| Document | Document Title |
|---|---|
| US11885249B2 |
Catalyst for exhaust gas purification
Provided is a catalyst for exhaust gas purification, the catalyst comprising: a noble metal; an alumina support particle; and a ZrO2 semiconductor support particle deposited on a surface of the alumina support particle. |
| US11885245B2 |
Oil pressure actuated phaser with a lock pin shutoff
An oil pressure actuated or torsion assisted phaser with a lock pin that has a position which shuts off communication between the advance and retard chambers and the front cam bearing and/or oil control valve, effectively acting as a shutoff valve and preventing leakage of oil from the advance and retard chambers. The prevention of leakage maintains oil in the phaser after engine shutdown. Additionally, by shutting off communication between the advance and retard chambers and the oil supply, the side load on the lock pin from the oil pressure torque on the rotor vanes during unlocking of the lock pin can be reduced or eliminated. |
| US11885244B2 |
Pumped heat energy storage system with electric heating integration
A method including: (i) operating a pumped-heat energy storage system (“PHES system”) in a charge mode to convert electricity into stored thermal energy in a hot thermal storage medium (“HTS medium”) by transferring heat from a working fluid to a warm HTS medium, resulting in a hot HTS medium, wherein the PHES system is further operable in a generation mode to convert at least a portion of the stored thermal energy into electricity; and (ii) heating the hot HTS medium with an electric heater above a temperature achievable by transferring heat from the working fluid to the warm HTS medium. |
| US11885243B2 |
Multi-functional fecal waste and garbage processor and associated methods
At least one aspect of the technology provides a self-contained processing facility configured to convert organic, high water-content waste, such as fecal sludge and garbage, into electricity while also generating and collecting potable water. |
| US11885236B2 |
Airfoil tip rail and method of cooling
An airfoil for a turbine engine includes an outer wall bounding an interior and defining a pressure side and a suction side, the outer wall extending axially between a leading edge and a trailing edge to define a chord-wise direction, and also extending radially between a root and a tip to define a span-wise direction. At least one cooling conduit can be formed in the interior of the airfoil, and a tip rail can project from the tip in the span-wise direction. |
| US11885232B2 |
Gas turbine system and movable body including the same
A gas turbine system includes: a compressor configured to compress external air to generate compressed air; a combustor configured to burn the compressed air together with fuel to generate a combustion gas; a turbine configured to be driven by the combustion gas; an exhaust unit configured to guide the combustion gas, which has passed through the turbine, to outside; a shell having a cylindrical shape and extending along an axis line about which the turbine is configured to rotate and being arranged so as to cover the compressor, the combustor, the turbine, and the exhaust unit; and an exit unit configured to guide the combustion gas, which has passed through the turbine, to a discharge port in the surface of the shell. |
| US11885229B2 |
Electric motor having an integrated cooling system and methods of cooling an electric motor
The present disclosure pertains to electric machines such as electric propulsion systems for aircraft that integrated cooling systems, and methods of cooling such an electric machine. Exemplary electric machines include an electric motor that has a stator, a rotor, and a drive shaft operably coupled to the rotor. Exemplary electric machines further include a motor cooling conduit that defines a pathway for conveying a cooling fluid through or around at least a portion of the electric motor, a casing assembly that circumferentially surrounds at least a portion of the electric motor, a casing assembly conduit integrally formed within at least a portion of the casing assembly which defines a pathway for conveying the cooling fluid through the at least a portion of the casing assembly, and a pump or compressor operably coupled to the drive shaft and configured to circulate the cooling fluid through the motor cooling conduit and the casing assembly conduit. |
| US11885228B2 |
System and method for inspecting fan blade tip clearance relative to an abradable fan case
A system and method for inspecting fan blade clearances in a fan stator module are presented. The method includes rotating a fan rotor assembly that includes an attached bracket situated between adjacent fan blades connected to the fan rotor assembly. The bracket includes a laser module and an inclinometer configured to measure a circumferential position of the laser module. The method further includes projecting a laser beam from the laser module to the fan case to determine a distance measurement between the laser module and the fan case at multiple circumferential points around the fan case. The distance measurement and circumferential position data is processed by a computing device to determine a clearance distance between a fan blade and the fan case. |
| US11885223B2 |
Method to prevent dual rod drill string drag
An apparatus and method for preventing drill string drag. Rotation encoders are provided for tracking the rotation of an inner and outer member of a dual-member drill string. Based upon the drilling conditions, the readings of the encoder can detect when the inner member is dragging on the outer member. When such a drag condition is detected, a processor can trigger remedial measures, which may include increasing a rotation rate of the inner member, sending a warning signal, stopping operation, or a combination of these. |
| US11885222B2 |
Inclination-based levelling system
A drilling machine includes an inclination-based levelling system. The drilling machine includes a frame with front and rear portions, and a plurality of support jacks including a pair of rear jacks proximate the rear portion of the frame and a front jack proximate the front portion of the frame. Each jack is extendable and retractable. The drilling machine also includes a sensor configured to monitor and transmit sensor data, the sensor data including at least one of a roll of the drilling machine and a pressure. A controller operatively associated with the sensor, is configured to calculate a volume of debris to be produced during an operation of the drilling machine, to select a machine height setting based on the calculated volume of debris, and to extend and retract the plurality of support jacks according to the selected machine height setting. |
| US11885219B2 |
Chemical injection system for a resource extraction system
A chemical injection system for a resource extraction system includes a controller having a memory and a processor. The memory stores instructions that cause the processor to receive a first pressure from a first pressure sensor of the resource extraction system, receive a second pressure from a second pressure sensor of the resource extraction system, determine a flowrate of a produced fluid of the resource extraction system based on the first pressure and the second pressure, determine an ion concentration of the produced fluid, and adjust an injection rate of a chemical into the resource extraction system based on the flowrate of the produced fluid, the ion concentration of the produced fluid, or both. |
| US11885217B2 |
Apparatus for and method of monitoring a drilling installation
An assembly includes two tubular elements, a primary and a secondary seal arranged between the two tubular elements, a seal cavity formed between the two tubular elements and the primary and the secondary seal, and a seal monitoring apparatus having a housing and a position sensor. The housing has a chamber enclosing a separator which divides the chamber into a first and a second sub-chamber. The first sub-chamber is fluidly connected to the seal cavity and is filled with a hydraulic fluid. The separator is movable in a first direction relative to the housing to increase a volume of the first sub-chamber and decrease a volume of the second sub-chamber, and in a second direction to decrease the volume of the first sub-chamber and increase the volume of the second sub-chamber. The position sensor generates an electrical signal which represents a position of the separator relative to the housing. |
| US11885215B2 |
Downhole pressure/temperature monitoring of ESP intake pressure and discharge temperature
Provided is a gauge mandrel, a sensing system, and a well system. The gauge mandrel, in one aspect, includes a tubular having a length (Lt), an internal diameter (Di) and a width (W), the internal diameter (Di) and the width (W) defining a sidewall thickness (t), the tubular defining a primary fluid passageway. The gauge mandrel, in accordance with this aspect, further includes a gauge cavity extending along at least a portion of the length (Lt) of the tubular and located entirely within the sidewall thickness (t), the gauge cavity having an insertion end configured to accept a gauge sensor. |
| US11885208B2 |
Automated precise constant pressure fracturing with electric pumps
A method of controlling a pumping stage of a fracturing fleet at a wellsite with a set of electric frac pumps to deliver fracturing fluids into a target formation at a steady pressure value. An global control process on a computer system communicatively connected to the plurality of pumping units can communicate a unit setpoint to each pumping unit, monitor the sensor measurements, compare the periodic datasets to a target pressure, and modify the fluid output of the pump units to achieve the target pressure during the pumping operation. The global control process can direct at least one pumping unit to deliver a fracturing treatment at a pressure higher or lower than the target pressure in response to changing wellbore environment pressures. |
| US11885202B2 |
Electric/hydraulic safety valve
Provided is an electro/hydraulic valve for use in a hydrocarbon production well, an electrically surface-controlled subsurface safety valve, and a method of operating an electrically surface-controlled subsurface safety valve. The electro/hydraulic valve for use in a hydrocarbon production well, in one aspect, includes a fluid chamber and an electro/mechanical pump having a fluid inlet and a fluid outlet, and further wherein an inlet check valve is positioned in fluid communication between the fluid chamber and the fluid inlet and an outlet check valve is positioned in fluid communication between the fluid outlet and a hydraulically controlled actuation member. |
| US11885200B2 |
Low power consumption electro-hydraulic system with multiple solenoids
An electro-hydraulic control system for actuating a control valve includes a control module. The control module is coupled to the surface via at least one hydraulic line and two electrical power lines. The control module uses one of the hydraulic lines as a “supply” line and the other line as a “return” line if included. Each hydraulic line of the at least one hydraulic lines can be used as an “open” line or a “close” line to open or close the control valve. The control module includes two normally closed (NC) solenoid valves (SOVs) that are coupled to the electrical power lines and can be controlled from the surface to open or close. The opening or closing of the NC SOVs in cooperation with hydraulic pressure on a “supply” line of the hydraulic lines operates (i.e., closes or opens) the control valve. |
| US11885199B2 |
Actuated sand dump system and methods
An apparatus, system and related methods for controlling a pressurized flow from a high or low pressure system. An actuated sand dump system and related methods include a first valve positioned downstream of a high or low pressure system, a second valve positioned downstream of the first valve, a choke positioned between in the first and second valves, a plurality of pressure gauges, and a control unit operable to automatically open and close the first and second valves and the choke in a predetermined sequence, upon initiating the predetermined sequence, and in response to pressure measurements from the plurality of pressure gauges. |
| US11885198B2 |
Choke system with capacity for passage of large debris
Embodiments include a choke system that passes enlarged debris despite having a relatively small diameter for an input port of the choke system. Embodiments also include systems to prevent dislodging of a choke seat when backpressure is supplied to the choke system. Embodiments also include sealing systems to prevent fluid leaks around the choke seat of the choke system. |
| US11885194B2 |
Rotating indexing coupling (RIC) assembly for installation and orientation of a subsea production tree
One illustrative apparatus (100) disclosed herein includes a stab body (37), at least one inlet/outlet (61) and a coupler body (35) positioned around the stab body (37), wherein the coupler body (35) is adapted to rotate relative to the stab body (37). Also included is at least one hydraulic coupling element (70) positioned on the coupler body (35) and at least one coiled tube (52) positioned around the stab body (37), the at least one coiled tube (52) being in fluid communication with the at least one first hydraulic coupling element (70) and the at least one inlet/outlet (61). |
| US11885192B1 |
Wireline jarring tool and methods of use
A wireline jarring tool includes an elongate body having opposing upper and lower ends, a longitudinal channel defined in the elongate body and extending between the upper and lower ends and sized to loosely receive a wireline, and a jarring assembly housed within the elongate body and operable to generate a jarring force transmittable to a bottom hole assembly (BHA) once the wireline jarring tool is secured to the BHA within a wellbore. The wireline jarring tool is conveyable into the wellbore by translating longitudinally along the wireline, and actuating the jarring assembly is configured to release the BHA from a stuck position within a wellbore. |
| US11885191B2 |
Patch for joining downhole ends of pipes
A downhole tool for joining a string of pipe to a tubular already downhole with a seal element made of metal or metal alloy with a melting point lower than the melting point of the tool and tubular but higher than the temperature of expected downhole operating conditions. |
| US11885190B2 |
Apparatus and method to longitudinally and circumferentially cut and remove a section of a wellbore tubular
An apparatus for cutting sections of a wellbore tubular includes a housing shaped to enable movement along an interior of the tubular. The housing has an upper end arranged to connect to a conveyance and a lower end comprising a guide. Cutting materials are disposed in the housing and arranged to cut the wellbore tubular in two, longitudinally spaced apart circumferential cuts and at least one longitudinal cut extending between the circumferential cuts. The cutting materials are arranged to create the circumferential cuts simultaneously or with a time delay chosen to optimize energy created when cutting. A method for cutting wellbore tubulars includes positioning the apparatus at a selected position in the wellbore and actuating the cutting materials. |
| US11885187B2 |
Control line activated tubing disconnect latch system
A method and apparatus are disclosed that use a control line to expand a piston that shears pins to disconnect a latching system for wellbore operations. |
| US11885186B2 |
High-temperature and high-pressure drilling fluid inhibition evaluation device and usage method thereof
A drilling fluid inhibition evaluation device includes a main test member, a temperature control pressurization system, a gas source, a circulation heating system, a confining pressure pump, a central control system, a computer, an ultrasonic detector and a safety valve electrically connected through pipelines, respectively, the main test member and the temperature control pressurization system sequentially connected with the gas source; the present disclosure can pre-pressurize experimental fluid and then inject the fluid into a dilatometer, so as to prevent the fluid from generating obvious changes of phase states, eliminate pressure setting errors caused by a saturated vapor pressure of the fluid, improve accuracy of evaluation results, inspect a real expansion state of the sample and simultaneously monitor structural change characteristics of a rock sample in real time through reflection conditions of sound waves. |
| US11885183B2 |
Downhole inductive coupler with ingot
An inductive coupler and method for a downhole tool such as a drill pipe comprising an electrically conductive ingot cast into a magnetically conducting electrically insulating (MCEI) annular mold. The MCEI mold may comprise an annular channel comprising a first perforation and one or more second perforations. The ingot may comprise first and seconds with sockets proximate the respective ends. The first perforation may comprise an electrical connection to a ground pin in the downhole tool. The one or more second perforations may comprise electrical connections to a similarly configured ingot within the downhole tool and to electrical equipment within the drill pipe. The ingot may further comprise cleats and flutes. The ingot may comprise an annular passageway around the interior of the ingot. The ingot may be sealed within the channel and each of the perforation may comprise a seal insolating the electrical connections from the downhole environment. |
| US11885180B2 |
Modular ladder system
A modular ladder system includes a first ladder module comprising a first plurality of ladder steps; a second ladder module comprising a second plurality of ladder steps; and a ladder base, the modular ladder system is configurable in an unassembled configuration and an assembled configuration; wherein: in the unassembled configuration, the first ladder module is detached from the second ladder module and the first and second ladder modules are stacked on the ladder base; and in the assembled configuration, the first ladder module is coupled to the ladder base and the second ladder module is attached to the first ladder module opposite the ladder base to define a ladder extending upward from the ladder base. |
| US11885175B2 |
Method, system and apparatus for controlling excessive gaps of a door
A method and system configured to correct a non-compliant, excessive gap condition between a door and a frame, correct a non-compliant, excessive gap condition between a pair of doors at the meeting edge, correct a non-compliant, excessive gap condition at least using a formed metal edge and mechanical fasteners, and correct a non-compliant, excessive gap condition at least using a formed metal edge and mechanical fasteners, whereby the formed metal edge may vary in dimensions to accommodate uneven gaps. |
| US11885174B2 |
Solar control coatings with quadruple metallic layers
A coated article includes a substrate, a first dielectric layer, a first metallic layer, a second dielectric layer, a second metallic layer, a third dielectric layer, a third metallic layer, a fourth dielectric layer, a fourth metallic layer and a fifth dielectric layer. At least one of the metallic layers is a discontinuous metallic layer having discontinuous metallic regions. An optional primer is positioned over any one of the metallic layers. Optionally a protective layer is provided as the outer most layer over the fifth dielectric layer. |
| US11885171B2 |
Vehicle interior component
A vehicle interior component is disclosed. The component may comprise a base comprising a bin; a cover moveable from a closed to an open position through an unlatched position; and a mechanism moveable to an extended position to prevent the cover from opening when subjected to an inertial force. The mechanism may hold the cover in a blocked position partially uncovering the bin. The mechanism may be re-set by opening the cover. The mechanism may comprise a blocker to prevent the cover from moving from the unlatched position to the open position. The cover may comprise a cam surface configured to move the blocker to re-set the mechanism and allow the cover to open. The cover may comprise an interface/bottom surface accessible when the cover is blocked by the mechanism. The component may comprise a console; storage compartment; instrument panel; floor console; or center console. |
| US11885168B2 |
Sliding barrier tracking system
Disclosed herein is a sliding door system including a motor, a driveshaft coupled to the motor, and a coupling mechanism fastened to the sliding door. The coupling mechanism is configured to convert rotation of the driveshaft into linear motion of the sliding door, such that movement of the coupling mechanism is directly correlated to movement of the sliding door. The sliding door system also includes a rotary encoder, a belt mechanically coupled to the coupling mechanism. The belt, as moved by the coupling mechanism, is configured to turn the rotary encoder as the sliding door moves, such that movement of the rotary encoder is directly correlated to movement of the sliding door and not directly correlated to movement of the motor and driveshaft. |
| US11885165B2 |
Furniture board having a hinge, and furniture item having such a furniture board
A furniture board includes an integrated or inserted hinge for guiding a movable furniture part. The furniture board has two side faces, an end face, and an end-face recess for receiving a hinge. The hinge includes a basic element, a linear guide and a pivot guide hinged thereto. The linear guide has forcibly guided movable elements, to which the pivot guide is hinged at a distance from the basic element. Two side faces of the furniture board lie one in a first and one in a second plane. The linear guide and the hinged connection of the pivot guide to the linear guide lie between the first and the second plane, at least in a closed state of the hinge. |
| US11885164B2 |
Coupling device and terminal equipment
A terminal device with a folding screen includes a coupling device with a middle frame fixing member, a first transmission assembly, a second transmission assembly and a third transmission assembly. A first transmission assembly is rotatable relative to the middle frame fixing member during rotation of the middle frame fixing member. The second transmission assembly has a first end hinged to the first transmission assembly and a second end slidably coupled to the first transmission assembly, and the second transmission assembly converts a rotation action of the first transmission assembly into a moving action along a second direction. A third end of the third transmission assembly pushes the middle frame fixing member to move towards a first side facing away from the first transmission assembly or a second side towards the first transmission assembly during the rotation of the middle frame fixing member. |
| US11885162B2 |
Counter balance device for a sash window
A counter balance device for a sash window includes a spiral balance having a hand-wound spiral rod connected to wind a torsion spring to generate an initial spring force that counter balances the window's weight for keeping the sash up when raised. The lower end of the spiral rod is connected to a rotation shaft rotatably disposed on a slide block. When a large repulsion force produced by the torsion spring is applied to the spiral rod, the rotation shaft is urged in a direction reverse to the rotation direction of the spiral rod by a buffer spring having a spring force which is larger than the initial spring force so that the rotation of the rotation shaft is tolerated. |
| US11885158B2 |
Deployable handle system using remote actuator
A vehicular door actuation system for a door of a vehicle includes a handle assembly, a latch and an actuator. The handle assembly includes a handle portion and a base portion. The base portion is disposed at the door of the vehicle and the handle portion is movable between a recessed position, where the handle portion nests at least partially in the base portion, and a ready position, where the handle portion extends from the base portion. The actuator is disposed at the door of the vehicle separate and remote from the handle assembly. A handle linkage operatively couples operation of the actuator to the handle portion to move the handle portion from the recessed position to the ready position. The latch mechanism latches the door in a closed state, and unlatches the door responsive to a user pulling the handle portion from the ready position to open the door. |
| US11885157B2 |
Latch assembly
An appliance door closure assembly is provided and comprises an inner door selectively coupled with an outer door. An anchor is in connection with the inner door and defines a retention space. A latch assembly is in connection with the outer door. The latch assembly includes a first cam having a first contact surface and pivotally coupled to a base. A second cam has a second contact surface engaged with the first contact surface of the first cam. The latch assembly is movable between a first position and a second position. |
| US11885156B2 |
Locking device for an electrical switchboard
A locking device includes: a housing intended to be mounted on an electrical switchboard between a first switching apparatus and a second switching apparatus, each of the switching apparatuses having a control lever able to move between a lower position, corresponding to an open state, and an upper position, corresponding to a closed state, a locking member able to move in rotation between: a first locking position, in which the locking member blocks the control lever of the first switching apparatus in the open position, and a second locking position, in which the locking member blocks the control lever of the second switching apparatus in the open position. |
| US11885155B2 |
Cabinet lock for use with programmable electronic key
A cabinet lock for protecting merchandise within a merchandise display cabinet having an inner door and an outer door. The cabinet lock includes a strike plate affixed to the inner door and a lock housing affixed to the outer door such that the cabinet is in a locked configuration that prevents access to the merchandise when the lock housing is operably engaged to the strike plate. A programmable electronic key communicates a security code with the cabinet lock and transfers electrical power to the cabinet lock to operate a lock mechanism between the locked configuration and an unlocked configuration. An indicator is provided for indicating whether the cabinet lock is in the locked configuration or the unlocked configuration. The indicator includes a first segment and a second segment that can be energized to visually indicate the status of the cabinet lock. |
| US11885150B2 |
Disc tumbler cylinder lock and key combination
A combination of a disc tumbler cylinder lock and a key. The disc tumbler cylinder lock includes rotation limiting device for the key and a guiding element. The key includes grooves for the guiding element, which has two rails making up some of said rotation limiting device, and both of the rails include at least one limiter protrusion arranged to facing inward in the disc tumbler cylinder lock. The key includes at least one recess for the limiter protrusions. The rotation limiting device further includes a front guide having the rails in association therewith. The front guide and the rails are arranged to allow the key, which is in a basic position in the disc tumbler cylinder lock, to be turned for releasing the locking of the disc tumbler cylinder lock. |
| US11885147B2 |
Large format theater design
Theater designs including social media, and theater entrances configured to draw patrons into a main area of the theater including an entrance having a curved wall and curved walkway having a horizon drop-off for display of content related to a motion picture or other feature to be shown in the theater. The content may be interactive or otherwise linked to patrons passing a hallway including the curved wall. Spatialized sound corresponding to the video “moves” with objects in the video and with patrons as they traverse walkway. |
| US11885142B2 |
Stair and walkway system and method
Disclosed is an arrangement including a staircase as well as walkway systems. The staircase includes a transitional member, and the walkways incorporate grate supports in order to facilitate the connection to adjacent structures. The arrangement also utilizes angled members which are configured with a reinforced flange existing in a dimension that has higher load requirements than the other flange. A novel step configuration is also disclosed. |
| US11885140B2 |
Prefabricated tile strip
A prefabricated tile strip includes a backing board, a tile region having plural tiles and grout. The grout can be composed of a resin/polymer-based grout that allows for superior water resistance, stain resistance, crack resistance and is transportable without breaking. The strip includes an edge region or flange on either side of the tiles to allow for simple screw in and glue on assembly, not even a wall is necessary, the strip can be attached directly to the studs. A step over/under water resistant edges can go directly onto a bathtub or shower ledge or onto the wet area of a tile floor (not separate ledge), allowing it to go straight down to the bottom of a shower floor, or It can step right over a thin plastic flange on a tub or shower base. |
| US11885139B2 |
Mounting device for building surfaces having elongated mounting slot
A mounting device or bracket for paneled building surfaces is disclosed. The mounting bracket includes an upper wall in the form of a flat surface for supporting various types of attachments. An elongated mounting slot extends through the upper wall, and the mounting bracket includes an elongated nut receptacle that is positioned below this elongated mounting slot. With an attachment being positioned on the upper wall, an attachment fastener may be directed through the attachment, then through the elongated mounting slot, and then may be threadably engaged with a nut that is positioned within and movable along the nut receptacle in its elongated dimension. The elongated configuration of the mounting slot and nut receptacle provides adjustability for the position of the attachment fastener relative to the mounting bracket, including after the mounting bracket has already been installed on the building surface. |
| US11885136B2 |
Handrail, kit, and method for installation of same
A handrail kit that includes a cover, a first endcap, a second endcap, and a support member is provided. The support member includes a longitudinal axis, a first end along the longitudinal axis, a second end along the longitudinal axis, a first lateral side, a second lateral side, a first longitudinal side, and a second longitudinal side. The first lateral side of the support member is configured to be secured directly against a mounting surface. The first endcap is configured to mate with the first end of the support member and the second endcap is configured to mate with the second end of the support member. The cover is configured to be placed over the second lateral side of the support member and to engage the first longitudinal side and the second longitudinal side of the support member. |
| US11885133B2 |
Soffit vent
An exterior elevated assembly with a walking surface is described which has features for facilitating inspection of the interior support frame of the assembly. The assembly includes a support frame for the walking surface, which defines an interior space and a soffit covering an underside of the support frame. The soffit provided with an opening. A vent panel is provided for covering the opening and a vent panel retention mechanism is provided for reversibly holding the vent panel in place over the opening. Methods and kits for installing a vent panel in a soffit of an exterior elevated assembly with a walking surface are also described. |
| US11885132B2 |
Non-combustible, net-zero energy building systems
Methods, systems, and apparatus for constructing a wall panel and building are disclosed. The wall panel can include: fiber-reinforced concrete layers including concrete with interwoven fibrous materials; an insulation layer; and a connector. The insulation layer is sandwiched between the fiber-reinforced concrete layers, and the connector extends through the insulation layer and concrete layers to create composite action between the insulation layer and the concrete layers. |
| US11885130B2 |
Ceiling grid lighting assembly with configured alignment
A ceiling grid lighting assembly for use in suspended ceiling systems is provided with multiple linear lighting modules in parallel arrangement. End plates are used to connect, support, and enclose longitudinal ends of the elongate body of each linear lighting modules while simultaneously functioning as reflective faces for optical cavities. A configured gap spacing between individual linear lighting modules can be used to house and support components such as additional light sources, acoustic or decorative panels, HVAC components, or power systems, controls or sensors. The end plate can also be configured to allow a T-bar to be placed in the configured gap spacing thereby enabling the mounting of the assembly in-line upon the longitudinal axis of a ceiling grid T-bar. Embodiments of linear lighting modules are presented comprising LED light sources, light guides and diffusers housed within the elongate body. The light guides may be edgelit from one or two sides and aligned horizontally or tilted relative to the ceiling grid plane. |
| US11885124B2 |
Prefabricated construction wall assembly
A prefabricated construction wall assembly comprising: a frame structure having a first thermal expansion coefficient; and a panel configured for covering at least a majority of the a face of the frame structure, said panel having a second thermal expansion coefficient different from the first thermal expansion coefficient, and a solid-surface exterior face exposed to an exterior of the wall assembly and an interior face connected to the face of the frame structure so as to withstand the thermal structural differences between the frame structure and the exterior face. |
| US11885121B2 |
System and method for protecting structures
Systems and methods are disclosed for protecting structures. In example embodiments, one or more waterproof barrier panels are sealed to one or more exterior walls of the structure. In other example embodiments, the barrier system comprises a plurality of sealing elements, protective panels and, optionally, tracks comprising shackles or hooks for suspending the protective panels. The barrier panel optionally comprises a thermoplastic olefin, and further optionally comprises a fire-resistant material. |
| US11885117B2 |
Structure having edge reinforcement on profiled rail
A profiled rail assembly for casting into concrete. The profiled rail assembly includes a profiled rail including a rail body having a rail slot extending in the direction of a longitudinal axis of the profiled rail, and a reinforcing body including a head element and at least one tension element protruding from the head element, the head element opposite the at least one tension element having a head element major face defining a contact surface for a formwork element. The at least one tension element is connected to the profiled rail. |
| US11885113B2 |
Drain system for use with a tile floor
A drain system includes a drain cover positionable over a drain opening in a floor. The drain cover has a sidewall extending about a periphery of the drain cover and a release surface on the sidewall tapering or sloping inwardly toward a bottom of the drain cover. The release surface is arranged to interface with a support frame configured to support and position the drain cover over the drain opening and reduce frictional and shear forces between the drain cover and the support frame during removal of the drain cover from the support frame. |
| US11885109B2 |
Washdown flush toilet
In a washdown flush toilet, a water discharge trap conduit includes: an inlet pipe part connected to a bowl part receiving waste; a trap ascending pipe part connected to the inlet pipe part and forming an ascending flow channel; and a trap descending pipe part connected to the trap ascending pipe part and forming a descending flow channel. With regard to a cross section perpendicular to a flow direction of the ascending flow channel, a portion on a downstream side of the ascending flow channel is provided with an enlarged part having a cross section area larger than that on an upstream side of the ascending flow channel. A downstream end of the ascending flow channel and/or an upstream side of the descending flow channel is provided with a shrunk part having a cross section area smaller than that on the upstream side of the ascending flow channel. |
| US11885108B2 |
Work machine and periphery monitoring system
In a hydraulic excavator including a machine body and a front work device, when an object is detected by sensors for detecting an object around the machine body when operation limiting control for limiting the operation of at least one of the machine body and the front work device is enabled, or when an operation device is operated, the detection of the object is notified to an operator by a first state warning, and when the operation limiting control is enabled and when the operation device is not operated, the detection of the object is notified to the operator by a second state warning that is weaker in warning intensity than the first state warning. Accordingly, the botheration for the operator can be suppressed while securing the effectiveness of an alarm in periphery monitoring, and the safety performance can be enhanced. |
| US11885107B2 |
Hose support structure, link for work vehicle, and work vehicle
A hose support structure includes a first round bar and a second round bar provided on a mounting surface of a first plate and extending in a first direction. A first restraint and a second restraint face the mounting surface in a second direction and are provided between the first round bar and the second round bar in a third direction. The first restraint extends from a first proximal end toward a first distal end in a fourth direction, and the second restraint extends in a fifth direction opposite to the fourth direction from a second proximal end connected to the first proximal end. A third restraint is provided opposite to the second restraint with respect to the first restraint in the first direction. At least a part of the second restraint is separated from the mounting surface by a second distance shorter than the first distance in the second direction. |
| US11885106B2 |
Working machine
A working machine includes: a support bracket provided on a machine body and including a boom pivotal support portion and a cylinder pivotal support portion; a boom pivotally supported by the boom pivotal support portion; a boom cylinder pivotally supported at the cylinder pivotal support portion and the boom, and causing the boom to swing upward and downward; a hydraulic hose extended through the support bracket from the rear of the support bracket to the front of the support bracket and connected to the boom cylinder; a first clamp to retain the hydraulic hose on the support bracket; and a second clamp to retain the hydraulic hose on the boom cylinder. The support bracket includes a through hole through which the hydraulic hose is passed in a fore-and-aft direction. The first clamp is disposed rearward of the through hole and forward of the rear end of the boom shaft. |
| US11885101B2 |
Remote operation system and remote operation server
Provided is a system which can avoid instability of an operating state of a working machine, when switching a remote operation actor of the working machine. In a case where a state of one or both of a working machine 40 or a first operator is a specified state when the working machine 40 is remotely operated through a first remote operation apparatus 10, a first notification corresponding to the specified state is transmitted to a remote operation server 30. In the remote operation server 30, a second remote operation apparatus 20 which is appropriate in view of content of the first notification is selected as the remote operation actor of the working machine 40. |
| US11885100B2 |
Quad track skid-steer loader
Disclosed embodiments are directed to quad track skid-steer loaders and power machines having a frame, a cab, and a lift arm assembly pivotally coupled to the frame rearward of at least a portion of the cab and extending forward of the frame. A first axle assembly and a second axle assembly on a first side of the frame mount first and second track assemblies. A third axle assembly and a fourth axle assembly on a second side of the frame mount third and fourth track assemblies. A first drive motor rotates the first and second axles to drive the first and second track assemblies and a second drive motor rotates the third and fourth axles to drive the third and fourth track assemblies. |
| US11885098B2 |
Serrated blade assembly using differently configured components
A wear member comprises a shank portion defining a longitudinal axis, a free end and a perimeter, at least one flat surface on the perimeter extending to the free end and a cross-hole defining a cross-hole axis along which the cross-hole extends through the at least one flat surface perpendicularly, and a wear portion extending downwardly axially from the shank portion, the wear portion including a polygonal configuration. |
| US11885095B1 |
Loader with improved arm path
A compact utility loader compact utility loader comprising a frame, a first track and a second track positioned on either side of the frame, and a pair of loader arms. The loader arms are configured to couple with an attachment via a hitch plate and a hitch pin. The compact utility loader is configured such that as the loader arms are raised and lowered, the hitch pin follows a path approximately defined by a curve ƒ(x)=4.641e0.34x The value “x” represents a horizontal direction and the function f(x) represents a vertical direction. |
| US11885094B2 |
Product and method for sealing and lubricating sewer manhole assemblies
A sewer manhole cover includes a frame having an access aperture and a cover for covering the access aperture. A primary seal is generated when the cover is placed on the frame either by way of contact between the frame and cover or by way of a gasket received within a groove formed into one of the frame or cover, wherein the gasket is compressed between the frame and cover. A method is provided for generating a secondary seal between the frame and cover by applying an amount of a viscous compound to a circumferential surface of the frame or cover, wherein the secondary seal is formed when the cover compresses the compound when the cover is received within the frame. |
| US11885093B2 |
Method of installing a hybrid foundation for offshore wind turbines
A method of installing a hybrid foundation for an offshore wind turbine, the method includes providing a monopile, friction wheel, and suction bucket; installing the friction wheel and suction bucket in the sea floor; and inserting the monopile through the opening into the sea floor. |
| US11885090B2 |
Frame rail assemblies and interlocking frame rail systems
A frame rail assembly for a boat dock structure includes a frame rail member and a removable resilient rub-rail member. The frame rail member includes a first side configured for securing the frame rail member to a side of the boat dock structure; a second side opposing the first side; a first channel extending along a length of the frame rail member; and a second channel below the first channel, the second channel extending along the length of the frame rail member. An interlocking frame rail system for boat dock structures includes a first frame rail member, a second frame rail member, and an upper connector member extending along at least a portion of a length of the first frame rail member and at least a portion of the length of a second frame rail member. |
| US11885082B2 |
Deck system
A deck system is disclosed having a mounting plate with a planar support surface and at least one locating rod extending from the support surface. The locating rod extends in a direction that is substantially perpendicular to the support surface. A beam having a first end and a second end is positioned on the support surface of the mounting plate. The first and second ends of the beam have a slot and the slot is disposed for receiving the locating rod. At least one tread is disposed to extend between the two spaced apart parallel oriented beams. The tread has opposed shoulders on the side of the tread that engages the spaced apart beams. The opposed shoulders are disposed for engaging a side of the spaced apart beams that are in adjacent relationship. |
| US11885076B2 |
Roadway infrastructure for autonomous vehicles
An elevated roadway for autonomous vehicles may include a pylon extending vertically from a ground anchor and comprising a metal tube defining a central cavity and a concrete column within the central cavity. The elevated roadway further includes a bracket coupled to the pylon and comprising a mounting plate secured to the pylon and a cantilevered road support member extending from the mounting plate. The elevated roadway may further include a cantilevered road section coupled to the pylon via the cantilevered road support member and comprising a joist structure structurally coupled to the cantilevered road support member, a road member above the joist structure and supported by the joist structure, and first and second side barriers along first and second sides of the road member, respectively. The road member may be adapted to receive a four-wheeled roadway vehicle. |
| US11885074B2 |
Tie plate dispenser and method therefore
Present embodiments relate to a tie plate dispenser which selectively changes the orientation of the tie plates being ejected, if needed. An actuator is used to flip the tie plate as it falls from an ejection location of the dispenser. |
| US11885073B2 |
Durable and dispersible creped mutli-ply tissue
Disclosed are multi-ply tissue products comprising a non-crosslinked binder that are durable and dispersible. The products generally have a Slosh time less than 2 minutes, such as less than about 60 seconds, such as less than about 45 seconds. Surprisingly, the foregoing Slosh times are achieved despite the tissue products having relatively high cross-machine direction (CD) wet tensile strength, such as greater than about 100 g/3″. Typically, increasing wet tensile strength, particularly wet CD tensile strength, negatively effects dispersability and increases Slosh time. Despite this trend, the present invention surprisingly provides a tissue product having a relatively high degree of wet strength and good dispersability. |
| US11885071B2 |
Aramid-mica composite insulating nanopaper and preparation method thereof
An aramid-mica composite insulating nanopaper and a preparation method thereof are disclosed. A mixture of mica and urea is subjected to a solid-phase ball milling, to obtain nano mica modified with amino groups on the surface, which is then assembled with the aramid nanofiber by stepwise suction filtration according to the present disclosure, to form an ordered nanopaper, thereby obtaining an aramid-mica composite insulating nanopaper with ultra-high insulation performances. |
| US11885069B2 |
Processes, methods, and systems for chemo-mechanical cellular explosion and solid and liquid products made by the same
Disclosed herein is a process, comprising combining one or more additives with a feedstock to obtain a first mixture, the feedstock comprising a fibrous material and water, the fibrous material comprising lignin, cellulose, and hemicellulose; and conditioning the first mixture to obtain a liquid product and a dry pulp product. Also disclosed herein are condition processes and machines for use with the same. Also disclosed herein are liquid products, dry pulp products, and fibrous pellets made by the disclosed processes, and methods of using the same. |
| US11885067B2 |
Warp transferring machine
A warp transferring machine includes a color transferring unit, a colored paper unit and a yarn arranging unit. The color transferring unit includes a heating roller, a driving shaft, a separable shaft, a supporting shaft that are rotatable about their respective axes and a pressing belt that is looped therearound to circulate continuously. The colored paper unit and the yarn arranging unit respectively guide a colored paper and a yarn toward the heating roller such that the pressing belt presses thereagainst so as to transfer colors of the colored paper onto the yarn. |
| US11885064B2 |
Apparatus for drying laundry or other items using ultraviolet radiation
An apparatus for drying laundry with ultraviolet radiation is provided. One or more ultraviolet light sources emit ultraviolet radiation, which, in various embodiments, is transmitted through a UV-radiation permeable transparent drum containing the wet laundry and other wet articles to be dried. Also provided is a dryer having ultraviolet light sources centrally situated with respect to the drum, wherein the ultraviolet light sources emit ultraviolet radiation directed at laundry in the drum. |
| US11885061B2 |
Washing machine appliance spacer assembly
A washing machine appliance is provided, including a cabinet having a rear panel, a wash tub located within the cabinet, and a shipping spacer assembly. The shipping spacer assembly is removably attached to the wash tub for fixing a distance between the wash tub and the cabinet in an installed position. The shipping spacer assembly includes a bolt, a spacer, and a locking mechanism. The bolt includes a shaft extending along an axial direction, and a head located at one end of the shaft. The bolt defines a lock-receiving feature along the shaft. The spacer defines a bolt cavity extending along the axial direction and removably receives the shaft. The locking mechanism removably engages the bolt at the lock-receiving feature to secure the spacer to the bolt. |
| US11885059B2 |
Suspension system
A laundry appliance includes a cabinet frame that defines a receiving aperture. A tub is disposed within the cabinet frame. A suspension support includes an engagement portion. The engagement portion includes an ejection surface sloping in a first direction and an assembling surface sloping in a second opposing direction to a retaining notch. A suspension rod extends between the tub and the suspension support and has a hook for selectively engaging the assembling surface in an installed position and selectively engaging the ejection surface in a misaligned position. |
| US11885058B2 |
Laundry treating appliance and method of operation
A laundry treating appliance for treating laundry items according to a cycle of operation includes a chassis defining an interior. A rotatable treating chamber is located within the interior. An antenna is configured to receive RFID data from RFID tags on the laundry items and outputs a signal indicative of the RFID data. A controller receives the signal from the antenna and is configured to process the signal and to suggest, alter, or implement the cycle of operation based on the signal. |
| US11885052B2 |
Braiding machines and carriers for braiding machines
A carrier for supporting a yarn to be used by a braiding machine, has: a spool carrying the yarn; a motor drivingly engaged to the spool; at least one sensor for producing data about a condition of the yarn in the spool; and a controller operatively connected to the motor and to the at least one sensor, the controller having a processor and a computer-readable medium operatively connected to the processor and having instructions stored thereon executable by the processor for: receiving said data from the at least one sensor; determining operation parameters of the motor based on the received data; and operating the motor per the determined operation parameters to create the desired tension in the yarn. |
| US11885049B2 |
Mesh belt used in apparatus for producing water absorbing body
A mesh belt used in a process for producing a water absorbing body which is formed by warps and wefts being woven with each other. One or more yarns which constitute(s) the warps or the wefts emerging on at least a transporting surface side of the mesh belt is made of an electrically conductive material. |
| US11885046B2 |
Web stretching device disposed between a carding device and a cross-lapper
Apparatus for forming a fibre mat, in particular a non-woven mat, comprising a fibre web-forming device, for example a card, a cross-tapper and a device for drafting the fibre web(s) disposed between the web forming device and the cross-lapper in order to draft the fibre web(s), in particular in a time-varying, specifically periodic manner, to thereby adjust a predetermined desired profile of the fibre mat leaving the cross-lapper, the web-forming device comprising at least one output belt (1, 2) for at least one web (5, 6), and preferably two output belts (1, 2) for two webs (5, 6), an upper and lower web respectively; wherein the cross-hipper has an input belt (7) for receiving the web(s) from the output belt(s) of the web forming device, characterised in that the arrangement is such that the path of the web, or of the at least one web, and preferably of the two, upper and lower, webs, between the output belt(s) of the web-forming device, in particular the card, and the input belt of the cross-lapper includes at least one inflection point (11, 12). |
| US11885044B2 |
Method for producing polypropylene nonwoven fabric
The polypropylene nonwoven fabric produced by the method for producing a polypropylene nonwoven fabric according to the present invention has features that it has excellent stretchability and excellent water pressure resistance. |
| US11885042B2 |
Spinneret assembly for spinning polymeric fibers
A spinneret assembly for spinning polymeric fibers, including: (a) a cap provided with an inlet port and a flared lower surface that flares outwardly from the inlet port in the direction of flow; (b) a spinneret having numerous spinning flow channels through its thickness; (c) a filter freely resting on the spinneret; and (d) a flow guide with a tapered geometry mounted in a cavity defined by the cap and the spinneret. The flow guide has an apex facing the inlet port, a base facing the filter, and one or more side surfaces tapering up to the apex. A diverging flow passage is defined by the tapering side surface(s) of the flow guide and the cap's flared lower surface. The base of the flow guide is spaced apart from an upper surface of the spinneret, creating a space that is in fluid communication with the divergent flow passage. |
| US11885035B2 |
Formation of lining layers in the cathode shells of aluminium electrolytic reduction cells
This disclosure relates to non-ferrous metallurgy and electrolytic production of Aluminium for lining a cathode assembly of an electrolytic cell. The present method includes laying materials while simultaneously distributing same over the surface of a base and levelling them at a height measured from the plane of the top edge of the shell of the cathode assembly of the electrolytic cell by gradually moving a device for installing unformed lining materials along a longitudinal axis of the cathode of the Aluminium electrolytic cell. Said device is configured in the form of a bridge equipped with a mechanical drive for movement. The bridge has guides on which a frame is mounted for vertical movement, said frame having cassettes provided with gates with a mechanical drive. The technical result is reduced labor costs, healthier working conditions for operatives, and better quality installation of the base of an electrolytic cell. |
| US11885034B2 |
Electrical power generation systems and methods regarding same
A solid or liquid fuel to plasma to electricity power source that provides at least one of electrical and thermal power comprising (i) at least one reaction cell for the catalysis of atomic hydrogen to form hydrinos, (ii) a chemical fuel mixture comprising at least two components chosen from: a source of H2O catalyst or H2O catalyst; a source of atomic hydrogen or atomic hydrogen; reactants to form the source of H2O catalyst or H2O catalyst and a source of atomic hydrogen or atomic hydrogen; one or more reactants to initiate the catalysis of atomic hydrogen; and a material to cause the fuel to be highly conductive, (iii) a fuel injection system such as a railgun shot injector, (iv) at least one set of electrodes that confine the fuel and an electrical power source that provides repetitive short bursts of low-voltage, high-current electrical energy to initiate rapid kinetics of the hydrino reaction and an energy gain due to forming hydrinos to form a brilliant-light emitting plasma, (v) a product recovery system such as at least one of an augmented plasma railgun recovery system and a gravity recovery system, (vi) a fuel pelletizer or shot maker comprising a smelter, a source or hydrogen and a source of H2O, a dripper and a water bath to form fuel pellets or shot, and an agitator to feed shot into the injector, and (vii) a power converter capable of converting the high-power light output of the cell into electricity such as a concentrated solar power device comprising a plurality of ultraviolet (UV) photoelectric cells or a plurality of photoelectric cells, and a UV window. |
| US11885033B2 |
Electrode structure for electrolyzer
Disclosed are an electrode structure including: an electrode plate; and a flow path guide disposed on one side of the electrode plate along the circumference of the electrode plate, and an electrolyzer including the electrode structure. |
| US11885031B2 |
Modular electrocatalytic processing for simultaneous conversion of carbon dioxide and wet shale gas
An apparatus for converting carbon dioxide and natural gas liquids into other chemicals and/or fuels, comprising at least one electrochemical cell, wherein the electrochemical cell reduces the endothermic load associated with electrochemical CO2 reduction, and a method for converting carbon dioxide and natural gas liquids into carbon monoxide and other chemicals and/or fuels, comprising converting CO2 into CO and converting C2H6 into C2H4 at a temperature in the range of 650° C.-750° C. |
| US11885028B2 |
Method of selectively interrupting a passive cathodic protection unit from a metallic structure
A method for changing an activation state of an interruption module for selectively interrupting at least one passive cathodic protection unit from a metallic structure. The method includes enabling a global positioning system (GPS) receiver in data communication with a controller of the interruption module, receiving GPS time via the GPS receiver from at least one global positioning system satellite in data communication therewith, synchronizing a real-time clock time of a real-time clock in data communication with the controller to GPS time, disabling the GPS receiver and changing the activation state of the interruption module if a predetermined activation state change time of the interruption module is between the local real-time clock time and the GPS time. |
| US11885025B2 |
High-strength steel sheet having excellent moldability and impact resistance, and method for manufacturing high-strength steel sheet having excellent moldability and impact resistance
A high-strength steel sheet includes a chemical composition including: by mass %, C: 0.080 to 0.500%, Si: 2.50% or less, Mn: 0.50 to 5.00%, P: 0.100% or less, S: 0.0100% or less, Al: 0.001 to 2.500%, N: 0.0150% or less, O: 0.0050% or less, and the balance: Fe and inevitable impurities. The high-strength steel sheet satisfying a predetermined formula has a microstructure in a region from ⅛t to ⅜t from a steel sheet surface. The microstructure includes: by volume %, 20% or more of acicular ferrite, 20% or more of an island-shaped hard structure including residual austenite, 2% to 25% of residual austenite, and 20% or less of aggregated ferrite. |
| US11885024B2 |
Gas introduction structure and processing apparatus
A gas introduction structure extends in a longitudinal direction of a processing container having a substantially cylindrical shape to supply gas into the processing container. The gas introduction structure includes an introduction section that partitions an introduction chamber, an ejection section that partitions a plurality of ejection chambers each including a plurality of gas holes through which the gas is ejected into the processing container, and a branch section that partitions a branch chamber connected to the introduction chamber. The branch chamber is branched to correspond to the number of ejection chambers in a tournament manner and connected to the ejection chambers. |
| US11885023B2 |
Substrate retaining apparatus, system including the apparatus, and method of using same
A substrate retaining apparatus, a load lock assembly comprising the substrate retaining apparatus, and a system including the substrate retaining apparatus are disclosed. The substrate retaining apparatus can include at least one sidewall and one or more heat shields. One or more of the at least one sidewall can include a cooling fluid conduit to facilitate cooling of substrates retained by the substrate retaining apparatus. Additionally or alternatively, one or more of the at least one sidewall can include a gas conduit to provide gas to a surface of a retained substrate. |
| US11885021B2 |
Gas supply member with baffle
A gas supply member includes a first side opposite a second side and an inner surface defining a first opening extending between the first and second sides. The gas supply member includes a third side orthogonal to the first side, the third side includes a first extension that has a face partially defining the second side, and the first extension includes a first plurality of holes extending through the first extension to the face. The gas supply member includes a fourth side opposite the third side, the fourth side includes a protrusion that has a face partially defining the second side. The gas supply member also includes a baffle disposed adjacent to the inner surface, the baffle includes a first portion extending from the inner surface and a second portion attached to the first portion, and the second portion orthogonal to the first portion and parallel to the third side. |
| US11885008B2 |
Film forming apparatus and method for reducing arcing
Embodiments of the present disclosure provide a substrate processing system. In one embodiment, the system includes a chamber, a target disposed within the chamber, a magnetron disposed proximate the target, a pedestal disposed within the chamber, and a first gas injector disposed at a sidewall of the chamber. The first gas injector includes a first gas channel extending through a body of the first gas injector, the first gas channel has a first gas outlet. The first gas injector also includes a second gas channel extending through the body of the first gas injector, wherein the second gas channel has a second gas outlet. The second gas channel includes a first portion, and a second portion branching off from an end of the first portion, wherein the second portion is disposed at an angle with respect to the first portion, and the first gas injector is operable to rotate about a longitudinal center axis of the body of the first gas injector. |
| US11884998B2 |
Surface treated steel sheet
Provided is a surface treated steel sheet which includes a base metal, and a plated layer formed on a surface of the base metal, wherein an average composition of the plated layer contains, in mass %, Mg: 0.5 to 2.0%, and [60.0≤Zn+Al≤98.0], [0.4≤Zn/Al≤1.5], and [Zn/Al×Mg≤1.6] are satisfied. |
| US11884997B2 |
Hot rolled plate or forging of an austenitic steel
A hot rolled plate or forging of an austenitic steel not susceptible to relaxation cracking is provided. The hot rolled plate or austenitic steel includes a composition having in percentages by weight: 0.019%≤C≤0.030%, 0.5%≤Mn≤2%, 0.1%≤Si≤0.75%, Al≤0.25%, 18%≤Cr≤25%, 14%≤Ni≤17%, 1.5%≤Mo≤3%, 0.001%≤B≤0.008%, 0.25%≤V≤0.35%, 0.23%≤N≤0.27%, the balance being iron and unavoidable impurities, Ni(eq.)≥1.11 Cr(eq.)−8.24, Cr(eq)=Cr+Mo+1.5Si+5V+3Al+0.02, Ni(eq)=Ni+30C+x(N−0.045)+0.87; x=30 for N≤0.2, x=22 for 0.2 |
| US11884993B2 |
Process for leaching metal sulfides with reagents having thiocarbonyl functional groups
This application pertains to methods of recovering metals from metal sulfides that involve contacting the metal sulfide with an acidic sulfate solution containing ferric sulfate and a reagent that has a thiocarbonyl functional group, wherein the concentration of reagent in the acidic sulfate solution is sufficient to increase the rate of metal ion extraction relative to an acidic sulfate solution that does not contain the reagent, to produce a pregnant solution containing the metal ions. |
| US11884990B2 |
High strength hot rolled or cold rolled and annealed steel and method of producing it
A steel strip or sheet having a complex phase microstructure including one or more of ferrite, carbide free bainite, martensite and/or retained austenite in its microstructure including: 0.16-0.25 wt. % C; 2.3-4.00 wt. % Mn; 5-50 ppm B; 5-100 ppm N; 0.001-1.10 wt. % Al tot; 0.05-1.10 wt. % Si; 0-0.04 wt. % Ti; 0-0.10 wt. % Cu; 0-0.10 wt. % Mo; 0-0.10 wt. % Ni; 0-0.20 wt. % V; 0-0.05 wt. % P; 0-0.05 wt. % S; 0-0.10 wt. % Sn; 0-0.025 wt. % Nb 0-0.025 wt% Ca; remainder iron and inevitable impurities. |
| US11884987B2 |
Galvannealed steel sheet
A method for the manufacture of a galvannealed steel sheet including the provision of a specific steel sheet, a recrystallization annealing with specific heating, soaking and cooling sub-steps using an inert gas, a hot-dip galvanizing and an alloying treatment; the galvannealed steel sheet and the use of the galvannealed steel sheet. |
| US11884980B2 |
Method for detection of traumatic brain injury
The present disclosure describes significant methylation changes in multiple genes and multiple metabolites in body fluid in response to TBI. Gene pathways affected included several known to be involved in neurological and brain function. A large number of good to excellent biomarkers for the detection of TBI was identified. The combination of epigenomic, clinical and metabolomic markers in different combinations overall were highly accurate for the detection of pediatric concussion using Artificial Intelligence-based techniques. |
| US11884978B2 |
Pathogen biomarkers and uses therefor
Disclosed are compositions, methods and apparatus for diagnosing and/or monitoring a virus-associated systemic inflammation by measurement of a host immune response. The invention can be used for diagnosis including early diagnosis, monitoring, making treatment decisions, or management of subjects suspected of having systemic inflammation associated with an infection. More particularly, the present disclosure relates to peripheral blood RNA and protein biomarkers that are useful for specifically distinguishing between the host systemic immune response to viruses as compared to the host immune response to other causes of systemic inflammation. |
| US11884977B2 |
Nanoarrays and methods of use thereof
Disclosed herein, inter alia, are nanoarrays and methods of use thereof. |
| US11884975B2 |
Sequencing methods and compositions for prenatal diagnoses
The invention provides methods for determining aneuploidy and/or fetal fraction in maternal samples comprising fetal and maternal cfDNA by massively parallel sequencing. The method comprises a novel protocol for preparing sequencing libraries that unexpectedly improves the quality of library DNA while expediting the process of analysis of samples for prenatal diagnoses. |
| US11884974B2 |
TIM-3 nanobody, a preparation method thereof, and use thereof
The application belongs to the technical field of animal or human antibodies, and discloses a TIM-3 nanobody, a preparation method thereof and use thereof. The nanobody is a TIM-3 nanobody with sequence of SEQ ID NO:1. TIM-3 antigen is a transient transfection expression by mammalian cells. TIM-3 antigen is used to screen the nanobody library repeatedly, specific phage of nanobody is obtained, and the target fragment is conducted sequencing. The application uses the HEK293 cell line to express antigen. Using the mammalian expression system to express human protein may maximumly guarantee the original structure of the protein, guarantee the protein to have a post-translational modification and specific modifications of eukaryotic proteins such as glycosylation, which makes the obtained protein have high activity. This method maximizes the original structure and activity of the protein; the nanobodies screened by the application can efficiently and specifically bind to the target. <110> Shihezi University <120> TIM-3 nanobody, a preparation method thereof, and use thereof <160> 3 <210> 1 <211> 1049 <212> DNA <213> Artificial Sequence <400> 1 GGTGGGCGGA CATTTCACAA GCTTAAGGAG ACAGTACATA TGAAATACCT ATTGCCTACG GCAGCCGCTG GATTGTTATT ACTCGCGGCC CAGCCGGCCA TGGCCCAGGT GCAGCTGCAG GAGTCTGGAG GAGGCTTGGT GCAGCCTGGG GGGTCTCTGA GACTCTCCTG TGCAGCCTCT GGGTTCACCT TCCGTAGATC TATTCTGAAA TGGCTCCGAC AGGCTCCAGG GAAGGAACTG GAGTGGGTGT CCACTATAGA TACATACTCT AATAACACAT ACTATGAAGA CTCCTTGAAG GGCCGATTCA CCATCTCCGC AGACAACGCC AAGAACACGC TGTATCTGCA AATGGACAGC CTGAAACCTG AGGACACGGC CGTGTATTAC TGTGCAAAGG GTGGAGGTGG TATCTACTCC CGCACGTATG ACTACCGGGG CCAGGGGACC CAGGTCACCG TCTCCTCAGC GGCCGCATAC CCGTACGACG TTCCGGACTA CGGTTCCCAC CACCATCACC ATCACTAGAC TGTTGAAAGT TGTTTAGCAA AACCTCATAC AGAAAATTCA TTTACTAACG TCTGGAAAGA CGACAAAACT TTAGATCGTT ACGCTAACTA TGAGGGCTGT CTGTGGAATG CTACAGGCGT TGTCGTTTGT ACTGGTGACG AAACTCAGTG TTACGGTACA TGGGTTCCTA TTGGGCTTGC TATCCCTGAA AATGAGGGTG GTGGCTCTGA GGGTGGCGGT TCTGAGGGTG GCGGTTCTGA GGGTGGCGGT ACTAAACCTC CTGAGTACGG TGATACACCT ATTCCGGGCT ATACTTATAT CAACCCTCTC GACGGCACTT ATCCGCCTGG TACTGAGCAA AACCCCGCTA ATCCTAATCC CTTCTCTTGA GGAGTCTCAG CCTCTTATAC TTTCATGTTT CAGATATAGG TTCCGAAATA GGCAGGTGCA TTAACTGTTA TACGGGCACT GTACTCATGC ACTGACCCCG TTAAACTTAT TACCAGTACA CTCCTGTATC ATCAAAAGCC ATGTATGA <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 GACACGAATTCGCCACCATGTTCAGCCACC <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <400> 3 GTGTCAAGCTTTCACTTGTCATCATCATCCTTGTA <210> 4 <211> 4541 <212> DNA <213> Unknown <400> 4 GAGCGCCCAA TACGCAAACC GCCTCTCCCC GCGCGTTGGC CGATTCATTA ATGCAGCTGG CACGACAGGT TTCCCGACTG GAAAGCGGGC AGTGAGCGCA ACGCAATTAA TGTGAGTTAG CTCACTCATT AGGCACCCCA GGCTTTACAC TTTATGCTTC CGGCTCGTAT GTTGTGTGGA ATTGTGAGCG GATAACAATT TCACACAGGA AACAGCTATG ACCATGATTA CGCCAAGCTT GCATGCAAAT TCTATTTCAA GGAGACAGTC ATAATGAAAT ACCTATTGCC TACGGCAGCC GCTGGATTGT TATTACTCGC GGCCCAGCCG GCCATGGCCC AGGTGCAGCT GCAGGAGTCT AGAGGGGACC CAGGTCACCG TCTCCTCAGC GGCCGCATAC CCGTACGACG TTCCGGACTA CGGTTCCCAC CACCATCACC ATCACTAGAC TGTTGAAAGT TGTTTAGCAA AACCTCATAC AGAAAATTCA TTTACTAACG TCTGGAAAGA CGACAAAACT TTAGATCGTT ACGCTAACTA TGAGGGCTGT CTGTGGAATG CTACAGGCGT TGTGGTTTGT ACTGGTGACG AAACTCAGTG TTACGGTACA TGGGTTCCTA TTGGGCTTGC TATCCCTGAA AATGAGGGTG GTGGCTCTGA GGTGGCGGT TCTGAGGGTG GCGGTTCTGA GGGTGGCGGT ACTAAACCTC CTGAGTACGG TGATACACCT ATTCCGGGCT ATACTTATAT CAACCCTCTC GACGGCACTT ATCCGCCTGG TACTGAGCAA AACCCCGCTA ATCCTAATCC TTCTCTTGAG GAGTCTCAGC CTCTTAATAC TTTCATGTTT CAGAATAATA GGTTCCGAAA TAGGCAGGGT GCATTAACTG TTTATACGGG CACTGTTACT CAAGGCACTG ACCCCGTTAA AACTTATTAC CAGTACACTC CTGTATCATC AAAAGCCATG TATGACGCTT ACTGGAACGG TAAATTCAGA GACTGCGCTT TCCATTCTGG CTTTAATGAG GACCCATTCG TTTGTGAATA TCAAGGCCAA TCGTCTGACC TGCCTCAACC TCCTGTCAAT GCTGGCGGCG GCTCTGGTGG TGGTTCTGGT GGCGGCTCTG AGGGTGGCGG CTCTGAGGGT GGCGGTTCTG AGGGTGGCGG CTCTGAGGGT GGCGGTTCCG GTGGCGGCTC CGGTTCCGGT GATTTTGATT ATGAAAAAAT GGCAAACGCT AATAAGGGGG CTATGACCGA AAATGCCGAT GAAAACGCGC TACAGTCTGA CGCTAAAGGC AAACTTGATT CTGTCGCTAC TGATTACGGT GCTGCTATCG ATGGTTTCAT TGGTGACGTT TCCGGCCTTG CTAATGGTAA TGGTGCTACT GGTGATTTTG CTGGCTCTAA TTCCCAAATG GCTCAAGTCG GTGACGGTGA TAATTCACCT TTAATGAATA ATTTCCGTCA ATATTTACCT TCTTTGCCTC AGTCGGTTGA ATGTCGCCCT TATGTCTTTG GCGCTGGTAA ACCATATGAA TTTTCTATTG ATTGTGACAA AATAAACTTA TTCCGTGGTG TCTTTGCGTT TCTTTTATAT GTTGCCACCT TTATGTATGT ATTTTCGACG TTTGCTAACA TACTGCGTAA TAAGGAGTCT TAATAAGAAT TCACTGGCCG TCGTTTTACA ACGTCGTGAC TGGGAAAACC CTGGCGTTAC CCAACTTAAT CGCCTTGCAG CACATCCCCC TTTCGCCAGC TGGCGTAATA GCGAAGAGGC CCGCACCGAT CGCCCTTCCC AACAGTTGCG CAGCCTGAAT GGCGAATGGC GCCTGATGCG GTATTTTCTC CTTACGCATC TGTGCGGTAT TTCACACCGC ATATAAATTG TAAACGTTAA TATTTTGTTA AAATTCGCGT TAAATTTTTG TTAAATCAGC TCATTTTTTA ACCAATAGGC CGAAATCGGC AAAATCCCTT ATAAATCAAA AGAATAGCCC GAGATAGGGT TGAGTGTTGT TCCAGTTTGG AACAAGAGTC CACTATTAAA GAACGTGGAC TCCAACGTCA AAGGGCGAAA AACCGTCTAT CAGGGCGATG GCCCACTACG TGAACCATCA CCCAAATCAA GTTTTTTGGG GTCGAGGTGC CGTAAAGCAC TAAATCGGAA CCCTAAAGGG AGCCCCCGAT TTAGAGCTTG ACGGGGAAAG CCGGCGAACG TGGCGAGAAA GGAAGGGAAG AAAGCGAAAG GAGCGGGCGC TAGGGCGCTG GCAAGTGTAG CGGTCACGCT GCGCGTAACC ACCACACCCG CCGCGCTTAA TGCGCCGCTA CAGGGCGCGT ACTATGGTTG CTTTGACGGG TGCACTCTCA GTACAATCTG CTCTGATGCC GCATAGTTAA GCCAGCCCCG ACACCCGCCA ACACCCGCTG ACGCGCCCTG ACGGGCTTGT CTGCTCCCGG CATCCGCTTA CAGACAAGCT GTGACCGTCT CCGGGAGCTG CATGTGTCAG AGGTTTTCAC CGTCATCACC GAAACGCGCG AGACGAAAGG GCCTCGTGAT ACGCCTATTT TTATAGGTTA ATGTCATGAT AATAATGGTT TCTTAGACGT CAGGTGGCAC TTTTCGGGGA AATGTGCGCG GAACCCCTAT TTGTTTATTT TTCTAAATAC ATTCAAATAT GTATCCGCTC ATGAGACAAT AACCCTGATA AATGCTTCAA TAATATTGAA AAAGGAAGAG TATGAGTATT CAACATTTCC GTGTCGCCCT TATTCCCTTT TTTGCGGCAT TTTGCCTTCC TGTTTTTGCT CACCCAGAAA CGCTGGTGAA AGTAAAAGAT GCTGAAGATC AGTTGGGTGC ACGAGTGGGT TACATCGAAC TGGATCTCAA CAGCGGTAAG ATCCTTGAGA GTTTTCGCCC CGAAGAACGT TTTCCAATGA TGAGCACTTT TAAAGTTCTG CTATGTGGCG CGGTATTATC CCGTATTGAC GCCGGGCAAG AGCAACTCGG TCGCCGCATA CACTATTCTC AGAATGACTT GGTTGAGTAC TCACCAGTCA CAGAAAAGCA TCTTACGGAT GGCATGACAG TAAGAGAATT ATGCAGTGCT GCCATAACCA TGAGTGATAA CACTGCGGCC AACTTACTTC TGACAACGAT CGGAGGACCG AAGGAGCTAA CCGCTTTTTT GCACAACATG GGGGATCATG TAACTCGCCT TGATCGTTGG GAACCGGAGC TGAATGAAGC CATACCAAAC GACGAGCGTG ACACCACGAT GCCTGTAGCA ATGGCAACAA CGTTGCGCAA ACTATTAACT GGCGAACTAC TTACTCTAGC TTCCCGGCAA CAATTAATAG ACTGGATGGA GGCGGATAAA GTTGCAGGAC CACTTCTGCG CTCGGCCCTT CCGGCTGGCT GGTTTATTGC TGATAAATCT GGAGCCGGTG AGCGTGGGTC TCGCGGTATC ATTGCAGCAC TGGGGCCAGA TGGTAAGCCC TCCCGTATCG TAGTTATCTA CACGACGGGG AGTCAGGCAA CTATGGATGA ACGAAATAGA CAGATCGCTG AGATAGGTGC CTCACTGATT AAGCATTGGT AACTGTCAGA CCAAGTTTAC TCATATATAC TTTAGATTGA TTTAAAACTT CATTTTTAAT TTAAAAGGAT CTAGGTGAAG ATCCTTTTTG ATAATCTCAT GACCAAAATC CCTTAACGTG AGTTTTCGTT CCACTGAGCG TCAGACCCCG TAGAAAAGAT CAAAGGATCT TCTTGAGATC CTTTTTTTCT GCGCGTAATC TGCTGCTTGC AAACAAAAAA ACCACCGCTA CCAGCGGTGG TTTGTTTGCC GGATCAAGAG CTACCAACTC TTTTTCCGAA GGTAACTGGC TTCAGCAGAG CGCAGATACC AAATACTGTC CTTCTAGTGT AGCCGTAGTT AGGCCACCAC TTCAAGAACT CTGTAGCACC GCCTACATAC CTCGCTCTGC TAATCCTGTT ACCAGTGGCT GCTGCCAGTG GCGATAAGTC GTGTCTTACC GGGTTGGACT CAAGACGATA GTTACCGGAT AAGGCGCAGC GGTCGGGCTG AACGGGGGGT TCGTGCACAC AGCCCAGCTT GGAGCGAACG ACCTACACCG AACTGAGATA CCTACAGCGT GAGCATTGAG AAAGCGCCAC GCTTCCCGAA GGGAGAAAGG CGGACAGGTA TCCGGTAAGC GGCAGGGTCG GAACAGGAGA GCGCACGAGG GAGCTTCCAG GGGGAAACGC CTGGTATCTT TATAGTCCTG TCGGGTTTCG CCACCTCTGA CTTGAGCGTC GATTTTTGTG ATGCTCGTCA GGGGGGCGGA GCCTATGGAA AAACGCCAGC AACGCGGCCT TTTTACGGTT CCTGGCCTTT TGCTGGCCTT TTGCTCACAT GTTCTTTCCT GCGTTATCCC CTGATTCTGT GGATAACCGT ATTACCGCCT TTGAGTGAGC TGATACCGCT CGCCGCAGCC GAACGACCGA GCGCAGCGAG TCAGTGAGCG AGGAAGCGGAA |
| US11884973B2 |
PCR measuring method and measurement device
The present invention is directed to provide new PCR measuring method and device. As one embodiment of the present invention, a DNA detection method for detecting DNA in a droplet being present in oil, the droplet containing the DNA and a fluorescent labeled probe, the fluorescent labeled probe being hybridized to the DNA, the method including: a first step of amplifying the DNA in the droplet by a nucleic acid amplification reaction; and a second step of measuring a melting temperature of the fluorescent labeled probe and the DNA in the droplet is provided. |
| US11884966B2 |
Tissue-specific methylation marker
Provided herein are compositions comprising tissue-specific markers for identifying a tissue of origin of a cell-free nucleic acid, e.g., a cell-free DNA molecule. Also provided herein are methods, compositions, and systems for identifying a tissue of origin of a cell-free nucleic acid by determining an absolute amount of cell-free nucleic acids comprising the tissue-specific marker. Also provided herein are methods, compositions, and systems for detecting a cancer in a tissue of an organism by analyzing tissue-specific markers. |
| US11884965B2 |
Chimeric primers with hairpin conformations and methods of using same
Methods and compositions for nucleic acid amplification, detection, and genotyping techniques are disclosed. In one embodiment, a nucleic acid molecule having a target-specific primer sequence; an anti-tag sequence 5′ of the target-specific primer sequence; a tag sequence 5′ of the anti-tag sequence; and a blocker between the anti-tag sequence and the tag sequence is disclosed. Compositions containing such a nucleic acid molecule and methods of using such a nucleic acid molecule are also disclosed. |
| US11884962B2 |
Functionalized gel beads
The present disclosure provides methods of generating supports (e.g., beads) comprising barcode molecules coupled thereto. A barcode molecule coupled to a support may comprise a barcode sequence and a functional sequence. A barcode molecule may be generated using two or more ligation reactions in a combinatorial fashion. A support comprising two or more different barcode molecules may be useful for analyzing or processing one or more analytes such as nucleic acid molecules, proteins, and/or perturbation agents. |
| US11884954B2 |
Protein complex based on DNA enzymes of E family of Escherichia coli and application thereof in artificial protein scaffolds
A protein complex based on DNA enzymes of an E family of Escherichia coli and an application thereof in artificial protein scaffolds are provided. The protein complex includes one or more of interaction pairs formed by a CL2 protein and an Im2 protein, a CL7 protein and an Im7 protein, a CL8 protein and an Im8 protein, or a CL9 protein and an Im9 protein. By protein engineering of a carboxyl terminus DNase domain of the DNA enzymes CE2, CE7, CE8 and CE9, mutants that lose DNA enzyme activity but still retain the ultra-high affinity with the corresponding Im protein are obtained, and protein interaction pairs CL2/Im2, CL7/Im7, CL8/Im8 and CL9/Im9 are constructed. These protein interaction pairs have properties of heat resistance, high affinity, high specificity, small molecular weight, fast assembly speed, etc. Based on this, an artificial protein scaffold is constructed for the construction of artificial multienzyme complexes. |
| US11884953B2 |
Method for preparing protein peptide based on connective tissue and prepared protein peptide and use thereof
A novel method for preparing an active protein peptide from connective tissue which includes steps of: connective tissue acquisition, segmenting, washing, pulverization, pH adjustment, enzymolysis, filteration, ultrafiltration, nanofiltration concentration, sterilization, freeze-drying, etc. The connective tissue protein peptide obtained by the method of the invention has features of high peptide content, high activity, etc., and the prepared active protein peptide of the connective tissue is easily absorbed by the human body, and has functions of preventing and/or alleviating and/or treating related diseases. Further, the method includes operation steps that are simple and easy to perform, which has low energy consumption, appropriate and effective utilization of animal natural resources, as well as environmental friendly, non pollution of environment, and low production costs, which is suitable for large-scale industrial production, and the purpose of efficiently preparing an protein active peptide from connective tissue can be achieved. |
| US11884952B2 |
Daptomycin-producing Streptomyces strain and use thereof
The present invention provides a novel daptomycin-producing Streptomyces strain and use thereof, the strain is a subspecies of streptomyces griseus, named Streptomyces griseus L340, and the preservation number is CGMCC17921. The genetic character and fermentation unit of the strain provided by the present invention are relatively stable, the culture and fermentation conditions are suitable for industrial production of daptomycin, and the interference of pigment in later separation and purification is eliminated. The secondary metabolite daptomycin is obtained through fermentation of the Streptomyces provided by the present invention, which has the advantages of no interference of pigment accumulation, cleaner metabolic spectrum and thus is obviously superior in later separation and purification. |
| US11884949B2 |
Methods of producing morphinan alkaloids and derivatives
A method of producing promorphinan, morphinan, nal-opioid, and nor-opioid alkaloid products through the increased conversion of a promorphinan alkaloid to a morphinan alkaloid. The method comprises contacting the promorphinan alkaloid with at least one enzyme. Contacting the promorphinan alkaloid with the at least one enzyme converts the promorphinan alkaloid to a morphinan alkaloid. |
| US11884942B2 |
Compositions and methods comprising the use of Exiguobacterium acetylicum and Bacillus coagluans α-glucanotransferase enzymes
An isolated and/or purified α-glucanotransferase from Exiguobacterium acetylicum, recombinantly engineered variants thereof, active fragments thereof, synthetic nucleic acids encoding the α-glucanotransferase and variants thereof, host cells comprising the synthetic nucleic acids, and compositions comprising the α-glucanotransferase are provided. Methods of using the compositions include the manufacture of oligosaccharides. |
| US11884938B2 |
Cell culture system
The embodiments of the invention described herein relate to systems and methods for culturing and/or maintaining intestinal cells, tissues and/or organoids in vitro. The cells, tissues and/or organoids cultured according to the methods and systems described herein can mimic or reproduce natural intestinal epithelial structures and behavior as well as support co-culture of intestinal microflora. |
| US11884937B2 |
Activation of innate immunity for enhanced nuclear reprogramming of somatic cells with mRNA
The nuclear reprogramming of somatic cells with mRNA encoding reprogramming factors is shown to be greatly accelerated by activation of innate immune responses in the somatic cell. Methods of activating innate immunity include activation of PKR, of toll-like receptors, e.g. TLR3, etc. In some embodiments the mRNA provides the activator of innate immunity. |
| US11884931B2 |
Oncolytic virus for colorectal cancer treatment using colorectal cancer cell-specific infectious newcastle disease virus and composition for colorectal cancer treatment using same
Provided is an M2-LVP-K1 virus including a colorectal cancer cell-specific mutant sialic acid binding domain and a composition for treating colorectal cancer including the same. The mutant sialic acid binding domain is constructed using directed evolution technology, and is a recombinant Newcastle disease virus constructed by substituting a normal sialic acid binding domain for a HN protein, a cell-binding receptor, to improve the specific infectivity to HCT116 cells. It was identified that M2-LVP-K1 recombinant Newcastle disease virus with improved colorectal cancer cell-specific infectivity has improved HCT116 cell death effect compared to the conventional normal recombinant Newcastle disease virus, and produces an excellent effect in inhibiting cancer tissue growth through in vivo experiments. The mutant recombinant Newcastle disease virus presented in this study relates to a therapeutic viral agent capable of inducing clinical symptom reduction, partial remission, or complete remission through colorectal cancer cell death or colorectal cancer tissue shrinkage. |
| US11884925B2 |
Synthetic immunomodulation with a CRISPR super-repressor in vivo
Provided herein are CRISPR-based synthetic repression systems as well as methods and compositions using the synthetic repression systems to treat septicemia, an adverse immune response in a subject and Waldenström macroglobulinemia. |
| US11884922B1 |
Tuning cascade assay kinetics via molecular design
The present disclosure relates to compositions of matter and assay methods used to detect one or more target nucleic acids of interest in a sample. The compositions and methods allow one to control reaction kinetics of the cascade assay by two orders of magnitude via molecular design of one of the reaction components; further, varying molecular design also allows for quantification of target nucleic acids of interest over a large range of concentrations or discriminating between extremely low copy numbers of target nucleic acids of interest. |
| US11884918B2 |
Systems and methods for modulating CRISPR activity
Provided herein are polynucleotides comprising sequence configured to bind to a CRISPR effector protein. Modulation of one or more modifications of the polynucleotides can be used to tune the activity of CRISPR effector proteins complexed with the polynucleotides. |
| US11884912B2 |
Cell culture device and method thereof
A cell culture device includes a culture unit, a gas supply unit, a first pressure unit, at least one inspecting unit and a control unit. The culture unit contains a cell culture liquid. The gas supply unit, connected with the culture unit, is used for transmitting a culture gas into the culture unit. The first pressure unit, connected with the culture unit, is used for applying a pressure to the cell culture liquid in the culture unit. The at least one inspecting unit, connected with the culture unit, is used for receiving the cell culture liquid for inspection. The control unit, electrically coupled with the culture unit, the first pressure unit, the gas supply unit and the at least one inspecting unit, is used for monitoring corresponding condition parameters to determine respective operations. In addition, a cell culture method for the cell culture device is also provided. |
| US11884909B2 |
Cluster airlift bioreactor
A bioreactor includes a plurality of spargers and a plurality of vertical circulation loops. A first vertical circulation loop of the plurality of vertical circulation loops includes a first sparging region and a first return region. The first vertical circulation loop is in liquid communication with one or more other loops of the plurality of vertical circulation loops. The first vertical circulation loop is characterized by an individual loop mass transfer coefficient. A controller is coupled to the plurality of spargers and configured to control the plurality of spargers together such that a cumulative mass transfer coefficient of the plurality of vertical circulation loops is within a threshold of the individual loop mass transfer coefficient associated with the first vertical circulation loop. |
| US11884904B2 |
Gas fermentation using multiple-pass trickle bed reactors
The subject matter of this application is using novel biological reactors for the fermentation of gases into liquid products. More specifically, the subject matter relates to the use of a Multiple-Pass Trickle Bed Reactor (MP-TBR) for the anaerobic or aerobic and biological fermentation of gases generated from industrial processes and/or from the gasification of biomass and other organic carbon sources. The products may include, but are not limited to, ethanol and other valuable chemicals. |
| US11884902B2 |
Systems and methods of forming and analyzing dissolvable articles
Systems and methods of forming and analyzing a dissolvable article are provided herein. In an embodiment, a method of analyzing a dissolvable article includes providing a dissolvable article comprising a water-soluble block copolymer and a fragrance, capturing a plurality of images of a surface of the dissolvable article using a three dimensional imaging device, wherein the plurality of images have different spatial properties and wherein the plurality of images are of a substantially similar viewing area of the three-dimensional imaging device, and determining a measurement of pore density and surface roughness of the surface of the dissolvable article. |
| US11884900B2 |
Cleaning compositions and methods of use thereof
The present disclosure relates to cleaning compositions that are used to clean semiconductor substrates. These cleaning compositions can remove the defects/contaminants arising from previous processing on the semiconductor substrates and thereby make the substrates appropriate for further processing. The cleaning compositions described herein primarily contain at least one pH adjusting agent and at least one biosurfactant. |
| US11884897B2 |
Hard surface cleaners including fluorosurfactants
Hard surface, in particular glass, cleaners having an ease in wipe-out while providing good cleaning with a streak-free, glossy shine are described. The cleaner includes at least one fluorosurfactant including a fluorinated functional group with 2 to 6 carbon atoms, and a hydrophilic moiety; at least one non-fluorinated surfactant; a combination of solvents; a combination of cleaning agents; and water. |
| US11884896B2 |
Sanitizing soap preparation comprising a benzalkonium chloride/alkyl trimonium cationic surfactant combination
Anti-microbial compositions for cleaning and sanitizing skin are disclosed. The anti-microbial compositions preferably comprises at least one quaternary ammonium chloride active and results in low irritation cleansing and sanitizing products that allow more frequent application. |
| US11884893B1 |
Antiwear system for improved copper corrosion
An oil-soluble ashless antiwear additive and a lubricating composition including the ashless antiwear additive having improved copper corrosion performance obtained by reacting an organic hydroxy compound with phosphorus pentasulfide to form a reaction product, distilling the reaction product and recovering a condensate, and reacting the condensate with an unsaturated carboxylic acid to form an oil-soluble phosphorus antiwear additive. |
| US11884886B2 |
Low pressure hydrocracking process for the production of a high yield of middle distillates from a high boiling hydrocarbon feedstock
The present invention provides for a low pressure, low temperature process for the production of middle distillate products, including aviation fuel and diesel, from the hydrocracking of a hydrocarbon feedstock consisting of a mixture of hydrocarbons, wherein a significant fraction of said mixture is C25+ hydrocarbons including hydrocarbons selected from Fischer-Tropsch wax, long chain paraffin and/or olefin, wherein the feedstock may include a water component. |
| US11884885B2 |
Co-processing of waste plastic pyrolysis oils and biorenewable feedstocks
A process is provided for producing a liquid hydrocarbon material suitable for use as a fuel or as a blending component in a fuel. The process includes co-processing a pyrolysis oil derived from a waste plastic raw material and a biorenewable feedstock comprising triglycerides in a catalytic cracking process in a presence of a solid catalyst at catalytic cracking conditions to provide a cracking product. The cracking product may be fractionated to provide at least one of a gasoline fraction and a middle distillate fraction. |
| US11884882B2 |
Electrochromic device
According to one embodiment, provided is an electrochromic device including an electrochromic layer, which contains a tungsten oxide material. The tungsten oxide material includes potassium-containing tungsten oxide particles having an average particle size of 100 nm or less. The potassium-containing tungsten oxide particles contain potassium within a range of 1 mol % to 50 mol %, and include a central section and a peripheral section adjacent to the central section. A periodicity of a crystal varies between the central section and the peripheral section. |
| US11884868B2 |
Latent heat storage material, and cold storage tool, logistic packaging container, transportation method, human body refrigeration tool and cold storage tool for beverages each using same
Provided are a latent heat storage material having a melting point within a prescribed temperature range; a latent heat. The latent heat storage material includes a compound (A) represented by a formula (A), an inorganic salt (B) represented by a formula (B) and composed of a cation of an alkali metal and an anion of the same element as the anion of the quaternary alkyl salt, and water. The compound (A) is a material that forms a clathrate hydrate together with the water, the composition ratio of the compound (A) and water is a composition ratio that gives a congruent melting point of the clathrate hydrate, and the molar ratio of the inorganic salt (B) to the compound (A) is 0.1 or more and 10 or less. |
| US11884863B2 |
Liquid-crystalline medium
A liquid-crystalline medium having least one compound of the formula I, and at least one compound of the formulae ST-1 to ST-17, in which R1 and R1*, A1 and A1*, Z1 and Z1*, X, L1 and L2, RST, ring A, ZST, p and q have the meanings indicated in claim 1, and the use thereof for an active-matrix display, in particular based on the VA, PSA, PA-VA, SS-VA, SA-VA, PS-VA, PALC, IPS, PS-IPS, UB-FFS, U-IPS, FFS or PS-FFS effect. |
| US11884862B2 |
Liquid-crystalline medium
Compounds of the formula I in which R1 is alkyl or alkoxy in which CH2 groups are optionally replaced, and X1 is alkyl OCF3, CF3, CHF2, OCF2CF3, CCF2CHFCF3, OCF═CF2, OCH═CF2 or F, a liquid-crystalline medium containing a compound of formula I, and use thereof in electro-optical liquid-crystal displays, in particular in TN, STN, TN-TFT, OCB, IPS, PS-IPS, FFS, HB-FFS or PS-FFS-, positive VA displays and in shutter spectacles for 3D effects and LC lenses. |
| US11884855B2 |
Synthesis of europium halide perovskites in solution phase
A solution phase synthesis process for preparing a rare earth perovskite, the process includes reacting an alkali metal material with a first surfactant ligand in the presence of a first solvent to obtain a first precursor complex solution; reacting a rare earth metal halide with a second surfactant ligand in the presence of a second solvent to obtain a second precursor complex solution; and reacting the first precursor complex solution with the second precursor complex solution in the presence of a third surfactant ligand and a third solvent to obtain the rare earth perovskite; wherein: the rare earth perovskite is in the form of nanocrystals; and the first solvent and third solvent comprise a non-coordinating solvent. |
| US11884853B2 |
Electroluminescent display devices and methods of making the same
A nanoparticle conjugate includes a quantum dot (QD) and a thermally activated delayed fluorescence (TADF) molecule bound to the QD. In some instances, the TADF molecule can be directly bound to a surface of the QD. In other instances, the TADF molecule can be indirectly bound to the QD via an interaction with one or more capping ligands disposed on a surface of the QD. Nanoparticle conjugates described herein can be incorporated into emissive layers of electroluminescent light-emitting diode devices to yield electroluminescent quantum dot-containing light-emitting diode (QD-LED) devices. |
| US11884846B2 |
Adhesive composition having a gel content based on cross-linking via keto groups or aldehyde groups
Described is an adhesive composition in the form of an aqueous polymer dispersion comprising tackifiers, a compound crosslinking via keto or aldehyde groups and a pressure-sensitive adhesive polymer which is formed by emulsion polymerization from soft (meth)acrylic ester monomers, acid monomers, monomers having keto or aldehyde groups, styrene and optionally further monomers, wherein the polymerization may be carried out in the presence of chain transfer agents. The pressure-sensitive adhesive polymer has certain gel contents. The pressure-sensitive adhesive composition may be used to produce adhesive labels, adhesive tapes or adhesive films. |
| US11884844B2 |
Composition for post-polishing to be used after primary polishing of silicon wafers
A polishing composition used in wafer polishing process for eliminating protrusion around laser mark, thereby achieving a flat polished surface, as well as a wafer polishing method using the polishing composition. A post-polishing composition for elimination of a laser mark remaining after polishing of silicon wafer with a primary polishing composition containing silica particles, water, and a basic compound, the post-polishing composition including silica particles, water, a tetraalkylammonium ion, and a water-soluble polymer, wherein the mass ratio of the tetraalkylammonium ion to SiO2 of the silica particles is 0.200 to 1.000:1; the mass ratio of SiO2 dissolved in the polishing composition to SiO2 of the silica particles is 0.100 to 1.500:1; and the mass ratio of the water-soluble polymer to SiO2 of the silica particles is 0.005 to 0.05:1. The silica particles have an average primary particle diameter of 1 nm to 100 nm. |
| US11884837B2 |
Scratch and mar resistant automotive coatings
Described herein is a 2K solvent borne coating system. The coating system includes an epoxy component (A), including: i) an epoxy resin; ii)—a solvent; iii)—at least one compound of formula (I): [(ER)x(R′O)y(HO)z(R″)t(SiO(4-x-y-z-t)]m (I) and/or oligomer or polymer compounds of the compound of formula (I), and iv)—optionally, at least one non-catalytic additive; and an acid resin component (B), including: an carboxylic acid resin; a solvent; optionally, at least one catalyst; and optionally, at least one additive. Also described herein are a 2K coating composition, a method to coat an automotive substrate with the composition, and a scratch and mar resistant coated surface of the 2K coating composition. |
| US11884832B2 |
Material restoration composition and method
A method of restoring a material surface utilizes a first composition (referred to herein as Composition A) and a second composition (referred to herein as Composition B). Methodologies guide application of Composition A and optionally Composition B to enact various restoration advantages to existing or new material surfaces. Composition A may be first applied to a material surface to remove surface contaminants and lift stains. During the described methodology, a user must wait a predetermined amount of time for Composition A to permeate the material surface. Optionally, Composition B may be subsequently applied to bond voids and damages areas of the material surface, or to add a new surface altogether above the original surface. A user may wait a predetermined amount of time for Composition B to cure. |
| US11884825B2 |
Exocyclic amine substituted coumarin compounds and uses as fluorescent labels
The present application relates to exocyclic amine-substituted coumarin derivatives and their uses as fluorescent labels. These compounds may be used as fluorescent labels for nucleotides in nucleic acid sequencing applications. |
| US11884823B2 |
Pneumatic tire
The invention is directed to a pneumatic tire comprising a vulcanization rubber composition, the vulcanizable rubber composition comprising: from 30 to 90 phr of a first functionalized styrene-butadiene rubber having a glass transition temperature Tg1 ranging from −70 to −50° C.; from 10 to 50 phr of a second functionalized styrene-butadiene rubber having a glass transition temperature Tg2 ranging from −110 to −70° C.; wherein Tg2−Tg1 is at least 10° C.; from 0 to 40 phr of at least one additional elastomer; from 50 to 150 phr of silica; from 0 to 50 phr of a hydrocarbon resin; and from 10 to 50 phr of an oil. |
| US11884814B2 |
Resin composition
Resin compositions including (A) a hollow organic polymer particle, (B) an epoxy resin, and (C) a curing agent provide cured products having a superior smear removal properties. |
| US11884811B2 |
Resin composition, resin film and organic electroluminescent device
Provided is a resin composition including a resin containing a polymer, a hygroscopic particle, and an organic solvent-soluble dispersant. Preferably the ratio of the dispersant relative to 100 parts by weight of the hygroscopic particle is 0.1 part by weight or more and 1000 parts by weight or less, and the absolute value of the difference in refractive index between the resin and the hygroscopic particle is 0.05 or less. Also provided are a resin film formed by molding the resin composition into a film shape, and an organic electroluminescent device including the resin film. |
| US11884809B2 |
Molded article and laminate incorporating acrylic resin composition
Disclosed is an acrylic resin composition that has excellent weather resistance and can be stably produced at high temperatures. Specifically, disclosed is an acrylic resin composition including, with respect to 100 parts by mass of an acrylic resin, from 0.1 to 8 parts by mass of a triazine-based UV absorber including 2-(4,6-diphenyl-1,3,5-triazin-2-yl)-5-[2-(2-ethylhexanoyloxy)ethoxy]phenol, wherein the acrylic resin used is an acrylic resin including at least 80 wt % of methyl methacrylate as a monomer component, and having a glass transition temperature of at least 80° C. |
| US11884807B2 |
Process and apparatus for manufacture of processable polyvinyl alcohol
The invention describes a method for the manufacture of a plasticized polyvinyl alcohol polymer mixture including the steps of: introducing into a mixing reactor a polyvinyl alcohol polymer comprising homopolymeric polyvinyl alcohol or a blend thereof having a degree of hydrolysis in the range of 93% to less than 98% or more; where the plasticizer comprises two or more compounds selected from the group consisting of diglycerol, triglycerol, xylose, D-mannitol, triacetin, dipentaerythritol, 1,4-butanediol, 3,3-dimethyl-1,2-butanediol, and caprolactam; reacting the water, the plasticizer and the polyvinyl alcohol polymer in the reaction zone to form the plasticized polymer; and allowing the plasticized polyvinyl alcohol polymer to pass from the primary outlet. |
| US11884804B2 |
Foam body, polyolefin-based foam sheet, and complex
A foam body constituted of a 4-methyl-1-pentene-based polymer, in which one or more temperatures showing a maximum value of loss tangent (tan δ) of dynamic viscoelasticity, which is obtained by dynamic viscoelasticity measurement conducted under the conditions of a temperature increase rate of 4° C./min, a frequency of 1.59 Hz, and a distortion of 0.1%, exist in at least a range of 10° C. or higher and 100° C. or lower, and the maximum value of the loss tangent is 0.5 or more and 3.5 or less. Another aspect relates to a polyolefin-based foam sheet constituted of a 4-methyl-1-pentene-based polymer, in which the difference in Shore A hardness of at least one surface at different times is defined. A further aspect relates to a complex including a foam body constituted of a 4-methyl-1-pentene-based polymer and a member which is bonded to the foam body and is different from the foam body. |
| US11884803B2 |
Sheet transport roller rubber composition and sheet transport roller
A rubber composition capable of manufacturing a sheet transport roller having an excellent friction coefficient and wear resistance. A sheet transport roller rubber composition contains an ethylene-α-olefin-diene copolymer as a base rubber, a sulfur-based crosslinking agent, and a coumarone-indene resin. It is preferable that the sheet transport roller rubber composition be obtained by mixing the base rubber and the coumarone-indene resin at a temperature equal to or higher than a softening point of the coumarone-indene resin to prepare a mixture, and then mixing this mixture with a sulfur-based crosslinking agent. |
| US11884800B2 |
Thermoplastic polymer composition and method for molding the same
A thermoplastic polymer composition comprises a polyethylene polymer composition and a salt of bicyclo[2.2.1]heptane-2,3-dicarboxylic acid. The polyethylene polymer composition can have a Melt Relaxation Ratio of 1.5 or greater. A method for molding a thermoplastic polymer composition comprises the steps of (a) providing an apparatus comprising a die and a mold cavity; (b) providing the thermoplastic polymer composition described above; (c) heating the thermoplastic polymer composition to melt the thermoplastic polymer composition; (d) extruding the molten thermoplastic polymer composition through the die to form a parison; (e) capturing the parison in the mold cavity; (f) blowing a pressurized fluid into the parison to inflate the parison and conform it to the interior surface of the mold cavity; (g) allowing the molded article to cool so that the molded article retains its shape; and (h) removing the molded article from the mold cavity. |
| US11884797B2 |
Additives for protection of polymers against ultraviolet light
The invention provides ultraviolet light absorber suitable for use as an additive in polymers, comprising particles of inorganic oxide having UV light-absorbing compound on their surface, wherein said UV light-absorbing compound is chemically bonded, either to a spacer provided on the surface of said particle, or directly to the surface of the particle. Process for preparing the additive absorber and a thermoplastic polymer (e.g., a film) comprising the absorber additive are also provided. |
| US11884793B2 |
Molded article with metallic appearance
The present invention relates to a molded article with a metallic appearance and a process for making the same. Particularly, the present invention relates to a molded article having a part that comprises a layer with a sandwich structure. |
| US11884786B2 |
Elastic parylene
Elastic Parylene films produced via chemical vapor deposition polymerization (CVDP) on a substrate are disclosed. |
| US11884783B2 |
Method and device for the destructive distillation of polyethylene and polypropylene waste
The invention relates to a method and device for processing industrial and domestic polyethylene and polypropylene waste by destructive distillation. A method for the destructive distillation of polyethylene and polypropylene waste includes charging a destructive distillation reactor with polyethylene and polypropylene waste that has been pre-cleaned of contaminants by flotation, and heating the furnace of the distillation reactor using a fuel burner; maintaining the temperature in a hydrocarbon collector tank using exhaust gases, regulating the outlet temperature of a vapour-gas mixture of hydrocarbons, and recovering paraffin fractions; fractionating the remaining distillation products in a fractionating column, and regulating the outlet temperature of the remaining vapour-gas mixture from the fractionating column; cooling the remaining vapour-gas mixture, separating same into a naphtha fraction and a gas fraction, and charging a subsequent destructive distillation reactor with feedstock, wherein prior to charging, the bottom part of each reactor is coated with a layer of a non-stick lubricant, the reactor furnaces are connected with the aid of air cushions, and the reactors are charged in several steps according to the following cycle: “charging a reactor with feedstock, generating a vacuum in the charged reactor space, heating the reactor to 110-260° C. to liquefy the charged feedstock”. |
| US11884782B2 |
Resin particles, conductive particles, conductive material and connection structure
Provided is a resin particle that can be uniformly brought into contact with an adherend, can effectively enhance adhesion to a conductive portion and impact resistance when electrodes are electrically connected to each other using a conductive particle having the conductive portion formed on a surface thereof, and further can effectively reduce connection resistance. In the resin particle according to the present invention, an exothermic peak is observed when differential scanning calorimetry is performed by heating the resin particle at a temperature rising rate of 5° C./min from 100° C. to 350° C. in an air atmosphere. |
| US11884780B2 |
Modified conjugated diene polymer and polymer composition including said modified conjugated diene polymer
The present invention provides a modified conjugated diene polymer that has excellent hydrophilicity and is useful for modification of polar polymers. The present invention also provides a modified conjugated diene polymer and a polymer modifier that, when used for modification of a polar polymer, can enhance characteristics, for example, flexibility, of the composition including the polymer and also offer excellent processability and shaping properties. The present invention further provides a polymer composition including such a conjugated diene polymer. A polymer modifier (A) includes a modified conjugated diene polymer (A1) having a hydrophilic group having a polyethylene glycol structure. |
| US11884779B2 |
Ionically modified silicones, compositions, and medical devices formed therefrom
A hydrophilic silicone, compositions comprising the same, and articles comprising the same are shown and described herein. The hydrophilic silicone is an ionically modified silicone compound wherein the compound comprises a zwitterionic moiety and has a net neutral charge. The hydrophilic silicone compounds may be provided as part of a composition, e.g., a composition suitable for forming a hydrogel, which may be employed to form a film material and even an article (e.g., in a contact lens). |
| US11884777B2 |
Diol compound, polycarbonate, and preparation method of the same
Provided is a diol compound of the following Chemical Formula 1, a polycarbonate comprising the diol compound, and a method of producing the polycarbonate: |
| US11884774B2 |
Bioabsorbable resin for additive manufacturing
Provided herein according to aspects of the present invention are resins that: (a) are suitable for use in additive manufacturing techniques such as bottom-up and top-down stereolithography, (b) produce objects that are bioresorbable, and (c) produce objects that are flexible or elastic (preferably at at least typical room temperatures of 25° C., and in some embodiments at typical human body temperatures of 37° C.). Such resins may include: (a) a bioresorbable polyester oligomer having reactive end groups; (b) non-reactive diluent; (c) optionally reactive diluent; and (d) a photoinitiator. |
| US11884770B2 |
Low viscosity poly(alkynyl carbamate) prepolymers
An alternative polyurethane composition is provided which comprises a reaction product of an azidated polyol and a poly(alkynyl carbamate) prepolymer, wherein reaction occurs at a temperature of from 20° C. to 200° C., optionally in the presence of a catalyst, wherein the poly(alkynyl carbamate) prepolymer comprises a reaction product of stoichiometric equivalents of a polyisocyanate and a component comprising 1-100% of an alkynol-ether of the formula (I): HC≡C—R—OH (I), wherein R is a linear or branched ether chain having from 1 to 15 atoms, and wherein the remainder of the hydroxyl-functional component comprises a first alkynol. The inclusion of an alkynol-ether reduces the viscosity of the composition without compromising its performance. The inventive alternative polyurethane compositions may find use in providing coatings, adhesives, sealants, films, elastomers, castings, foams, and composites. |
| US11884768B2 |
Methods and compositions for forming elastomeric polyurethane articles and associated elastomeric polyurethane articles formed therefrom
Methods for forming elastomeric polyurethane articles are provided in which an isocyanate component including an isocyanate prepolymer is mixed with an isocyanate-reactive component having a viscosity ranging from 50,000 to 200,000 centipoise as measured by ASTM standard D2196, and wherein is applied as one or more layers onto a surface of a carrier substrate at an application rate ranging from 0.5 to 20 g/sec, with each one of said applied one or more layers independently having a thickness ranging from 0.2 and 10 millimeters and having a total thickness ranging from ranging from 0.2 to 60 millimeters. The applied layers are cured in the absence of added heat via an exothermic reaction to form the elastomeric polyurethane article having an abrasion resistance ranging from 20 to 250 mm3, a hardness ranging from 60 Asker C to 90 Asker C, and a density ranging from 330 and 1000 kg/m3. |
| US11884767B2 |
High cis-1,4 block copolymers of polybutadiene and polyisoprene
A vulcanizable composition comprising rubber component, a filler, and a curing agent, where the rubber component includes a block copolymer of polybutadiene and polyisoprene, and where the block copolymer has a cis content of at least 90%. |
| US11884765B2 |
Biodegradable elastic hydrogels for bioprinting
Disclosed herein are hydrogel compositions comprising a triblock copolymer having a formula A-B-A, wherein A is a polycaprolactone (PCL) block or a polyvalerolactone (PVL) block and B is a polyethylene glycol (PEG) block. Also disclosed are methods of making a hydrogel comprising providing a photoinitiator and a triblock copolymer having a formula A-B-A, wherein the triblock copolymer comprises one or more ethylenically unsaturated moieties; and photocrosslinking the triblock copolymer, thereby forming a hydrogel. Also disclosed are methods of printing a three-dimensional (3D) article comprising extruding a printing composition from a deposition nozzle moving relative to a substrate, the printing composition comprising a photoinitiator and any herein disclosed triblock copolymer, wherein the triblock copolymer comprises one or more ethylenically unsaturated moieties; depositing one or more layers comprising the printing composition on the substrate; and photocrosslinking the triblock copolymer to form the printed 3D article. |
| US11884764B2 |
Membranes for liquid treatment
The invention concerns the field of polymer chemistry and relates to membranes, such as those that can be used, for example, for the preparation of aqueous solutions using microfiltration or ultrafiltration.The object of the present invention is to specify membranes which have improved anti-fouling properties and sliding friction properties.The object is attained with membranes comprised at least predominantly of multiblock copolymers of the general formula (1) where X=connection point E=C2 to C4 alkyl ether A=other block component not containing silicone R=C1 to C4 alkyl radical and/or phenyl radical m=1 |
| US11884763B2 |
Spherical particles comprising carbon nanomaterial-graft-polyolefin and methods of production and uses thereof
A nonlimiting example method of forming highly spherical carbon nanomaterial-graft-polyolefin (CNM-g-polyolefin) particles may comprising: mixing a mixture comprising: (a) a CNM-g-polyolefin comprising a polyolefin grafted to a carbon nanomaterial, (b) a carrier fluid that is immiscible with the polyolefin of the CNM-g-polyolefin, optionally (c) a thermoplastic polymer not grafted to a CNM, and optionally (d) an emulsion stabilizer at a temperature greater than a melting point or softening temperature of the polyolefin of the CNM-g-polyolefin and the thermoplastic polymer, when included, and at a shear rate sufficiently high to disperse the CNM-g-polyolefin in the carrier fluid; cooling the mixture to below the melting point or softening temperature to form the CNM-g-polyolefin particles; and separating the CNM-g-polyolefin particles from the carrier fluid. |
| US11884756B2 |
Production method for modified vinyl alcohol polymer particle and particle obtained thereby
A method of producing modified vinyl alcohol-based polymer particles, includes mixing vinyl alcohol-based polymer particles with a mixed medium containing unsaturated carboxylic acid, an acid catalyst, and water, wherein, by mixing the vinyl alcohol-based polymer particles with the mixed medium, the vinyl alcohol-based polymer particles are reacted with the unsaturated carboxylic acid to obtain modified vinyl alcohol-based polymer particles containing a vinyl ester unit represented by a formula (2) below, having a vinyl alcohol unit content based on the total constitutional units of 60 mol % or more and less than 95 mol %, and having an average particle diameter from 50 to 2000 μm. The production method is capable of controlling the particle shape and does not cause the problem of the residual sulfur content, and is further convenient and economically advantageous. |
| US11884747B2 |
Compstatin analogs with increased solubility and improved pharmacokinetic properties
Compounds comprising peptides capable of binding C3 protein and inhibiting complement activation are disclosed. The compounds comprise compstatin analogs in which the N-terminus and/or C-terminus contains an added component that improves (1) the peptide's solubility at physiological pH; (2) the peptide's plasma half-life; (3) the peptide's intraocular retention; and/or (4) the peptide's binding affinity to C3 or its fragments as compared to an unmodified compstatin peptide under equivalent conditions. Pharmaceutical compositions and methods of using the compounds are also disclosed. |
| US11884746B2 |
Matriptase and u-plasminogen activator substrates and other cleavable moieties and methods of use thereof
The invention relates generally to polypeptides that include a cleavable moiety that is a substrate for at least one protease selected from matriptase and u-plasminogen activator (uPA), to activatable antibodies and other larger molecules that include the cleavable moiety that is a substrate for at least one protease selected from matriptase and u-plasminogen activator, and to methods of making and using these polypeptides that include a cleavable moiety that is a substrate for at least one protease selected from matriptase and u-plasminogen activator in a variety of therapeutic, diagnostic and prophylactic indications. |
| US11884745B2 |
Method of removing lipopeptides from solutions and changing their structure
The present invention is a method for removing lipopeptides from solutions and changing their structure from cyclic to linear. The lipopeptide capture and sequestration takes place from solutions containing water through sorption. In the case of cyclic lipopeptides, in which the peptide ring is closed by a lactone bond, sorption is additionally associated with hydrolysis reactions occurring on the surface of active carbon, leading to linearization as a result of breaking the lactone bond. |
| US11884744B2 |
Compound targeting IL-23A and B-cell activating factor (BAFF) and uses thereof
The disclosure relates to compounds specific for IL23A and BAFF, compositions comprising the compounds, and methods of use thereof. Nucleic acids, cells, and methods of production related to the compounds and compositions are also disclosed. |
| US11884740B1 |
Anti-CD20 antibody compositions
Provided herein are populations of anti-CD20 antibody proteins with specified ranges of post-translational modifications. Also provided are methods of using and methods of making such populations of anti-CD20 antibody proteins. |
| US11884737B2 |
Treatment of autoimmune disorders with CD154 antibodies
The present invention relates to a method of treating an autoimmune or inflammatory disease or a neurodegenerative disease with an antibody to CD154. |
| US11884736B2 |
Antibodies which bind to glucagon-like peptide 1 receptor (GLP1R)
The present disclosure relates to antibodies or antigen-binding fragments thereof that bind specifically to the glucagon-like peptide 1 receptor (GLP1R) protein, and methods of use thereof. In various embodiments, the antibodies or antigen-binding fragments thereof are fully human antibodies that bind to GLP1R. In some embodiments, the antibodies or antigen-binding fragments thereof are useful for attenuating GLP1R activity, thus providing a means of treating, preventing, or alleviating a disease, disorder or condition associated with GLP1R in humans. In some embodiments, the antibodies or antigen-binding fragments thereof elevate glucose levels when administered to a subject and thereby treat hypoglycemia, such as post-bariatric hypoglycemia (PBH), by attenuating insulin secretion from pancreatic beta cells and decreasing insulin expression. |
| US11884734B2 |
Anti-MET antibodies and methods of use thereof
Provided herein are compositions, methods and uses involving antibodies that specifically bind to MET, a receptor tyrosine kinase, and modulate the expression and/or activity of MET. Also provided are uses and methods for managing, treating, or preventing disorders, such as cancer. In one aspect, provided herein is a monoclonal antibody or antigen-binding fragment thereof that binds to the Sema/PSI domain of human MET. Also provided herein is a kit comprising an antibody or antigen-binding fragment provided herein. Also provided herein is a method of managing, protecting against, or treating cancer in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody or antigen-binding fragment provided herein. |
| US11884729B2 |
Anti-L1CAM antibodies and uses thereof
The present disclosure provides antibodies that specifically bind to L1CAM and compositions comprising such antibodies. Also provided herein are methods for preventing or treating diseases or conditions which comprise a tumor using the anti-L1CAM antibodies. |
| US11884724B2 |
Anti-PD-L1 antibodies and uses thereof
The present application relates to anti-PD-L1 antibodies or antigen binding fragments thereof, nucleic acid encoding the same, therapeutic compositions thereof, and their use to enhance T-cell function to upregulate cell-mediated immune responses and for the treatment of T cell dysfunctional disorders, such as tumor immunity, for the treatment of and cancer. |
| US11884723B2 |
Use of anti-human SIRPa v1 antibodies and method for producing anti-SIRPa v1 antibodies
The invention is in the field of immunotherapy. The present invention provides antibodies useful in therapeutic and diagnostic applications targeting human SIRPa, said antibodies enhancing the cross-presentation of antigens to T cells. The invention also provides antibodies against specific isoforms of SIRP a and able to disrupt the interaction between those isoforms of SIRP a and human CD47 for use in treating or preventing a disease, or diagnostic applications, and methods for producing and/or selecting anti-human SIRPa antibodies that bind with different affinities to various isoforms of human SIRP members. |
| US11884722B2 |
Anti-GPRC5D antibodies, bispecific antigen binding molecules that bind GPRC5D and CD3, and uses thereof
Provided herein are antibodies that specifically bind to GPRC5D. Also described are related polynucleotides capable of encoding the provided GPRC5D-specific antibodies or antigen-binding fragments, cells expressing the provided antibodies or antigen-binding fragments, as well as associated vectors and detectably labeled antibodies or antigen-binding fragments. In addition, methods of using the provided antibodies are described. For example, the provided antibodies may be used to diagnose, treat, or monitor GPRC5D-expressing cancer progression, regression, or stability; to determine whether or not a patient should be treated for cancer; or to determine whether or not a subject is afflicted with GPRC5D-expressing cancer and thus may be amenable to treatment with a GPRC5D-specific anti-cancer therapeutic, such as the multispecific antibodies against GPRC5D and CD3 described herein. |
| US11884720B2 |
Antibody constructs for MSLN and CD3
The present invention relates to a bispecific antibody construct comprising a first binding domain which binds to human MSLN on the surface of a target cell and a second binding domain which binds to human CD3 on the surface of a T cell. Moreover, the invention provides a polynucleotide encoding the antibody construct, a vector comprising said polynucleotide and a host cell transformed or transfected with said polynucleotide or vector. Furthermore, the invention provides a process for the production of the antibody construct of the invention, a medical use of said antibody construct and a kit comprising said antibody construct. |
| US11884716B2 |
Compositions and methods of phospholipase A2 receptor chimeric autoantibody receptor T cells
The invention includes compositions comprising at least one chimeric autoantibody receptor (CAAR) specific for an anti-phospholipase A2 receptor (PLA2R) autoantibody-based B cell receptor, polynucleotides encoding the CAAR, vectors comprising a polynucleotide encoding the CAAR, and recombinant T cells comprising the CAAR. The invention also includes methods of making a genetically modified cell, e.g., a genetically modified T cell, expressing a PLA2R-CAAR wherein the expressed CAAR comprises a PLA2R extracellular domain. |
| US11884715B2 |
Activin receptor type IIB variants and methods of use thereof
The invention features polypeptides that include an extracellular ActRIIB variant. In some embodiments, a polypeptide of the invention includes an extracellular ActRIIB variant fused to an Fc domain monomer or moiety. The invention also features pharmaceutical compositions and methods of using the polypeptides to treat diseases and conditions involving weakness and atrophy of muscles, bone damage, low red blood cell levels (e.g., anemia or blood loss), fibrosis, and/or pulmonary hypertension. |
| US11884712B2 |
Multi-chain chimeric polypeptides and uses thereof
Provided herein are multi-chain chimeric polypeptides that include: (a) a first chimeric polypeptide including a first target-binding domain, a soluble tissue factor domain, and a first domain of a pair of affinity domains; and (b) a second chimeric polypeptide including a second domain of a pair of affinity domains and a second target-binding domain, where the first chimeric polypeptide and the second chimeric polypeptide associate through the binding of the first domain and the second domain of the pair of affinity domains. Also provided here are methods of using these multi-chain chimeric polypeptides and nucleic acids encoding these multi-chain chimeric polypeptides. |
| US11884710B2 |
Peptide compounds and methods of use in wound healing
Peptide compounds and compositions containing the peptide compounds and methods for treating various infections, wounds, and skin conditions such as atopic dermatitis. Examples of wounds that may be treated include surface wounds such as lacerations, abrasions, avulsions, incisions, and amputations, pressure sores, bed sores, wounds due to peripheral vascular disease, post-surgical wounds, diabetic ulcers and wounds, burns, ocular wounds and abrasions, ocular ulcers, and treatment of inflammatory conditions such as dry eye. The peptide compounds and compositions may be used as treatments to enhance acceptance of grafts such as skin grafts and organ grafts. |
| US11884709B2 |
Peptides for the treatment of resorptive bone disease
Described are methods and associated uses for the treatment of resorptive bone disease using peptides comprising part of the C-terminal portion of soricidin. Also described are methods and associated uses for inhibiting osteoclast activity and/or bone resorption using the peptides. |
| US11884707B2 |
Compositions for detection, inhibition and imaging of indoleamine 2, 3-dioxygenase 1 (IDO1) and methods of making and using same
The present application provides stable peptide-based IDO1 capture agents and methods of use as detection, imaging, diagnostic and therapeutic agents. The application further provides methods of manufacturing IDO1 imaging agents. |
| US11884704B2 |
Compositions comprising HIV envelopes to induce CH235 lineage antibodies
In certain aspects the invention provides HIV-1 immunogens, including HIV-1 envelope selections from individual CH505, and methods for swarm immunizations using combinations of HIV-1 envelopes. |
| US11884697B2 |
Oxysterols and methods of use thereof
Compounds are provided according to Formula (I), and pharmaceutically acceptable salts thereof, and pharmaceutical compositions thereof; wherein A, R1, and R5 are as defined herein. Compounds of the present invention are contemplated useful for the prevention and treatment of a variety of conditions. |
| US11884692B2 |
Methods for purification of messenger RNA
The present invention provides, among other things, methods of purifying messenger RNA (mRNA) including the steps of (a) precipitating mRNA from an impure preparation; (b) subjecting the impure preparation comprising precipitated mRNA to a purification process involving membrane filtration such that the precipitated mRNA is captured by a membrane; and (c) eluting the captured precipitated mRNA from the membrane by re-solubilizing the mRNA, thereby resulting in a purified mRNA solution. In some embodiments, a purification process involving membrane filtration suitable for the present invention is tangential flow filtration. |
| US11884688B2 |
Borylated amino acid compositions comprising BTS and BTS(OMe) for use in boron neutron capture therapy and methods thereof
Borylated Amino Acid compositions comprising tyrosine derivatives BTS and BTS(OMe) and novel methods of making BTS and BTS(OMe) are disclosed herein. Consequently, the BTS and/or BTS(OMe) can be scaled up to commercial scale and administered to patients as a Neutron Capture Agent and provide a method of treating cancer, immunological disorders, and other disease by utilizing a Neutron Capture Therapy modality. |
| US11884685B2 |
Rhenium complexes and methods of use for treating cancer
A composition comprising the following structure: (1) wherein Re represents a rhenium ion having a +1 charge; (I) represents an uncharged bidentate ligand containing at least one ring containing a ring nitrogen atom bound to the rhenium (Re), and the bidentate ligand containing another nitrogen atom, either in a ring or not in a ring, bound to the rhenium (Re); and L1, L2, L3, and L4 are neutral ligands with at least one neutral ligand being an isonitrile ligand of the formula —CN—R, wherein R is an aliphatic or aromatic hydrocarbon group containing 1-20 carbon atoms; and X− represents a non-coordinating monovalent anion; wherein the bidentate ligand and R are optionally substituted by one or more groups selected from (i)-(xi) as further discussed above. Methods for treating a condition that benefits from ER stress induction, such as cancer, by administering the above rhenium complex are also disclosed. |
| US11884683B2 |
Tricyclic heterocycle compounds useful as HIV integrase inhibitors
The present invention relates to Tricyclic Heterocycle Compounds of Formula (I): (I) and pharmaceutically acceptable salts or prodrug thereof, wherein R1, R2, R3, R4, R5, R6 and n are as defined herein. The present invention also relates to compositions comprising at least one Tricyclic Heterocycle Compound, and methods of using the Tricyclic Heterocycle Compounds for treating or preventing HIV infection in a subject. |
| US11884681B2 |
3H,4H,5H,6H,7H-pyrimido[4,5-b][1,4]oxazine-4,6-dione derivatives as TRPA1 inhibitors
The present disclosure provides certain 3H,4H,5H,6H,7H-pyrimido[4,5-b][1,4]oxazine-4,6-dione derivatives that are inhibitors of transient receptor potential ankyrin 1 (TRPA1), and are therefore useful for the treatment of diseases treatable by inhibition of TRPA1. Also provided are pharmaceutical compositions containing the same, and processes for preparing said compounds. |
| US11884677B1 |
5-(substitutedphenyl)-7-imino-7,8-dihydropyrimido[4,5-d]pyrimidine-2,4(1H,3H)-dione analogues as anti-inflammatory agents
Compounds for treating an inflammatory disease, disorder, or condition and, particularly, to compounds that are 5-(substitutedphenyl)-7-imino-7,8-dihydropyrimido[4,5-d]pyrimidine-2,4(1H,3H)-dione analogues and their use as anti-inflammatory agents. |
| US11884676B2 |
Substituted pyrimido[1,2-b]pyridazines as positive allosteric modulators of the muscarinic acetylcholine receptor M4
Disclosed herein are analogues of 6-(4-((2,3-dihydrobenzo[b][1,4]dioxin-6-yl)oxy)piperidin-1 -yl)-[1,2,4]triazolo[4,3-b]pyridazine of formula (Ib), which may be useful as positive allosteric modulators of the muscarinic acetylcholine receptor M4 (mAChR M4). Also disclosed herein are methods of making the compounds, pharmaceutical compositions comprising the compounds, and methods of treating neurological and psychiatric disorders associated with muscarinic acetylcholine receptor dysfunction using the compounds and compositions. |
| US11884673B2 |
Modulators of ion channel receptors and uses thereof
Compounds useful in the modulation of ion channel activity in cells are disclosed herein. This disclosure also relates to use of these compounds in the treatment of pain, and pharmaceutical compositions containing these compounds and methods for their preparation. |
| US11884671B2 |
Purinone compounds and their use in treating cancer
The specification generally relates to compounds of Formula (I): (I) and pharmaceutically acceptable salts thereof, where R, A1, A2 and A3 have any of the meanings defined herein. The specification also relates to the use of such compounds and salts thereof to treat or prevent DNA-PK mediated disease, including cancer. The specification further relates to pharmaceutical compositions comprising such compounds and salts; kits comprising such compounds and salts; methods of manufacture of such compounds and salts; intermediates useful in the manufacture of such compounds and salts; and to methods of treating DNA-PK mediated disease, including cancer, using such compounds and salts. |
| US11884669B1 |
Pyrrolo[3,2-c][1,7]naphthyridine-2-carboxylic acid compounds as CK2 inhibitors
The pyrrolo[3,2-c][1,7]naphthyridine-2-carboxylic acid compounds, identified as CK2 inhibitors, are useful as anticancer and/or antitumor agents, and as agents for treating other kinase-associated conditions including inflammation, pain, and certain immunological disorders, and other types of diseases such as diabetes, viral infection, neurodegenerative diseases. The described compounds have the formula I: |
| US11884665B2 |
Pyrazolopyridines and triazolopyridines as A2A / A2B inhibitors
This application relates to compounds of Formula (I): or pharmaceutically acceptable salts thereof, which modulate the activity of adenosine receptors, such as subtypes A2A and A2B receptors, and are useful in the treatment of diseases related to the activity of adenosine receptors including, for example, cancer, inflammatory diseases, cardiovascular diseases, and neurodegenerative diseases. |
| US11884664B2 |
Protein tyrosine phosphatase inhibitors
Compounds of Formula I or a stereoisomer, tautomer, prodrug or pharmaceutically acceptable salt thereof are provided, which are useful for the treatment of hyperproliferative diseases. Methods of using compounds of Formula I or a stereoisomer, tautomer, prodrug or pharmaceutically acceptable salt thereof, for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions are disclosed. |
| US11884658B1 |
1-cyclopropyl-6-fluoro-4-oxo-7-(4-((2-thioxobenzo[d]thiazol-3(2H)-yl)methyl)piperazin-1-yl)-1,4-dihydroquinoline-3-carboxylic acid as an antimicrobial compound
A 1-cyclopropyl-6-fluoro-4-oxo-7-(4-((2-thioxobenzo[d]thiazol-3(2H)-1-3-carboxylic acid compound, its synthesis, and its use as an antimicrobial agent. |
| US11884656B2 |
Pyrrole derivatives as PLK1 inhibitors
The invention provides compounds of the formula (3): or a pharmaceutically acceptable salt or tautomer thereof, wherein: Z is a 5-membered heteroaryl ring containing one or two nitrogen ring members and optionally one further heteroatom ring member selected from N and O; ring X is a benzene or pyridine ring; ring Y is a benzene, pyridine, thiophene or furan ring; Ar1 is an optionally substituted benzene, pyridine, thiophene or furan ring; m is 0, 1 or 2; n is 0, 1 or 2; R1 is selected from various substituents: R2 is selected from hydrogen and a C1-4 hydrocarbon group; R3 is selected from hydrogen and a C1-4 hydrocarbon group; R4 is selected from various substituents; R5 is selected from various substituents; Ar2 is an optionally substituted phenyl, pyridyl or pyridone group; R6 is a group Q1-Ra—Rb; Q1 is absent or is a C1-3 saturated hydrocarbon linker; Ra is selected from O; C(O); C(O)O; CONRc; N(Rc)CO; N(Rc)CONRc, NRc; and SO2NRc; Rb is selected from hydrogen and various substituents; and Rb is selected from R4. The compounds are useful in the treatment of cancers. |
| US11884654B2 |
Substituted anilines as CCR(4) antagonists
Aniline compounds are provided which bind to CCR(4) and are useful for the treatment of diseases such as allergic diseases, autoimmune diseases, graft rejection and cancer. |
| US11884652B2 |
Tetrazole derivatives as TRPA1 inhibitors
The present disclosure provides certain tetrazole derivatives that are inhibitors of transient receptor potential ankyrin 1 (TRPA1), and are therefore useful for the treatment of diseases treatable by inhibition of TRPA1. Also provided are pharmaceutical compositions containing the same, and processes for preparing said compounds. |
| US11884651B1 |
7-(4-((4-benzylidene-5-oxo-2-phenyl-4,5-dihydro-1H-imidazol-1-yl)methyl)piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid as an anti-inflammatory compound
A 7-(4-((4-benzylidene-5-oxo-2-phenyl-4,5-dihydro-1H-imidazol-1-yl)methyl)piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4-dihydroquinoline-3-carboxylic acid compound, its synthesis, and its use as an anti-inflammatory agent. |
| US11884649B2 |
IRE1α inhibitors and uses thereof
Disclosed herein, inter alia, are compounds for inhibiting IRE1α and uses thereof. |
| US11884647B2 |
Compounds and methods for targeting pathogenic blood vessels
The disclosure provides compounds, and compositions, including pharmaceutical compositions, kits that include the compounds, and methods of using (or administering) and making the compounds. The disclosure further provides compounds or compositions thereof for use in a method of modulating PLXDC1 (TEM7) and/or PLXDC2 or killing pathogenic blood vessles. The disclosure further provides compounds or compositions thereof for use in a method of treating a disease, disorder, or condition that is mediated, at least in part, by PEDF receptors or by angiogenesis. |
| US11884645B2 |
Sulfonyl acetamides as NLRP3 inhibitors
The present invention relates to compounds of formula (1): wherein Q is selected from O or S; R1 is a 5-membered nitrogen-containing heteroaryl group substituted with R6 and optionally further substituted; R2 is an alpha, alpha′-substituted cyclic group which may optionally be further substituted; R3 and R4 are each independently hydrogen, halogen, —OH, —NH2, —CN, —R5, —OR5, —NHR5 or —N(R5)2; or R3 and R4 together with the carbon atom to which they are attached may form a 3 to 7 membered saturated or unsaturated, optionally substituted cyclic group; R5 is independently an optionally substituted C1-C4 alkyl group; and R6 is any group comprising a nitrogen atom. The present invention further relates to salts, solvates and prodrugs of such compounds, to pharmaceutical compositions comprising such compounds, and to the use of such compounds in the treatment and prevention of medical disorders and diseases, most especially by the inhibition of NLRP3. |
| US11884642B2 |
Compounds useful as potassium channel openers
The present invention discloses novel compounds which are useful as potassium channel openers, in particular as openers of the Kv7.4 potassium channel. The novel compounds are compounds according to formula I, wherein n=0 or 1, RL is a substituent selected from the group consisting of unsubstituted or substituted cycloalkyl groups, in particular bicycloalkyl groups, unsubstituted or substituted phenyl groups, unsubstituted or substituted thienyl groups or cyclopentathienyl groups, and unsubstituted or substituted indanyl groups, which optionally contain heteroatoms, and RR is a substituent selected from the group consisting of unsubstituted or substituted phenyl groups or unsubstituted or substituted benzyl groups, which optionally contain heteroatoms, or a stereoisomer, a tautomer, a prodrug or a salt, preferably pharmaceutically acceptable salt thereof. |
| US11884636B2 |
Gonadotropin releasing hormone receptor antagonist and use thereof
The present invention provides a compound or a pharmaceutically acceptable salt, isomer, prodrug, polymorph or solvate thereof, and a preparation method therefor and use thereof. The compound provided in the present invention has comparable or superior activity to Elagolix as a GnRHR antagonist in calcium flux assays and have better pharmacokinetic properties. |
| US11884635B2 |
Solid state forms of (S)-2-(((S)-6,8-difluoro-1,2,3,4-tetrahydronaphthalen-2-yl)amino)-N-(1-(2-methyl-1-(neopentylamino)propan-2-yl)-1H-imidazol-4-yl)pentanamide and uses thereof
The present disclosure relates to: a) solid state forms of hydrobromide salts of Compound 1; b) pharmaceutical compositions comprising one or more solid state forms of hydrobromide salts of Compound 1, and, optionally, a pharmaceutically acceptable carrier; c) methods of treating tumors or cancers by administering one or more solid state forms of hydrobromide salts of Compound 1 to a subject in need thereof; and d) methods for the preparation of solid state forms of Compound 1. |
| US11884634B2 |
Compositions of solid forms of (S)-2-(((S)-6,8-difluoro-1,2,3,4- tetrahydronaphthalen-2-yl)amino)-N-(1-(2-methyl-1-(neopentylamino)propan-2-yl)-1H-imidazol-4-yl)pentanamide
The present disclosure relates to: a) solid state forms of hydrobromide salts of Compound 1; b) pharmaceutical compositions comprising one or more solid state forms of hydrobromide salts of Compound 1, and, optionally, a pharmaceutically acceptable carrier; c) methods of treating tumors or cancers by administering one or more solid state forms of hydrobromide salts of Compound 1 to a subject in need thereof; and d) methods for the preparation of solid state forms of Compound 1. |
| US11884630B2 |
Heterocyclic compounds and their uses
Provided are certain pharmaceutical formulations of omecamtiv mecarbil and methods for their preparation and use. |
| US11884629B2 |
N,N diethyl-N'phenylpiperazine alpha 7 and alpha 9 nicotinic acetylcholine receptor agonists and antagonists
Provided are embodiments of para-substituted 1,1-dialkyl-4-phenylpiperazin-1-ium iodides advantageous for modulating inflammation that have been synthesized and their electrophysiology activities for α9, α9α10, and α7 nAChRs compared. The para position contained alkyl or aryl amides, or heterocyclic isosteres for the amide, and the alkyl groups were varied at the ammonium piperazine nitrogen to see if compensatory changes in size at this position of the molecule impacted function. The compounds were characterized with two-electrode voltage-clamp measurements on Xenopus oocytes expressing nAChRs. General, the compounds were more potent for α9-containing receptors than for α7, and the majority were either full or strong partial agonists for α9-containing nAChR. |
| US11884628B2 |
Method for synthesizing lactam derivatives without use of catalyst
Disclosed is a simple synthesis method of lactam derivatives, comprising: with formamide functioning as both an amine source and a hydrogen source (hydrolyzed to produce formic acid), carrying out a cycloamination reaction on a raw material keto acid in the absence of a solvent or a catalyst to simply synthesize a lactam derivative. Compared with previous reports, the present disclosure has the following advantages: the time required for the reaction is greatly shortened, the selectivity is remarkably improved, a conversion rate of a keto acid derivative is greater than 99%, and the yield of the lactam derivative can reach 70% to 94%. |
| US11884622B2 |
Tricyclodecane dimethanol composition and preparation method of the same
Provided are a tricyclodecane dimethanol composition which may be usefully applied to the preparation of a high heat resistant polyester by reducing the content of impurities, and a preparation method thereof. |
| US11884620B2 |
Use of polyamines in the pretreatment of biomass
The present invention provides for a method to deconstruct a biomass: the method comprising: (a) introducing a solvent comprising a polyamine, or a mixture of polyamines, to a biomass to dissolve at least part of solid biomass in the solvent, wherein the polyamine is a Brønsted or Lewis base, and/or the polyamine is a hydrogen bond donor and/or acceptor; (b) optionally introducing an enzyme and/or a microbe to the solubilized biomass mixture such that the enzyme and/or microbe produces a sugar from the solubilized biomass mixture; (c) optionally separating the sugar from the solubilized biomass mixture; and (d) optionally separating the lignan from the solubilized biomass mixture. |
| US11884618B2 |
Preparation of (meth)acrylic acid esters
The invention relates to a method for preparation of (meth)acrylic acid esters from (meth)acrylic acid anhydrides. The method involves: reacting a (meth)acrylic acid anhydride of Formula (I): wherein R1 is a hydrogen atom or a methyl group; with a substrate in the presence of a first catalyst to form a product mixture comprising the (meth)acrylic acid ester; and wherein: the substrate is selected from the group consisting of: primary alcohols; secondary alcohols; tertiary alcohols; and phenols; and the first catalyst comprises a salt of magnesium or of a rare earth element. |
| US11884615B2 |
Modified beta zeolitic (*BEA) catalyst for isomerization of alkylated aromatics, and method for isomerization of alkylated aromatics
The present invention relates to a catalyst for isomerization of alkylated aromatics such as mixed xylenes, using xylene isomerization catalyst particles including post-framework modified *BEA zeolite in which zirconium atoms and/or hafnium atoms, optionally in combination with titanium atoms, form a part of a framework of a beta-type zeolite. |
| US11884612B2 |
Covalent peptide binders
There are provided, inter alia, compositions and methods for covalently binding peptides to proteins. |
| US11884608B2 |
Dimerization of cyclopentadiene from side stream from debutanizer
A system and a process for dimerizing cyclopentadiene (CPD) including producing a C6+C7 rich bottoms stream and a C5 rich side draw from a debutanizer, where the C5 rich side draw and at least a portion of the C6+C7 rich bottoms stream are directed to a dimerizer where the CPD is thermally dimerized to dicyclopentadiene (DCPD). DCPD is more stable than CPD and thus safer to handle. |
| US11884605B2 |
Hybrid catalysts comprising a zeolite and a mixed metal oxide component for converting syngas into C2 and C3 olefins
A hybrid catalyst including a metal oxide catalyst component comprising chromium, zinc, and at least one additional metal selected from the group consisting of aluminum and gallium, and a microporous catalyst component that is a molecular sieve having 8-MR pore openings. The metal oxide catalyst component includes anatomic ratio of chromium:zinc (Cr:Zn) from 0.35 to 1.00, and the at least one additional metal is present in an amount from 25.0 at % to 40.0 at %. A process for preparing C2 and C3 olefins comprising: a) introducing a feed stream comprising hydrogen gas and a carbon-containing gas selected from the group consisting of carbon monoxide, carbon dioxide, and mixtures thereof into a reaction zone of a reactor; and b) converting the feed stream into a product stream comprising C2 and C3 olefins in the reaction zone in the presence of said hybrid catalyst. |
| US11884599B2 |
Gypsum wallboard slurry and method for making the same
A slurry for manufacturing gypsum board is disclosed. The slurry comprises calcined gypsum, water, a foaming agent, and a thickening agent. The thickening agent of the present disclosure acts to improve the cohesiveness of the slurry without adversely affecting the setting time of the slurry, the paper-to-core bond (wet and dry), or the head of the slurry by acting as a defoaming agent or coalescing agent. Examples of suitable thickening agents include cellulose ether and co-polymers containing varying degrees of polyacrylamide and acrylic acid. A gypsum board and method of forming the slurry and the gypsum board are also disclosed. The gypsum board comprises a gypsum layer formed from the slurry. |
| US11884593B2 |
Leveling and noise reducing mortar composition
A mortar composition, in particular a leveling mortar composition, including: a) 3-45 wt. % of a hydraulic binder, b) 15-80 wt. % of lightweight aggregates, c) 5-50 wt. % of a polymer. |
| US11884592B2 |
Hydraulic composition for grout
A hydraulic composition including water; a hydraulic binder; at least one setting retarder; and at least one polysaccharide; the weight ratio of the water/hydraulic binder being greater than 1.5, methods of using the composition as a mixture in a grout and a corresponding method for preparing a grout and the grout thereby obtained. |
| US11884589B2 |
Settable compositions comprising remediated coal ash and methods of cementing in subterranean formations
Some embodiments of the present invention comprise a method of cementing comprising: placing a settable composition into a well bore, the settable composition comprising remediated coal ash, hydraulic cement, and water; and allowing the settable composition to set. Other embodiments comprise a method of cementing comprising: placing a settable composition into a well bore, the settable composition comprising remediated coal ash, calcium hydroxide (lime), and water; and allowing the settable composition to set. Other embodiments comprise a settable composition comprising: remediated coal ash, hydraulic cement, calcium hydroxide, natural pozzolan and water; and allowing the composition to set. Other embodiments comprise a settable composition comprising remediated coal ash and any combination of hydraulic cement, calcium hydroxide, slag, fly ash, and natural or other pozzolan. |
| US11884587B2 |
Silicon-lithium-lead system, conductive paste and preparation method thereof
The present disclosure discloses a silicon-lithium-lead system, a conductive paste and a preparation method thereof, and belongs to the field of solar cells. A silicon-lead-lithium oxide frit includes the following composition: Sia—Pbb—Lic—(Bx—Aly—Biz)-Me-Of, where, 0 |
| US11884584B2 |
Glass for magnetic recording medium substrate or for glass spacer for magnetic recording and reproducing
A glass, which is a glass for a magnetic recording medium substrate or for a glass spacer for a magnetic recording and reproducing apparatus, is an amorphous oxide glass. An SiO2 content ranges from 56 mol % to 80 mol %, an Li2O content ranges from 1 mol % to 10 mol %, a B2O3 content ranges from 0 mol % to 4 mol %, a Na2O content is 0 mol %, a total content of MgO and CaO (MgO+CaO) ranges from 9 mol % to 40 mol %, and the oxide glass has a specific gravity of 2.75 g/cm3 or less, a glass transition temperature of 650° C. or higher, and a Young's modulus of 90 GPa or more. |
| US11884583B2 |
Method for producing colored glass for pharmaceutical containers and colored glass for pharmaceutical containers
The present invention relates to a method of producing a colored glass for a pharmaceutical container by which the transmittance of a glass to be obtained is easily controlled so as to satisfy the standards of the Japanese Pharmacopoeia. |
| US11884580B2 |
Solar-control glazing unit comprising a layer of titanium nitride
A glass article having anti-sun properties includes a glass substrate having a stack of layers, which includes, successively from the surface of the substrate: a first module M1 having a layer based on a dielectric material with a thickness e1 or of a set of layers, a layer TN1 including titanium nitride with a thickness of between 2 nanometers and 80 nanometers, a second module M2 including a layer based on a dielectric material with a thickness e2 or of a set of layers based on dielectric materials with a cumulative thickness e2, an intermediate layer including at least one element selected from silicon, aluminum, titanium or a mixture of at least two of these elements is deposited between the layer TN1 and the first module M1 and/or between the layer TN1 and the second module M2, the intermediate layer having a thickness of between 0.2 nm and 6 nm. |
| US11884572B2 |
Method for bending glass sheets in an apparatus, and apparatus for bending glass sheets
A method for bending glass sheets in an apparatus and an apparatus for bending glass sheets, the apparatus comprising at least one compartment heating the glass sheet to be bent, a press bending station which comprises a male mould to bend a glass sheet, brought through at least one compartment heating the glass sheet to the press bending station by pressing it, and at least one conveyor to transport a mould trolley that may be provided with a female mould and a glass sheet placed on the female mould through the at least one compartment heating the glass sheet to the press bending station. In order to replace the male mould in use at the press bending station with a male mould to be used next, a trolley is delivered which is suitable for carrying the male mould to the press bending station to receive the male mould to be removed from use on said trolley to carry the male mould to be removed from use away from the press bending station by said trolley, and a trolley is delivered which is suitable for carrying a male mould and provided with the male mould to be brought into use to the press bending station in order to carry the male mould to be brought into use to the press bending station. |
| US11884571B2 |
Alternative fluorinating agents for the production of fluorinated quartz glass
A process for producing a fluorinated quartz glass is described, including providing an SiO2 soot body; reacting the SiO2 soot body with a fluorinating agent having a boiling point of greater than or equal to −10° C. to obtain a fluorinated SiO2 soot body; and vitrifying the fluorinated SiO2 soot body. |
| US11884570B2 |
Process for manufacturing an optical element from glass
The disclosure concerns to a process for manufacturing an optical element from glass, wherein a blank of glass is tempered, for example in such a way that the blank is cooler in its interior than on its exterior, wherein the tempered blank between a first mold and a second mold, which are moved towards one another to form a closed cavity, is press-molded, for example on both sides, to form the optical element, wherein the first mold and/or the second mold comprises an escape cavity slide which is compressed by the formation of a closed cavity by means of the first mold and the second mold as a function of the volume of the blank, so that, during press-molding, an additional edge which is dependent on the volume of the blank is formed with the optical element. |
| US11884566B2 |
Engineered yeast as a method for bioremediation
Metal bioremediation and metal mining strategies can include compositions and methods. |
| US11884564B2 |
Amorphous cobalt-inherent silicon oxide catalyst
Claimed herein is a method of applying amorphous Co—SiOx to activate PMS and produce SO4·− due to the formation of Co(II)-Ov, pairs via the substitution of Si by Co. The inherent Co significantly change the electronic structure of O and Si atoms in the Co—SiOx via final state effects and increase the conductivity in terms of more effective electron transfers. The claimed method using Co—SiOx functions as a more effective oxidative catalyst for the faster degradation of pollutants. The simplicity of the synthetic procedures indicates that the conductive Co—SiOx could be used for the activation of PMS and other electrochemical applications on a wider scale. |
| US11884562B2 |
Apparatus and method for urea electrolysis with controlled alkalinity
Apparatus and method for electrolysis of urea is capable of removing urea from waste-water generated by human urine or agricultural run-off while simultaneously producing cleaner water and hydrogen gas. The apparatus and method employ at least one water reduction electrode located close to at least one urea oxidation electrode. The water reduction electrode operates to generate a locally high pH such that the urea oxidation electrode operates in a locally high pH envelope where it can perform its reaction efficiently to break down the urea with little or no impact on the pH of the bulk solution. |
| US11884559B2 |
Electrochemical cell for wastewater treatment with improved electrical protection
An electrochemical cell for wastewater treatment comprises a catalyst coated membrane, an open pore mesh placed on each side of the catalyst coated membrane, and a compression frame placed next to each of the open pore meshes. Each compression frame has compression arms spread within the area delimited by the perimeter of the frame to apply a uniform compression force through fasteners which protrude through the compression arms, the open pore meshes and the catalyst coated membrane. Each open pore mesh comprises a flat surface and an embossed surface. The embossed surface can comprise embossed areas around the holes in the open pore mesh, transverse embossed areas which, in the assembled cell, are placed next to the compression arms of the compression frames and peripheral embossed areas along the perimeter of the open pore meshes. The embossed surface provides an improved protection against electro-circuiting. |
| US11884557B2 |
Container with UV purification
A water container for purifying water. The water container includes an opening configured to receive water, a container body arranged to enclose the water and a water purifying unit configured to purify the water. The water purifying unit includes an at least partially transparent plate, which includes a coating of metal-oxide nanoparticles on a first side facing the container body, wherein the first side is configured to be in contact with the water, and an ultraviolet light module configured to radiate towards a second side of the at least partially transparent plate such that light from the ultraviolet light module at least partially passes through the at least partially transparent plate. Also, a method for purifying water within a water container. |
| US11884556B2 |
Liquid, air, and surface treatment using high intensity broad-spectrum pulsed light
Liquid, air, or surface treatment/sterilization/disinfection using pulsed light to eliminate, reduce, degrade, render inert, or nullify physical, chemical, biological, microbiological, or non-microbiological contaminants is disclosed herein. The system also includes at least one power supply powering the light source of the reactor, an ionized wire wrapped outside the light source of the reactor, at least one digital multiplexer connected to the at least one power supply, and a controller to control the at least one digital multiplexer to power the light source to strobe the pulsed light at a predetermined fluence, a predetermined pulsed width, and a predetermined frequency or spectrum to eliminate, reduce, degrade, render inert, or nullify the physical, chemical, biological, microbiological, or non-microbiological contaminants in a liquid flow, air, or surface at a molecular level. |
| US11884554B2 |
Process for precipitating a carbonate or (oxy)hydroxide
Process for precipitating a carbonate or (oxy)hydroxide comprising nickel from an aqueous solution of a nickel salt wherein such process is carried out in a vessel comprising (A) a vessel body, (B) one or more elements that control the hydraulic flow of the slurry formed during the precipitation and that induce a loop-type circulation flow, and (C) a stirrer whose stirrer element is in the vessel but located separately from the element(s) (B). |
| US11884553B2 |
Magnesium oxide powder, thermally conductive filler, resin composition, and production method for magnesium oxide powder
This magnesium oxide powder contains secondary particles in which a plurality of primary particles of magnesium oxide having a crystal phase and a grain boundary phase are at least partially fused together by the grain boundary phase, and a median diameter obtained by a laser diffraction scattering method is 300 μm or less. |
| US11884550B2 |
Shaped gel articles and sintered articles prepared therefrom
Shaped gel articles that are formed within a mold cavity and that retain the size and shape of the mold cavity upon removal from the mold cavity, sintered articles prepared from the shaped gel articles, and methods of making the sintered articles are provided. The shaped gel articles are formed from a casting sol that contains colloidal silica particles that are treated with a surface modification composition that includes a silane surface modification agent having a radically polymerizable group. The sintered article has a shape identical to the mold cavity (except in regions where the mold cavity was overfilled) and to the shaped gel article but reduced in size proportional to the amount of isotropic shrinkage. |
| US11884547B2 |
Chalcogen-grafted carbon materials and processes for their preparation
Chalcogen-grafted carbon material as well as their functionalized forms are described along with processes for their preparation. More specifically, the chalcogen is covalently linked to the carbon scaffold of a polyaromatic carbon via C═X and/or C—X—C bonds. Processes for their preparation include a single thermal treatment without the use of strong acids or anhydrous solvents. |
| US11884542B2 |
Permanently polarized hydroxyapatite, a process for its manufacture and uses thereof
The present invention relates to a permanently polarized hydroxyapatite and a composition or material comprising thereof. The present invention further relates to a process for obtaining a permanently polarized hydroxyapatite and to different uses of the permanently polarized hydroxyapatite or the composition or material comprising thereof. |
| US11884540B2 |
Methods and systems for producing hypobromite by adding acid to reactants
The reaction of sodium hypochlorite with sodium bromide is slow, and commonly only part of the bromide is converted to hypobromite. Methods to accelerate the reaction by adding a regulated amount of acid to a solution comprising bleach and bromide are provided, whereby the yield of hypobromite can be increased. The amount of acid added can be predetermined based on the content of a base in the bleach, and acid can be added to neutralize the base. The amount of acid added can be based on a measured parameter of the reaction that is indicative of reaction kinetics. For example, the amount of acid can be actively controlled by measuring pH, absorbance of visible or near Ultraviolet light, or temperature of the reacting solution and adjusting acid. |
| US11884536B2 |
Electrical interconnection structure, electronic apparatus and manufacturing methods for the same
Provided are an electrical interconnection structure, an electronic apparatus and manufacturing methods therefor, which can provide a reliable electrical interconnection structure between the MEMS apparatus and an external circuit while sealing and encapsulating the MEMS device. The electrical interconnection structure includes: a bonding metal; a first dielectric layer and a second dielectric layer. The first dielectric layer includes a first through hole penetrating the first dielectric layer and exposing the bonding metal. The first through hole is filled with a first conductive material electrically connected to the bonding metal. The second dielectric layer includes a second through hole. An orthographic projection of second conductive material in the second through hole covers an orthographic projection of first conductive material in the first through hole onto the plane of the base. The second through hole is filled with a second conductive material electrically connected to the first conductive material. |
| US11884535B2 |
Device, package structure and manufacturing method of device
A package structure includes a first substrate and a first device disposed on the first substrate. The first device includes at least one anchor structure, a film structure anchored by the anchor structure and an actuator configured to control the film structure to form a first vent temporarily. The film structure partitions a space into a first volume to be connected to an ear canal and a second volume connected to an ambient of a wearable sound device. The ear canal and the ambient are connected via the first vent when the first vent is opened. The first vent is opened by controlling a first membrane portion and a second membrane portion of the film structure, such that a difference between a first displacement of the first membrane portion and a second displacement of the second membrane portion is larger than a thickness of the film structure. |
| US11884534B2 |
System for emergency pressure relief and vapor capture
Preloading a containment vessel with Low Vapor Pressure (LVP) liquid; partially evacuating the containment vessel to generate a vacuum in a headspace above the LVP liquid; and relieving material from a process vessel into the containment vessel during a process relief event in the process vessel. The containment vessel pressure may be equalized with ambient conditions prior to preloading the LVP liquid. The containment vessel size and quantity of LVP liquid may be determined to absorb the energy and mass of relieving fluids from the maximum anticipated relief scenario, permitting the gases to condense to liquid form to be recovered in liquid state instead of atmospherically venting or combusting the gases. The containment vessel headspace may be partially occupied with High Vapor Pressure (HVP) liquid comprising C5-C10 hydrocarbons configured to flash during the evacuation step to create and occupy a headspace, providing additional head space volume and heat rejection capacity. |
| US11884533B2 |
Water container with manual dispensing valve
Disclosed is a water dispenser including a container with an out-let channel at the bottom thereof and a manually operated valve arrangement with a valve member resiliently pre-stressed towards a closing state. |
| US11884532B2 |
Method of installation of a vacuumed controlled level sensing liquid dispensing system and use thereof
A gravity flow liquid disinfectant dispensing reservoir comprised of a tapered base and a neck portion that extends centrally from the reservoir. An aperture located on the bottom of the reservoir facilitates the dispensing of liquid (i.e., disinfectant) from the reservoir into a holding tank. In another embodiment, a closed system for dispensing a liquid disinfectant into a tank containing liquid (effluent) and controlled via vacuum. The gravity flow device introduces disinfectant to the tank as the water level rises, giving the ultimate amount of contact time for treatment of effluent. Utilizing gravity and vacuum controlled dispensing of disinfectant dispenses disinfectant continuously and automatically in real time and provides for maximum contact time for minimal pathogen survival. |
| US11884525B2 |
Systems and methods for limiting operation of a lift device
A lift device includes a lift assembly, a platform, and a controller. The lift assembly is configured to be driven to increase or decrease in length by extension and retraction of one or more actuators. The platform is coupled at an upper end of the lift assembly. The controller is configured to receive a value of a pitch angle and a roll angle of the lift device from an orientation sensor. The controller is further configured to determine a maximum allowable elevation of the platform based on at least one of the value of the roll angle and the value of the pitch angle of the lift device. The controller is further configured to limit operation of the lift assembly based on the maximum allowable elevation of the platform. |
| US11884518B2 |
Systems and methods for distance control between pipelayers
A pipelayer machine includes a propulsion system, a ranging, and a controller in communication with the propulsion system and the ranging system. The controller is configured to receive a predetermined distance that the pipelayer machine is to maintain between the pipelayer machine and an adjacent pipelayer machine, determine, via the ranging system, a first distance between the pipelayer machine and the adjacent pipelayer machine, and determine that a difference between the first distance and the predetermined distance is outside of a predetermined tolerance range. The controller is further configured to modify a speed of the propulsion system based at least in part on determining that the difference is outside of the predetermined tolerance range, wherein modifying the speed of the propulsion system causes acceleration or deceleration of the pipelayer machine. |
| US11884514B2 |
Safety brake device and safety brake method
A method and device for safety braking an elevator having an upright guide rail wherein the device includes a housing having braking elements on both sides of and being movable along the guide rail, a safety restraint on both sides between the housing and the braking elements, and a clampable and lockable actuating device that unlocks and unclamps in response to a triggering event and brings the braking elements into braking engagement with the guide rail. The actuating device, when unclamped, develops a feed force and movement transverse to the guide rail longitudinal axis engaging the braking elements with the guide rail from a laterally distanced initial position, wherein the braking elements are entrained by frictional contact on the guide rail and enter the safety restraint, and wherein the actuating device is moved back into the initial position, clamped and locked by the braking elements located in the safety restraint. |
| US11884512B2 |
Car and entity safety supervising unit for an elevator
A car safety supervising unit (SSU) for an elevator having an elevator car displaceable within an elevator shaft includes at least one sensor for sensing car-related parameters and outputting corresponding car-related signals, an I/O interface for inputting input signals into the car SSU and for outputting output signals to external devices and a signal processing unit for processing at least one of the car-related signals and the input signals and for generating the output signals. In an installation operation mode, the signal processing unit processes exclusively the car-related signals and generates the output signals based exclusively on the car-related signals whereby the car SSU accomplishes basic safety functions for safely operating the elevator with a limited number of available sensors. In a normal operation mode, the signal processing unit processes both the car-related signals and the input signals and generates the output signals based on both. |
| US11884502B2 |
Tape dispenser
A tape dispenser providing a dispensing assembly adapted to accommodate various widths of tape, wherein the dispensing assembly is operatively associated with a handle assembly to enable self-alignment of the dispensing tape and the dispensing assembly, and wherein a cutting assembly is operatively associated with the dispensing assembly for selectively cutting the dispensing tape. |
| US11884494B2 |
Tire enhancement product, package, and method
A tire-enhancement product has a container comprising a dissolvable packaging material; and a solute encased in the container that is inert to the solute. The container is configured to be placed in an interior volume of a tire, to which solvent can be added. The container is configured to dissolve when placed in a predetermined solvent, and the solute is configured to mix with the solvent to form a tire-enhancement mixture. |
| US11884493B1 |
Container shuttles having omnidirectional wheels
Systems and methods are disclosed for container shuttles having omnidirectional wheels. In one embodiment, an example system for shuttle transportation may include a first linear synchronous motor arranged in a first orientation, a second linear synchronous motor arranged in a second orientation that is offset with respect to the first linear synchronous motor, and a shuttle having a permanent magnet and a plurality of omnidirectional wheels. The shuttle may be configured to be propelled in a first direction via the first linear synchronous motor and the permanent magnet, and to be propelled in a second direction via the second linear synchronous motor and the permanent magnet. |
| US11884491B2 |
Apparatus and method for the suspended conveyance of items
An apparatus for the suspended conveyance of items includes a conveyor system which has a conveyor rail along which the items can each be conveyed suspended from an overhead adapter, and a plurality of buffer devices which are coupled to the conveyor system, which buffer devices are each designed as a circulating storage device, which buffer devices have a discharge conveyor, a separating unit arranged upstream of the discharge conveyor, an identification unit arranged downstream of the separating unit, and a diverter element arranged on the discharge line for discharging the overhead adapters, wherein the discharge conveyor is operable at a first conveying speed when no overhead adapter to be discharged has been identified, is operable at a second conveying speed when an overhead adapter to be discharged has been identified, wherein the second conveying speed is lower than the first conveying speed. |
| US11884489B2 |
Picking device for storing medicine bottles and method for retrieval
A picking device for storing bottles and a corresponding method are provided. The picking device includes a plurality of storage locations for bottles, an operating device having a gripper, at least one storing device, at least one identification device and an unloading device. The storage locations have storage location receptacles and the storing device has at least one storing receptacle for bottles, wherein the storage location receptacles and the storing receptacle are configured such that the bottles are held therein in such a way that they are protected against rolling. The gripper includes a gripping member configured such that the bottles are movable from the storing receptacles and storage location receptacles by being lifted by the gripping member or by being pulled to a holding area of the gripper. |
| US11884486B2 |
Robust grabber arm for refuse collection vehicle
A robust grabber arm for use as part of a refuse collection vehicle has an inner arm member and an outer arm member which are designed to have parallel beams coupled to one another so that a wide operating profile is created. Further, care is taken in configuring compounds so that each of the hinge points and coupling points are accessible for service and maintenance purposes. To provide additional consistency, common bearings and hinge pins are used throughout, so that maintenance and possible replacement can be easily achieved. |
| US11884485B1 |
Autonomous refuse container
An autonomous mobile robotic refuse container device that transports itself from a storage location to a refuse collection location and back to the storage location after collection of the refuse. When it is time for refuse collection, the robotic device autonomously navigates from the refuse container storage location to the refuse collection location. Once the refuse within the container has been collected, the robotic device autonomously navigates back to the refuse container storage location. |
| US11884484B2 |
Bin aid
A bin aid is provided that is adapted to raise and lower a bin lid of a bin, the bin aid including a main body and a connection means functionally connectable with the main body and able to functionally engage with the bin lid. The connection means includes a rotatable unit and a control means for controlling one or more functions to aid the use of a bin including to selectively control the connection means. The connection means is able selectively to raise and to lower the bin lid with respect to the closely located bin. |
| US11884483B1 |
Collapsible container with slidable retractable wall
In multiple embodiments, a collapsible container includes a base and a plurality of walls pivotably connected to edges of the base and collapsible onto the base. The plurality of walls include a retractable first wall. The first wall includes a frame having a lower horizontal portion and a pair of upstanding vertical portions extending upward from the lower horizontal portion to define an access opening therebetween. An upper beam is slidably coupled to the vertical portions and movable between a first position away from the lower horizontal portion of the frame and a second position proximate the lower horizontal portion of the frame. In some embodiments, the first wall includes a mid-beam coupled to the upper beam. The mid-beam is spaced away from the upper beam and spaced away from the lower horizontal portion of the frame when the upper beam is in the first position. |
| US11884480B2 |
Blasting system with dual dispensers from single chamber
A tank assembly. The tank assembly comprises a shell, a plurality of conical dispensers, a plurality of drawtubes, a plurality of drawtube apertures, a slurry reservoir, one or more spray equipment and a slurry mixture. The slurry reservoir comprises a fluid reservoir within the shell of the tank assembly. The slurry reservoir comprises an upper reservoir and a conical dispensers reservoir. The conical dispensers reservoir can comprise a fluid space within the plurality of conical dispensers. each among the plurality of drawtubes comprise a drawtube axis. The plurality of drawtubes comprise at least a first drawtube and a second drawtube. |
| US11884479B2 |
Pizza box and blank
A pizza box for containing a baked pizza is provided. The pizza box is suitable for assuming a box-like configuration and has a base, a lid, side walls, a front wall, a rear wall, and flaps joined to the side walls, the flaps being suitable for being removably constrained by engagement in flap coupling seats on the front wall. At least one flap has a gripping portion which, when the pizza box is in a closed configuration, extends externally, allowing a pulling force to be applied to the gripping portion to disengage the at least one flap from at least one of the flap coupling seats and to bring the pizza box into a laterally open configuration. A blank for producing a pizza box in a single piece is also provided. |
| US11884478B2 |
Egg carton with dual handles
An egg carton having base and lid trays that when disposed in vertical alignment (with the lid tray on top of the base tray) form a closed egg carton. The base and lid trays each include a pair of mating handle components, such that when assembled to form a closed carton provide both enhanced strength and ease of carrying the assembled carton. The handles also facilitate handling of the base and lid trays separately during manufacture, packing and transport, and during and after filling the base with eggs. The new base, lid and carton assembly are particularly useful when adapted for holding more than a dozen eggs, for example when holding 30 or more eggs in a rectilinear array of egg cells (arranged in linear rows and transverse linear columns), such as a 5×6 array of egg cells. The lid may further include a labeling area above a select portion of the base cells, the labeling area comprising a flat panel top wall and a depending sidewall forming an empty interior cavity below the top wall, for insertion of labeling material. |
| US11884469B2 |
Packaging system
A packaging system for a respiratory mask has a first compartment configured to receive at least a first portion of the respiratory mask, and a second compartment configured to receive at least a second portion of the respiratory mask, the first and second compartments being separated by an internal wall including at least respiratory mask retention feature that may be configured to retain at least the respiratory mask to the packaging system. |
| US11884465B2 |
Hydration reservoir
A hydration reservoir is provided. The hydration reservoir may include at least two panels of resilient material joined together at edges to define a bladder and a bladder volume for storing a liquid. The at least two panels may be deformable as the bladder is emptied of liquid. One of the at least two panels may be molded into a three-dimensional shape. |
| US11884462B2 |
Tray
A tray made of cardboard, paperboard or other lightweight foldable sheet material that comprises one or more pockets (8) for receiving product. The tray comprises a top sheet defining one or more top sheet openings for the one or more pockets and a bottom sheet attached to the top sheet that comprises one or more bottom sheet openings that are aligned with the top sheet openings. |
| US11884459B2 |
Spouted pouch and a closure assembly
A spouted pouch (1) has a spout (10) with a neck (14) extending upward from an attachment portion (12). A cap unit (30) has a cap body (35) and an integrated ring member (50), made as one piece of plastic. A ring member is integrally formed to the lower edge of the skirt of the cap body and comprises an annular base portion (51) connected via breakable bridges (53) to the skirt. The base portion and the spout body (11) have cooperating permanent snap-fit joint portions (56, 21, 23) that keep the ring member fixed to the spout upon removal of the cap body. The pouch further comprises a flow control device (80) made distinct from the spout and from the cap unit. The flow control device is mounted to the neck (14) and has an external part (82) located outside of the exterior surface of the neck. The cap body is arranged over the neck and the flow control device. The ring member and the external part of the flow control device have cooperating retention portions (55, 83). |
| US11884458B2 |
Liquid dispenser with securing mechanism
A liquid dispenser is for the delivery of pharmaceutical liquids, including a droplet dispenser, the liquid reservoir thereof being formed by a squeezable bottle body. Two measures secure the liquid dispenser, namely the provision of a cover body, an application of force on the squeezable bottle body being able to be prevented thereby, as well as a cap with a rotatable locking ring. The removal of the cap and the transfer of the cover body into a use position requires the deformation of an annular partial element. |
| US11884451B2 |
Modular utility bottle
A modular bottle (e.g., for holding liquid or dry storage contents) and its various assemblies, components, and structures are provided. The bottle can include a body portion including an open longitudinal end and an interior region, an end cap configured to be secured over the open longitudinal end to enclose the interior region, and a flexible loop. The end cap can include a pair of knobs disposed on a circumferential side surface of the end cap. Each end of the flexible loop can define an aperture that is smaller than a largest diameter of each of the pair of knobs such that each end of the flexible loop is selectively couplable with each of the pair of knobs. |
| US11884446B2 |
Passivation, pH protective or lubricity coating for pharmaceutical package, coating process and apparatus
A method for providing a passivation layer or pH protective coating on a substrate surface by PECVD is provided, the method comprising generating a plasma from a gaseous reactant comprising polymerizing gases. The lubricity, passivation, pH protective, hydrophobicity, and/or barrier properties of the passivation layer or pH protective coating are set by setting the ratio of the O2 to the organosilicon precursor in the precursor feed, and/or by setting the electric power used for generating the plasma. In particular, a passivation layer or pH protective coating made by the method is provided. Pharmaceutical packages coated by the method and the use of such packages protecting composition contained in the vessel against mechanical and/or chemical effects of the surface of the package without a passivation layer or pH protective coating material are also provided. |
| US11884444B2 |
Robotic product labeling system
A system moves items, like containers and/or pallets, through a label printing station. The station has a label printer that prints adhesive labels; and a robot arm terminating at a movable end with a suction pad or vacuum device and sensors. The station has sensors configured to measure a height of the item; and a processor coupled to receive the height of the item, to control the robot arm and label printer, and to receive label information from a server. The processor has a memory containing code that computes desired label positions based on height of the container/pallet. A method of labeling an item includes printing an adhesive label with the label information obtained from a server; receiving the adhesive label on a suction pad or vacuum device attached to a movable end of a robot arm, and determining a first labeling position from measured height of the container/pallet. |
| US11884440B2 |
Method, apparatus, device and storage medium for controlling paste squeeze device
A method for controlling a paste squeeze device includes: identifying identity information of a user approaching the paste squeeze device; acquiring target usage information corresponding to the identity information, the target usage information including a target paste type and a target usage amount; and controlling the paste squeeze controller on the storage part storing a paste of the target paste type to squeeze out a paste of the target usage amount. The paste squeeze controller on the corresponding storage part can be controlled to squeeze out the paste of a target usage amount based on the identity information of different users, thereby providing accurate amount of paste specific to the individual user. |
| US11884439B2 |
Plastic bag dispenser device
A plastic bag dispenser device for dispensing feces bags with help from a moisture pad includes a tube. The tube has an aperture positioned on the side of the tube. The aperture provides an opening for a user to grab a canine feces bag. A lid is positioned on top of the tube. A compartment is attached to the top of the lid. The compartment defines a space for a moisture pad to be placed. The moisture pad wets the fingers of the user. A roll of bags is stored within the hollow interior of the tube. Each of the bags is coupled to each other by a perforation line. The user can separate each bag from the roll by pulling the bag from the perforation line. A snap hook clip is attached to the exterior of the tube and is used for attaching the tube to a canine leash. |
| US11884438B2 |
Adaptive container loading assembly
An adaptive container loading assembly is provided and includes a container forming assembly, a container shuttle assembly, and a product transport assembly. The container forming provides a plurality of varying sized containers. The container shuttle assembly is positioned adjacent to the container forming assembly and includes a linear synchronous motor guideway shaped in an endless loop, and a plurality of transport vehicles moveable about the guideway, each transport vehicle a leading shuttle and a trailing shuttle spaced apart by a determined distance to accommodate and receive the plurality of varying sized containers. The product transport assembly is positioned adjacent the container shuttle assembly and includes a robot arm to position product in the plurality of varying sized containers. |
| US11884436B2 |
Apparatus for the packaging of containers of devices for pharmaceutical use
An apparatus for packaging containers of devices for pharmaceutical use includes a robotic arm movable from a gripping position, in which it picks up a container previously sealed by at least one protective sheet, to a release position in which it inserts the container into a bag through a suitable opening provided on a side of the bag; wherein the robotic arm is connected to at least one position control camera configured to read coordinates of a midpoint of the opening with respect to a lying plane on which the bag lies and/or an angle of rotation of the bag with respect to an axis perpendicular to the lying plane, so as to ensure the correct positioning and release of the container inside the bag. |
| US11884434B2 |
Packaging machine and method for producing a packaging unit as well as a packaging unit made of packaging sleeves and an outer packaging
Shown and described are a packaging machine and a method for producing a packaging unit from a packaging sleeve group comprising a plurality of flat folded, upright packaging sleeves, and an outer packaging. It is provided that the packaging machine comprises at least one conveyer unit for conveying the packaging sleeve group in a conveyor direction perpendicular to the longitudinal extent of the packaging group and at least one outer packaging unit for preparing an outer packaging-shaping sheet material in a base position, and in that, seen in the conveyor direction behind the sheet material in the base position, a sealing unit is provided for sealing of the sheet material enclosed in the packaging sleeve group. |
| US11884433B2 |
Container comprising a plurality of portion packets of a product for oral use
The disclosure relates to a container comprising a plurality of portion packets of a product for oral use. |
| US11884432B2 |
Cartoning apparatus
The invention relates to a cartoning apparatus (1) of items comprising: a sorting machine (100), which is configured to arrange the items into clusters, and a die-cut magazine (125), in which a plurality of die-cuts (5) are stored for packaging the clusters of items. Where the die-cut magazine is flanked in plan to the sorting machine and is spaced therefrom so that between the die-cut magazine (125) and the sorting machine there is a passage gap (126) with a width greater than 50 cm in at least a stretch of the passage gap. |
| US11884428B2 |
Transfer station for API seed crystals
The present disclosure is directed to a big-bag transfer station for API seed crystals. The transfer station may permit the filling of smaller containers, such as bags or pouches, from a large container, such as a big bag. The transfer station may permit the transfer without contaminating the atmosphere of the room in which the station is housed. Additionally, the transfer station may limit cross-contamination between filling cycles by employing single-use liners. |
| US11884427B2 |
Stud-propelling mechanisms for securing a launch vehicle to a landing platform, and associated systems and methods
Stud-propelling mechanisms for securing a launch vehicle to a landing platform, and associated systems and methods, are disclosed. A representative system includes a fastening mechanism carried by a landing support element of a portion of a launch vehicle, the mechanism configured to fasten the landing support element to the landing surface when the launch vehicle portion is on the landing surface. The fastening mechanism can include a barrel structure for propelling a stud and an interference portion positioned to receive the stud upon activation of an energetic material that propels the stud. The stud can bind in the interference portion and in the landing surface to fasten the landing support element to the landing surface. A representative method includes automatically fastening a portion of a launch vehicle to a landing surface using a stud carried by the portion of the launch vehicle. |
| US11884422B2 |
Base stations for unmanned aerial vehicles (UAVs)
A base station is disclosed for an unmanned aerial vehicle (UAV). The base station includes: an enclosure; a slide mechanism that is connected to the enclosure and which is repositionable between a retracted position and an extended position; and a cradle that is connected to the slide mechanism and which defines a chamber that is configured to receive the UAV such that the UAV is movable into and out of the enclosure during repositioning of the slide mechanism between the retracted position and the extended position. The cradle includes: an upper shell; a lower shell that is connected to the upper shell; and at least one thermal insulator that is located between the upper shell and the lower shell. |
| US11884420B2 |
Gimbal device and flying apparatus
This gimbal device comprises: a driving unit in which a main board is disposed; a first housing coupled to the driving unit; a first motor disposed within the first housing; and a first connection unit electrically connected to the first motor. The first connection unit includes: a first region extending in a first circumferential direction along the outer circumferential surface of the first motor; a first bent region bent from the first region; and a second region extending from the first bent region in a second circumferential direction, wherein one among the first circumferential direction and the second circumferential direction is the clockwise direction, and the other is the counterclockwise direction. |
| US11884419B2 |
Exterior aircraft light and aircraft comprising an exterior aircraft light
An exterior aircraft light that can be used on an aircraft includes a dome-shaped light transmissive cover, a light emission assembly, and an interface assembly. The light emission assembly comprises a light emission tower portion, having a cover-facing end and an opposite aircraft-facing end and having a hollow channel extending between the aircraft-facing end and the cover-facing end, a platform portion, and at least one light source and at least one optical element, arranged on the platform portion. The interface assembly extends through the hollow channel of the light emission tower portion and comprises an elevated base, which is configured for mechanically supporting and electrically connecting an electric component, the electric component being at least one of a data reception component, a data transmission component, and a data generation component. The interface assembly further comprises at least one signal line, which extends from the elevated base through the interface assembly. |
| US11884413B2 |
Operating a vehicle with rotors while avoiding a band of rotor rotational speed
A method is provided for operating a vehicle that includes rotors driven by actuators to cause the vehicle to move. The method includes determining rotational speeds at which to drive the rotors to achieve a controlled movement of the vehicle. The rotational speeds include a rotational speed for a rotor of a pair of the rotors driven by a pair of the actuators. The method includes monitoring the rotational speed to detect that the rotational speed has approached or reached a defined avoid band of rotational speeds, and biasing the rotational speed to produce at least one biased rotational speed for respective rotors of the pair that is outside the defined avoid band. The method includes generating commands for the actuators based on the rotational speeds, and modifying the commands including those of the commands for the pair of the actuators based on the at least one biased rotational speed. |
| US11884410B2 |
Dual function links for gas turbine engine mounts
Dual function links for gas turbine engine mounts are disclosed. An example apparatus for mounting a casing of a gas turbine engine to a pylon, the apparatus includes a first pin and a linkage including a first linkage portion including the first pin, a second linkage portion, the second linkage portion forming a first load path between the gas turbine engine and the pylon, the second linkage portion arranged with respect to the first linkage portion such that a gap prevents the first linkage portion from forming a second load path between the gas turbine engine and the pylon. |
| US11884409B2 |
Aircraft electric motor with integrated cooling system
Aircraft electric motors include a motor unit having a rotor and a stator. The stator includes a plurality of windings and cooling channels arranged to provide cooling thereto. A drive unit is configured to drive operation of the motor unit. A cooling system includes a working fluid arranged within a cooling fluid flow path, wherein the cooling fluid flow path includes a liquid cooling path configured to direct flow of the working fluid through, at least, the cooling channels of the motor unit and a vapor cooling path configured to direct flow of the working fluid through the drive unit and a separator arranged upstream of each of the liquid cooling path and the vapor cooling path and configured to direct a liquid portion of the working fluid into the liquid cooling path and configured to direct a vapor portion of the working fluid into the vapor cooling path. |
| US11884407B2 |
Parachute device, flight device, and flying body ejection mechanism
A parachute device includes a parachute, a parachute accommodation section configured to accommodate the parachute, at least one flying body including a flying body main body section connected to the parachute, and a gas generating device configured to generate gas. The parachute device further includes an ejection section configured to eject the flying body, and a lead wire configured to ignite the gas generating device. The flying body main body section is engaged with the ejection section, the gas generating device is disposed in an internal space defined by the ejection section and the flying body main body section, and the lead wire is led out from the internal space in a different direction from an ejection direction of the flying body in a state with one end connected to the gas generating device. |
| US11884401B2 |
Lavatory systems having containment compartments
A lavatory system within an internal cabin of a vehicle includes an enclosure defining an interior chamber, a first lavatory unit within the interior chamber, and a second lavatory within the interior chamber. The first lavatory unit is adjacent to the second lavatory unit. In at least one embodiment, a lavatory within an internal cabin of a vehicle includes an interior chamber defined by one or more outer walls, and a storage compartment extending outwardly from at least one of outer walls. The storage compartment defines an internal storage space that connects to the interior chamber. In at least one embodiment, a lavatory includes a first lavatory unit, a second lavatory adjacent to the first lavatory unit, and a containment compartment common to the first lavatory unit and the second lavatory unit. |
| US11884397B2 |
Unmanned aerial vehicle delivery systems
Certain embodiments of the present application relate to a method for releasing a parcel from an unmanned aerial vehicle (UAV). The parcel is engaged with a hook attached to a line suspended from the UAV. The method includes lowering the hook such that the parcel is at least partially supported by a target surface, thereby performing an attempt to release the parcel from the hook, performing at least one iteration of an iterative procedure. The iterative procedure includes raising the hook, and determining whether the line remains loaded. The iterative procedure further includes lowering the hook an additional time in response to a determination that the line remains loaded, thereby performing an additional attempt to release the parcel from the hook. The iterative procedure further includes performing an additional iteration of the iterative procedure in response to the number of attempts failing to satisfy a threshold number of attempts. |
| US11884396B1 |
Rapid release interface for airdrop lashings
An apparatus for rigging and derigging lashings of an airdrop platform with one action includes a rapid release interface assembly. A loop member replaces the D-ring at the one end of a lashing. The rapid release interface system is installed in the space between the platform side rail and panel end members. Pins will slide through the lashing loop members to secure the end of the lashing to the rapid release interface system. With all of the pins on a common drive, the pins are all opened and closed together, or at the same time. In this manner, the one end of the lashing can be secured or released with one action making it faster and easier to derig a payload from an airdrop platform. |
| US11884392B2 |
Autonomous aircraft control systems
An aircraft assistance method for reducing drag on the aircraft. The method includes flying an autonomous aircraft near the aircraft. An optimal position where vortices created by the autonomous aircraft or the aircraft interact with the other aircraft and/or autonomous aircraft to reduce drag and/or increase lift on the aircraft is determined. The autonomous aircraft is positioned in the optimal position. The method may include a landing assistance system with at least one autonomous aircraft configured to provide the aircraft with information regarding a desired position relative to a runway. The at least one autonomous aircraft may be configured to communicate with the aircraft through a processor and/or a display in the aircraft. The autonomous aircraft may be subject to a drone control system for a plurality of drones configured to position the plurality of drones in a formation. |
| US11884390B2 |
Managing a fleet of spraying aerial vehicles
A computing system is providing for managing a fleet of spraying vehicles by selecting one or more field zones to be sprayed by a fleet of spraying vehicles. The system reviews spraying requirements including material and quantity to be sprayed and reviews spraying vehicle parameters for each spraying vehicle in of the fleet. The system then calculates a travel plan for each spraying vehicle such that the selected field zones can be sprayed accordingly without spraying areas outside the selected field zones. Once in operation, the system verifies travel plan execution of each spraying vehicle and adjusts one or more travel plans in case of vehicle malfunctions, unexpected weather conditions, and unexpected field obstacles. |
| US11884389B2 |
Wing for an aircraft
A wing for an aircraft is disclosed having a fixed wing, a foldable wing tip portion and a flight latch device for latching the foldable wing tip portion in the extended position, wherein the flight latch device includes a housing, a latch bolt, and a motor for driving the latch bolt between the latched and unlatched positions. A flight latch device includes a threaded shaft rotationally driven by the motor, a nut engaging the shaft, so that the nut can rotate relative to the shaft, the nut is connected to the housing via a linear guide and is connected to the latch bolt for common linear movement with the latch bolt, and the flight latch device includes an offset compensation, providing that the shaft is supported pivotable relative to the housing and the latch bolt is coupled to the nut via a compensational bearing allowing angular play between the nut and the latch bolt. |
| US11884388B2 |
Aerial vehicle with deployable components
An unmanned aerial vehicle (UAV) having wings stowed against a fuselage of the UAV in a first arrangement is disclosed. Methods and systems for deploying the wings into a second arrangement are disclosed. For example, after a launch of the UAV, the UAV monitors for at least one pre-set condition. The at least one pre-condition being a pre-condition associated with deploying wings of the UAV into the second arrangement. Upon detecting the at least one pre-set condition, the wings of the UAV are deployed into a second arrangement. Deploying the wings comprises activating, in response to detecting the at least one pre-set condition associated with the UAV, a gearbox configured to transition the wings from the first arrangement to the second arrangement. Roll control may be maintained throughout launch and deployment. |
| US11884384B2 |
Systems and methods for landing gear actuation via trunnion drive
A landing gear actuation system is disclosed herein. The landing gear actuation system includes a trunnion sprocket coupled to a movable member, a drive motor, and a flexible drive member extending between and to the motor and the trunnion sprocket. The motor is configured to move the flexible drive member, wherein the movement of the flexible drive member moves the trunnion sprocket and the movable member. The flexible drive member may be a belt or a chain. |
| US11884372B2 |
Floatation device
A floatation device is provided. In some embodiments, a floatation device is provided, comprising an inflatable ring composed of a transparent material, wherein the inflatable ring includes: an outer air chamber having a first valve for inflating the outer air chamber; an inner air chamber having a second valve for inflating the inner air chamber, wherein the outer air chamber and the inner air chamber are not in communication; a cut through the outer air chamber and the inner air chamber of the inflatable ring that forms opposing ends of the inflatable ring; and a plurality of fasteners placed on a top surface and a bottom surface of the outer or inner air chamber for detachably connecting the opposing ends of the inflatable ring. |
| US11884371B2 |
Device, method, and program for controlling ship body
A ship body control device is provided, which includes a rudder controller configured to control a rudder angle of a ship, a sensor configured to measure a ship body direction of the ship, and an autopilot controller configured to output a rudder angle command to the rudder controller. The autopilot controller includes an angle-of-deviation calculating module configured to calculate a deviation angle of a stern direction from a target stern direction based on the ship body direction, and a rudder angle command setting module configured to set the rudder angle command so as to maintain a current rudder angle when the deviation angle is less than a first threshold, and to change it to a given fixed turning rudder angle when the deviation angle is the first threshold or more. |
| US11884370B2 |
Waterboard
A surfboard is disclosed herewith comprising an external housing and attachment means. The attachment means may comprise any known attachment technique such as receptacle means, adhesive means, suction means, screws, clamps, tongue and groove, Velcro®, or magnetic means, The housing may be of any shape but a cylindrical shape to tightly receive a standard water can and/or bottle is preferred. Said housing may be further insulated and/or have an external storage pocket. |
| US11884367B2 |
Multi-anchoring depth control system
A multi-anchor depth control system for a boat or other watercraft having a line for securing anchors to the boat, at least two anchors attached at or near opposing ends of the line, a depth finder, and a controller configured to automatically adjust the amount of line released from the boat to maintain the anchors on the floor of the body of water in which the boat is floating, based upon information obtained from the depth finder. |
| US11884363B2 |
Sprocket wheel for a bicycle drive
An individual chain wheel for a bicycle front crank arrangement for engaging in a drive chain includes a plurality of teeth formed on a circumference of the chain wheel and having a first and a second group of teeth. The teeth of the second group of teeth are arranged in an alternating manner between the teeth of the first group of teeth. Each tooth has a load flank via which force is transmitted between an adjacent roller of the drive chain and the respective tooth. Each tooth of the first group may also have at least one profile with an opening in the vicinity of the flank, in which a portion of an inner link plate of the drive chain, which portion protrudes beyond the roller, engages. |
| US11884361B2 |
Bicycle apparatus
A bicycle apparatus is basically provided with a housing, an assist motor and a case. The housing is configured to be provided to a bicycle. The assist motor housed in an internal space of the housing. The assist motor is configured to add an assisting force to a manual drive force inputted from a bicycle crankshaft. The case that is separate from the housing. The ABS unit provided in an internal space of the case. The ABS unit is configured to control a braking force that is applied to a wheel of the bicycle. |
| US11884358B2 |
Adjustable axle retaining structure
An adjustable axle retaining structure is disclosed. The structure includes an axle receiving feature on a first leg of a fork assembly and a retaining sleeve within a clamping member on a second leg of the fork assembly. An axle is inserted through the clamping member, the wheel hub and coupled with the axle receiving feature. A component of the axle is tightened thereby moving the retaining sleeve partially out of the clamping member and toward the wheel hub until the wheel hub is in contact with both the retaining sleeve and the axle receiving feature, wherein the moving of the retaining sleeve allows the axle to radially couple the wheel hub with the fork assembly without modifying a preestablished geometry of the fork assembly. |
| US11884342B2 |
Cast-in track system component bushing
A component for a track-type machine comprises a body, a through-bore extending through the body forming an inner wall, and a bushing located in the through-bore. The bushing comprises a bearing surface, an outer surface engaging the inner wall, a flange extending from the outer surface and extending into the inner wall, and retention features located in the outer surface proximate the flange. The retention features comprise voids in the bushing filled-in by material of the body. Methods of manufacturing a component for a track-type system comprises casting-in-place a bushing with a flange and retention features into the component. |
| US11884341B2 |
Active motor current limiting of synchronous motor drives
A method of controlling operation of an electric machine includes: calculating a voltage-based torque limit based on a voltage constraint of a direct current (DC) bus supplying power to an inverter for powering the electric machine; calculating a current-based torque limit based on a motor current limit; determining a final torque limit based on the voltage-based torque limit and the current-based torque limit; determining a limited command torque based on a torque command and the final torque limit; and generating at least one current command based on, at least, the limited command torque. A control system for controlling operation of an electric machine is also provided. |
| US11884340B2 |
Steering control device
A steering control device includes: a first calculator configured to calculate, according to a turning state, a first control amount for causing a motor to generate an assistance force; a second calculator configured to calculate a second control amount for adapting an actual angle to a target angle that is convertible into a turning angle of a steering wheel and generated when a host control device intervenes in steering control; and a third calculator configured to calculate, according to the turning state, a third control amount for offsetting the second control amount when the host control device intervenes in steering control. |
| US11884334B2 |
Panel connector devices
A device and method for the protection of a first member and second member from corrosion by utilizing a connector that bonds the members without allowing direct contact of the members. |
| US11884332B2 |
Automobile hood
In an automobile hood, sufficient panel rigidity and dent resistance of a panel are secured while achieving weight reduction. An automobile hood having panel, reinforcing member and joint that joins the panel and the reinforcing member such that the reinforcing member includes a structure formed from a plurality of units having hexagonal annular shape disposed in a close-packed arrangement. Floor of the unit has an annular end part. All of annular end part is located between first circle and second circle wherein first circle is inscribed within a first ridge line overlapping with an outer end part of the floor. Second circle is concentric with first circle and has a radius that is 60% of a radius of the first circle. Width of upper face of floor is 2 mm or more over the entire area of the annular end part in the circumferential direction of the annular end part. |
| US11884328B2 |
Land vehicles incorporating monocoques and modular mold systems for making the same
Land vehicles, modular systems for forming monocoques of land vehicles, and methods of forming monocoques of land vehicles using modular systems are envisioned. In certain embodiments, the land vehicles are provided as delivery vehicles and/or utility vehicles. A land vehicle includes a monocoque supporting a plurality of wheels to permit movement of the vehicle relative to an underlying surface in use of the land vehicle. |
| US11884325B2 |
Platform structure for electric vehicle
A platform structure for an electric vehicle is proposed. More particularly, according to the platform structure for an electric vehicle, a frame configured by coupling pipes to each other to form a lattice structure is installed to have a vertical double structure, and each pipe constituting an upper frame and each pipe constituting a lower frame intersect with each other such that rigidity of the platform structure is secured and the manufacturing period thereof due to easy manufacturing is decreased to reduce manufacturing cost. The platform structure for an electric vehicle includes a frame of the platform structure configured in such a manner that pipes are coupled to each other by brackets to form a lattice structure. |
| US11884318B2 |
Steering device
A steering device including a steering column supporting a steering shaft to be coupled to a steering wheel. The steering column is sandwiched between a bracket including a first support plate and a second support plate with a tightening shaft penetrating the first support plate and the second support plate and including a male thread at an end of the tightening shaft on a side close to the second support plate having a nut attached thereon. An operation lever is disposed between the nut and the second support plate and penetrated by the tightening shaft. A case including a bottom surface facing an end surface of the tightening shaft is attached to the operation lever, and a coil spring coming into contact with the bottom surface and the tightening shaft. |
| US11884317B2 |
Method for positioning a steering wheel of a motor vehicle in a rest position and/or an easy-entry position and a motor vehicle to carry out the method
A method for positioning a steering wheel of a motor vehicle in a rest position and/or an easy-entry position. The steering wheel has an operative connection to an adjustment means via which the steering wheel can be moved in a steering wheel adjustment field. A most recently set steering wheel position is established as the current steering wheel position. A target position in the steering wheel adjustment field, which represents the maximum increase in space for a driver in relation to the currently set steering wheel position, is determined. This target position is established as a rest position and/or as an easy-entry position. The steering wheel is moved into the established rest position and/or easy-entry position. |
| US11884316B2 |
Axially adjustable steering column assembly
A steering column assembly includes a steering column extending along a longitudinal axis between a first end and a second end. The steering column includes an outer jacket located at the first end, a middle jacket telescopically connected to the outer jacket and extending towards the second end, and an inner jacket telescopically connected to the middle jacket and extending further towards the second end. The steering column assembly also includes at least one axial adjustment actuator that telescopically moves the middle jacket with respect to the outer jacket. The at least one axial adjustment actuator includes a first gear rack fixed to the outer jacket and a second gear rack fixed to the inner jacket, at least one gear located between, and in tooth meshed engagement with, the first gear rack and the second gear rack and driven to translate the inner jacket relative to the outer jacket. |
| US11884314B2 |
Laterally operating payload handling device
A loading frame includes a rectangular u-shaped frame with an opening at one side, forks extendable and retractable between the closed side and the open side of the U-shaped frame, loading frame wheels on one arm of the U-shaped frame, and a truck interface on the other arm of the U-shaped frame. The loading frame wheels and truck interface support travel of the frame in a direction other than the direction of travel of the forks between the open and closed sides of the U-shaped frame. |
| US11884312B2 |
Object macrocells in frame locked rasters for real-time driving, positive train control, and general purpose anti-collision
A system for controlling movement of a vehicle that includes a camera system mounted on the vehicle and configured to generate image signals of terrain within the vehicle path of movement of the vehicle, a radar system mounted on the vehicle and configured to generate distance signals to an object in the terrain, and a processor having multiple GPU rasters in a series data processing configuration that are configured to utilize a hypotenuse processing function for drawing lines from pixel to moving entity center (MEC) or from macro cell center to MEC, and a detector configured to test for raster frame lock between the multiple GPU rasters structured to determine a relative speed of the vehicle with respect to the object in the path of movement of the vehicle, and to generate control signals to alter the direction or speed of the vehicle or both to avoid the object. |
| US11884310B2 |
Systems and methods for detecting tanks in railway environments
In one embodiment, a method includes identifying, by an image detection tool, a tank within an image of a railway environment and identifying, by the image detection tool, a railroad track within the image of the railway environment. The method also includes determining, by the image detection tool, a distance between the tank and the railroad track and comparing, by the image detection tool, the distance between the tank and the railroad track to a predetermined threshold distance. The method further includes determining, by the image detection tool, that the tank presents a hazard to the railway environment in response to comparing the distance between the tank and the railroad track to the predetermined threshold distance. |
| US11884309B2 |
Railcar air conditioning duct
A railcar air conditioning duct according to one aspect which guides air fed from an air conditioner mounted on a railcar. The railcar includes: a duct wall forming an air flow passage which guides air in a car longitudinal direction; and a plurality of through holes lined up in the car longitudinal direction, the through holes being open at the duct wall as air outlet ports through which the air in the air flow passage is blown from the air flow passage toward a passenger room. A ratio of an opening area of one of the through holes to an area of one of a plurality of partial regions formed by dividing, in the car longitudinal direction, an inner surface of a lower wall portion such that in plan view, the regions contain the respective through holes falls within a range of 2.0% or more and 7.5% or less. |
| US11884307B2 |
Overhead transport and route management system
An overhead transport system includes a suspended railway and a motorized carrier configured to travel along the suspended railway. The motorized carrier includes a motorized trolley configured to move the motorized carrier along the suspended railway, chassis/beam configured to carry an object below the motorized trolley, and a bumper and deflection system configured to prevent the object from contacting another object. |
| US11884301B2 |
Travel plan information distribution system
With an object of notifying a peripheral vehicle or a person of a travel plan of an own vehicle at an appropriate timing, and providing a safe automatic driving system, a travel plan information distribution system is characterized by including a travel plan information compilation unit that, based on information output by a positional information and frontal road shape information acquisition unit and a sensor information acquisition unit, compiles travel plan information including a travel plan category and a time at which travel is to be started or a position from which a travel plan is to be started, a wireless communication device that transmits travel plan information to a peripheral vehicle, and a travel plan information distribution control unit that selects and outputs necessary details of travel plan information at a safe and necessary timing. |
| US11884300B2 |
Control system for autonomous vehicle
A control system for a vehicle includes a time sensitive network switch and one or more processors. The time sensitive network switch is configured to receive sensor data from light detection and ranging (LIDAR) sensors, radio detection and ranging (RADAR) sensors, or image sensors. The sensor data is representative of estimated objects that are in an external environment of the autonomous vehicle. The one or more processors are configured to receive the sensor data and determine instructions to control movement of the autonomous vehicle at least partially based on the sensor data from the time sensitive network switch and at least partially based on map data. |
| US11884299B2 |
Vehicle traveling control device, vehicle traveling control method, control circuit, and storage medium
A vehicle traveling control device includes: a communicator periodically receiving a dynamic map; a sensor management circuit collecting, from one or more sensors measuring a state of objects around a vehicle, a result of measurement representing the state of objects around the vehicle; a surrounding information comparator comparing object data represented by the dynamic map with object data represented by the result of measurement, and in response to finding mismatching object data, detecting, from the mismatching object data, data of the dynamic map representing an object within a specified range from the vehicle; and a proximity information processor setting, from the data of the dynamic map detected by the surrounding information comparator, data representing the vehicle as an avoidance non-target object in traveling control, and setting data representing an object other than the vehicle as an avoidance target object in traveling control or the avoidance non-target object. |
| US11884298B2 |
Safe driving operations of autonomous vehicles
An autonomous vehicle includes a detection system for identifying the presence of authorities or emergency vehicles on a road, such as law enforcement vehicles, fire engines, fire trucks, police officers, first responders, traffic cones, flares, etc. The detection system may include audio and visual detection system dedicated to the detection of authorities. Additionally, systems that correlate the detected authorities and/or any audible or visual instructions given by the authorities to changes in the behavior of the autonomous vehicle. The autonomous vehicle may react to the detected authorities or emergency vehicles by determining a driving related operation to safely operate around the detected authorities or emergency vehicles. |
| US11884294B2 |
Lane change planning and control in autonomous machine applications
In various examples, sensor data may be collected using one or more sensors of an ego-vehicle to generate a representation of an environment surrounding the ego-vehicle. The representation may include lanes of the roadway and object locations within the lanes. The representation of the environment may be provided as input to a longitudinal speed profile identifier, which may project a plurality of longitudinal speed profile candidates onto a target lane. Each of the plurality of longitudinal speed profiles candidates may be evaluated one or more times based on one or more sets of criteria. Using scores from the evaluation, a target gap and a particular longitudinal speed profile from the longitudinal speed profile candidates may be selected. Once the longitudinal speed profile for a target gap has been determined, the system may execute a lane change maneuver according to the longitudinal speed profile. |
| US11884288B2 |
Dynamic vehicle weight classification for route optimization
A method for classifying a weight of a vehicle includes determining a system enablement state of the vehicle load detection and classification system, monitoring a vehicle weight, determining a change in the vehicle weight, comparing the change in the vehicle weight to a first predefined weight change threshold, and categorizing the change in the vehicle weight in response to determining that the change in the vehicle weight exceeds the first predefined weight change threshold. The method also includes determining if a weight has been left in the vehicle after key-off and determining if a weight has been placed in a cargo compartment of the vehicle which exceeds the weight rating of the cargo compartment. The method also includes optimizing a route to a destination based at least on the change in the vehicle weight and displaying the optimized route to the destination using a human machine interface of the vehicle. |
| US11884287B2 |
Enhanced vehicle operation
Operation data from one or more vehicle subsystems are input to a vehicle dynamics model. Predicted operation data of the one or more vehicle subsystems are output from the vehicle dynamics model. The operation data and the predicted operation data are input to an optimization program that is programmed to output control directives for the one or more vehicle subsystems. One or more vehicle subsystems are operated according to the output control directives. |
| US11884277B2 |
Method for producing a model of the surroundings of a vehicle
A method provided for producing a model of the surroundings of a vehicle, wherein a lane is determined on the basis of objects, free space boundaries and/or roadway limitations. The lane indicates the zone around the vehicle in which the vehicle can drive freely. The lane includes at least one lane segment, the lane segment comprising at least one lane segment boundary, in particular a front lane segment boundary, a rear lane segment boundary, a left lane segment boundary and a right lane segment boundary. The distance from the vehicle to the lane segment boundary is determined, and the lane is made available to a driver assistance system. |
| US11884274B2 |
Mode driving assistance system for vehicle
A mode driving assistance system for a vehicle assists a driver when the driver conducts mode driving by operating an operation member such that a traveling speed meets a time series change in the traveling speed. The operation member is disposed on a chassis dynamometer. The operation member conducts at least one of acceleration or deceleration of the vehicle. The system includes: a display that the driver can observe visually; a storage that stores a target value relating to an operation amount of the operation member in time series; a first detector that detects an actual value of the operation amount of the operation member; and a controller that displays the target value of the operation amount of the operation member stored in the storage and the actual value of the operation amount of the operation member detected by the first detector, as a time series image on the display. |
| US11884272B2 |
Motorcycle-drive assistance apparatus
There is provided a motorcycle-drive assistance apparatus that makes rapid deceleration by an engine brake possible so that braking control unintended by a rider can be avoided. The motorcycle-drive assistance apparatus is configured in such a way that a deceleration-start inter-vehicle distance calculation unit calculates a deceleration-start inter-vehicle distance, by use of an acceleration value read from an engine-brake acceleration value storage unit, based on an own-vehicle speed calculated by an own-vehicle speed calculation unit and a road-surface gradient angle calculated by a road-surface gradient angle calculation unit and in such a way that when the inter-vehicle distance between an own vehicle and another vehicle, detected by an object detection unit, becomes smaller than the calculated deceleration-start inter-vehicle distance, deceleration of the own vehicle through the engine brake is started. |
| US11884270B2 |
System and method for intent monitoring of other road actors
Systems, methods, and autonomous vehicles may obtain one or more images associated with an environment surrounding an autonomous vehicle; determine, based on the one or more images, an orientation of a head worn item of protective equipment of an operator of a vehicle; determine, based on the orientation of the head worn item of protective equipment, a direction of a gaze of the operator and a time period associated with the direction of the gaze of the operator; determine, based on the direction of the gaze of the operator and the time period associated with the direction of the gaze of the operator, a predicted motion path of the vehicle; and control, based on the predicted motion path of the vehicle, at least one autonomous driving operation of the autonomous vehicle. |
| US11884269B2 |
Systems and methods for determining future intentions of objects
Systems/methods for operating an autonomous vehicle. The methods comprise, by a computing device: using sensor data to track an object that was detected in proximity to the autonomous vehicle; classifying the object into at least one dynamic state class of a plurality of dynamic state classes; transforming the at least one dynamic state class into at least one goal class of a plurality of goal classes; transforming the at least one goal class into at least one proposed future intention class of a plurality of proposed future intention classes; determining at least one predicted future intention of the object based on the proposed future intention class; and/or causing the autonomous vehicle to perform at least one autonomous driving operation based on the at least one predicted future intention determined for the object. |
| US11884267B2 |
System for avoiding blind spot of vehicle using accident history information and method thereof
A system for avoiding blind spot using accident history information, includes an image sensor configured to provide image information by acquiring a surrounding image of a host vehicle, and a vehicle controller. The vehicle controller is configured to detect, through the image sensor, an adjacent vehicle traveling adjacent to the host vehicle and a license plate of the adjacent vehicle; determine a dangerous level of the blind spot of the adjacent vehicle, based on accident history information of the adjacent vehicle and driver tendency information of a driver of the adjacent vehicle obtained by inquiring about the license plate of the adjacent vehicle, after determining a blind spot range of the adjacent vehicle; and generate a path in which the host vehicle deviates from the blind spot or avoids the blind spot to reduce the dangerous level of the blind spot, based on a traveling situation of the host vehicle. |
| US11884265B1 |
Parking assistance method and parking assistance device
A plurality of different reference images for specifying a target parking space is preliminarily stored. The different reference images are generated by using an imaging device that captures an image around a subject vehicle. After that, when the subject vehicle is parked in the target parking space, the current image captured around the subject vehicle is verified with at least one reference image of the plurality of different reference images to recognize the target parking space, and the travel operation of the subject vehicle to the target parking space is autonomously controlled based on positional information of the recognized target parking space. |
| US11884264B2 |
Driveway maneuvers for autonomous vehicles
Aspects of the disclosure provide for controlling an autonomous vehicle to enter a driveway. As an example, an instruction to pickup or drop off a passenger at a location may be received. It may be determined that the vehicle is arriving in a lane on an opposite side of a street as the location, the lane having a traffic direction opposite to a traffic direction of a lane adjacent to the location. A difficulty score to maneuver the vehicle to the lane adjacent to the location may be determined, and the difficulty score may be compared to a predetermined difficulty score. Based on the comparison, it may be determined to an available driveway on the same side of the street as the location. The vehicle may be controlled to enter the available driveway. |
| US11884258B2 |
Systems and methods for smart load shedding of a transport vehicle while in transit
Systems and methods for providing load shedding in a vehicle are provided. Particularly, the vehicle may be an electric vehicle and the loads that are shed may be HVAC or refrigeration loads. The load shedding methods and systems may include a predictive model of energy consumption, determining a predicted energy consumption and comparing it to a stored energy at the vehicle. If the predicted energy consumption exceeds the stored energy, load shedding operations may be performed at a transport climate control system, such as adjusting a set point, adjusting an operating mode of the transport climate control system, increasing a dead band of a compressor of the transport climate control system, utilizing free cooling such as ambient air to provide climate control in the vehicle, or increasing cooling provided by the transport climate control system to an energy storage of the vehicle. |
| US11884257B2 |
Method for controlling driving force of vehicle
A method for controlling driving force of a vehicle includes determining a natural frequency of vehicle suspension pitch motion according to characteristics of a suspension device of the vehicle, providing a filter configured for removing or passing a natural frequency component of the vehicle suspension pitch motion to a control unit of the vehicle, determining, by the control unit, a required driving force command based on vehicle driving information collected during vehicle driving, determining, by the control unit, a final front wheel driving force command and a final rear wheel driving force command through a filtering process using the filter from the determined required driving force command, and controlling, by the control unit, a driving force applied to a front wheel and a rear wheel of the vehicle by a driving device for driving the vehicle according to the determined final front wheel driving force command and the determined final rear wheel driving force command. |
| US11884255B2 |
Vehicle fuel consumption monitor and feedback systems
Excess fuel consumption monitor and feedback systems for vehicles include sensor arrays of two primary types including those sensors deployed as part of a vehicle manufacturer established sensor suite and sensors deployed as after-market sensors. Together, these sensor suites include sensors coupled to vehicle subsystems and operating environments associated with the vehicle. Data from these sensors may be used as parametric inputs to drive algorithmic calculations which have outputs that express excess fuel consumption. Expressions of excess fuel consumption may be made instantaneously as real-time feedback to a vehicle operator/driver and/or a fleet manager as part of a summary report. |
| US11884254B2 |
Vehicle brake system and method for increasing brake pressure in a first wheel brake cylinder and limiting brake pressure in a second wheel brake cylinder of a vehicle brake system
A vehicle brake system and method for increasing the brake pressure in a first wheel brake cylinder and for limiting the brake pressure in a second wheel brake cylinder of a vehicle brake system. The method includes increasing a first brake pressure in the first wheel brake cylinder by controlling/holding a wheel inlet valve in its open state and controlling/holding a first wheel outlet valve in its closed state, and limiting an increase of a second brake pressure in the second wheel brake cylinder during the transfer of brake fluid into the first wheel brake cylinder by controlling/holding a second wheel inlet valve in its closed state and controlling a second wheel outlet valve into its open state. The second wheel outlet valve is controlled with a pulse width-modulated signal so that during the transfer of brake fluid, the second wheel outlet valve is permanently in its open state. |
| US11884253B2 |
Vehicle brake system
A vehicle brake system is disclosed for dynamic braking of a vehicle based on wheel speeds, including a first wheel speed sensor, a second wheel speed sensor, a main controller for calculating a first wheel speed of each wheel by a signal received from the first wheel speed sensor to generate a first wheel speed signal and to perform dynamic braking control based on the first wheel speed signal, an auxiliary controller for calculating a second wheel speed of each wheel by a signal received from the second wheel speed sensor to generate a second wheel speed signal, and digital signal transfer lines for transceiving a normal signal or abnormality signal between the main and auxiliary controllers. |
| US11884252B2 |
Enhanced threat assessment
A computer includes a processor and a memory, the memory including instructions executable by the processor to predict a collision time between a corner point of a host vehicle and a target vehicle, predict a reach time for the corner point of the host vehicle to reach the target vehicle based on a predicted relative heading angle between the host vehicle and the target vehicle, and determine a threat number based on the lower of the collision time and the reach time. |
| US11884250B2 |
Brake cooling assembly
In some examples, a cooling system includes a brake assembly defining a plurality of cooling channels. The brake assembly is configured to be positioned within a wheel cavity of a wheel. The cooling system includes a distributor configured to receive a flow of cooling fluid and supply the cooling fluid to the plurality of cooling channels. One or more cooling channels are configured to receive the cooling fluid and discharge the cooling fluid into the wheel cavity of the wheel. The cooling system may include a fan configured to provide the cooling fluid to the distributor. |
| US11884249B2 |
Anti-lock brake device for bicycle
The disclosure provides an anti-lock brake device including an oil pressure tank, a valve, and a movable component. The oil pressure tank has an accommodation space, an oil inlet channel, and an oil outlet channel connected to the accommodation space. The valve is slidably located in the oil inlet channel and for sealing or opening an oil inlet of the oil inlet channel. The movable component is located in the accommodation space and has a connecting channel corresponding to the oil inlet and an oil outlet of the oil outlet channel. When the movable component is slid to a depressurized position, the movable component is moved away from the valve for sealing the oil inlet, a first volume is produced between the connecting channel and the oil inlet, and a second volume, smaller than the first volume, is removed from between the connecting channel and the oil outlet. |
| US11884247B2 |
Automobile rain and temperature sensor module comprising a compound providing a thermally conductive medium between the cover of a housing and a temperature sensing element
A rain and temperature sensing module including a housing having a cover plate formed of a transparent material, a printed circuit board disposed within the housing and having a light emitter, a light receiver, and a temperature sensing element disposed thereon, a transparent compound disposed within the housing and covering the light emitter, the light receiver, and the temperature sensing element, the transparent compound filling a space between the printed circuit board and the cover plate, wherein the transparent compound has a refractive index that is substantially equal to a refractive index of the cover plate, and wherein the transparent compound provides a thermally conductive medium between the cover plate and the temperature sensing element. |
| US11884246B1 |
Swing away hitch
A spare tire mounted, swing way bike rack is provided having a upper receiver attachment and a lower receiver attachment are supported on upper and lower adjustment bars, respectively, and are a similar standard size as otherwise conventional hitch receives. Both secondary mounting points allow aftermarket accessories of those design to affix to a conventionally sized hitch receiver to be attached thereto in a manner that allows those attachment to swing with the vehicles rear door. |
| US11884243B2 |
Assemblies for supporting a load relative to a roof of a vehicle
Assemblies for supporting a load relative to a roof of a vehicle, and vehicle roof tray assemblies are disclosed. Disclosed assemblies include an elongate member and an engaging mechanism. The elongate member defines a support surface for supporting the load, and has a pair of opposed, diverging retention surfaces extending away from the support surface. The engaging mechanism is configured to abut the retention surfaces to engage the elongate member. A slat for a vehicle roof tray is also disclosed. |
| US11884235B2 |
Mobile control of a vehicle
When a mobile device is securely connected to a vehicle, at least a portion of a control interface of the vehicle can be extended to the mobile device, allowing a user of the mobile device to operate certain functions of the vehicle from the mobile device. For example, a passenger of a vehicle can control some aspects of the vehicle, while the driver controls driving aspects. Optionally, the passenger can take the role of a co-driver or co-pilot of the vehicle in some embodiments. |
| US11884233B1 |
Biometric vulnerability-based control of a passenger restraint system aboard a motor vehicle
A method for controlling a passenger restraint system aboard a motor vehicle includes receiving, via a controller, biometric vulnerability classifier signal(s) indicative of vulnerability characteristics of a passenger seated in an interior of the motor vehicle. In response to the biometric vulnerability classifier signal(s) and a detected vehicle event requiring an actuation of the passenger restraint system, the method includes automatically adjusting an actual capacity setting of the passenger restraint system via the controller. A motor vehicle includes a vehicle body defining a vehicle interior, a passenger restraint system positioned in the vehicle interior; and a controller operable for controlling the actual capacity setting of the passenger restraint system in accordance with the method. The passenger restraint system may include a seatbelt, a seat, and one or more airbag systems. |
| US11884232B2 |
Seatbelt assistance systems, vehicles, and methods
Systems, vehicles, and methods for seatbelt assistance. A system may include a sensor. The sensor may be configured to detect a physical property of a user sitting on a seat. The system may further include a motor. The motor may be configured to extend a seatbelt part towards a body center of the user. The system may further include an electronic control unit (ECU). The ECU may be coupled to the sensor and the motor. The ECU may be configured to receive the detected physical property of the user. The ECU may be further configured to prompt the motor to extend the seatbelt part towards the body center of the user based on the detected physical property of the user. |
| US11884231B2 |
Deflector for a diffusor of a gas generator
A deflector for a diffusor of a gas generator of an airbag module is disclosed. The deflector comprises a substantially tubular deflector base body and a gas discharge device connected thereto, wherein the gas discharge device has a substantially rectangular base and two outflow regions on opposite sidewalls so that gas can flow substantially in opposite directions along the longitudinal axes of the tubular deflector base body out of the interior of the gas discharge device to the outside. |
| US11884229B1 |
Vehicle including a moveable console with airbag
A vehicle includes a dash. A first seat and a second seat are spaced from the dash. A console is adjacent to the dash with the console being movable from a stowed position disposed in the dash to a deployed position extending from the dash between the first seat and the second seat. An airbag is supported by the console with the airbag being inflatable to an inflated position when the console is in the deployed position. |
| US11884228B2 |
Airbag on law-enforcement vehicle partition
A vehicle includes a vehicle body defines an occupant cabin. The vehicle body includes a ceiling above the occupant cabin and a floor below the occupant cabin. The vehicle includes a partition extending from the floor to the ceiling and dividing the occupant cabin into an officer compartment and a detainee compartment. The partition has a front surface facing the officer compartment and a rear surface facing the detainee compartment. An airbag is supported by the partition and is inflatable into the detainee compartment. |
| US11884227B2 |
Child safety seat
A child safety seat includes a restraining device, and an alert device and a switch serially connected in a series circuit. The restraining device includes a strap and a tether connector provided at a free end of the strap, the restraining device having an idle position and a deployed position, the restraining device being arranged in the deployed position to engage with a corresponding structure provided in a vehicle for restraining the child safety seat. The switch is operatively coupled to the restraining device and has an open state and a closed state, each of the open state and the closed state of the switch uniquely corresponding to one of the idle position and the deployed position of the restraining device. The alert device is activable to emit an alert signal when the series circuit is closed. |
| US11884225B2 |
Methods and systems for point of impact detection
Techniques are disclosed for detecting a point-of-impact of a vehicle collision. A mobile device receives a set of sensor measurements from sensors of the mobile device. The mobile device generates a crash feature vector from the sensor measurements and one or more point-of-impact features. The mobile device executes a set of classifiers using the crash feature vector and the one or more point-of-impact features. Each classifier of the set of classifiers is configured to generate an output that is partially indicative of a point-of-impact of the collision. The mobile device generates, from the output of each classifier of the set of classifiers, a prediction of a point of impact of the vehicle collision. The mobile device then transmits an indication of the point of impact to a remote device. |
| US11884223B2 |
Ground vehicle bumper system
A vehicle includes a body having a first outer periphery in a first plane parallel to a surface on which the vehicle moves in a horizontal direction; a bumper assembly having a second outer periphery in a second plane parallel to the first plane and including portions that extend beyond the first outer periphery; one or more flexible couplings coupling the bumper assembly to the body and allowing for horizontal planar deflection of the bumper assembly relative to the body when the bumper assembly impacts an obstacle; one or more sensors mounted to detect planar deflection of the bumper assembly and being configured to generate signals indicating the bumper assembly has deflected at least a threshold amount; and a drive system configured to propel the vehicle and, in response to the signals indicating the bumper assembly has deflected at least a threshold amount, cause the vehicle to stop moving. |
| US11884222B1 |
Adaptive energy absorption module and vehicle bumper assembly
A vehicle bumper assembly includes an adaptive energy absorption module operatively connected to a vehicle bumper body. The adaptive energy absorption module includes a primary deformable impact absorber member defining a primary impact chamber having a shape that is structurally adaptive or otherwise conforms to an impact force received by the bumper body. A secondary deformable impact absorber member is arranged in the primary impact chamber and defines a secondary impact chamber containing a shear thickening fluid that exhibits a decreasing viscosity responsive to the impact force. A plurality of fluidically connected tertiary deformable impact absorber members are arranged in an array the primary impact chamber and defines a plurality of tertiary impact chambers containing a volume of fluid, and has a shape that is structurally adaptive to the impact force. |
| US11884221B2 |
On-board electrical network of a motor vehicle
An on-board electrical network (4) of a motor vehicle (2) has a first voltage circuit (I) and a second voltage circuit (II), wherein the first voltage circuit has a first operating voltage higher than a second operating voltage in the second voltage circuit. The first voltage circuit is connected to the second voltage circuit via a DC voltage converter (8). The first voltage circuit has a battery (10) and the second voltage circuit has a main battery (12) and an auxiliary voltage source (14). By means of a first switching element (16) and a second switching element (18) at least one of transmission control unit (20) and/or integrated hybrid controller (22) are supplied with electrical energy from the main battery (12) and/or the auxiliary voltage source (14). Control unit (20) and/or hybrid controller (22) can be selectably disconnected from either the main battery (12) and/or the auxiliary voltage source (14). |
| US11884220B2 |
Protector for wire harness and wire harness apparatus
Provided is a wire harness apparatus 80 that uses a protector 10 for a wire harness that includes a body portion 16 into which a wire harness W is to be inserted; a cover body 18 that covers an opening portion 56 of the body portion 16; a joining portion 20 with flexibility that is formed thinner than the body portion 16 and the cover body 18 and rotatably joins the cover body 18 to a first side wall 22a of the body portion 16; a body contact portion 40 provided on the first side wall 22a of the body portion 16; and a cover body contact portion 58 provided on the cover body 18 that transfers a load applied to the cover body 18 to the body portion 16 by the cover body contact portion 58 coming into contact with the body contact portion 40. |
| US11884218B2 |
Wire guide device
A wire guide body includes: a vehicle body-side guide portion having a configuration in which a plurality of vehicle body-side link members are coupled so as to form a string and to be capable of being curved as seen in a plan view, the vehicle body-side guide portion being coupled to a vehicle body-side bracket; a door-side guide portion having a configuration in which a plurality of door-side link members are coupled so as to form a string and to be capable of being curved as seen in a plan view, the door-side guide portion being coupled to a door-side bracket; and a relay link member including a vehicle body-side coupling portion that is coupled to the vehicle body-side guide portion, and a door-side coupling portion that is disposed at a position lower than the vehicle body-side coupling portion and that is coupled to the door-side guide portion. |
| US11884217B2 |
Rotatable tool holder for vehicles
A vehicle tool rack for storing and accessing various individual equipment elements carried aboard a vehicle comprises a base and a turntable rotatably carried on the base such that the turntable is rotatable relative to the base. A plurality of tool receptacles are carried aboard the turntable, whereby the turntable is adapted to simultaneously receive a plurality of individual equipment elements. A plurality of circumferentially-spaced base magnets are fixedly carried by the base and a plurality of circumferentially-spaced turntable magnets are fixedly carried by the turntable. The base magnets and the turntable magnets remain spaced from one another. The turntable has a plurality of distinct stable rotational positions relative to the base wherein the turntable magnets interact with the base magnets to resist rotation out of the distinct stable rotational positions. |
| US11884215B2 |
Rear-view camera for pick-up trucks with open tailgates
One general aspect includes a driver assistance system for a vehicle. The driver assistance system also includes a camera system having at least one rear camera constructed and arranged to obtain an image of an area behind a rear of the vehicle; a tailgate position determining system constructed and arranged to determine a position of a tailgate of the vehicle, and where the image provided by the camera system of the rear of the vehicle is selected based upon the position of the tailgate of the vehicle. |
| US11884211B2 |
Vehicle side mirror
A vehicle side mirror includes a base member and a mirror housing movably connected to the base member. The mirror housing includes a mirror and a mounting bracket connected to the base member and configured to mount the vehicle side mirror to a door panel of a vehicle. The mounting bracket includes a pivot surface on which the mounting bracket is configured to pivot with respect to a door panel of the vehicle. A flexible attachment member is configured to secure the mounting bracket to the door panel after being pivoted on the pivot surface. |
| US11884206B2 |
Collaborative support for obstructed line of sight scenarios
Systems and methods of collision detection are provided which combine the concept of collaborative support with common/existing in-vehicle imaging and proximity sensor technologies. In particular, an “intermediary” vehicle may signal one or more objects (e.g. other vehicles, pedestrians, etc.) which are within the line of sight of the intermediary vehicle (and thus its imaging and proximity sensors), but not within the line of sight of each other, to a potential collision between the two objects. |
| US11884205B2 |
Messaging system
A messaging system includes a message board and a remote communicatively coupled to the message board and configured for receiving a user input. In the system, the remote is configured to transmit a message to the message board with instructions for displaying a message based on the user input. In some configurations, the messaging system can be installed in a vehicle. In such configuration, the message board can be communicatively coupled to an on-board diagnostics port of the vehicle. |
| US11884204B1 |
Operator vigilance using disengagements and headlight modifications
Systems and methods are provided for modulating headlight characteristics according to a calculated probability of future unplanned disengagement of advanced driver-assistance systems or automated driving systems, collectively referred to as driving automation systems. In particular, some embodiments aim to alert drivers of both a likelihood of unplanned disengagement, as well as a source of unplanned disengagement. |
| US11884203B2 |
Shock-absorbing vehicle headlight system
Shock-absorbing vehicle headlight system, having a vehicle frame element, a vehicle headlight housing, two release elements and a release mechanism connected to the vehicle frame element and designed to transition the vehicle headlight housing between a basic position and an adjustment position. The release mechanism includes a blocking element, switchable between a blocking position (BP) and a release position (RP). The vehicle headlight housing is held in the basic position in the BP and transitions to the adjustment position in the RP. A force transmission device mechanically couples the blocking element to the release elements and includes a rotary shaft and a control element. Displacement of each release element can be converted into rotary movement of the rotary shaft, which in turn can be converted into rotary movement of the control element, which is operatively connected to the blocking element in order to push the blocking element into the RP. |
| US11884202B2 |
Laser-based fiber-coupled white light system
A laser-based fiber-coupled white light system is provided. The system includes a laser device comprising a gallium and nitrogen containing emitting region having an output facet configured to output a laser emission with a first wavelength ranging from 385 nm to 495 nm. The system further includes a phosphor member to receive the laser emission in a range of angles of incidence to a spot on a primary surface with a size greater than 5 μm. The phosphor member converts the laser emission with the first wavelength to a phosphor emission with a second wavelength in either reflective or transmissive mode and mixed at least partially with laser emission to produce a white light emission. Additionally, the system includes a fiber coupled to the phosphor member to capture the white light emission to deliver the white light emission to a remote lighthead or distribute the white light emission directly. |
| US11884201B1 |
Tarp with integrated rigid straps for a movable cargo hold
A tarp for a movable cargo hold has a tarp fabric comprising a proximal end and a distal end. At least three nylon straps extend across the tarp fabric. Each of the at least three nylon straps comprise a proximal end, a middle portion, and a distal end. A first set of at least two rigid straps covers the proximal end of the at least three nylon straps. A second set of at least two rigid straps covers the distal end of the at least three nylons straps. Openings on each of the at least two rigid straps, the proximal end and distal end of the tarp fabric, and the proximal and distal end of the at least three nylon straps receive rivets. The rivets distribute forces applied to each of the at least two rigid straps. The at least two rigid straps immobilize the tarp. |
| US11884200B2 |
Modular pop-up semi-dry bathroom
A slide-up bathroom for a vehicle that have the following characteristic: telescopic walls that allow an upper section of the slide-up bathroom to move up and down relative to a lower section of the slide-up bathroom; and a toilet storage container for the toilet to move in and out thereof and into a main interior of the slide-up bathroom. |
| US11884196B2 |
Multi-functional cargo transfer vehicle and method
A multi-functional cargo transfer vehicle and method. The multi-functional cargo transfer vehicle comprises a vehicle body, a cargo conveying rack, a lifting mechanism, and a control system; the vehicle body is located below for providing a platform and support; the cargo conveying rack is located above the vehicle body and includes a plurality of layers for loading and unloading cargoes; the lifting mechanism is located on the outer side of the cargo conveying rack for lifting the cargo conveying rack; the control system is located on the vehicle body for controlling omni-directional driving, accurate butt joint, and automatic loading and unloading of the multi-functional cargo transfer vehicle. Accordingly, a multi-functional cargo transfer vehicle is adopted such that the multi-task functions of loading and unloading, transporting, and conveying of cargoes are simultaneously realized, thereby efficiently completing the transferring process of cargoes from a storage place to a transporting carrier. |
| US11884195B2 |
Headrest
Headrest (1) for a racing vehicle (10) comprising a cockpit (11) wherein a driver (20) wearing a helmet (30) can sit, comprising a flexible casing (2) configured to be anchored to a vehicle body (12) and at least one energy-absorbing member (3) comprising at least one honeycomb cellular structure (9) arranged inside said casing (2). The energy-absorbing member (3) further comprising a foam pad (8) shaped so as to hold the at least one honeycomb cellular structure (9). |
| US11884193B2 |
Suspension system
A space-saving suspension apparatus comprising a coarse suspension device, a mechanical assembly, and a fine suspension device coupling a supported frame to a base frame at a neutral height such that forces and/or displacements of either the base frame or the supported frame result in oppositely directed forces and/or displacements of the other of the base frame and the supported frame. In some embodiments, the neutral height is adjustable. |
| US11884190B2 |
Vehicle seat
The invention relates to a vehicle seat comprising a seat surface and a backrest. The seat surface and the backrest comprise, in particular, a seat cover which forms a surface of the seat surface and the backrest. Two fastening means which are spaced apart in the transverse direction are attached to the backrest or the seat surface, an additional device, in particular a child seat, being able to be attached thereby to the vehicle seat. Advantageously the fastening means are attached at a transition between the seat surface and the backrest. If the fastening means are not required for attaching the additional device, the fastening means may be covered. To this end, the vehicle seat comprises a covering element which is configured to be strip-shaped. |
| US11884189B2 |
Child safety seat
A child safety seat includes an ISOFIX assembly and a base. The ISOFIX assembly includes a support foot, a connecting portion, and a sliding rail portion between the support foot and the connecting portion. The connecting portion connects to a car seat. The sliding rail portion includes a first sliding rail portion and a second sliding rail portion connected to the first sliding rail portion. A width of the second sliding rail portion is larger than a width of the first sliding rail portion. The base has a frame assembly which has a sleeve portion slidably sleeved on the sliding rail portion. The sleeve portion includes first and second sleeve portions slidably sleeved on corresponding first and second sliding rail portions. The base is operable to be adjusted telescopically with respect to the ISOFIX assembly through a sliding cooperation between the sliding rail portion and the sleeve portion. |
| US11884188B2 |
Method and apparatus for a rotatable child safety seat
A rotatable child safety seat can include a seat shell for receiving a child therein, a rotating pedestal, and a seat base. The pedestal and seat shell can rotate with respect to the seat base. The pedestal can include a locking pin and the seat base can include a multitude of pin receiving apertures that allow a user to rotate the seat shell and pedestal in either a clockwise or counter-clockwise direction at a number of different angles or positions. The child safety seat can also include two separate seat belt/LATCH tether pathways. One seat belt/LATCH tether pathway can be provided on the seat back of the seat shell and can be used when the child safety seat is in a forward-facing configuration and the other seat belt/LATCH tether pathway can be provided in the seat base and used when in a rearward-facing configuration. |
| US11884185B2 |
Vehicle seat
A vehicle seat having fewer components and having a pitching mechanism advantageous for strength/rigidity is provided. The vehicle seat includes: a base frame mounted in a vehicle compartment; a cushion frame pin-connected to a first connecting point of the base frame to be capable of a forward leaning operation; a back frame disposed to be capable of a reclining operation with respect to the cushion frame; a front link swingably pin-connected at a proximal end side thereof with a second connecting point of the base frame and slidably connected at a distal end side thereof with the cushion frame; a lock unit for locking the cushion frame to the base frame at a seated position and regulating a pitching operation of the main frame; and a release member for releasing a locked state. |
| US11884184B2 |
Information processing device, information processing method, and information processing program
An information processing device includes a control unit configured to determine whether to include a regenerative brake in specifications of a proposed vehicle based on regenerative brake operation data acquired while a first vehicle including the regenerative brake is traveling in a predetermined area. The proposed vehicle is a vehicle proposed as a vehicle for a customer to drive in the predetermined area. |
| US11884179B2 |
Bidirectional energy transfer system and method that utilize a supply device
A bidirectional energy transfer system includes a supply device having a vehicle port, an inverter port, a converter, and an isolation transformer. The vehicle port is configured to electrically couple the supply device to an electrified vehicle. The inverter port is configured to electrically couple the supply device to an inverter that is separate from the supply device. |
| US11884178B2 |
Bidirectional charging events based on predicted and actual power outages
Systems and methods may coordinate and execute bidirectional energy transfer events between electrified vehicles and other devices or structures. Weather related data and/or grid related data may be leveraged for predicting the likelihood of power outage conditions of a grid power source. When power outage conditions are likely, a charging storage limit of a traction battery pack of the electrified vehicle may be automatically increased. The increased charging storage limit temporarily increases the energy storage capacity of the traction battery pack in anticipation of expected power outage conditions, thereby better preparing the traction battery pack for use as a backup power source during the power outage conditions. |
| US11884175B2 |
Self-powered drone tether
Battery powered quadrotors or drones have a limited operation time. To extend operation time, a powered tether can be used. This tether provides power to the drone allowing it to stay up indefinitely. Most tethered drones are captured to the base station. The tether can reel in and out as the drone moves, but the drone can't go higher or further than the maximum length of the tether. If the tether can be automatically disconnected, the drone could fly off for some remote mission, assuming the drone had an onboard power source such as rechargeable batteries. The present invention relates to a self-powered drone tether that comprises a rechargeable drone in flight which is referred to as the rechargeable drone, a drone that carries a powered tether which is referred to as the tether drone, a coupling mechanism between the rechargeable drone and the tether drone, and a base station with a powered tether and tether deployment system. |
| US11884174B2 |
Optical communication system for management of vehicle batteries
A vehicle is provided that includes a battery management system with an energy storage device configured to power the vehicle. The energy storage device includes a battery module with: at least one sensor, a processor, and an optical transceiver. The battery management system also includes a control unit to control the energy storage device, and a control unit optical transceiver configured for bidirectional free-space optical communication with the battery module optical transceiver via a free-space optical communication link. The battery module processor is configured to receive sensor readings and transmit them to the control unit via the free-space optical communication link. Based on the sensor readings, the control unit sends commands to the battery module processor via the free-space optical communication link. |
| US11884172B2 |
Battery charging for hybrid electric powerplants
A battery charging system for a hybrid electric powerplant can be configured to determine a maximum available charging power available from windmilling and/or excess thermal engine power available, and to use up to the maximum available charging power and/or the excess thermal engine power available to charge a battery. In certain embodiments, a control module can be configured to determine the maximum available charging power available from windmilling. |
| US11884166B2 |
Battery pack reinforcement assemblies
Reinforcement assemblies and associated methods are provided for reinforcing a battery pack of an electrified vehicle. An exemplary battery pack may include a battery internal component (e.g., a battery array), an enclosure assembly for housing the battery internal component, and a reinforcement assembly secured to the enclosure assembly. The reinforcement assembly may include a beam and a bracket secured to the beam. The reinforcement assembly may be positioned at expected high impact load locations of the enclosure assembly and is configured for absorbing and transferring energy during vehicle impact loading events, thereby minimizing transfer of the impact loads inside the battery pack where relatively sensitive battery internal components are housed. |
| US11884164B2 |
System and method for controlling charging of battery of eco-friendly vehicle
A system for controlling charging of a battery of an eco-friendly vehicle includes: an on-board charger (OBC) mounted in the vehicle, setting a required charging current based on available charging current information received from a power supply unit supplying power for charging the battery, transmitting the required charging current to the power supply unit, and converting the power supplied from the power supply unit to charge the battery; and a controller determining whether charging of the battery is completed, and when it is determined that charging of the battery is abnormally terminated in a state where charging is not completed, changing the required charging current to charge the battery based on first information supplied from the power supply unit upon abnormal termination of charging and based on second information supplied from the power supply unit upon normal completion of charging. |
| US11884159B2 |
Electric vehicle
An electric vehicle (10) comprising: a frame (11); an electric battery module (24) comprising at least one battery connected to the frame; an electric motor (20) receiving power from the battery module (24); a transmission system (80) provided with a transmission casing (208B); said electric motor (20) is closely coupled to the transmission system (80) and is mounted on the transmission casing (208B); and a rear wheel (84) receiving power from the electric motor (20) through the transmission system (80) and said rear wheel (84) is connected to the frame using a rear suspension system; wherein the rear wheel (84) is connected to the frame (11) using said casing (208B) forming a part of the rear suspension system. |
| US11884155B2 |
Graphical user interface for display of autonomous vehicle behaviors
Techniques are disclosed for creating and presenting a graphical user interface for display of autonomous vehicle behaviors. The techniques include determining a trajectory of a vehicle operating in a real-world environment. Sensors of the vehicle obtain sensor data representing an object in the real-world environment. A maneuver of the vehicle to avoid a collision with the object is predicted based on the sensor data and the trajectory of the vehicle. It is determined that a passenger comfort level of a passenger riding in the vehicle will decrease based on the maneuver of the vehicle. The passenger comfort level is measured by passenger sensors of the vehicle. A graphical user interface is generated including representations of the vehicle, the object, and a graphic, text, or a symbol alerting the passenger of the predicted maneuver. The graphical user interface is transmitted to a display device of the vehicle. |
| US11884153B2 |
Display device and motor vehicle with the display device
A base unit with a base dent region supports a main display unit having a main display panel. The main display unit is integrated in the base dent region and is rotatable about a base axis between a main loaded position and a main viewing position where the main display panel is visually accessible to a user from a predefined head position. The display device includes an auxiliary display unit which is integrated in a main dent region of the main display unit. The auxiliary display unit includes an auxiliary display panel which is designed to be visually accessible to the user from the predefined head position by rotating the main display unit about the base axis. |
| US11884150B2 |
Tandem wheel assembly with wheel end brake assembly
A tandem wheel assembly for a work vehicle includes a tandem wheel housing, a center drive member rotatably disposed within the housing, first and second wheel end assemblies, a coupler between each wheel end drive member and the center drive member, and a brake assembly. Each wheel end assembly includes an input shaft, a wheel end drive member mounted thereon, a wheel end gear train coupled to the input shaft, an output shaft coupled to the wheel end gear train, and a wheel end hub coupled to the output shaft for supporting one of the wheels. The brake assembly is coupled to the tandem wheel housing and to the input shaft or the output shaft of at least one of the first wheel end assembly or the second wheel end assembly and reduces the amount of backlash. |
| US11884148B2 |
Utility vehicle
A utility vehicle includes a plurality of ground-engaging members, a frame supported by the ground-engaging members, and a powertrain assembly. The powertrain assembly includes an engine, a shiftable transmission, a continuously variable transmission, and a charger. Additionally, the utility vehicle may include a cooling assembly fluidly coupled to at least the engine and the charger. |
| US11884143B2 |
Reinforcing structure of automobile exterior panel
A reinforcing structure of an automobile exterior panel improving performance in absorbing an impact load, the reinforcing structure of an automobile exterior panel comprising an outer panel 110 of a sheet shape, a reinforcing member 120 arranged at a vehicle inner side from the outer panel 110, an inner panel 135 of a sheet shape arranged at a vehicle inner side from the reinforcing member 120, and a support member 140 provided at a vehicle outer side from the inner panel 135 and supporting the reinforcing member 120 from a vehicle inner side, the support member 140 comprised of tube-shaped member having axial centers directed from the vehicle inner side toward the vehicle outer side. |
| US11884142B1 |
Protective tire device
A system for a protective tire device including a cover assembly, strap assembly and a tire assembly is disclosed. The cover assembly includes a dome cover. The dome cover includes through holes reinforced with O-rings located equidistantly about a circumference of the dome cover. Each through hole receives one of a plurality of elastomeric straps having a hook at a distal end thereof. The dome cover is mounted over a tire sitting atop a tire stack. The elastomeric straps extend downwardly along the tire stack. The hooks of the elastomeric straps are extended towards a center of the tire stack such that the elastomeric straps are sandwiched between two tires of the tire stack. The hooks engage an inner liner of the tire from underneath, creating tension on the elastomeric straps and securing the dome cover to the tire to prevent access to the interior of the tire stack. |
| US11884139B2 |
Air ventilation apparatus for vehicle using Coanda effect
An air ventilation apparatus for a vehicle using a Coanda effect according to one embodiment of the present invention includes a duct housing having a hollow shape in which an air inlet is formed in one end portion thereof and an air outlet is formed in the other end portion thereof, a cover member having one end portion coupled to surround the other end portion of the duct housing and having the other end portion which is coupled to the board and in which a communication hole is formed to communicate with the discharge port, and an air guide member which is disposed inside the cover member, is hinge-coupled to the duct housing so as to be vertically rotatable, and has a through-hole through which the air outlet communicates with the communication hole. |
| US11884136B2 |
System and method for idle mitigation on a utility truck with an electrically isolated hydraulically controlled aerial work platform
An idle mitigation system for a bucket truck which includes an alternate source of power for the vehicle air conditioner which is coupled to the hydraulic system of the bucket truck which hydraulic system is alternately powered by an electric motor which, when run in reverse, can charge batteries. |
| US11884134B2 |
Cooling system of a vehicle, comprising a coolant circuit which can be operated as a cooling circuit for an AC operation and as a heat pump circuit for a heating operation
A cooling system of a vehicle, including a coolant circuit, which can be operated as a cooling circuit for an AC operation and as a heat pump circuit for a heating operation, an evaporator, a coolant compressor, a heat exchanger in the form of a coolant condenser or gas cooler for the coolant circuit or in the form of a heat pump evaporator for the heat pump circuit, a first expansion element which is paired with the evaporator, a second expansion element, the heat pump evaporator function of which is paired with the heat exchanger, and an inner heat exchanger with a high-pressure section and a low-pressure section. The low-pressure section is fluidically connected to the downstream coolant compressor. The high-pressure section of the inner heat exchanger is arranged in a coolant circuit section which connects the second expansion element to the heat exchanger. |
| US11884130B2 |
Bearing arrangement and air vent having such a bearing arrangement
A bearing arrangement has a bearing pin and a coupling pin, and a second bearing component, which components are mounted on a wall so as to be rotatable about a common axis of rotation. The bearing pin extends along, and the coupling pin extends eccentrically to the axis of rotation. The bearing pin is accommodated in a bearing opening of the wall. The coupling pin is accommodated in a guide slot of the wall and projects from the guide slot. The second bearing component has a first opening, in which the bearing pin is accommodated, and a second opening arranged eccentrically to the first opening, in which second opening the coupling pin is accommodated. The bearing pin is connected to the second bearing component via a lock, and the second bearing component is supported on the coupling pin. |
| US11884129B2 |
Device for regulating a throughflow and distributing a fluid in a fluid circuit
A device for regulating a throughflow and distributing a fluid in a fluid circuit, in particular a refrigerant. The device has a housing with ports for connecting to fluid lines which are connected to at least one inner volume of the housing designed as a valve chamber via a respective through opening, and at least one valve element arranged in the valve chamber with a drive element for moving the valve element relative to the housing. The at least one valve element is mounted such that it can be displaced in a linear manner in the axial direction along a longitudinal axis such that a passage for the fluid is opened between a first port designed as an inlet and a second port designed as a first outlet and/or a third port designed as a second outlet. |
| US11884126B2 |
HVAC temperature stratification door systems and methods
An HVAC system includes an evaporator, a heater, a plurality of outlets, and a sliding control door downstream of the evaporator, which is configured to allow air to flow across one or both of a heated path across the heater and a bypass path bypassing the heater. A sliding stratification door is downstream of the temperature control door and positionable to, in an intermediate position, direct air flowing through the bypass path to be mixed with air that flowed across the heated path before flowing out of the plurality of outlets. |
| US11884123B2 |
Vehicle integrated control method and system
A vehicle integrated control method includes determining a road surface status, determining a vehicle status, determining an integrated control mode by determining a control status of an electronic control suspension and a motion of a sprung mass and an unsprung mass based on the determination results of the road surface status and the vehicle status, and controlling the electronic control suspension and an in-wheel system by determining a control amount based on the determined integrated control mode. |
| US11884121B2 |
Active suspension device and control device for suspension
An ECU includes: a road surface height measurer which measures road surface heights at three or more points along a vehicle-width direction in front of a tire mounted on a wheel; a position detector which detects a position at which a difference of the road surface height from an adjacent road surface height is equal to or larger than a predetermined threshold among the road surface heights at three or more points measured by the road surface height measurer; and a road surface condition determiner which excludes a value of the road surface height at the position at which the difference detected by the position detector is equal to or larger than the predetermined threshold, and determines a condition of the road surface based on the road surface heights at positions at each of which the difference from an adjacent road surface height is smaller than the predetermined threshold. |
| US11884119B2 |
Vehicle behavior device
Provided is a vehicle behavior device including: a variable damper, which is provided between a vehicle body side and a wheel side of a vehicle, and is configured to adjust a force to be generated; a camera device configured to measure a road surface state forward of the vehicle; a future vehicle state estimation unit configured to predict a sprung behavior of the vehicle from a road surface displacement acquired by the camera device and a vehicle speed; and a command value calculation unit configured to obtain a force to be generated by the variable damper based on a predicted value obtained by the future vehicle state estimation unit, and output a command signal. |
| US11884117B2 |
Vehicle having adjustable compression and rebound damping
A damping control system for a vehicle having a suspension located between a plurality of ground engaging members and a vehicle frame are disclosed. The vehicle including at least one adjustable shock absorber having an adjustable damping characteristic. |
| US11884116B2 |
Weight distribution hitch with compact moment bar
A weight distribution hitch system comprising a vehicle attachment member comprising a forward end configured to rigidly attach to a vehicle, and a rearward end extending rearwardly toward a trailer, the rearward end comprising an upper portion comprising a trailer attachment member configured to pivotally attach to a coupler of the trailer, and a lower portion configured to receive a moment bar, a moment bar forward end attached to the lower portion of the rearward end of the vehicle attachment member so as to prevent rotation about a horizontal axis, and a moment bar rearward end; a tension member comprising a top end configured to be supported by a frame member of the trailer, and a bottom end configured to support the rearward end of the moment bar, and wherein, when the tension member is in tension, it imposes an upward force on the moment bar rearward end, which, in turn, imposes a forward moment on the vehicle; and wherein the length of the moment bar is less than 28 inches is disclosed. |
| US11884115B2 |
Method for producing a reinforcement structure for a tire
The reinforcing structure for a tire is in the form of a stratified assembly formed of two layers of reinforcing strips of completely connected cross section, and flattened in shape. According to the method, the strips of each layer are laid side by side in a main direction of laying. The strips of the first layer are spaced apart by a distance that is less than the width of the strips of the second layer and in such a way that the edges of the strips of the first layer overlap the edges of the strips of the second layer. The two layers of strips are separated by a layer of uncoupling rubber. |
| US11884112B2 |
Tire failure prediction system and tire failure prediction method
A tire failure prediction system includes first and second temperature sensors to detect temperatures of first and second tires mounted on a traveling vehicle, a temperature acquisition unit to acquire the temperatures detected by the first and second temperature sensors, and a determination unit to determine, based on the temperatures acquired, a possibility of failure for the first and second tires. The vehicle includes axles on which the tires are mounted. The first and second tires are mounted on an identical axle of the vehicle. Mounting positions of the first and second tires are symmetrical on the identical axle. The determination unit determines that the first tire has a possibility of failure where the temperature of the first tire is greater than a predetermined threshold, and a difference between the temperatures of the first and second tires is greater than a predetermined first temperature threshold. |
| US11884111B2 |
Tire insert and vehicle wheel comprising said tire insert
A tire insert for vehicle wheel which has an annular element made in one piece of polymer material is provided. The annular element has a base portion suitable for being accommodated in a rim seat of a rim and an enlarged portion having a section larger than the base portion. The enlarged portion is shaped to have shape and size to always be spaced apart from an inner tire side when the tire is inflated to a predetermined standard working pressure. When the tire is deflated, the enlarged portion comes into contact with the tire to support the tire while the vehicle wheel is running. A vehicle wheel having a tire, a rim onto which the tire is mounted, and the tire insert is also provided. |
| US11884110B2 |
Tire
A tire includes a surface geometry arrangement on a surface of a sidewall portion. The surface geometry arrangement includes a ridge pair in which two ridges bend so as to intersect each other a multiple number of times. |
| US11884104B2 |
Static discharge element for non-pneumatic tire
A non-pneumatic tire is provided that has a hub with a central axis. A supporting structure is located outward from the hub in a radial direction, and a shear band is located outward from the supporting structure in the radial direction. Tread is located outward from the shear band in the radial direction. A static discharge element extends from a first radial end of the supporting structure to a second radial end of the supporting structure. The first radial end is located closer to the central axis than the second radial end in the radial direction. The static discharge element is electrically conductive to conduct electricity through the supporting structure. |
| US11884102B2 |
Expandable wheel
An expandable wheel (100) assembly attached to a vehicle includes a circular rim disc (200) operable to receive a plurality of drive members (300) about its circumference. The drive members (300) are pivotally connected to the rim disc (200) and expand outward from the rim disc (200) via sliding levers (500) when a rotational force is applied to the rim disc (200). As a result, the drive members (300) increase the ground clearance and enhance the ability for the vehicle to negotiate variable terrain while also increasing the top velocity of the vehicle. The expandable wheel (100) assembly contracts to a circumferential closed position when the rotational force is removed. |
| US11884099B2 |
Variable shape structure having bend members
Bend members making up a variable shape structure each have a central coupling point, a one-end coupling point, and an other-end coupling point that are arranged so as to form a V shape with a fixed bend angle. A central coupling point of the first bend member and a central coupling point of the second bend member are pivotally coupled together. A central coupling point of the third bend member and a central coupling point of the fourth bend member are pivotally coupled together. A one-end coupling point of the first bend member and a one-end coupling point of the third bend member are pivotally coupled together. A one-end coupling point of the second bend member and a one-end coupling point of the fourth bend member are pivotally coupled together. The first, the second, the third, and the fourth bend members are of the same shape and the same size. |
| US11884092B2 |
Writing instrument comprising a switchable flow material
The present disclosure relates to a writing instrument comprising a tubular body, a reservoir for an ink composition. The writing instrument comprises a nib comprising a switchable flow material, wherein the switchable flow material is configured to switch between a fluid flow preventing condition and a fluid flow enabling condition by a stimulus. The switchable flow material is configured to control flow of the ink composition from the reservoir to or towards a writing surface. |
| US11884090B1 |
Pivoting pop up article and method
A pivoting pop up article and method of making has a hinge fold positioned between a front cover and a rear cover. A displacement leaf includes a base, a leg and a tab. A base leaf couple secures the base of the displacement leaf to the front cover. The base is offset relative to the hinge fold for defining a base offset dimension between the hinge fold and the base. A first interior couple secures an interior leaf to the rear cover. A second interior couple secures the interior leaf to the rear cover. The first interior couple and the second interior couple define a channel between the rear cover and the interior leaf. The base offset dimension causes the displacement leaf to be pivoted within the channel during pivoting the front cover between a closed position and an open position for extending the tab above the rear cover. |
| US11884088B2 |
System and method for printing documents with texture
An aqueous inkjet printer also ejects drops of UV material on an aqueous ink image and exposes the aqueous ink image and the UV material to UV radiation before passing the aqueous ink image and UV material through a thermal dryer. The exposure to UV radiation pins the UV material to the aqueous ink image and underlying substrate and the thermal dryer fixes the aqueous ink image to the substrate while releasing free radicals from the UV material. Thus, the printer produces textured prints that do not have free radicals that can irritate skin or produce noxious odors. |
| US11884083B2 |
Liquid discharge apparatus
A liquid discharge apparatus includes: a discharge head including nozzles; a head scanning mechanism that reciprocatingly moves the discharge head in a main scanning direction; a conveyer that conveys a recording medium in a sub-scanning direction; and a controller. In one pass, the controller executes: recording processing in which an image is formed on the recording medium by moving the discharge head in the main scanning direction and discharging liquid from the discharge head; setting processing in which the discharge head moves to a starting position of the recording processing for a subsequent pass following the one pass by changing a moving direction of the discharge head at a standstill position; and conveyance processing in which the recording medium is conveyed in the sub-scanning direction. |
| US11884076B2 |
Fluid management system for inkjet machines
Embodiments described herein provide for a fluid management system and a method of utilizing the fluid management system. The fluid management system includes a servicing fluid management system and an ink management system. The servicing fluid management system and the ink management system run in parallel within an inkjet chamber. The ink management system supports the flow of inkjet materials between a waste tank, one or more inkjet material supply tanks, an ink management module, and the inkjet printer. The servicing fluid management system supports the flow of servicing fluids between the waste tank, one or more servicing fluid supply tanks, a servicing fluid management module, and the inkjet printer. |
| US11884073B2 |
Liquid discharging head and printing apparatus
There is provided liquid discharging head including individual channels, supply throttles, and return throttles formed in plates. The supply throttles are formed in first plate of the plates and the return throttles are formed in second plate of the plates. Each of the supply throttles has cross section which is rectangle having first and second sides. Each of the return throttles has cross section which is rectangle having first and second sides. The length of the first side of each of the supply throttles and the length of the first side of each of the return throttles are substantially identical. The length of the second side of each of the supply throttles and the length of the second side of each of the return throttles are substantially identical. Aspect ratio of each of the supply throttles and aspect ratio of each of the return throttles are substantially identical. |
| US11884072B2 |
Liquid discharge head
A liquid discharge head includes a flow passage substrate which is formed with individual flow passages, the individual flow passages including nozzles and pressure chambers communicated with the nozzles respectively, the pressure chambers being open on a surface of the flow passage substrate; a sealing member which is adhered to the surface via an adhesive and which seals the pressure chambers; and an actuator substrate which has a piezoelectric layer adhered to a surface of the sealing member on a side opposite to the flow passage substrate via an adhesive and individual electrodes formed on a side opposite to the sealing member with respect to the piezoelectric layer. The sealing member is composed of a material different from a material of the piezoelectric layer; and the surface has an adhesion area to which the sealing member is adhered and a non-adhesion area to which the sealing member is not adhered. |
| US11884069B2 |
Liquid discharge apparatus
There is provided a liquid discharge apparatus including: a first shift register; a plurality of discharge sections configured to discharge droplets based on head control data; and a first wiring for transmitting the head control data to the first shift register, in which the apparatus is configured to be operated in a first print mode in which printing is performed with a first gradation number, and in a second print mode in which printing is performed with a second gradation number smaller than the first gradation number, based on the head control data, in the first print mode, a data size of the head control data is a sum of a first data size, a second data size, and a third data size, and in the second print mode, a data size of the head control data is a sum of the first data size and the second data size. |
| US11884068B2 |
Liquid discharge apparatus
There is provided a liquid discharge apparatus including: a discharge section; a first wiring for transmitting a setting information signal group that has a first setting information signal and a second setting information signal and a discharge control signal group; and a second wiring for transmitting a driving signal, in which the apparatus is configured to be operated in a first print mode in which printing is performed with a first gradation number according to the setting information signal group, and in a second print mode in which printing is performed with a second gradation number smaller than the first gradation number, and in the second print mode, the droplets are discharged from the discharge section according to the first setting information signal and the second setting information signal in which bit data of the first setting information signal is inverted. |
| US11884065B2 |
Liquid discharge apparatus and liquid discharge method
A liquid discharge apparatus includes a liquid discharge portion having a liquid discharge port and a liquid discharge unit. The liquid discharge portion performs a liquid discharge to discharge a liquid in a liquid discharge direction. The liquid discharge unit holds the liquid discharge portion and is movable along the liquid discharge direction. The liquid discharge apparatus further includes a first driver to move the liquid discharge unit along the liquid discharge direction, a second driver to move the liquid discharge portion relative to the liquid discharge unit along the liquid discharge direction, an abnormality detector to detect an abnormality of the liquid discharge unit, and circuitry. The circuitry increases an excitation current of the first driver in response to an abnormality detection signal from the abnormality detector or an instruction to clean the liquid discharge portion, and drives the second driver after increasing the excitation current. |
| US11884063B2 |
Friction reduction system and method
A friction reduction system for reducing friction of an intermediate transfer member (ITM) of a printing system, while the ITM is guided along the printing system by a guiding arrangement. The friction reduction system includes a fluid reservoir mounted within the printing system, a fluid depositing arrangement disposed along the ITM, and a control mechanism, adapted to control depositing of fluid, from the fluid depositing arrangement onto the guiding arrangement or onto at least a portion of the ITM. Depositing of the fluid reduces friction between the ITM and the guiding arrangement. |
| US11884062B2 |
Media cartridge
A media cartridge includes: a base including: a media chamber having a mouth, and a lower portion of a media outlet; first and second wings configured to support a media spool therebetween; and a cover connected between the first and second wings, and including: an upper portion of the media outlet, and a perimeter configured to engage the mouth of the media chamber, to suspend the first and second wings within the media chamber and place the upper portion of the media outlet adjacent to the lower portion of the media outlet. |
| US11884060B2 |
Print device
A print device includes a head, a medium holding portion, an opening/closing cover, a feed path, a sensor, a window portion, and a blocking wall. The medium holding portion holds the medium and open to allow the medium to be taken out and put in. The opening/closing cover opens and closes an opening in the medium holding portion. The feed path extends from the medium holding portion toward the head and feeding the medium. The sensor is provided in the feed path. The window portion is provided in a position corresponding to between the sensor and the head, in a wall portion of the case, and allows the inside of the case to be seen from outside. The blocking wall is provided between the sensor and the window portion, and blocks a light coming in through the window portion toward the sensor. |
| US11884055B2 |
Laminated hybrid metallized polymer films, system, and method for erosion protection of composite structures
There is provided a laminated hybrid metallized polymer film for erosion protection of a composite structure. The laminated hybrid metallized polymer film includes a metal foil layer, a laminating adhesive layer underlying the metal foil layer, and a polymer film layer underlying the laminating adhesive layer. The polymer film layer is laminated to the metal foil layer with the laminating adhesive layer coupled between the metal foil layer and the polymer film layer. The laminated hybrid metallized polymer film further includes an adhesive layer underlying the polymer film layer. The adhesive layer adheres the polymer film layer to a substrate surface of the composite structure. The metal foil layer, the laminating adhesive layer, the polymer film layer, and the adhesive layer form the laminated hybrid metallized polymer film for application over and to the substrate surface of the composite structure. |
| US11884052B2 |
Module and method of manufacturing the same
A module includes a first member with a first surface, a second member with a second surface opposed to the first surface, a first bonding agent, and a second bonding agent. The first bonding agent is provided in a first region on the second surface, and bonds the second member to the first surface with first bonding strength allowing the second member to be retained on the first surface. The second bonding agent is provided in a second region on the second surface, and bonds the second member to the first surface with second bonding strength allowing the second member to be retained on the first surface. Second curing time taken before the second bonding agent exhibits the second bonding strength by curing in a predetermined atmosphere is shorter than first curing time taken before the first bonding agent exhibits the first bonding strength by curing in the predetermined atmosphere. |
| US11884050B2 |
Curved-surface laminating device and curved-surface laminating method
The present disclosure provides a curved-surface laminating device and a curved-surface laminating method, for realizing lamination of a curved-surface cover plate and a flexible panel. The curved-surface laminating device comprises: a flexible profiling jig comprising a laminating surface with a shape matched with the curved-surface cover plate; a bearing film arranged between the laminating surface and the flexible panel and extending to two sides of the laminating surface, the bearing film being configured to be attached to the flexible panel; and a tensioning device in contact with the bearing film extending to the two sides of the laminating surface and configured to tension the bearing film, so that the bearing film and the laminating surface are profiled. |
| US11884040B2 |
Light weight gypsum board
This invention provides gypsum wallboards with a unique microstructure where the walls between voids are enhanced in thickness and strength to substantially improve the strength and handling properties of the wallboards. A method of making lightweight gypsum wallboards is also provided. |
| US11884038B2 |
Apparatus for manufacturing a packaging product, and kit for forming an apparatus
An apparatus for manufacturing a packaging product from a packaging-material web may include a production device for making the packaging-material web; a drawing device for drawing the packaging-material web off from a packaging-material source; a deforming device for deforming the packaging-material web; a removal conveying device for removing the packaging-material product from the apparatus; and/or a dispensing device for dispensing the packaging-material product in an aligned manner; and using a module interface, via which at least one of the functional units, forming a structural unit, can be connected in a releasable manner to an adjacent functional unit upwards and/or downwards in the conveying direction and/or changed over therewith. |
| US11884035B2 |
Drum and method for manufacturing a tire blank
Drum (10) for manufacturing a tire blank, comprising a shaft, two flanges (14) movable in translation along the shaft, and means for supplying compressed air, each flange comprising at least one pneumatic effector (36). At least one flange comprises a first, radially internal ring (46) and a second, radially external ring (48) movable in rotation around the first ring by means of at least two airtight pivot connections (50), the rings and the pivot connections delimiting at least one sealed chamber (52), said flange comprising at least one first compressed-air circulation channel (54), a first section (56) of the first channel belonging to the first ring being connected at one of its ends to the sealed chamber, and a second section (58) of the first channel belonging to the second ring being connected at one of its ends to the sealed chamber. |
| US11884030B2 |
Method of manufacturing a lightweight, structurally reinforced object of thermoplastic material
Lightweight, structurally reinforced thermoplastic objects comprising at least one reinforcement zone are manufactured by providing a heatable rigid forming chamber with a chamber volume. At a temperature below the thermoplastic softening temperature, the chamber is loaded with a plurality of thermoplastic lofting bodies and a plurality of thermoplastic reinforcement bodies wherein the lofting bodies are heat-loftable bodies comprising a thermoplastic matrix containing an elastically compressed assembly of reinforcement fibers embedded therein, lofty non-woven bodies comprising an elastically compressible assembly of reinforcement fibers and thermoplastic fibers. Upon closing the chamber, lofting bodies of lofty non-wovens are elastically compressed, producing an internal pressure. After heating the chamber above softening temperature, reinforcement bodies and lofting bodies are ow thermoplastically formable, and lofting bodies configured as heat-loftable bodies produce a second internal pressure. After a predetermined processing time, the chamber is cooled yielding a structurally reinforced object. |
| US11884029B2 |
Method of manufacturing a wind turbine blade with fewer manufacturing defects
The present invention relates to a method of manufacturing a wind turbine blade using a two-step curing process, wherein the second curing is performed in the presence of a resin flow medium (76) comprising a curing inhibitor. |
| US11884027B2 |
Wind turbine blade mold with built-in high precision geometric references on B-surface
Provided herein is a wind turbine blade mold system having built in precision pins to locate structural components (e.g. spar caps) during layup of composite segments. A plurality of pins can be inserted into apertures within the mold, with discs attached to the pins to maintain fixed relative distance to spar caps positioned relative to the pins to ensure precise positioning, thereby preventing/inhibiting movement of the spar cap relative to the mold. The pins can include a first extension that pierce through the layers of composite layups, and protrude above the B-surface of the blade skin. Additionally, the pins can include a marker tip releasably attached to the pin top to provide visual identification of the pin and underlying structural components. The pins can remain embedded within the final molded part. |
| US11884026B2 |
Molded article and method for making the same
A composite article includes a first segment and a second segment spaced apart form the first segment. The composite article includes continuous fibers that extend from the first segment to the second segment. The composite article also includes discontinuous fiber distributed throughout the composite article. |
| US11884018B2 |
Finishing three-dimensional printed parts
Examples disclosed herein relate to a finishing system for a three-dimensional (3D) printed part. Example systems include a sensor to detect a marking on a portion of the 3D printed part. A post-processing component of the system may perform a finishing operation on the portion of the 3D printed part while the marking is detected on the 3D printed part. |
| US11884014B2 |
Tool for dispensing multiple materials with discrete positional control without need for sequential tool change
A method for operating the 3D printing tool includes positioning a first material distribution barrel within a first barrel orifice, where a first barrel tip is disposed at a first end of the first material distribution barrel. The method further includes positioning a second material distribution barrel within a second barrel orifice, where a second barrel tip is disposed at a first end of the second material distribution barrel. The method further includes dispensing building material from the first material distribution barrel when the first material distribution barrel is substantially vertically oriented and a second material distribution barrel is oriented at an angle from the vertical. |
| US11884008B2 |
System and method of making printed articles
A system for forming a product with different size particles is disclosed. The system comprises at least one print head region configured to retain a first group of print heads configurable to additively print at least a first portion of the product with a first material and a second group of print heads configurable to additively print at least a second portion of the product with a second material. The described system may also comprise a processor configured to regulate the first group of print heads and the second group of print heads to distribute the first material and the second material. A method of making an object by ink jet printing using the disclosed system is also disclosed. |
| US11884005B2 |
Methods of manufacturing articles utilizing foam particles
Methods for manufacturing articles of footwear are provided. In various aspects, the methods comprise utilizing additive manufacturing methods with foam particles. In some aspects, the disclosed methods comprise selectively depositing a binding material on foam particles in a target area such that the binding material coats at least a portion of defining surfaces of the foam particles with the binding material. The binding material is then cured to affix foam particles in the target area to one another. In various aspects, the disclosed methods can be used to manufacturer articles with sub-regions that differential levels of affixing between the foam particles, and thereby resulting in sub-regions with different properties such as density, resilience, and/or flexural modulus. This abstract is intended as a scanning tool for purposes of searching in the particular art and is not intended to be limiting of the present disclosure. |
| US11884003B2 |
Method for producing polymer member
To suppress peeling off of a polymer coating in a polymer member formed to have the polymer coating provided on a surface of a polymer shaped object, performed are: a curing step of causing a curable composition to be cured by energy rays to prepare the polymer shaped object; a coating step of forming the polymer coating on the polymer shaped object; and a post-curing step of irradiating the polymer shaped object with the energy rays after the coating step, wherein, in the curing step, the polymer shaped object in which a reactive functional group is left is prepared. |
| US11884001B2 |
Method for manufacturing a silicone elastomer article using a 3D printer
The invention relates to an additive manufacturing method for producing a three-dimensional elastomer silicone article. The elastomer silicone article is built up layer by layer by printing a silicone composition crosslinkable by addition reactions comprising at least one organopolysiloxane-polyoxyalkylene copolymer with a 3D printer selected from an extrusion 3D printer or a material jetting 3D printer. |
| US11883998B2 |
Apparatus and method for producing plastic containers with non-circular cross-sections
Apparatus for producing plastic containers has a heating device having a transport device for transporting the plastic preforms singly along a predefined transport path. The transport device has a plurality of holding devices for holding the plastic preforms, and at least one heating unit for heating the plastic preforms, wherein furthermore a rotating device is provided which rotates the plastic preforms held by the holding devices and is connected to a forming device, which transforms the plastic preforms transported by the heating device into plastic containers. The apparatus has an alignment device which enables alignment of the rotational position of the plastic preforms with respect to their longitudinal direction relative to the holding devices holding these plastic preforms and/or the apparatus has a rotational position alignment device arranged along the transport path which enables alignment of a rotational position of the holding devices with the plastic preforms arranged thereon. |
| US11883995B2 |
Members for sealing, baffling, or reinforcing
An article comprising: a carrier (12), activatable material (14) disposed on the carrier, one or more carrier extensions (16) extending from the carrier; wherein the article is adapted to provide sealing, baffling, or reinforcement within a structure's cavity. |
| US11883993B2 |
Die-formed chamfered plastic floor and preparation method thereof
A die-formed chamfered plastic floor and a preparation method thereof are disclosed. The method includes: mixing raw materials for preparing a plastic floor matrix to obtain a mixed material; subjecting the mixed material to an extrusion, a laminating-embossing treatment, a die forming-chamfering treatment, a coating with an ultraviolet curable paint, a slicing, and a tenoning in sequence, to obtain the die-formed chamfered plastic floor. In the disclosure, a die forming-chamfering treatment is set between a laminating-embossing treatment and a coating with an ultraviolet curable paint, and thereby a chamfer embossing could be formed on the surface of the workpiece through pressing. |
| US11883992B2 |
Molding support device for injection molding machine
Provided are a basic data input unit to input basic data including molding conditions data related to molding conditions and screw data related to the form of the screw; a calculation formula data setting unit to set solid phase rate calculation formula data to calculate the solid phase rate of the molten resin in a heating cylinder based on this basic data; a calculation processing function unit having a solid phase rate calculation processing unit to use calculation processing based on the basic data and the solid phase rate calculation formula data to calculate an estimated solid phase rate of the molten resin at the measurement completion; and an output processing function unit that performs display processing to display information related to the estimated solid phase rate on a display. |
| US11883991B2 |
Control device of injection molding machine and method of setting mold clamping force
A control device of an injection molding machine, the injection molding machine including: a mold clamping device that advances and retracts a movable mold with respect to a fixed mold; and an injection device that injects and fills a molten material into a cavity formed between both the molds, the control device including: a display unit that displays a setting screen for setting molding conditions of the injection molding machine; and a setting unit that sets the molding conditions based on information displayed on the setting screen. |
| US11883989B2 |
Method for producing press molded body
A method for producing a press molded body is provided in which a material X that contains a thermoplastic resin Rx and carbon fibers A having a weight average fiber length LwA and a material Y that contains a thermoplastic resin Ry and carbon fibers B having a weight average fiber length LwB are heated, and the heated material X and material Y are pressed within a mold at the same time, thereby producing a press molded body which has a region X that is formed of the material X and a region Y that is formed of the material Y. This method for producing a press molded body is configured such that: LwB |
| US11883988B2 |
Poly(vinyl alcohol) mold release film for artificial marble molding use, and method for producing artificial marble using same
Disclosed is a mold release film that is to be placed between a stock solution that serves as a raw material for artificial marble and a shaping apparatus when the stock solution is fed to the shaping apparatus, and then solidified and molded. |
| US11883979B1 |
Method and apparatus for producing engineered stone slabs with variable width veins
An apparatus including a tool device configured to be used in the manufacturing of engineered stone slabs. The tool device may be configured to travel in an x-y plane in order to create a physically disrupted region in a mixture of resin and aggregate minerals. The tool device may have a mechanism configured to vary a width of the physically disrupted region of the mixture while traveling in the x-y plane. The apparatus may further include a spray device, which is configured to deposit colorant in an area in a wake of travel of the tool device in the x-y plane. The spray device may be configured to deposit colorant in an area while the physically disrupted region is being created in the area. The tool device may be a carving device with a V-shaped component. The tool device may be a stirring device having one or more prongs. |
| US11883973B2 |
Cutting apparatus and contact position specifying program
A controller uses detection information of a contact sensor or time-series data of a detection value related to a drive motor included in a rotation mechanism and/or a feed mechanism to acquire a coordinate value when a cutting tool comes into contact with a to-be-cut object or a component. The controller determines a relative positional relationship between the cutting tool and a rotation center of the to-be-cut object based on coordinate values when the cutting tool comes into contact with the to-be-cut object subjected to turning work or a reference surface whose relative positional relationship with the rotation center of the to-be-cut object is known at least at two positions different from a rotation angle position of the cutting tool during the turning work. |
| US11883971B2 |
Electronic personal care device
An electronic personal care device with a housing defining a sealed cavity. A power source positioned within the sealed cavity of the housing. A first circuit board is positioned within the sealed cavity of the housing. A second circuit board positioned outside the sealed cavity and in electrical connection with the power source. A light guide is mounted to the second circuit board. The light guide having a body defining an opening. A light source is positioned within the opening, spaced apart from the light guide and mounted to the circuit board. A transparent adhesive layer is positioned around the light source and on the second circuit board forming water tight seal. |
| US11883969B2 |
Hair sculptor
A hair length mapping or cutting device uses multiple comb elements to capture bunches of hair as it is traversed across a scalp. The comb elements are traversed away from the scalp to individually measure or cut each bunch of hair to length. Hair may be cut to conform to a hair style mapped, for instance, from an earlier measurement of a hair style. |
| US11883968B2 |
Cutting length adjustment mechanism, adjustment drive and hair cutting appliance
A cutting length adjustment mechanism for a hair cutting appliance, a hair cutting appliance, a method of operating a cutting length adjustment mechanism for a hair cutting appliance and an adjustment drive for a cutting length adjustment mechanism for a hair cutting appliance wherein the adjustment drive includes an actuator that is configured to actuate a movable portion of the cutting length adjustment mechanism with respect to a housing portion of the hair cutting appliance, and a movement sensor unit that is configured to detect a movement of the hair cutting appliance, the movement involving at least one of an orientation change and a position change. The actuator is further configured to output an adjustment control signal that is derived from the detected movement. In a length adjustment mode, the actuator is operated on the basis of the adjustment control signal. |
| US11883965B2 |
Cognitive robotic tool selector and applicator
Robotic processor embodiments determine via graphical image analysis physical attributes of an engagement area of a work-piece that a specified tool physically engages to execute a specific action. The processors identify a model set plurality of alternate substitute tools that are each available within a physical environment of the engagement area and have a body portion with physical dimensions that conform to physical dimensions of the work-piece engagement area, and thereby select a substitute tool that has a body portion that best conforms to the physical dimensions of the work-piece engagement area and meets constraints for substitute tool selection for executing the specific action. |
| US11883964B2 |
Method and control system for verifying and updating camera calibration for robot control
A computing system and a method for calibration verification is presented. The computing system is configured to perform a first calibration operation, and to control a robot arm to move a verification symbol to a reference location. The robot control system further receives, from a camera, a reference image of the verification symbol, and determines a reference image coordinate for the verification symbol. The robot control system further controls the robot arm to move the verification symbol to the reference location again during an idle period, receives an additional image of the verification symbol, and determines a verification image coordinate. The robot control system determines a deviation parameter value based the reference image coordinate and the verification image coordinate, and whether the deviation parameter value exceeds a defined threshold, and performs a second calibration operation if the threshold is exceeded. |
| US11883954B2 |
Flexible member
A flexible member is provided which can have excellent load resistance and flexibility while being more compact. This flexible member has a main body part in which multiple wave washers having closed ring shapes is stacked in an axial direction and joined to each other by multiple joint parts, and the main body part is able to be bent with respect to the axial direction due to elastic deformation of the wave washers. Each of the joint parts includes: a pair of welded parts in linear shape, being gradually separated from each other in a circumferential direction from an inner circumferential side toward an outer circumferential side of the wave washer. |
| US11883951B2 |
Gripping device having a pair of deformable gripping elements configured to form an inner gripping space and to retain a container in the inner gripping space
A gripping device includes a body defining a constraint opening. A gripping member is engaged to the body and is configured to grasp a container. The gripping member includes deformable gripping elements arranged in correspondence of the constraint opening and configured to embrace, when the gripping device is in use, a respective portion of the container. The gripping elements are configured to form an inner gripping space. The gripping member is configured to operate at least between a rest configuration and a gripping configuration wherein the deformable gripping elements are deformed and retain, when the gripping device is in use and in correspondence of the inner gripping space, a container. |
| US11883947B2 |
Machine learning enabled visual servoing with dedicated hardware acceleration
A system controller for visual servoing includes a technology module with dedicated hardware acceleration for deep neural network that retrieves a desired configuration of a workpiece object being manipulated by a robotic device and receives visual feedback information from one or more sensors on or near the robotic device that includes a current configuration of the workpiece object. The hardware accelerator executes a machine learning model trained to process the visual feedback information and determine a configuration error based on a difference between the current configuration of the workpiece object and the desired configuration of the workpiece object. A servo control module adapts a servo control signal to the robotic device for manipulation of the workpiece object in response to the configuration error. |
| US11883933B1 |
Screw-driven spreading tool with a disengage
According to one example, a tool includes a second arm pivotally coupled to a first arm, a lead screw nut pivotally coupled to a second portion of the second arm, and a lead screw extending through an opening of the lead screw nut, the lead screw being pivotally and rotationally coupled to a second portion of the first arm. The tool has an engaged configuration and a disengaged configuration. In the engaged configuration, a first portion of the first arm may be pivoted further from a first portion of the second arm when the lead screw is rotated. In the disengaged configuration, the first portion of the first arm may be pivoted closer to the first portion of the second arm without the lead screw being rotated. |
| US11883917B2 |
Power tool dust collector
An auxiliary handle is for use with a power tool having a housing that includes a first notch and a second notch. The auxiliary handle includes a shaft, a first clamp coupled to the shaft and having a first protrusion configured to engage the first notch, and a second clamp arranged on the shaft and having a second protrusion configured to engage the second notch. When the first protrusion of the first clamp engages the first notch, the second clamp is movable along the shaft between a first position, in which the second protrusion engages the second notch, and a second position, in which the second protrusion is disengaged from the second notch. The auxiliary handle also includes a grip coupled to the shaft. When the grip is rotated relative to the second clamp, the second clamp is moved from the second position toward the first position. |
| US11883909B2 |
Systems and methods to design part weld processes
Systems and methods to design part weld processes are disclosed. An example system for monitoring welding of components of a workpiece with multiple arc welds in a fixture includes: one or more weld sensors configured to collect data associated with the multiple arc welds; and a computing device configured to: access a weld program; provide weld instructions defined in the weld program and associated with a sequence of welds for the workpiece, the weld instructions comprising a visual slide including an image of the workpiece and a visual indication of a first location of a first weld; based on the weld program, display the visual slide at a first zoom level; based on the weld program, display the visual slide at a second zoom level; and monitor first weld data from the one or more sensors during a first weld to determine a status of the first weld. |
| US11883907B2 |
Flange fitting for tubular structures
Devices, systems, and methods are directed to automated techniques for fitting flanges to tubular sections used to form tubular structures, such as large-scale structures used in industrial applications (e.g., wind towers and pipelines). As compared to manual techniques for fitting flanges to tubular sections, the devices, systems, and methods of the present disclosure facilitate faster attachment of flanges, which may be useful for achieving cost-effective throughput. By way of further comparison to manual techniques, the devices, systems, and methods of the present disclosure may, further or instead, facilitate achieving tighter dimensional tolerances. In turn, such tighter dimensional tolerances may be useful for forming thinner-walled, lighter, and lower cost tubular structures. Still further or in the alternative, automated techniques for fitting flanges to tubular sections may facilitate attachment of multipiece flanges or other non-traditional flange geometries. |
| US11883906B2 |
High manganese steel pipe with step-out weld zone erosion-corrosion resistance and method of making the same
A metal cored wire for submerged arc welding, the wire comprising a steel sheath with a core comprising powders of: carbon in a range of about 0.3 wt. % to about 1.2 wt. %; silicon in a range of about 0.1 wt. % to about 3.0 wt. %; manganese in a range of about 9.0 wt. % to about 30 wt. %; chromium in an amount less than about 8 wt. %; nickel in an amount less than about 6 wt. %; molybdenum in an amount less than about 6 wt. %; tungsten in an amount less than about 5 wt. %; copper in an amount less than about 4 wt. %; niobium in an amount less than about 2 wt. %; vanadium in an amount less than about 2 wt. %; titanium in an amount less than about 2 wt. %; nitrogen in an amount less than about 0.4 wt. %; boron in an amount less than about 1 wt. %; at least one of: (i) sulfur in an amount less than about 0.3 wt. %; (ii) phosphorous in an amount less than about 0.03 wt. %; or a combination thereof; and the balance with iron. |
| US11883903B2 |
Method and appliance for cutting materials by multi-beam femtosecond laser
Disclosed is a method for cutting dielectric or semiconducting material with a laser. The method includes the following steps: emission of a laser beam including at least one burst of N femtoseconds laser pulses; spatial separation of the laser beam into a first split beam having a first energy, and respectively, a second split beam having a second energy; spatial concentration of energy of the first split beam in a first zone of the material, respectively, of the second split beam in a second zone of the material, the first zone and the second zone being separate and staggered by a distance dx; and adjustment of the distance between the first zone and the second zone in such a way as to initiate a straight micro-fracture oriented between the first zone and the second zone. |
| US11883902B2 |
Friction stir welding using a PCBN-based tool
The present application relates to a friction stir welding tool insert comprising a polycrystalline cubic boron nitride, PCBN, composite material with a textured surface layer. The textured surface layer comprises a pre-defined repeating pattern. |
| US11883899B2 |
Apparatus for replacing welding tip of welder and apparatus for supplying same
An apparatus for supplying a welding tip of a welder and an apparatus for replacing the same include a fixed bracket secured to a support. The apparatus includes an actuator coupled to the fixed bracket and a first moving member moved by the actuator. A second moving member is coupled to the first moving member and hingedly coupled to the fixed bracket. A third moving member is hingedly coupled to the second moving member. A first welding tip removal member is coupled to the third moving member to separate a welding to tip coupled to a shank. A fourth moving member is disposed opposite to the first moving member. A fifth moving member is coupled to the fourth moving member and hingedly coupled to the fixed bracket. A sixth moving member is coupled to the fifth moving member. A second welding tip removal member is coupled to the sixth moving member. |
| US11883896B2 |
Recognition of components for welding and cutting torches
Recognizing interchangeable torch components, such as consumables, for welding and cutting torches includes determining that one or more interchangeable torch components installed in an operative end of a torch are genuine. Operational parameters for the one or more interchangeable torch components can also be determined. When the one or more interchangeable torch components are determined to be genuine, an indicator assembly can be activated to provide a first indication. When the operational parameters are implemented at a power supply connected to the torch, the indicator assembly can be activated to provide a second indication. |
| US11883893B2 |
Saw blade
A saw blade contains a body, in particular of a hard material, having a cutting portion. The cutting portion has a length and a width and being provided along its length with a plurality of teeth which are formed by a plurality of grooves. Each tooth being formed by at least two grooves. There is a first plurality of grooves, the grooves of which are parallel to each other along a first direction and in that there is a second plurality of grooves, the grooves of which are parallel to each other in a second direction. The first direction and the second direction are inclined to each other such that along the length of the cutting portion at least one of the grooves of the first plurality of grooves is intersected by a groove of the second plurality of grooves. |
| US11883892B2 |
Stop for a work platform tool
A stop for a tool that engages a work piece on a work platform includes a mounting assembly that can be movably mounted on the tool so that the mounting assembly is selectively positionable on the tool. A first member is operatively connected to the mounting assembly and projects outwardly from the mounting assembly. A second member projects from the first member to engage and locate the work piece with respect to the tool. The second member is mounted on the first member for movement along a length of the first member and is selectively fixed to the first member to adjust a distance between the second member and the mounting assembly. |
| US11883889B2 |
Support assembly for a core drill
A support assembly for a core drill uses an improved reinforcement. The reinforcement can include an extension extending between a center of the tool and a perimeter of the tool the extension can be a non-planar structure having a channel along a portion of the structure. The reinforcement can include a slanted element that can be associated with the extension, that can be formed monolithic with the extension, or otherwise combined with an extension. Multiple slanted elements can be used to form an extension. A top plate can be included for strengthening the reinforcement. |
| US11883888B2 |
Modular drill with enhanced bump-off capability
A rotary cutting tool with enhanced bump-off capability is disclosed. The cutting tool includes a tool shank having a pocket. A replaceable cutting head is at least partially disposed within the pocket of the tool shank with an interference fit. A coupling pin assembly is at least partially received within a bore of the tool shank. The coupling pin assembly comprises a sleeve member and a coupling pin at least partially disposed within the sleeve member. The sleeve member includes an upper portion and a lower portion having a non-circular cross-sectional shape with a bump-off surface. An actuation screw contacts the coupling pin assembly and causes the replaceable cutting head to move relative to the tool shank. The bump-off surface of the lower portion of the sleeve member extends radially outward with respect to the coupling pin by a distance, D, thereby providing enhanced bump-off capability. |
| US11883887B2 |
Drill
For improving a drill, in particular a spiral drill, comprising a base body extending substantially longitudinally in a direction axial to a drill axis, said base body comprising a drilling portion, wherein a radially inward core region in relation to the drill axis and a radially outer region are provided in the base body in the drilling portion, and the drilling portion comprises a plurality of spiral-shaped recesses in the outer region, and arranged between each two spiral-shaped recesses is a wall part, it is proposed that the drill comprises at least four main cutting edges, in particular exactly four main cutting edge and/or the drill comprises at least three central cutting edge portions. |
| US11883878B2 |
Diecasting tool
A diecasting tool has an insert for producing a cooled motor housing. The diecasting tool has mould halves including: a stationary mould half; and movable mould half. One of the mould halves has a cylindrically extending annular gap having a central axis. The moveable mould half is arranged so as to be movable parallel to the central axis. The insert is arranged in the cylindrically extending annular gap. The insert is a bush. One end of the bush projects into a mould cavity, which is formed by the stationary mould half and the movable mould half, and is at least partially surrounded in a form-fitting manner by the casting material in a state when the casting material is cast. |
| US11883875B2 |
Forging device and method for manufacturing forged product
A forging apparatus and a forged product manufacturing method aim to prevent decrease in the temperature of a forging space and the temperature of a forging material, efficiently maintain the uniformity of the temperatures of upper and lower dies, and improve forging efficiency. In the forging apparatus and the forged product manufacturing method according to the present invention, the upper and lower dies are heated by a heating mechanism in a housing in which a charging port of an integrally formed housing body is closed by a door, the upper and lower dies are moved relatively in a facing direction of the upper and lower dies, the heating mechanism is moved relatively in the facing direction with respect to at least one of the relatively moving upper and lower dies, and whereby the forging material is forged between the upper and lower dies. Furthermore, the forged product manufacturing method is used to manufacture a forged product from the forging material. |
| US11883872B2 |
Metal containers and methods of manufacture
A method of reducing a thickness and increasing a height of a cylindrical wall of a metal cup to form a can body comprises positioning a wall-ironing punch inside the cup, moving an annular wall-ironing die axially over the closed end of the cup towards the open end of the cup, but not beyond the open end of the cup, in order to iron the cylindrical wall from the closed end up to a position axially spaced from the open end and moving the wall-ironing die back in an opposite direction to remove the can body from the die. Methods of altering a diameter of one or more regions of a can body are also disclosed. |
| US11883871B2 |
Pipe receiving assembly for a pipe grooving device
A pipe grooving device includes an assembly adapted to receive an end of the pipe. The assembly includes a cup which surrounds a pipe end stop. The cup and the pipe end stop may be mounted on a fixed pinion about which a carriage rotates. The carriage carries geared cams which engage the pinion and rotate synchronously when the carriage rotates relatively the pinion. The cams engage a pipe element received by the cup and form a circumferential groove in the pipe element. The cup and the pipe end stop move independently of one another axially along a pinion shaft to actuate rotation of the carriage. The cup accommodates dimensional pipe diameter tolerances and mitigates pipe flare and maintains pipe roundness during the grooving process. |
| US11883869B2 |
Butt retrieval system
A butt retrieval system having a butt retrieval receptacle supported outside the main footprint of an extrusion press such that maintenance and/or repair of the system is simplified. The butt retrieval system includes a butt retrieval receptacle moveable between a butt retrieving position and a butt unloading position. The butt retrieval receptable has a cantilevered arm extending from a base portion of the butt retrieval receptacle in a direction towards the centerline of the associated extrusion press. |
| US11883868B2 |
Method for producing a metal article
A method for producing a metal article, in particular a slab, a pre-strip, a strip, or a sheet, in which the article is first conveyed in the conveying direction through a scale washer and then through a rolling mill, wherein the rolling mill has at least one roll stand, in particular a first roll stand in the conveying direction. The article is subjected in the scale washer to at least one upper row of nozzles, which descales the upper side of the article, and to at least one lower row of nozzles, which descales the lower side of the article. |
| US11883865B2 |
Blister pack disposal system
Compositions comprising a blister pack, a container dimensioned to hold the blister pack and a pharmacological agent activity mitigation component are provided. Also provided are methods of making and using the compositions. |
| US11883862B2 |
Pipeline automatic scale removal and storage device
The present invention discloses a pipeline automatic scale removal and storage device. The device comprises a scale remover, a scale storage device and a coupling; the scale remover is composed of a scale breaking mechanism, a cutting mechanism and a grinding mechanism; a plurality of groups of scale breaking teeth of the scale breaking mechanism can preliminarily break scale on an inner wall of a pipeline; the cutting mechanism cuts and eliminates the scale on the inner wall of the pipeline through a plurality of installed cutting blades; and a plurality of groups of grinding blocks of the grinding mechanism further grind and eliminate the scale on the pipeline; and the scale storage device is used for realizing storage for the scale. The scale storage device is hermetically and movably installed in the pipeline. The device of the present invention can automatically thoroughly eliminate the scale in the pipeline. |
| US11883860B2 |
Methods for using an integrated scraper-sponge
Methods of using an integrated scraper-sponge having a scraper layer with and edge and fixed between the first and second sponge and/or abrasive layers. The scraper sponge is wetted and applied to a surface that is contaminated. The scraper-sponge is moved about the contaminated surface or dabbed onto the surface. The wet sponge portion loosens residue while the scraper edge scrapes residue from the surface as the scraper is moved about the contaminated surface. |
| US11883859B2 |
Laser cleaning method and device for improving uniformity of laser cleaning surface
A laser cleaning method and device for improving uniformity of a laser cleaning surface are provided. The laser cleaning method includes: applying a peaked-top sine wave signal to a motor; controlling a galvanometer to swing in a reciprocated manner by the motor; shaping a laser beam emitted by a laser to a linear beam by the reciprocated swing of the galvanometer; and performing laser cleaning using the shaped linear beam. |
| US11883858B2 |
Substrate processing device and substrate processing method
The substrate processing apparatus includes: a nozzle having a spout and adapted to spout SPM from the spout toward a substrate; a mixing portion communicating with the spout; a sulfuric acid-containing liquid supply device which recovers liquid supplied to and expelled from the substrate held by a substrate holding unit, prepares a sulfuric acid-containing liquid from the recovered liquid, and supplies the prepared sulfuric acid-containing liquid to the mixing portion; and a control device. The control device performs: a sulfuric acid-containing liquid preparing step of recovering SPM supplied to and expelled from the substrate and preparing the sulfuric acid-containing liquid; and an SPM spouting step of supplying the prepared sulfuric acid-containing liquid and hydrogen peroxide water to the mixing portion, mixing the sulfuric acid-containing liquid and hydrogen peroxide water together in the mixing portion to prepare SPM, and spouting the prepared SPM from the spout. |
| US11883854B2 |
Optical sorter
An optical sorter includes a light source, a color sensor, a determination part configured to determine a foreign object and/or a defective product, a color shift amount calculation part configured to calculate, based on a color image acquired by the color sensor, an amount of a color shift that occurs due to the fact that at least two element groups out of an R element group, a G element group, and a B element group are spaced apart from each other in a transit direction of a sorting target, a speed calculation part configured to calculate a transit speed of the sorting target based on a separation distance between the at least two element groups in the transit direction, the color shift amount, and a scan time, which is a time required for the color sensor to scan the sorting target once, and a sorting device configured to perform a trajectory change operation for changing a trajectory of a specific sorting target determined based on a result of the determination by the determination part at a timing determined based on the transit speed calculated by the speed calculation part. |
| US11883852B2 |
Systems and methods of processing undeliverable delivery items
Provided herein are processing systems, computer readable media, and methods for processing undeliverable delivery items. A system includes a camera and a hardware processor operably connected to the camera and configured to perform operations that include capturing, using the camera, an image of a delivery item that is undeliverable to an intended recipient or at an intended delivery location, the image including an address of the intended recipient. The operations also include embedding, by the hardware processor, processing data with the image to thereby generate an embedded image as a printable file, the embedded image including the image of the delivery item framed by a template area that includes a reason for the delivery item being undeliverable. The operations also include notifying a sender of the delivery item that the delivery item is undeliverable via a hard copy printout of the embedded image. |
| US11883848B2 |
Classification process for superabsorbent polymer particles
The invention relates to a classification process for superabsorbent polymer particles, comprising classifying the water-absorbent polymer particles in a screen machine under reduced pressure wherein the pressure above the uppermost sieve is from 0 to 4.0 mbar per sieve higher than below the undermost sieve. |
| US11883847B2 |
Blocking plate structure for improved acoustic transmission efficiency
An acoustic matching structure is used to increase the power radiated from a transducing element with a higher impedance into a surrounding acoustic medium with a lower acoustic impedance. The acoustic matching structure consists of a thin, substantially planar cavity bounded by a two end walls and a side wall. The end walls of the cavity are formed by a blocking plate wall and a transducing element wall separated by a short distance (less than one quarter of the wavelength of acoustic waves in the surrounding medium at the operating frequency). The end walls and side wall bound a cavity with diameter approximately equal to half of the wavelength of acoustic waves in the surrounding medium. In operation, a transducing element generates acoustic oscillations in the fluid in the cavity. The transducing element may be an actuator which generates motion of an end wall in a direction perpendicular to the plane of the cavity to excite acoustic oscillations in the fluid in the cavity, and the cavity geometry and resonant amplification increase the amplitude of the resulting pressure oscillation. The cavity side wall or end walls contain at least one aperture positioned away from the center of the cavity to allow pressure waves to propagate into the surrounding acoustic medium. |
| US11883846B2 |
Method for manufacturing an ultrasound transducer and ultrasound probe
A method for making ultrasound transducers and ultrasound probes includes providing a piezoelectric layer having a first surface and a second surface, where the second surface is on an opposite side of the piezoelectric layer from the first surface. The method includes fabricating a plurality of conductive through vias extending from the first surface to the second surface of the piezoelectric layer, where fabricating the plurality of conductive through vias comprises cutting a plurality of trenches through the piezoelectric layer and filling each of the plurality of trenches with a conductive material. The method includes cutting the piezoelectric layer into a plurality of transducer units after fabricating the plurality of conductive through vias and cutting each of the transducer units into a plurality of transducer elements. |
| US11883837B2 |
System and method for liquid dispense and coverage control
Light can be used to monitor coating a liquid on a substrate. By directing the light to a spot on the substrate, when the liquid passes through the spot, some light will be reflected, while some light will be scattered. Monitoring this behavior can indicate whether a substrate has been successfully coated with the liquid, as well as identifying defects. Further, coating times can be monitored to make process adjustments. |
| US11883836B2 |
Dispensing device suitable for a foamable product
A dispensing device for dispensing a foamable product. The dispensing device comprises a dispensing channel (110; 210; 410). The dispensing channel has: an inlet (111; 211; 411) for communicating with a valve-element (120) of a container (130) containing the foamable product; and an outlet (112; 212; 412) for dispensing the foamable product. The dispensing channel (110; 210; 410) further comprises a variable-volume cavity (140; 240; 440) at the outlet. The variable-volume cavity (140; 240; 440) is defined at least partly by a first component (142; 242; 442) and a second component (144; 244; 444) that is separate from and rigidly movably with respect to the first component to vary the volume of the variable-volume cavity (140; 240; 440) between a first configuration and a second configuration. In the first configuration, the variable-volume cavity (140; 240; 440) has a first volume and the outlet (112; 212; 412) is closed. In the second configuration, the variable-volume cavity has a second volume and the outlet (112; 212; 412) is open. The second volume is greater than the first volume. |
| US11883833B2 |
Dielectric materials
The present disclosure describes methods, devices and systems comprising materials comprising dielectrics. In various aspects, electrodes layered or imbedded with these dielectrics provide enhanced properties for a wide range of applications, such as the enhanced separation of analytes, such as biological molecules or particles (nucleic acids, viruses) with an electrokinetic field. |
| US11883832B2 |
Releasable dust mitigation covering
A covering includes an outer material, a plurality of conductive-fibers, and a fastening material. The outer material includes a front surface and a back surface and the conductive-fibers are disposed between the front surface and the back surface. The conductive-fibers are configured to receive a voltage that causes the conductive-fibers to repel and remove dust from the front surface of the outer material. The fastening material is coupled to the back surface of the outer material and facilitates releasably attaching the outer material to an article. |
| US11883827B2 |
Material reduction machine with dynamic infeed control
A material reduction machine includes a prime mover driving a cutting mechanism. An infeed portion engages a piece of material to feed it forward to the cutting mechanism. A sensor senses a machine load parameter via the cutting mechanism and/or prime mover and reports a signal to a controller operatively coupled to the infeed portion to control sequential cutting cycles on the piece of material. The controller utilizes a stored first stop threshold value for stopping a first cutting cycle and continues monitoring the signal as machine load increases momentarily after reaching the first stop threshold. The controller determines and adopts a second stop threshold value based on observation of the machine load parameter indicative of maximum load during the continued monitoring following attainment of the first stop threshold, and further being based on a stored correction factor. The second stop threshold value is used for a second cutting cycle. |
| US11883826B2 |
Unit and method for fragmenting a bagged solid mass
Disclosed is a fragmentation unit including: —a frame in which there extends a region for receiving a bag, the contents of which is to be fragmented, the region being delimited by the ground and by four virtual planar vertical faces, and divided into a front area and a rear area of equal dimensions by a vertical plane, —at least two pressure plates that are able to move towards each other and vertically, each having a front edge and a vertical planar pressing face, having a rear edge, the rear edge being situated behind a plane containing the virtual planar rear face, and the front edge being tangential to a vertical plane parallel to the plane and dividing the front area of the region into two sub-areas. Also disclosed is a fragmentation method. |
| US11883823B2 |
Methods for the filtration of small-volume heterogeneous suspensions in a digital microfluidic device
Disclosed herein are two related techniques for digital microfluidic (DMF) processing of liquids that rely on electrostatic actuation of fluid through a strip of solid, porous media. In the first technique, droplets in a DMF device containing particles of different sizes are driven through a solid porous medium, allowing for filtering, concentration, and recovery of the particles into droplets on the basis of size. In the second technique, an aliquot of liquid media is loaded directly onto a solid porous medium, where it is wicked into a DMF device, such that the filtrate can be collected into droplets. Both techniques may be useful for generating plasma from whole blood on a DMF device, an operation that will have far-reaching implications for diagnostic applications of digital microfluidics. |
| US11883813B2 |
Carbazolium salt and use thereof in anion exchange membranes
Compositions comprising a tetraaryl ammonium salt, a tetraaryl ammonium salt covalently bound to a polymer and methods for manufacturing the same are disclosed. The disclosed compositions are useful e.g., for an anion exchange membrane, or an anion conducting polymer, and may further be used in electrochemical devices such as alkaline fuel cells, and alkaline redox-flow batteries. |
| US11883811B2 |
Catalyst material and method of manufacturing the same
A method of manufacturing a catalyst material includes the steps of: providing a body having an open-porous foam structure and comprising at least a first metal or alloy; providing particles, each of which particles comprising at least a second metal or alloy; distributing the particles on the body; forming a structural connection between each of at least a subset of the particles and the body; and forming an oxide film on at least the subset of the particles and the body, wherein the oxide film has a catalytically active surface. |
| US11883806B2 |
Active component carrier composition, and method for manufacture of catalyst materials
An active component carrier composition is disclosed comprising a mixture of one or more catalytically active components and one or more oxidized disulfide oil (ODSO) compounds, including a water-soluble fraction of ODSO. In certain embodiments the ODSO is obtained from the effluent of an enhanced MEROX process. The active component carrier composition facilitates transfer of catalytically active components (or components that will be catalytically active in the finished solid catalyst material) onto the surface of support materials. |
| US11883805B2 |
Catalytic composition
A catalytic composition for treating a NOx-containing exhaust gas, wherein the composition comprises a copper-substituted small-pore zeolite comprising: i) Ce and/or La in a total amount of about 5 to about 400 g/ft3; and ii) Nd and/or Nb in a total amount of about 5 to about 400 g/ft3. |
| US11883804B2 |
Method of making SSZ-13 zeolites with high acidity and low silica to alumina ratio (SAR)
A method of forming an SSZ-13 zeolite in a hydrothermal synthesis yields an SSZ-13 zeolite that exhibits a silica to alumina (SiO2:Al2O3) molar ratio (SAR) that is less than 16:1; has a morphology that includes one or more of cubic, spheroidal, or rhombic particles with a crystal size that is in the range of about 0.1 micrometer (μm) to 10 μm. This SSZ-13 also exhibits a Brönsted acidity that is in the range of 2.0 mmol/g to 3.4 mmol/g as measured by ammonia temperature programmed desorption. A catalyst formed by substituting a metal into the framework of the zeolite provides for low temperature light-off of the NOx conversion reactions, while maintaining substantial performance at higher temperatures demonstrating hydrothermal stability. |
| US11883802B2 |
Silicon carbide porous body and method for producing the same
A silicon carbide porous body includes: (A) silicon carbide particles as an aggregate; and (B) at least one selected from the group consisting of metallic silicon, alumina, silica, mullite and cordierite. The silicon carbide porous body has amorphous and/or crystalline SiO2 or SiO on a surface(s) of the component (A) and/or the component (B). The silicon carbide porous body contains 6% by mass or less of α-cristobalite in the amorphous and/or crystalline SiO2 or SiO. |
| US11883795B2 |
Ammonia decomposition catalyst and method of decomposing ammonia using the catalyst
Provided are an ammonia decomposition catalyst and a method of decomposing ammonia. The ammonia decomposition catalyst includes an activated carbon carrier and a metal loaded on the carrier, wherein a Brunauer, Emmett and Teller (BET) specific surface area of the carrier is about 850 m2/g or more, and the metal includes cerium (Ce). |
| US11883792B1 |
Process for preparing a polypropylene-based sponge-like porous thin film
Sponge-like porous polypropylene thin film, and a method for preparing a sponge-like porous polypropylene thin film. The method includes dissolving polypropylene in an organic solvent to form a solution under reflux condition; adding a cavity forming agent to the solution and mixing the solution until the cavity forming agent is well-dispersed therein; applying the well-dispersed solution onto the solid substrate through spin coating to form a thin film on the solid substrate; peeling the thin film off the solid substrate; extracting the cavity forming agent from the peeled thin film by washing the peeled thin film in an aqueous or nonaqueous solvent, thereby obtaining a sponge-like porous polypropylene thin film with cavities, macro-voids, and micropores. The sponge-like porous polypropylene thin film is used as an oil sorbent. The sponge-like porous polypropylene thin film has about 400 to about 700 swellable cavities per cm2. |
| US11883790B2 |
Hollow particles, method for producing same, and usage of same
This invention provides hollow particles having a shell containing at least one layer and having an average particle diameter of 10 to 150 nm, wherein a ratio β between absorbance at 908 cm−1 (A908) and absorbance at 1722 cm−1 (A1722) in an infrared absorption spectrum obtained by measuring the hollow particles by ATR-FTIR (absorbance ratio β: A908/A1722) is 0.1 or less. |
| US11883788B2 |
Production system for producing formulations
The present invention relates to a production system for manufacturing of formulations, comprising a unit (1). The unit (1) includes a subunit (1.1) which includes a combination of a process mixer and a buffer tank, means of feeding defined amounts of feedstocks into the process mixer, a measurement unit for ascertaining properties of a part-batch of a formulation manufactured in the process mixer, an evaluation unit for determining a deviation of properties of the part-batches manufactured in the process mixer from the properties of a predefined target state, and a unit for adjusting the feed of feedstocks in view of the deviations. The present invention also relates to a process for manufacturing formulations. |
| US11883784B2 |
Microporous membrane and methods to make same
A method is disclosed for forming a microporous membrane that incorporates an additive having low water solubility at the membrane's active surface from a precipitation fluid. The incorporated additive at the membrane's active surface can improve one or more of the membrane's hydrophilicity, wettability, anti-fouling behavior, blood compatibility, and stability over long periods of use or repetitive use. The microporous membrane with this modified active surface can be a hollow fiber, flat sheet, or other self-supporting shape. The microporous membranes can be used for membrane filtering or a solute and/or solvent exchange process, which involve contacting aqueous-based fluid or blood with the microporous membrane, such processes for dialysis, blood oxygenation, or blood separation filtering, or other processes. |
| US11883772B2 |
Product for metal adsorption
A product for adsorbing one or more heavy metals from a liquid is disclosed. The product may comprise attapulgite that has been surface functionalized with a surface coating agent that includes one or more mercury affinity functional groups that chemically bond to the attapulgite surface, wherein the weight percentage of components of the product includes: 91-99 wt. % attapulgite and 1-9 wt. % surface coating agent that includes the one or more mercury affinity functional groups. The product has a surface area in the range of 115-145 m2/g as measured using the BET method. The heavy metal includes mercury and/or lead. Also disclosed is a method of producing the product and a method of adsorbing at least one heavy metal in a liquid using the product. |
| US11883770B2 |
Porous composite
In a porous composite, a base material has a honeycomb structure whose inside is partitioned into a plurality of cells. In the plurality of cells, a plurality of first cells whose one ends in the longitudinal direction are sealed, and a plurality of second cells whose other ends in the longitudinal direction are sealed are arranged alternately. A collection layer covers inner surfaces of the plurality of first cells. An overall Sa that is an arithmetical mean height Sa indicating a surface roughness of a surface of the collection layer in the plurality of first cells is greater than or equal to 0.1 μm and less than or equal to 12 μm. An overall mean thickness that is a mean thickness of the collection layer in the plurality of first cells is greater than or equal to 10 μm and less than or equal to 40 μm. |
| US11883752B1 |
Mechanical action toy
A mechanical action toy having a first support member and a second support member for supporting first and second beverage containers in spaced apart relation. The first and second support members have elongate piercing members and elongate shield members that are configured to be used by opposing players in a game where the object is to pierce the opponent's beverage container. |
| US11883746B2 |
Adversarial reinforcement learning for procedural content generation and improved generalization
Methods, apparatus and systems are provided for training a first reinforcement-learning (RL) agent and a second RL agent coupled to a computer game environment using RL techniques. The first RL agent iteratively generates a sub-goal sequence in relation to an overall goal within the computer game environment, where the first RL agent generates a new sub-goal for the sub-goal sequence after a second RL agent, interacting with the computer game environment, successfully achieves a current sub-goal in the sub-goal sequence. The second RL agent iteratively interacts with the computer game environment to achieve the current sub-goal in which each iterative interaction includes an attempt by the second RL agent for interacting with the computer game environment to achieve the current sub-goal. The first RL agent is updated using a first reward issued when the second RL agent successfully achieves the current sub-goal. The second RL agent is updated when a second reward is issued by the computer game environment based on the performance of the second RL agent attempting to achieve said current sub-goal. Once validly trained, the first RL agent forms a final first RL agent for automatic procedural content generation (PCG) in the computer game environment and the second RL agent forms a final second RL agent for automatically interacting with a PCG computer game environment. |
| US11883740B2 |
Matching puzzle video game combining special game elements
A method, implemented as computer code being executed by one or more processors, in which computer game graphics for a casual, social game are shown on a display of a computing device, where the casual, social game is downloaded as an app to a smartphone and/or tablet computer and can be accessed or played using a social network application or environment; and in which one or more of the processors are programmed such that: a notification is automatically generated if a player is stuck at a level for more than a defined time or after more than a defined number of attempts to pass that level, the notification alerting friends of the player so that they can assist him or her. |
| US11883739B2 |
Replaceable liquid scent cartridge
A convenient system with replacement hardware is provided for rendering scents within a computing environment. In some implementations, a scent cartridge unit is provided that is replaceable within a scent-rendering hardware unit that is computer-controlled to render one or more scents to be experienced by a user. The scent-rendering hardware unit includes one or more aerosol generators that are adapted to release individual scents. In some implementations, more than one scent may be released at the same time, rendering a complex scent. In some implementations, base scent material may be provided within multiple aerosol generators within an array, and the base scent material may be released in predetermined amounts, durations, and intensities depending on the desired scent. The array may be electronically driven by signals provided by driver circuitry. |
| US11883736B2 |
Device and method of manufacturing for a snow and water sport sliding device with a pneumatic core
A snow and water sport sliding device with a pneumatic core and method of manufacturing the device. The device includes a top layer comprising a front tip, a middle segment with a binding plate, and a back segment with an adjustable air valve. Top layer may also include a blade spring system. The device also includes a main core component layer under the top layer that comprises of a hollow air chamber, and a base layer. Base layer may include embedded metal edge. |