing unit includes a plurality of containing grooves evenly distributed in a circumferential direction of the flexible tube, and the outer wall of the flexible tube is concaved inwards to form the containing grooves; the airbag assemblies and the containing units are arranged in a one-to-one correspondence mode, each airbag assembly includes a plurality of elastic airbags, the elastic airbags and the containing grooves are arranged in a one-to-one correspondence mode, and the elastic airbags are connected to inner walls of the containing grooves; the pressure supply assembly is selectively communicated with the elastic airbags of one or more airbag assemblies and configured to inject fluid media with certain pressure into the elastic airbags. According to the present invention, the insertion tube can be prevented from jittering. |
US11944261B2 |
Electronic endoscope system and data processing device
An electronic endoscope system includes an electronic endoscope, a processor that includes an evaluation unit, and a monitor. The evaluation unit includes an image evaluation value calculation unit that calculates an image evaluation value indicating an intensity of lesion in the living tissue for each of a plurality of images of the living tissue, and a lesion evaluation unit that calculates a representative evaluation value of the image evaluation value from the image evaluation values of the plurality of images corresponding to a plurality of sections for each of the plurality of sections in which a region of the organ is divided using information of an imaging position in the organ whose image is captured and evaluates an extent of the lesion in a depth direction inside the organ using the representative evaluation value. |
US11944260B2 |
Vacuum cleaner
A vacuum cleaner including a vacuum motor configured to draw an air flow through an air flow path of the vacuum cleaner; a dirt separator having dirt, receptacle; a display screen; and a controller configured to control images displayed on the screen. The dirt receptacle has a closed configuration in which it can receive dirt separated from the air flow, and an open configuration in which dirt contained in the dirt receptacle can be emptied therefrom. The controller is configured to display video instructions on the screen. |
US11944259B2 |
Vacuum cleaner
A vacuum cleaner comprises a nozzle (N) for cleaning a surface, a suction tube (T) for receiving input air from the nozzle (N), a cyclone device having a cyclone (C) and a dirt container (DC) both oriented substantially perpendicular to the suction tube (T), a cyclone device input coupled to the suction tube (T) from which the input air is transported, following a spiral around a center, in a first direction substantially perpendicular to the suction tube (T) to reach a stage (V) at which dirt is separated from the input air to obtain cyclone output air, from which stage the cyclone output air is conveyed through a conduit in a second direction substantially perpendicular to the suction tube (T) and opposite to the first direction to arrive at a cyclone device output, a filter (F) for filtering the cyclone output air, and an airflow generator (A) for generating an airflow through the suction tube (T), the cyclone (C) and the filter (F), wherein when the nozzle (N) is touching the surface, the suction tube (T) is put in a substantially horizontal position, the first and second directions are substantially perpendicular to the surface, with the notion substantially perpendicular allowing for a deviation of not more than 35 degrees. |
US11944256B2 |
Easy loading silverware basket
A dishwasher system for cleaning dishes may include at least one rack configured to receive a silverware basket, the basket including at least one silverware compartment, a pair of camshafts including a first camshaft and a second camshaft, each fixed to the rack and operable by a gearbox configured to rotate the camshafts with respect to the rack, the camshafts arranged below the silverware basket, and a cam arranged at each end of each of the camshafts, wherein upon rotation of the camshaft by the gearbox, the cams affect the height of a respective corner of the basket to allow the silverware therein to be lifted or lowered and exposed to spray at various heights or angles from sprayers within the dishwasher. |
US11944255B2 |
Wall mounted dishwasher
A wall mounted dishwasher incorporates storage into an exterior door of the dishwasher to facilitate user access to utensils stored in the dishwasher. The exterior door may be hinged and configured to rotate about a substantially vertical axis, and one or more spray devices and/or one or more fluid collection pans may be integrated into the exterior door. |
US11944252B2 |
Cleaning system and method for cleaning items to be cleaned
A cleaning system (110) and a method for cleaning items to be cleaned (112) are proposed. The cleaning system (110) comprises: a) at least one cleaning apparatus (114), having at least one at least partially closed cleaning chamber (116) with at least one loading apparatus (118) for loading the items to be cleaned (112) with at least one cleaning liquid; and b) at least one transport system (144) for the automatic transport of the items to be cleaned (112), the transport system (144) comprising: a. at least one first conveying apparatus (146) for the delivery of dirty items to be cleaned (112); b. at least one second conveying apparatus (148) for the transport of the dirty items to be cleaned (112) to the cleaning apparatus (114); c. at least one transfer apparatus (150) for the transfer of at least one part of the dirty items to be cleaned (112) from the first conveying apparatus (146) onto the second conveying apparatus (148); and d. at least one buffer store (152) for the buffer storage of at least one part of the dirty items to be cleaned (112), the transfer apparatus (150) being set up to selectively transfer the dirty items to be cleaned (112) from the first conveying apparatus (146) directly onto the second conveying apparatus (148), or to buffer store them in the buffer store (152) and to subsequently transfer them onto the second conveying apparatus (148). |
US11944251B2 |
Domestic dishwasher
A household dishwasher includes a washing container having a floor, and a spray arm supported for rotation about an axis of rotation and including spray nozzles for applying washing liquor and/or fresh water to a dishwasher load received in the washing container. The spray arm is designed so as to be capable of being disassembled and re-assembled along the axis of rotation, in order to transfer the spray arm from a first mode, in which the spray nozzles point away from the floor, into a second mode, in which the spray nozzles point toward the floor, and vice versa. |
US11944250B2 |
Cleaning system incorporating stitch bonded cleaning pad with multi-filament stitches
A cleaning pad structure of stitch bonded construction incorporating one or more substrate layers of an absorbent nonwoven material with an optional additional fluid blocking substrate layer of polymer film or other suitable material in juxtaposed relation to the absorbent nonwoven layers. Stitching yarns are introduced in stitching relation through the substrate layers. One face of the pad defines a cleaning surface of raised yarn loops formed by the stitched yarns. The pad further includes an attachment surface facing away from the cleaning surface. The stitches of yarns across the attachment surface define an engagement surface for attachment to cooperating hooking elements across a surface of a mop head to define a hook and loop attachment system. |
US11944249B2 |
Nozzle for cleaner
A nozzle for a cleaner includes a nozzle housing having a suction flow path through which air containing dust flows, a first rotation cleaning unit and a second rotation cleaning unit located on a bottom side of the nozzle housing, the first rotation cleaning unit and the second rotation cleaning unit being spaced apart from each other in a left-right direction of the nozzle housing, each of the first rotation cleaning unit and the second rotation cleaning unit having a rotation plate, a driving device located in the nozzle housing, and a water tank located on the nozzle housing, the water tank being configured to store water to be supplied to the first rotation cleaning unit and the second rotation cleaning unit. The water tank includes a first chamber, and a second chamber spaced apart from the first chamber in the left-right direction of the nozzle housing. |
US11944248B2 |
Surface cleaning device with automated control
A surface cleaner is provided. The surface cleaner comprises: an operating component configured to perform a function of the surface cleaner; a base moveable along a surface; an accelerometer configured to generate a signal; and a controller in communication with the accelerometer and the operating component, wherein the controller is operable to control the operating component based on the signal, and wherein the operating component is selected from a group consisting of a suction motor operable to generate an airflow, a brushroll motor operable to drive a brushroll, an actuator operable to adjust a height of a brushroll from the surface, a pump operable to deliver a cleaning fluid, an actuator operable to control an airflow or fluid valve, and an indicator operable to indicate a parameter of the surface cleaner. |
US11944247B2 |
Mopping member, mopping apparatus, cleaning robot, and control method for cleaning robot
Disclosed relates to a mopping member, a mopping apparatus, a cleaning robot, and a control method for the cleaning robot. The mopping member includes a first mop and a second mop; the first mop is provided with a first rotating center, the second mop is provided with a second rotating center, and the distance between the first rotating center and the second rotating center is a rotating center distance. When the first mop and the second mop rotate, a short-diameter edge of one mop corresponds to a long-diameter edge of the other mop; at a connection line position of the first rotating center and the second rotating center, a gap between the first mop and the second mop is formed between the short-diameter edge of one mop and the corresponding long-diameter edge of the other mop. |
US11944242B2 |
Scrubbing tool having a dissolvable cleaning head
A scrubbing tool for cleaning a surface that has a handle for holding by a user in a cleaning operation. The handle has a first connector. The scrubbing tool also has a cleaning head having a second connector configured to mate with the first connector in order to attach the cleaning head to the handle in an engaged position. The cleaning head is comprised entirely of a material configured to dissolve in water and has a cleaning agent. |
US11944241B1 |
Hands-free toilet paper dispenser
The hands-free toilet paper dispenser comprises a toilet paper holder, a sheet feeder mechanism, a motion sensor, and a fragrance dispenser. The hands-free toilet paper dispenser may mount on a wall of a bathroom adjacent to a toilet. The hands-free toilet paper dispenser may hold a roll of toilet paper on the toilet paper holder. The sheet feeder mechanism may be adapted to dispense one or more sheets of toilet paper when a user's hand passes in front of the motion sensor without having to touch the hands-free toilet paper dispenser. The fragrance dispenser may be operable to dispense a fragrance into the bathroom to mask odors resulting from use of the toilet. |
US11944240B2 |
Fabric warming rack
An unenclosed fabric warming rack includes at least one rod extending along a horizontal plane, a first light source positioned on a first end of the at least one rod, and a second light source positioned on a second end of the at least one rod. |
US11944232B2 |
Apparatus for making a beverage, comprising an image acquisition device
An apparatus for making a beverage including an infusion chamber for a capsule containing a food substance, an insertion opening for inserting the capsule into the apparatus, a transfer channel for transferring the capsule from the insertion opening to the infusion chamber, an image acquisition device to acquire at least one image of a portion of the capsule. The image acquisition device includes an optical sensor facing an image capture zone in which, in use, said capsule is located or passes. A viewing window, made of transparent material, is interposed between the optical sensor and the image capture zone. A heating element for heating the viewing window is applied to, or incorporated in, the viewing window. |
US11944229B2 |
Electric kettle
An electric kettle may include a body configured to form a space in which liquid, such as water may be contained, a handle that protrudes from an outer surface of the body, a heating module provided inside of the body to heat liquid inside of the body, an operation portion provided in the handle to operate so as to control an operation of the heating module, and a main printed circuit board (PCB) provided inside of the handle to control the operation of the heating module according to an operation of the operation portion. The body may have a double wall structure including two walls spaced apart from each other, and an electric wire that connects the main PCB and the heating module may be guided from the handle to the heating module through a space between the two walls. |
US11944220B2 |
Bedding system and method
The present disclosure relates to a bedding system that can minimize the time, labor and/or frustration associated with making a bed. It comprises a fitted sheet to fit over the mattress top surface and side surfaces and a flat sheet to fit over the fitted sheet outer surface. The flat sheet lower section is being secured/coupled to the fitted sheet lower section. The bedding system further comprises a bedspread to fit over the flat sheet outer surface. The bedspread lower longitudinal edge, the bedspread first side longitudinal edge, the bedspread second side longitudinal edge and the bedspread upper section are being releasably secured to the flat sheet lower longitudinal edge, the flat sheet first side longitudinal edge, the flat sheet second side longitudinal edge and the flat sheet upper section along their respective lengths. |
US11944218B2 |
System and method of providing packing inventory sensing and management of a supply compartment for a storage receptacle
A package deposit enclosure designed for public use is powered by an efficient storage battery and photovoltaic cell array. These unique features allow the package deposit enclosure to be placed in locations where no power is available, but where there is frequent human traffic. Sensing and wireless data communication features allow the unit to be emptied less often than typical package delivery enclosures. Wireless communication also allows users' access to real-time information. On board power enables other functions, such as lighting and audio, to enhance device functionality. |
US11944217B1 |
Anti-theft package delivery apparatus and system
A package delivery apparatus for securing delivered packages includes a flexible bag, a security strap, and a locking mechanism. The flexible bag is configured to accommodate one or more packages and includes an opening adjustable between an open position and a closed position. The security strap is integrated with the bag and cinches around the opening. The locking mechanism selectively allows the security strap to move in one direction to secure the closed position. The locking mechanism includes a housing, a lock element, a ratcheting mechanism, and a handle mechanism. The security strap extends through the housing and the ratcheting mechanism and is coupled to the handle mechanism. Moving the handle mechanism to an extended position cinches and locks the bag closed. The lock element is selectively actuated to disengage the security strap from the ratcheting mechanism and allow the bag to be re-opened. |
US11944206B1 |
Detachable rocking chair structure
A detachable rocking chair structure is provided. The detachable rocking chair structure includes a main backrest rod, a main backrest reinforcement rod, a cushion side rod, a connecting crossbar, an elastic band, and a rocking chair cover, where the main backrest reinforcement rod includes a first end connected to the main backrest rod and a second end connected to the cushion side rod; the connecting crossbar and the elastic band are connected to the cushion side rod; and the rocking chair cover is sleeved on an upper surface of each of the main backrest rod, the cushion side rod, the connecting crossbar, and the elastic band. |
US11944202B2 |
Folding headrest stand
A compact headrest stand that selectively unfolds to support a user's head over a support surface. The stand includes a lower member pivotally attached to an upper member. A downward-extending lip configured to capture the edge of a support surface is formed on the opposite edge of the lower member. The upper member includes a center void and two support arms, each with a saddle clip. Attached to the saddle clips is a headrest assembly configured to support the user's forehead and facial bones. During use, the lower member is placed on a support surface, and the upper member is rotated upward and diagonally aligned over the lower member. The headrest is placed on the saddle clips and can swivel between the two support arms. Attached to the lower member is a stop leaf that, when diagonally aligned, holds the upper member diagonally over the lower member. |
US11944199B2 |
Mechanical stretching device for movable seat unit and seat unit
The present disclosure relates to a mechanical stretching device for a movable seat unit, and a movable seat unit thereof. The mechanical stretching device includes: a linkage support that comprises a support structure configured to support the mechanical stretching device on ground and a linkage structure attachable to a seating portion of the seat unit; a back mechanism that is pivotally connected to the linkage support and is configured to attach to a backrest of the seat unit; and a leg stretching structure including a footrest element, and the leg stretching structure is pivotally connected to the linkage support, and the footrest element is attached to a footrest of the seat unit. The mechanical stretching device is configured to implement a sequential conversion or a reverse sequential conversion of the seat unit from a sitting state to a relaxing state and to a lying state. |
US11944191B2 |
Foldable buffet station
This invention is a foldable buffet station comprising supporting legs and a countertop frame mounted on upper ends of the supporting legs. The supporting legs comprise two sets of supporting panels on left and right sides. Each set of the supporting panels comprises a front supporting panel and a rear supporting panel which are rotationally connected. The countertop frame comprises a front beam, a rear beam, and two left and right side beams which form a rectangular frame. The two left and right side beams are respectively fixed at upper ends of the two rear supporting panels on left and right sides. The rear beam is detachably fixed at upper ends of the two back side supporting panels. The front beam is fixed at upper ends of the two front side supporting panels. When it is necessary to fold the buffet cart, the cooking module on the countertop frame is removed first, and then the rear beam is removed; since the front supporting panels and the rear supporting panels are rotationally connected, pushing the two rear supporting panels at this time results in rotation and folding, and the side beams follow the corresponding supporting panels to rotate. As a result, the occupying space of the entire buffet cart can be greatly reduced, which is convenient for transportation and storage. |
US11944190B2 |
Post engageable table
A post engageable table system is provided where one or two half sections of a table are removably engageable to one or both sides of an upright support post. Compressive fasteners adjacent recesses on a contact edge of each table half section are positionable to a compressive engagement with a second side of the post wherein they can be engaged, removed, or adjusted for height in such an engagement. |
US11944185B2 |
Modular accessory system for storage containers with MOLLE webbing
A modular system for a container with MOLLE webbing is described, comprising a two component coupling system including: 1), a clip component which couples to the MOLLE on the container; and 2), a bracket component that couples to the clip and support various modular subcomponents. The same modular accessory system works with hard coolers while allowing the lid to close flat against the lip of the bucket while the modular accessories are in use. |
US11944173B2 |
Takeout food container
The present invention discloses a disposable takeout food container, comprising a first sleeve cover, and a second sleeve cover. The first sleeve cover and the second sleeve cover when oriented perpendicular to a tray and engaged with the tray, support the tray at an elevated position, functioning as serving tray stands to form a stable table-tray. |
US11944172B2 |
Portable listening device with sensors
An earbud includes a housing that includes a driver assembly positioned within the housing forming a front volume in front of the driver and a back volume behind the driver. An acoustic insert is positioned behind the driver assembly and attached to an interior surface of the housing such that it forms a bass channel that is routed from the back volume to a vent in the housing. |
US11944167B2 |
Wristbands with magnetic coupling
A wristband can comfortably secure an electronic device, such as a wristwatch or fitness/health tracking device, to a wrist of a user. The wristband can include a number of magnets that allow the wristband to be magnetically coupled to itself when folded over or when separate band portions are overlapping. The magnets can include a polymer mixed with a magnetic material to provide magnetic properties and flexibility. The magnets can be joined together by a continuous support structure that extends through opposing pairs of the magnets. The support structure can provide substantial and ability as well as tensile strength. The magnets and the support structure can be surrounded by a flexible cover to protect the components within. |
US11944164B2 |
Device clamping, multi-purpose, with removable, interchangeable and customizable plate
A mechanical closure and fastening device, having a first part (1), made of a plate with a pin (1A) extending therefrom, the pin having first and second shaped sections in registry alignment and a narrower engaging section therebetween; and a second part (2), made of three plates (2A), (2B) and (2C), joined together, each having an opening in registry alignment and shaped to receive the first and second shaped sections when the pin is inserted thereinto; wherein plate (2B) has a rotatable plate within a fixed housing and having a lever (3) with which the rotatable plate may be rotated between an open position and a tightened, locked position within the housing, wherein in the tightened, locked position the opening in the rotatable plate is rotated out of registry alignment with the openings in plates (2A) and (2C); and wherein when the rotatable plate is in the open position, and the pin (1A) is inserted into the openings, the first and second shaped sections of pin (1A) are fixedly engaged by the openings in plates (2A) and (2C), and the engaging section therebetween is aligned with the opening in plate (2B), the rotatable plate may be rotated with the lever (3) about the engaging section to the tightened, locked position to thereby capture the first shaped section and lock the first and second parts (1) and (2) together. |
US11944161B2 |
Process for thermoregulating a flexible cellular material by compression and expansion of the gas trapped in its cells and associated device
A flexible cellular material is thermoregulated by compressing and expanding gas trapped in its cells A flexible elastomer material of a device that provide thermoregulation includes two layers of different shore hardness and conductivity and is has gas-filled cells. Each cell has a zone to store the gas when compressing the material in the layer C with higher hardness and thermal conductivity and another zone to expand the gas when decompressing the material in the layer D with lower hardness and thermal conductivity. The flexible material can be used as a sole in shoes to maintain a cool temperature. With each step, the cell zones located in the layer C act as adiabatic chambers whose gasses heat with compression. When the foot leaves the ground the zones of cells located in the layer D then act as a reactor nozzle that will expand the air and therefore cool it. |
US11944155B2 |
Article of footwear having an elevated plate sole structure
An article of footwear is provided having an elevated plate structure incorporated in the sole structure and optionally including a fluid-filled chamber. The elevated plate structure can include an upper plate and a plurality of legs extending downward toward the outsole. End portions of the legs can engage an upper region of the outsole. The elevated plate structure can form a cage region that can optionally include a fluid-filled chamber substantially disposed therein. The elevated plate structure can further include a lower plate disposed at an upper region of the outsole, which can form a lower portion of the cage region. Portions of the legs can be integrated with impact-attenuating members in the heel region in various configurations and can provide features for the impact-attenuating members, such as support, impact-attenuation and adjustable impact-attenuation features. |
US11944153B2 |
Articles of footwear with engineered wood
An article of footwear includes an upper and a sole structure that defines a forefoot region, a midfoot region, and a heel region. The sole structure comprises densified wood and includes an upper midsole cushioning member, a lower midsole cushioning member, an outsole coupled with a bottom surface of the lower midsole cushioning member, and a plate positioned between the upper midsole cushioning member and the lower midsole cushioning member. |
US11944140B2 |
Glove
A glove that is detectable by a metal detector. The glove is prepared from latex formulation including a metallic additive. The metallic additive includes a pigment, a surfactant and a solvent. The metallic additive is used in an amount of at least 10 phr based on an amount of a latex formulation. |
US11944138B2 |
Face mask and method for manufacturing thereof
A face mask and a method for manufacturing the face mask are disclosed. The face mask comprises a sheet, a first lateral flap, a second lateral flap, a first loop, a second loop and an elastic film. The sheet comprises a central portion, a first lateral portion, a second lateral portion and an opening. The first lateral flap is coupled to the first lateral portion to form a first chamber. The second lateral flap is coupled to the second lateral portion to form a second chamber. The first loop connects to a first strap and is coupled to the first lateral flap. The second loop connects to a second strap and is coupled to the second lateral flap. The elastic film is coupled to the sheet and covers the opening. |
US11944137B2 |
Face shield, monitoring system and barrier formation in the same
A face shield and a face shield monitoring and tracking system, which enables the monitoring of the use of the face shield in real time and the transmission and storage of data and information regarding its use for further management and analysis. The face shield is also equipped with an electrostatic field provided on the surface of a front panel, to attract and retain contaminated droplet particles or aerosols present in the environment. |
US11944134B2 |
Article of warmth with integrated and concealed battery retention pocket
An electrically heated article of warmth adapted to generate heat to a user person's body. The article of warmth has at least one integrally formed pocket to support and conceal one or more batteries at desired locations and orientations therein for the comfort of the user person. The pocket is formed between opposed fabric materials to define a hollow concealed pocket space. An opening is formed in one of the opposed fabric materials for access to the hollow concealed pocket space. The opposed fabric materials have an inner surface facing one another in the hollow concealed pocket space. The inner surfaces have sticky materials which when the inner surfaces are placed against one another they exhibit a binding retention force. The one or more batteries are retained at the desired locations and orientations by the retention force of the of the inner surface of the opposed fabric materials being placed in contact with one another. In one embodiment, only one of the inners surfaces has a sticky material and the batteries are provided with a further sticky material to bind to the inner surface. |
US11944130B2 |
Vaporizer device
A vaporizer device includes various modular components. The vaporizer device includes a first subassembly. The first subassembly includes a cartridge connector that secures a vaporizer cartridge to the vaporizer device and includes at least two receptacle contacts that electrically communicate with the vaporizer cartridge. The vaporizer device includes a second subassembly. The second subassembly includes a skeleton defining a rigid tray that retains at least a power source. The vaporizer device also includes a third subassembly. The third subassembly includes a plurality of charging contacts that supply power to the power source, and an end cap that encloses an end of the vaporizer device. |
US11944126B2 |
Inhalation component generation device, method of controlling inhalation component generation device, and program
An inhalation component generation device includes a load configured to vaporize or atomize an inhalation component source with electric power from a power supply, and a control unit configured to be capable of acquiring a voltage value of the power supply. The control unit is configured to be capable of estimating or detecting at least one of degradation and failure of the power supply based on a time period required for the voltage value of the power supply to reach an upper limit from a lower limit of a predetermined voltage range during charging of the power supply. |
US11944122B2 |
Vapor provision device with liquid capture
An assembly for a vapor provision device includes a reservoir for storing source liquid; a liquid conduit for delivering the source liquid from the reservoir to a vapor generator for vaporizing the source liquid; and a liquid capture element in liquid transfer contact with at least a portion of the liquid conduit between the vapor generator and a part of the liquid conduit that receives liquid from the reservoir, and including an absorbent structure providing a higher capillary force than a capillary force of the reservoir. |
US11944117B2 |
Method for manufacturing heated cigarette product
A method of manufacturing a smoking article that contains, as members, at least a tobacco rod, a cooling segment, and a filter segment and in which a low-stiffness member L and a high-stiffness member H are adjacent to each other, the method includes (A) placing an adhesive on either surface of a tipping paper to form each portion of a high adhesive weight and a low adhesive weight per unit area after solidification, where the portion of a high adhesive weight is provided in a region for wrapping the member L; and (B) preparing a composite segment that contains at least the tobacco rod, the cooling segment, and the filter segment and wrapping the composite segment in the tipping paper. |
US11944116B1 |
Device and method for removing unwanted objects from cut tobacco in a cut tobacco production line
A device for removing unwanted objects from cut tobacco in a cut tobacco production line is disclosed, which includes: a raw cut tobacco feeding and conveying unit (N1), a heavy unwanted object removal unit (N2), a cut tobacco dispersion and recovery unit (N3), a moderate unwanted object removal unit (N4), a cut tobacco humidification unit (N5) and a light unwanted object removal unit (N6). An unwanted object removal method using the cut tobacco unwanted object removal device is also disclosed. The device and method of the disclosure can effectively remove unwanted objects from cut tobacco. |
US11944115B2 |
Methods and systems for incorporating nicotine into oral products
This document provides methods and systems for stabilizing nicotine and incorporating nicotine into one or more oral products. This document also provides oral products. Nicotine can be stabilized by mixing liquid nicotine with cellulosic fiber such that the liquid nicotine absorbs into pores of the cellulosic fiber to form a cellulosic fiber-nicotine mixture. In some cases, a cellulosic fiber-nicotine mixture can be combined with one or more binders and molded into an oral product. |
US11944114B2 |
Smokeless tobacco lipid granules
A smokeless tobacco product includes a plurality of orally disintegrable granules. Each granule has a lipid core and at least one layer surrounding the core. The core can also include binders, powdered tobacco carbohydrates, water soluble polymers, flavorants, salts, sweeteners, and combinations thereof. The orally disintegrable granules can provide a pleasing texture and/or flavor experience. |
US11944113B2 |
Nutritionally enhanced isolate from stabilized rice bran and method of production
Provided is a nutritionally enhanced derivative (isolate) from Stabilized Rice Bran (SRB) with improved antioxidant, fat and protein levels enhancing both the nutritional and yield values over existing techniques. Also provided is an improved method that utilizes certain enzyme combinations under various time and temperature conditions for extracting these nutritionally enhanced isolates from SRB. |
US11944111B2 |
Stabilizing sorbic acid in beverage syrup
A method for preparing a sorbate powder comprising dissolving sorbate salt in water, adding a stabilizing carrier to the sorbate solution, and spray drying the sorbate solution to form the sorbate powder. The sorbate powder is stable in beverage syrup. |
US11944110B2 |
Meat treatment composition and use thereof
This invention concerns reduction of moisture loss during the processing of meat. The present invention resides in the finding that pre-treatment of fresh meat with compositions comprising acetic acid salts and certain polysaccharide materials can reduce moisture loss with as much as 15%, as compared to non-treated meat. In some embodiments, the compositions are based on ingredients that can be labeled as ‘natural ingredients’. The invention provides compositions comprising such combinations of one or more acetic acid salts with one or more polysaccharide materials; methods and uses involving the treatment of meat with said compositions; as well as the meat products that are accordingly obtained. |
US11944105B1 |
Method and apparatus for conveying a meat product and using a knife for automated cutting of meat
The technology as disclosed herein includes a method and apparatus for deboning a meat item, and more particular for deboning a poultry item including performing an initial shoulder cut for removing boneless breast meat from the poultry carcass or frame. The technology as disclosed and claimed further includes a method and apparatus for removing a tender meat portion from a poultry item. The method and apparatus disclosed and claimed herein is a combination of a robotic arm including an ultrasonic knife implement and/or an annular blade knife implement and a vision system for varying the cut path based on the shape and size of the poultry item. The combination as claimed including the ultrasonic knife can perform a meat cut while penetrating the meat with less force than the typical penetration that occurs when using a traditional knife. The combination as claimed including the annular blade knife implement can remove the tender meat portion for the keel bone and posterior sheath. |
US11944103B2 |
Device for cooking and topping of food
A device, comprising a cooker and a topper for auto cooking and or topping of food. |
US11944102B2 |
Method for controlling pest infestations
The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5′ UAAACAAUCGCAAGAAGCUGA 3′ (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5′ AGCUUCUUGCGAUUGUUUAAG 3′ (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided. |
US11944095B2 |
Substrate for efficient use in sanitizing and disinfecting
The current invention relates to modifying the surface of a cellulose-containing nonwoven substrate carrying a quaternary ammonium compound. A material for a nonwoven disinfecting wipe is provided which material includes a nonwoven substrate comprising cellulose and synthetic fibers and a combination of poly(vinylamine) and poly(amideamine-epichlorohydrin). Further, a method is provided for preparing a material for a nonwoven disinfecting wipe, the method comprising treating a nonwoven substrate comprising cellulose with poly(vinylamine) and poly(amideamine-epichlorohydrin). |
US11944094B1 |
Seed germination activator for control of broomrape
A seed germination activator for control of broomrape includes butylisobutylphthalate (hereinafter “BIP”). A biocontrol composition includes BIP and at least two nonionic surfactants for administration in irrigation water. Methods of controlling broomrape may include administering the biocontrol composition comprising BIP in the irrigation water prior to planting crops. |
US11944092B2 |
Compositions for controlling phytoplankton contamination
A composition for mitigating, inhibiting, ameliorating and/or eliminating phytoplankton growth in a waterbody, the composition comprising an active ingredient at concentration of 80.0-99.5% (w/w) of the composition and a coating material at concentration of 0.5-20% (w/w) of the composition; wherein the critical surface tension of the composition is between 15-60 dyn/cm and wherein the relative density of the composition, prior to being submerged in water, is above 1 g/cm3. |
US11944089B2 |
Monitoring apparatus for temperature-controlled sample collection and transport
A portable temperature-controlled container for receiving and housing one or more handheld carriers, each handheld carrier configured to transfer samples to and from a temperature-controlled storage environment, the handheld carrier including a handle and a tray portion, the tray portion configured to be slid into a port of a rack or tower provided in the temperature-controlled storage environment in order to withdraw a sample located in the port, the portable temperature-controlled container including a housing having an opening forming an internal cavity configured to receive one or more handheld carriers, and a lid configured to substantially close the opening, where the housing includes a recess configured to receive the handle of the handheld carrier such that closing of the lid substantially seals the internal cavity when the one or more handheld carriers are placed in the housing. |
US11944088B2 |
Ex vivo organ care system
The invention generally relates to systems, methods, and devices for ex vivo organ care. More particularly, in various embodiments, the invention relates to caring for a liver ex vivo at physiologic or near-physiologic conditions. |
US11944087B2 |
Agricultural sprayer with real-time, on-machine target sensor
An agricultural applicator, that applies material to an agricultural field, includes an on-board, real-time image sensor that senses targets for the material to be applied. A controller controls applicators, such as nozzles or other applicators, to apply the material to the sensed targets. |
US11944083B2 |
Rotating rod holder
An apparatus for stowing and/or transporting rod-shaped structures such that the rods are easily insertable into, and removable from, the rod holder when it is located underneath an overhead obstruction that would otherwise prevent insertion or removal of rods into the rod holder. The rod holder rotates away from the receiving structure to which it is attached by operation of a rotatable attachment between the rod holder and a base. The base comprises a latching mechanism to prevent the rod holder from rotating unless it is released using a latch release lever. The rod holder allows insertion of longer rods into the rod holder than would otherwise be possible using rod holders of the prior art. The rod holder increases ease of access to rods stored in the rod holder. An exemplary use case is the storage of fishing rods under a T-top on a fishing boat. |
US11944078B1 |
Metering and dispensing container
A metering dispenser for pet products and other products has a container and a tunnel within the container. The tunnel has a product receiving opening near an internal wall of the container and a dispensing opening extending through an opposite wall. When the container is moved, products fall into the receiving opening, through the tunnel and out through the dispensing opening. Pet product ingestion is extended and pets learn to manipulate the container to obtain food and treats. |
US11944077B2 |
System and method for an animal puzzle bowl for mental stimulation of senior animals
An animal puzzle bowl is disclosed having a plurality of sockets and a lid with a coupling joint configured to couple with those sockets in a plurality of orientations. The lid may include elements such as a lip or grip for an animal to interact with to allow for opening of the lid so the animal may reach the contents of the bowl. The lids may also include holes so the animal may be encouraged to interact with the bowl by the sight or smell of food or other items of interest. The bowl base can include more than one bowl to allow for a combination of lids to be used. By varying the combination and orientation of the lids an animal must problem solve to reach a desired item in the bowl each time, thus mentally stimulating the animal. |
US11944075B2 |
Top-fill hummingbird feeder with float valve base closure mechanism having a foam/frame float
A top-fill hummingbird feeder is provided having a nectar container with a liquid flow opening at a lower end and a removable cap at an upper end, a feeding basin positioned below the nectar container, and a sealing mechanism associated with the liquid flow opening and the feeding basin. The sealing mechanism includes a bottle seal assembly configured for removable coupling with a base of the feeding basin, and a float valve captured by said bottle seal assembly to prevent rotation thereof while allowing the float valve to move upwardly and downwardly with changing nectar levels in the feeding basin. The float valve includes a float having a frame with a buoyant member mounted thereon, the buoyant member being made of a closed-cell foam. |
US11944072B1 |
Intelligent bird feeding observation device
An intelligent bird feeding observation device, including: a storage bin, wherein a top of the storage bin is provided with a feed inlet, and two opposite sides of the storage bin are provided with a sliding groove of which one end penetrates through the storage bin; a cover body, wherein the cover body is movably covered on the feed inlet of the storage bin through a rotating shaft, and the rotating shaft is positioned in the sliding groove; a tray, wherein the tray is arranged at a bottom of the storage bin, the tray is provided with a feeding cavity with an opening at the top, and the storage bin covers part of the feeding cavity and is communicated with the feeding cavity; and a camera module, wherein the camera module is arranged on the storage bin and photographs towards the feeding cavity of the tray. |
US11944071B2 |
Portable protective shield device for protecting pet animals against attack
Described herein is a portable protective shield device for providing an instant protection to a pet animal against a sudden attack by an aggressive animal without causing any harm to the attacking animal. The device includes a pet protective shield capable of being actuated from a ready position to a protective position, the pet protective shield comprising at least one shielding member that, upon actuation, expands to form a shield around the pet. The present subject matter focuses on protecting the pet/animal under attack rather than tackling the attacker. |
US11944068B2 |
Adjustable dog toy
A dog toy comprises a first component having a body that defines a cavity, the body having an opening into the cavity. The dog toy also comprises a second component having a body comprising a first protrusion and a second protrusion. Each of the first protrusion and the second protrusion is selectively insertable into the first component opening in a manner where it remains within the opening to close the opening and is removable from the first component opening when a separation force is applied. The separation force for the first protrusion is different than the separation force for the second protrusion. A treat can be inserted into the first component cavity, the first component cavity can be closed by insertion of the first protrusion or second protrusion into the first component opening, and a dog can gain access to the treat by separating the first component and the second component. |
US11944067B2 |
Cage assembly for animal test subjects
A cage assembly can have at least one enclosure. Each enclosure can have a floor defining a floor area having a major dimension and a cover having a bottom surface. A spacing between the bottom surface of the cover and the floor can define a cage height. At least one sidewall can extend between the floor and the cover. A ratio of the cage height to the major dimension of the floor area of each enclosure of the at least one enclosure can be at least 0.70. |
US11944056B1 |
Maize hybrid X13R182
A novel maize variety designated X13R182 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X13R182 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X13R182 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X13R182, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X13R182 are provided. Methods for producing maize varieties derived from maize variety X13R182 and methods of using maize variety X13R182 are disclosed. |
US11944053B2 |
Integrated ceiling device with mechanical arrangement for a light source
An integrated ceiling device includes integrated ceiling device including an electronic device housing, a heat dissipating structure, a light source, and a reflection/refraction assembly. An air gap is defined between the electronics housing and other components allowing ambient air to flow therethrough for cooling. |
US11944051B2 |
Planter with elevated internal portion and water preservation features
A planter includes an interior surface and a riser extending from a bottom of the interior surface and including a space between the riser and lateral walls of the planter. The riser includes an open-top recess formed in a top portion of the riser. A plate including a protrusion extending from a bottom side of the plate and forming an open-top reservoir on a top side of the protrusion. The protrusion is configured to be coupled with the recess to secure the plate to the riser. |
US11944050B2 |
Fixtureless lamp
The present disclosure provides advantageous lighting systems that can be installed on parallel rows of horizontal supports. The lighting systems can be configured to have a single electrical feedthrough on one end of the lamp that can also act as a mating feature between the lamp and supports. More particularly, the present disclosure provides improved lighting systems that are fixtureless, waterproof, customizable, and easy to install/remove. |
US11944049B2 |
Vertical grow tower conveyance system for controlled environment agriculture including tower shuttle
A vertical farming structure having vertical grow towers and associated conveyance mechanisms for moving the vertical grow towers through a controlled environment, while being exposed to controlled conditions, such as lighting, airflow, humidity and nutritional support. The present disclosure describes a reciprocating cam mechanism that provides a cost-efficient mechanism for conveying vertical grow towers in the controlled environment. The reciprocating cam mechanism can be arranged to increase the spacing of the grow towers as they are conveyed through the controlled environment to index the crops growing on the towers. The present disclosure also describes a tower shuttle mechanism that provides operational flexibility by decoupling the loading and unloading operations of the grow towers from the vertical farming structure and, therefore, allowing multiple grow towers to be extracted for harvesting in a batch process before loading new grow towers into the vertical farming structure in a separate process. |
US11944047B2 |
Automated data-based irrigation system and method
A system and method for obtaining real-time data regarding the condition of a crop and planning and executing an irrigation cycle in response to the data. The invention uses an unmanned aerial vehicle to survey the conditions within an irrigated area. The unmanned aerial vehicle is operated from a base station mounted on the boom assembly of a pivot irrigation system. The inventive system determines a position for the base station and uses that position to land the UAV. |
US11944045B2 |
Liquid containment and focus for subterranean capillary irrigation
This invention is related to a gravity flow, multipurpose bidirectional nonpressurized climate smart subirrigation conduit apparatus for managing soil moisture and growing plants. The subirrigation conduit apparatus creates a suspended virtual water table at the desired buried depth, thus creating a anaerobic saturated zone and a capillary fringe. The capillary fringe is describe in the art as a moisture zone that has perfect air and moisture mixture for plant growth, can also be used to irrigate with high turbidity obstruction liquids such as precipitation runoff and alternative waters such as untreated greywater. When too much water is present within the landscape, the Multipurpose bidirectional nonpressurized climate smart subirrigation conduit apparatus can be used in reverse flow to drain the landscape. Bidirectional nonpressurized flow is achieved by gravity water equalization thus cutting any need for energy consumption. |
US11944037B2 |
Hemp harvester
A hemp harvester which strips the leaves and flowers from the stalks and branches of a hemp plant and separates them for subsequent processing includes a branch lifter for lifting and bunching the branches of the hemp plants as the harvester advances towards them; a stripper with counter rotating stripper rollers having radially extending resiliently flexible paddles which converge as said rolls turn to trap said flowers and leaves between them and strip the flowers and leaves from said stalks and branches; a capture system for capturing the separated flowers and leaves as they are stripped from the stalk and branches of the plants, a transfer and mulcher system for mulching and transferring said flowers and leaves from said capture system to a collection chamber; and an uprooting system for uprooting and collecting the stripped plants as said hemp harvester passes. |
US11944036B2 |
Forage harvester
A forage harvester with at least one work assembly is disclosed. The forage harvester has a corn cracker to process grain components and a driver assistance system. The driver assistance system controls the corn cracker by adjusting the machine parameters of the corn cracker. In particular, the driver assistance system has an optimization model which includes a multidimensional characteristic map that represents a relationship between a processing quality of the grain components and at least three parameters that comprise an input parameter representing a current harvesting process state and at least one machine parameter of the corn cracker as an output parameter. Thus, the driver assistance system determines the output parameter in the control routine during the harvesting process based on the varying input parameter from the optimization model and adjusts it in the corn cracker to achieve a uniform given processing quality of the grain components during the harvesting process. |
US11944032B2 |
Autonomous vehicle systems and methods
An autonomous mowing system comprising: a memory configured to hold a set of path data defining a set of paths, the set of paths comprising a transit path to a maintenance area and a set of mow paths to cover the maintenance area; a processor coupled to the memory; a computer-readable medium coupled to the processor, the computer-readable medium storing a set of instructions executable by the processor, the set of instructions comprising instructions for: using the set of path data, determining a plurality of candidate routes that traverse the transit path and fully cover the maintenance area and a total cost for each of the plurality of candidate routes; determining a least cost route from the plurality of candidate routes; and configuring an autonomous mower to follow the least cost route to mow the maintenance area. |
US11944031B2 |
Produce harvesting apparatus and precision farming system
This invention relates to a precision agriculture produce harvesting system and produce harvesting apparatus configured for integration with the system, an essential feature of which is a harvesting device subsystem (100) that includes a harvesting device, for instance pruning shears (102) and a harvesting separation stroke detector (108) housed within a control module housing (110) mounted to the shears (102). A person operating the pruning shears (102) produces discernible separation strokes when the handles (104) of the shears (102) are squeezed together to produce a shearing action. The stroke detector (108) detects the separation strokes of the shears (102). By the addition of the control module (108) to the pruning shears (102), the shears are essentially converted into a data logging device by means of which important aspects of a produce harvesting process can be digitised and supplied to a harvest data digital data processing system. |
US11944027B2 |
Combine header equipped with an automated header transport system and drawbar
A header that includes at least one support and transport wheel assembly having an axle and two wheels. The wheel assembly is coupled to the main body of the header by an actuating system that includes an actuator mechanism configured to actuate a swivel movement of the axle and the wheels, the swivel movement being configured to bring the wheel assembly to or from a position wherein the axle is transversal to the longitudinal direction of the header. The wheel assembly is equipped with a drawbar that is deployable from a storage position to a deployed position, wherein the movement of the drawbar between the positions is synchronized with the swivel movement of the wheel assembly. |
US11944026B1 |
Agricultural implements with real time adjustments based on measured soil properties
An agricultural implement has implement settings for soil engaging tools that are controlled based on measured temporal and long-term soil properties in a field. A controller receives data from various soil and optical sensors and provides decision support for adjusting the implement settings. The soil sensors include a square or modified square electrical array that includes two independent, isolated disk coulters running side-by-side followed by two independent, isolated soil engaging runners. One runner has an optical sensor for organic matter, and the other runner has a temperature and moisture sensor. Above-ground optical sensors can be used to measure soil and plant material ahead of and behind the soil engaging tool. The controller can provide real time alerts to an operator that adjustments to the implement settings are needed, or the adjustments can be made automatically based on operator set thresholds, factory settings, or historical individual or global grower adjustments. |
US11944025B2 |
Agricultural drill/planter/coulter/disc blade with step plane notch edge
A ground engaging agricultural blade, coulter, or disc having a central opening adapted to be attached to an implement for rotation about a substantially horizontal axis of rotation; the coulter or disc have an outer periphery; and plurality of step plane notches disposed in the outer periphery. The blade can be used with a hub disposed around the central opening or a spacer spool on a shaft extending through the central openings of adjacent blades, the spacer spools extending radially outwardly by a distance. |
US11950521B2 |
Resistive random-access memory (RRAM) device and forming method thereof
A resistive random-access memory (RRAM) device includes a bottom electrode, a high work function layer, a resistive material layer, a top electrode and high work function spacers. The bottom electrode, the high work function layer, the resistive material layer and the top electrode are sequentially stacked on a substrate, wherein the resistive material layer includes a bottom part and a top part. The high work function spacers cover sidewalls of the bottom part, thereby constituting a RRAM cell. The present invention also provides a method of forming a RRAM device. |
US11950520B2 |
Optically switchable memory
A method of manufacturing a storage device for storing information, apparatus for storing information, an optical memristor device and a memory cell are disclosed. A method comprises providing at least one first electrode and at least one further electrode and providing each of at least one region of a first material between, and in electrical connection with, a respective first electrode and a further electrode whereby said step of providing at least one region comprises providing in the first material, a plurality of changeable particles that have charge storage capacity and at least one electrical property that is reversibly changeable responsive to absorption of incident electromagnetic radiation. |
US11950508B2 |
Light emitting device
A light emitting device includes a first electrode, a second electrode, and at least one emission layer between the first electrode and the second electrode and includes at least one polycyclic compound represented by Formula 1 below, thereby exhibiting long service life characteristics. In Formula 1, the substituents are the same as defined in the detailed description. |
US11950507B2 |
Organic electroluminescence device
Disclosed is an organic electroluminescence device. The organic electroluminescence device has an organic layer having a specific combination in which a hole transporting material is doped with a p-type conductive doped material. The organic electroluminescence device can provide better device performance, such as lifetime improvement and voltage reduction. |
US11950505B2 |
Carbazole-based compound and organic light emitting diode comprising same
Provided is a compound of Chemical Formula 1: wherein: X1 is N or CR, X2 is N or CR′, and X3 is N or CR″; two or more of X1 to X3 are N; R, R′, R″ and R1 each independently is hydrogen or deuterium, a is an integer of 0 to 9, and when a is 2 or greater, the R1s are the same as or different from each other; Ar1 and Ar2 each independently is a substituted or unsubstituted aryl group; L is a direct bond or a substituted or unsubstituted arylene group, n is an integer of 1 to 3, and when n is 2 or 3, the Ls are the same as or different from each other; and R11 to R18 each independently is hydrogen, deuterium, a nitrile group, or a substituted or unsubstituted: alkyl group, cycloalkyl group, alkoxy group, aryloxy group, aryl group, or heteroaryl group, or bond to adjacent groups to form a substituted or unsubstituted ring, and an organic light emitting device comprising same. |
US11950503B2 |
Organic material and photoelectric conversion element
An organic material represented by General Formula (1): where, in General Formula (1), R1 is an alkyl group having 6 carbon atoms or more but 20 carbon atoms or less; n is an integer of from 1 through 3; X1 to X4 are each a hydrogen atom or a fluorine atom; and Z is a compound represented by General Formula (2), (3), or (4) below: where, in General Formulae (2) to (4), R2, R3, and R4 are each an alkyl group having 6 carbon atoms or more but 20 carbon atoms or less; and Y is an oxygen atom or a sulfur atom. |
US11950500B2 |
Organic light emitting diode and organic light emitting device having thereof
The present disclosure relates to an organic light emitting diode that includes at least one emitting material layer including an anthracene-based host and a boron-based dopant, at least one electron blocking layer including an amine-based compound substituted with at least one polycyclic aryl group, and optionally at least one hole blocking layer including an azine-based compound or a benzimidazole-based compound. The organic light emitting diode has enhanced luminous efficiency as well as excellent luminous lifetime. |
US11950498B2 |
Compound, material for organic electroluminescence element using same, organic electroluminescence element, and electronic device
This compound is represented by formula (1) |
US11950495B2 |
Organic light-emitting device and organometallic compound
Provided are an organometallic compound represented by Formula 1 and an organic light-emitting device including a first compound represented by Formula 1. The organic light-emitting device includes: a first electrode; a second electrode facing the first electrode; and an organic layer between the first electrode and the second electrode and including an emission layer, wherein the organic layer includes the first compound represented by Formula 1: |
US11950492B2 |
Organic electroluminescence device and polycyclic compound for organic electroluminescence device
An organic electroluminescence device includes a first electrode, a hole transport region on the first electrode, an emission layer on the hole transport region, an electron transport region on the emission layer, and a second electrode on the electron transport region, wherein the emission layer includes a polycyclic compound containing one electron donor and one electron acceptor, and the electron donor includes an azaborine group and the electron acceptor includes any one of a cyano group, a carbonyl group, a boron group, a sulfonyl group, a sulfinyl group, a phosphine oxide group, a nitrogen-containing five-membered ring, or a nitrogen-containing six-membered monocyclic ring. |
US11950491B2 |
Semiconductor mixed material and application thereof
A semiconductor mixed material comprises an electron donor, a first electron acceptor and a second electron acceptor. The first electron donor is a conjugated polymer. The energy gap of the first electron acceptor is less than 1.4 eV. At least one of the molecular stackability, π-π*stackability, and crystallinity of the second electron acceptor is smaller than the first electron acceptor. The electron donor system is configured to be a matrix to blend the first electron acceptor and the second electron acceptor. The present invention also provides an organic electronic device including the semiconductor mixed material. |
US11950490B2 |
Display device having conductive spacers connecting anode and cathode on opposing substrates
The disclosure provides a display panel and a display device. The display panel includes a first substrate and a second substrate, the second substrate has an organic electroluminescent device, an anode layer of the organic electroluminescent device is away from the first substrate and a cathode layer thereof is closer to the first substrate than the anode layer; the cathode layer is electrically connected to an auxiliary electrode on a light entering surface of the first substrate through multiple conductive spacers, the cathode layer is a transparent electrode layer; the auxiliary electrode has a resistance smaller than that of the cathode layer of the organic electroluminescent device; the auxiliary electrode is a grid-shaped auxiliary electrode and in a non-display region, the auxiliary electrode is opaque; the multiple conductive spacers includes first conductive spacers on the auxiliary electrode and second conductive spacers on the cathode layer of the second substrate. |
US11950486B2 |
Display device and manufacturing method thereof, electronic apparatus
A display device, an electronic apparatus and a method for manufacturing the display device are disclosed. The display device includes an array substrate and a first thin film encapsulation layer disposed on the array substrate. The array substrate is a silicon based organic light-emitting diode array substrate, and the array substrate includes a silicon substrate and a light-emitting device disposed on the silicon substrate; a second thin film encapsulation layer disposed between the light-emitting device and the first thin film encapsulation layer; and a color filter layer disposed between the first thin film encapsulation layer and the second thin film encapsulation layer, at each edge of the first thin film encapsulation layer, an orthographic projection of the array substrate on a plane parallel to the array substrate extends beyond an orthographic projection of the first thin film encapsulation layer on the plane. |
US11950485B2 |
Display apparatus
Provided is a display apparatus including a substrate having a display area including a main pixel, and a sensor area including a sub-pixel and a transmission portion, a plurality of first lines arranged in the sensor area, extending in a first direction, and bypassing the transmission portion, and a first electrode layer under the plurality of first lines, between the sub-pixel and the transmission portion, and at least partially overlapping a spacing region between the plurality of first lines. |
US11950478B2 |
Display apparatus
A display apparatus is disclosed that includes a first display area and a second display area adjacent to the first display area. The first and second display areas include first and second light emitting areas having first and second pixel densities, respectively. The first and second light emitting areas at an interface between the first and second display areas are arranged such that in operation light emitted by the first and second light emitting areas produces a gradual decrease in light intensity from the first display area to the second display area near the interface. |
US11950477B2 |
OLED display panel and OLED display device
The present application discloses an OLED display panel, including a plurality of first color sub-pixels, a plurality of second color sub-pixels, and a plurality of third color sub-pixels, wherein the first-color subpixels, the second-color subpixels, and the third-color subpixels constitute a plurality of repeating units, the repeating units include a first repeating unit and a second repeating unit, and the first repeating unit and the second repeating unit are arranged at intervals in any row or any column. |
US11950476B2 |
Display device having an opening between pixels
A display device includes a substrate; a transistor disposed on the substrate; a first insulating layer disposed on the transistor; and a first pixel electrode and a second pixel electrode disposed on the first insulating layer to be adjacent to each other. The first insulating layer includes a first opening between the first pixel electrode and the second pixel electrode. |
US11950475B2 |
Display device including light-emitting layers with opposing-direction portions
A display device includes a display panel having first and second regions with the second region having a higher resolution than the first region and an electronic module under the first region. The display panel includes first and second emission layers in a first sub-region of the first region with the second emission layer being spaced apart from the first emission layer. The first emission layer has a first light-emitting portion and a second light-emitting portion adjacent to the first light-emitting portion in a first direction, and the second emission layer has a third light-emitting portion and a fourth light-emitting portion adjacent to the third light-emitting portion in the first direction. The first light-emitting portion is inclined from the second light-emitting portion toward a lower surface of the display panel, and the fourth light-emitting portion is inclined from the third light-emitting portion toward an upper surface of the display panel. |
US11950472B2 |
Flexible display apparatus including dummy pattern between wirings
A flexible display apparatus includes a flexible substrate having an active area and an inactive area, the inactive area including a first area adjacent to the active area, a second area in which a pad is disposed, and a bending area disposed between the first area and the second area, wherein a plurality of wirings extending from the second area to the first area are disposed in the bending area, and at least one dummy pattern is in between the plurality of wirings. |
US11950470B2 |
Display device with hole surrounded by data lines in different layers
A display device comprising: first and second pixels; a first data line connected to the first pixel and configured to have data voltages applied thereto; and a second data line connected to the second pixel, the second data line being adjacent to the first data line, and configured to have the data voltages applied thereto, wherein the first data line includes a 1A-th data line which is in a first data layer, and the second data line includes a 2B-th data line which is in a second data layer different from the first data layer. |
US11950467B2 |
Display device and method of providing the same
A display device includes a driving member which provides an electrical signal and includes a connection terminal which transmits the electrical signal, a pad electrode which receives the electrical signal from the driving member and is electrically connected to the connection terminal of the driving member, an organic layer on the pad electrode, the organic layer including a side surface defining an opening of the organic layer which exposes the pad electrode to outside the organic layer and within the opening, a protrusion protruding from the side surface, and a connection conductive layer which electrically connects the pad electrode to the connection terminal, within the opening of the organic layer, where the connection conductive layer covers each of the pad electrode which is exposed by the opening of the organic layer, the side surface of the organic layer, and the protrusion of the organic layer. |
US11950466B2 |
Display substrate, method of manufacturing the same, and display apparatus
A display substrate, a method of manufacturing the same, and a display apparatus are provided. Multiple subpixels in the display substrate include first and second subpixels. Each subpixel includes a power signal line pattern and a light-emitting element. The power signal line pattern includes first and second power line portions. At least a part of the first power line portion extends in a second direction. The light-emitting element includes an anode pattern. In the display substrate, an overlap between the anode pattern of the first subpixel and the power signal line pattern is larger in area than an overlap between the anode pattern of the second subpixel and the power signal line pattern, an overlap between the anode pattern of the first subpixel and the first power line portion is larger in area than an overlap between the anode pattern of the first subpixel and the second power line portion. |
US11950462B2 |
Display device
A first conductive layer in the same layer as that of a first electrode is coupled to a third conductive layer and a second electrode in the same layer as that of a third metal layer through a slit formed in a flattening film of a non-display area. Second conductive layers in the same layer as that of a second metal layer are provided to overlap with the slit. |
US11950458B2 |
Display apparatus having self-aligned structures
A display apparatus includes a base substrate, a thin film transistor layer on the base substrate, an insulation layer on the thin film transistor layer, a first electrode on the insulation layer and in a light emitting area, a pixel defining layer having an opening that has a size and a shape substantially same as that of the first electrode, and on the insulation layer, a light emitting layer on the first electrode, and a second electrode on the light emitting layer. |
US11950454B2 |
Display panel and display device
A display panel and a display device are disclosed, the display panel comprises: a base substrate; and pixel circuits in an array, the display panel comprises a light transmittance region and a display region around the light transmittance region, the pixel circuits are disposed in the display region, a gate line of each row of m rows of pixel circuits is divided into a first gate line portion and a second gate line portion which are connected through an auxiliary gate line, a data line of each column of n columns of pixel circuits is divided into a first data line portion and a second data line portion which are connected through an auxiliary data line. |
US11950453B2 |
Display device and method of manufacturing the same
A display device includes a ferromagnetic layer including a ferromagnetic material, a cover window disposed above the ferromagnetic layer, and a display panel disposed between the ferromagnetic layer and the cover window, where the display panel includes a curved area which is bent. |
US11950445B2 |
Foldable display screen including multi-cover protection layers
A foldable display screen includes a display panel, a first optical adhesive layer, a first cover protection layer, a second optical adhesive layer, and a second cover protection layer; the first optical adhesive layer is located on the display panel; the first cover protection layer is located on a side of the first optical adhesive layer away from the display panel; the second optical adhesive layer is located on a side of the first cover protection layer away from the first optical adhesive layer; the second cover protection layer is located on a side of the second optical adhesive layer away from the first cover protection layer. At an operating temperature, an elastic modulus of the second optical adhesive layer is smaller than an elastic modulus of the first optical adhesive layer. |
US11950443B2 |
OLED display device
An OLED display device includes a display panel, a metal sheet, and a middle frame. The display panel is closely attached to one side of the metal sheet, and is defined with a foldable area and a non-foldable area. The metal sheet is disposed between the middle frame and the display panel. The middle frame is disposed on one side of the metal sheet facing away from the display panel. The foldable area of the middle frame is disposed with a hub piece, and the foldable area of the metal sheet is disposed with a magnet sheet, and the magnet sheet is disposed opposite to the hub piece. |
US11950441B2 |
Organic electron-conducting layer having N-dopant
Various embodiments may include an organic electron-conducting layer comprising an n-dopant having the structure: wherein Ln denotes a number n of independently selected ligands L; M is a metal; R and R′ comprise compounds independently selected; n is from 0 to 5; m is from 1 to 6; n+m is from 2 to 6; and x has a value of 0, 1 or 2. |
US11950438B2 |
Inorganic light emitting diode and inorganic light emitting device including the same
The present disclosure relates to an inorganic light emitting diode (LED) in which an emitting material layer (EML) includes inorganic luminescent particles dispersed in a siloxane matrix, wherein the siloxane matrix has a thickness equal to or less than a thickness of a layer of the inorganic luminescent particles, and an inorganic light emitting device including the inorganic LED. The siloxane matrix allows surface defects of the inorganic luminescent particles to be minimized and to prevent injections of holes and electrons from being delayed. The inorganic LED and the inorganic light emitting device lower their driving voltages and improve their luminous efficiency. |
US11950429B2 |
Ferroelectric capacitors, transistors, memory devices, and methods of manufacturing ferroelectric devices
The present invention relates to ferroelectric capacitors, transistors, memory device, and method of manufacturing ferroelectric devices. The ferroelectric capacitor includes a first electrode, a second electrode facing the first electrode, a ferroelectric layer between the first electrode and the second electrode, and an interfacial layer between the ferroelectric layer and the first electrode or between the ferroelectric layer and the second electrode. The ferroelectric layer includes hafnium-based oxide. The interfacial layer includes HfO2. |
US11950428B2 |
Three-dimensional memory device and manufacturing method thereof
A memory device includes a first stacking structure, a second stacking structure, a plurality of first isolation structures, gate dielectric layers, channel layers and conductive pillars. The first stacking structure includes a plurality of first gate layers, and a second stacking structure includes a plurality of second gate layers, where the first stacking structure and the second stacking structure are located on a substrate and separated from each other through a trench. The first isolation structures are located in the trench, where a plurality of cell regions are respectively confined between two adjacent first isolation structures of the first isolation structures in the trench, where the first isolation structures each includes a first main layer and a first liner surrounding the first main layer, where the first liner separates the first main layer from the first stacking structure and the second stacking structure. The gate dielectric layers are respectively located in one of the cell regions, and cover opposing sidewalls of the first stacking structure and the second stacking structure as well as opposing sidewalls of the first isolation structures. The channel layers respectively cover an inner surface of one of the gate dielectric layers. The conductive pillars stand on the substrate within the cell regions, and are laterally surrounded by the channel layers, where at least two of the conductive pillars are located in each of the cell regions, and the at least two conductive pillars in each of the cell regions are laterally separated from one another. |
US11950425B2 |
Semiconductor memory device with mold structure
A mold structure includes gate electrodes stacked on a first substrate, a channel structure penetrating a first region of the mold structure to cross the gate electrodes, a first through structure penetrating a second region of the mold structure, and a second through structure penetrating a third region of the mold structure. The mold structure includes memory cell blocks extending in a first direction and spaced apart in a second direction, and a dummy block extending in the first direction and disposed between the memory cell blocks. Each of the memory cell and dummy blocks includes a cell region and an extension region arranged in the first direction. The first region is the cell region of one of the memory cell blocks, the second region is the extension region of the one of the memory cell blocks, and the third region is the extension region of the dummy block. |
US11950423B2 |
Semiconductor device and electronic system including the same
A semiconductor device includes: a cell area including a cell substrate, a memory cell array, and a first bonding metal pad on the memory cell array, the memory cell array including a plurality of word lines stacked on the cell substrate and a plurality of bit lines on the plurality of word lines; and a peripheral circuit area having the cell area stacked thereon and including a peripheral circuit substrate, a plurality of circuits on the peripheral circuit substrate, and a second bonding metal pad bonded to the first bonding metal pad, wherein the plurality of circuits include: a plurality of planar channel transistors respectively including a channel along a top surface of the peripheral circuit substrate; and at least one recess channel transistor including a channel along a surface of a recess trench arranged in the peripheral circuit. |
US11950420B2 |
Memory device
A memory device includes gate electrode layers stacked on an upper surface of a substrate and each including a plurality of unit electrodes extending in a first direction, and a plurality of connecting electrodes connecting the unit electrodes to each other. The memory device also includes channel structures extending through the gate electrode layers in a direction perpendicular to the upper surface of the substrate, first common source lines extending in the first direction and interposed between the unit electrodes, and second common source lines extending in the first direction between the first common source lines and each having a first line and a second line separated from each other in the first direction by the connecting electrodes. |
US11950418B2 |
Method and structure for forming stairs in three-dimensional memory devices
Embodiments of a three-dimensional (3D) memory device and fabrication methods thereof are disclosed. In an example, a method for forming a 3D memory device includes the following operations. A dielectric stack is formed to have interleaved sacrificial layers and dielectric layers. A stair is formed in the dielectric stack. The stair includes one or more sacrificial layers of the sacrificial layers and one or more dielectric layers of the dielectric layers. The stair exposes one of the sacrificial layers on a top surface and the one or more sacrificial layers on a side surface. An insulating portion is formed to cover the side surface of the stair to cover the one or more sacrificial layers. A sacrificial portion is formed to cover the top surface of the stair. The sacrificial portion is in contact with the one of sacrificial layers. The one or more sacrificial layers and the sacrificial portion are replaced with one or more conductor layers. |
US11950414B2 |
Memory device
According to one embodiment, a memory device includes a substrate; a structure including a plurality of conductive layers stacked on the substrate; and a pillar arranged inside the structure and including a semiconductor layer that extends in a direction perpendicular to a surface of the substrate. The semiconductor layer includes a first portion on a side of an upper portion of the structure, and a second portion between the first portion and the substrate. The first portion has a thickness larger than a thickness of the second portion. |
US11950413B2 |
High voltage polysilicon gate in high-K metal gate device
An integrated circuit device includes a plurality of metal gates each having a metal electrode and a high-κ dielectric and a plurality of polysilicon gates each having a polysilicon electrode and conventional (non high-κ) dielectrics. The polysilicon gates may have adaptations for operation as high voltage gates including thick dielectric layers and area greater than one μm2. Polysilicon gates with these adaptations may be operative with gate voltages of 10 V or higher and may be used in embedded memory devices. |
US11950412B2 |
Gate fringing effect based channel formation for semiconductor device
A memory device is described. Generally, the device includes a string of memory transistors, a source select transistor coupled to a first end of the string of memory transistor and a drain select transistor coupled to a second end of the string of memory transistor. Each memory transistor includes a gate electrode formed adjacent to a charge trapping layer and there is neither a source nor a drain junction between adjacent pairs of memory transistors or between the memory transistors and source select transistor or drain select transistor. In one embodiment, the memory transistors are spaced apart from adjacent memory transistors and the source select transistor and drain select transistor, such that channels are formed therebetween based on a gate fringing effect associated with the memory transistors. Other embodiments are also described. |
US11950411B2 |
Semiconductor memory devices with dielectric fin structures
A semiconductor device includes a plurality of first nanostructures extending along a first lateral direction. The semiconductor device includes a first epitaxial structure and second epitaxial structure respectively coupled to ends of each of the plurality of first nanostructures along the first lateral direction. The semiconductor device includes a dielectric fin structure disposed immediately next to a sidewall of each of the plurality of first nanostructures facing a second lateral direction perpendicular to the first lateral direction. The semiconductor device includes a first gate structure wrapping around each of the plurality of first nanostructures except for the sidewalls of the first nanostructures. The semiconductor device includes a metal structure disposed above the first gate structure and coupled to one of the first or second epitaxial structure. |
US11950409B2 |
Semiconductor device having diode connectedto memory device and circuit including the same
A semiconductor device and a circuit are provided. The semiconductor device includes a substrate, a first gate structure, a first doped region, and a capacitor structure. The substrate includes a first well region having a first conductive type. The first gate structure is disposed on the substrate. The first doped region is in the substrate and has a second conductive type different from the first conductive type. The first gate structure and the first doped region are included in a first transistor. The capacitor structure includes a first electrode electrically coupled to the first doped region. The second doped region is in the substrate and has the second conductive type. The second doped region is electrically coupled to the first electrode of the capacitor structure and the first doped region. |
US11950403B2 |
Widened conductive line structures and staircase structures for semiconductor devices
Systems, methods, and apparatuses for widened conductive line structures and staircase structures for semiconductor devices are described herein. One memory device includes an array of vertically stacked memory cells, the array including a vertical stack of horizontally oriented conductive lines. Each conductive line comprises a first portion extending in a first horizontal direction and a second portion extending in a second horizontal direction, wherein the second portion of each conductive line is of a width greater than the first portion of each conductive line. |
US11950402B2 |
Memory device having 2-transistor vertical memory cell and shield structures
Some embodiments include apparatuses and methods of forming the apparatuses. One of the apparatuses includes a conductive region, a first data line, a second data line, a first memory cell coupled to the first data line and the conductive region, a second memory cell coupled to the second data line and the conductive region, a conductive structure, and a conductive line. The first memory cell includes a first transistor coupled to a second transistor, the first transistor including a first charge storage structure. The second memory cell includes a third transistor coupled to a fourth transistor, the third transistor including a second charge storage structure. The conductive structure is located between and electrically separated from the first and second charge storage structures. The conductive line forms a gate of each of the first, second, third, and fourth transistors. |
US11950390B2 |
Conductor assembly for a power distribution system
An electrical conductor assembly for use in a power distribution assembly includes an electrical conductor and a casing covering at least a portion of the electrical conductor. A spring member is mounted to the casing and configured to apply a compressive force to the electrical conductor. |
US11950389B2 |
Subsea variable speed drive apparatus
A subsea variable speed drive apparatus comprising a pressure resistant container (90) comprising a curved wall section having a curved, internal surface (90a); and a variable speed drive comprising at least one power electronics module (50) arranged inside the container and held at a predetermined ambient pressure. The at least one power electronics module is mounted on a heatsink (40) which is mounted on the internal surface, the heatsink comprising a curved surface (40b) contacting the internal surface and having a radius of curvature corresponding to the radius of curvature of the internal surface. A subsea hydrocarbon fluid pumping system comprising such subsea variable speed drive apparatuses and a related method are also disclosed. |
US11950388B2 |
Electronic board for voltage converter
Circuit board, defining a plurality of switching arms connected in parallel so as to convert a first voltage into a second voltage, at least one of which is DC voltage. The board includes a plurality of controllable electronic switches mounted pairwise in series on either side of a midpoint, so as to produce the switching arms connected in parallel. A plurality of decoupling capacitors are connected in parallel to one another, and in parallel to the DC voltage. Two electrically conductive layers are arranged parallel to one other, one of which is at the highest potential of the DC voltage and the other of which is at the lowest potential of the DC voltage. Each of the decoupling capacitors having one terminal connected to one of these electrically conductive layers and its other terminal connected to the other of these electrically conductive layers. |
US11950387B2 |
Methods for forming hermetically-sealed packages including feedthrough assemblies
Methods of forming hermetically-sealed packages are disclosed. In one or more embodiments, the hermetically-sealed package can include a housing and a feedthrough assembly that forms a part of the housing. The feedthrough assembly can include a non-conductive substrate and a feedthrough. The feedthrough can include a via from an outer surface to an inner surface of the non-conductive substrate, a conductive material disposed in the via, and an external contact disposed over the via on the outer surface of the non-conductive substrate. The external contact can be electrically coupled to the conductive material disposed in the via. Further, the external contact can be hermetically sealed to the outer surface of the non-conductive substrate by a laser bond surrounding the via. |
US11950385B2 |
Material removal from inner surface to preserve perception of outer surface aesthetics
A veneer for a wall-mounted keypad may include indicia that are laser cut therethrough and that are representative of functions that may be performed by the keypad. The veneer may include a recess that extends into an inner surface of the veneer, proximate to the indicia. The recess may be shaped such that a perceived aesthetic of an outer surface of the veneer is preserved during formation of the indicia. The recess may for example have an organic shape defined by a curved outer perimeter that does not define any corners. |
US11950384B2 |
Dynamic electrical and fluid delivery system with indexing motion for batch processing chambers
Process assemblies and cable management assemblies for managing cables in tight envelopes. A processing assembly includes a top chamber having at least one substrate support, a support shaft, a robot spindle assembly, a stator and a cable management system. The cable management system includes an inner trough assembly and an outer trough assembly configured to move relative to one another, and a plurality of chain links configured to house at least one cable for delivering power to the process assembly. |
US11950383B2 |
Display apparatus
A display apparatus according to a concept of the disclosure includes: a display panel configured to display an image in a front direction; a top chassis positioned in a front direction of the display panel; a bottom chassis positioned in a rear direction of the display panel; a rear cover covering a rear side of the bottom chassis; and a stand member being accommodatable in the rear cover and selectively coupled with a rear surface of the rear cover, wherein the rear cover includes an accommodating portion in which the stand member is accommodated and a coupling portion coupled with the stand member, and the stand member includes an inserting protrusion which is inserted into the accommodating portion and the coupling portion. |
US11950378B2 |
Via bond attachment
A method for attaching two electronics boards, e.g., a testing PCB and a space transformer, comprises rack welding resin prepreg and a mylar film to a testing PCB; laser drilling via holes in the resin prepreg and mylar film such that the holes are aligned on one side of the resin prepreg with connection/capture pads on the testing PCB and aligned (after attachment) on the other side of the resin prepreg with connection capture pads on a space transformer, filling the via holes with sintering paste; applying a pressure treatment to remove air, bubbles, and voids from the sintering paste; removing the mylar film; and using a lamination press cycle to attach a space transformer to the resin prepreg. |
US11950375B2 |
Printing components to substrate posts
A method of printing comprises providing a component source wafer comprising components, a transfer device, and a patterned substrate. The patterned substrate comprises substrate posts that extend from a surface of the patterned substrate. Components are picked up from the component source wafer by adhering the components to the transfer device. One or more of the picked-up components are printed to the patterned substrate by disposing each of the one or more picked-up components onto one of the substrate posts, thereby providing one or more printed components in a printed structure. |
US11950370B2 |
Information processing device, information processing method, and program
An information processing device is used in a mounting system that performs processing of mounting a component on a mounting target. The information processing device includes: a memory section configured to store multiple pieces of abutting part data including a shape of an abutting part that abuts against the component, multiple pieces of attachment part data including a shape of an attachment part to be attached to an attachment section to which a collection member for collecting the component is attached, and multiple pieces of connection part data including a shape of a connection part that connects the abutting part and the attachment part, in the collection member; and a control section configured to output one or more of the abutting part data, the attachment part data, and the connection part data stored in the memory section. |
US11950369B2 |
Work system and feeder carriage transfer method
A work system includes a mounting system which mounts a component on a board and an unmanned conveyance system having an unmanned conveyance vehicle. The unmanned conveyance system includes a first notifier which notifies the mounting system of an arrival notification indicating that the unmanned conveyance vehicle arrives at a position where separating the feeder carriage from the base starts, and a first processor which causes the unmanned conveyance vehicle to travel in a direction away from the base upon receiving, from the mounting system, a release notification indicating that a connection of the feeder carriage is released. The mounting system includes a second processor which causes the connection mechanism to release the connection of the feeder carriage upon receiving the arrival notification, and a second notifier which notifies the unmanned conveyance system of the release notification upon being informed of completion of the release operation. |
US11950363B2 |
Sensor interposer employing castellated through-vias
An example sensor interposer employing castellated through-vias formed in a PCB includes a planar substrate defining a plurality of castellated through-vias; a first electrical contact formed on the planar substrate and electrically coupled to a first castellated through-via; a second electrical contact formed on the planar substrate and electrically coupled to a second castellated through-via, the second castellated through-via electrically isolated from the first castellated through-via; and a guard trace formed on the planar substrate, the guard trace having a first portion formed on a first surface of the planar substrate and electrically coupling a third castellated through-via to a fourth castellated through-via, the guard trace having a second portion formed on a second surface of the planar substrate and electrically coupling the third castellated through-via to the fourth castellated through-via, the guard trace formed between the first and second electrical contacts to provide electrical isolation between the first and second electrical contacts. |
US11950361B2 |
Method and procedure for miniaturing a multi-layer PCB
A multiple layer printed circuit board (PCB) in which the cores (or core layers) are removed and replaced with prepreg layers, which provide structure integrity for the PCB. Such a multi-layer PCB may include signal layers, ground plane layers, inner signal layers, and a single core substrate layer. Each of the layers may be separated from the other layers by at least one prepreg substrate layer. |
US11950359B2 |
Card reader
A card reader for use with a card may include a card insertion part provided with an insertion port into which the card is inserted, a protruded part which is provided on a front face of the card insertion part and is protruded to a front side with respect to the card insertion part, a breakage detection wiring which is provided in an inside of the protruded part, and a detection part which detects at least one of disconnection and a short circuit of the breakage detection wiring. |
US11950357B2 |
Circuit board for transmitting high-frequency signal and method for manufacturing the same
A method for manufacturing a circuit board circuit board for transmitting high-frequency signal, including: providing a first-line circuit board (20), a second circuit board (40), at least one third circuit board (50), a fourth circuit board (60), a fifth circuit board (61), and a sixth circuit board (62); stacking the first circuit board (20), the second circuit board (40), and third circuit board (50) in that order, and stacking the fourth circuit board (60), the sixth circuit board (62), and the fifth circuit board (61) on the third circuit board (50), and pressing them together to obtain the circuit board circuit board for transmitting high-frequency signal. The method manufacturing the circuit board circuit board for transmitting high-frequency signal can reduce a width of the transmission line. The present disclosure further provides the circuit board circuit board for transmitting high-frequency signal obtained by the above method. |
US11950356B2 |
Mating backplane for high speed, high density electrical connector
A printed circuit board includes a plurality of layers including attachment layers and routing layers; and via patterns formed in the plurality of layers, each of the via patterns including first and second signal vias forming a differential signal pair, the first and second signal vias extending through at least the attachment layers; ground vias extending through at least the attachment layers, the ground vias including ground conductors; and shadow vias located adjacent to each of the first and second signal vias, wherein the shadow vias are free of conductive material in the attachment layers. The printed circuit board may further include slot vias extending through the attachment layers and located between via patterns. |
US11950352B2 |
Split structure particle accelerators
A particle accelerator can include a first waveguide portion and a second waveguide portion. The first waveguide portion can include a first plurality of cell portions and a first iris portion that is disposed between two of the first plurality of cell portions. The first iris portion can include a first portion of an aperture such that the aperture is configured to be disposed about a beam axis. The first waveguide portion can further include a first bonding surface. The second waveguide portion can include a second plurality of cell portions and a second iris portion that is disposed between two of the second plurality of cell portions. The second iris portion can include a second portion of the aperture. The second waveguide portion can include a second bonding surface. |
US11950351B2 |
Electromagnetic field control member
Provided is an electromagnetic field control member, the member including an insulating member made of a ceramic having a tubular shape and including a plurality of through holes extending in an axial direction; a conductive member that is made of a metal, seals off each of the through holes, and leaves an opening portion in the through hole, the opening portion opening to an outer periphery of the insulating member; and a power feed terminal connected to the conductive member. The through holes each include inner wall surfaces further including inclined surfaces for which a width between inner walls facing each other increases from an inner periphery of the insulating member to an outer periphery of the insulating member: and vertical surfaces that are located on an inner peripheral side of the insulating member and for which a width between inner walls facing each other is constant. |
US11950350B2 |
Radio wave radiating device and oven having same
A radio wave radiating device includes: a radio wave supply unit extending in one direction, one end of the radio wave supply unit being connected to a power source, an earth part spaced apart from the radio wave supply unit by a predetermined distance in a direction intersecting with the one direction, extending in the one direction, one end of the earth part being connected to a ground, and a radiating element connected to another end of the radio wave supply unit and another end of the earth part, respectively, and configured to radiate a radio wave received from the radio wave supply unit. The radiating element includes a middle portion connecting the radio wave supply unit and the earth part, a first radiating portion extending in a direction away from the earth part, and a second radiating portion extending in a direction away from the radio wave supply unit. |
US11950349B2 |
Combination microwave and hood system
A combined ventilation and microwave oven system includes an external enclosure with a top portion defining recirculation vent outlets, a cooling air inlet, a cooling air outlet, and an outside vent outlet, first and second side portions, and a bottom portion defining a vent inlet. The vent inlet is connected with the recirculation vent outlets and the outside vent outlet via airflow pathways. A hood assembly is disposed within the external enclosure and includes a first hood fan disposed between the cooking cavity and the first side portion and a second hood fan disposed between the cooking cavity and the second side portion. The hood assembly is configured to direct air through the vent inlet and through an interior of the external enclosure. A cooling fan is disposed between the cooking cavity and the second side portion to direct air through the cooling air inlet and the cooling air outlet. |
US11950348B2 |
Induction coil assembly for uterine ablation and method
A vapor delivery device includes an induction coil system. The induction coil system can include a coiled fluid tube, a coiled wire, a capsule between the coiled fluid tube and the wire, and a cooling fluid supply configured to force a cooling fluid through the capsule across the coiled wire. The induction coil system can include a closed loop ferrite core, a wire coiled around a first portion of the ferrite core, and a fluid tube coiled around a second portion of the ferrite core. A wire coil can be contained in a cartridge system removably coupleable to a disposable vapor delivery device. The system can include a fluid flow controller and induction power regulation to maintain a specific operating pressure range for vapor within a uterus or other bodily cavity, tract, or duct. |
US11950347B2 |
Induction heat cooking apparatus to implement WPT and PFC power converter
An induction heat cooking apparatus that includes: a rectifier that is configured to convert alternating current (AC) voltage supplied from an external power source into direct current (DC) voltage; an inverter that is configured to generate current based on DC voltage received from the rectifier and provide the current to output nodes; heating coils that are configured to, based on the current generated by the inverter, generate magnetic fields for providing heat; a first capacitive unit that includes one or more resonance capacitors and that is coupled between the output nodes; a second capacitive unit that includes one or more wireless power transfer (WPT) capacitors and that is configured to be coupled between the output nodes; and a mode conversion switch that is configured to couple the second capacitive unit to the first capacitive unit in parallel is disclosed. |
US11950346B2 |
Configuring a bridge with groups after addition of said bridge to a lighting system
A system (1) for configuring a bridge (13) in a wireless lighting system (31), which has been commissioned, is configured to determine that a bridge has been added to the wireless lighting system. The wireless lighting system comprises a plurality of lighting devices (14-19). The system is further configured to obtain information relating to the plurality of lighting devices, analyze the information, and determine one or more groups of lighting devices based on the analysis. At least one of the one or more groups comprises multiple of the plurality of lighting devices. The system is further configured to configure the bridge with the determined one or more groups upon determining that the bridge has been added to the wireless lighting system. |
US11950345B2 |
Method for controlling cheering sticks to emit light based on UWB location technology
The invention discloses a method for controlling cheering sticks to emit light based on a UWB location technology, First, setting location base stations, and generating a wireless local area network by the location base stations to cover a target area; next, after cheering sticks are connected to the location base stations through the wireless local area network, calculating positions of the cheering sticks according to signals sent by the location base stations; and converting the position coordinates into display coordinates according to a stadium seat mapping table obtained from the base stations; and finally, acquiring, by the cheering sticks, animation data from the location base stations, calculating play sequences of the cheering sticks according to the animation data and the display coordinates, acquiring, by the cheering sticks, play times from the base stations, and synchronously playing the play sequences to realize animation play of a whole cheering stick array. |
US11950343B2 |
Configurable lighting system
Apparatus, systems, and methods for controlling light output in a lighting system based on defined light profiles are provided. In one example implementation, a light fixture can include a first light emitting diode (LED) array having one or more LED light sources and a second LED array having one or more LED light sources. The light fixture can include a power circuit configured to provide power to the first LED array and the second LED array according to a power distribution among the first LED array and the second LED array. The light fixture can include one or more control devices configured to control the power circuit to adjust the power distribution among the first LED array and the second LED array based at least in part on a signal indicative of a real time clock and a defined light profile associated with a user identified to be present in a space illuminated by the light fixture. |
US11950337B2 |
Wiring boards for array-based electronic devices
In accordance with certain embodiments, lighting systems include one or more lightsheets each including a plurality of strings of light-emitting elements, control elements, and power conductors for supplying power to the light-emitting elements and control elements. |
US11950335B2 |
Display device
A display device includes a glass substrate, light emitting diodes (LEDs) and driving circuits. The glass substrate includes first and second sides. The driving circuits are coupled to the LEDs. An anode of each of the LEDs receives a first anode signal different from a first reference anode signal by a first signal difference and a second anode signal different from a second reference anode signal by a second signal difference. A cathode of each of the LEDs receives a first cathode signal different from a first reference cathode signal by a third signal difference and a second cathode signal different from a second reference cathode signal by a fourth signal difference. The LEDs that are closer to the second side have greater first and third signal difference, and the LEDs that are closer to the first side have greater second fourth signal difference. |
US11950334B2 |
Horticulture grow lights
A grow light includes a plurality of cool white LEDs, a plurality of warm white LEDs, and a driver electrically coupled to the cool white LEDs and the warm white LEDs. An intensity level and spectral composition of the radiant energy emitted by the grow light may be tuned or configured by varying a ratio of the quantity of cool white LEDs to the quantity of warm white LEDs, by varying a spatial arrangement among the cool white LEDs and the warm white LEDs, or by varying a level of current provided to some or all of the cool white LEDs and the warm white LEDs. |
US11950333B2 |
Light-emitting module
Light (light (L1)) at peak luminous intensity in a light distribution of a first region (12a) of a light-irradiating surface (12) is sent to a first region (32a) of a target surface (32) via a first region (22a) of a reflecting surface (22). Light (light (L2)) at peak luminous intensity in a light distribution in a second region (12b) of the light-irradiating surface (12) is sent to a second region (32b) of the target surface (32) via a second region (22b) of the reflecting surface (22). An optical distance from the first region (12a) of the light-irradiating surface (12) to the first region (32a) of the target surface (32) via the first region (22a) of the reflecting surface (22) is greater than an optical distance from the second region (12b) of the light-irradiating surface (12) to the second region (32b) of the target surface (32) via the second region (22b) of the reflecting surface (22). The luminous intensity of the light (L1) is higher than the luminous intensity of the light (L2). |
US11950330B2 |
Fluid permeable heater assembly for an aerosol-generating system and method for assembling a fluid permeable heater for an aerosol-generating system
A cartridge for an aerosol-generating system is provided, including a liquid storage portion including a housing containing a liquid aerosol-forming substrate, the housing having an open end; and a heater assembly including: an electrical heating element configured to heat the substrate to form an aerosol, the heating element including a planar filament arrangement having one or more electrically conductive filaments, an electrically insulating substrate having a planar attachment face, the filament arrangement disposed on the planar attachment face, and clamping elements mechanically fixing the filament arrangement to the electrically insulating substrate and applying a pulling force onto the filament arrangement, at least a portion of the heater assembly being fluid-permeable, and the heater assembly being arranged over the open end of the housing. |
US11950328B2 |
System and method for a closed-loop bake-out control
A control system for operating a heater includes a controller configured to determine an operational power level based on a measured performance characteristic of the heater, a power set-point, and a power control algorithm, determine a bake-out power level based on a measured leakage current at the heater, a leakage current threshold, and a moisture control algorithm, and select a power level to be applied to the heater. The selected power level is the lower power level from among the operational power level and the bake-out power level. |
US11950324B2 |
Techniques for multi-data rate communications
Techniques for multi-data rate communications include receiving, by a first node device within a mesh network, an information element that specifies one or more communication modes supported by a second node device within the mesh network; selecting, by the first node device, a first communication mode from the one or more communication modes, wherein a first metric value determined for the first communication mode based on the information element is lower than a second metric value determined for a default communication mode by a threshold value; and configuring, by the first node device, a communication link between the first node device and the second node device according to the first communication mode. |
US11950322B2 |
Storage of UE contexts in RAN for inactive UEs
Systems and methods are disclosed herein that relate to configuration of a periodic updating timer for, e.g., a Radio Access Network (RAN)-controlled inactive state. In some embodiments, a method of operation of a RAN node in a cellular communications network comprises configuring a User Equipment (UE) with a timer value T for a periodic updating timer. In this manner, the RAN node is able to configure the UE with a time value T, e.g., for use by the UE for providing periodic update messages while the UE is operating in an inactive state such as, e.g., a RAN-controlled inactive state. |
US11950321B2 |
Methods and systems of using remote subscriber identification modules at a device
The present invention discloses methods and systems for communicating at a cellular router between a first wireless communication module and a first subscriber identity module (SIM). The cellular router receives a first request from a first wireless communication module and encapsulates the first request in a first modified request. The cellular router then sends the first modified request to a first SIM card in a first communication apparatus and waits for a first modified reply. While waiting for the first modified reply the cellular router sends at least one halt message to the first wireless communication module after a first time threshold. After receiving the first modified reply, the cellular router decapsulates the first modified reply to retrieve a first reply and sends the first reply to the first wireless communication module where the first modified reply is a reply to the first modified request. |
US11950316B1 |
Vehicle-passenger assistance facilitation
Vehicles may be associated with a variety of different types of events, including events associated with vehicle operations and/or events associated with vehicle passengers. The present disclosure is related to, when an event is detected, exchanging information with a vehicle passenger, such as via the passenger's mobile device and/or wearable device. In some instances, an event may be detected, and examples of the present disclosure may provide an application notification presenting various information. The notification may, in some examples, be configured to help the passenger locate the passenger device, to alert the passenger to the event, to provide instructions, and/or to provide a control interface for controlling a vehicle operation. In some examples, the notification may supersede operations of the passenger device, such as by being presented even if the device is in a locked state or has an unrelated application open and in the foreground. |
US11950312B2 |
Terminal apparatus, base station apparatus, and method
A terminal apparatus in communication with a base station apparatus includes a receiver configured to receive, from the base station apparatus, a message related to Radio Resource Control (RRC) connection reconfiguration, and a processing unit. The processing unit determines, based on information included in the message related to the RRC connection reconfiguration, a DRB to which a DAPS is to be applied and a DRB to which the DAPS is not to be applied, and associates, with a target primary cell, an RLC entity and a DTCH logical channel for the DRB to which the DAPS is not to be applied. |
US11950311B2 |
Terminal apparatus and method for storing priority information for cell reselection
A terminal apparatus includes: a transmitter configured to transmit a first message for requesting resume from an inactive state to a connected state; a receiver configured to receive a second message that includes priority information for cell selection (first information) and indicates a transition to an idle state (release of connection); and a controller configured to store the first information, in which the controller determines, based on whether or not a transition from an inactive state to an idle state is triggered by reception of the second message, in a case of storing the first information, whether to store or discard the first information. |
US11950307B2 |
Efficient handling of a resource control state change and multi-node connectivity
This document describes techniques and devices for efficient handling of a resource control state change and multi-node connectivity. Instead of performing multiple radio resource control (RRC) procedures to change a resource control state of a user equipment (UE) and establish, modify, or release a connection with multi-node connectivity, the techniques described herein combine the multiple RRC procedures into a single RRC procedure that supports both a resource control state change and multi-node connectivity. In particular, a master node sends a resource control state and multi-node connectivity message that includes both state change information and multi-node connectivity information. With this single message, timing and power resources of the UE can be conserved and failures resulting from asynchronous communication of the state change information and the multi-node connectivity information can be avoided. |
US11950303B2 |
Communication system using wireless communication, communication apparatus, and control method
A communication system includes a communication apparatus and a communication terminal configured to wirelessly communicate with each other, wherein the communication terminal includes a first wireless communication interface configured to support a Bluetooth® standard and include a single antenna, and wherein the communication apparatus includes a second wireless communication interface configured to support the Bluetooth® standard and include a plurality of antennas, and includes one or more controllers configured to function as a unit configured to obtain angle information and field intensity information based on a result of reception of radio waves, by the plurality of antennas, transmitted from the single antenna; and a unit configured to transmit an establishment request for wireless communication based on the Bluetooth® standard to the first wireless communication interface via the second wireless communication interface based on a fact that the angle information and the field intensity information satisfy a predetermined condition. |
US11950300B2 |
Using a smartphone to control another device by voice
A method and system for implementing a speech-enabled interface of a host device via an electronic mobile device in a network are provided. The method includes establishing a communication session between the host device and the mobile device via a session service provider. According to some embodiments, a barcode can be adopted to enable the pairing of the host device and mobile device. Furthermore, the present method and system employ the voice interface in conjunction with speech recognition systems and natural language processing to interpret voice input for the hosting device, which can be used to perform one or more actions related to the hosting device. |
US11950296B2 |
Method of performing random access procedure, and transmitting device, apparatus and storage medium therefor
In the present disclosure, a UE transmits a random access preamble (RAP) on a physical random access channel (PRACH) and a control channel (CCCH) service data unit (SDU) on a physical uplink shared channel (PUSCH); and receives a medium access control (MAC) protocol data unit (PDU) based on transmitting the RAP and the CCCH SDU. The MAC PDU includes a first part, and a second part after the first part. The first part includes multiple UE contention resolution identities (UE CRIDs). |
US11950281B2 |
Method and device for transmitting data
Aspects of the disclosure provide a method of transmitting data, including monitoring a data transmission of a first base station in a preset license before talk (LBT) time-frequency region in at least one fixed frame period (FFP). The preset LBT time-frequency region includes at least one time-frequency sub-region. The method can further include determining FFP transmission mode information of the first base station based on a monitoring result on each time-frequency sub-region in the preset LBT time-frequency region in each FFP, and determining an FFP transmission mode of the first base station based on the FFP transmission mode information. |
US11950280B2 |
Channelization and BWP
Methods, systems, and apparatus designed to support flexible carrier bandwidths in new radio. Multiple carrier bands may be combined into a single composite carrier depending on channel availability in the carrier bands. A composite carrier indicator (CCI) indicates to network devices, the available carrier bands within the channel occupancy time. In addition, bandwidth part inactivity time is suspended when channel access is not available. |
US11950274B2 |
Method for scheduling logical channel, method for generating configuration information, and device
The present disclosure relates to a method for scheduling a logical channel, a method for generating configuration information and a device. The method for scheduling a logical channel comprises: determining, according to logical channel configuration information, a coverage area of each logical channel, the configuration information comprising coverage area information of the logical channel; selecting, according to a transmission distance of a grant, a logical channel having a coverage area matching the transmission distance; and allocating a resource to the selected logical channel, and completing scheduling. The method for generating configuration information comprises: generating configuration information according to service quality information of a service, the configuration information comprising coverage area information of each logical channel; and sending the configuration information to user equipment. The invention achieves generation of logical channel configuration information comprising coverage area information and scheduling of a logical channel according to the configuration information. The method for scheduling a logical channel, the method for generating configuration information, and the device according to embodiments of the present disclosure ensure that a transmission distance requirement is met during a communication process, thereby enhancing communication performance. |
US11950271B1 |
Limiting uplink noise by adjusting MIMO transmission layers
Dynamically limiting MIMO transmission layers assigned to wireless devices to mitigate uplink noise levels measured at an access node (e.g. RSSI). The transmission layers can be adjusted based on a device capability or power class. For example, maximum MIMO transmission layers assigned to HPUEs can be reduced first. |
US11950270B2 |
Method and apparatus for collecting and processing interference information
A system that incorporates the subject disclosure may perform, for example, a method for receiving interference information from each of the plurality of communication devices detecting interference information in a plurality of segments of a radio frequency spectrum, correlating the interference information of the plurality of communication devices to generate correlated information, and identifying a plurality of interferers according to the correlated information. Other embodiments are disclosed. |
US11950269B2 |
Transmission method and apparatus for reducing latency in wireless cellular communication
Methods and apparatuses are provided in which information for a length of a short transmission time interval (STTI) is transmitted to a terminal. A timing advance for the terminal is transmitted to the terminal. The timing advance is included in a timing advance range among different timing advance ranges, and the timing advance range is associated with the information for the length of the STTI. A signal is transmitted to the terminal based on the information for the length of the STTI. |
US11950268B2 |
Methods and devices for resource allocation for control resource region
Embodiments of the present disclosure relate to methods, devices and apparatus for resource allocation for a control resource region in a wireless communication system. In an embodiment of the present disclosure, a method may include determining resource units each containing a predetermined number of resource blocks based on available transmission resources. Resource blocks not contained in the resource units are distributed in the available transmission resources to divide resource blocks contained in the resource units into a plurality of resource segments. The method also comprise allocating one or more of the determined resource units to the control resource region and transmitting resource allocation information indicating the allocated one or more of resource units. With embodiments of the present disclosure, there is provided an effective solution for resource allocation for control resource region. |
US11950266B2 |
System and method for supporting GAN service request capability in a wireless user equipment (UE) device
In one embodiment, a scheme is disclosed for supporting wireless access network service request capability in a user equipment (UE) device that is operable in wide area cellular network (WACN) bands as well as in wireless access network bands (e.g., GAN bands and/or UMA bands). The UE device includes capability for gaining Internet Protocol (IP) connectivity with a wireless access network node (e.g., a GAN controller (GANC) or UMA network controller (UNC)). Thereafter, the UE device is operable to initiate a registration request message towards the wireless access network node, wherein the registration request message includes at least one information element pertaining to wireless access network services required by the UE device. |
US11950262B2 |
Sidelink beam management
Methods, systems, and devices for wireless communications are described. A device may be configured to support multi-beam, or multi-panel operations, or both which may allow multiple sidelink transmissions to occur simultaneously. In some cases, flexible beam-management for the beamformed sidelink communications is implemented to manage the beams. A transmitting UE may indicate transmission beam information to the base station that the base station may use to schedule sidelink transmissions as part of a beam management procedure. The beam management procedure may allow a transmitting UE to update transmission beam information based on the mobility of the sidelink UEs and other environmental factors. In some cases, beam management includes a beam training procedure that may be implemented to refine the sidelink beams, where support for multi-panel and multi-beam operation may allow for multiple beams to be trained simultaneously. |
US11950256B2 |
Wireless communication device, wireless communication method, and computer program
A wireless communication device including an acquisition unit that acquires an information set related to a transmission parameter when transmitting a resource arbitrarily selected from a predetermined resource pool to a transmission target (for example, performing grant-free transmission), and a setting unit that sets the transmission parameter using the information set. |
US11950249B2 |
Two-stage grant for uplink data transmission in new radio-unlicensed (NR-U)
Wireless communications systems and methods related to communicating in a communication medium are provided. A first wireless communication device communicates with a second wireless communication device, a first scheduling grant. The first wireless communication device communicates, with the second wireless communication device, a second scheduling grant including at least one of a start slot index (SSI) or a slot format indicator (SFI). The first wireless communication device communicates, with the second wireless communication device, an uplink communication signal based on the first scheduling grant and the second scheduling grant. |
US11950246B2 |
Sidelink vehicle to vulnerable road user techniques for wireless communications systems
Methods, systems, and devices for wireless communications are described. A first wireless device may receive an indication of one or more parameters for communications over a sidelink channel during a first time period, where the one or more parameters may include a time threshold for a second resource pool. The wireless device may transmit data over a first resource pool of the sidelink channel during a first portion of the first time period based on the one or more parameters, the first resource pool including resources for communications between the first wireless device and a second wireless device. The wireless device may monitor the second resource pool during a second portion of the first time period for the time threshold, the second resource pool including resources for communications between the first wireless device and a third wireless device. |
US11950241B2 |
Self-contained time division duplex (TDD) subframe structure for wireless communications
Aspects of the present disclosure provide a self-contained subframe structure for time division duplex (TDD) carriers. Information transmitted on a TDD carrier may be grouped into subframes, and each subframe can provide communications in both directions (e.g., uplink and downlink) to enable such communications without needing further information in another subframe. In one aspect of the disclosure, a single subframe may include scheduling information, data transmission corresponding to the scheduling information, and acknowledgment packets corresponding to the data transmission. Furthermore, the subframe may additionally include a header and/or a trailer to provide certain bi-directional communications functions. |
US11950236B2 |
Node and method for prescheduling ULink resources in a wireless network according to a UE's application requirements
Example embodiments presented herein are directed towards a wireless device (101) and a network node (102, 103, 104, 110, 111, 115), and corresponding methods therein, for prescheduling uplink communications in a wireless network. Such prescheduling is performed prior to the time the uplink communication is needed. According to the example embodiments, the prescheduling is performed with the network node having knowledge of a communication pattern of the wireless device via at least one prescheduling parameter obtained by the network node (the base station, or a core network node), either transmitted by the wireless device or else retrieved by the network node from subscription or historical data. The prescheduling parameter may relate to the application or service that has been activated, and a prescheduling cancellation is sent when it is halted. |
US11950235B2 |
Resource selection with sidelink receiver sensing
Methods, systems, and devices for wireless communications are described. In some examples, a first UE may receive an indication of first resources from a second UE. In some examples, the second UE may be a UE configured to receive a transmission from a third UE over the first resources. In some such examples, the first UE may transmit, to a fourth UE, a sidelink transmission over available resources that exclude the first resources. Additionally, or alternatively, the second UE may be a UE that received sidelink control information from the third UE indicating the resources for transmission by the third UE to a fourth UE. In some such examples, the first UE may transmit, to the second UE, a sidelink transmission over available resources that exclude the first resources. |
US11950234B2 |
Method for determining sidelink category, terminal device, and network device
A method for determining a sidelink type, a terminal device, and a network device are provided. The method comprises: receiving downlink control information (DCI) sent by a network device; determining, on the basis of the DCI, a first type of sidelink or a second type of sidelink as a target sidelink according to a preset rule, the first type of sidelink being different from the second type of sidelink in configuration parameters; and using the target sidelink to perform data transmission of the sidelink. |
US11950232B2 |
Multiplexing sidelink control information-only grants and data-only traffic
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a first user equipment (UE) may transmit, to a second UE, a grant-only indicator to indicate that a second stage sidelink control information (SCI-2) is decoupled from physical sidelink shared channel (PSSCH) data in a slot, and that the SCI-2 indicates an SCI-2-only grant. The first UE may transmit, to the second UE in the slot, the SCI-2-only grant multiplexed with data-only traffic in a first PSSCH transmission based at least in part on the grant-only indicator, wherein the SCI-2-only grant indicates a resource allocation for a subsequent slot. Numerous other aspects are described. |
US11950227B2 |
Periodic radio resource
A base station central unit receives, from a base station distributed unit, configuration parameters of at least one periodic radio resource for packet transmissions of a wireless device in a radio resource control (RRC) inactive state or RRC idle state. The base station central unit sends, to the base station distributed unit, a wireless device context release message comprising an RRC release message and an indication that the base station distributed unit maintains the at least one periodic radio resource after the wireless device transitions to the RRC idle state or the RRC inactive state. The base station central unit receives, via the base station distributed unit, data from the wireless device while the wireless device is in the RRC inactive state or the RRC idle state. |
US11950225B2 |
Selective channel state measurement and report for small data transfer in power saving mode
A user equipment (UE) may initiate a Type-1 or Type-2 random access procedure from a power saving mode, generate a channel state information (CSI) report and a buffer status report, and selectively multiplex the CSI report and BSR with mobile originated (MO) data in a random-access message of the random-access procedure. The UE may further transmit a request to remain in the power saving mode after finishing the transmission of the MO data. The configuration of random access and CSI reporting procedure depends on the UE type or UE capability supported by the network. |
US11950223B2 |
Scheduling new radio (NR) shared channel transmission
In a general aspect, a User Equipment (UE) in a cellular communications network receives a Radio Resource Control (RRC) signaling message from a base station communicatively coupled to the UE over a communications channel. The UE accesses a search space in the RRC signaling message. The UE identifies a fallback Downlink Control Information (DCI) Information Element (IE) included in the search space. The UE determines whether an aggregation factor is indicated in the fallback DCI IE for shared channel communications with the base station, over multiple slots in the communications channel. The UE determines an uplink/downlink (UL/DL) configuration for transmission on the communications channel. The UE schedules an aggregated transmission over multiple slots in the communications channel based on the aggregation factor and the uplink/downlink configuration. |
US11950222B2 |
Techniques for wireless communication using sub-slot based physical sidelink shared channels
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment (UE) may receive a configuration that indicates multiple time intervals corresponding to multiple physical sidelink shared channels (PSSCHs) within a slot, wherein at least one PSSCH, of the multiple PSSCHs, starts in a symbol other than an initial data symbol of the slot. The UE may communicate in one or more PSSCHs, of the multiple PSSCHs, within the slot based at least in part on the configuration. Numerous other aspects are described. |
US11950221B2 |
Techniques to synchronize radio access technologies for co-channel operation
Methods, systems, and devices for wireless communications are described. A wireless device that uses a first radio access technology (RAT) may identify a transmission timing scheme for a shared radio frequency spectrum band, the transmission timing scheme comprising a first set of time intervals allocated for transmissions using a first RAT and a second set of time intervals allocated for transmissions using a second RAT. The wireless device may transmit, during a time interval of the first set of time intervals, a channel reservation signal indicating an end time of the time interval and indicating that the wireless device uses the first RAT. The wireless device may transmit, based at least in part on the transmitted channel reservation signal, over the shared radio frequency spectrum band during at least a portion of the time interval before the end time of the time interval. |
US11950214B2 |
Devices, methods and computer programs for saving frequency resources in wireless communications
A client device for wireless communication includes a transceiver and a processor. The transceiver is configured to receive frequency resource information to indicate a set of frequency resources for a physical random access channel (PRACH) preamble transmission. The frequency resource information includes at least one of: an interlace information indicating at least one of an interlace of a block-interlaced frequency-division multiplexing (B-IFDM) allocation, a resource element allocation information indicating a subset of resource elements within each block of the at least one B-IFDM interlace, and a resource element spacing information, such that an at least one resource element within at least one block of the at least one B-IFDM interlace is allocated for the transmission of one PRACH preamble according to a tone-interlaced frequency-division multiplexing (T-IFDM) allocation. The resource element allocation is repeated in each block of the at least one B-IFDM interlace. |
US11950213B2 |
Controlling deployment of IoT devices over wireless networks with an adaptive gateway
Systems, machine-readable media, and methods to control deployment of IoT devices over wireless networks with an adaptive gateway are provided. A gateway device may broadcast on different channels in a first time slot of a time interval. The gateway device may receive a response from a sensor device in a second time slot of the time interval. The gateway device may further communicate to the sensor device in a third time slot of the time interval. The gateway device may receive transmissions from the sensor device in one or more subsequent instances of the fourth time slot of the time interval. Based at least in part on the one or more transmissions from the sensor device, the gateway device may transmit data to one or more computer systems via one or more networks. |
US11950209B2 |
Reuse of control resources for data transmission
Example embodiments of the present disclosure relate to a device, method, apparatus and computer readable storage medium for reusing control resources for data transmission. In example embodiments, if downlink data is to be transmitted to a terminal device, a network device determines a control resource set associated with the terminal device in a control resource region. The network device selects, from the control resource set, localized control resources for control information associated with the downlink data, and selects data resources for the downlink data in the control resource region and a data resource region. The network device transmits the control information to the terminal device by using the localized control resources, and transmits the downlink data to the terminal device by using the data resources. |
US11950207B2 |
Tracking area planning
A method is disclosed for improved tracking area planning and handling, comprising: assigning a single tracking area code to a plurality of eNodeBs at a messaging concentrator gateway, the messaging concentrator gateway situated in a network between the plurality of eNodeBs and the core network; storing, at the messaging concentrator gateway, at least one indicator of a last known location of a user equipment (UE) other than the single tracking area code; receiving a paging message from the core network at the messaging concentrator gateway for a UE; and performing a paging sequence using the at least one indicator to identify a set of eNodeBs to page the UE, thereby allowing larger tracking area list sizes to be used without increasing signaling traffic between the radio access network and the core network. |
US11950206B2 |
Paging on narrow beam and alignment with default DRX
In accordance with an example embodiment of the present invention, a method comprising: receiving from a network node, by a user equipment of a plurality of user equipment associated with more than one communication beam of a communication network, information comprising locations in time of the user equipment during paging occasions with at least one cell of the communication network associated over more than one communication beam, wherein the information identifies any provided order of the more than one communication beam covering the locations in time of the user equipment during the paging occasions; and based on the information, identifying by the user equipment at least one communication beam and timing of at least one paging occasion, of the paging occasions, for the user equipment. |
US11950204B2 |
Method and apparatus for transmitting and receiving a signal in the wireless communication system
In an exemplary embodiment, a method performed by a relay user equipment (UE) in a wireless communication system is provided. The method comprising: receiving, from a base station (BS), a paging configuration including at least one of a number of total paging frame, a number of paging occasion for a paging frame, an offset for paging frame, a first DRX cycle of a remote UE, or paging search space; transmitting, to a remote UE, the paging configuration; receiving, from the remote UE, information related the remote UE including at least one of identity of the remote UE, paging identity of the remote UE or a second DRX cycle of the remote UE; identifying a paging occasion of the remote UE based on the information related the remote UE and the paging configuration; and monitoring the paging occasion of the remote UE for receiving a paging message for the remote UE. |
US11950201B2 |
Triggering of an aperiodic or semi-periodic positioning reference signal procedure
In an aspect, a UE obtains a plurality of positioning reference signal (PRS) configurations. The UE receives, from a BS, an L1 or L2 message that indicates one of the plurality of PRS configurations, which in turn triggers an aperiodic or semi-periodic PRS procedure in accordance with the indicated PRS configuration. |
US11950200B2 |
Enabling user equipment (UE) positioning anchors for vehicle-to-everything (V2X), vehicle-to-vehicle (V2V), and vehicle-to-pedestrian (V2P) positioning
A method of wireless communication by a positioning entity includes determining an accuracy of a positioning estimate of a first non-anchor sidelink user equipment (UE). The method also includes determining the accuracy satisfies an accuracy condition. The method further includes configuring the first non-anchor sidelink UE as a first anchor UE based on the positioning estimate satisfying the accuracy condition. |
US11950195B2 |
Performing measurements in telecommunication systems including absolute time difference between measurements
A method, device and computer readable medium for performing measurements in telecommunication systems are disclosed. The method comprises: includes receiving, from a first network device, a first configuration of a first measurement object for a carrier frequency; receiving, from a second network device, a second configuration of a second measurement object for the carrier frequency; determining an absolute time difference between a first measurement timing in the first configuration and a second measurement timing in the second configuration; and in response to determining that the absolute time difference is below a predetermined threshold, performing a single measurement for the carrier frequency based on the first measurement timing in the first configuration or the second measurement timing in the second configuration. |
US11950193B2 |
Method and device for transmitting S-SSB in NR V2X
An operating method of a first device (100) in a wireless communication system is presented. The method can comprise the steps of receiving an SL SSB from a second device, and acquiring bit information on the basis of the order in which a first m-sequence and a second m-sequence are mapped to a first PSS symbol and a second PSS symbol. |
US11950189B2 |
Method and apparatus for uplink transmission and reception in wireless communication system
Disclosed are a method and an apparatus for uplink transmission and reception in a wireless communication system. A method for transmitting an uplink channel according to an embodiment of the present disclosure may comprise the steps of: receiving downlink control information (DCI) from a base station; and transmitting the uplink channel to the base station on the basis of the DCI. N (N is a natural number) transmit power control (TCI) command values may be indicated by the DCI, and transmission power of the uplink channel may be determined on the basis of one of the N TPC command values. |
US11950186B2 |
Power saving techniques
Techniques are described to enable a user equipment (UE) to save power consumption and/or can enable the UE to acquire the channel state in time without reducing the UE's data transmission efficiency. An example technique includes determining, by the communication device, an operating mode based on a first signaling, and operating the communication device in the operating mode, where the operating mode includes any one of a normal mode, a first power saving mode, a second power saving mode, a third power saving mode, or a fourth power saving mode. |
US11950185B2 |
Wake-up signal configuration
Systems and methods for configuring wake-up signals are provided. A network node allocates a first wake-up signal (WUS) at a first frequency location and one or more second WUSs at second frequency location(s). Responsive to receiving a page associated with a wireless device, the network node transmits the appropriate first or second WUS on the configured frequency. |
US11950182B2 |
Negotiation of a PC5 rat for a V2X service
Embodiments of a User Equipment (UE) and methods of communication are generally described herein. The UE may be configurable to operate as an initiating UE for a vehicle-to-everything (V2X) application that includes PCS communication between the initiating UE and a receiving UE. The initiating UE may receive, from a base station, control signaling that indicates a default PCS radio access technology (RAT) for the V2X service. The default PCS RAT may be either a Long Term Evolution (LTE) PCS RAT or a New Radio (NR) PCS RAT. Based on the default PCS RAT and/or PCS RATs supported by the initiating UE, the initiating UE may select either the LTE PCS RAT or the NR PCS RAT. The selected PCS RAT may be proposed, in a negotiation with the receiving UE, for the V2X service. |
US11950174B2 |
Detailed alarm messages and support
In one embodiment, a method of alerting a user of a WCD is described. The method includes receiving an alert from the WCD on a remote device associated with the user and in communication with the WCD and transcribing the alert into a message for the user. The method also includes personalizing the message for the user and delivering the message to the user via the remote device. |
US11950170B2 |
Passive sensor tracking using observations of Wi-Fi access points
A method of passive sensor tracking includes using a Wi-Fi access point that transmits a management frame comprising sensor data of a sensor as part of Wi-Fi wireless network discovery, associating unique identifying information of the Wi-Fi access point with a sensor in a sensor tracking database, receiving observation data of the Wi-Fi access point from a Wi-Fi AP Database, the observation data including the unique identifying information of the Wi-Fi access point and the sensor data of the sensor, and storing the sensor data in the sensor tracking database. The Wi-Fi AP Database receives one or more reports comprising observation data from one or more wireless devices that encounter the Wi-Fi access point. |
US11950169B2 |
Uplink positioning methods and apparatuses for non-terrestrial networks
Apparatus, methods and computer program products for user equipment positioning solutions and related signalling. An apparatus comprising at least one processor and at least one memory including computer program code, the at least one memory and the computer program code are configured, with the at least one processor, to cause the apparatus to at least send (550), to a network node of a communication network, at least one signaling configuration with at least one set periodicity, wherein the at least one signaling configuration is for use at the network node in calculating at least position information for relaying to the communication network at least for positioning support of the apparatus, and receive (570) the positioning support from the communication network in response to the at least one signaling configuration. |
US11950163B2 |
Crowdsourced contact tracing
Systems and methods include the following. Information about a first electronic communication device is transmitted to at least one server and/or decentralized infrastructure. The information includes vicinity information. A status signal associated with a first user of the first electronic communication device is optionally transmitted. Contact proximity network information about a contact proximity network is received. The contact proximity network is based on the information from a plurality of electronic communication devices and information about the association between users and electronic communication devices. The contact proximity network information includes status signal information and interconnected nodes corresponding to different users and pairwise connections between users based upon their relative physical space and time proximity. A notification indicating a network-based proximity of a first user to a second user is provided, indicating a minimum number of connections between the first user and the second user during a specified time frame. |
US11950159B2 |
Method and device for reselecting heterogeneous network in sidelink relaying
Proposed is a method for a first device to perform wireless communication. The method may comprise the steps of: establishing a connection with a second device; and reselecting a cell on the basis that the first device is in a radio resource control (RRC) IDLE state or an RRC INACTIVE state. For example, a priority related to cell reselection can be set such that a cell related to a new radio (NR) has a high priority. For example, cell reselection can be performed first on the cell related to the NR on the basis of the priority related to cell reselection. |
US11950158B2 |
Method and device for distributing idle user equipment in multi-carrier based mobile communication system
The present invention relates to a method and device for distributing idle UE by a carrier in eNB of a multi-carrier based mobile communication system. The method of distributing idle UE in a multi-carrier based mobile communication system according to the present invention includes a process of determining a search rate by a carrier on the basis of information representing load on the carrier, a step of determining a cell reselection priority on the idle UE on the basis of the determined search rate, and a process of transmitting the determined cell reselection priority to the idle UE. |
US11950157B2 |
Mobility and load balancing target selection for unlicensed carriers
Methods, nodes and computer program products control radio channel deployment when using un-licensed carriers in a wireless communication network and control mobility and/or load balancing target selection when using un-licensed carriers. When performed in an access node, unlicensed carrier intrinsic cell channel load is determined in a cell served by the access node based on one or more predetermined channel load indicators and neighbor cell channel load information is obtained, from one or more neighboring access nodes. The neighbor cell channel load information includes unlicensed carrier channel load in respective cells based on the one or more predetermined channel load indicators. At least one channel deployment operation is initiated based on an outcome of one or more comparative operations including the determined unlicensed carrier intrinsic cell channel load and/or the obtained neighbor cell channel load information. |
US11950156B2 |
Techniques for sharing transmission power during handover in wireless communications
This disclosure provides systems, methods and apparatus, including computer programs encoded on computer storage media, for cancelling transmissions during handover operations. In one aspect, a user equipment (UE) can cancel at least a portion of a first uplink transmission where the first uplink transmission overlaps with a second uplink transmission scheduled by a target cell in a dual active protocol stack (DAPS)-based handover (HO). In another aspect, a network can receive, from the UE, a capability indicating whether cancelling uplink transmission from a source cell in DAPS-based HO is supported, and the network can schedule an uplink transmission for the UE during the DAPS-based HO to the target cell based on the capability. |
US11950151B2 |
Self-organizing networks (SON) for mobility robustness optimization (MRO) and automatic network slice creation
Some embodiments of this disclosure include apparatuses and methods for applying mobility robustness optimization (MRO) and automatic network slice creation in 5G Self-Organizing Networks (SON). A network system may identify user equipment (UE) performing a handover from a first node to a second node. The network system may apply a MRO function to identify a target parameter corresponding to the handover. The network system may monitor connection measurements and/or radio link failure reports to identify the handover as failing to meet the target parameter. The network system may then modify the target parameter to facilitate the handover to the second node. For the automatic creation of a network slice instance (NSI), a network system may receive network slice specifications and apply the specifications to an automatic NSI creation function. The network system may instantiate network functions according to the automatic NSI creation function to create an NSI. |
US11950148B2 |
Handover management method
In accordance with an aspect of the present disclosure, there is provided a handover management method performed by a session management function (SMF). The method comprises, receiving handover information related to a user equipment (UE) receiving a predetermined service by accessing a source radio access network (S-RAN), obtaining, after receiving the handover information, resource information on a resource used when the predetermined service is provided to the UE at the S-RAN, and transmitting, to a user plane function (UPF), a request that a resource corresponding to the obtained resource information is to be secured in a target radio access network (T-RAN). |
US11950147B2 |
Smart non-stand alone (NSA) operation between mm-wave and SUB6
A method is provided. The method includes determining, while a user equipment (UE) is connected to a long term evolution (LTE) cell, that the UE supports connection with a first fifth generation (5G) frequency range (FR1) base station (gNB) and a second 5G frequency range (FR2) base station (SgNB), when the UE is camped to an FR1 cell, determining whether at least one connection condition is satisfied, and controlling to release the UE from the FR1 cell and initiating the UE to an FR2 cell when the at least one connection condition is determined to be satisfied. |
US11950145B2 |
Beamforming in wireless communications
Aspects described herein relate to wireless communications. According to some aspects, a first base station may coordinate with a second base station to select beamforming codewords. The first base station may receive an index indicating beamforming codewords used by a second base station. The first base station may select a beamforming codeword for use in transmitting signals to a wireless device based on the beamforming codeword indicated by the second base station. |
US11950143B2 |
Method and device for supporting handover
The present disclosure relates to a communication method and system for converging a 5th-Generation (5G) communication system for supporting higher data rates beyond a 4th-Generation (4G) system with a technology for Internet of Things (IoT). The present disclosure may be applied to intelligent services based on the 5G communication technology and the IoT-related technology, such as smart home, smart building, smart city, smart car, connected car, health care, digital education, smart retail, security and safety services. According to an aspect of the embodiments of the present disclosure, a method for supporting handover is provided, comprising: receiving a message from a central unit control plane entity of a target base station; receiving a data packet from a source base station; and discarding a packet data convergence protocol (PDCP) service data unit (SDU) including the PDCP sequence number (SN) in the received data packet according to the indication of the message. |
US11950140B2 |
System and method for providing device management and network management at an edge device
An edge device is disclosed and includes a processor, a memory, and a power management unit (PMU). The processor executes code instructions of an edge throughput services management system for managing a wireless network and one or more devices operatively coupled to the wireless network and the edge device. The processor detects a number of managed client information handling systems operatively coupled to the edge device; creates a persona associated with each of the managed client information handling systems; conducts an inventory of one or more applications requiring network access associated within each persona; prioritizes each persona for network access; and prioritizes each application associated with each persona for network access. The edge throughput services management system to provide a service for monitoring and recommending adjustments to the wireless network and managed client information handling systems for flexible data bandwidth access to the wireless network. |
US11950136B2 |
Load relocation in a communications network
This application discloses a load relocation method, apparatus, and a system. The method includes determining, by a communications network entity, a target access management entity for load relocation; and sending, to an access network entity, an identifier of an original access management entity and an identifier of the target access management entity or an address of the target access management entity with respect to the access network entity. The access network entity sends a message from a user equipment (UE) to the target access management entity based on the identifier of the original access management entity carried in the message from the UE. In the foregoing solution, signaling overheads in a load relocation process are reduced and load relocation efficiency is improved. |
US11950135B2 |
Data transmission method and device
A data transmission method and device includes, when the target length of a time-domain resource required by a target transmission block is greater than a first length of an available time-domain resource of a target time slot, the network access device determines a size of a first transmission sub-block transmitted on the available time-domain resource of the target time slot, divides the target transmission block into the first and second transmission sub-blocks according to the size of the first transmission sub-block, in which a second length of a time-domain resource required by the second transmission sub-block is equal to the difference between the target length and the first length, determines a first time-domain resource configured to transmit the second transmission sub-block in the next time slot after the target time slot according to the second length, and sends a first resource allocation message to a terminal. |
US11950134B2 |
Method and device in communication nodes for wireless communication
The present disclosure discloses a method and a device in communication nodes for wireless communications. In a first node, a successful transmission of a first packet is acknowledged by a first entity, the first entity being used for unicast; a second entity being used for non-unicast does not indicate that the second entity deletes a duplicated first packet; the second entity being used for unicast indicates that the second entity deletes a duplicated first packet; herein, the first entity and the second entity are associated with a same higher layer entity. The present disclosure helps avoid deleting a same packet repeatedly transmitted through multicast, thus ensuring the continuity of traffics received by multicast, which further reduces higher layer retransmissions triggered by deletion of the packet, thus decreasing traffic delay. |
US11950132B2 |
Wireless communication system, base station, user equipment, and wireless communication method
A wireless communication system includes a first wireless communication device, and a second wireless communication device. The first wireless communication device includes: a communicator that delivers, to the second wireless communication device, data addressed to a third wireless communication device and receives, from the second wireless communication device, information on communication quality according to failed data of which delivery fails among the data delivered from the second wireless communication device to the third wireless communication device; and a controller that controls delivery of the data in accordance with the information on the communication quality. |
US11950126B2 |
Half duplex techniques for wireless communications
Aspects described herein relate to receiving, over a sub-channel of multiple sub-channels, ultra-reliable quality-of-service (QoS) traffic from one or more UEs over a time duration wherein other sub-channels of the multiple sub-channels are used for initial ultra-reliable QoS transmissions from one or more other transmitting UEs over the time duration, and relaying, along with one or more other relaying UEs, the ultra-reliable QoS traffic over a subsequent time duration. |
US11950125B2 |
Consistent Quality of Service policy in a software defined enterprise
Systems and methods for providing enhanced Quality of Service (QoS) network transmissions can be based on an application sub-class or a user class. Systems and methods can include inspecting the information packet having a network level QoS field having a first network level QoS portion and a second network level QoS portion, determining an application sub-class or user class associated with the information packet, tagging the first network level QoS portion of the information packet according to a first network level QoS value, tagging the second network level QoS portion of the information packet according to a traffic priority indication and to a determined application sub-class or user class, and queuing the information packet for transmission from a network element based on the tagged first network level QoS portion and the second network level QoS portion. |
US11950124B2 |
Methods, apparatus and systems for integrated access and backhaul bearer management
A method for data radio bearer management, the method including: transmitting a data radio bearer (DRB) setup request message to a wireless communication node; receiving a DRB setup response message from the wireless communication node, determining at least one DRB and at least one Quality of Service (QoS) flow mapped to the at least one DRB supported by the wireless communication node; and configuring the wireless communication node to support the at least one DRB and the at least one QoS flow. |
US11950117B2 |
Large scale radio frequency signal information processing and analysis system
A large-scale radio frequency signal information processing and analysis system that provides advanced signal analysis for telecommunication applications, including band capacity and geographical density determinations and detection, classification, identification, and geolocation of signals across a wide range of frequencies and across broad geographical areas. The system may utilize a range of novel algorithms for bin-wise processing, Rayleigh distribution analysis, telecommunication signal classification, receiver anomaly detection, transmitter density estimation, transmitter detection and location, geolocation analysis, telecommunication activity estimation, telecommunication utilization estimation, frequency utilization estimation, and data interpolation. |
US11950115B2 |
Wireless communication performance measurement method and wireless communication performance measurement system
A measurement station collects radio base station performance information related to a radio communication performance of each radio base station, radio connection information related to a radio communication performance and a communication status of a corresponding radio terminal station, generates a measurement condition and an expected measurement result based on the radio base station performance information and the radio connection information, and notifies a measurement control signal corresponding to the measurement condition to the radio terminal station through the radio base station; the radio terminal station performs a communication setting of an own station based on the notified measurement control signal, and notifies a measurement preparation status to the measurement station; and the measurement station measures the radio communication performance by causing a flow of a measurement traffic to the radio terminal station through the radio base station, acquiring a measurement result, and determining whether the measurement result is within a range of the expected measurement result. |
US11950113B2 |
Prioritizations during beam failure recovery
Methods, systems, and devices for wireless communications are described. A user equipment (UE) may determine, during a beam failure recovery period, that a configured control resource set at least partially overlaps with a beam failure recovery control resource set. The UE may configure, based at least in part on the at least partial overlap, a receive beam to receive the beam failure recovery control resource set. The UE may receive a control signal over the beam failure recovery control resource set during the beam failure recovery period. |
US11950108B2 |
Reusing resources in a wireless relay
An operation method of a repeater relaying wireless communications between a base station and at least one terminal in a communication system may include: transmitting, to the base station, a first capability report including information on beam-related capability supported by the repeater; transmitting, to the base station, a first request signal for requesting to perform first configuration for coverage extension of the repeater; receiving, from the base station, information on the first configuration configured based on the first capability report and the first request signal; and relaying the wireless communications between the base station and the at least one terminal based on one or more beams formed based on the received first configuration. |
US11950106B2 |
User equipment capability indication of receive beamforming for cell identification
An apparatus of a New Radio (NR) User Equipment (UE), a method, and a system. The apparatus includes a Radio Frequency (RF) interface, and processing circuitry coupled to the RF interface. The processing circuitry is to: generate a signal including capability information of the UE, wherein a time period for intra-frequency cell detection and measurement for the UE is based on the capability information; and cause a transmission of the signal within a cellular network to include the UE using the RF interface. |
US11950104B2 |
Method and device for adjusting automatic retransmission, base station, and user equipment
Provided are a method and apparatus for adjusting automatic retransmission. The method includes detecting uplink retransmission service information of at least two target user equipments (UEs), where after listen before talk (LBT) detection performed on a grant-free uplink transmission resource in an unlicensed spectrum fails, the at least two target UEs are capable of sharing a same original retransmission alternative resource to perform automatic uplink retransmission; determining whether the original retransmission alternative resource is overloaded according to the uplink retransmission service information; adjusting related configuration information of retransmission alternative resource to obtain adjusted retransmission configuration information in response to determining that the original retransmission alternative resource is overloaded; and delivering the adjusted retransmission configuration information to the at least two target UEs. |
US11950103B2 |
Communication control device, method of controlling communication, and communication system
A communication control device (40) includes: an acquisition unit (441) that acquires a spectrum grant request following a certain scheme from a plurality of second radio systems that perform a wireless communication using a radio wave of a frequency band used by a first radio system; a classification unit (442) that groups the second radio systems into a plurality of groups according to a scheme of the spectrum grant request; and a calculation unit (443) that calculates a communication parameter of the second radio system for each of the groups. |
US11950102B2 |
Method for beam management in unlicensed band, terminal device, and network device
Embodiments of the present disclosure provide a method for beam management in an unlicensed band, a terminal device, and a network device. The method includes: receiving, by a terminal device, a reference signal resource from a network device; measuring, by the terminal device, the reference signal resource in the unlicensed band, to obtain a beam measurement result; and sending, by the terminal device using an uplink resource for transmitting a beam report, the beam report comprising the beam measurement result. |
US11950100B2 |
Method for determining a jitter attack, jitter attack detecting device, and computer program
A method to determine a jitter attack on authorization system granting permission using a resource comprising: receiving at least three subcarrier signals from an authentication device, determining a relative phase deviation from an expected relative phase behavior for the at least three subcarrier signals, and concluding on a jitter attack if the relative phase deviation fulfills a predetermined criterion. |
US11950096B2 |
Using a client device for providing extra level of security for critical parameters
Aspects of the present disclosure are drawn to client device for use with a network controller and an external server, the network controller being configured to manage a wireless network, to change a critical parameter of the wireless network, to transmit a request for a one time password (OTP). The external server being configured to generate the OTP in response to the request for the OTP, to provide a notification of the OTP and to transmit the OTP to the network controller. The network controller being configured to additionally receive the OTP from the external server. The client device including a memory having a data structure stored therein, the data structure including a list of configurable critical parameters of the wireless network, and including a processor configured to execute instructions stored on the memory to cause the client device to receive a request to configure a configurable parameter of the wireless network. The client device also determines whether the configurable parameter of the wireless network matches a configurable critical parameter of the wireless network within the list of configurable critical parameters of the wireless network. The client device further transmits, when the configurable parameter of the wireless network matches a configurable critical parameter of the wireless network within the list of configurable critical parameters of the wireless network, the request for the OTP. The client device may also receive the notification of the OTP from the external server and access the OTP based on the notification and may transmit the OTP to the network controller. |
US11950095B2 |
Communication apparatus and method for controlling the same
A communication apparatus automatically starts operating in a direct wireless communication mode in conjunction with a user's logging in to the communication apparatus. |
US11950094B2 |
Customer communication system
A system for automatic authentication of service requests includes authentication of a remote access device. This authentication may be accomplished automatically prior to text or audio communication between a customer and a service agent. In some embodiments, authentication is accomplished automatically by authentication of the remote access device or accomplished by asking the customer questions. A single authentication of the remote access device may be used to authenticate a service request transferred between service agents. The authentication of the remote device may include, for example, use of a personal identification number, a fingerprint, a photograph, and/or a hardware identifier. |
US11950092B2 |
Location of a mobile device with 5G wireless access using SUPL
Techniques described herein provide means by which cell information indicative of a location of a UE may be conveyed to a location server over a 5G NR data connection using a SUPL message with an LTE cell ID data field. In some embodiments, for example, the UE may include the Cell ID of a LTE neighbor cell or information regarding a 5G NR serving cell, such as a portion of the 5G NR Cell ID or a reserved value or sequence identifying the 5G NR serving cell. The techniques may be applicable to the Secure User Plane Location (SUPL) solution defined by OMA and may enable a UE and a SUPL Location Platform (SLP) to support location of the UE using a version of SUPL without explicit support of 5G NR wireless access. |
US11950090B2 |
In-car adaptive sound quality output method, device, storage medium and car audio system
The application relates to a sound quality output method. The method includes: obtaining the current volume level input by the user; determine the audio signal gain difference between the current volume level and the baseline volume level according to the current volume level and the preset baseline volume level, determining an equal loudness curve difference between the current volume level and the baseline volume level according to the audio signal gain difference, and the current volume level and the baseline volume level, determining the audio quality response curve corresponding to the current volume level according to the equal loudness curve difference and the pre-stored audio quality response curve corresponding to the baseline volume level, determining the output signal parameters of multiple audio output channels according to the audio quality response curve corresponding to the current volume level. The application optimizes the sound quality effect and enhances acoustic experience. |
US11950083B2 |
Head tracking correlated motion detection for spatial audio applications
Embodiments are disclosed for head tracking state detection based on correlated motion of a source device and a headset communicatively coupled to the source device. In an embodiment, a method comprises: obtaining, using one or more processors of a source device, source device motion data from a source device and headset motion data from a headset; determining, using the one or more processors, correlation measures using the source device motion data and the headset motion data; updating, using the one or more processors, a motion tracking state based on the determined correlation measures; and initiating head pose tracking in accordance with the updated motion tracking state. |
US11950082B2 |
Method and apparatus for audio processing
An apparatus and method of loudspeaker equalization. The method combines default tunings (generated based on a default listening environment) and room tunings (generated based on an end user listening environment) to result in combined tunings that account for differences between the end user listening environment and the default listening environment. |
US11950079B2 |
Delay estimation method and apparatus
A delay estimation method includes determining a cross-correlation coefficient of a multi-channel signal of a current frame, determining a delay track estimation value of the current frame based on buffered inter-channel time difference information of at least one past frame, determining an adaptive window function of the current frame, performing weighting on the cross-correlation coefficient based on the delay track estimation value of the current frame and the adaptive window function of the current frame, to obtain a weighted cross-correlation coefficient, and determining an inter-channel time difference of the current frame based on the weighted cross-correlation coefficient. |
US11950073B2 |
Coaxial speaker
The present invention provides a coaxial speaker, which includes a frame, a vibration system and a magnetic circuit system. The magnetic circuit system includes a magnetic conduction assembly and a magnet assembly. The magnetic conduction assembly includes a first magnetic conduction plate, an inner side wall and an outer side wall, and a second magnetic conduction plate fixed on the side of the inner side wall. The magnet assembly includes a first magnet that forms a first magnetic gap and a second magnet that forms a second magnetic gap, a first vibration assembly and a second vibration assembly. The present invention is provided with high internal space integration, high magnetic circuit utilization, and meets the requirements of the full frequency domain. |
US11950071B2 |
Acoustic device
The present invention provides an acoustic device including a frame, a vibration system and a magnetic system. The vibration system includes a diaphragm, a voice coil assembly, and a support assembly. The support assembly includes a flexible circuit board and a support membrane. The flexible circuit board includes a first fixing end secured to the frame, a second fixing end secured to the voice coil assembly, a connecting portion, and a soldering pad. The voice coil assembly includes a first voice coil and a second voice coil. The first voice coil includes a first leading wire. The first leading wire has a first extension part extending from a surface of the first voice coil, a second extension part bending and extending from the first extension part along an outer surface of the second voice coil, and a soldering part welding to the soldering pad. |
US11950070B2 |
Sound production device
A sound production device includes a substrate having a cavity and a plurality of cantilever diaphragms fixed on the substrate. Each of the plurality of the cantilever diaphragms includes a fixed end fixed on the substrate and a free end extending from the fixed end to a position suspended above the cavity. The free end includes a first surface and a second surface oppositely arranged. The free end and the substrate or other free ends are spaced to form a gap. The sound production device further includes a first dielectric elastomer actuator, a second dielectric elastomer actuator, and a flexible connector. The sound production device of the present disclosures adopts dielectric elastomer actuators on both of the upper and lower sides of the cantilever diaphragms to together act on the cantilever diaphragms, thereby improving the linearity of the sound production device. |
US11950066B2 |
TWS earphone interaction method and system using residual slots
The present disclosure provides a TWS earphone interaction method and system, and TWS earphones. When a main earphone and a secondary earphone receive a data packet sent by an audio source, within a residual slot of a data transmission slot, the main earphone and the secondary earphone can perform data interaction, wherein the residual slot is the remaining data transmission slot after the data packet is transmitted. When a data packet is received, the main earphone sends acknowledgment information to the audio source, within a residual slot of a next data transmission slot, the main earphone and the secondary earphone can perform data interaction, wherein the residual slot is the remaining of the next data transmission slot after the acknowledgment information is sent. |
US11950065B2 |
Speaker system
A full-range speaker is driven by an original sound signal output from a sound source. A vibration detection unit detects vibration of the full-range speaker and outputs a playback signal. A subtractor outputs an error signal indicating the difference between the original sound signal and the play back signal. The error signal is amplified by the amplifier to drive the woofer which increases the sound pressure level in the low frequency range by outputting a sound in the same phase as the sound of the full range speaker if the sound pressure level of the full range speaker is insufficient, or in the opposite phase as the sound of the full range speaker if the sound pressure level is excessive. If the sound pressure level is excessive, the sound pressure level is reduced by outputting a sound in phase with the sound of the full range speaker. |
US11950064B2 |
Method for audio rendering by an apparatus
A method for audio rendering by an apparatus comprising at least one audio rendering device, the method comprising: extracting (S10) a plurality of frequency band components from an input audio signal; determining (S15) from the device frequency response and the plurality of extracted frequency band components at least one indicator representative of masking frequencies energy, masking frequencies corresponding to frequency bands that are above a frequency threshold; determining at least one correction factor (S16) from the indicator representative of masking frequencies energy; e) for each frequency band, determining a second acoustic level threshold (S20) by modifying (S17) with the correction factor a predetermined first acoustic level threshold associated with said frequency band, and determining a reduction gain from a comparison (S30) between an acoustic level of the extracted frequency band and the second acoustic level threshold associated to said extracted frequency band, and applying (S40) the reduction gain. |
US11950060B2 |
Hearing device
The present disclosure concerns a hearing device (10) with improved sealing and providing easy exchange of for example covers and/or filters and/or sealings in/on the hearing device. |
US11950059B2 |
Antenna structure for hearing devices
A hearing device includes an enclosure comprising a shell and a faceplate and is configured for at least partial insertion within an ear of a user. An antenna structure of the hearing device is oriented such that a direction of an electric field (E-field) of a propagating electromagnetic signal generated by the antenna structure is directed non-tangentially with respect to the user at the location of the user's ear. The antenna structure includes an antenna disposed in or on the faceplate and a ground plane at least partially supported by the faceplate. A battery and electronic circuitry are disposed within the shell. The electronic circuitry is powered by the battery and is electrically coupled to send and/or receive signals via the antenna structure. |
US11950056B2 |
Method, apparatus and system for neural network hearing aid
The disclosure generally relates to a method, system and apparatus to improve a user's understanding of speech in real-time conversations by processing the audio through a neural network contained in a hearing device. The hearing device may be a headphone or hearing aid. In one embodiment, the disclosure relates to an apparatus to enhance incoming audio signal. The apparatus includes a controller to receive an incoming signal and provide a controller output signal; a neural network engine (NNE) circuitry in communication with the controller, the NNE circuitry activatable by the controller, the NNE circuitry configured to generate an NNE output signal from the controller output signal; and a digital signal processing (DSP) circuitry to receive one or more of controller output signal or the NNE circuitry output signal to thereby generate a processed signal; wherein the controller determines a processing path of the controller output signal through one of the DSP or the NNE circuitries as a function of one or more of predefined parameters, incoming signal characteristics and NNE circuitry feedback. |
US11950053B2 |
MEMS chip
The present invention discloses a MEMS chip including a substrate with a back cavity; a capacitance system disposed on the substrate including a back plate, a membrane opposite to the back plate forming an inner cavity; a protruding portion accommodated in the inner cavity, fixed on one of the back plate and the membrane and spaced apart from the other along a vibration direction; a support system configured to support the capacitance system, including a first fixation portion suspending the membrane on the substrate, and a second fixation portion suspending the back plate on the substrate; the protruding portion comprises an annular first protruding portion and an annular second protruding portion surrounding the first protruding portion. The MEMS chip has higher sensitivity, higher resonance frequency and higher low frequency property. |
US11950052B2 |
Acoustic transducer with gap-controlling geometry and method of manufacturing an acoustic transducer
A transducer of the preferred embodiment including a transducer and a plurality of adjacent, tapered cantilevered beams. Each of the beams define a beam base, a beam tip, and a beam body disposed between the beam base and the beam tip. The beams are arranged such that each of the beam tips extends toward a common area. Each beam is joined to the substrate along the beam base and is free from the substrate along the beam body. A preferred method of manufacturing a transducer can include: depositing alternating layers of piezoelectric and electrode onto the substrate in block, processing the deposited layers to define cantilever geometry in block, depositing metal traces in block, and releasing the cantilevered beams from the substrate in block. |
US11950051B2 |
Piezoelectric speaker
A piezoelectric speaker (10) includes: a piezoelectric film (35); a fixing face (17) for fixing the piezoelectric film (35) to a support; and an interposed layer (40) disposed between the piezoelectric film (35) and the fixing face (17). The interposed layer (40) has a holding degree of 5×108 N/m3 or less. |
US11950049B2 |
Acoustic reflector, speaker unit, and chair
An acoustic reflector includes a reflection portion on which an elliptical reflection surface is formed, in which sound output from a speaker device that has an output position of the sound at or near one focal point on the elliptical reflection surface is reflected by the elliptical reflection surface, and the reflection portion has a size that reflects sound in a range of equal to or less than a nominal directional angle of the speaker device. As a result, because an outer shape of the reflection portion is formed to have a size in the range corresponding to the nominal directional angle of the speaker device, it is possible to reduce the size of the acoustic reflector. |
US11950048B2 |
Sound absorption material, method of making the same and speaker box filled with the same
The present invention discloses a sound absorption material including an organic frame material; a binder; a thickener; and a plurality of sound absorption grains attached to the organic frame material via the binder, having a grain size in a range of 10-100 μm. The stability and the sound absorption performance of the sound absorption material have been effectively improved. |
US11950047B2 |
Loudspeaker
A loudspeaker for producing sound at bass frequencies including: a diaphragm; a frame, wherein a proximal end of the diaphragm is suspended from the frame by at least one proximal suspension element, wherein the at least one proximal suspension element is configured to substantially prevent translational movement of the proximal end of the diaphragm relative to the frame, whilst permitting translational movement of a distal end of the diaphragm which is opposite to the proximal end of the diaphragm; a drive unit configured to move the distal end of the diaphragm based on an electrical signal. |
US11950039B2 |
Ringed-shaped biometric earpiece
A wearable device includes a ring-shaped housing having a central opening and defining an annular interior volume. The housing is configured to be worn within an ear of a subject such that the subjects ear canal is exposed by the central opening. At least one optical emitter and at least one optical detector are supported within the housing. The housing includes at least one window through which light can be delivered from the at least one optical emitter to the ear, and through which light from the ear can be delivered to the at least one optical detector. |
US11950037B2 |
External microphone combined with a heating system
A surface vehicle includes a microphone detecting sounds originating outside of the surface vehicle. A heating element is mounted in association with the microphone and provides heat for preventing accumulation of ice near the microphone wherein the ice accumulation would degrade an ability of the microphone to detect sounds originating outside of the surface vehicle. |
US11950036B2 |
Speaker assembly
An electronic device can include a housing defining an aperture and a display positioned in the aperture. The display and the housing can define an internal volume in which a speaker assembly is positioned. The speaker assembly can include a speaker module and a speaker enclosure in fluid communication, with the speaker enclosure at least partially defining a speaker volume. |
US11950035B2 |
Sound generating apparatus for vehicles and vehicle including the same
A sound generating apparatus for vehicles may include a sound generating device to be covered by a vehicle interior material of a vehicle. The sound generating device may be configured to vibrate the vehicle interior material. A vehicle including the sound generating apparatus for vehicles may include a vehicle interior material, covering a vehicle structure, and at least one sound generating apparatus disposed at the vehicle interior material. The vehicle interior material may vibrate according to a vibration of the sound generating apparatus to output a sound. |
US11950030B2 |
Electronic apparatus and method of controlling the same, and recording medium
An electronic apparatus enables a user to suitably select sound to be collected in connection with moving image capturing. The electronic apparatus is communicable with a plurality of sound collection devices, and includes a display control unit that displays, for each of the plurality of sound collection devices, a display item corresponding to the each sound collection device, based on positional information for the respective each sound collection device, acquired by a position acquisition unit, and displays, with the plurality of displayed display items, an image acquired by an image acquisition unit, wherein the display control unit displays, for the each sound collection device, the corresponding display item, even if the display item corresponds to a sound collection device not located within a range of image capturing of the acquired image, and a control unit associates and records the acquired image and sound information in a recording device. |
US11950027B2 |
Interactive projection system and operation method thereof
An interactive projection system including a projector and a touch interactive light source device is provided. The projector includes a projection optical engine, a camera module, and a control module. The touch interactive light source device includes at least one infrared light source module and a wireless signal transmission module. The control module is electrically connected to the projection optical engine and the camera module, and controls the touch interactive light source device through the wireless signal transmission module, so that the touch interactive light source device is placed in a recommended installation position and the interactive projection system is in an interactive mode. An operation method of the interactive projection system is also provided. |
US11950026B2 |
Methods and apparatus employing angular and spatial modulation of light
A light projection system including a light source and a light controller to generate modulatable beams of light and an angular light modulator (ALM) positioned to selectively direct the light from each beam. The light controller can be a spatial light modulator or a processor programmed to control light output. The angular light modulator may be a digital micromirror device (DMD). The ALM may be configured to direct the images into diffraction orders or using scanning the images. A LIDAR system to detect a position of an object including a first source of a two-dimensional array of beams of light and ALM to project light into a selected one of a plurality of directions. An illumination system, comprising a first angular-spatial light modulator (ASLM) and a second ASLM system configured such a first beam and a second beam of light intersect. |
US11950023B2 |
Intelligent automobile networking system
An intelligent automobile networking system, which includes a cloud server, a dash camera installed on a vehicle communicatively coupled to the cloud server for recording the video and position information related to the driving of the vehicle, an IP camera installed on a place exclude the dash camera and the cloud server to record surveillance images of that place, and a mobile device is communicatively coupled to the cloud server, the dash cam and the IP camera, wherein, two-way information between the vehicle and the field installed with the IP camera can be received, shared and commonly managed, and the system App is cross-platform installed on the cloud server, the mobile terminal and the dash camera. |
US11950010B2 |
Imaging apparatus and imaging system
This technology relates to an imaging apparatus and an imaging system for improving the accuracy of distance measurement performed by use of SPADs.The imaging apparatus includes a pixel array section having pixel sections arrayed therein. Each pixel section includes: an SPAD (single photon avalanche photodiode); a resistance component configured to be connected serially with the SPAD; an output section configured to output a light reception signal indicating photon incidence on the SPAD; and a pulse generation section configured to output a pulse signal in synchronism with the output of the light reception signal. Each pixel sections further includes at least one of: a switch configured to be connected interposingly between the SPAD and the resistance component and turned off in synchronism with the pulse signal; or a pull-in section configured to pull in an input current flowing through the SPAD via the resistance component in synchronism with the pulse signal, thereby suppressing the input current flowing through the SPAD. This technology may be applied to cameras that capture range images, for example. |
US11950009B2 |
Solid-state image sensor
In a solid-state image sensor that compares an amount of change in light amount and a threshold, time required to adjust the threshold is shortened.The solid-state image sensor includes a voltage comparison unit and a count unit. In the solid-state image sensor, the voltage comparison unit compares an analog signal according to an amount of change in incident light with a predetermined voltage indicating a boundary of a predetermined voltage range, and outputs a comparison result as a voltage comparison result. Furthermore, in the solid-state image sensor, the count unit counts a count value every time the voltage comparison result indicating that the analog signal falls outside the voltage range is output. |
US11950006B2 |
White balance and fixed pattern noise frame calibration using distal cap
The disclosure extends to methods, systems, and computer program products for producing an image in light deficient environments and correction of white balance and/or fixed pattern noise at startup or at any other time during a procedure. |
US11950005B2 |
Solid-state imaging device and imaging apparatus
A solid-state imaging device includes: a photoelectric conversion element that is disposed on a semiconductor substrate and generates signal charges by photoelectric conversion; a first diffusion layer that holds signal charges transferred from the photoelectric conversion element; a capacitive element that holds signal charges overflowing from the photoelectric conversion element; an amplifier transistor that outputs a signal according to the signal charges in the first diffusion layer; a first contact that is connected to the first diffusion layer; a second contact that is connected to a gate of the amplifier transistor; and a first wire that connects the first contact and the second contact. A shortest distance between the semiconductor substrate and the first wire is less than a shortest distance between the semiconductor substrate and the capacitive element. |
US11950002B2 |
Analog resolution adjustment for CMOS image sensor
Analog power savings is achieved by pre-charging only those pixels of a sensor array that are needed as determined responsive to any one of a power configuration, image size, image position of interest, desired/selected frame rate, desired/selected resolution, etc. To that end, the solution presented herein selects one or more sensor segments, each comprising a subset of pixels of the sensor array, and only pre-charges the pixels in the selected segment(s). In so doing, the solution presented herein provides a power savings proportional to the number of uncharged pixel circuits. |
US11949999B2 |
Systems and methods for gate-based vehicle image capture
A gate-based vehicle image capture system for analyzing vehicle image data is presented. The system may include a portable imaging gate apparatus configured to capture vehicle image data of a vehicle. The portable imaging gate apparatus may include a plurality of imaging assemblies positioned at a plurality of viewing angles. The system may further include an external processing server configured to receive the vehicle image data from the portable imaging gate apparatus. The external processing server may also analyze the vehicle image data to identify a plurality of vehicle features, and determine a first vehicle feature from the plurality of vehicle features. The first vehicle feature may be related to a vehicle incident. The system may also include a provider server configured to receive the first vehicle feature from the external processing server, and update an aspect of a risk evaluation based on the first vehicle feature. |
US11949998B2 |
Photographic paddle and process of use thereof
A photographic paddle and process of use thereof are provided. The photographic paddle is used for photographing interior or close-up vehicle exterior region features of a subject vehicle, and to rapidly produce high-quality images that are reflection-free and glare-free. The photographic paddle has the ability to produce wide-angle high-quality images and stereoscopic three-dimensional images that are reflection-free and glare-free. The photographic paddle has additional utility to photograph interior and close-up vehicle exterior region features of a subject vehicle in-situ in a densely arranged inventory lot without having to move the vehicle to and from a staging area. The photographic paddle has further utility as a versatile process that is able to rapidly adapt to changing photographic conditions as the photographic paddle moves relative to vehicle features to be photographed, ensuring capture and production of high-quality, reflection-free, and glare-free images without having to set the camera prior to each image capture. |
US11949993B2 |
Electric device, controlling method of controlling electric device, and computer readable storage medium
An electric device according to the embodiments of the present disclosure includes a camera module that takes a photograph of a subject to acquire a first camera image, and takes a photograph of the subject to acquire a second camera image with a wider angle of view than the first camera image; an image signal processor that controls the camera module to acquire a camera image; and a display module that displays an image. |
US11949992B2 |
UAV panoramic imaging
A method includes in response to receiving an instruction for starting a panoramic mode, controlling an unmanned aerial vehicle (UAV) to hover at or near a predetermined location; while the UAV is hovering at or near the predetermined location, causing an image capturing device to capture a plurality of images by controlling a carrier that couples the image capturing device to the UAV to rotate the image capturing device about a first axis of the carrier; and stabilizing the image capturing device against motions with respect to a second axis or a third axis of the carrier while the image capturing device is rotating about the first axis of the carrier. |
US11949991B2 |
Panoramic image capture for multispectral sensor
An image capture device may include a first spectral filter and a second spectral filter arranged so that a panoramic image capture operation captures light filtered by the first spectral filter and light filtered by the second spectral filter in a same region of a combined image and one or more processors to: capture a plurality of images based on the panoramic image capture operation; extract first information and second information from the plurality of images, wherein the first information is associated with the first spectral filter and the second information is associated with the second spectral filter; identify an association between the first information and the second information based on a feature captured in the plurality of images via the first spectral filter and the second spectral filter; and store or provide information based on the association between the first information and the second information. |
US11949990B2 |
Scale-down capture preview for a panorama capture user interface
This document describes apparatuses and techniques enabling a scale down capture preview for a panorama capture user interface. This scale down preview enables users to more-easily and more-accurately capture images for a panorama. |
US11949989B2 |
Multiple camera imager for inspection of large diameter pipes, chambers or tunnels
One embodiment provides a system, including: an inspection platform configured to move through underground infrastructure; an imaging device coupled to the inspection platform; the imaging device comprising a camera housing that arranges an array of four or more cameras in a predetermined configuration; the camera housing comprising a plurality of apertures, wherein each aperture houses a respective camera therein with a viewing axis offset about 30 degrees to about 120 degrees from a viewing axis of an adjacent camera within the array; and circuitry that operates the imaging device to capture a plurality of images using the four or more cameras; where the circuitry captures the plurality of images for a composite image of an interior region of the underground infrastructure, and where the region is larger than a single viewing field of any of the four or more cameras. Other embodiments are described and claimed. |
US11949988B2 |
Camera actuator including a dummy member and camera module including same
Disclosed in an embodiment of the present invention is a camera actuator including a housing, a mover disposed in the housing and including an optical member, a tilting guide unit disposed between the housing and the mover, a driving unit which is disposed in the housing and drives the mover, and an elastic member disposed between the tilting guide unit and the housing, wherein the driving unit includes a first magnet disposed on a first side surface of the mover and a dummy member disposed on a second side surface of the mover facing the first side surface. |
US11949986B2 |
Anti-shake method, anti-shake apparatus, and electronic device
The present application discloses an anti-shake method, an anti-shake apparatus, and an electronic device. The method includes: acquiring, in a case that a camera of an electronic device captures a first picture in real time, a shaking parameter of the electronic device; and cropping a first region in the first picture according to a first cropping parameter corresponding to the shaking parameter, and displaying the cropped first picture, where the first picture includes the first region and a second region, the second region is a common region of the first picture and N frames of pictures, the N frames of pictures are pictures captured before the first picture is captured, and N is an integer greater than or equal to 1. |
US11949983B2 |
Transmission and confirmation of camera configuration data and commands through a network
Systems and methods for transferring data between a server and a system of cameras. One embodiment provides a low-power radio frequency (“RF”) network for a system of cameras. The network comprises a server configured to access information related to the system of cameras, wherein the server receives a signal indicating a user input, and a first camera of the system of camera. The first camera is configured to receive a status report from a second camera of the system of cameras, update a cache of the first camera based on the status report from the second camera of the system of cameras, and transmit the updated cache of the first camera to the server. |
US11949981B2 |
Display device, method for controlling display device, and non-transitory computer readable medium for reducing power consumption relating to image display
A display device according to one embodiment of the present disclosure acquires time series images; processes the acquired images; performs control so that a processed image is displayed on a display; detects a closed state of an eyelid of a user; and starts power saving processing to reduce power consumption of the image processing or the displaying, in response to the detection of the closed state of the eyelid, and instructs restart of processing that was being performed before the power saving processing, in the image processing or the displaying, at a timing when a specific time has elapsed from the detection of the closed state of the eyelid. |
US11949977B2 |
Electronic equipment, method for controlling the same, and recording medium
Electronic equipment includes an obtaining unit configured to obtain a third image in which a first image captured via a first optical system and a second image captured via a second optical system are arranged side by side, the second image having parallax with the first image and a setting unit configured to set, in the third image, a target area to which predetermined processing is to be applied, based on a user operation. The setting unit is configured to set the target area in such a manner that the item indicating the target area includes either one of the first image and the second image. |
US11949976B2 |
Systems and methods for obtaining a smart panoramic image
Mobile handheld electronic devices such as smartphones, comprising a Wide camera for capturing Wide images with respective Wide fields of view (FOVW), a Tele camera for capturing Tele images with respective Tele fields of view (FOVT) smaller than FOVW, and a processor configured to stitch a plurality of Wide images into a panorama image with a field of view FOVP>FOVW and to pin a Tele image to a given location within the panorama image to obtain a smart panorama image. |
US11949966B2 |
Processing method, apparatus, medium and device for track data in multimedia resource
A computer device receives a signaling file corresponding to a multimedia resource. The signaling file includes descriptors corresponding to a plurality of track data of the multimedia resource, respectively. Dependency identifiers included in the descriptors correspond to the main bitstream track data pointing to descriptors corresponding to the library picture track data. The computer device parses the signaling file and determines a dependency relationship between the main bitstream track data and the library picture track data according to the dependency identifiers. The computer device sequentially acquires the library picture track data and the main bitstream track data from a data source side according to the dependency relationship. |
US11949963B2 |
Methods and systems for transmitting highlights of sporting events to communication devices
A highlight transmission service allows users of communication devices to view highlights of sporting events while the sporting events are occurring without having to watch the sporting events. For example, a computer-implemented method may comprise: determining that a highlight of a sporting event is to be conveyed to a communication device; and transmitting data regarding the highlight of the sporting event to the communication device over a network during the sporting event in order to allow a user of the communication device to view the highlight of the sporting event. |
US11949962B2 |
Method and computer system using proxy IP addresses and PII in measuring ad effectiveness across devices
A profile provider: (i) associates a primary online device (OD1) with a set-top box (STB); (ii) a location of OD1 at some point in time is estimated to be “near” the STB, thereby establishing a STB proxy location; (iii) one or more secondary online devices (OD2s) are observed to be located “near” the STB proxy location and are associated with the STB; and (iv) a television advertisement is selected to be directed to the STB, which selection is based at least in part on profile information linked to one of the associated OD2s. The method can be particularly advantageous in situations wherein: the STB is not connected to any computer network; the STB is not ever connected to the same local area network as OD1 or OD2; or television service (used by the STB) and online access (used by OD1 and OD2s) are provided by different service providers. |
US11949956B2 |
Methods and systems for generating notifications based on the interests of guests
Methods and systems are provided herein for generating notifications based on the interests of guests. Guests may request notifications on their host's television, and the system will generate notifications based on the guest's interests and preferences as stored in the guest's user profile. In doing so, the guest will be notified of events of interest, such as when a favorite sports team scores a point or when an important scene in a favorite movie is playing. The system monitors the network of the apartment or house and detects when a guest device is accessing the network. The system then accesses the guest's interests and identifies a set of programs based on these interests. The system then monitors these programs and generates notifications on the display device when an event of interest has occurred in one of the identified programs. |
US11949954B2 |
Methods and apparatuses for a modular and extensible advertisement request
Aspects of the subject disclosure may include, for example, transmitting a first request that includes a key, wherein the key identifies: a processing system that is a targeted recipient of an advertisement, a stream in which a primary content item is being provisioned to the processing system, and a service provider, based at least in part on the transmitting of the first request, obtaining information pertaining to an advertisement from a device of the service provider, and inserting the information within a portion of the stream corresponding to a break in the primary content item. Other embodiments are disclosed. |
US11949952B2 |
Display apparatus, information terminal and information processing method
A television receiver 101 is connected to two or more wireless terminals via a communication line. A controller 214 and a network I/F 212 in the television receiver 101 send pieces of login information entered from the two or more wireless terminals to the content distribution server and obtain pieces of content list information each generated by the content distribution server based on the pieces of login information. An aggregated content list in which the obtained pieces of content list information are aggregated is generated. The display 210 displays the aggregated content list. The content list information includes content available for viewing on the information terminal connected to the communication line. The aggregated content list includes content available for viewing on the two or more information terminals in which the pieces of content list information are aggregated. |
US11949950B2 |
Electronic device and control method therefor
An electronic device and a control method therefor are provided. The electronic device includes controller, multimedia playing apparatus and input apparatus both connected to the controller, the controller includes processor and memory, wherein program instructions stored in the memory are executed by the processor to perform operations including: in response to target operation of user, obtaining input information of user; determining session information on session in which user participates according to the input information, the session information including at least target content in which user participates; determining target playing progress and target playing speed factor for the target content; controlling the multimedia playing apparatus to play the target content according to the target playing progress and the target playing speed factor, the target playing speed factor being greater than 1. |
US11949949B2 |
Content generation based on audience engagement
Various implementations disclosed herein include devices, systems, and methods for performing content generation based on audience engagement. In some implementations, a method includes presenting a first portion of content. Engagement data is obtained for an audience comprising a plurality of persons while the first portion of the content is presented. Based on the engagement data, a collective engagement level of the audience is determined for the first portion of the content. A second portion of the content that has not been presented is adjusted based on the collective engagement level of the audience for the first portion of the content in order to satisfy an engagement threshold. After adjusting the second portion of the content, the second portion of the content is presented to the audience. |
US11949948B2 |
Playback control based on image capture
An electronic device is provided for control of playback based on image capture. The electronic device includes circuitry. The circuitry is communicatively coupled to an imaging apparatus and a rendering device that plays content. The circuitry acquires, from the imaging apparatus, one or more images of a user of the electronic device and a physical space associated with the user. The circuitry detects a lip movement of the user based on the acquired one or more images. The circuitry determines whether the user is in a conversation based on the detected lip movement of the user. The circuitry controls playback of the content on the rendering device based on the determination. |
US11949945B2 |
Dynamic creation of low latency video streams in a live event
A method for creating a low latency DASH (LL-DASH) video stream from a Low latency HLS video stream (LL-HLS) is provided. The LL-HLS video stream corresponding to a live event is retrieved. The LL-HLS video stream is converted to a LL-DASH video stream. This conversion of the LL-DASH stream from the LL-HLS stream provides reformatting without encoding of the LL-DASH stream. |
US11949944B2 |
Methods, systems, articles of manufacture, and apparatus to identify media using screen capture
Methods, apparatus, systems, and articles of manufacture are disclosed that utilize screen capture to identify media. Example meter devices disclosed herein are to, in response to determining a media device is powered on, monitor a media device to detect audio output by the media device. Disclosed example meter devices are also to, in response to audio not being detected for a period of time, instruct an image capture device to capture image data representative of a media presentation by the media device. Disclosed example meter devices are also to instruct the image capture device to stop capturing the image data in response to detection of audio output by the media device. Disclosed example meter devices are also to determine, based on whether the image data corresponds to a menu presentation by the media device, whether to transmit the image data to a central facility for media identification. |
US11949943B2 |
Gaze-responsive advertisement
This disclosure provides a system by which content/service providers can enable gaze-responsive advertisement/targeted content mechanisms for CPE devices like STB's/OTT streaming devices or systems or display devices. The system creates a new opportunity for content/service providers to advertise and helps in generating revenue. The system leverages using gaze-based technology in CPE devices like STB's or large display devices. A gaze-based algorithm helps the CPE devices to locate the viewer point of attention, using which gaze-responsive advertisement/content targeting can be achieved. The disclosure provides an end to end solution—from content creation to content consumption for gaze-responsive advertisement/media delivery. |
US11949942B2 |
Display device
According to an embodiment, a display device includes a display, a network interface configured to communicate with an external server, and a controller configured to capture audio content during playback of Audio/Video (A/V) content, acquire a first content identifier based on the captured audio content, display a first pop-up window corresponding to the acquired first content identifier on the display, when a mute interval is continued for a predetermined time, capture video content, acquire a second content identifier based on captured video content, and, when the acquired second content identifier is not identical to the first content identifier, display a second pop-up window corresponding to the second content identifier on the display. |
US11949941B2 |
Dynamic context-based video streaming overlay generation
Disclosed are some implementations of systems, apparatus, methods and computer program products for customizing and dynamically generating overlay graphical user interfaces (GUIs) within the context of a video streaming environment. |
US11949939B2 |
Non-volatile memory system and method for storing and transferring set top box system data
A nonvolatile memory is coupled to a processor in a set top box. On the timing sequence set within the system, set top box data is transferred from the processor to the nonvolatile memory. Set top box system data includes user data and set top box specific data. The current data is maintained in the nonvolatile memory. The system data can be transferred to second memory by a wireless connection even when the set top box is not coupled to a power supply. The system data can then be provided from the second memory to any selected device, computer or location, such as another set top box, a diagnostic tool, a repair facility or other selected location. |
US11949938B2 |
Techniques for authorizing controller devices
Embodiments of the present disclosure present devices, methods, and computer readable medium for enabling controller device to control proprietary digital media players, network accessories, and virtual assistants, providing an overall improved user experience. The techniques disclosed herein reduce clutter because a single controller can control various different devices and accessories. The techniques discloses also can include identifying a change in the configuration information for the computing device. The technique for accessory control can include transmitting updated configuration information for the controller, the configuration information associating a function for the computing device with a user interface element value for the controller. |
US11949935B2 |
Methods and apparatus for network-based monitoring and serving of media to in-vehicle occupants
Example methods, apparatus, systems, and articles of manufacture are disclosed for network-based monitoring and serving of media to in-vehicle occupants. An example method includes linking panelist data corresponding to media exposure to first telemetry data collected by a vehicle to create linked panelist-telemetry data; and training a neural network to estimate vehicle occupant demographics based on second telemetry data using a first subgroup of the linked panelist-telemetry data. |
US11949933B2 |
Systems and methods for managing access to content assets
Delay in output of a requested content asset by a user device may be reduced by sending a portion of the content asset to the user device in a particular type of format, such as an unsecured format. The unsecured portion of the content asset may be sent to the user device while a license for the content asset is being processed. The size of the unsecured portion of the content asset may be determined based on a time for the user device to receive the license. The time for the user device to receive the license may be determined based on a time to process the license. After sending the license to the user device, another portion of the content asset may be sent to the user device in a secured format. The user device may use the license to access the secured portion of the content asset. |
US11949928B2 |
Video loading method and device
The present disclosure provides techniques of preloading video data. The techniques comprises acquiring a video to be played; acquiring information indicative of historical behaviors of users who watched the video; segmenting the video into a plurality of video segments; determining a historical search rate corresponding to each of the plurality of video segments based on the information indicative of the historical behaviors of the users; and determining a video segment among the plurality of video segments as a first target video segment based on the historical search rate corresponding to each of the plurality of video segments, wherein the video segment has a historical search rate greater than or equal to a preset probability threshold; and preloading the first target video segment of the video. |
US11949922B2 |
Simulating a local experience by live streaming sharable viewpoints of a live event
A system interconnects multiple client devices over a network. A local group of the client devices is located at a live event and a remote group is located remote from the live event. Each client device of the local group is a potential source of a live stream which, when rendered by another client device, causes display of a vantage point of the live event. The system dynamically updates a subscription list to include an indication of any client device of the local group that is actively live streaming and remove an indication of any client device of the local group that terminated live streaming. The system can enable selective access to any live streams of any client device of the updated subscription list and disable access to any live streams of any client device removed from the updated subscription list. |
US11949915B2 |
Encoding and decoding a sequence of pictures
An apparatus for decoding a sequence of pictures from a data stream is configured for decoding a picture of the sequence by: deriving a residual transform signal of the picture from the data stream; combining the residual transform signal with a buffered transform signal of a previous picture of the sequence so as to obtain a transform signal of the picture, the transform signal representing the picture in spectral components; and subjecting the transform signal to a spectral-to-spatial transformation, wherein the buffered transform signal comprises a selection out of spectral components representing the previous picture. |
US11949914B2 |
Image decoding apparatus and image coding apparatus
An image decoding apparatus including a header decoder configured to decode, from coded data, a flag indicating whether dependent quantization is enabled and a flag prohibiting transform skip residual quantization, and a TU decoder configured to decode a transform coefficient in a TU block in an RRC mode in which a LAST position is coded, the LAST position corresponding to a decoding start position for the transform coefficient, or a TSRC mode in which the LAST position is not coded. The TU decoder performs dependent quantization in the RRC mode in a case that the transform coefficient for transform skip is decoded in the TSRC mode, and does not perform dependent quantization in the RRC mode in a case that the transform coefficient for transform skip is decoded in the RRC mode. |
US11949913B2 |
Method and apparatus of encoding/decoding image data based on tree structure-based block division
Disclosed are methods and apparatuses for image data encoding/decoding. A method of decoding an image includes receiving a bitstream in which the image is encoded; obtaining index information for specifying a block division type of a current block in the image; and determining the block division type of the current block from a candidate group pre-defined in the decoding apparatus. The candidate group includes a plurality of candidate division types, including at least one of a non-division, a first quad-division, a second quad-division, a binary-division or a triple-division. The method also includes dividing the current block into a plurality of sub-blocks; and decoding each of the sub-blocks with reference to syntax information obtained from the bitstream. |
US11949909B2 |
Global motion estimation using road and ground object labels for geometry-based point cloud compression
An example device for coding point cloud data includes a memory configured to store data representing points of a point cloud, and one or more processors implemented in circuitry and configured to: determine height values of points in a point cloud; classify the points into a set of ground points or a set of object points according to the height values; and code the ground points and the object points according to the classifications. The one or more processors may determine top and bottom thresholds and classify the ground and object points according to the top and bottom thresholds. The one or more processors may further code a data structure, such as a geometry parameter set (GPS), including data representing the top and bottom thresholds. |
US11949904B2 |
Image processing method based on inter prediction mode, and device therefor
In the present disclosure, a method of decoding a video signal and a device therefor are disclosed. Specifically, a method of decoding an image based on an inter prediction mode includes deriving a motion vector of an available spatial neighboring block around a current block; deriving a collocated block of the current block based on the motion vector of the spatial neighboring block; deriving a motion vector in a sub-block unit in the current block based on a motion vector of the collocated block; and generating a prediction block of the current block using the motion vector derived in the sub-block unit, wherein the collocated block may be specified by the motion vector of the spatial neighboring block in one pre-defined reference picture. |
US11949902B2 |
Method and apparatus for video coding
A method for video decoding in a decoder is provided. Coding information of a current block (CB) from a coded video bitstream is decoded. The coding information includes weighted prediction information that indicates a weighted prediction for the CB. A determination is made as to whether to apply a prediction refinement with optical flow (PROF) on the CB based on the weighted prediction information. The CB is reconstructed based on the weighted prediction and whether the PROF is determined to be applied on the CB. |
US11949893B2 |
Sub-picture level indicator signaling in video coding
A video coding mechanism is disclosed. The mechanism includes receiving a bitstream comprising one or more sub-pictures partitioned from a picture and a sub-picture level indicator indicating resource requirements for decoding a current sub-picture. The bitstream is parsed to obtain the sub-picture level indicator and the current sub-picture. Resources are allocated to decode the current sub-picture based on the sub-picture level indicator. The current sub-picture is decoded to create a video sequence by employing the allocated resources. The video sequence is forwarded for display. |
US11949888B2 |
Block partitioning methods for video coding
The present disclosure provides systems and methods for processing video content. The method can include: partitioning, along a partitioning edge, a plurality of blocks associated with a picture into a first partition and a second partition; performing inter prediction on the plurality of blocks, to generate a first prediction signal for the first partition and a second prediction signal for the second partition; and blending the first and second prediction signals for edge blocks associated with the partitioning edge. |
US11949887B2 |
Transmission apparatus, transmission method, and program
A transmission apparatus, a transmission method, and a program that can reduce the number of times that useless transmission of image data is performed due to a failure in reception of image data indicating a reference destination. A transmission failure likelihood data management section checks the likelihood of a failure in transmission of first image data. Second image is an image rendered in a frame buffer for the first time after a timing when a predetermined time has elapsed since the transmission of the first image data. An encoding processing section controls whether or not to generate second image data requiring no reference destination, depending on the likelihood of the failure in the transmission of the first image data at a timing of encoding the second image. |
US11949886B2 |
Methods for determining prediction value, encoder, and decoder
Methods for determining a prediction value, an encoder, and a decoder are provided. Reconstructed values of neighboring samples of a current block are acquired, and then filtered to obtain a reference value set of the current block. When a size of the current block is smaller than a preset threshold value, a first constant value is calculated according to a bit depth value of a luma component of a sample in the current block. A difference between the first constant value and a first reference value in the reference value set is determined as a first prediction input value in a prediction input value set. Other prediction input values in the prediction input value set other than the first prediction input value are determined according to the reference value set. Prediction values of samples at specific positions in the current block is calculated and then filtered. |
US11949884B2 |
Encoder, decoder, encoding method, and decoding method
An encoder encodes a video, and includes: circuitry; and memory coupled to the circuitry. Using the memory, the circuitry: obtains at least two items of prediction information for a first partition included in the video; derives at least one template from neighboring samples which neighbor the first partition; calculates at least two costs, using the at least one template and the at least two items of prediction information; using the at least two costs, (i) determines at least one splitting direction for the first partition or (ii) assigns one of the at least two items of prediction information to a second partition split from the first partition according to the splitting direction, and another thereof to a third partition split from the first partition according to the splitting direction; and encodes the first partition according to the splitting direction and the at least two items of prediction information. |
US11949882B2 |
Image data encoding and decoding
An image encoding apparatus comprises a selector configured to select, from a set of candidate prediction operations each defining at least a prediction direction, a prediction operation for prediction of samples of a current region of a current image, the current region comprising an array of two or more rows and two or more columns of samples; an intra-image predictor configured to derive predicted samples of the current region with respect to one or more of a group of reference samples of the same image in dependence upon a prediction direction, defined by the selected prediction operation, between a current sample to be predicted and a reference position amongst the reference samples; in which, for at least some of the candidate prediction operations, the group of reference samples comprises two or more parallel linear arrays of reference samples disposed at different respective separations from the current region; a detector configured to detect whether samples corresponding to any of the two or more parallel linear arrays of reference samples are unavailable for use in prediction of samples of the current region and, if any of the two or more parallel linear arrays of reference samples are unavailable, to inhibit selection, by the selector, of a candidate prediction operation dependent upon the unavailable reference samples. |
US11949881B2 |
Apparatus for encoding and decoding image using adaptive DCT coefficient scanning based on pixel similarity and method therefor
The present invention discloses an encoding apparatus using a Discrete Cosine Transform (DCT) scanning, which includes a mode selection means for selecting an optimal mode for intra prediction; an intra prediction means for performing intra prediction onto video inputted based on the mode selected in the mode selection means; a DCT and quantization means for performing DCT and quantization onto residual coefficients of a block outputted from the intra prediction means; and an entropy encoding means for performing entropy encoding onto DCT coefficients acquired from the DCT and quantization by using a scanning mode decided based on pixel similarity of the residual coefficients. |
US11949879B2 |
Video coding method and apparatus, computer device, and storage medium
This application relates to a video coding method and apparatus, a computer device, and a storage medium. The method includes: obtaining a current coding unit; obtaining target pixel gradient data through calculation according to a pixel value of a pixel in the current coding unit, the target pixel gradient data being obtained according to a difference between the pixel value of the pixel and a reference pixel value; determining a target division decision result corresponding to the current coding unit according to the target pixel gradient data; and performing video coding on the current coding unit according to the target division decision result. |
US11949876B2 |
Method and system for embedding information in a video signal
A method for embedding information in a video signal is described. The method comprises receiving (305) a message (30) including the information; dividing (310) the message (30) in a first message part (132) and a second message part (134); acquiring (320) a first video frame (9) and a second video frame (10) from the video signal, wherein the second video frame (10) is temporally subsequent to the first video frame (9), and the video frames (9, 10) each include a pre-set number of pixels; and determining (330) a motion map (122) associated with the second video frame (10), wherein the motion map (122) indicates a movement of each of the pixels of in the second video frame (10) compared to the first video frame (9). The method further comprises embedding (360) the first message part (132) in the pixels of the second video frame (10) including weighting the first message part (132) for each pixel of the second video frame (10) based on the motion map (122); and embedding (365) the second message part (134) in the pixels of the second video frame (10) including weighting the second message part (134) for each pixel of the second video frame (10) based on an inverse of the motion map (122). Furthermore, a graphical encoder (100) and a system (1) are described, which are configured to perform such method. |
US11949871B2 |
Architecture flexible binary arithmetic coding system
In the subject architecture flexible binary arithmetic coding system, coding circuitry of an electronic device may receive video data that is to be coded (e.g., to be encoded or decoded) by binary arithmetic coding. The coding circuitry may also compute at least one of a least probable symbol (LPS) range or a most probable symbol (MPS) range based on a multiplication operation (e.g., without performing a table look-up operation). The coding circuitry may perform binary arithmetic coding on the video data using the at least one of the LPS range or the MPS range. The computation of the LPS range and/or the MPS range using the multiplication operation may have a lower computational cost than using a table look-up operation. |
US11949870B2 |
Context modeling for low-frequency non-separable transformation signaling for video coding
An example method includes determining a color component of a unit of video data; determining, based at least on the color component, a context for context-adaptive binary arithmetic coding (CABAC) a syntax element that specifies a value of a low-frequency non-separable transform (LFNST) index for the unit of video data; CABAC decoding, based on the determined context and via a syntax structure for the unit of video data, the syntax element that specifies the value of the LFNST index for the unit of video data; and inverse-transforming, based on a transform indicated by the value of the LFNST index, transform coefficients of the unit of video data. |
US11949868B2 |
Method and device for selecting context model of quantization coefficient end flag bit
Embodiments of the present disclosure provide a method and device for selecting a context model of a quantized coefficient end flag. The method comprises: obtaining a scanning position POS of a non-zero coefficient corresponding to current quantized coefficient end flag in a specific scanning order; wherein the scanning position POS is a subscript of the non-zero coefficient in the scanning order; configuring a first context model array, and using a fixed value as the base to calculate the logarithmic value of the value of the scanning position POS plus 1, and according to the logarithmic value, selecting a first context model from the first context model array; and using the first context model to encode or decode a binary symbol of the current quantized coefficient end flag. According to the technical solution of the present application, it is able to improve encoding and decoding efficiency for a quantized coefficient end flag, thereby further improve the efficiency of video encoding and decoding. |
US11949867B2 |
Image encoding apparatus, image decoding apparatus, control methods and non-transitory computer-readable storage medium
An image decoding apparatus comprises a decoder which decodes data indicating a plurality of values corresponding to a part of a quantization matrix; a generator which derives the plurality of values from the data and generates the matrix; and an inverse quantizing unit which performs the inverse quantizing on an object block using the matrix, wherein, if width or height of the matrix is larger than or equal to a predetermined size, the generating unit generates the matrix by associating a first value among the plurality of values with a first element corresponding to DC component in the matrix, associating a second value with a second element adjacent to the first element, and, for the elements other than the first and second elements, associating each of one or more values with a plurality of elements of the matrix. |
US11949866B2 |
High-level syntax control on implicit transform
In a method of video decoding at a video decoder, a coded video bitstream is received. The coded video bitstream includes a first high level syntax (HLS) element indicating whether a second HLS element is included in the coded video bitstream. The second HLS element indicates whether explicit multiple transform selection (MTS) for intra coding is enabled. Whether an implicit MTS is enabled for a current block is determined responsive to (i) the first HLS element indicating that the second HLS element is included in the coded video bitstream, (ii) the second HLS element indicating that the explicit MTS for intra coding is disabled, and (iii) a prediction mode of the current block is an intra prediction mode. Further, the current block is reconstructed based on whether the implicit MTS is enabled. |
US11949865B2 |
Image encoding/decoding method using pixel value range constituting image
An image encoding/decoding method using a pixel value range constituting an image is disclosed, wherein the image decoding method using a pixel value range constituting an image comprises the steps of: receiving a bitstream; acquiring information of a pixel value range forming a first unit image included in the received bitstream; and decoding the first unit image on the basis of the acquired information of the pixel value range. Therefore, compression efficiency can be improved in an image encoding or decoding process. |
US11949864B2 |
Video coding method and device, video decoding method and device
Provided are an encoding method and apparatus, and a decoding method and apparatus for adaptively selecting a context model used to entropy-encode and entropy-decode a syntax element, based on various shapes of coding units. The image decoding method includes: determining a context model based on block shape information including at least one of a shape, direction, width, ratio of width and height, or size of a coding unit; obtaining, from a bitstream based on the context model, information about a split shape mode for splitting the coding unit; and determining a split shape mode of the coding unit, based on the information about the split shape mode. |
US11949856B2 |
Intra mode selection in intra prediction
A method of controlling intra prediction for decoding or encoding of a video sequence, is performed by at least one processor and includes obtaining intra prediction modes including directional modes respectively corresponding to angular prediction directions, a first amount of one or more of the directional modes being excluded from the intra prediction modes based on a second amount of the intra prediction modes and a third amount of most probable modes (MPMs). The method further includes selecting, as the MPMs, two or more of the intra prediction modes from which the one or more of the directional modes are excluded, and selecting, for decoding the video sequence, one of the intra prediction modes from which the one or more of the directional modes are excluded. |
US11949854B2 |
Method and apparatus for video coding
Aspects of the disclosure provide methods and apparatuses for video encoding/decoding. In some examples, an apparatus for video decoding includes processing circuitry. The processing circuitry decodes prediction information of a current block in a current picture from a coded video bitstream. The prediction information is indicative of a prediction mode that combines an intra prediction and an inter prediction. The intra prediction is based on at least a first reference sample in the current picture, and the inter prediction is based on at least a second reference sample in a reference picture of the current picture. Further, the processing circuitry determines coding tools associated with the prediction mode that combines the intra prediction and the inter prediction and reconstruct at least a sample of the current block according to the determined coding tools associated with the prediction mode. |
US11949852B2 |
Method and apparatus of residual coding selection for lossless coding mode in video coding
A method and apparatus of video coding, where according to one method, input data related to a current block in a current picture are received at a video encoder side or compressed data comprising the current block are received at a video decoder side. A first syntax at a high level in a video bitstream regarding residual coding type is signaled at the encoder side or parsed at the decoder side. A target coding mode is determined for the current block based on information comprising a value of the first syntax. The current block is encoded at the encoder side or decoded at the decoder side according to the target coding mode. The high level may correspond to a slice header or a picture header. |
US11949846B1 |
Image data encoding/decoding method and apparatus
Disclosed are methods and apparatuses for decoding an image. A method includes receiving a bitstream obtained by encoding the image; dividing a first coding block into a plurality of second coding blocks; generating a prediction block of a second coding block based on syntax information obtained from the bitstream; and reconstructing the second coding block based on the prediction block and a residual block of the second coding block, the residual block being obtained by performing a dequantization and an inverse-transform on quantized transform coefficients from the bitstream. The first coding block has a recursive division structure. The first coding block is divided based on at least one of a quad tree division, a binary tree division or a triple tree division. |
US11949845B2 |
Dynamic visual overlay for enhanced terrain perception on remote control construction equipment
During operation of a machine, an understanding of terrain features is critical. Accordingly, disclosed embodiments augment a video stream, captured by a camera mounted on the machine, with terrain information. In particular, an overlay is generated on at least one image frame. The overlay, which may comprise one or more semi-transparent bands, may cyclically recede from a foreground to a background of the image frame(s), cyclically advance from a background to a foreground of the image frame(s), or cyclically move horizontally across the image frame(s). The overlay may be colorized to illustrate the height of the terrain underneath the overlay. |
US11949842B2 |
Color management system, information processing apparatus, and storage medium
In a color management system including a server and an image forming apparatus, the server stores information of a colorimetric sensor and paper information corresponding to the colorimetric sensor, obtains information of a colorimetric sensor mounted in the image forming apparatus, designates paper to use when executing a color adjustment process of the image forming apparatus, and, based on the stored paper information, selects a colorimetric sensor of the image forming apparatus corresponding to the designated paper. The image forming apparatus comprises causes a printer engine to print a chart on the designated paper in accordance with a color adjustment job for executing the color adjustment process, and measures a colorimetric value of the printed chart using the selected colorimetric sensor. |
US11949837B2 |
Management apparatus and image reading system
A management apparatus that realizes transmission of scanned data, which is generated by each of a plurality of image readers including a first image reader and a second image reader, in accordance with address information associated with the image reader, the management apparatus including a storage that stores a plurality of pieces of address information including first address information associated with the first image reader and second address information associated with the second image reader, a receiver configured to receive a duplication instruction that duplicates the first address information as the second address information, and a setting section that causes the storage to store the first address information stored in the storage as the second address information in accordance with the duplication instruction. |
US11949830B2 |
Printing apparatus capable of counting the number of times of printing, method for controlling printing apparatus, and storage medium
If the printing protocol associated with a received print job is not an internet printing protocol, the number of times of printing is counted for each type of printing protocol. If the printing protocol associated with a received print job is an internet printing protocol, the number of times of printing is counted while distinguishing a transmission source application by identifying a transmission source application. |
US11949828B2 |
Information processing apparatus, information processing system, and non-transitory computer readable medium for performing preprocessing and character recognition to acquire item and value of image
An information processing apparatus includes a processor configured to acquire, from a read image, a predetermined item, and a value corresponding to the item, the read image being obtained by reading a document and being subjected, prior to acquisition of the item and the value, to preprocessing and character recognition. Further, the processor is configured to, in response to not successfully acquiring at least one of the item and the value, change a setting on the preprocessing or a setting on the character recognition in accordance with the acquisition or non-acquisition state of the item and the value, and then perform the preprocessing or the character recognition. In response to not successfully acquiring at least one of the item and the value, the processor is further configured to identify where the item and the value are located. |
US11949826B2 |
Image reading device and image forming apparatus incorporating same
An image reading device includes a sensor and circuitry. The sensor reads an image on a recording medium. The circuitry inspects the image and outputs an inspection result. The circuitry excludes an area of the recording medium as a first area from an area to be inspected, based on a type of the recording medium or a position of the recording medium with respect to a reading position at which the sensor reads the image, to determine a second area to be inspected. The circuitry outputs the inspection result based on the second area. |
US11949824B2 |
Image forming apparatus and method for notifying detection of virus
Provided is an image forming apparatus including a display, an authenticator, an image former, a detector, and one or more controllers. The authenticator authenticates a user's login to the image forming apparatus. The image former forms an image based on a job for which an execution instruction has been inputted by the user. The detector performs virus detection at execution of the job. The one or more controllers control display of notification information that notifies a detection of a virus. The one or more controllers control the display of the notification information depending on the user's login status on the image forming apparatus at the time of the detection of a virus. |
US11949823B2 |
Apparatus, system, and method for analog to digital film conversion
Provided for is a film conversion apparatus comprising a body and a first reel shaft having a first proximal end and a first distal end. A first reel may be disposed on the first distal end. The apparatus may include a second reel shaft having a second proximal end and a second distal end, where the first proximal end and the second proximal end are movably attached to the body. A second reel may be disposed on the second distal end. The apparatus may further include a camera configured to capture a plurality of frames and a computer configured to convert the plurality of frames to a digital format. |
US11949813B2 |
Providing enhanced call content based on call number association
One example may include receiving a call, identifying whether a calling party number and a called party number associated with the call have a pre-existing relationship stored in a database, responsive to identifying the pre-existing relationship, modifying a call message header of a call message to include a code object identifying enhanced call content, and forwarding the modified call message to an intended recipient device of the call. |
US11949804B2 |
Voice communication network defense system
Voice communication network defense security which allows for managing and/or preventing voice calls based on which telecommunication carrier provided the calling number. By managing calls based on telecommunication carrier as opposed to the calling number, the present invention seeks to prevent intrusion by wrongdoers who may otherwise be in possession with an unlimited supply of calling numbers. Further, by implementing the security measures at the voice communication network perimeter, voice calls can be managed and/or prevented/block in real-time while the call is in a pre-answer state. As a result, the present invention provides the capability to prevent/block wrongdoers from accessing the intra-voice communication network or, at a minimum ensures that potential wrongdoers are properly vetted through an investigative process. |
US11949802B1 |
Blockchain-based platform system for interworking with one machine-to-machine(oneM2M) and lightweight machine-to-machine (LWM2M), and method of implementing blockchain-based platform
A blockchain-based platform system for interworking with one machine-to-machine (oneM2M) and lightweight machine-to-machine (LWM2M) and a method of implementing a blockchain-based platform are provided. The blockchain-based platform system for interworking with oneM2M and LWM2M includes a hyperledger fabric network configured to validate chaincode called in association with a first client application and generate an event in association with the validated chaincode, and a fabric bridge gateway configured to perform interworking with an LWM2M protocol and a oneM2M platform by transmitting a request or a response corresponding to the event to a second client application. |
US11949799B2 |
I/O circuit design for SRAM-based PUF generators
Disclosed is an input/output circuit for a physical unclonable function generator circuit. In one embodiment, a physical unclonable function (PUF) generator includes: a PUF cell array comprising a plurality of bit cells configured in a plurality of columns and at least one row, and at least one input/output (I/O) circuit each coupled to at least two neighboring columns of the PUF cell array, wherein the at least one I/O circuit each comprises a sense amplifier (SA) with no cross-coupled pair of transistors, wherein the SA comprises two cross-coupled inverters with no access transistor and a SA enable transistor, and wherein the at least one I/O circuit each is configured to access and determine logical states of at least two bit cells in the at least two neighboring columns; and based on the determined logical states of the plurality of bit cells, to generate a PUF signature. |
US11949796B1 |
Secure digital communications
Disclosed in some examples are methods, systems, and machine readable mediums for secure end-to-end digital communications involving mobile wallets. The result is direct, secure, in-band messaging using mobile wallets that may be used to send messages such as payments, requests for money, financial information, or messages to authorize a debit or credit. |
US11949785B1 |
Biometric authenticated biometric enrollment
An example method includes receiving an encrypted biometric enrollment data and user identifier data. The encrypted biometric enrollment data includes at least one biometric enrollment sample from a user encrypted using an encryption key. The encryption key is generated based on a user secret and the user identifier is associated with the user. The user identifier is matched with a stored user secret. A decryption key is generated based on the stored user secret. The encrypted biometric enrollment data is decrypted using the decryption key. The at least one biometric enrollment sample is retrieved from the decrypted biometric enrollment data. The at least one biometric enrollment sample is processed using a biometric processing algorithm to generate a biometric reference template. A biometric reference template identifier uniquely identifying the biometric reference template is generated. An encryption key is generated based on the stored user secret and encrypts an enrollment confirmation message. |
US11949782B1 |
Systems and methods for post-quantum cryptography communications channels
Systems, apparatuses, methods, and computer program products are disclosed for PQC. An example method includes transmitting a first portion of an electronic communication to a client device over a non-PQC communications channel, wherein the client device comprises a PQC shim circuitry. The example method further includes transmitting one or more communications between a PQC callback circuitry and the client device over a PQC communications channel, wherein the client device is a non-PQC device. The example method further includes transmitting a second portion of the electronic communication to the client device over a PQC communications channel. |
US11949779B2 |
Method and apparatus for registering shared key
Provided is a method and apparatus for registering a shared key. A method of registering, by a second electronic device, a shared digital key in a target device includes receiving a digital key sharing attestation and a key tracking server (KTS) signature corresponding to the digital key sharing attestation, receiving an authentication request from the target device, and transmitting an authentication response including the digital key sharing attestation and the KTS signature to the target device in response to the authentication request. |
US11949776B2 |
Establishing a cryptographic tunnel between a first tunnel endpoint and a second tunnel endpoint where a private key used during the tunnel establishment is remotely located from the second tunnel endpoint
A responder device receives, from an initiator device, a request to initiate a cryptographic tunnel between the initiator device and the responder device. The responder device does not include a static private key to be used in an asymmetric cryptography algorithm when establishing the tunnel. The responder device transmits a request to a key server that has access to the static private key and receives a response that is based on at least a result of at least one cryptographic operation using the static private key. The responder device receives from the key server, or generates, a transport key(s) for the responder device to use for sending and receiving data on the cryptographic tunnel. The responder device transmits a response to the initiator device that includes information for the initiator device to generate a transport key(s) that it is to use for sending and receiving data on the cryptographic tunnel. |
US11949773B2 |
Systems and methods for secure key management using distributed ledger technology
The present disclosure is directed to systems and methods for securely managing and administering an encryption/decryption key using distributed ledger technology (DLT). In some examples, a client may possess a data attribute (or a dataset of data attributes). The client may receive tokenization parameters to apply to the data attribute to encrypt the data attribute. After tokenizing the data attribute, the client may then request the creation of an encryption key to be applied to the token. A third-party key management system (KMS) may create an encryption key and a salt. The salt may be applied to the token, and the salted token may then be encrypted. Additionally, a decryption key may be created and stored securely at the third-party KMS. The client may transmit the encrypted token to a third-party consolidation platform, wherein the consolidation platform requests access to the decryption key to unveil the underlying token. |
US11949771B2 |
Secure blockchain integrated circuit
An integrated circuit comprising a CPU coupled to a system bus, a network interface configured to interface with an external device, and a crypto neuromorphic core coupled to the system bus. The cryptographic core comprising a processor or core, an internal bus, and a non-transitory computer-readable memory, wherein the crypto neuromorphic core is isolated from the CPU and the network interface via the system bus and the crypto neuromorphic core runs its own operating system. The crypto neuromorphic core is configured to: contain a secure core comprising a secure processor and dedicated/protected memory; store a private key in the dedicated/protected memory accessible to the secure core but not accessible to other components of the crypto neuromorphic core, the central processing unit, and the network interface; add data to a blockchain using the private key via the network interface; and read data from the blockchain via the network interface. |
US11949768B2 |
Light-triggered transponder
A light-triggered transponder includes one or more of photo cells, a clock recovery circuit and a reverse antenna system. The clock recovery circuit (CRC) includes a photoconductor with a source terminal, a drain terminal for receiving a voltage, the photoconductor resistance varying with received light intensity. The CRC is configured to generate a recovered clock. A reverse antenna system connected to at least one photo cell and configured to transmit data. The photoconductor configured to produce a modulated voltage signal from an incident modulated light incident. The CRC can include an amplifier coupled to the source terminal of the photoconductor via a capacitor for receiving the modulated voltage signal and outputting an analog signal generated from the voltage signal. The CRC can include an inverter coupled to the amplifier and configured to digitize the analog signal of the amplifier. |
US11949767B2 |
Communication apparatus, method of controlling communication apparatus, and storage medium
A communication apparatus includes a first counter configured to synchronize with a reference time, a second counter configured to synchronize with the first counter, a generation unit configured to generate a synchronization signal each time when a value of the second counter is incremented by a predetermined number, a correction unit configured to correct the value of the second counter toward a value of the first counter, and a control unit configured to control the correction unit to cause the correction unit to calculate a difference between the value of the first counter and the value of the second counter and, in a case where the calculated difference is greater than a predetermined threshold value, the correction unit to correct the value of the second counter step by step. |
US11949766B2 |
Auto-negotiation method and apparatus
An interface obtains basic page information from another interface. The basic page information includes N bits, the N bits include an FEC function indicator bit sequence including an FEC ability indicator bit and an FEC requested indicator bit. The interface determines, based on values of a plurality of bits in the N bits, an operation mode supported by the another interface. The FEC function indicator bit sequence includes a first FEC function indicator bit corresponding to m FEC abilities; or the FEC function indicator bit sequence includes a first FEC ability indicator bit corresponding to n FEC abilities, where both m and n are greater than or equal to 1. Because one FEC function indicator bit indicates more FEC abilities, N bits in a basic page can carry more information, so that a process of increasing auto-negotiation pages is slowed down, thereby avoiding impact on auto-negotiation efficiency. |
US11949765B2 |
Systems and methods for data transmission based on a link layer packet structure
A device may be configured to generate data packets including a packet header and a payload. The packet header may include a value that signals whether the payload encapsulates input data according to a single short packet encapsulation, a single long packet encapsulation, a segmented encapsulation, or a concatenated encapsulation. |
US11949758B2 |
Detecting under-utilized features and providing training, instruction, or technical support in an observation platform
In a method of query derivation in an observation platform a signal from a first communication device is received at a second communication device that is associated with a computer system. The computer system is associated with an organization and a first characteristic of the signal corresponds to an audible source. The signal is parsed, by the computer system according to a policy, to determine metadata associated with the signal, wherein the first communication device is operated by a user and wherein the policy dictates rules for use of the metadata. The computer system determines a prior user history of the user. The computer system converts the audible source of the signal to text or machine understandable language. The computer system derives a query related to the organization based on at least one of the prior user history, the metadata, and the text or machine understandable language. |
US11949752B2 |
Mobile event notifications for network enabled objects
Disclosed is a mobile event streaming system that receives customer application lifecycle and user events including a message, event source and a destination then processes data for consumption by one or more customers, generating a secure data stream and sending the processed data over the generated data stream. An example system for receiving, processing, and delivering customer application lifecycle and user engagement data includes a server system having at least one processor, memory and a network interface where the memory stores program instructions for receiving, storing, processing and transmitting messages via the network interface. The mobile event streaming system may be a distributed content delivery service wherein the content delivered via the service is processed. Processing the data comprises the addition of metadata, one or more identifiers such as user, and event identifiers including predictions of future user engagement to enable real-time data consumption by customers. |
US11949751B2 |
Systems and methods for restricting electronic activities from being linked with record objects
The present disclosure relates to restricting electronic activities from being linked with record objects. According to at least one aspect of the disclosure, a method can include accessing, by one or more processors, a plurality of electronic activities, accessing a plurality of record objects of one or more systems of record, identifying an electronic activity of the plurality of electronic activities to match to one or more record objects, determining a data source provider associated with providing access to the electronic activity, and identifying a system of record corresponding to the determined data source provider. The system of record can include a plurality of candidate record objects to which to match the electronic activity. The method can include restricting the electronic activity from being linked with the at least one record object. |
US11949747B2 |
Apparatus, method and article to facilitate automatic detection and removal of fraudulent user information in a network environment
A fraud detection system may obtain a number of known fraudulent end-user profiles and/or otherwise undesirable end-user profiles. Using statistical analysis techniques that include clustering the end-user profiles by attributes and attribute values and/or combinations of attributes and attribute values, the fraud detection system identifies on a continuous, periodic, or aperiodic basis those attribute values and/or attribute value combinations that appear in fraudulent or otherwise undesirable end-user profiles. Using this data, the fraud detection system generates one or more queries to identify those end-user profiles having attribute values or combinations of attribute values that likely indicate a fraudulent or otherwise undesirable end-user profile. The fraud detection system can run these queries against incoming registrations to identify and screen fraudulent end-user profiles from entering the system and can also run these queries against stored end-user profile databases to identify and remove fraudulent or otherwise undesirable end-user profiles from the end-user database. |
US11949745B2 |
Collaboration design leveraging application server
Techniques are described for improving the efficiency of collaboration session synchronization between applications, particularly applications that consume heavy application data. In an embodiment, a computer-implemented method comprises employing, by an application server operatively coupled to a processor, a context management server to manage synchronization of usage context information between a first client device and one or more second client devices related to simultaneous usage of an application provided by the application server during a collaboration session established between the first client device and the one or more second client devices. The method further comprises managing, by the application server, synchronization and exchange of application data between the first client device and the one or more second client devices during the collaboration session without sharing the application data with the context management server. |
US11949744B2 |
Enhanced online privacy
Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, for enhancing online user privacy. Methods can include receiving tag information specifying a given publisher identifier for a publisher and a given client identifier assigned to a user of the client device by the publisher. A given service identifier assigned to the user by the service apparatus is obtained. A mapping between the given service identifier to the given client identifier is created. A list of client identifiers assigned to a set of users by the publisher is received. A list of matched service identifiers corresponding to the list of client identifiers are stored. Multiple content requests are received from multiple different client devices accessing services provided by the service apparatus. Responses to the content requests are based on whether the client devices provide service identifiers that are included in the list of matched service identifiers. |
US11949739B2 |
Methods, apparatuses, and computer program products for management of data deletion requests based on geographically distributed data
Systems, apparatuses, methods, and computer program products are provided for managing geographically distributed data storage in a group-based communication system and for servicing deletion requests related thereto. In some embodiments, an apparatus physically located in a first geographic area defined by a first geographic boundary is provided. In embodiments, upon determining that an entity identifier associated with a message is associated with a geographic data storage policy, the apparatus is configured to transmit a geographic data residency message package comprising message data of the message to a geographic data residency server physically located within a second geographic area defined by a second geographic boundary. The second geographic area is associated with the geographic data storage policy. In some embodiments, the apparatus is configured to update the message data of the message with residency token data received from the geographic data residency server. |
US11949737B1 |
Allocation of server resources in remote-access computing environments
The subject matter of this specification can be implemented in, among other things, a method and a system to perform the method that includes receiving a request from a client device to execute an application, selecting servers that provide remote desktop environment and host the requested application, determining, based on a priority level for a client session to be established, a capacity of system resources and a current utilization level of each server, that the client device is to be directed to a first server, the first server having an expected utilization level that satisfies a threshold condition, and directing the request to the first server to establish the client session and to execute the requested application as part of the client session. |
US11949730B2 |
Context-aware interface layer for remote applications
Various embodiments of the present application set forth a computer-implemented method comprising receiving, at an endpoint device, a user input associated with a first remote application running on a workstation instance associated with the user, determining, based on a context associated with the user input, a first asset associated with the user input, and causing the workstation instance to modify an asset file in a local file system of the workstation instance, wherein the asset file corresponds to at least a portion of the first asset. |
US11949728B2 |
System and method for optimizing virtual world computations through an N-tier architecture
Systems and methods for optimizing virtual world computations through an n-tier architecture including at least three tiers are provided. In a sample three-tier architecture, a first tier comprises a client software engine configured to receive input data, send the data to the second tier, and perform end-user processing. A second tier connects to the first tier and to a third tier through a network and comprises a client-dedicated module that is dynamically instantiated and which is configured to either prepare the received data for subsequent processing from the client software engine or send the received data to the third tier. The third tier comprises a virtual world processing module configured to receive and process data from the second tier, generating world state updates, and to dynamically instantiate the client-dedicated module to spawn client-dedicated instances. The world state updates are sent to corresponding client-dedicated module instances for further processing. |
US11949727B2 |
Organic conversations in a virtual group setting
A video conferencing system includes data relating to the focus of attention of an attendee in a virtual conference. The system determines the focus of attention of attendee as a function of the data and modifies an audio output and/or a video output of the system as a function of the focus of attention of the attendee. |
US11949725B2 |
Alarms for a system of smart media playback devices
One embodiment provides for a media playback device comprising a memory device to store instructions; one or more processors to execute the instructions stored on the memory device, the instructions to cause the one or more processors to provide a playback queue manager to manage one or more media playback queues including a set of media items associated with a scheduled event and a playback routing manager to determine an output destination for the set of media items based on context associated with the scheduled event, the playback routing manager to route output of playback of the set of media items to one or more of multiple different connected media playback devices based on the context associated with the scheduled event. |
US11949721B2 |
Communication devices and methods for operating a communication device
A communication device may include a message generator configured to generate a message in accordance with a command set to use a communication service provided by a communication session setup protocol; and a modem circuit coupled to the message generator and configured to operate in accordance with the message generated by the message generator; wherein the message generator is configured to generate the message comprising a command to at least one of control or establish an Internet Protocol Multimedia Subsystem service. |
US11949719B2 |
Systems and methods of information security monitoring with third-party indicators of compromise
An information security monitoring system can import indicators of compromise (IOC) definitions in disparate formats from third-party source systems, convert them into editable security definitions in an internal system format, and provide a user interface for composing or editing these security definitions with enhancements, including complex security definitions such as those having a nested Boolean structure and/or those that reference one or more security definitions, a behavioral rule, and/or a vulnerability description. One or more whitelists can be added to handle exceptions. Each composed or modified security definition is then compiled into an executable rule. The executable rule, when evaluated, produces a result indicative of an endpoint security action needed in view of an endpoint event that meets the composed or modified security definition. |
US11949716B2 |
System for secure channel selection for multi-factor authentication using non-fungible electronic resources
Systems, computer program products, and methods are described herein for secure channel selection for multi-factor authentication using non-fungible electronic resources. The present invention is configured to receive, from a user input device, a request from a user to access resources; determine a first authentication channel for verification of user identity; trigger an authentication channel validation engine to validate the first authentication channel; retrieve authentication channel information associated with the first authentication channel; determine that the user has a non-fungible token (NFT) for the first authentication channel; retrieve, from one or more metadata layers of the NFT, authentication channel descriptors associated with the first authentication channel; compare the authentication channel information with the authentication channel descriptors to determine a match; determine that the first authentication channel is valid based on at least the match; and initialize verification of the user identity via the first authentication channel. |
US11949714B2 |
Cross-site request forgery protection
Digital data processing systems of the type in which a server digital data device (“server”) is coupled to a client digital data device (“client”) over a network, e.g., the Internet, include web server software executing within an application layer on the server that responds to a request from the client by (i) validating a key received from the client with that request, (ii) generating a result code indicative of a success of that validation, (iii) initiating processing of the request, including invoking server resource software executing outside the application layer. The server resource software, which checks the result code upon invocation and before performing a protected operation required for processing the request, responds to a result code indicating that the result did not validate by exiting before executing the protected operation. |
US11949712B2 |
Monitoring of JavaScript object properties for detection of web browser security threats
Detection of a security threat to a web browser by: Wrapping a suspect JavaScript code with a detection JavaScript code, wherein, when the wrapped suspect JavaScript code is executed in a web browser, the detection JavaScript code indirectly monitors access to a property of a non-writable, non-configurable JavaScript property, to detect an attempt by the suspect JavaScript code to perform a malicious action in the web browser. Executing the wrapped suspect JavaScript code in the web browser, to effect the monitoring and the detection. |
US11949708B2 |
Systems and methods for accelerated remediations of cybersecurity alerts and cybersecurity events in a cybersecurity event detection and response platform
A system and method for accelerating a threat mitigation of malicious cybersecurity activity includes: identifying, via one or more processors, a cybersecurity event associated with a third-party application or a third-party service of a subscriber; generating, via the one or more processors, a service-proposed remediation action for the cybersecurity event based on the identifying of the cybersecurity event; automatically assessing, via the one or more processors, the service-proposed remediation action against automated remediation criteria of the subscriber based on the generation of the service-proposed remediation action; automatically constructing, via the one or more processors, a remediation action application programming interface (API) request for the service-proposed remediation action based on the service-proposed remediation action satisfying the automated remediation criteria of the subscriber; and automatically executing, via the one or more processors, the remediation action API request to remediation or mitigate a suspected cybersecurity threat associated with the cybersecurity event. |
US11949706B2 |
System and method for assigning threat valuations to network events and security events
A method including receiving a record in a first timeframe; establishing a plurality of threat vectors for the record; merging the plurality of threat vectors to the record; generating a risk valuation for the record based on the plurality of threat vectors; merging the risk valuation to the record to form a risk event; and storing the risk event in a computer-readable data store. |
US11949702B1 |
Analysis and mitigation of network security risks
A method comprises acquiring anomaly data including a plurality of anomalies detected from streaming data, wherein each of the anomalies relates to an entity on or associated with a computer network. The method determines a risk score of each of the anomalies, and adjusts the risk score of an anomaly according to a set of factors. The method further determines, for each of a plurality of sliding time windows of different lengths, an entity score of the entity in relation to the sliding time window, based on an aggregation of risk scores of all anomalies related to the entity that were detected within the sliding time window, where the entity score corresponds to a risk level associated with the entity. An action to prevent the entity from performing an operation can be determined and caused to occur based on the entity score. |
US11949693B2 |
User and group specific threat protection system and method
A method of managing access to a network destination. The method includes establishing a first network zone for a user, the first network zone including a plurality of network destinations. The first network zone is monitored and one or more changes in the first network zone are determined. A first network destination in the first network zone is analyzed responsive to determining the one or more changes in the first network zone to determine a first threat. An attempt by the user to access the first network destination is detected, and access by the user to the first network destination is restricted based on the determining the first threat. |
US11949691B2 |
Malicious peer identification
An example operation may include one or more of receiving, by each of one or more peripheral peers of a blockchain network, a new block from an orderer peer, calculating a hash of the new block, determining the calculated hash is different than hashes from a majority of peripheral peers, determining that one or more blocks that correspond to the different hashes from the majority of peripheral peers are different from the new block, and in response ceasing committing blocks to the blockchain network. |
US11949689B2 |
Unified authentication system for decentralized identity platforms
A unified authentication system for decentralized identity platforms is disclosed. In various embodiments, a request comprising one or more identity claims and a digital address is received. The digital address is used to verify, via a verification node associated with a digital address provider, the one or more identity claims. Access to a service is provided, in response to the request, based at least in part on a response from the verification node indicating the one or more identity claims have been verified. The verification node is configured to obtain consent, in real time, from a user with which the digital address is associated, prior to providing said response indicating the one or more identity claims have been verified. |
US11949688B2 |
Securing browser cookies
Methods, systems, and apparatus, including an apparatus for verifying the integrity of requests. In some aspects, a method includes receiving, from an application, a request including an attestation token of the application. The attestation token includes a set of data that includes at least a public key of the application and a token creation time that indicates a time at which the attestation token was created. The attestation also includes a signature of the set of data. The signature is generated using a private key that corresponds to the public key. The integrity of the request is verified using the attestation token. The verification includes determining that the integrity of the request is valid based on a determination that the token creation time is within a threshold duration of the time at which the request was received and a determination that the set of data has not been. |
US11949686B2 |
System for intrusion detection using resource activity analysis
Systems, computer program products, and methods are described herein for intrusion detection using resource activity analysis. The present invention is configured to receive, from a computing device of a user, an indication that the user has accessed a resource allocation portfolio of a customer; determine a geographic information of the user; retrieve a geographic information of the customer; determine that the geographic information of the user does not match the geographic information of the customer; determine an exposure level associated with the user access of the resource allocation portfolio of the customer; determine that the exposure level is greater than a predetermined threshold; and automatically trigger a transmission of a notification to a computing device of an administrator indicating that the exposure level associated with the user access of the resource allocation portfolio of the customer is greater than the predetermined threshold. |
US11949685B2 |
Application platform with flexible permissioning
Systems and methods are provided for an application platform with flexible permissioning. In one embodiment, an application platform with flexible permissioning comprises: a service provider server adapted to interact with an application development server and a client device over a network, the service provider server adapted to implement at least one application programming interface (API); one or more processors; and one or more memories adapted to store machine-readable instructions which when executed by the processors cause the application platform with flexible permissioning to: maintain a profile associated with at least one application developer using the application development server; receive an API call from the application developer; authenticate the application developer and authorize the API call; assign an access level to the application developer based on the profile associated with the application developer; and control permissions given to the application developer to perform operations available based on the assigned access level. |
US11949684B2 |
Security tool
A system includes a set of adapter interfaces, a router module, and a processor. Each adapter interface is assigned to a different level of security. The router module sends requests to the adapter interfaces, based on the security levels associated with the devices that submitted the requests. A first adapter interface establishes a first connection to the servers, providing access to a first zone. A second adapter interface establishes a second connection to the servers, providing access to a second zone. The first zone includes a set of resources assigned to the first level of security that is not included in the second zone. Each adapter interface further receives data and applies different levels of security to the data, based on the security levels associated with the devices that submitted the data. |
US11949683B2 |
Guest access to control devices
A method for granting guest access to a control device includes detecting, by a monitoring control unit, a new connection of a guest device to a network, transmitting, by the monitoring control unit and to an authorized device, a request to grant access to the guest device to control a monitoring system, in response to the request, receiving, by the monitoring control unit, approval to grant access to the guest device to control the monitoring system, and in response to the approval, transmitting, by the monitoring control unit and to the guest device, (i) data that allows the guest device to access a web service and (ii) a temporary authentication token. |
US11949679B1 |
Distinguishing between functional tracking domains and nonfunctional tracking domains on a host web page
Distinguishing between functional tracking domains and nonfunctional tracking domains on a host web page. In particular, a list of known tracking domains that load content into host web pages may be received. This list of tracking domains may include tracking domains that are functional and tracking domains that are nonfunctional. The tracking domains that are functional may be determined by evaluating various behaviors and characteristics of the tracking domains. Once functional tracking domains have been determined, these functional tracking domains may be allowed, and other tracking domains may be blocked from loading content onto host web pages thereby preserving the functionality of the web pages. |
US11949677B2 |
Resource access based on audio signal
A resource server system granting to users access to a resource based on the very fact that the users' computing systems can demonstrate that they heard an audio signal. Specifically, the resource server system detects receipt of a message from a client computing system, and interprets the message as representing that the client computing system heard an audio signal. In response, the resource server system grants a user of the client computing system access to the resource. This may be performed for multiple client computing systems that each demonstrate that they heard the audio signal. Thus, the principles described herein allow for the granting of access to resources to other computing systems within the audible proximity of a computing system that transmitted the audio signal. |
US11949673B1 |
Gesture authentication using a smart ring
Systems and methods for performing multi-factor authentication using a smart ring are disclosed. An exemplary method includes performing a first authentication operation by: collecting, by sensors, gestural data representing a candidate gesture corresponding to ring movement; comparing the candidate gesture to an authentication gesture for a known user; when the candidate gesture matches the authentication gesture, generating a first signal indicating that a particular user has been identified and authenticated as the known user; and transmitting the first signal to a second device, wherein the second device controls access to a resource. The method also includes performing a second authentication operation by detecting contact between the ring and an external component; and generating and transmitting a second signal in response to detecting the contact, and when the second device receives the first and the second signals, causing the second device to grant the particular user access to the resource. |
US11949668B2 |
Systems and methods for authenticating user devices
A method may include receiving, from a user device, a registration request that includes a subscription concealed identifier (SUCI), identifying a network element to decode the SUCI and forwarding the SUCI to the identified network element. The method may also include decoding the SUCI to identify a subscription permanent identifier (SUPI), identifying a unified data management (UDM) device associated with the SUPI and transmitting an authentication request to the identified UDM device to obtain authentication information associated with the user device. The method may further include receiving the authentication information and authenticating the user device based on the received authentication information. |
US11949666B2 |
Chromosomal identification
The present invention relates to a method, apparatus, and system for communication with a user's family members using the DNA of the user without making the DNA profile public. According to a first aspect, there is provided a computer implemented method of locating one or more members of a familial network, comprising the steps of: generating one or more encryption keys derived from a first genomic sequence; encrypting a message using the or each encryption key to form an encrypted message; sending the encrypted message to one or more remote devices wherein decrypting the encrypted message at the one or more remote devices uses one or more encryption keys derived from a second genomic sequence; and receiving a confirmation regarding whether the decryption of the encrypted message was successful by any of the one or more remote devices. |
US11949665B1 |
Providing anonymous network data to an artificial intelligence model for processing in near-real time
A device may receive, from a network device in near-real time, a packet of data associated with network traffic of a network, wherein the packet includes privacy-related data and network-related data. The device may read the privacy-related data from the packet. The device may generate anonymous data based on the privacy-related data, wherein the anonymous data obscures the privacy-related data. The device may generate a mapping between the anonymous data and the privacy-related data. The device may combine the anonymous data and the network-related data to generate a masked packet. The device may provide the masked packet to a server device. The device may receive, from the server device, data identifying a recommendation that is generated by processing the masked packet with an artificial intelligence model. The device may perform one or more actions based on the recommendation. |
US11949662B2 |
Virtual on-demand internet connectivity for management controllers
A method for virtual on-demand internet connectivity for management controllers is disclosed. The method includes starting, on a management controller of a computing device connected to a management network, a management session in response to a valid login request from an authorized system administrator computer. The method includes, after startup of the management session, establishing a proxy in a browser of a device with a connection to a public network. The proxy enables the management controller to send one or more internet requests through the proxy using the connection to the public network. The method includes providing information to the system administrator computer. The provided information includes information received by the management controller in response to the one or more internet requests. |
US11949660B2 |
Methods for enabling enhanced firewall rules via ARP-based annotations
In an embodiment, a computer-implemented method for enabling enhanced firewall rules via ARP-based annotations is described. In an embodiment, a method comprises detecting, by a hypervisor implemented in a first host, that a first process is executing on the first host. The hypervisor determines first context information for the first process, generates a first request, encapsulates the first request and the first context information in a first packet, and transmits the first packet to a central controller to cause the central controller to update the controller's table to indicate that the first process is executing on the first host. In response to receiving a second packet from the central controller and determining that the second packet comprises a first response, the hypervisor extracts second context information from the second packet and, based on the second context information, determines that a second process is executing on a second host. |
US11949658B2 |
Increased coverage of application-based traffic classification with local and cloud classification services
A cloud-based traffic classification engine maintains a catalog of application-based traffic classes which have been developed based on known applications, and a local traffic classification engine maintains a subset of these classes. Network traffic intercepted by the firewall which cannot be classified by the local engine is forwarded to the cloud-based engine for classification. Upon determination of a class of the traffic, the cloud-based engine forwards the determined class and corresponding signature to the local engine. The firewall maintains a cache which is updated with the signatures corresponding to the class communicated by the cloud-based engine. Subsequent network traffic sent from the application can be determined to correspond to the application and classified according locally at the firewall based on the cached signatures. Localization of the cache to the firewall reduces latency of traffic classification operations as the catalog of classification information stored in the cloud scales. |
US11949657B2 |
Autonomous alerting based on defined categorizations for network space and network boundary changes
Introduced here are Internet monitoring platforms configured to define, monitor, and assess the boundary of a private network associated with a client. By monitoring the entire Internet, a private network, and relationships between these networks, an Internet monitoring platform can discover changes in the boundary of the private network that is defined by those assets on the private network capable of interfacing with a public network, such as the Internet. The Internet monitoring platform may, in response to discovering the boundary of the private network has experienced a change, identify an appropriate remediation action by mapping the change to a technological issue, a relevant business relationship, etc. For example. If the Internet monitoring platform discovers that the boundary of the private network has expanded due to the introduction of a new cloud computing asset, the Internet monitoring platform may automatically reconfigure a network tool so that traffic generated by the new computing device is examined. |
US11949654B2 |
Distributed offload leveraging different offload devices
Techniques for distributed offload leveraging different offload devices are disclosed. In some embodiments, a system, process, and/or computer program product for distributed offload leveraging different offload devices includes receiving a flow at a firewall of a security service (e.g., a cloud-based security service); inspecting the flow at the firewall to determine meta information associated with the flow; and offloading the flow to an offload entity (e.g., a SmartNIC, software executed on a Network Interface Card (NIC), and/or a network device, such as a network router and/or network switch) based on the meta information associated with the flow (e.g., an application identification associated with the flow determined using deep packet inspection) and based on a policy. |
US11949650B2 |
System and method for improving network performance when using secure DNS access schemes
A system and method for improving network performance of DNS queries. The system includes a terminal which receives DNS queries from a customer premise equipment (CPE), and supplies matching DNS records in response to the queries. The terminal monitors all traffic from the CPE and generates a preload list containing domains and a time schedule at which name resolution should be requested for the domains. A DNS preload client in the CPE receives the preload list from the terminal, and submits preload DNS queries for name resolution of domains contained in the preload list at times specified in the time schedule. Preload records supplied in response to the preload DNS queries are stored by the CPE and used to resolve DNS queries from applications installed on the CPE. |
US11949644B2 |
Systems and methods for relaying messages in a communications system
The various embodiments described herein include methods, devices, and systems for relaying messages in a communications system. In one aspect, a method is performed at a server having one or more processors and memory storing instructions for execution by the one or more processors. The method includes: (1) obtaining a plurality of incoming messages; (2) identifying one or more messages from among the plurality of incoming messages, the one or more messages obtained from a first user; (3) receiving a feedback message from a second user about at least one of: the first user and a first message of the one or more messages; and (4) sending the feedback message from the second user to a plurality of users, where the plurality of users track at least one of: the first user and the first message. |
US11949643B2 |
Apparatus and method for displaying announcements from instant messaging services
An announcement display method according to an embodiment of the present disclosure is performed by a computing device, and includes displaying an intro screen including a friend account list of a user account, and fixedly displaying an announcement list at the top of the intro screen, wherein the announcement list comprises an announcement of at least one chat room to which the user account belongs. |
US11949638B1 |
Methods and systems for hyperchat conversations among large networked populations with collective intelligence amplification
The present disclosure describes systems and methods for enabling real-time conversational dialog among a large population of networked human users while facilitating convergence on groupwise decisions, insights, and solutions, and amplifying collective intelligence. A collaboration server running a collaboration application is provided, wherein the collaboration server is in communication with the plurality of the networked computing devices and each computing device is associated with one user of the population of human participants. In some cases, the collaboration server defines a plurality of sub-groups of the population of human participants. A local chat application configured for displaying a conversational prompt received from the collaboration server is provided on each networked computing device. The local chat application enables real-time chat communication with other users of a sub-group assigned by the collaboration server. According to some embodiments, the computer mediated collaboration enables through communication between the collaboration application and the local chat applications. |
US11949633B2 |
User equipment full duplex capability reporting as a function of transmission power
Certain aspects of the present disclosure provide techniques for a method for wireless communications by a user equipment (UE), comprising generating a report indicating a capability of the UE to perform full duplex (FD) communications dependent on transmission power level and transmitting the report to a network entity. |
US11949632B2 |
Selection of grant and CSI
Uplink resources for semi-persistent channel state information (SP-CSI) reports and other uplink transport block transmissions may be managed. If resources allocated to the SP-CSI reports overlap, in time, with resources allocated to the uplink transport block transmissions, a determination of whether to drop an SP-CSI report may be made. Various selection criteria may be used to make this determination. |
US11949631B2 |
Method and apparatus for radio link monitoring measurements in a system using bandwidth parts
When a downlink bandwidth part (BWP) is switched from a first BWP to a second BWP without a change of a cell defining synchronization signal block (SSB), if a reference signal type for Radio Link Monitoring (RLM) is set to an SSB type, a radio terminal (12) continues to use for RLM measurements a first SSB associated with the first BWP after switching of the downlink BWP to the second BWP. This for example enables the radio terminal to monitor a suitable Reference Signal (RS) for RLM measurements after switching of the DL active BWP. |
US11949628B1 |
Adaptive millimeter wave physical layer wireless architecture for on-body products
Technologies to improve wireless communications by on-body products are described. One device includes millimeter wave (mmWave) frequency front-end circuitry and a baseband processor with an Orthogonal Frequency Division Multiplexing (OFDM) physical (PHY) layer. The baseband processor determines received signal strength indicator (RSSI) value and phase value associated with a wireless channel in a mmWave frequency range. The baseband processor determines a state of motion of the device using the RSSI value and the phase value. The baseband processor sends data to the second device using a first subcarrier structure of the OFDM PHY layer, in response to the state of motion being a first state of motion. The baseband processor sends data to the second device using a second subcarrier structure of the OFDM physical layer, in response to the state motion being a second state of motion having more motion than the first state of motion. |
US11949619B2 |
Short physical downlink control channel (sPDCCH) mapping design
A method, network node and wireless device for receiving and/or mapping a physical downlink control channel, PDCCH, to resource elements of a time-frequency grid are provided in which the PDCCH is mapped to resource elements of the time-frequency grid by configuring resource element groups, REGs, each REG spanning one orthogonal frequency division multiplex, OFDM, symbol, and the PDCCH being at least two OFDM symbols. In accordance with one embodiment, the method includes receiving the PDCCH from the network node on one of a plurality of sets of physical resource blocks, PRBs. |
US11949618B2 |
Distortion probing reference signal configuration
Methods, systems, and devices for wireless communications are described. A configuration for a reference signal used to determine a non-linear behavior of transmission components at a transmitting device may be determined. The configuration for the reference signal may be determined based on signaling transmitted by the transmitting device, signaling transmitted by a device that receives the reference signal, or both. Additionally, or alternatively, the configuration for the reference signal may be determined based on a configuration of other signals transmitted by the transmitting device prior to or concurrently with the transmission of the reference signal. The determined configuration may be used to generate and transmit the reference signal or to determine a configuration of a received reference signal. In both cases, a non-linear response of transmission components at the transmitting device may be determined based on the reference signal. |
US11949616B2 |
Wireless communication method and wireless communication terminal using same
The present invention relates to a wireless communication method for suggesting a packet preamble structure for efficient communication in a wireless communication environment in which a legacy terminal and a non-legacy terminal are mixed, and a wireless communication terminal using the same.For this, the present invention provides a wireless communication method including: generating a packet including a first preamble and a second preamble, wherein a first symbol and a second symbol of the second preamble are modulated using binary phase shift keying (BPSK); and transmitting the generated packet and a wireless communication terminal using the same. |
US11949615B2 |
User equipment (UE) feedback of quantized per-path angle of arrival
A method of wireless communication by a user equipment (UE) comprises receiving, from a base station, multiple reference signals, and estimating a channel based on the received reference signals. The channel comprises multiple channel paths. The method also includes quantizing an angle of arrival (AoA) of each channel path into one of a group of quantization levels. The method further includes reporting to the base station the quantized angle of arrival, and also a delay and/or power level for the quantized angle of arrival. |
US11949612B2 |
Methods, apparatus and systems for discovering wireless communication nodes
Methods, apparatus and systems for wireless communication nodes to discover each other are disclosed. In one embodiment, a method performed by a first wireless communication node is disclosed. The method comprises: transmitting, to each of a plurality of second wireless communication nodes, respective configuration information that is utilized by the second wireless communication node to transmit a discovery signal in order to be discovered by at least one other second wireless communication node. At least two of the plurality of second wireless communication nodes transmit their discovery signals at different time domain positions based on their respective configuration information. |
US11949609B2 |
EHT preamble designs for transmissions to mixed clients in wireless communications
Various proposed schemes pertaining to extreme high-throughput (EHT) preamble designs for transmissions to mixed clients in wireless communications are described. In one example, an aggregated Physical Layer Convergence Procedure (PLCP) protocol data unit (PPDU), which is transmitted over a plurality of 80-MHz bandwidths with data for a plurality of stations (STAs), is received. A preamble of a specific one of the plurality of 80-MHz bandwidths is then decoded. |
US11949607B2 |
Method and apparatus for coexistance of device-to-device communications and cellular communications in mobile communications system
The present disclosure relates to a communication method and system for converging a 5th-Generation (5G) communication system for supporting higher data rates beyond a 4th-Generation (4G) system with a technology for Internet of Things (IoT). The present disclosure may be applied to intelligent services based on the 5G communication technology and the IoT-related technology, such as smart home, smart building, smart city, smart car, connected car, health care, digital education, smart retail, security and safety services. The present disclosure provides a method and an apparatus for coexistence of device-to-device communications and cellular communications in a mobile communications system. |
US11949606B2 |
Increased utilization of wireless frequency channels partially occupied by incumbent systems
A wireless communication device, method and system. The device includes a memory, and a processing circuitry coupled to the memory. The processing circuitry is to: decode at least one signal field portion of a signal field of a Physical Layer Convergence Protocol (PLCP) Data Unit (PPDU) received over a bonded channel, the bonded channel comprising a plurality of subchannels including a punctured subchannel, the signal field portion on at least one unpunctured subchannel of the plurality of subchannels; determine, from the at least one signal field portion, information on a resource allocation for the device, the resource allocation indicating at least one resource unit (RU) used in a data field of the PPDU for the device; and decode a data field portion of the data field of the PPDU, the data field portion received on a part of the punctured subchannel based on the resource allocation. |
US11949601B1 |
Efficient buffer utilization for network data units
Approaches, techniques, and mechanisms are disclosed for efficiently buffering data units within a network device. A traffic manager or other network device component receives Transport Data Units (“TDUs”), which are sub-portions of Protocol Data Units (“PDUs”). Rather than buffer an entire TDU together, the component divides the TDU into multiple Storage Data Units (“SDUs”) that can fit in SDU buffer entries within physical memory banks. A TDU-to-SDU Mapping (“TSM”) memory stores TSM lists that indicate which SDU entries store SDUs for a given TDU. Physical memory banks in which the SDUs are stored may be grouped together into logical SDU banks that are accessed together as if a single bank. The TSM memory may include a number of distinct TSM banks, with each logical SDU bank having a corresponding TSM bank. Techniques for maintaining inter-packet and intra-packet linking data compatible with such buffers are also disclosed. |
US11949599B2 |
Method and system of implementing conversation-sensitive collection for a link aggregation group
A method is executed by a network device for implementing conversation-sensitive collection for frames received on a port of a link of a link aggregation group. The network device executes an aggregator to collect the frames for aggregator clients, where each frame is associated with a service identifier and a conversation identifier. The service identifier identifies a data flow at a link level for a service. The conversation identifier identifies the data flow at a link aggregation group level, where each conversation data flow consists of an ordered sequence of frames, and where the conversation-sensitive collection maintains the ordered sequence by discarding frames of conversations not allocated to the port. |
US11949593B2 |
Stateless address translation at an autonomous system (AS) boundary for host privacy
Stateless address translation at an Autonomous System (AS) boundary for host privacy may be provided. An address associated with a host device in the AS may be received. The address may comprise a network prefix and an interface identifier (ID). Then a cypher value may be assigned to a cypher bit range in the network prefix. The cypher value may be associated with a first cypher algorithm of a plurality of cypher algorithms. Next, the address may be encoded wherein encoding the address comprises applying the first cypher algorithm to encode a coding bit range in the address that is less significant than the cypher bit range. The encoded address may then be used for flows from the host that egress the AS. |
US11949590B1 |
Maintaining processing core affinity for fragmented packets in network devices
Techniques are disclosed for maintaining processing unit core affinity for fragmented packets. In one example, a service physical interface card (PIC) implementing a service plane of a network device receives fragmented and/or non-fragmented packet data for a traffic flow. The service PIC comprises at least one processing unit comprising multiple cores. A routing engine operating in a control plane of the network device defines one or more core groups comprising a subset of the cores. The routing engine assigns the traffic flow to a core group and a forwarding engine operating in a forwarding plane of the network device forwards the packet data for the traffic flow to the assigned core group. A core of the assigned core group applies a network service to the fragmented and/or non-fragmented packet data for the traffic flow, and the forwarding engine forwards the packet data for the traffic flow toward a destination. |
US11949588B2 |
Large-scale real-time multimedia communications
A method, an apparatus for real-time multimedia communications using a software-defined network (SDN) are provided. The method includes receiving, in a periodic manner, a path metric associated with a first service node in the SDN and a second service node in the SDN, wherein the path metric comprises at least one of: a load status of at least one of the first service node or the second service node, or a transmission metric between the first service node and the second service node; and in response to receiving the path metric, updating a cascade network topology comprising an optimal path for transmitting multimedia data between a first edge node and a second edge node. |
US11949586B2 |
Load-aware ECMP with flow tables
A semiconductor chip for implementing load-aware equal-cost multipath routing includes a number of ports and several pipes, each pipe being coupled to a portion of ports on the semiconductor chip, and a central unit consisting of a state machine and multiple databases. The databases contain information regarding a communication network including an overlay network and an underlay network, and the state machine is implemented in hardware and can determine at least one feature of the overlay network and a corresponding group of paths within the underlay network. |
US11949585B2 |
BIER packet sending method and apparatus
This application provides a BIER packet sending method. The method includes: receiving a BIER packet that is encapsulated using an IPv6 protocol and that is sent by a second forwarding device, where the BIER packet includes an IPv6 basic header and a BIER header, a destination address field in the IPv6 basic header is a first IPv6 address of the first forwarding device; determining, based on an identifier corresponding to a first IPv6 address in a forwarding table, to perform BIER forwarding on the BIER packet, where the identifier is used to indicate that the first IPv6 address is a destination address for BIER forwarding. In the technical solution provided in this application, a node may determine, based on the identifier of the first IPv6 address, to perform BIER forwarding on the BIER packet. |
US11949584B2 |
Utilizing domain segment identifiers for inter-domain shortest path segment routing
An ingress network device may receive a core domain network segment identifier associated with a core domain network of the multi-domain network. The ingress network device may receive location data of an egress network device associated with a second leaf domain network of the multi-domain network, wherein the location data may include data identifying the core domain network segment identifier, a second leaf domain network segment identifier associated with the second leaf domain network, and an egress network device segment identifier associated with the egress network device. The ingress network device may store the core domain network segment identifier and the location data, and may utilize the core domain segment identifier and the location data to route traffic to the egress network device. |
US11949583B2 |
Enforcing reference operating state compliance for cloud computing-based compute appliances
A process includes enforcing compliance of a compute appliance to a reference operating state for the compute appliance. The compute appliance is part of a cloud-based computing system. Enforcing compliance with the reference operating state includes, responsive to a startup of the compute appliance, the compute appliance determining an actual compute state of the compute appliance. The actual compute state includes an actual physical topology placement of a hardware component of the compute appliance. Determining the actual compute state includes determining the physical topology placement of the hardware component. Enforcing compliance with the reference operating state includes verifying whether the actual compute state complies with the reference compute state. The verification includes comparing the actual compute state to the reference compute state. Enforcing compliance with the reference operating state includes, responsive to a result of the verification, controlling whether the compute appliance is part of the cloud-based computing system. |
US11949580B2 |
Data center management based on probing
Various example embodiments for supporting data center management are presented herein. Various example embodiments for supporting data center management may be configured to support fabric service management for a data center fabric including a set of servers and a fabric network configured to support communications of the servers. Various example embodiments for supporting fabric service management within a data center may be configured to support a capability for configuring a fabric network of the data center fabric of the data center based on merging and unmerging of underlay and overlay configurations. Various example embodiments for supporting fabric service management within a data center may be configured to support a capability for debugging a fabric network of the data center fabric of the data center based on use of probes. |
US11949578B2 |
Adaptive probing to discover a protocol for network tracing
Techniques for using traceroute with tunnels and cloud-based systems for determining measures of network performance are presented. Systems and methods provide adaptive probing of a service path in a network, wherein the service path includes a plurality of legs. The systems and methods include, for one or more legs of the plurality of legs, sending a number of probes using one of a plurality of protocols; responsive to receiving a response from the number of probes, determining the one of the plurality of protocols is successful and storing this protocol the one or more legs; and, responsive to failure to receive the response, sending a number of probes using another one of the plurality of protocols and continuing until a successful protocol is determined or all of the plurality of protocols fail. |
US11949574B2 |
Data processing method and apparatus, electronic device and computer-readable storage medium
A data processing method is provided. The method incudes that: determining whether a relationship between a processing delay correlation value of data to be processed when processed by a network side device and a preset threshold value satisfies a preset relationship or not; and in response to determining that the relationship between the processing delay correlation value and the preset threshold value satisfies the preset relationship, sending the data to be processed to the network side device for processing. |
US11949573B2 |
System and method for parallel testing of multiple data processing channels for data processing optimization
Systems, computer program products, and methods are described herein for the parallel testing of multiple data processing channels. The present invention may be configured to generate a data packet, send the data packet to a processing channel for processing at a send time, receive the processed data from the processing channel at a return time, determine the percent accuracy for the processed data from the processing channel, and record the send time, return time, and percent accuracy in an analytics system. The present invention may also be configured to determine the security of the processing channel and record the security in the analytics system. |
US11949571B2 |
Unified telemetry data
A memory stores telemetry data for an information handling system. A processor analyzes applications being executed within the information handling system, and determines one or more of the applications that collect and send the telemetry data. The processor also retrieves a first list of different sets of data to be tracked for each of the applications. Each of the sets of data to be tracked is associated with a different one of the applications. The processor creates a second list of data being logged in the information handling system. Based on the first and second lists, the processor creates a comprehensive list of data tracked by the applications. |
US11949561B2 |
Automated preventative controls in digital workflow
A system includes a processor and memory storing instructions that cause the processor to receive, from a client device, inputs defining associations between one or more control objectives and one more policies, wherein the one or more control objectives define one or more functions to be performed to comply with the one or more policies. The processor may map the one or more policies associated with the one or more control objectives to an application environment and receive, from the client device or a different client device, a change set to an application in the application environment, wherein the change set comprises one or more modifications to the application. The processor may then determine whether the change set adheres to the one or more policies and restrict implementation of the change set in response to determining that the change set does not adhere to the one more policies. |
US11949553B2 |
Transmission parameter configuration method and apparatus
In a transmission parameter configuration method, a first node receives a transmission configuration message, where the transmission configuration message includes transmission configuration index information and a transmission parameter corresponding to the transmission configuration index information, and the transmission configuration index information is used to identify different transmission modes. The first node obtains a transmission indication message, where the transmission indication message includes the transmission configuration index information, and the transmission indication message is used to indicate to the first node to apply the transmission parameter corresponding to the transmission configuration index information. The first node performs, based on the transmission configuration index information, data transmission by using the transmission parameter corresponding to the transmission configuration index information. The method can meet requirements of more application scenarios, support more transmission modes, and reduce overheads caused by transmission parameters. |
US11949544B2 |
Deep learning-based polymorphic platform
A polymorphic platform for wireless communication systems is provided that employs trained classification techniques to determine physical layer parameters from a transmitter at a receiver. The system includes a learning module to determine transmitted physical layer parameters of the signal using a trained classification module, such as a deep learning neural network. The trained classification module receives I/Q input samples from receiver circuitry and processes the I/Q input samples to determine transmitted physical layer parameters from the transmitter. The system includes a polymorphic processing unit that demodulates data from the signal based on the determined transmitted parameters. |
US11949539B2 |
Burst-tolerant decision feedback equalization
A first sequence of data bits is shifted into storage elements of a signal receiver during a first sequence of bit-time intervals, and a memory access command indicates that a second sequence of data bits is to be received within the signal receiver during a second sequence of bit-time intervals. Contents of the shift-register storage elements are conditionally overwritten with a predetermined set of seed bits, depending on whether one or more bit-time intervals will transpire between the first and second sequences of bit-time intervals. Equalization signals generated based, at least in part, on contents of the shift-register storage elements are used to adjust respective signal levels representative of one or more bits of the second sequence of data bits. |
US11949534B2 |
Method and device for controlling a smart device
A method for controlling a smart device is provided. The method comprises identifying a user-furniture interaction activity of a user interacting with a home furnishing product by analyzing sensor data, captured by an imaging sensor, depicting a scene of the user interacting with the home furnishing product. The method further comprises comparing the user-furniture interaction activity against a set of predetermined user-furniture interaction activities, thereby determining a specific predetermined user-furniture interaction activity among the set of predetermined user-furniture interaction activities, wherein each of the predetermined user-furniture interaction activities is associated with a rule of controlling a smart device. The method further comprises controlling the smart device in accordance with the rule. |
US11949533B2 |
Sink device
A voice controlled device comprises a housing, a dock, a coupling mechanism, and a microphone. The dock is configured to connect the housing to a plurality of host appliances. The coupling mechanism is configured to receive an identification value indicative of docking between the voice controlled device and a currently connected host appliance of the plurality of host appliances. The microphone is configured to receive one or more voice inputs for the currently connected host appliance. A command is provided based on the one or more voice inputs and the identification value. |
US11949529B2 |
Camera format selection
The subject technology receives, at a local device, a requested camera format based on specifications of a display associated with a remote device. The remote device and the local device are devices participating in a video conference. The requested camera format includes a first resolution. Camera formats supported by a camera associated with the local device are determined. If a second resolution of a first camera format matches among the supported camera formats matches with the first resolution, the first camera format is selected for capturing the video stream by the camera. Otherwise, a second camera format among the supported camera formats is determined for capturing the video stream so as to maximize a field of view of the video stream relative to other camera formats supported by the camera. |
US11949527B2 |
Shared augmented reality experience in video chat
Methods and systems are disclosed for performing operations for providing a shared augmented reality experience in a video chat. A video chat can be established between a plurality of client devices. During the video chat, videos of users associated with the client devices can be displayed. During the video chat, a request from a first client device to activate a first AR experience can be received, and in response, and body parts of users depicted in the videos are modified to include one or more AR elements associated with the first AR experience. |
US11949524B2 |
Methods and systems for automated quota determination based on resource selection in online charging systems
Systems and methods are provided for granting service units associated with a charging session for providing network service to an end user. The method includes receiving a request message for the network service; selecting one or more offerings associated with the received request message prior to applying quota determination rules, where each offering includes one or more associated resources. The method further includes applying quota determination rules to the selected one or more offerings based on the associated resources, and rating the service request based on the selected one or more offerings and the results of applying the quota determination rules, where the rating results in an assigned quota. The method further includes transmitting the assigned quota for the requested service, where the assigned quota includes the granted service units. |
US11949523B2 |
Data storage metering and billing
A method for data storage metering and billing includes receiving, at an owner server on a periodic basis, storage utilization data. The storage utilization data includes one or more measurements of data storage usage for data storage at a customer location of a customer where the customer location is remote from the owner server. The method includes calculating, from the storage utilization data, average storage utilization data that includes an average of the storage utilization data from the customer location for a billing period. The method includes calculating billing information for the average storage utilization data for the billing period where the billing information is calculated from the average storage utilization data and a calculated storage billing rate, and providing, to the customer, access to the billing information. |
US11949522B2 |
Adaptive backoff time in power-over-ethernet detection cycles
One aspect provides a power sourcing equipment controller for providing power to a powered device using power-over-Ethernet (PoE). The power sourcing equipment includes a voltage-output logic block to output a sequence of voltage signals, the voltage signals comprising at least a detection signal and a classification signal; a current-measurement logic block to measure current provided responsive to the voltage signals; a backoff-time-determination logic block to determine a backoff time in response to the current-measurement logic block detecting the provided current exceeding a predetermined threshold, the backoff time being determined based on an amount of time needed for discharging an internal capacitor associated with the powered device; and a timing logic block to cause the voltage-output logic block to delay the output of a next sequence of voltage signals based on the determined backoff time, thereby facilitating powering up of a device compliant with a different PoE standard. |
US11949521B2 |
Data transmission method and device
A data transmission method and device are provided in embodiments of this disclosure. The method includes: starting to transmit data to a network device on a resource configured in one period; changing an RV value or a resource or a DMRS from a current value to another value in case that a terminal needs to transmit data beyond the boundary of the period. |
US11949514B2 |
Method and apparatus for generating hybrid automatic repeat request HARQ information
This application provides an example method and an example apparatus for generating hybrid automatic repeat request (HARQ) information. The method includes receiving, by a terminal device, a first message sent by a network device. The first message is used to indicate that there are a plurality of active bandwidth parts (BWPs) in a cell or that there are M BWP groups in the cell, the M BWP groups may be obtained by dividing, by the network device, N configured BWPs, any BWP group includes an active BWP, M and N are integers greater than or equal to 2, and M is less than or equal to N. The method also includes generating, by the terminal device, HARQ information based on the plurality of active BWPs or the M BWP groups. |
US11949513B2 |
Method and device for transmitting HARQ feedback information in unlicensed band
Provided are a method and a device for enabling HARQ feedback information to be transmitted in response to the reception of a downlink data channel in the unlicensed band. The method may include: receiving downlink control information including resource allocation information for a downlink data channel (PDSCH) in an unlicensed band; receiving HARQ timing indication information for transmitting HARQ feedback information in the unlicensed band; and transmitting the HARQ feedback information in the unlicensed band according to the HARQ timing indication information. |
US11949506B2 |
Preamble with detectable WLAN version identification
Systems and methods for generating a control signal for automatic wireless network version detection of a transmission. The control signal enables a receiver to detect the wireless network version detection of the transmission, so that the proper wireless network version is used for interpreting signaling information and decoding of the payload of the transmission. In some examples, the control signal is within a preamble of the transmission. The wireless network version can be an IEEE 802.11 version, such as proposed IEEE 802.11be. The control signal is compatible with legacy systems and can indicate the legacy signaling information by way of a Legacy Signal (SIG) (L-SIG) symbol. In some examples, the control signal can indicate the wireless network version by using an identifier symbol which is generated from at least part of, but is not identical to, the L-SIG symbol. |
US11949505B2 |
Scheduling of uplink data using demodulation reference signal and scheduled resources
Various embodiments disclosed herein provide for facilitating scheduling of uplink data using demodulation reference signal and scheduled resources. According to an embodiment, a system can comprise configuring a network device with a periodic rate of specified sounding reference signals with a periodicity using radio resource control signaling. The system can further facilitate estimating channel state information associated with a channel via which the network device communicates. The system can further facilitate transmitting an uplink grant with uplink transmission parameters to set up a physical uplink shared channel, wherein the uplink transmission parameters are determined based on the channel state information. The system can further facilitate estimating scheduling parameters based on a first estimation information associated with the physical uplink shared channel. |
US11949504B2 |
Techniques for indicating duplex mode capability
Methods, systems, and devices for wireless communications are described. A user equipment (UE) may transmit control signaling indicating a capability of the UE for supporting a first duplex mode and indicating a mode switching latency of the UE for switching between the first duplex mode and a second duplex mode. In some cases, the UE may transmit an indication of a set of supported full-duplex channel combinations, where each channel combination of the set of supported full-duplex channel combinations may include an uplink channel and a downlink channel. In some cases, the UE may transmit an indication of a duration for which the capability of the UE for supporting the first duplex mode is applicable. The UE may receive scheduling information based on the capability of the UE for supporting the first duplex mode and the mode switching latency, and communicate with a base station based on the scheduling information. |
US11949498B2 |
Optical modulator
An optical modulator comprises, as optical modulator components, first and second transmitter chains and a first optical time division multiplex, OTDM, generator arranged to receive time interleaved optical pulses generated by one of said optical modulator components. |
US11949495B2 |
Next generation mobile satellite service (MSS)
A system and method for operating a hybrid 4G satellite network. The method includes providing a NGSG including a satellite AS/NAS stack, a terrestrial 4G stack and a relay to connect the satellite AS/NAS stack and the terrestrial 4G stack; transporting a 4G traffic between a 4G UE and the NGSG using a satellite air interface; utilizing a terrestrial network between the NGSG and a 4G CN to transport the 4G traffic; and mapping, with the relay, the 4G traffic between the satellite AS/NAS stack and the terrestrial 4G stack and vice versa, where the satellite air interface is better suited for satellite communications than the terrestrial network. A system and method for multiplexing a first-generation UE and a second-generation UE on a satellite channel. |
US11949494B2 |
Differential routing for non-geostationary orbit (NGSO) satellite systems
A Non-Geostationary Orbit (NGSO) satellite system is described that utilizes backbone route tables at its satellites that define different snapshots of a time-varying backbone topology of the NGSO satellite system. Because each satellite may see a different portion of the backbone topology, the backbone route tables at different satellites may be different from each other. Also, the backbone route tables at the satellites may be active at different times as the backbone topology changes over time. Different routing groups of backbone route tables may be defined in order to represent different routing options for packets arriving at a satellite. The routing options for a routing group may emphasis various network performance and security goals for traffic assigned to the routing group. |
US11949493B2 |
Mobile terminal and methods of use
A mobile terminal and its methods of use are disclosed herein. In an embodiment, a mobile terminal for enabling radio communications includes a common reference device, frequency conversion circuitry, and pilot tracking circuitry and/or signal tracking circuitry. The common reference device provides a common reference signal for frequency conversions. The frequency conversion circuitry uses the common reference signal from the common reference device to perform a frequency conversion of incoming or outgoing communications. The pilot tracking circuitry determines a frequency error based on a frequency of a received pilot signal and causes an adjustment to the frequency conversion performed by the frequency conversion circuitry based on the frequency error. The signal tracking circuitry determines a frequency error signal based on the frequency of an incoming communication signal and causes an adjustment to the frequency conversion performed by the frequency conversion circuitry based on the frequency error. |
US11949490B2 |
Relay apparatus
A relay apparatus according to an embodiment is for use in a mobile communication system. The relay apparatus comprises: a reception side RLC entity configured to receive data from a first communication apparatus; and a transmission side RLC entity configured to transmit, to a second communication apparatus, the data received by the reception side RLC entity. The transmission side RLC entity is configured to receive, from the second communication apparatus, a first acknowledgement indicating that the second communication apparatus has successfully received the transmitted data. The reception side RLC entity is configured to transmit, to the first communication apparatus, a second acknowledgement indicating that the reception side RLC entity has successfully received the data after waiting until the transmission side RLC entity receives the first acknowledgement. |
US11949486B2 |
Beam selection for a radio transceiver device
There is provided mechanisms for beam selection. A method is performed by a first radio transceiver device. The method comprises obtaining link quality estimates of a radio signal conveyed to the first radio transceiver device from a second radio transceiver device by means of at least a first beam taken from a first beam set and a second beam. The second beam is wider than the first beam. The method comprises selecting which one of the first beam and the second beam to use for continued communications of radio signals with the second radio transceiver device in accordance with a comparison between the link quality estimates of the first beam and compensated link quality estimates of the second beam. |
US11949482B2 |
Method and device in UE and base station for multi-antenna transmission
The disclosure provides a method and a device in a User Equipment (UE) and a base station for multi-antenna transmission. The UE transmits a first radio signal in a first time interval, and receives a second radio signal in a second time interval; and then monitors a third radio signal in a third time interval. The first radio signal includes first information, and the second radio signal includes second information. Target information is used for receiving the third radio signal. A time-domain position of the second time interval is used for determining whether the target information is the first information or the second information. A time-domain position of the third time interval is associated to a time-domain position of the first time interval. The UE can select a beam direction corresponding to a downlink channel according to its measurement, thereby improving efficiency and performances of downlink transmission. |
US11949478B2 |
Carrier aggregation capability reporting apparatus and method, and carrier measurement apparatus and method
The present disclosure provides a carrier aggregation capability reporting apparatus and method, so as to prevent a user equipment (UE) from repeatedly reporting capability information corresponding to a carrier combination supported by the UE, and reduce waste of signaling resources used for reporting. The method includes: determining, by the UE, information about a carrier combination supported by the UE and information about a sub-combination that is of the carrier combination and that is supported by the UE; and reporting, by the UE to a base station, the determined information about the carrier combination supported by the UE and the determined information about the sub-combination that is of the carrier combination and that is supported by the UE. |
US11949477B2 |
Adaptation of MIMO mode in mmW WLAN systems
Systems, methods, and instrumentalities are disclosed for adaptation of multiple input multiple output (MIMO) mode in mmW Wireless Local Area Network (WLAN) systems. A first station (STA) may receive a mode change request from a second STA. The mode change request may indicate a mode change for a MIMO mode, a polarization mode, and/or an orthogonal frequency-division multiple access (OFDMA) mode. The mode change request may include one or more STA fields. The one or more STA fields may include a STA field associated with the first STA. Each of the one or more STA fields may include a MIMO mode subfield, a polarization mode subfield, and/or an OFDMA mode subfield. The first STA may change the MIMO mode, the polarization mode, and/or the OFDMA mode, for example, based on the mode change request. The first STA may send a mode change response to the second STA. |
US11949475B2 |
Method of signal processing by a massive MIMO base station receiver
Embodiments of the present disclosure provide a method of processing received signal using a massive MIMO base station (BS). The BS comprises a radio unit (RU), a distributed unit (DU) and an interface. The method comprises receiving a plurality of signals corresponding to the plurality of antennas, said signals comprises at least one of data signals, demodulation reference signals (DMRS) and sounding reference signals (SRS). The RU or DU performs a grouping operation on a subset of the plurality of signals corresponding to a subset of antennas to generate signal groups. The RU performs a first stage filtering on the signals associated with each group using group specific filters to obtain group specific filtered signals. The DU performs a second stage filtering on the group specific filtered signals to obtain second stage filtered signals. |
US11949468B2 |
Multistage combining sub-system for distributed antenna system
A multistage combining sub-system for a distributed antenna system (“DAS”) is disclosed. The combining sub-system can receive broadband uplink signals from remote units of the DAS. The sub-system can divide the received broadband uplink signals into sets of narrowband uplink signals. The combining sub-system can select subsets of narrowband uplink signals from the sets of narrowband uplink signals. The subsets can be selected based on the narrowband signals in the subsets having a signal characteristic indicative of useful information. The combining sub-system can combine the selected subsets of narrowband uplink signals for routing to a base station. Combining the selected subsets of narrowband uplink signals can involve excluding narrowband uplink signals that are not included in the selected subsets of narrowband uplink signals. |
US11949463B1 |
Measurement based methods for accessing and characterizing quantum communication channels
Various embodiments of the present disclosure are directed to accessing a quantum communication channel undetected and/or characterizing this communication channel based upon attempted access. An example method includes accessing a quantum communication channel transmitting one or more qubits. The method includes the introduction of a noise signal to the quantum communication channel and then applying in its absence one or more weak or variable-strength measurements to the quantum communication channel. A strength of at least one measurement of the one or more measurements is based at least in part upon the current noise signal. The method further includes obtaining information associated with the one or more qubits based on the one or more measurements. |
US11949456B2 |
Systems and methods for communication by wavelength toggling
A system for communication is provided. The system includes an emitter transmitting a first code of a first wavelength. The system includes a filter or variable waveplate receiving the first code. The system includes a receiver sensor receiving the filtered first code. The system includes the emitter transmitting a second code of a second wavelength. The system includes the variable waveplate or other filter receiving the second signal. The system includes the receiver sensor receiving the filtered second code. The first and second codes may be used for communication, synchronizing the emitter, and other purposes. |
US11949450B1 |
Systems, apparatus, articles of manufacture, and methods for code merging in communication systems
Systems, apparatus, methods, and articles of manufacture are disclosed for code merging in communication systems. An example apparatus includes at least one memory, machine-readable instructions, and processor circuitry to at least one of instantiate or execute the machine-readable instructions to at least identify first data as line-of-sight data based on a first range of a first target object, identify second data as multipath data based on a second range of a second target object, after a determination that the second data includes a data portion not included in the first data, output communication data based on a merge of the first data and the second data, and cause movement of at least one of the first target object or the second target object based on the communication data. |
US11949448B2 |
Submarine optical communication system and communication method
In order to readily carry out communication between terminal stations, a submarine optical communication system includes a first terminal station including a first monitoring means for monitoring the signal quality of dummy light a first dummy light source that outputs dummy light to the second terminal station, and a first light transmitting means for transmitting an optical signal to the second terminal station, the optical signal including a first signal quality of the dummy light; and the second terminal station including a second dummy light source that outputs dummy light to the first monitoring means, a second monitoring means for monitoring the signal quality of the dummy light, and a light receiving means for receiving the optical signal. |
US11949447B2 |
Smart scheduling of TSCH networks to avoid self-interference
A wireless communication system includes a network manager configured to wirelessly communicate with a plurality of wireless nodes of a wireless network. The network manager and at least one wireless node include a transceiver connected to transmit and receive wireless communication via an antenna. The network manager and/or the wireless node include a cognitive engine configured to receive information regarding an environment of the wireless network as input and, in response, generate configuration data as output. Subsequent communication on the wireless network is updated using the configuration data. |
US11949445B2 |
Protective case having card storages for portable electronic device
A protective case configured to cover a portable electronic device is provided. The protective case may include a first card storage configured to receive a first card, and a second card storage configured to store a second card where the second card storage is spaced apart from the first card storage. |
US11949444B2 |
Wearable device antenna
A wearable device includes a frame and a magnetic coupler opening formed in the frame. Wearable device further includes a processor, a memory accessible to the processor, and a very high frequency (VHF) radio transceiver for data transmission and reception and connected to the processor. Wearable device further includes a magnetic coupler connected to the VHF radio transceiver. Magnetic coupler includes a diamagnetic material shaped to form a VHF transmission or reception terminal that partially or fully aligns with the magnetic coupler opening. During transmission, magnetic coupler is configured to radiate transmitted VHF band radio modulated signals into tissue of the user. During reception, magnetic coupler is configured to absorb received VHF band radio modulated signals from the tissue of the user. |
US11949442B2 |
Mobile conversion apparatus for docking cellular data devices
A mobile conversion apparatus for docking cellular data devices including push-to-talk over cellular (PoC) devices. The apparatus includes a Universal Serial Bus Type-C (USB-C) connection. The conversion apparatus is designed and configured to couple the PoC device to a mobile communications interface within a vehicle using the USB-C connection. The PoC device is horizontally insertable into the conversion apparatus exposing only the top of the PoC device leaving only the display and knob of the PoC device exposed on the face of the conversion apparatus. In this manner, the conversion apparatus effectively docks the PoC device, thereby connecting the two together via the USB-C connection. |
US11949441B2 |
Transmitter and method for generating radio frequency transmit signal, mobile device and base station
A transmitter for generating a radio frequency, RF, transmit signal is provided. The transmitter includes signal generation circuitry configured to generate, based on a sequence of first control words each indicating a respective frequency shift with respect to a target frequency of the RF transmit signal, a RF carrier signal with sequentially varying frequency over time in order to frequency spread the RF transmit signal. Further, the transmitter includes modulation circuitry configured to generate the RF transmit signal by modulating the RF carrier signal with a modulation control signal. The transmitter additionally includes modification circuitry configured to generate the modulation control signal by modifying, based on the sequence of first control words, phase information of a baseband signal bearing information to be transmitted or phase information of a signal derived from the baseband signal in order to frequency de-spread the RF transmit signal. |
US11949440B2 |
Multi-user interleaving and modulation in a wireless network
A wireless transmit/receive unit (WTRU) may receive a constellation symbol that includes indications that each are associated with a respective WTRU of a plurality of WTRUs. The WTRU may determine that a first weight associated with a first indication of the indications is different than a second weight associated with a second indication of the indications. The indications may comprise indications of bits modulated at a multi-user constellation bit division multiple access modulator (MU-CBDMAM). |
US11949438B2 |
Multi-band antenna for use with limited size ground planes
Multi-band antenna for use with limited size ground planes. In one embodiment, the multi-band antenna includes a substrate having a first radiator branch and a second radiator branch; a first switch that is connected with the first radiator branch and a radio module; and a second switch that is connected with the second radiator branch and matching circuitry. Selection between different states of the first switch and the second switch enable the multi-band antenna to operate in a plurality of operating bands. These operating bands may include both the high and low frequency bands for a long-term evolution (LTE) communication device as well as a global navigation satellite system (GNSS) frequency band. Methods of operating the multi-band antenna as well as systems that incorporate the multi-band antenna are also disclosed. |
US11949435B2 |
Markov encoder-decoder optimized for cyclo-stationary communications channel or storage media
A cyclo-stationary characteristic of a communications channel and/or storage media is determined. The cyclo-stationary characteristic has K-cycles, K>1. Markov transition probabilities are determined that depend on a discrete phase ϕ=t mod K, wherein t is a discrete time value. An encoder to optimize the Markov transition probabilities for encoding data sent through the communications channel and/or stored on the storage media. The optimized Markov transition probabilities are used to decode the data from the communication channel and/or read from the storage media. |
US11949434B2 |
Low latency communication with carrier-aggregation-based fountain codes
Methods, systems, and devices for wireless communications are described. An encoding device (e.g., a user equipment (UE) or a base station) may divide one or more data units (e.g., packet data convergence protocol (PDCP) protocol data units (PDU)) into a set of data blocks. The encoding device may encode the set of data blocks using a fountain code and may generate a set of data units (e.g., radio link control (RLC) PDUs) based on encoding the set of data blocks using the fountain code. The UE may allocate a first subset of the set of data units to a first carrier and a second subset of the set of data units to a second carrier and may transmit the first subset over the first carrier and the second subset over the second carrier. |
US11949433B2 |
Transmitting apparatus and interleaving method thereof
A transmitting apparatus is provided. The transmitting apparatus includes: an encoder configured to generate a low-density parity check (LDPC) codeword by LDPC encoding of input bits based on a parity check matrix including information word bits and parity bits, the LDPC codeword including a plurality of bit groups each including a plurality of bits; an interleaver configured to interleave the LDPC codeword; and a modulator configured to map the interleaved LDPC codeword onto a modulation symbol, wherein the interleaver is further configured to interleave the LDPC codeword such that a bit included in a predetermined bit group from among the plurality of bit groups constituting the LDPC codeword onto a predetermined bit of the modulation symbol. |
US11949430B2 |
Parallel system to calculate low density parity check
An LDPC encoding method and a system for error code detection. In the method and system, partial syndromes using a user portion and a low density parity check matrix are calculated, a parity portion of a codeword is calculated using the partial syndromes and using a quasi-cyclic matrix, the parity portion is generated by segment processing of the quasi-cyclic matrix, and the user portion and the parity portion are concatenated to complete the codeword. |
US11949428B2 |
Iterative error correction in memory systems
A system and method for detecting and correcting memory errors in CXL components is presented. The method includes receiving, into a decoder, a memory transfer block (MTB), wherein the MTB comprises data and parity information, wherein the MTB is arranged in a first dimension and a second dimension. An error checking and a correction function on the MTB is performed using a binary hamming code logic within the decoder in the first dimension. An error checking and a correction function on the MTB is performed using a non-binary hamming code logic within the decoder in the second dimension. Further, the binary hamming code logic and the non-binary hamming code logic perform the error checking on the MTB simultaneously. |
US11949426B2 |
Configurable analog-to-digital conversion parameters
Aspects relate to analog-to-digital conversion of an analog signal. The resolution (number of bits) and/or the quantization levels of the analog-to-digital conversion may be configurable. A device may configure its analog-to-digital conversion parameters. For example, a first device may reduce the number of bits for its analog-to-digital converter to reduce power consumption. In this case, the first device may transmit an indication of selected analog-to-digital conversion parameters to a second device that will transmit to the first device. In this way, the second device may take appropriate action, if needed. A device may request another device to use certain analog-to-digital conversion parameters. For example, a first device may determine that a second device should use a larger number of bits for its analog-to-digital conversion process to improve the quality of the communication between the first and second devices. |
US11949424B2 |
Device, method and storage medium for frequency calibration for voltage-controlled oscillators
The present disclosure provide a device, method and storage medium for frequency calibration for voltage-controlled oscillators. The device includes: A frequency divider connected with a VCO, a time-digital converter connected with the frequency divider, a logic controller connected with the time-digital converter, a digital-to-analog converter connected with the voltage-controlled oscillator; The frequency divider is used to divide the signal generated by the voltage-controlled oscillator into N times to get the frequency divider signal; Time-digital converter is used to measure the actual time period of frequency division signal; And the logic controller is used to generate the control voltage according to the difference between the actual time period of the frequency division signal and the calibration period of the frequency division signal, and adjust the frequency of the VCO according to the control voltage. The frequency precision of VCO is improved and the model-free adaptive frequency calibration of VCO is realized. |
US11949420B2 |
Clock spread spectrum circuit, electronic equipment, and clock spread spectrum method
A clock spread spectrum circuit, an electronic equipment, and a clock spread spectrum method are disclosed. The clock spread spectrum circuit includes a control circuit, a signal generation circuit, and a duty cycle adjustment circuit. The duty cycle adjustment circuit is configured to generate a target voltage having a duty cycle that is equal to a target duty cycle, the control circuit is configured to generate a frequency control word according to a modulation parameter, and the frequency control word changes discretely with time; and the signal generation circuit is configured to receive the target voltage and the frequency control word and generate and output a spread spectrum output signal that is spectrum-spread according to the target voltage and the frequency control word, and the spread spectrum output signal corresponds to the frequency control word and a duty cycle of the spread spectrum output signal is the target duty cycle. |
US11949418B2 |
Comparator circuit and ad converter
A comparator circuit includes a zeroth capacitor having a first terminal fed with an input voltage, a zeroth inverter having an input terminal connected to a second terminal of the zeroth capacitor at a zeroth node, a first capacitor having a first terminal connected to the output terminal of the zeroth inverter at a first node, a first inverter having an input terminal connected to a second terminal of the first capacitor at a second node, a second inverter having an input terminal connected to the output terminal of the first inverter at a third node, a zeroth switch switching conduction between the zeroth and first nodes, a first switch switching conduction between the second and third nodes, a second switch switching conduction between the first and third nodes, and a third switch switching conduction between the third node and the output terminal of the second inverter. |
US11949415B2 |
Logic operation circuit for computation in memory
The present disclosure relates to a logic operation circuit for computation in memory, which comprises an equivalent circuit input terminal, a reference circuit input terminal, a reset input terminal and an output terminal; wherein the equivalent circuit input terminal is configured to input the equivalent voltage of a memory computing array, the reset input terminal is configured to input a reset voltage, and the reference circuit input terminal is configured to input a reference voltage; the logic operation circuit for computation in memory outputs different output voltages according to the difference between the equivalent voltage and the reference voltage, and the output voltage is output through the output terminal; the logic operation circuit of the present disclosure has a simple structure, reduced complexity and effectively saved resources. |