最新美国发明专利第2022-04-12期 - 专利汇|PatentHub专利检索|专利查询网|发明专利查询分析

Document	Document Title
US11299813B2	Method for manufacturing hologram pattern and specimen including metal plating layer having hologram pattern on surface thereof According to a method for manufacturing a hologram pattern of the present invention, the hologram pattern is applied to a metal plating layer (not a metal specimen). Accordingly, materials which can be plated are widely applicable. The hologram pattern, which becomes appeared in various colors depending on light and user's vision, can be formed with a simple process.
US11299812B2	Electrolytic solution generator An electrolytic solution generator includes an electrolyzing unit having a stacked structure in which a conductive film is interpose between a cathode and an anode, the electrolyzing unit electrolyzing a liquid, and a housing in which the electrolyzing unit is placed. A channel is disposed in the housing, and a groove is disposed in the electrolyzing unit, as a groove which is open to the channel and to which at least a part of an interface between the conductive film and the cathode and an interface between the conductive film and the anode is exposed. A space is disposed between at least either an outer periphery of the cathode or an outer periphery of the anode and an inner surface of the housing.
US11299811B2	Continuous flow reactor and hybrid electro-catalyst for high selectivity production of C2H4 from CO2 and water via electrolysis An electrochemical reactor for use with a liquid electrolyte is capable of generating gaseous products. An electrically conducting porous layer that is hydrophilic on the catalyst side and hydrophobic on the gas side are utilized. These different surface properties promote the transport of product gases formed at the catalyst through the porous layer to the gas side. The catalyst is formed from a hybrid Cu2O—CuBr film that has a high selectivity for ethylene gas from reacting CO2 and water in an electrochemical cell.
US11299810B2	Barrier layer for corrosion protection in electrochemical devices The invention is directed to a barrier layer for corrosion protection in electrochemical devices, e.g. carbon based gas diffusion layers (GDLs) in electrochemical devices, comprising electrically conductive ceramic material and a non-ionomeric polymer binder. The electrically conductive ceramic material has an electrical conductivity of >0.1 S/cm, preferably >1 S/cm in air atmosphere (as detected by the powder method) and is selected from the group of precious metal and/or base metal containing oxides, carbides, nitrides, borides and mixtures and combinations thereof. Membrane-electrode assemblies (MEAs), catalyst-coated membranes (CCMs), gas diffusion electrodes (GDEs) and gas diffusion layers (GDLs) comprising the barrier layer of the invention show improved corrosion resistance, preferably against carbon corrosion; particularly in start-up/shut-down cycles and fuel starvation situations of PEM fuel cells.
US11299805B2	Plasma corrision resistive heater for high temperature processing Implementations described herein protect a substrate support from corrosive cleaning gases used at high temperatures. In one embodiment, a substrate support has a shaft having an outer wall. The substrate support has a heater. The heater has a body having a top surface, a side surface and a bottom surface extending from the outer wall of the shaft. The top surface is configured to support a substrate during plasma processing of the substrate. A covering is provided for at least two of the top surface, side surface and bottom surface. The covering is selected to resist corrosion of the body at temperatures in excess of about 400 degrees Celsius. A sleeve circumscribing the shaft, the sleeve and the outer wall of the shaft forming a space therebetween, the space adapted to flow a purge gas therethrough in a direction toward the body.
US11299804B2	Method of manufacturing semiconductor device, non-transitory computer-readable recording medium and substrate processing apparatus Described herein is a technique capable of suppressing deposits. According to one aspect of the technique, there is provided a method including: (a) supplying a source gas into a process chamber through a source gas nozzle while heating the process chamber; and (b) supplying a reactive gas into the process chamber, wherein (a) and (b) are alternately performed one by one to form a film on the plurality of the substrates while satisfying conditions including: (i) a supply time of the source gas in (a) in each cycle is 20 seconds or less; (ii) a pressure of the source gas in the source gas nozzle in (a) is 50 Pa or less; (iii) an inner temperature of the process chamber in (a) is 500° C. or less; and (iv) number of cycles performed continuously to form the film on the plurality of the substrates is 100 cycles or less.
US11299803B2	Metallic coating process for combustor panels using a barrel configuration A method of coating a component includes attaching the component to a support that is configured to hold a plurality of components and placing a base of the support in a holder that is attached to rotatable member of a fixture, wherein an axis of the holder is parallel to an axis of rotation of the rotatable member. The method also includes transporting the fixture into a coating chamber wherein a direction of an exit stream of a coater in oriented perpendicularly to the axis of rotation, exposing the fixture and the component to a reverse transfer arc cleaning/pre-heating procedure, and exposing the fixture and the component to a coating procedure during which a coating is directed at the component in a direction perpendicular to the axis of rotation while the rotatable member is rotating. The method further includes transporting the fixture and removing the component from the support fixture.
US11299802B2	Germanium tetraflouride and hydrogen mixtures for an ion implantation system The current disclosure is directed to methods and assemblies configured to deliver a mixture of germanium tetrafluoride (GeF4) and hydrogen (H2) gases to an ion implantation apparatus, so H2 is present in an amount in the range of 25%-67% (volume) of the gas mixture, or the GeF4 and H2 are present in a volume ratio (GeF4:H2) in the range of 3:1 to 33:67. The use of the H2 gas in an amount in mixture or relative to the GeF4 gas prevents the volatilization of cathode material, thereby improving performance and lifetime of the ion implantation apparatus. Gas mixtures according to the disclosure also result in a significant Ge+ current gain and W+ peak reduction during an ion implantation procedure.
US11299799B2	Austenitic stainless steel product having excellent surface properties and manufacturing method of the same An austenitic stainless steel product having excellent surface characteristics and a manufacturing method therefor are disclosed. The disclosed austenitic stainless steel product comprises an austenitic stainless steel comprising, by weight percent, 0.005 to 0.15% of C, 0.1 to 1.0% of Si, 0.1 to 2.0% of Mn, 6.0 to 8.0% of Ni, 16 to 18% of Cr, 0.1 to 4.0% of Cu, 0.005 to 0.2% of N, 0.01 to 0.2% of Mo, and the remainder comprising iron (Fe) and other unavoidable impurities, and a Ni surface negative segregation thereof defined by the following formula (1) is 0.6 to 0.9 and the martensite fraction thereof is 10 to 30%. (CNi-Min)/(CNi-Ave) formula (1) Here, CNi-min is the minimum concentration of Ni on the surface and CNi-Ave is the average concentration of Ni on the surface.
US11299797B2	Copper-containing, high-toughness and rapidly degradable magnesium alloy, preparation method therefor and use thereof Provided are a copper-containing, high-toughness and rapidly degradable magnesium alloy, a preparation method therefor and the use thereof, wherein same relate to the field of materials for oil and gas exploitation. When the magnesium alloy is in an as-cast state, an extrusion state or an aging state, a strengthening phase thereof mainly includes an Mg12CuRE-type long-period phase and an Mg5RE phase and an Mg2Cu phase, the Mg12CuRE-type long-period phase has a volume fraction of 3-60%, the Mg5RE phase has a volume fraction of 0.5-20%, and the Mg2Cu phase has a volume fraction of 0.5-15%, wherein RE is a rare-earth metal element.
US11299795B2	Lead-free patenting process and equipment The controlled cooling of previously heated and substantially straight steel wires of diameter more than 3.5 mm to a predetermined temperature including the steps: guiding the wires along individual paths through first coolant bath having bath liquid of water and a stabilizing additive, the bath liquid and the wires create a steam film around each wire along individual paths; directing an impinging liquid immersed inside first coolant bath towards the wires over a length along individual paths to cool down the wires, the impinging liquid decreases the thickness of the steam film or destabilizes the steam film, increasing speed of cooling over the length along individual paths; guiding the wires along individual paths out of the first coolant bath to be cooled down in air; after the further cooling, guiding the wires along individual paths through second coolant bath.
US11299790B2	Compositions and methods for identifying secretory antibody-bound microbes The invention relates to the identification of secretory antibody-bound bacteria in the microbiota in a subject that influence the development and progression of inflammatory diseases and disorders. Thus, the invention relates to compositions and methods for detecting and identifying the constituents of a subject's microbiota, methods of modifying the constituents of the microbiota, and methods for treating inflammatory diseases and disorders in a subject in need thereof.
US11299788B2	Method for the quantification of Faecalibacterium prausnitzii phylogroup I and/or phylogroup II members and the use thereof as biomarkers The present invention relates to a novel method for an accurate quantification in intestinal samples of Faecalibacterium prausnitzii phylogroup I members (PHGI) and/or Faecalibacterium prausnitzii phylogroup II members (PHGII). It further relates to a method for detecting intestinal diseases, including the screening, diagnosis, differential diagnosis, and/or monitoring of disease activity or progression in a human subject comprising determining the abundance of PHGI and/or PHGII in an intestinal sample from said subject. Moreover, it relates to a method for the prediction of the efficacy of a drug in the therapeutic treatment of an intestinal disease in a human subject comprising determining the abundance of PHGI and/or PHGII in an intestinal sample from said subject.
US11299786B2	Gene panel to predict response to androgen deprivation in prostate cancer Methods for predicting the response of prostate cancer to androgen deprivation therapy (ADT) using a gene signature of five genes (CSPG5, FKBP6, FOSB, STMN1, and TTC27) is provided. Also provided are sets containing specific binding molecules for each of CSPG5, FKBP6, FOSB, STMN1, and TTC27 and kits containing such sets.
US11299784B2	Biomarkers for predicting degree of weight loss The present invention relates to a method for predicting the degree of weight loss attainable by applying one or more dietary interventions to a subject and/or the degree of maintenance of weight loss following one or more dietary interventions; which method comprises determining the level of microRNA-486 (miR-486) in one or more samples obtained from the subject; and/or determining the nucleotide of the subject at one or more polymorphic positions genetically linked to miR-486.
US11299780B2	Methods of producing nucleic acid libraries Provided are methods of producing nucleic acid libraries. In certain aspects, the methods include combining target nucleic acids (e.g., 5′ phosphorylated nucleic acids) and an oligonucleotide pool. Oligonucleotides of the oligonucleotide pool may include complementarity regions of varying length and nucleotide sequence, and a complementarity region identification sequence. In such aspects, the combining is under conditions in which oligonucleotides of the oligonucleotide pool hybridize to nucleic acids of the target nucleic acids (e.g., 5′ phosphorylated nucleic acids) having overhang regions that are complementary in sequence and have corresponding lengths with respect to the complementarity regions of the oligonucleotides. Compositions and kits that find use, e.g., in practicing the methods of the present disclosure are also provided.
US11299779B2	Nucleic acid modification and identification method A method of identifying a polynucleic acid (PNA) is presented, including the steps of providing a PNA; modifying one or more nucleobases of the PNA by addition or removal of a hydrogen bonding partner, thereby altering the base pairing capacity of the one or more nucleobases; base pairing a complementary nucleic acid to the PNA, including base pairing to at least one modified nucleobase; identifying the sequence of the complementary nucleic acid at least at the position that is complementary to at least one modified nucleobase.
US11299777B2	Isothermal amplification components and processes The technology relates in part to methods and compositions for isothermal amplification of nucleic acids.
US11299775B2	Method for designing primer, primer, primer set, DNA amplification method, and analysis method A method for designing a primer supplied to a PCR reaction includes a primer designing step of defining a 5′-end-side base sequence of the primer so as to include a base sequence or its complementary base sequence, the base sequence enabling identification of, among thermal cycles in the PCR reaction, a synthesis cycle of a DNA molecule in an amplification product obtained by the PCR reaction performed with the primer, the identification being based on base-sequence data obtained by sequencing the amplification product.
US11299774B2	Spatially distinguished, multiplex nucleic acid analysis of biological specimens A method for spatially tagging nucleic acids of a biological specimen, including steps of (a) providing a solid support comprising different nucleic acid probes that are randomly located on the solid support, wherein the different nucleic acid probes each includes a barcode sequence that differs from the barcode sequence of other randomly located probes on the solid support; (b) performing a nucleic acid detection reaction on the solid support to locate the barcode sequences on the solid support; (c) contacting a biological specimen with the solid support that has the randomly located probes; (d) hybridizing the randomly located probes to target nucleic acids from portions of the biological specimen; and (e) modifying the randomly located probes that are hybridized to the target nucleic acids, thereby producing modified probes that include the barcode sequences and a target specific modification, thereby spatially tagging the nucleic acids of the biological specimen.
US11299769B2	Target reporter constructs and uses thereof Provided herein are methods and compositions for the detection of target nucleic acids using target reporter constructs (TRCs) which comprise target sequences complementary to the target nucleic acid. Further provided are methods of replicating the TRCs using rolling circle replication and/or rolling circle amplification to produce replicated TRCs which can be detected using probe sequences within the replicated TRCs.
US11299767B2	Method for generating a three-dimensional nucleic acid containing matrix Methods of making a three-dimensional matrix of nucleic acids within a cell is provided.
US11299765B2	Methods and compositions for preparing sequencing libraries Embodiments provided herein relate to methods and compositions for next generation sequencing. Some embodiments include the preparation of a template library from a target nucleic acid in contact with a surface, and sequencing the library on the surface.
US11299760B2	Use of monensin to regulate glycosylation of recombinant proteins Methods of modulating the properties of a cell culture expressing a protein of interest are provided. In various embodiments the methods relate to the addition of cell-cycle inhibitors to growing cell cultures.
US11299752B2	Bio-production of lentiviral vectors The present disclosure provides a method of generating a stable producer cell line. The generation of stable producer cell lines, such as those provided in accordance with the present invention, increases the reproducibility and ease of creating high titer lentiviral stocks while easing biosafety concerns and the variation in expressed envelope proteins defines the tropism of the generated virus. The present disclosure also provides for a novel lentiviral transfer vector plasmid.
US11299750B2	Cultured transgenic cell allowing growth of norovirus, and use thereof An object of the present invention is to solve problems in terms of stagnation of research on norovirus by providing a cultured transgenic cell or a transgenic animal in which murine norovirus (MNV) can be grown across the barrier of host specificity in mammalian cells, and providing a screening method that uses the cultured transgenic cell or the transgenic animal. The present inventors have found that MNV infection is determined in a cultured transgenic mammalian cell or a mammal possessing the cultured transgenic mammalian cell as its own cell, the cultured transgenic mammalian cell containing one or more species selected from the entirety or a portion of the murine CD300F gene and/or a CD300 family gene having an extracellular domain nucleotide sequence similar to that of the murine CD300F gene. The present inventors have solved the aforementioned problems by providing, for example, a norovirus-related drug screening method on the basis of this finding.
US11299738B2	Further novel oligonucleotide-ligand conjugates The present invention relates to a compound comprising a modified saccharide moiety conjugated to a nucleic acid. The compound is useful in medicine for RNA interference therapy or for research and diagnostic purposes. In particular, the compound is useful in treating liver disease.
US11299736B1	Conjugated antisense compounds and their use Provided herein are oligomeric compounds with conjugate groups. In certain embodiments, the oligomeric compounds are conjugated to N-Acetylgalactosamine.
US11299735B2	Compositions and methods for detecting and treating insulin resistance A miR-1983 inhibitor comprising an anti-miR-1983 oligonucleotide that is complementary to at least part of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1), the part comprising at least nucleotides 2 to 8 of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1).
US11299731B1	CRISPR editing to embed nucleic acid landing pads into genomes of live cells The present disclosure relates to compositions, methods, modules and automated integrated instrumentation for multiplex delivery of “landing pad” edits into the genomes of a population of live cells. The landing pads then may be leveraged to insert very large DNA sequences into the genomes of the population of live cells.
US11299728B2	Sample extraction and preparation device A fluid sample extraction device is disclosed comprising a housing defining an internal fluid passage having a distal open end and a proximal open end and a porous medium within the fluid passage, between the distal open end and proximal open end. The porous medium, which may be glass, is configured to allow fluid flow in the fluid passage to flow around the porous medium, toward the proximal open end of the housing, when fluid is drawn from the distal open end toward the proximal open end, and to allow fluid in the fluid passage to flow toward the distal open end of the housing, through the porous medium when the fluid is forced toward the distal open end. The porous medium is also configured to capture nucleic acids in the porous medium from the fluid when fluid is forced through the porous medium. Devices and kits are also disclosed.
US11299726B2	Methods for DNA and RNA extraction from fixed paraffin-embedded tissue samples Methods and reagents are provided for the rapid extraction of nucleic acids from a fixed paraffin embedded sample (e.g., a FFPET sample). In some embodiments, the methods comprise incubating one or more sections of said tissue sample in a lysis solution comprising a buffer sufficient to maintain the pH of said solution at a pH ranging from about pH 4 to about pH 9; a chaotropic agent; a chelating agent; and a detergent; where the incubating is at a temperature ranging from about 50° C. to about 100° C.; and recovering the nucleic acid from said lysis solution.
US11299722B2	Modified lipase and use thereof The present invention has an object of providing a modified lipase having excellent stability and reactivity at a high temperature. Provided is a modified lipase with improved reactivity and/or stability at a high temperature, the modified lipase having an amino acid sequence including one or more amino acid substitutions which are selected from the group consisting of T130C-S153C, A249P, F259Y, S282P, S283Y and S300P in the amino acid sequence represented by SEQ ID NO: 1, or an amino acid sequence having 90% or more sequence identity therewith.
US11299716B2	Aldehyde dehydrogenase variants and methods of use The invention provides polypeptides and encoding nucleic acids of aldehyde dehydrogenase variants. The invention also provides cells expressing aldehyde dehydrogenase variants. The invention further provides methods for producing 3-hydroxybutyraldehyde (3-HBal) and/or 1,3-butanediol (1,3-BDO), or an ester or amide thereof, comprising culturing cells expressing an aldehyde dehydrogenase variant or using lysates of such cells. The invention additional provides methods for producing 4-hydroxybutyraldehyde (4-HBal) and/or 1,4-butanediol (1,4-BDO), or an ester or amide thereof, comprising culturing cells expressing an aldehyde dehydrogenase variant or using lysates of such cells.
US11299714B2	Engineered adult-like human heart tissue A cardiac organoid containing 3-D matter of adult human heart tissue.
US11299709B2	Pluripotent stem cell and T cell differentiated therefrom and application thereof The present invention provides a pluripotent stem cell comprising a co-expression vector in which Runx1 and Hoxa9 are of in tandem, and a T cell differentiated therefrom and application thereof. In the present invention, Pluripotent stem cells inducibly co-expressing exogenous Runx1 and Hoxa9 are successfully established by introducing an exogenous vector co-expressing Runx1 and Hoxa9 into pluripotent stem cells. The pluripotent stem cells are directionally differentiated into T-lineage progenitor cells and will be developed into T cells. The pluripotent stem cell-derived T cells obtained by the method of the present invention are not only functionally normal but also have no tumorigenic risk.
US11299702B2	Portable disposable re-usable culture device for rapid diagnosis of infectious agents The present invention is directed to compositions, tools, methods and devices to culture microorganisms and, in particular, to compositions, tools, methods and devices for the detection of microorganisms in biological samples.
US11299695B2	Beer making machine with direct steam injection A beer making system may use direct steam injection during wort manufacturing. Steam may be added directly to the wort, and may be part of a recirculating mash system. The steam may be the primary mechanism for adding heat to the system, and may eliminate many problems that often occur when using conventional heating systems. A water reservoir may feed a stream generator, which may inject steam into wort during mashing or boiling steps. A controller may monitor temperature and other parameters, and may calculate the dilution of wort based on the water added through the steam injection and allow a brewing system to compensate for said dilution and still produce desired results.
US11299687B2	Guiding member in the form of a metal ring for assembly with friction and with the articulating and/or sliding capability of a shaft The bore of the ring has workings (1a) suitable to act as a grease reserve at the friction area. A self-lubricating coating (3) with low wettability is applied to the entire surface of the said bore, including in the workings (1a) suitable to act as a grease reserve, such that after wearing of the layer of self-lubricating coating at the friction surface of the bore, the difference in wettability between the said friction surface and the workings still having the coating, enables the grease to be drawn out of the said workings in order to lubricate the said friction surface.
US11299685B2	Fuel and engine oil composition and its use A composition is provided that contains a major amount of a base oil and a minor amount of at least one butylene oxide-modified alkyl-bis-ethoxylated monoamine, wherein the alkyl group have carbon atoms in the range of 8 to 22 and ethylene oxide to butylenes oxide is in a ratio in the range of about 3:1 to about 2:1. The composition provides improved friction modification in fuel and in lubricating oils.
US11299684B2	High naphthenic content marine fuel compositions Marine diesel fuel/fuel blending component compositions and fuel oil/fuel blending component compositions are provided that are derived from crude oils having high naphthenes to aromatics volume and/or weight ratios and a low sulfur content. In addition to having a high naphthenes to aromatics ratio, a low sulfur content, and a low but substantial content of aromatics, such fuels and/or fuel blending components can have a reduced or minimized carbon intensity relative to fuels derived from conventional sources. The unexpected ratio of naphthenes to aromatics contributes to the fuels and/or fuel blending components further having additional unexpected properties, including low density, low kinematic viscosity, and/or high energy density.
US11299682B2	Systems and methods for crude oil desalting and dehydration in a single vessel A system for crude oil desalting and dehydration in a single vessel is disclosed. The system comprises a pressure vessel defining a cavity and comprising a sealed bulkhead separating the cavity into a first compartment and a second compartment. Disposed within the first compartment is a first distributor disposed within the first compartment, a first electrical grid assembly, and a transfer conduit that passes through the bulkhead from the first compartment to the second compartment, the second compartment being in fluid communication with the first compartment via the transfer conduit. The pressure vessel may further comprise an overflow weir in the first compartment and a second electrical grid assembly disposed within the second compartment and aligned substantially transverse to a flow path extending from the transfer conduit to the crude collection header.
US11299681B2	Process for reducing the amount of carbon disulphide (CS2) in a hydrocarbon feed The present disclosure relates to a process for reducing the amount of carbon disulphide (CS2) in a hydrocarbon feed containing C5-C8 fractions. The hydrocarbon feed is treated with an amine functionalized anion exchange resin (basic anion exchange resin) to obtain a mixture comprising a liquid fraction containing treated hydrocarbon and a solid mass containing an adduct of CS2 and the amine functionalized anion exchange resin. The so obtained liquid fraction containing the treated hydrocarbon is separated from the solid mass to obtain the hydrocarbon having CS2 content less than 2 ppm. The amine functionalized anion exchange resin can be regenerated from the solid mass.
US11299675B2	Polymerizable polar compound, liquid crystal composition and liquid crystal display device A polar compound having high chemical stability, high capability of aligning liquid crystal molecules, high solubility in a liquid crystal composition, and a large voltage holding ratio when the compound is used in a liquid crystal display device; and a composition containing the compound. The compound is represented by formula (1). In formula (1), for example, P1 is a group represented by any one of formulas (1b) to (1i), P2 is a group represented by formula (1d), Sp1 and Sp2 are a single bond, Z1, Z2, Z3, Z4 and Z5 are —COO—, and ring A1, ring A2, ring A3 and ring A4 are 1,4-phenylene:
US11299674B2	Liquid crystal composition and display device thereof The present invention provides a liquid crystal composition comprising: at least one compound of general Formula I; at least one compound of general Formula II; at least one compound of general Formula M and at least one compound of general Formula N. The present invention also provides a liquid crystal display device comprising the liquid crystal composition. The liquid crystal composition provided in the present invention has a higher optical anisotropy, a higher clearing point, a higher dielectric anisotropy, a high transmittance and a larger average elastic constant. When the liquid crystal composition is used in the IPS liquid crystal display device, the transmittance of the display device can be effectively improved, so that the display device has a good display performance while also having good energy-saving and environment-friendly characteristics.
US11299668B2	Methods and compositions for acidizing and stabilizing formation of fracture faces in the same treatment An acidizing and formation stabilizing treatment fluid for stabilizing a fracture in a subterranean formation. An acid generating agent generates an acid in situ to acidize the formation thereby enhancing the fractures within and to cure an acid-catalyzed, curable resin to stabilize the formation.
US11299666B2	Surfactant composition for the reinjection of produced water The invention relates to the use of a non-ionic surfactant and an anionic surfactant for enhancing the injectivity of an injection well, wherein the non-ionic surfactant and the anionic surfactant are added to produced water, to form a reinjection stream which is injected into a subterranean formation by the injection well.
US11299661B2	Water-based drilling fluids that include lubricants One or more embodiments presently described are directed to drilling fluid compositions that include lubricants, methods for making drilling fluids, and methods for drilling subterranean wells utilizing the drilling fluids. According to one embodiment, a drilling fluid composition may include a base fluid including water, a weighting agent in an amount of from 0.1 weight percent (wt. %) to 75 wt. % relative to the total weight of the water-based drilling fluid, and a lubricant in an amount of from 1 wt. % to 10 wt. % relative to the total weight of the water-based drilling fluid. The lubricant may include one or more alkyl esters and a fatty acid blend including at least palmitic acid and stearic acid. The sum of the weight percent of the palmitic acid and stearic acid may be at least 50 wt. % of the fatty acid blend.
US11299658B2	Condensation-curable polyethersilicone tile adhesives Tiles are adhesively bonded to substrates such as kitchen or bathroom walls by a process in which a tile adhesive is used, the tile adhesive being a one component RTV-1 moisture-curable tile adhesives having properties superior to conventional cementitious and RTU tile adhesives, which contain at least one low viscosity alkoxysilyl-functional polymer, a silicone resin, an aminoalkyl-functional alkoxysilane or partial hydrolysate thereof, and in excess of 60 weight percent mineral filler, of which at least 50 weight percent is a non-reinforcing filler.
US11299653B2	Composition, adhesive film, laminate, method for producing cured product pattern, and method for manufacturing circuit substrate There are provided a composition having excellent adhesiveness and wettability, an adhesive film, a laminate, a method for producing a cured product pattern, and a method for manufacturing a circuit substrate. A composition for forming an adhesive film for imprinting, includes a compound 1 or a compound group 2; and a solvent, in which the compound 1 and the like is a compound decomposable into two or more compounds in a case where a polarity conversion group is treated, and at least one compound has a molecular weight of 30 to 400, and at least one compound has a molecular weight of 1,000 or more, the compound 1: a compound is a resin having a polymerizable group and a polarity conversion group, in which the resin has the polarity conversion group in at least a main chain or a side chain, the polarity conversion group is bonded to the main chain of the resin via a linking group in a case where the polarity conversion group is provided in the side chain, and the number of atoms constituting a chain of the linking group is 8 or more; and the compound group 2: a compound that has a polymerizable group and does not have a polarity conversion group, and a compound that does not have a polymerizable group and has a polarity conversion group.
US11299650B2	Silicone based self-adhering article and a method for making same An article includes a non-tacky cured silicone first layer, an optional foamed material and a tacky cured silicone second layer wherein the first layer is directly bound to the second layer and the article is conformable to a body part. The article removably adheres to a body part. Also described is a method of making the article.
US11299648B2	Polymer, coating composition comprising same, and organic light emitting diode using same The present specification relates to a polymer comprising: a first unit represented by Formula 1; and a second unit represented by Formula 2, a coating composition comprising the same, and an organic light emitting device formed by using the same.
US11299642B2	Systems and methods of additive printing of functional electronic circuits A composition, method, and system for directly printing and creating complete functional 3D electronic circuits and devices without any thermal or laser post-processing treatment, by using at least Triphenylamine (TPA) as a powder binding agent. The composition can have mechanical characteristics that allow it to be melted and extruded on a structure, and electrical properties that allow it to function as at least one of a conductor, insulator, resistor, p-type semiconductor, n-type semiconductor, or capacitor.
US11299641B2	Curable liquid composition, composition-accommodating container, liquid composition discharging device, cured material, and method of manufacturing cured material A curable liquid composition includes a monomer having an SI value of less than 3.0 and a photopolymerization initiator having a weight average molecular weight of 500 or greater, wherein the curable liquid composition is negative in skin sensitization.
US11299635B2	Bis-Azo colorants for use as bluing agents This invention relates to bis-azo colorants for use as bluing agents, laundry care compositions comprising bis-azo colorants that may serve as bluing agents, processes for making such bluing agents and laundry care compositions and methods of using the same. The bluing agents are generally comprised of at least two components: at least one chromophore component and at least one polymeric component. These bluing agents are advantageous in providing a whitening effect to fabrics, while not building up over time and causing undesirable blue discoloration to the treated fabrics.
US11299633B2	Leucoindigo salt solution with very low content of aniline and method of making same Stable aqueous leucoindigo solution comprising an aromatic amine in the form of aniline or aniline and N-methylaniline, wherein said leucoindigo is in the form of an alkali metal salt;wherein the concentration of the aromatic amine is below 40 ppm determined according to ISO 14362-1:2017(E); andwherein the concentration of the leucoindigo salt is in a concentration range of from 10 to 45% by weight based on the total weight of the solution, and wherein the stability of the solution is measured at a temperature of 23° C.; orwherein the concentration of the leucoindigo salt is in a concentration range of from 45 to 65% by weight based on the total weight of the solution, and wherein the stability of the solution is measured at a temperature of 60° C.
US11299631B2	Asphalt composition for road paving The present invention relates to an asphalt composition for road pavement, which is excellent in drying strength, strength after immersion in water, and strength after immersion in petroleum, a method for producing the same, and a road paving method.[1] An asphalt composition for road pavement, containing asphalt, a polyester resin, and an aggregate, wherein the polyester resin is one subjected to melt-kneading and a ratio of the polyester resin is 5 parts by mass or more and 50 parts by mass or less based on 100 parts by mass of the asphalt; [2] a method for producing an asphalt composition for road pavement, including a step of mixing asphalt, a polyester resin, and an aggregate at 130° C. or higher and 200° C. or lower, wherein the polyester resin used in the mixing step is one subjected to melt-kneading, and a ratio of the polyester resin is 5 parts by mass or more and 50 parts by mass or less based on 100 parts by mass of the asphalt; and [3] a road paving method including a step of laying an asphalt composition obtained by the method of [2], thereby forming an asphalt paving material layer.
US11299630B2	Templated assembly of collagen fibers and uses thereof The present invention relates to a biomaterial fabrication process for the manufacture of a collagen based fabric for an aligned collagen fiber network.
US11299628B2	Organopolysiloxane composition Provided is an organopolysiloxane composition, comprising: (A) an organopolysiloxane having at least two silicon atom-bonded alkenyl groups in each molecule, (B) an organohydrogenpolysiloxane having at least two silicon atom-bonded hydrogen atoms in each molecule, (C) a platinum catalyst, and (D) a specific isocyanide compound.
US11299619B2	Composite structure having an inorganic coating adhered thereto and method of making same The present disclosure provides a composite structure and associated method for preparing a composite substrate comprising an inorganic coating that is adhered to an organic-based substrate via an adhesion promoting agent comprising a molecule having a urea moiety at one end of the molecule and an alkoxysilane moiety at the other end of the molecule. The use of adhesion promoting agent having at least one of an amine or imine moiety and an alkoxysilane moiety promotes tight adhesion of the inorganic coating to the substrate.
US11299618B2	Polyacetal resin composition and article molded therefrom The present invention provides a polyacetal resin composition comprising (A) a polyacetal resin and (B) zinc oxide, wherein the content of oxyalkylene constituent units other than an oxymethylene group in the polyacetal resin (A) is 0.1% by mass or more, and wherein the total surface area of the zinc oxide (B) in the polyacetal resin composition is 0.1 to 40 m2 per 100 g of the polyacetal resin (A); as well as an article molded therefrom.
US11299613B2	Ethylene-alpha-olefin copolymer-triallyl phosphate composition A peroxide-curable ethylene copolymer composition comprising (A) a crosslinkable ethylene/alpha-olefin copolymer, (B) an effective amount of triallyl phosphate (TAP), (C) an organic peroxide; and, optionally, (D) a supplemental polymer; wherein the (A) crosslinkable ethylene/alpha-olefin copolymer is made by copolymerizing ethylene and an olefin-functional comonomer in the presence of a molecular catalyst useful therefor. Also provided are a cured product made from the composition, methods of making and using same, and articles containing same.
US11299608B2	Thermoplastic resin composition, method for producing same and molded body Disclosed is a thermoplastic resin composition designed to, even when containing a filler, reduce a trade-off between stiffness and impact resistance to achieve a balance between impact resistance and stiffness, a method for producing the same, and a molded body. The thermoplastic resin composition is obtained by blending a polyolefin resin, a polyamide resin containing an inorganic filler, and a modified elastomer having a reactive group that reacts with the polyamide resin, wherein the polyolefin resin has a number-average molecular weight of 350,000 or more, and the polyamide resin has a structure in which a hydrocarbon group interposed between adjacent amide bonds in a main chain has 5 or less straight chain carbon atoms. The molded body is composed of the thermoplastic resin composition. The method for producing the thermoplastic resin composition includes melt-kneading a polyolefin resin and a melt-kneaded product of a polyamide resin and a modified elastomer.
US11299604B2	Rubber mixture and tire made by the same The present disclosure provides a rubber mixture and a tire made the same. The rubber mixture consists essentially of: at least one kind of polar or non-polar rubber, at least one kind of filler, at least one kind of vulcanizing agent, at least one kind of accelerant, an optional anti-scorching agent, and an optional aromatic material. The accelerant is a compound containing two or more X-Y single bonds, wherein X is selected from element O and S, and Y is selected from element N and P. The rubber mixture and the tires of the present disclosure adopt improved accelerants and anti-scorching agents to reduce the generation of pungent volatile organic compound such as aniline, cyclohexylamine, tert-butylamine, and imine, thereby improving the odor problem of the tire. Meanwhile, the present disclosure omits carbon black, zinc oxide and other substances with fine powders, thereby reducing dust hazards to the operators.
US11299601B2	UV-photocured resin layer and image display device using the same A UV-photocured resin layer (and an image display device including the UV-photocured resin layer), the UV-photocured resin layer including the following cured components: an acrylate-based oligomer component selected from the group consisting of a polyisoprene-based (meth)acrylate oligomer, a polybutadiene-based (meth)acrylate oligomer, and a polyurethane-based (meth)acrylate oligomer; an acrylic-based monomer component; a plasticizer component; and a photoradical polymerization initiator component.
US11299595B2	Heat-shrinkable polyester film and package Provided is a heat-shrinkable polyester film which has heat shrinkage properties in a main shrinkage direction in the longitudinal direction, a small variation in shrinkage in the width direction, and less likely generated wrinkles and strains at the time of shrinkage finishing. The polyester film is prepared from a polyester raw material resin comprising 50 mol % or more of an ethylene terephthalate unit in 100 mol % of constituent units of a polyester, diol components selected from aliphatic, alicyclic, and aromatic diols, and an amorphous monomer component that is 2% or more in 100 mol % of either a polyhydric alcohol component or a polybasic carboxylic acid component in the whole polyester resin, wherein the polyester does not contain polybasic carboxylic acids of tribasic or more, and the polyester film is obtained by uniaxial drawing in the longitudinal direction.
US11299594B2	Carbinol-functional silicone resin, and method for producing silicone-modified polyester Provided herein is a carbinol-functional silicone resin. The carbinol-functional silicone resin is prepared by reacting a raw silicone resin having at least 1 mass % of silicon atom-bonded hydroxyl groups, silicon atom-bonded alkoxy groups, or a combination thereof, and a dihydroxy-functional compound, in the presence of a condensation catalyst and a solvent. The carbinol-functional silicone resin can produce a solid silicone-modified polyester without gelation of the silicone resin.
US11299591B2	Polyethyleneimine compounds containing N-halamine and derivatives thereof This invention relates to odor control molecules comprised of polyethyleneimine compounds containing N-halamine and derivatives thereof.
US11299587B2	Starting material, for bulk drug or additives for drug, and bulk drug or drug using same The present invention provides a raw material for bulk drugs and a pharmaceutical additive which provide excellent formulation stability and excellent over-time stability of drug efficacy when used to modify a bulk drug, a polypeptide, a bioactive protein, an enzyme, and the like. The present invention relates to a raw material for bulk drugs or a pharmaceutical additive, containing: a polyether composition (A) represented by formula (1), wherein the polyether composition (A) has a unimodal molecular weight distribution, the polyether composition (A) has a ratio (Mw/Mn) of the weight average molecular weight (Mw) to the number average molecular weight (Mn) of 1.20 or less, and the polyether composition (A) contains a compound in which m is 1 in formula (1) in an amount of 90 wt % or more based on the weight of the polyether composition (A), in formula (1), OR1, R2O, R3O, and R4O are each independently a C2-C8 oxyalkylene group; when each of these moieties exists in the plural number, each OR1, each R2O, each R3O, and each R4O may be the same as or different from each other; these moieties may be bonded randomly or in block; a, b, c, and d are each independently an integer of 50 to 1200; X1 to X4 are each independently a hydrogen atom, a substituent represented by formula (2), or a substituent represented by formula (3); and m is an integer of 1 to 10.
US11299586B2	Fluorinated ether polymer, the preparation method therefore and use thereof The embodiments herein relate to a fluorinated ether polymer which is capable of forming coatings with stain resistance, anti-fingerprint and anti-scratching properties. The polymer may be cured with multiple measures, therefore it has a variety of applications in coating and ink industry. The fluorinated ether polymers of the embodiments herein may be added into coating formulations to decrease the surface energy of resulting coatings. It is also feasible that the fluorinated ether polymers of the embodiments herein are used as the main resin component in coating formulations. The embodiments herein also relates to a method for manufacturing the polyester resin, and the use of the polyester resin in industries.
US11299585B2	Oligocarbonate polyols obtained from dianhydrohexitol dialkylcarbonate or a dimer of dianhydrohexitol carbonate, method for the production thereof and uses thereof Provided is a method for producing an oligocarbonate polyol devoid of aromatic groups and phenolic functions, comprising a step of polycondensation by transesterification of monomers (A1) and/or dimers (A2) and of diol monomers (B1) and/or of triol monomers (B2), in a particular molar ratio, in order to obtain an oligocarbonate polyol having a molar mass of less than 5000 g/mol and at least two hydroxyl-type chain ends, the monomer (A1) corresponding to the following formula: (A1) and the dimer (A2) corresponding to the following formula: (A2) as well as the oligocarbonate polyol that can be obtained by this method and the polycarbonate that can be obtained by reacting this oligocarbonate with a polyisocyanate.
US11299582B2	Breathable elastomeric composites with tether-containing conducting polymers for nanoscale diffusion control and protection An interpenetrating network (IPN) polymer membrane material includes a soft polyurethane interspersed with a crosslinked conducting polymer. The material can be reversibly “switched” between its oxidized and reduced states by the application of a small voltage, ˜1 to 4 volts, thus modulating its diffusivity.
US11299578B2	Self-restoring polyurethane-based polymer and preparation method therefor A self-restoring polyurethane-based polymer obtained by polymerization of a composition containing an aromatic disulfide diol represented by Chemical Formula, HO—Ar1—S—S—Ar2—OH, an alicyclic polyisocyanate, and a polyol. Ar1 and Ar2 each are independently a substituted or unsubstituted C6-C30 arylene group. The composition satisfies Equation, 0.1≤M[disulfide]/M[OH]. M[disulfide] is a total mole number of the aromatic disulfide diol in the composition, and M[OH] is a total mole number of the aromatic disulfide diol and the polyol in the composition.
US11299574B2	Latex polymer for improved paint washability The present invention is directed to a coating composition or paint comprising a polymer system including one or more latex polymers, wherein the acid content and molecular weight of the latex polymers are balanced to provide a coating composition that demonstrates optimal performance characteristics of washability or stain resistance, especially when used in a flat finish paint.
US11299573B2	Stable mass polymerizable polycycloolefin compositions as 3D printing materials and a method of fabrication thereof Embodiments in accordance with the present invention encompass compositions encompassing a latent organo-ruthenium compound, a pyridine compound, a photosensitizer and an ultra violet light blocking compound along with one or more monomers which undergo ring open metathesis polymerization (ROMP) when said composition is exposed to suitable actinic radiation to form a substantially transparent film or a three dimensional object. Surprisingly, the compositions are very stable at ambient conditions to temperatures up to 80° C. for several days and undergo mass polymerization only when subjected to actinic radiation under inert atmosphere such as for example a blanket of nitrogen. Accordingly, compositions of this invention are useful in various opto-electronic applications, including as 3D printing materials, coatings, encapsulants, fillers, leveling agents, among others.
US11299572B2	Block copolymer The present application can provide a block copolymer and a use thereof. The block copolymer of the present application can have excellent self-assembly properties or phase separation characteristics and excellent etching selectivity, and various other functions as required can be freely imparted thereto.
US11299570B2	Low-viscosity photocurable adhesive compositions Photocurable (meth)acrylate compositions with low viscosity when uncured, and high flexibility and shear/tensile strength when cured, further possessing rapid tack-free fixture times, comprising mixtures of urethane acrylate resin, isobornyl acrylate, N,N-dimethylacrylamide, a photoinitiator component, and a low percentage of tetrahydrofurfuryl acrylate, for example from about 9% to about 15% by weight based on the weight of the composition. Applications can include adhesive bonding of medical tubing, UV/Visible transparent plastics material medical devices or equipment, or other flexible UV/Visible transparent material substrates.
US11299562B2	Methods for terminating olefin polymerizations Catalyst deactivating agents and compositions containing catalyst deactivating agents are disclosed. These catalyst deactivating agents can be used in methods of controlling polymerization reactions, methods of terminating polymerization reactions, methods of operating polymerization reactors, and methods of transitioning between catalyst systems.
US11299551B2	Composite binding molecules targeting immunosuppressive B cells Provided are anti-CD19 and anti-CD38 common light chain bispecific antibodies. The anti-CD19 and anti-CD38 bispecific antibodies described herein are useful in methods for treating a cancer or a tumor.
US11299550B2	Anti-CD73 antibodies and uses thereof Anti-CD73 antibodies and antigen-binding fragments thereof are described. Also described are nucleic acids encoding the antibodies, compositions comprising the antibodies, and methods of producing the antibodies and using the antibodies for treating or preventing diseases such as cancer.
US11299547B2	CMET monoclonal binding agents, drug conjugates thereof and uses thereof Presented herein, in certain embodiments, are compositions comprising monoclonal binding agents that specifically bind to the extracellular domain of cMET and uses thereof.
US11299546B2	FLT3-specific chimeric antigen receptors and methods using same An embodiment of the invention provides a chimeric antigen receptor (C AR) comprising an antigen binding domain specific for FLT3, a transmembrane domain, and an intracellular T cell signaling domain. Nucleic acids, recombinant expression vectors, host cells, populations of cells, antibodies, or antigen binding portions thereof, and pharmaceutical compositions relating to the CARs are disclosed. Methods of detecting the presence of a proliferative disorder, e.g., cancer, in a mammal and methods of treating or preventing a proliferative disorder, e.g., cancer, in a mammal are also disclosed.
US11299545B2	Anti-HLA-C antibodies and uses thereof Anti-HLA-C6 antibodies and antigen-binding fragments thereof are described. Also described are nucleic acids encoding the antibodies, compositions comprising the antibodies, methods of producing the antibodies, and methods of using the antibodies for treating or preventing diseases, such as autoimmune diseases.
US11299544B2	Biomarkers and methods of treating PD-1 and PD-L1 related conditions Provided herein are biomarkers for the treatment of pathological conditions, such as cancer, and method of using PD-1/PD-L1 pathway antagonists. In particular, provided are biomarkers for patient selection and prognosis in cancer, as well as methods of therapeutic treatment, articles of manufacture and methods for making them, diagnostic kits, methods of detection and methods of advertising related thereto.
US11299541B2	Biopharmaceutical compositions The present disclosure relates to compositions, for treating interleukin 5 (IL-5) mediated diseases, and related methods.
US11299539B2	Methods of producing two chain proteins in bacteria Provided herein are methods of producing a polypeptide containing two chains, such as an antibody including a light chain and a heavy chain. In particular, methods are provided for producing heterologous secretory proteins in bacteria through utilization of optimized expression vectors and culture processes.
US11299537B2	Methods for treatment of motor neuron diseases The invention relates to methods and agents useful for treating motor neuron diseases (MNDs), in particular, amyotrophic lateral sclerosis (ALS). Methods and agents for treating various physiological and pathological conditions associated with motor neuron diseases are also provided.
US11299530B2	SIRP alpha-CD70 fusion protein and methods of use thereof SIRPalpha-CD70 fusion proteins are provided. Accordingly, there is provided a SIRPalpha-CD70 fusion protein comprising a single amino acid linker between the SIRPalpha and the CD70. Also there is provided a SIRPalpha-CD70 fusion protein in a form of at least a homo-trimer. Also provided are polynucleotides and nucleic acid constructs encoding the SIRPalpha-CD70 fusion protein, host-cells expressing the SIRPalpha-CD70 fusion protein and methods of use thereof.
US11299529B2	Chimeric antigen receptors A chimeric antigen receptor (CAR) comprising an extracellular spacer which comprises at least part of the extracellular domain of human low affinity nerve growth factor (LNGFR) or a derivative thereof.
US11299524B2	KIF13B-derived peptide and method of inhibiting angiogenesis A construct composed of a Kinesin-derived Angiogenesis Inhibitor peptide and one or more carrier moieties and/or stabilizing moieties is provided as are methods for inhibiting angiogenesis and treating a disease or condition characterized by excessive vascularity.
US11299522B2	Method of producing proteins in filamentous fungi with decreased CLR2 activity The present invention relates to a method of producing a recombinant polypeptide a filamentous fungus which is genetically modified to decrease or eliminate the activity of cellulase regulator 2 (CLR2) and to express said recombinant polypeptide. The method further relates to a filamentous fungus Myceliophthora thermophila, which is genetically modified to decrease or eliminate the activity of CLR2 and the use of this filamentous fungus in the production of a recombinant polypeptide.
US11299520B2	Compositions comprising a chimeric bacterial surface layer protein and methods of use thereof The invention features engineered probiotic lacto acid bacteria (LAB) expressing a chimeric Clostridium difficile/Lactobacillus acidophilus SlpA, or fragment thereof, and its use for the treatment or prevention of Clostridium difficile infection and gut colonization.
US11299519B2	Host cells and methods using a repressor polypeptide and an inducible promoter for gene expression The present invention provides for a system comprising (a) a first nucleic acid comprising a nucleotide sequence encoding a nucleotide sequence of interest operatively linked to a promoter comprising a repressor polypeptide binding site, and (b) a second nucleic acid comprising a nucleotide sequence encoding a repressor polypeptide having at least 70% amino acid identity with EilR, SmvR, KmrR, RcdA, or QacR; wherein expression of the nucleotide sequence of interest from the promoter is induced by the presence of a hydrophobic inducer, such as a hydrophobic cation inducer, such as a triarylmethane, acridine, phenazine, phenothiazine, or xanthene.
US11299512B2	Cyclic di-nucleotide compounds and methods of use Disclosed are cyclic-di-nucleotide cGAMP analogs, methods of synthesizing the compounds, pharmaceutical compositions comprising the compounds thereof, and use of compounds and compositions in medical therapy.
US11299510B2	Substituted pyridopyrrolopyrimidine ribonucleosides for therapeutic uses Substituted pyridopyrrolopyrimidine ribonucleosides of general formula I, wherein R is as described in the independent claim, preferably R is selected from the group comprising thiophen-3-yl, furan-2-yl, furan-3-yl, benzofuran-2-yl, methylsulfanyl, methoxy, amino, dimethylamino, methyl; and pharmaceutically acceptable salt thereof, their optical isomers and mixtures of such optical isomers. Compounds according to the invention show strong cytostatic and cytotoxic effects on cell lines of tumor origin in a wide variety of diseases including tumors of different histogenetic origin.
US11299505B2	Bis-imine titanium complex, catalytic system comprising said bis-imine titanium complex and process for the (co)polymertzation of conjugated dienes Bis-imine titanium complex having general formula (I): wherein: R1 and R2, mutually identical or different, represent a hydrogen atom; or are selected from linear or branched, optionally halogenated, C1-C20 alkyl groups, preferably C1-C15, optionally substituted cycloalkyl groups; R3 and R4, mutually identical or different, represent a hydrogen atom; or are selected from linear or branched, optionally halogenated, C1-C20 alkyl groups, preferably C1-C15, optionally substituted cycloalkyl groups, optionally substituted aryl groups; X1, X2, X3 and X4, mutually identical or different, represent a halogen atom such as chlorine, bromine, iodine; or are selected from linear or branched C1-C20 alkyl groups, preferably C1-C15, —OCOR5 groups or —OR5 groups wherein R5 is selected from linear or branched C1-C20 alkyl groups, preferably C1-C15; or represent an acetylacetonate group (acac); provided that when R1 and R2 represent a methyl group and X1, X2, X3 and X4 represent a chlorine atom, R3 and R4 are different from 2,6-di-isopropylphenyl.
US11299504B2	Process for preparing a triazine-based precursor, the precursor prepared thereby, a method for producing a micro-particulate complex using the precursor, and the micro-particulate complex produced thereby A process for preparing a triazine-based precursor for producing a micro-particulate complex containing a far infrared-emissive silica particle comprises steps of: a) subjecting 2-4-6-trichloro-1,3,5-triazine and a first nucleophilic compound to a displacement reaction in the presence of a first solvent at a first temperature range to form an intermediate; and b) subjecting the intermediate and a second nucleophilic compound to a further displacement reaction in the presence of a second solvent at a second temperature range higher than the first temperature range.
US11299503B2	Compound, coating composition comprising the same, organic light emitting device using the same and method for manufacturing the same The present specification relates to a compound represented by Chemical Formula 1, a coating composition comprising the compound, an organic light emitting device formed using the coating composition, and a method for manufacturing the same.
US11299502B2	Condensed cyclic compound and organic light-emitting device including condensed cyclic compound A condensed cyclic compound and an organic light-emitting device including the same are provided. When the condensed cyclic compound is used as an emission layer material in a device, the device may have excellent driving voltage, efficiency, and colorimetric purity. An organic light-emitting device including the condensed cyclic compound may have a low driving voltage, excellent efficiency, and a long lifespan.
US11299499B2	Preparation method and application of isoxazinone compounds Disclosed herein are a preparation method and an application of an isoxazinone compound (I), where the preparation method includes: reacting compound (II) with a carboxylic acid (III) in the presence of a dehydrating agent and a base to produce the isoxazinone compound (I); and subjecting the isoxazinone compound (I) and a protonic acid salt of an amino compound (IV) or R3OH (VII) to ring-opening reaction in the presence of a base to produce a bisamide compound (V) or an N-acyl benzoate compound (VI).
US11299495B2	Spiro-lactam NMDA receptor modulators and uses thereof Disclosed are compounds having potency in the modulation of NMDA receptor activity. Such compounds can be used in the treatment of conditions such as depression and related disorders. Orally delivered formulations and other pharmaceutically acceptable delivery forms of the compounds, including intravenous formulations, are also disclosed.
US11299492B2	JAK kinase inhibitor compounds for treatment of respiratory disease The invention provides compounds of formula (I): wherein X is and the variables are defined in the specification, or a pharmaceutically-acceptable salt thereof, that are useful as JAK kinase inhibitors. The invention also provides pharmaceutical compositions comprising such compounds, methods of using such compounds to treat respiratory diseases, and processes and intermediates useful for preparing such compounds.
US11299490B2	Benzenesulfonamide compounds and their use as therapeutic agents This invention is directed to benzenesulfonamide compounds, as stereoisomers, enantiomers, tautomers thereof or mixtures thereof; or pharmaceutically acceptable salts, solvates or prodrugs thereof, for the treatment of diseases or conditions associated with voltage-gated sodium channels, such as epilepsy.
US11299489B1	Thiazole compounds as protein kinase inhibitors Thiazole compounds of Formula (I) shown below and pharmaceutical compositions containing one of such compounds: wherein R1 and R2 are defined in the specification. Also disclosed are methods of inhibiting a tyrosine kinase and treating cancer associated with a tyrosine kinase with one of the thiazole compounds.
US11299486B2	Benzazole compounds and methods for making and using the compounds Disclosed are novel benzazole compounds and compositions comprising the compounds. The compounds are useful as kinase inhibitors including interleukin receptor associated kinases (IRAK) inhibitors. Also disclosed are methods of making and using the compounds and compositions. The disclosed compounds and/or compositions may be used to treat or prevent an IRAK-associated disease or condition.
US11299478B2	2-cyanopyrimidin-4-yl carbamate or urea derivative or salt thereof, and pharmaceutical composition including same Provided is a 2-cyanopyrimidin-4-yl carbamate or urea derivative or pharmaceutically acceptable salt thereof, a process for the preparation thereof, and a pharmaceutical composition comprising the same. The 2-cyanopyrimidin-4-yl carbamate or urea derivative or pharmaceutically acceptable salt thereof selectively inhibits cathepsin K and therefore can be usefully applied for preventing or treating osteoporosis.
US11299476B2	Dopamine D3 receptor selective antagonists/partial agonists; method of making; and use thereof Disclosed herein novel dopamine D3 receptor selective antagonists/partial agonists compounds with high affinity and metabolic stability useful for the treatment of psychiatric and neurological disorders and as research and diagnostic tools. Also disclosed are methods of making the compounds.
US11299468B2	Methods for producing 5-(halomethyl)furfural The present disclosure provides methods to produce 5-(halomethyl)furfural, including 5-(chloromethyl)furfural, by acid-catalyzed conversion of C6 saccharides, including isomers thereof, polymers thereof, and certain derivatives thereof. The methods make use of acids with lower concentrations, and allows for conversion of sugars into 5-(halomethyl)furfural at higher temperatures and faster reaction or residence times.
US11299466B2	Compound, and organic electronic element comprising same The present specification relates to a compound of Chemical Formula 1 and an organic electronic device comprising the same.
US11299463B2	Process for the manufacture of pyrazoles or pyrimidones In one aspect the invention relates to the use of an amine compound in a process for the manufacture of a fluorinated or non-fluorinated 5- or 6-membered heterocyclic compound containing two nitrogen atoms in the ring system of the said compound, preferably of pyrazoles or pyrimidones. The invention also relates to a process for the manufacture of pyrazoles or pyrimidones, which may be fluorinated or may not be fluorinated (non-fluorinated). Especially, the invention relates to process for the manufacture of fluorinated pyrazoles or pyrimidones, and in particular the invention relates to process for the manufacture of such fluorinated pyrazoles or pyrimidones, which each are very important building blocks for pharmaceutical and agro-applications. For example, the fungicides are Bixafen, Fluxapyroxad, Fluindapyr, Sedaxane, Isopyrazam and Benzovindifupyr strongly depend on such fluorinated pyrazoles as key building blocks, or for Florasulam and Clorasulam-methyl (Diclosulam), respectively.
US11299462B2	Crystal form of oxopicolinamide derivative and preparation method therefor Provided are a crystal form of an oxopicolinamide derivative and a preparation method therefor. In particular, provided are crystal forms A, B, C, D, E, and F of a compound as shown in formula (I) and a preparation method therefor. Crystal forms A, B, C, D, E, and F of the compound of formula (I) obtained in the present disclosure have good crystal stability and chemical stability, and can be better used in clinical treatment.
US11299460B2	MDM2 inhibitor, preparation method therefor, pharmaceutical composition thereof and use thereof The present invention relates to an MDM2 inhabitor, a preparation method therefor, a pharmaceutical composition thereof, and the use thereof specifically, the present invention relates to a compound represented by formula I. The compound has excellent MDM2 inhibitory activities, and can be used for preparing a pharmaceutical composition for treating cancers and other diseases related to MDM2 activities, particularly p53 wild-type cancer.
US11299453B2	Compounds for use in the elimination of pluripotent stem cells The present invention relates to a method of reducing the number or percentage of pluripotent stem cells or of enriching differentiating or differentiated cells in a cell population comprising pluripotent stem cells and differentiating cells or differentiated cells derived from the pluripotent stem cells, the method comprising the step of contacting the cell population with a compound according to the general formula (1).
US11299451B2	Method for synthesizing 2-(1-cyclohexenyl)ethylamine A method for synthesizing 2-(1-cyclohexenyl)ethylamine. Cyclohexanone (II) is reacted with a Grignard reagent in a first organic solvent to produce 1-vinylcyclohexanol (III), which is then subjected to chlorination and rearrangement reaction with a chlorinating reagent in a second organic solvent in the presence of an organic base to synthesize (2-chloroethylmethylene)cyclolxane (IV). Then (2-chloroethylmethylene)cyclohexane (IV) and urotropine are subjected to quaternization in a third organic solvent to synthesize N-cyclohexylidene ethyl urotropine hydrochloride (V). Finally, the N-cyclohexylidene ethyl urotropine hydrochloride (V) undergoes hydrolysis and rearrangement reaction in a solvent in the presence of an inorganic mineral acid to synthesize 2-(1-cyclohexenyl)ethylamine (I).
US11299450B2	System and process for co-producing dimethyl carbonate and ethylene glycol A system and a process for co-producing dimethyl carbonate and ethylene glycol. The system comprises an interconnected ethylene carbonate preparation unit and an ethylene carbonate alcoholysis unit. The ethylene carbonate preparation unit comprises a fixed bed reactor and a light-component stripping column connected to each other. The fixed bed reactor is filled with a supported ionic liquid catalyst. The process comprises the steps of: reacting carbon dioxide and ethylene oxide as raw materials in the fixed bed reactor to produce ethylene carbonate, purifying the ethylene carbonate and then mixing it with an alcoholysis reaction catalyst, and reacting the mixture with methanol in a reactive distillation tower, producing dimethyl carbonate and ethylene glycol. The process increases the conversion rate of ethylene oxide and avoids the need for a process of separating conventional homogeneous catalysts from ethylene carbonate, thereby reducing process energy consumption and simplifying process procedures.
US11299445B2	Process for preparing fluorobenzene derivatives and benzoic acid hypofluorite derivatives The invention relates to a use of a fluorination gas, and the elemental fluorine (F2) is preferably present in a high concentration, for example, in a concentration of elemental fluorine (F2), especially of equal to much higher than 15% or even 20% by volume, and to a process for the manufacture of a fluorinated benzene derivative starting from benzoic acid derivative by direct fluorination employing a fluorination gas, wherein the elemental fluorine (F2) is preferably present in a high concentration, and subsequent decarboxylation of the benzoic acid hypofluorite derivative obtained by direct fluorination. The process of the invention is also directed to the manufacture of a benzoic acid hypofluorite derivative by direct fluorination of benzoic acid derivative. Especially the invention is of interest in the preparation of fluorinated benzene derivative, final products and as well intermediates, for usage in agro-, pharma-, electronics-, catalyst, solvent and other functional chemical applications.
US11299444B2	Selective hydrogen removal Processes are provided for the removal of hydrogen from a mixture. The process can be performed by contacting a mixture comprising hydrogen, oxygen, and one or more organic compounds with a synthetic zeolite to produce water or steam. The synthetic zeolite can include Si and Al and has a SiO2:Al2O3 molar ratio of greater than 4:1, an 8-membered ring zeolite having a framework type of AEI, AFT, AFX, CHA, CDO, DDR, EDI, ERI, IHW, ITE, ITW, KFI, MER, MTF, MWF, LEV, LTA, PAU, PWN, RHO, SFW or UFI, a degree of crystallinity of at least 80% as measured by ASTM D535-197, and at least 0.01 wt % of at least one catalytic metal, based on a weight of the synthetic zeolite, where the at least one catalytic metal can include Ru, Rh, Pd, Ag, Os, Ir, Pt, Au, Mo, W, Re, Co, Ni, Zn, Cr, Mn, Ce, Ga, alloys thereof, or mixtures thereof. At least 95% of the catalytic metal can be disposed within a plurality of pores of the synthetic zeolite.
US11299443B2	Distillate production from olefins in moving bed reactors Systems and methods are provided for oligomerization of olefins to distillate boiling range products while also recycling naphtha boiling range olefins as part of the feed. By performing the olefin oligomerization while also recycling naphtha boiling range olefins, it has been discovered that the resulting distillate boiling range products can have an unexpected improvement in diesel combustion quality, such as an unexpected improvement in cetane rating. In order to manage coke formation and maintain consistent activity profile for the oligomerization catalyst, the reaction can be performed in a moving bed reactor. Additional temperature control can be maintained by the recycling of the naphtha boiling range portions of the oligomerization product back to the reactor.
US11299441B2	Calcium sulfate urea granules and methods for producing and using the same A calcium sulfate urea (UCS) fertilizer granule and methods for making and using the same are disclosed. The granule can include urea, calcium sulfate, and a calcium sulfate urea adduct, wherein a portion of the surface of the calcium sulfate urea adduct includes a layer comprising urea, calcium sulfate, or calcium sulfate urea adduct, or any combination or all thereof.
US11299440B2	Bodily remains decomposition An organic composition for decomposing bodily remains including a composite mixture of compost, peat, sulfur, and gypsum. The composite mixture is configured to combine with the bodily remains to decompose the bodily remains. The combined mixture has a reduced pH for reducing the detrimental effects of the bodily remains on the environment.
US11299439B2	Mycorrhizae and/or Bacillus amyloliquefaciens liquid fertilizer compatible formulations The present invention is directed to agricultural formulations containing mycorrhizae and/or Bacillus amyloliquefaciens that are compatible with liquid fertilizers. The present invention further relates to methods of improving plant growth by applying mycorrhizae and/or Bacillus amyloliquefaciens containing formulations to an area where a plant will grow.
US11299438B2	Method of obtaining a liquid organic biofertilizer for soil and/or plants, the biofertilizer and methods of using the same The invention relates to the production and use of environmentally friendly liquid organic biofertilizer for soils and/or plants which is colonized by natural soil microorganisms. It is proposed the method in which, due to the optimal processing of a starting humus-containing soil or soil mixture colonized by natural soil microorganisms with applying the proposed “soft” controlled turbulence action without cavitation effects, the conditions for preserving and reproducing the natural soil microorganisms in their natural medium are provided, as a result it is obtained the final product in the form of a homogenous fine-dispersed suspension, which contains the solids of 10-50 microns size. This product is mainly composed of water-soluble nitrogen (preferably 40 mg/100 g fertilizer) and water-soluble carbon (preferably 470 mg/100 g fertilizer) and is suitable for packaging and long-term storage. The claimed biofertilizer is uniformly colonized by the hardened natural soil microorganisms which are in the state of anabiosis and spore forms, their concentration being at its maximum. The proposed treating soil, seeds or plants with using this biofertilizer results in higher crop yields, improved fertility of depleted soils and restored fertility of sandy and sandy-loam soils.
US11299432B2	Method of making a refractory article A method of making a refractory article is provided. The method includes: a) mixing a binder system, a refractory charge, and a second colloidal binder to form an aqueous slurry; b) casting the aqueous slurry into a mold; c) subjecting the mold containing the aqueous slurry to a temperature that is lower than a slurry casting temperature for a time sufficient to form a green strength article; and d) firing the green strength article at a temperature of at least 450° C. for a time sufficient to achieve thermal homogeneity, thereby forming a refractory article. Refractory articles made in accordance with the method have a unique combination of pore structure and mechanical properties.
US11299431B2	Ceramic sintered body, insert, cutting tool, and friction stir welding tool Provided is a ceramic sintered body having high wear resistance and chipping resistance. Also provided are an insert, a cutting tool and a friction stir welding tool, each of which uses such a high-performance ceramic sintered body. The ceramic sintered body includes Al2O3 (alumina), WC (tungsten carbide) and ZrO2 (zirconia), wherein Zr (zirconium) element is present at either one or both of: (1) a grain boundary between crystal grains of the Al2O3; and (2) a grain boundary of crystal grains of the Al2O and crystal grains of the WC, wherein the ceramic sintered body contains 55.0 to 97.5 vol % of the WC, 0.1 to 18.0 vol % of the ZrO2, and the balance being the Al2O3, and wherein the ZrO2 is in a phase of tetragonal structure (T) or a mixed phase of tetragonal structure (T) and monoclinic structure (M).
US11299428B2	High strength ceramics with novel fracture mode The present invention provides a method for making a high strength, small grain size ceramic having a trans-granular fracture mode by rapid densification of a green body and subsequent cooling of the densified ceramic. The ceramic may include dislocations, defects, dopants, and/or secondary phases that are formed as a result of the process and resulting in stress fields capable of redirecting or arresting cracks within the material. This ceramic can maintain transparency from ultraviolet to mid-wave infrared.
US11299425B2	Composite material comprising a fibrous reinforcement and a poly(phospho-sialate) geopolymer matrix and associated manufacturing method A composite material containing a matrix and a fibrous reinforcement, in particular a textile embedded in the matrix. The matrix includes a geopolymer of the poly(phospho-sialate) type having the following formula I: (1) (—P—O—Si—O—Al—O—)n in which n is greater than 2. The matrix further includes zirconium covalently bonded to the matrix, especially in the —ZrO form and/or in the —O—Zr—O form. The matrix has a melting temperature greater than 700° C., especially equal to or greater than 1200° C.
US11299424B2	Pozzolanic compositions containing fly ash and remediation agents for use in cementitious materials It has been unexpectedly discovered that the addition of a natural or other pozzolan to non-spec fly ash significantly improves the properties of the non-spec fly ash to the extent it can be certified under ASTM C618 and AASHTO 295, as either a Class F or Class C fly ash. The natural pozzolan may be a volcanic ejecta, such as pumice or perlite. Other pozzolans may also be used for this beneficiation process. Many pozzolans are experimentally tested and may be used to beneficiate non-spec fly ash into certifiable Class F fly ash. Additionally, this disclosure provides a method of converting a Class C fly ash to a more valuable Class F fly ash. This discovery will extend diminishing Class F fly ash supplies and turn non-spec fly ash waste streams into valuable, certified fly ash pozzolan which will protect and enhance concrete, mortars and grouts.
US11299422B2	Method for producing insulating glass unit and method for producing glass window A gas adsorbent is placed on at least a surface of a first plate on one side in a thickness direction thereof or a surface of a second plate on one side in a thickness direction thereof. The gas adsorbent has a shape with relatively raised and lowered parts arranged alternately. The gas adsorbent is placed along a sealant that joins the first and second plates.
US11299418B2	Unfired heat and/or sound insulation product and insulation blanket obtained therefrom The invention relates to an uncured thermal and/or sound insulation product, based on mineral wool, advantageously on glass wool, that is in the form of a ply comprising a mineral wool layer sized by at least one binder, said sized layer having: a surface density, or basis weight, of less than or equal to 350 g/m2, preferably less than or equal to 300 g/m2, or less than or equal to 250 g/m2, and, optionally, greater than or equal to 200 g/m2, a micronaire of at most 3 under 5 grams, preferably of at most 15 l/min, better still of at most 12 l/min, and of at least 9 l/min, and the ply having a thickness of greater than 10 mm, or greater than or equal to 15 mm, or even greater than or equal to 25 mm. The invention makes it possible to propose a thermal and/or sound insulation product that is lighter while retaining satisfactory thermal and/or sound insulation properties and a good mechanical strength.
US11299415B2	Dissolved air flotation system and methods for biological nutrient removal A wastewater treatment system including a contact tank, a dissolved air flotation unit, a fermentation unit, and a biological treatment unit is disclosed. A method of retrofitting a wastewater treatment system by arranging the wastewater treatment system such that floated biosolids are fermented in an anerobic environment and fluidly connecting the biological treatment unit to receive at least a portion of the fermented solids is also disclosed. The method optionally includes providing a fermentation unit and fluidly connecting the fermentation unit to a biological treatment unit. A method of treating wastewater including combining the wastewater with activated sludge, floating biosolids from the activated wastewater, fermenting the floated biosolids, and biologically treating the effluent with the fermented solids is also disclosed. A method of facilitating delivery of soluble organic carbon to a biological treatment unit is also disclosed.
US11299414B2	Multiple attached growth reactor system Described herein are attached growth reactor systems which increase nitrifying bacteria biomass through a variety of means during warm weather. As a consequence, the attached growth reactor system contains sufficient nitrifying bacteria biomass to remove ammonia from wastewater in cold to moderate climates. In one example, there are two attached growth reactors into which wastewater is distributed discontinuously. Specifically, wastewater is transferred to the first attached growth reactor for a first period of time and then is transferred to the second attached growth reactor for a second period of time during warm weather which effectively doubles the nitrifying bacteria biomass in the system. During cold weather, approximately half of the wastewater is applied to each reactor simultaneously.
US11299410B2	Water filter with water enrichment The present invention describes a water filter apparatus (100, 100a) with integrated nutrient enrichment and/or enhancement. Desired nutrients, ions, hydrogen ions, ceramic, stones, metal etc. packed in granules or balls are selectively disposed inside a stick capsule (160), shell capsule (180) or hydrogen capsule (190). One or two stick capsules (160) are located inside a filter element (150). The stick capsule has a tapered end (162) and in association with T-shaped posts (157) formed on an inside of a cap (151) of the filter element, dynamic flow of water along the tapered end (162) induces nutrient-rich water to flow through perforations (165) at the end of the stick capsule (160), mixes/blends the two streams of water before water is discharged through a faucet (144). The filtered water is also enhanced by treating the water through flavor treatment, anti-bacterial, anti-chlorine, activated carbon and so on.
US11299404B2	Condensation catalyst systems and methods A reactor system may comprise a housing; and a condensation catalyst layer within the housing comprising a condensation catalyst comprised of at least one of a base-substituted zeolite, a stannous salt, or a phosphonitrile chloride. The condensation catalyst layer may be configured to catalyze a condensation reaction of a plurality of silane diols in water flowing through the housing into a plurality of siloxanes.
US11299402B2	Precursor materials for li-ion battery cathode synthesis Provided are particles for use as a precursor material for synthesis of Li-ion cathode active material of a lithium-ion cell comprising: a non-lithiated nickel oxide particle of the formula MOx wherein M comprises 80 at % Ni or greater and wherein x is 0.7 to 1.2, M optionally excluding boron in the MOx crystal structure; and a modifier oxide intermixed with, coated on, present within, or combinations thereof the non-lithiated nickel oxide particle, wherein the modifier oxide is associated with the non-lithiated nickel oxide such that a calcination at 500 degrees Celsius for 2 hours results in crystallite growth measured by XRD of 2 nanometers or less. Also provided are processes of forming electrochemically active particles using the precursors nickel oxides.
US11299401B2	Positive electrode active material for secondary battery, manufacturing method thereof, and secondary battery including same The present invention provides a positive electrode active material for a secondary battery, which includes a lithium transition metal oxide including nickel (Ni) and cobalt (Co), and at least one selected from the group consisting of aluminum (Al), manganese (Mn), and a combination thereof. The lithium transition metal oxide is characterized in that the content of nickel (Ni) in the total transition metal elements is 80 mol % or more, and the cation mixing ratio of Ni cations in a lithium layer in the lithium transition metal oxide structure is 1.1% or less.
US11299400B2	Hierarchical porous ZrO2 material, method of preparing the same, and application thereof A method for preparing a hierarchical porous ZrO2 includes the following steps: S1, dissolving a triblock copolymer in an organic solvent to obtain a solution A, dissolving a tannin extract in distilled water to obtain a solution B, mixing the solution A and the solution B and stirring to obtain a mixed solution; S2, adding a zirconium salt to the mixed solution obtained in step S1 and stirring; S3, heating the mixed solution obtained in step S2 in an oven to obtain ZrO2, promoting the conversion of the crystal form of ZrO2; S4, calcining ZrO2 at a high temperature to obtain the hierarchical porous ZrO2.
US11299398B2	Modified calcium aluminate compound and production method therefor The present invention provides a novel method for producing a calcium aluminate compound having a modified surface. The present invention provides: a method for producing a modified calcium aluminate compound characterized by irradiating a calcium aluminate compound dispersed in an organic dispersion medium with a femtosecond laser, thereby modifying the surface of the calcium aluminate compound; and a modified calcium aluminate compound characterized by being obtained by this method and having at least one of an OH group, a CO group, a CH group, and an NH group.
US11299396B2	System for the production of carbon nanotubes from carbon matter, preferably, plastic waste and solar energy; method of production The present invention relates to a system for the production of carbon nanotubes from carbonaceous matter, preferably, plastic waste and solar energy; Method of production.
US11299395B2	Porous one-dimensional polymeric graphitic carbon nitride-based nanosystems for catalytic conversion of carbon monoxide and carbon dioxide under ambient conditions In some aspects and embodiments, the present application provides a wide range of porous 1-D polymeric graphitic carbon-nitride materials that are atomically doped with binary metals in different morphologies. In some embodiments, the graphitic carbon-nitride materials can be prepared with high mass production from inexpensive and natural abundant precursors. In some embodiments, the materials were used successfully for the oxidation of CO to CO2 under ambient reaction temperature in addition to the reduction of CO2 into hydrocarbons. In some embodiments, the materials can be used for practical and large-scale gas conversion for household or industrial applications.
US11299393B2	On-chip signal path with electrical and physical connection An exemplary microelectromechanical system (MEMS) device comprises a plurality of stacked layers, including at least one layer that includes micromechanical components that respond to a force to be measured. Two of the layers may include respective first and second external electrical connection points. A plurality of conductive paths may be disposed in a continuous manner over an external surface of each of the plurality of layers between the first and second external electrical connection points.
US11299392B2	Packaging for MEMS transducers The Application describes a substrate design for a MEMS transducer package. The substrate is defined by a conductive layer which forms the upper and lower surfaces of the substrate. The substrate is also provided with a conductive portion which is electrically isolated from the rest of the conductive layer. The conductive portion is supported between a first plane defined by the upper surface of the substrate and a second plane defined by the lower surface of the substrate by an electrically insulating moulding substance.
US11299389B2	Saddle with interface having passively morphing elements and method of use Saddle with passively morphing interface panels and method of use, wherein passively morphing interface panels morphs in surface profile to be reshaped upon contact with a supporting surface of a horse's dynamic back and of horses of varying sizes and shapes, so that a direct load path is created from the riders concentrated downward weight on a chassis through a pair of symmetrically opposed line of contact edges, aligned with tilted sagittal plane sections through the horse's back surface, and making contact with the midline area of opposed pair of elements made of rigid materials that are caused to tip out of plane until moment forces are balanced, which occurs when the element's entire length makes contact with the supporting horse's back causing the elements interface's surface profile to be reshaped, without directed input, to momentarily match the varying supporting surface profiles of a horse's dynamic back.
US11299385B2	Multiple-piece vacuum-insulated heating tank of water dispenser A multiple-piece vacuum-insulated heating tank for use in a water dispenser includes a threaded cover, a thermal insulation cover, and a heating tank body. The threaded cover is mounted on an upper opening of the heating tank body and includes a plastic cover and a protective cover mounted on and around the plastic cover. The thermal insulation cover is fitted in the upper opening and includes an upper cover and a lower cover. The lower cover is cup-shaped; is mounted with a heating tube, a water inlet pipe, a water outlet pipe, a thermowell, a temperature-sensing heat pipe, a heat collector block, and two snap-action thermostats at the bottom side; and has a sidewall formed with a step adjacent to the bottom side. The heating tank not only has a multiple-piece structure that facilitates mass production and maintenance, but also dispenses with electronic temperature control as is conventionally required.
US11299381B2	Winch handle operated bottle closures and methods for using Novel closures for bottles comprising a bottle closure having a socket shaped and sized to receive the drive head of a convention winch handle and a closure means for securing the closure to the neck of the bottle to seal the bottle. Two such closures are described, one of for use with beer style bottle and another for rum or whiskey style bottles. The closures are particularly useful for bottled beverages brought aboard sailboats that use manual winches. The closures can be removed from the bottles using winch handles that are already aboard the sailboat, allowing the beverages to be consumed.
US11299376B2	Method for the positionally accurate receiving and depositing of a container using a gantry stacker and gantry stacker for this purpose A gantry stacker having a spreader for containers and including a locating system arranged on the gantry stacker that determines a position of the gantry stacker. To permit a more precise receiving or depositing of containers in a predefined position in a container terminal, sensors are arranged on the gantry stacker, with the sensors and the locating system being connected to a control unit, and the control unit determines a position of the spreader, of a container to be received or of a deposit site from the position of the gantry stacker using the signals from the sensors.
US11299374B2	Method and kit for retrofitting elevator machines with thrust bearing, and retrofitted elevator machine Disclosed is a method for retrofitting an elevator machine with a thrust bearing, including removing, from a bearing stand, a first cover plate, providing access to an end portion of a motor shaft, securing an extension shaft against the end portion of the motor shaft, securing a thrust bearing housing against or axially offset from the bearing stand, positioning a thrust bearing in the bearing housing, wherein an inner race of the thrust bearing is securely positioned against, and axially fixed to, the extension shaft, and an outer race of the thrust bearing is securely positioned against the bearing housing, and securing a second cover plate to the bearing housing.
US11299360B2	Image forming apparatus for forming image on sheet In an image forming apparatus that can form images on both surfaces of a sheet, a first roller conveys a sheet conveyed from a reversal roller and a first motor drives the reversal and first rollers. A one-way clutch restricts transfer of a driving force from the first motor to the first roller while the reversal roller is conveying a sheet in a first direction, and permits transfer of a driving force from the first motor to the first roller while the reversal roller is conveying a sheet in a second direction. Second and third rollers are provided on a downstream side of the first roller. A second motor drives the second and third rollers. A controller drives both of the first and second motors when resuming conveyance of a sheet conveyed on a duplex conveyance path after causing the sheet to await abutment with the second roller.
US11299359B2	Lapper assembly The present disclosure provides embodiments of a lapper assembly for use to overlap successive sheets of wood veneer or other materials along a conveyor. The lapper assembly may include a stop member configured to be rotatably mounted to a roller such that the stop member is pivotable around the rotational axis of the roller independently of the rotational angle of the roller. The lapper assembly may further include a lever arm coupled to one end of the stop member. An actuator may be pivotably coupled to the lever arm and the conveyor frame, and operated to pivot the stop member between a workpiece engaging position, in which the stop member extends into the path of workpiece flow, and a workpiece disengaging position below the path. Optionally, the lapper assembly roller and other rollers upstream/downstream may be operatively connected to a drive. Corresponding systems and methods are also disclosed herein.
US11299358B1	Storage bin sweep system with enhanced peripheral sweep capability A system for moving particles across a floor surface of a storage bin having a peripheral wall extending upwardly from the floor surface. The system may comprise a bin sweep apparatus having an inboard end for locating toward to a central area of the bin and an outboard end for locating toward a peripheral area of the bin. The system may also comprise a peripheral sweeping apparatus configured to mount on the bin sweep apparatus to sweep particles on the floor surface adjacent to the peripheral wall toward the bin sweep apparatus. The peripheral sweeping apparatus may be mounted on the bin sweep apparatus toward the outboard end thereof.
US11299357B1	Vacuum conveyor system for removing articles, such as containers, from trays A transfer system for removing articles from trays includes a supply conveyor and a discharge conveyor A separation and transfer arrangement, including an article transport member, is interposed between a downstream end of the supply conveyor and an upstream end of the article discharge conveyor. The article transport member. Which may be a vacuum conveyor, acts on an upper end defined by each article to suspend the articles therebelow, and advances the articles from the downstream end of the supply conveyor to the upstream end of the discharge conveyor, which are at generally the same elevation. A tray transport member extends from the downstream end of the supply conveyor, and advances the trays downwardly in an upstream-to-downstream direction so that the trays are positioned below the upstream end of the discharge conveyor as the articles are deposited on the upstream end of the discharge conveyor by the article transport member.
US11299356B1	Product purchase system including product retrieval robot of add-on product based upon mobile device and related methods A product purchase system may include a product retrieval robot for a physical store and a mobile wireless communications device associated with a given user and configured to obtain product identifying data for a given product for purchase in the physical store. The given product for purchase may be placed by the given user into a physical shopping cart. The system may also include a server configured to identify the given product for purchase based upon the product identifying data, and determine an add-on product associated with the given product for purchase and located in the physical store. The product retrieval robot may be configured to cooperate with the server to retrieve the add-on product from the physical store and deliver the add-on product to the physical shopping cart.
US11299352B2	Automatic cart transport system An automatic cart transport system. A track located in a factory working floor provides a trackway for an endless flexible conveyor chain. A plurality of chain units including a first chain portion having vertical rollers and a second chain portion having horizontal rollers are flexibly coupled, and the chain is advanced along the trackway by a drive motor. The chain units support thereabove, but within the track, a coupling plate having therein an aperture for accepting and capturing a chain connection shaft which is detachably connected to a cart. The cart is automatically towed along a defined pathway on the working floor of a factory by the chain, when connected to the coupling plate on the endless flexible conveyor chain.
US11299346B1	Pharmacy order filling system and related methods Drug packets may be dispensed as a belt of drug packets. Machine-readable identifiers in the belt may be automatically read to identify drug packets and associate the drug packets with the received orders. The drug packets may be automatically inspected to confirm contents of the drug packets against the received orders. The belt may be automatically separated into segments of drug packets. Each of the segments may correspond to a supply period and each of the drug packets within each of the segments may correspond to a drug dose event for the multi-drug regimen within the supply period. The segments of the belt may be automatically accumulated into belt rolls such that, for each of the belt rolls, a first segment end is on an interior of the belt roll and a second segment end is on an exterior of the belt roll.
US11299344B2	Storage systems and methods A storage system is described where goods are stored in containers (10) and the containers (10) are stored in stacks. Above the stacks runs a grid network of tracks on which load handling devices run. The containers (10) may be provided with one or more of the following services: power, power control, heating, lighting, cooling, sensing means, and data logging means. The provision of these services within individual containers rather than across the system as a whole, allows for flexibility in storage whilst reducing cost and inefficiency.
US11299343B1	Refuse hopper A refuse hopper is disclosed which may be mounted in the bed of a pick-up truck, a flat-bed truck or on a trailer. The refuse hopper includes a horizontally disposed support frame having a rear end, a front end, a first side and a second side. A hopper is pivotally mounted on the support frame and has a front end, a rear end, a front side and a second side. The refuse hopper is selectively movable between a horizontally disposed loading position and a dumping position. A compactor plate is pivotally mounted to the hopper and is movable between an upwardly extending loading position to a refuse packing position within the hopper. The hopper has a volume of about 2-4.5 cubic yards.
US11299337B2	Flexible packages with flat panels Flexible packages with reinforcing areas and flat panels.
US11299335B1	Flexible packaging rib stiffeners A padded mailer includes ribs that provide stiffness, especially in the transverse direction. The increased stiffness helps prevent the mailer from flipping over during conveying, which would put a label on the underside of the mailer.
US11299334B2	Membrane lid with integrated two-stage tab system The present invention relates to a resealable membrane lid for a container comprising a peelable portion and a removable portion. When the resealable peelable portion is peeled back, the seal onto the container is not disturbed. When the removable portion is removed from the container, the container contents may be accessed. The peelable portion may be resealed onto the container at any point in the process.
US11299331B2	Container A container of a plastic material has a container body (1) for receiving a fluid and a neck part (7) adjoining the container body (1). The neck part (7) has at its free end a discharge opening for the fluid closed by a head part (11) and covered by a cap (19). The cap (19) interacts with individual blocking elements via a retaining ring (21), starting from an attachment position of the cap (19). Rotary motions in both directions of rotation are permitted along a predetermined path of travel. During a further screw-on motion beyond the predetermined path of travel, a part of second blocking elements completely passes over assigned first blocking elements, and in so doing the head part (11) is penetrated by the opening part of the cap (19). During a subsequent unscrewing motion of the cap (19) for the purpose of releasing the discharge opening, the retaining ring (21) is disengaged from the cap (19) and, in the process, is secured on the neck part (7) at least temporarily against rotation in the unscrewing direction by at least one blocking element.
US11299328B2	Bottle and cap arrangement A bottle assembly that includes a bottle with a finish having a mouth for containing an E-liquid. The mouth of the bottle is sealed with a plug having an anti-drip well. The anti-drip well sized to prevent inadvertent spillage of the E-liquid contained within the bottle. An annular cap protrusion of the plug can engage with a channel on an upper portion of the bottle to attach the plug with the upper portioned with the mouth of the bottle. A lower channel edge can include a notch that can be used as a wedge to incrementally remove the plug from the mouth of the bottle without damage thereto.
US11299326B2	Reclosable pouch with an elongate closure mechanism A reclosable pouch in combination with an elongate closure mechanism. The pouch has a mouth defining an opening into an interior space. The elongate closure mechanism includes a first base member disposed along a first sidewall. A pair of interlocking members extends from a first surface of the first base member. The interlocking members are parallel to each other with a space therebetween. A plurality of partial indentations is disposed along a second surface of the first base member, extending longitudinally between the opposite ends of the elongate closure mechanism, and being visible between the opposite ends of the elongate closure mechanism. The interlocking members extending from the first base member occlude and deocclude with a pair of interlocking members extending from the second base member, in order to resealably close the mouth. The plurality of partial indentations remains visible during the occluding and deoccluding.
US11299325B2	Packages with raised portions Packages having raised portions that provide improvements in displaying graphics, such as images and branding.
US11299324B2	Produce container An embodiment includes a bag comprising mesh and film side walls and a reinforcing strip of film; wherein (a) the mesh side wall is sealed to opposing side edges of the film side wall; (b) the reinforcing strip of film is sealed to an upper portion of the mesh side wall and to the opposing side edges of the film side wall; (c) the film side wall has a bottom extension, which is monolithic with the film side wall, extending upwardly and sealed along a lateral extent of a bottom portion of the mesh side wall; (d) the film side wall is non-coplanar with a portion of the bottom extension; (e) another portion of the bottom extension is non-coplanar with the mesh side wall; and (f) a horizontal axis intersects the bottom portion of the film side wall and three portions of the bottom extension.
US11299318B2	Portable container and container assembly An accessory for use with a portable container includes a jacket having a storage member and configured to extend around at least a portion of the sidewall of the container and a connection member connected to the jacket and configured to support the jacket in connection with the container. The connection member includes a connector configured to be connected to a port on the container such that a portion of the connector is received through the port.
US11299317B2	Carton with tab A foldable food carton including a lid portion; a bottom portion; and a viewable tab attached to the lid portion, wherein the tab comprises one or more of alphabetic text, numeric text, QR code, bar code, graphic, design, or combination thereof printed on the tab. A method of assembling a carton with a viewable tab, including providing a carton in an unfolded configuration, and folding the carton into an assembled configuration, wherein upon folding the carton into the assembled configuration the tab moves from a first position to a second position.
US11299315B2	Foldable box connection structure, foldable box and method of using the same The invention provides a foldable box connection structure, a foldable box and a method of using the same. The foldable box connection structure comprises a first side plate, a second side plate, a first hinge, a first top plate, a seam cover plate and a positioning plate. The first hinge is used to connect the first top plate and the second side plate. The seam cover plate can be folded to cover the first hinge, and the seam cover plate and the positioning plate are configured to secure the first hinge. The foldable box includes the above-mentioned connection structure. In the present invention, the first top plate is hooked by the first hinge and the seam cover plate, and a second top plate is hooked by a third hinge, so that the foldable box has a fixed structure.
US11299312B2	Method for producing a leak-tight vessel, and a leak-tight vessel The present invention describes a method for producing a leak-tight vessel for holding a gas and/or liquid, comprising the steps of winding a heat-sealable thermoplastic barrier strip around a removable mandrel in such a way that each strip fragment overlaps with a substantially parallel strip fragment over at least a lateral overlapping distance, consolidating the overlapping strip fragments so as to form a gas and/or liquid tight layer, winding a fibrous material around the gas and/or liquid tight layer, thereby leaving an opening large enough for removing the mandrel. The invention also describes a leak-tight vessel produced in this way.
US11299308B2	Electronic product packaging system An electronic product packaging system includes a robot on which a vacuum suction device adapted to pick up a packaging box and a gripper adapted to grab an electronic product are disposed, a packaging box loading platform adapted to load a pile of a plurality of the packaging boxes stacked together, a product loading device having a loading groove adapted to load a row of a plurality of the electronic products, and a packaging platform carrying the electronic products and the packaging boxes. The robot is configured to pick up the packaging box from the packaging box loading platform and place the packaging box on the packaging platform with the vacuum suction device. The robot is configured to grab the electronic product from the product loading device and place and pack the electronic product into the packaging box on the packaging platform with the gripper.
US11299305B2	Sewn stack of absorbent sheets The invention provides a stack comprising a plurality of absorbent sheets stacked in facing arrangement. The stack is bound along its top edge by at least one line of stitches comprising a plurality of spaced apart stitch holes and a thread disposed therein. Individual sheets further comprise a line of perforations comprising a plurality of spaced apart perforation holes. The line of stitches and the line of perforations are such that there is generally a one-to-one numerical correspondence amongst at least a majority of the plurality of stitch holes and perforation holes.
US11299304B2	Device and method for transporting ready-cut and filled hose pieces The present invention relates to a simplified device and a process-technically simplified and also more rapidly applicable method for transporting readily cut and filled hose pieces within a machine for producing pouches filled with brewable material. The device according to the invention has a transport wheel which has several supports distributed over its circumference, each holding a pouch which are pivotally mounted on the transport wheel. In the method according to the invention, a hose piece for forming a pouch with at least one chamber between a head and a bottom is inserted in the radial direction into a support of the transport wheel. In a removal station the pouch is removed radially from the transport wheel with the bottom leading.
US11299303B2	Food article loading system and method A food article loading system including a shuttle conveyor mounted for reciprocal movement having a first paddle belt for receiving food articles, and upper and lower drives engaging the upper and lower passes of the first paddle belt; a loading head having a second paddle belt for receiving the food articles from the first paddle belt lower pass; a slide gate for receiving groupings of food articles from the loading head; and a control for independently actuating the upper and lower drives to operate at selected speeds, to cause rotation of the first belt and the shuttle conveyor to reciprocate longitudinally to receive and retain a first predetermined number of the food articles, deposit a second predetermined number of the elongate food articles onto the second belt at a selected frequency, and selectively open the slide gate to allow groupings of food articles to fall into receptacles.
US11299302B2	Integrated semiconductor die parceling platforms In certain embodiments, a system includes: an inspection station configured to receive a die vessel, wherein the inspection station is configured to inspect the die vessel for defects; a desiccant station configured to receive the die vessel from the inspection station, wherein the desiccant station is configured to add a desiccant to the die vessel; a bundle station configured to receive the die vessel from the desiccant station, wherein the bundle station is configured to combine the die vessel with another die vessel as a die bundle; and a bagging station configured to receive the die bundle from the bundle station, wherein the bagging station is configured to dispose the die bundle in a die bag and to heat seal the die bag with the die bundle inside.
US11299300B2	Pouch filling station A table top appliance rapidly fills a pouch through some mechanical actuation or automation by inserting the pouch into the appliance and the machine fills the pouch. One embodiment of the food pouch filling station may be a mechanical version that includes a method to pump or push the contents of the container into the pouch. A second embodiment of the food pouch filling station may be an electric pump version that fills pouches and may have the option of controlling the amount of food dispensed. The food pouch filling station may also include a valve that connects to the pouch to control the flow to the pouch.
US11299298B2	Connection device with separation controlled by non-pyrotechnic thermal effect with reduced reaction time In order to provide a temporary connection between two structure elements, such as two parts of a space launcher or of another type of spacecraft or aircraft, a connection device with controlled separation comprises a thermally breakable layer, two thermal containment layers, between which the thermally breakable layer is arranged, and an electrically conductive element arranged between the two thermal containment layers in such a way as to heat the thermally breakable layer using the Joule effect when an electric current passes through the electrically conductive element.
US11299297B1	Magnetic shield system for spacecraft A system to create a magnetic field or fields around the outside of a spacecraft to provide protection from cosmic and solar radiation. Electromagnets are placed within one or more layers of the outer shell or surface of a spacecraft and are used to generate magnetic fields. Side electromagnets are placed within one or more of the side layers of the outer shell or surface of the spacecraft and separate configurations of electromagnets are positioned within one or more layers of the outer shell or surface of the spacecraft, in a cross shaped configuration, either Quadrupole electromagnet configuration or two right-angled electromagnet configuration, at the front and rear of the spacecraft in geometric alignment with the opposite poled side positioned electromagnets. Magnetic field lines are channeled around the outside of the spacecraft by use of the right-angled electromagnet configuration or centered on the center of the quadrupole electromagnet configuration.
US11299296B2	Spacecraft Disclosed is a spacecraft including: a housing defining an exterior space, the housing having a first face and a second face; and first and second radiators carried by the first and second faces, the first and second radiators each having an inner main face, an outer main face, and side faces. The spacecraft includes a first auxiliary radiator and a first auxiliary heat transfer device thermally connecting the first auxiliary radiator to the inner main face of the second radiator, the first auxiliary radiator being arranged in a first portion of the exterior space defined by the outer main face of the first radiator and by first planes containing the side faces of the first radiator. The first auxiliary heat transfer device includes a heat conducting device. The first auxiliary radiator is composed solely of one or two radiating panels supporting the heat conducting device.
US11299288B2	Method of presenting flight data of an aircraft and a graphical user interface for use with the same A method of presenting flight data of one or more aircrafts, including the steps of: receiving dataset associated with the aircraft from a data management system; applying an analysis process to compare at least two portions of the received dataset; and presenting the analysed data portions to a user in a visualized manner. A graphical user interface is also included for use with the method.
US11299287B1	Methods and systems for orienting a thrust propulsor in response to a failure event of a vertical take-off and landing aircraft Aspects relate to systems and methods for orienting a thrust propulsor in response to a failure event of a vertical take-off and landing (VTOL) aircraft. An exemplary system includes a plurality of lift propulsors mechanically connected to a VTOL aircraft, wherein each of the plurality of lift propulsors are configured to produce lift, a plurality of sensors, wherein at least a sensor is configured to detect a failure of at least a lift propulsor, and transmit a failure datum, a thrust propulsor mechanically attached to the VTOL aircraft with an orientable joint, wherein the thrust propulsor is configured to produce thrust and orient the thrust propulsor as a function of a thrust orientation datum, and a flight controller configured to receive the failure datum, generate a thrust orientation datum as a function of the failure datum, and transmit the thrust orientation datum to the orientable joint.
US11299286B2	System and method for operating a multi-engine aircraft The present disclosure provides methods and systems for operating a rotorcraft comprising a plurality of engines configured to provide motive power to the rotorcraft and at least one rotor coupled to the plurality of engines. Failure of an active engine of the rotorcraft is detected when the rotorcraft is operated in an asymmetric operating regime (AOR), in which at least one first engine of the plurality of engines is the active engine and is operated in an active mode to provide motive power to the rotorcraft and at least one second engine of the plurality of engines is a standby engine and is operated in a standby mode to provide substantially no motive power to the rotorcraft. At least one flight control input is adjusted to compensate for a reduction in rotational speed of the at least one rotor resulting from the failure of the active engine. An increase in a power output of the standby engine of the rotorcraft is commanded.
US11299285B2	Systems and methods for providing throttle guidance as a function of flight path acceleration Technologically improved vehicle control systems and methods are described. The provided vehicle control systems and methods embody an inner loop auto-throttle control for causing delta-throttle changes, i.e., servo changes, to achieve desired acceleration targets. The system generates an error on a potential flight path angle using a received thrust acceleration command. The error on the potential flight path angle is converted into an equivalent acceleration. A throttle rate command TLA_ratecmd is generated by converting the equivalent acceleration into the throttle rate command TLA_ratecmd.
US11299280B2	Leading-edge thermal anti-ice systems and methods An anti-ice system is disclosed, including an airfoil structure having a leading-edge portion facing a wind direction. The airfoil structure includes an outer skin and an inner skin which form a plurality of channels, each channel having an air inlet and an air outlet. An air delivery duct inside the airfoil structure extends transverse to the wind direction and has a plurality of openings directed toward the air inlets of the channels. A heat exchanger is configured to provide hot air to the air delivery duct.
US11299273B2	Contoured passenger seat privacy shell shape of aircraft passenger compartment suites An aircraft passenger compartment suite may include a privacy shell element proximate to an aircraft seat installed within the aircraft passenger compartment suite. The privacy shell element may include a first section configured to conform to a primary section of the aircraft seat, and a second section configured to conform to an auxiliary section of the aircraft seat. The privacy shell element may include a first profile configured to conform with the aircraft seat when the aircraft seat is in a first position, and a second profile configured to conform with the aircraft seat when the aircraft seat is in a second position. The second profile of the privacy shell element may be configured to occupy a greater amount of passenger aircraft living space surrounding the aircraft passenger compartment suite than an amount of passenger aircraft living space occupied by the first profile of the privacy shell element.
US11299271B2	Automatic announcement in a passenger aircraft An announcement device or a passenger aircraft contains a memory or announcements with assigned potential flight phases and a control and evaluation unit with inputs for input signals with information relating to flight phases of the passenger aircraft, an output for the announcements, wherein the control and evaluation unit is configured to determine a current flight phase on the basis of the input signals, to check whether an announcement for the current flight phase is present in the memory, and to output this announcement as the current announcement at the output.A passenger aircraft contains the announcement device.In a method for outputting an announcement, announcements and input signals are provided, a current flight phase is automatically determined from the said input signals and a possibly present associated current announcement is output.A cabin management system of a passenger aircraft is used as an announcement device and/or to carry out the method.
US11299263B2	Automatic, active blade tracking and balance system The present invention includes an apparatus and method for automatically adjusting the tracking of one or more blades comprising: a blade tracking adjustment mechanism connected to one or more blades of an aircraft; a blade tracking measurement system that measures the tracking of the one or more blades; and a computer that receives an output from the blade tracking measurement system with tracking information for each of the one or more blades; wherein the computer outputs instructions for the blade tracking adjustment mechanism to change a pitch of one or more of the blades to correct blade tracking.
US11299262B2	Composite skid member with varying cross-sections Various implementations directed to composite skid member with varying cross-sections are provided. In one implementation, an aircraft landing gear assembly may include two composite skid members configured to contact the ground, where each composite skid member includes a first cross-section and a second cross-section, and where the first cross-section is different than the second cross-section. The aircraft landing gear assembly may also include two cross members configured to couple to a fuselage of an aircraft and configured to interconnect the two composite skid members.
US11299257B2	Aircraft, systems, and methods for trim control in fly-by-wire aircraft systems Aircraft, fly-by-wire systems, and controllers are provided. An aircraft includes a trim control system and a fly-by-wire system. The trim control system is configured for controlling surfaces of the aircraft. The fly-by-wire system is communicatively coupled with the trim control system and includes an input device and a controller. The input device is configured to receive a re-trim input from a user. The controller is communicatively coupled with the input device and is configured to control the trim control system, to obtain the re-trim input from the user, and to set a pitch trim of the aircraft based on a stable flight condition at a present airspeed of the aircraft in response to the re-trim input from the input device.
US11299247B1	Watercraft paddle with drip diverting edge A single or double bladed watercraft paddle having an improved blade with a bottom edge configured to divert water flow off of a raised paddle blade to reduce the likelihood of it flowing or dripping into the watercraft, onto the paddler, or onto the paddler hands. In one embodiment, the bottom edge of the paddle blade is provided with a notch or plurality of adjacent notches, in another embodiment, the bottom edge of the paddle blade is provided with a protrusion or plurality of adjacent protrusions, and in another embodiment the bottom edge of the paddle blade is provided with a combination of adjacent notches and protrusions. The notches and protrusions may be of various shapes and sizes.
US11299246B1	Propeller assembly with noise reducing hub arrangement A propeller assembly is provided for mounting on a rotatable propeller shaft having a terminal end. The propeller assembly includes a housing structure extending along a longitudinal axis and having first and second ends. The housing structure includes an inner surface defining a cavity and an opening in the second end in communication with the cavity. A bushing assembly has first and second ends and includes an outer surface engageablc with the inner surface of the housing structure. An adaptor has first and second sides and is adapted for receipt on the propeller shaft. The adaptor has an enlarged portion having a diameter greater than a diameter of the opening in the second end of the housing structure. A nut is receivable on the terminal end of the propeller shaft. The nut is threadable on the propeller shaft to a tightened configuration wherein the nut engages the adaptor and maintains the propeller assembly on the propeller shaft. The nut, in the tightened configuration, the first side of the adaptor engages the second end of the bushing assembly and the enlarged portion of the adaptor is spaced from the second end of the housing structure.
US11299244B2	UV LED waveguide system with scattering for anti-fouling The invention provides a waveguide element (1000) comprising a first face (1001) and a second face (1002) with radiation transmissive material (1005) configured between the first face (1001) and the second face (1002), wherein the radiation transmissive material (1005) is transmissive for UV radiation, wherein the radiation transmissive material (1005) is a matrix material for a phase (1010) of another composition than the radiation transmissive material (1005), wherein the phase (1010) is available in the matrix as regions (1110) with the regions (1110) having mean particle radii (r1) selected from the range of 50-1500 nm and having an average region concentration selected from the range of 1104-1.5108/mm3 of the radiation transmissive material (1005).
US11299242B2	U-tank active roll dampening system for and method for active roll dampening of a vessel U-tank active roll dampening system and method for active roll dampening of a vessel provided with a U-tank enabling controlling of fluid level in side tanks in anti-phase in front of vessel roll motion period.
US11299237B2	Electronic device and method for controlling electronic device An electronic device comprises a wireless transmitter and an operation device. The operation device comprises a base, a brake lever, operation portions and an electronic controller. The base is to be removably attached to a handlebar. The operation portions includes first, second and third operation portions. The first operation portion is arranged on the base. The second and third operation portions are arranged adjacent to the brake lever and are disposed between the brake lever and the handlebar. At least one of the operation portions includes a lever. At least one of the operation portions includes a button. The electronic controller is configured to transmit an operation signal to the wireless transmitter upon operation of any of the operation portions to control at least one bicycle component that is any one of a shifting device, a brake device, an adjustable seatpost, a suspension and a drive unit.
US11299233B2	Method and apparatus for an adjustable damper A vehicle suspension damper is described. The vehicle suspension damper includes: a pilot valve assembly; a primary valve; and an adjuster, wherein the pilot valve assembly meters fluid to the primary valve, and the adjuster moves the primary valve.
US11299224B2	Three-row wheel vehicle A three-row wheel vehicle having front, center and rear wheels has laterally spaced leading arms each pivotably connected to a vehicle body, laterally spaced swing arms each connected to the front end of the leading arm swingably in the front and rear direction and rotatably supporting the front wheel at the lower end, and laterally spaced connecting links each attached at one end to the swing arm pivotably around an axis and attached at the other end to the vehicle body pivotably around another axis; heights of the axes are different when the vehicle is on a horizontal flat traveling road; and each connecting link is arranged to apply a reaction force including an upward component to the swing arm when a rearward force acts from the front wheel to the one end via the swing arm.
US11299220B2	Track assembly for a towed vehicle A track system for use with a towed vehicle has an attachment assembly and a multi-member frame assembly. The multi-member frame assembly includes a primary frame member connected to the attachment assembly, at least one wheel-bearing frame member pivotably connected to the primary frame member about a pivot located within a recess, and at least one resilient bushing assembly located within the recess and engaging the pivot. The at least one bushing assembly is resiliently deformable in a circumferential direction to permit pivoting of the pivot with respect to the recess, and is fixedly connected within the recess to resiliently bias the pivot towards a rest position with respect to the recess. The track system further includes leading and trailing idler wheel assemblies rotatably connected to the at least one wheel-bearing frame member, and an endless track.
US11299214B2	Closed structural component and process for preparing the same The present invention is directed to a closed structural component and process for preparing the same.
US11299211B2	Lower vehicle-body structure of electric vehicle A lower vehicle-body structure of an electric vehicle to increase resistance to lateral collision and also improve front-end collision load transfer performance of a tunnel. The lower vehicle-body structure of an electric vehicle includes a floor having a tunnel formed in a front part at a middle in a vehicle-width direction; and a floor cross member spanning, above the floor, between side sills disposed on opposite sides of the floor. Also, a rear end of the tunnel is located directly in front of the floor cross member, and reinforcing brackets are provided extending from the tunnel toward an upper end of the floor cross member and connected to the upper end of the floor cross member.
US11299210B2	Structural integration brace for front vehicle compartment In accordance with an exemplary embodiment, a vehicle is provided that includes: a body; a drive system configured to propel the body; and a front motor compartment formed within the body, the front motor compartment including: a first shock tower; a second shock tower; and a structural integration brace for a vehicle, including: a first end attached to a first shock tower of the vehicle; and a second end attached to a second shock tower of the vehicle; wherein the structural integration brace extends between the first end and the second end, generating a load path therebetween within the front motor compartment of the vehicle.
US11299209B1	Vehicle pillar pass through for sealing baffle The present disclosure describes a vehicle including an inner wheelbase panel, a first panel, a second panel and a pillar that is coupled to the wheelbase panel. The pillar includes a wall, a first flange, a second flange, and a tunnel. The wall defines an inner cavity and an outer cavity. The first flange extends outwardly from the wall and the second flange extends inwardly from the wall. The vehicle includes baffle which extends through the tunnel and is sized and shaped to seal both the inner cavity and the outer cavity.
US11299206B2	Vehicle structure for a cross-vehicle load path A load impact management system for an automotive vehicle includes a load member extending from a first vehicle frame rail to a second vehicle frame rail and perpendicular to each of the first and second vehicle frame rails and to a vehicle body axis. The load member is coupled to the first vehicle frame rail at two attachment points and coupled to the second vehicle frame rail at two attachment points. The load member defines a load path between a first side of the automotive vehicle to a second side of the automotive vehicle opposite the first side and the load member is forward of a passenger compartment of the vehicle.
US11299200B1	Steering systems for vehicles A steering system for a wheel of a vehicle includes a pivot member having multiple pivot-node locations. The pivot member is connectable at a first pivot-node location to a sub-frame of the wheel. A steering rod is actuatable to rotate the wheel about a steering axis and is mechanically coupled with the pivot member to be co-pivotable with the pivot member. A suspension-connector rod has a first end that is connected to the pivot member at a second pivot-node location, and has a second end that is connectable to a suspension arm linking the wheel of the vehicle to the sub-frame. When the steering system is installed in a vehicle, a lateral force acting upon the wheel is transmitted via the steering rod to the pivot member so as to rotate the pivot member, and the rotation is effective to transmit a substantially-vertical force vector to the sub-frame.
US11299195B2	Vehicle steering system A vehicle steering system, including: a steering actuator including an electric motor, a steering rod configured to steer a wheel by a steering amount, and a motion converting mechanism configured to convert a rotating motion of a motor rotation shaft into a motion of the steering rod; first and second motor rotation angle sensors configured to detect a motor rotation angle; a steering amount sensor configured to detect a motion amount of the steering rod as the steering amount; and a controller configured to execute a steering amount control and to perform detection-value inappropriateness determination in which it is determined that any one or two of a detection value of the first motor rotation angle sensor, a detection value of the second motor rotation angle sensor, and a detection value of the steering amount sensor are inappropriate based on comparison among the detection values.
US11299190B2	Infant car seat challenge testing station A station for conducting an infant car seat challenge test includes a first portion, a second portion, and a resilient cushion. The first portion has a top configured as an open-top receptacle. The resilient cushion is disposed in and is coupled to the open-top receptacle. The resilient cushion has a sloped top surface where the sloped top surface is sloped towards a first side of the open-top receptacle. The resilient cushion is adapted to support an infant car seat thereon. The second portion is coupled to the first portion at a second side of the open-top receptacle. The second portion includes a platform positioned above the open-top receptacle wherein the platform is adapted to support an electronic display thereon.
US11299189B2	Motorized cart retriever for monitoring cart status A motorized cart retriever, which may be a cart pusher or a cart puller, can apply a force to a nest of human-propelled, wheeled carts to facilitate retrieval of the carts. The cart retriever can include a transceiver configured to wirelessly receive cart status information from cart transmitters of the wheeled carts and wirelessly report event data to a control unit. The cart status information may include an identification of the cart transmitter, a location of the cart, a lock or unlock status of a cart wheel, a misuse condition, etc. The event data can include the cart status information, a number of wheeled carts being retrieved, etc. The cart wheel may include a brake. The transceiver may communicate a message to the cart wheel to keep the brake unactuated during retrieval. The control unit may analyze the event data to detect traffic patterns of the carts.
US11299188B2	Moving body According to one embodiment, a moving body includes an electrical component, a base frame that includes caster portions provided to be runnable on a floor surface, and is formed such that a front side is narrower than a rear side along a front-rear direction, the rear side is opened, and thus another moving body is insertable from the rear side, and a battery case that accommodates a battery supplying power to the electrical component and has an opening and closing lid opening rearward. A restricting member is provided inside the base frame and restricts a position of the other moving body inserted from the rear side to a position where the opening and closing lid opens at least to an angle at which the battery in the battery case is replaceable.
US11299186B2	Knock-down hamper A hamper has a base having a base frame with a base shelf provided inside the base frame, and a plurality of caster assemblies secured to the base frame. A supporting frame assembly has two U-shaped frames, with each U-shaped frame having a horizontal base bar and two vertical bars extending from opposite ends of the base bar, with the two U-shaped frames coupled to each other at the center of each base bar, and with the base bars secured to the base. A fabric body has a plurality of side walls, and four vertical corner sleeve pockets, with each vertical corner sleeve pocket defining a channel that receives a separate vertical bar. A top frame secured to the upper ends of the vertical bars.
US11299184B2	Railcar bogie including protective film and protective film-equipped plate spring A railcar bogie includes: a protection target member of the railcar bogie; and a protective film including an adhesive surface stuck to the protection target member. The protective film is configured such that an impact absorbing layer and a flame-retardant layer are laminated in this order from the protection target member side. The impact absorbing layer is thicker than the flame-retardant layer.
US11299182B2	Suspended public transit system Provided herein are transit systems for travel overhead of streets, having: at least a first vehicle and a second vehicle; a main track on which the vehicles travel, the main track having a suspended overhead rail over the streets by a support structure, such that the vehicles travel at an elevated level overhead of street level; docking stations for the vehicles to lower to the street level for loading and/or unloading passengers and/or cargo; a two-position switch at each docking station, having cables enabling vertical movement of the vehicle, and a replacement track; wherein the two-position switch allows for docking of the first vehicle while the second vehicle passes the docked first vehicle, by enabling lowering of the first vehicle from the elevated level to the street level, and the replacement track providing a track portion for the second vehicle on which to pass the first vehicle.
US11299180B2	Vehicle control device, vehicle control method, and storage medium A vehicle control device includes: a recognizer configured to recognize a surrounding situation of a vehicle based on an output of an on-board sensor; an interruption vehicle specifier configured to specify an interruption vehicle attempting to interrupt a travel lane from a lateral side of the travel lane in which there is the vehicle based on a recognition result of the recognizer; and a driving controller configured to control at least one of an acceleration or deceleration speed or steering of the vehicle based on a position of the specified interruption vehicle.
US11299179B2	Quality index and real-time forward propagation of virtual controls for smart enablement of automated driving A system to enable an automobile vehicle automated driving control includes a quality index of an automated driving control system prior to enablement of an automated driving control function of an automobile vehicle. An adaptive forward propagation horizon and a prediction horizon for assessment of the quality index are computed. Vehicle states and road geometry are propagated over the adaptive forward propagation horizon, and the quality index is assessed based on forward propagated states over the prediction horizon. A first signal permits actuation of the automated driving control function of the automobile vehicle and a second signal precludes actuation of the automated driving control function. One of the first signal or the second signal is elected based on the results of assessing a quality control index trajectory over the adaptive forward propagation horizon.
US11299178B1	Vehicle travel control method and vehicle travel control device A travel control method for a vehicle having an autonomous travel control function includes: detecting an oncoming vehicle travelling in the opposite lane of the travel lane in which the subject vehicle travels; predicting whether or not the oncoming vehicle enters into the travel lane in which the subject vehicle travels; when it is predicted that the oncoming vehicle enters into the travel lane in which the subject vehicle travels, setting initial deceleration of the subject vehicle in a case of time until the subject vehicle and the oncoming vehicle pass each other being relatively long to a smaller value than the initial deceleration in a case of the time being relatively short; and executing deceleration travel control of the subject vehicle.
US11299177B2	Information processing method, electronic device, and storage medium An information processing method, an electronic device, and a storage medium are provided, which are related to the fields of big data, cloud computing, automatic driving, and the like. The specific implementation includes: receiving a data acquisition task and an acquisition strategy issued by a cloud; analyzing the acquisition strategy to obtain priority information of the acquired data for the data acquisition task; and taking the priority information as an importance degree identifier corresponding to the acquired data, and performing preferential transmission after data acquisition and data screening according to the importance degree identifier.
US11299172B2	Automotive autonomous driving to perform complex recurrent low speed manoeuvres An automotive autonomous driving system comprising automotive on-board systems comprising a propulsion system, a braking system, a steering system, and a sensory system, an automotive user interface, and an automotive electronic control unit connected to, via an automotive on-board communications network, and configured to cooperate with, the automotive on-board systems and the automotive user interface to provide an automotive autonomous driving system. The automotive electronic control unit is further configured to store and populate a database of recurrent low speed manoeuvres and cause recurrent low speed manoeuvres stored in the database of recurrent low speed manoeuvres to be repeated in autonomous driving mode.
US11299171B2	Driving support control device of vehicle, driving support system of vehicle, and driving support control method of vehicle A driving support control device of a vehicle is provided including an acquiring unit configured to acquire a traveling state of the vehicle which is detected and a traveling environment of the vehicle, and a control unit, configured to, in a case where zero-point learning of a yaw rate sensor has not been completed, cause a driving support unit to execute collision avoidance support using a reduced operational area reduced from a reference operational area which becomes a reference in view of an error of the yaw rate sensor as an operational area of collision avoidance support, and the traveling state of the vehicle and the traveling environment of the vehicle.
US11299168B2	Time synchronization scheme between different computation nodes in autonomous driving system A method, apparatus, and system for timing synchronization between multiple computing nodes in an autonomous vehicle host system is disclosed. Timing of a first computing node of an autonomous vehicle host system is calibrated based on an external time source. A first timing message is transmitted from the first computing node to a second computing node of the autonomous vehicle host system via a first communication channel between the first computing node and the second computing node. Timing of the second computing node is calibrated based on the first timing message, wherein immediately subsequent to the calibration of timing of the second computing node, timing of the first computing node and of the second computing node is synchronized.
US11299167B2	System and method for improving real-time estimates of visitor volume to places The present invention is a system and method for improving the accuracy with which human behavioral insights regarding visitor volume to places can be predicted. The process aligns at least two different data sets and normalizes the information by removing statistical bias. In a particular implementation motor vehicle data is collected from a known subset of road-borne vehicles and compared to data collected from unknown vehicles. The data is then increased or discounted to remove biases present in the known subset. The system analyzes the normalized data and returns a report including predictions to a human user.
US11299165B2	Evaluation device and evaluation method To enhance safety in vehicle operation. An evaluation device according to the present technology includes a communication unit capable of communicating with a vehicle, and a control unit that performs an evaluation of a state related to sensing of danger by a user on the basis of an electroencephalogram of the user detected by an electroencephalogram sensor, and causes the communication unit to transmit evaluation result information to the vehicle. That is, for example, on the basis of an electroencephalogram of a user such as a driver of a vehicle, evaluation of a state related to sensing of danger such as whether or not the user has sensed a danger is performed, and evaluation result information is transmitted to the vehicle side.
US11299161B2	Vehicle control system, vehicle control method, and storage medium A vehicle control system includes: an information acquiring unit that acquires an index value relating to easiness of merging which is evaluated on the basis of at least one of vehicle information relating to an operation of another vehicle that has advanced from a merging lane to a main lane before a subject vehicle and external system information acquired near a merging point using the other vehicle in a case in which the subject vehicle is running in the merging lane merging into the main lane; and an automated driving control unit that executes automated driving of the subject vehicle on the basis of the index value acquired by the information acquiring unit.
US11299160B2	Vehicle control device, vehicle control method, and storage medium A vehicle control device (100, 1) including: a detector (110, 16) detecting other vehicles; a lane change executer (154) executing a lane change of a subject vehicle on the basis of states of the other vehicles detected by the detector without depending on a steering operation of a vehicle occupant of the subject vehicle; a determiner (152) determining whether or not the lane change is to be continued on the basis of the states of the other vehicles executing a lane change from a third lane adjacent to a second lane to the second lane, which are being detected or have been detected by the detector, after control of executing a lane change of the subject vehicle from a first lane to the second lane adjacent to the first lane is started by the lane change executer; and a return controller (156) returning the subject vehicle from the second lane to the first lane in a case in which it is determined that the lane change is not to be continued by the determiner.
US11299159B2	Apparatus for and method of controlling vehicle creep torque A method of and an apparatus of controlling a creep torque to be exerted on a vehicle, may include facilitating a control unit to determine from a vehicle speed signal whether or not a vehicle comes to a stop, facilitating the control unit to determine from a slope angle signal a state of a road in accordance with a slope angle of the road; facilitating the control unit to determine a gear-shift step state, facilitating the control unit to decide a creep torque command on the basis of a result of the determination, the gear-shift step state, and information on the state of the road in accordance with the slope angle, and facilitating the control unit to output the decided creep torque command to perform creep torque control that generates a creep torque corresponding to the creep torque command from a motor.
US11299155B2	Driving control apparatus for vehicle An ACC function for performing constant speed cruise according to a target speed when there is no preceding other vehicle in a vehicle's driving lane and performing following cruise by maintaining a predetermined inter-vehicle distance when there is a preceding other vehicle, an LKA function for maintaining cruise, an override function for stopping the ACC function and the LKA function by a driver's operation intervention, and a fallback function for performing fallback control of the ACC function and/or the LKA function, with notifying the driver of stopping the ACC function and/or the LKA function and operation takeover, at a time of system operational design domain deviation of the ACC function and/or the LKA function, override threshold values of the functions serving as a determination criterion of the operation intervention for stopping the ACC function and/or the LKA function at the time of system operational design domain deviation are configured to be altered to a value greater than during normal operation when the functions are within a system operational design domain.
US11299153B2	Vehicle traveling control apparatus A vehicle traveling control apparatus comprises a driving support ECU. The driving support ECU determines whether or not a driver of a vehicle is under an abnormal state where the driver losses an ability to drive the vehicle. The driving support ECU executes a deceleration control to decelerate the vehicle after an abnormal determination time point at which it is determined that the driver is under the abnormal state. The driving support ECU decelerates a vehicle speed of the vehicle to within a predetermined low vehicle speed range and thereafter, causes the vehicle to travel at a speed within the low vehicle speed range.
US11299151B2	Enhanced vehicle tracking The present invention relates to a method and system for accurately predicting future trajectories of observed objects in dense and ever-changing city environments. More particularly, the present invention relates to substantially continuously tracking and estimating the future movements of an observed object. As an example, an observed object may be a moving vehicle, for example along a path or road. Aspects and/or embodiments seek to provide an end to end method and system for substantially continuously tracking and predicting future movements of a newly observed object, such as a vehicle, using motion prior data extracted from map data.
US11299149B2	Considerate driving system Driving control systems and methods include a first vehicle having one or more processors programmed to receive an individual driving behavior model specific to a driver of a second vehicle proximate the first vehicle. The individual driving behavior model is based on historical driving behavior of the driver of the second vehicle. The one or more processors are programmed to identify a motion plan for the first vehicle based on the individual driving behavior model specific to the driver of the second vehicle, and to control movement of the first vehicle according to the identified motion plan.
US11299148B2	Travel control apparatus and vehicle The present invention provides a travel control apparatus for controlling traveling of a self-vehicle to avoid another vehicle on a front side, the apparatus comprising: a calculation unit for calculating a relative speed between the self-vehicle and the other vehicle; a state detection unit for detecting an operation state of the other vehicle; and a control unit for controlling avoidance processing of avoiding the other vehicle and causing the self-vehicle to pass a lateral side of the other vehicle, wherein the control unit changes a separation distance to separate the self-vehicle and the other vehicle in the avoidance processing in accordance with the relative speed calculated by the calculation unit and the operation state detected by the state detection unit.
US11299144B2	Method for providing vehicle-trajectory information and method for locating a pothole A method for providing vehicle-trajectory information. The method includes a read-in task, in which at least one item of inertial information is read in that indicates at least one parameter of a movement of a vehicle during travel. In addition, the method includes an acquisition task, in which location information is acquired that indicates the position of the vehicle during the movement. In a last determination task, the vehicle-trajectory information is determined using the inertial information and the location information, the vehicle-trajectory information representing the movement of the vehicle at the position.
US11299142B2	Hybrid electric powertrain architectures and control logic for vehicle response management Presented are hybrid electric vehicle (HEV) powertrains and control logic for vehicle response management, methods for making/operating HEV powertrains, and motor vehicles equipped with HEV powertrains. A method of controlling a hybrid powertrain includes receiving data indicative of a motor speed of a traction motor and torque commands for the motor, an engine, and an engine disconnect clutch (EDC). A vehicle controller uses a state observer module to estimate a jerk response based on the motor speed, and determines if the EDC is in a torque-transmitting active state. Responsive to the EDC being in the active state, the controller calculates an incremental feedback control signal that is predicted to reduce the estimated jerk based on the engine, motor, and clutch torque commands. One or more torque command signals are transmitted to the engine, motor and/or EDC to modulate a torque output thereof based on the incremental feedback control signal.
US11299139B2	Drive train for a vehicle A drive train for a vehicle includes a first electromagnetic device, a second electromagnetic device electrically coupled to the first electromagnetic device by an electrical power transmission system, and an engine coupled to the first electromagnetic device and configured to drive the first electromagnetic device to provide electrical energy. In all modes of operation where the engine drives the first electromagnetic device to provide the electrical energy, the first electromagnetic device operates without providing the electrical energy to an energy storage device.
US11299137B2	Lateral control for vehicle wireless charging guidance A method for providing low speed lateral steering control for an autonomously driven or semi-autonomously driven vehicle includes obtaining a desired final vehicle position relative to a current vehicle position, and calculating, by one or more data processors, a target vehicle position based on the current vehicle position and the desired final vehicle position. The method further includes calculating, by the one or more data processors, a road wheel angle command value based on the target vehicle position; determining, by the one or more data processors, a control signal based on the calculated road wheel command value; and providing the control signal to a steering controller.
US11299135B2	Vehicle brake control device A brake control device including a pressure adjusting unit including an electric pump and an electromagnetic valve, and that adjusts, using the electromagnetic valve, a brake liquid discharged by the electric pump to an adjusted liquid pressure and introduces the adjusted liquid pressure to the wheel cylinders of the rear wheels; and a master unit that includes a master cylinder and a master piston, and that includes a master chamber connected to the wheel cylinders of the front wheels and a servo chamber to which the adjusted liquid pressure is introduced and which provides, to the master piston, an advancing force that opposes a retreating force applied to the master piston by the master chamber.
US11299132B2	Driving support apparatus A driving support apparatus is provided with: a determinator configured to determine a collision probability; and a braking controller programmed to perform a braking control, and a preliminary braking control. The braking controller includes: a braking force increaser configured to increase the braking force applied in the preliminary braking control; and a braking force adjuster configured to perform adjustment, if the braking force applied at an end time point of the preliminary braking control is greater than the braking force applied at a start time point of the braking control in such a manner that a braking force applied in transferring from the preliminary braking control to the braking control has a small change amount, or in such a manner that it is greater than the braking force applied at the end time point of the preliminary braking control.
US11299127B2	Authorized operation of vehicles A system for starting a vehicle has a first apparatus having a microprocessor, a first data repository, a normally open electrical imposed between positive vehicle battery voltage and a keyed ignition switch, and a second electronic apparatus comprising a second microprocessor executing second coded instructions from a non-transitory medium, the second microprocessor coupled with the first microprocessor, a second data repository coupled to the second microprocessor and storing a list of identities of drivers authorized to operate the vehicle, and an input mechanism enabling a candidate driver to identify to the second microprocessor. The candidate driver identifies to the second microprocessor by the input mechanism, the second microprocessor, executing the second coded instructions, determines if the driver identity matches an identity on the list drivers authorized to operate the vehicle, and if so, causes the first microprocessor to close the normally open contact.
US11299120B1	Side airbag assemblies and methods of assembly A side airbag assembly is attachable to a frame of a seat of a vehicle. The side airbag assembly may include an inflatable airbag cushion in a packaged configuration. The inflatable airbag cushion may be inflated by an inflator in fluid communication with the inflatable airbag cushion to supply inflation gas to inflate the inflatable airbag cushion. The inflator may include an attachment stud to mount the airbag assembly to the side of a seat. The side airbag assembly may further include a wrapper configured to wrap around the inflator and the inflatable airbag cushion in the packaged configuration and a cap that is coupled to the wrapper. The cap is configured to enclose a first end of the inflatable airbag cushion in the packaged configuration.
US11299117B2	Energy absorbing device An energy absorbing device includes a deformable elongate member that is arranged in a manner such that the device, in use, deforms in a controlled manner upon the absorption of impact energy. The invention also provides a method for manufacturing the energy absorbing device.
US11299115B2	Power storage unit control device A power storage unit control device includes a discharging circuit that discharges from a power storage unit to a load, a control circuit that controls the discharging circuit, and a switching unit that executes a discharge prohibition mode in which discharge control of the discharging circuit by the control circuit is prohibited, if a stop signal based on an operation stopped state of a vehicle is received and a power source unit is greater than or equal to a predetermined voltage, and executes a discharge permission mode in which discharge control of the discharging circuit by the control circuit is permitted, if an operation signal based on the operating state of the vehicle is received and the power source unit is greater than or equal to the predetermined voltage.
US11299110B2	Acoustic insulation structure for power train An acoustic insulation structure for a power train according to the present disclosure is provided with a cover member that covers at least an internal combustion engine of the power train including the internal combustion engine, and that includes a pool portion in which water that has entered into the inside of the cover member pools; and a water-absorption member arranged at the inside of the cover member. The cover member includes a moisture outlet that releases, into the atmospheric air, moisture present inside the cover member. The water-absorption member extends to the moisture outlet from the pool portion.
US11299108B2	Vehicular camera with pliable connection of PCBS A vehicular camera configured to be disposed at a vehicle so as to have a field of view exterior of the vehicle includes a lens holder, an imager printed circuit board, a connector printed circuit board and a rear housing. The circuitry of the imager printed circuit board is electrically connected to the circuitry of the connector printed circuit board via a flexible electrical connector. The imager printed circuit board has an imager disposed at a side thereof and is attached to the lens holder with the imager side facing the lens. The imager printed circuit board and the connector printed circuit board are joined together via a pliable material. The rear housing is mated with the lens holder to encase the imager printed circuit board and the connector printed board.
US11299107B2	Camera signal monitoring apparatus and method The present invention provides a camera signal monitoring apparatus and method, the camera signal monitoring apparatus including a vehicle information input unit receiving a vehicle speed and a yaw rate signal of a vehicle; a navigation information input unit receiving a road curvature signal provided in a high precision map; a camera information input unit receiving a camera signal including a vehicle speed and a yaw rate signal from a vehicle front camera; and a monitoring unit calculating a reference curvature value based on at least one of the vehicle speed and the yaw rate signal of the vehicle, which are input from the vehicle information input unit, or the road curvature signal from the navigation information input unit, and determining a reliability by comparing the calculated reference curvature value with a curvature value calculated using the camera signal input from the camera information input unit.
US11299106B2	Mounting system for a mobile microphone A mounting assembly for a radio handset microphone including an adapter configured to couple to a mechanical hang-up clip. The adapter includes a housing configured to receive a magnet.
US11299104B1	Universal crossmember assembly for a roof rack of a motor vehicle A universal crossmember assembly is provided for a motor vehicle having a roof and first and second rails attached to the roof. The assembly includes a crossbar having first and second ends along an axis. The assembly further includes a first clamp mechanism engaged with the first end for securing the crossbar to the first rail. The assembly further includes a second clamp mechanism engaged with the second end for securing the crossbar to the second rail. Each clamp mechanism includes at least first and second jaws having an associated one of first and second rail gripping surfaces for gripping one of the rails when an actuator is moved to an actuated position. Each clamp mechanism further includes a biasing mechanism capable of urging the first jaw away from the second jaw when the actuator is moved to a non-actuated position.
US11299096B2	Rear-view mirror device mounted in a vehicle, vehicle-mounted display device, vehicle-mounted display system A glass plate includes a first arcuate surface at an outer circumferential edge part, the first arcuate surface facing a front surface side. A frame supports the glass plate from a rear surface side and includes a second arcuate surface in a portion toward the glass plate. A display unit is stored in a housing and outputs a display light toward the glass plate. A center C and a radius R of the second arcuate surface are made to be identical to a center C and a radius R of the first arcuate surface, respectively.
US11299092B2	Indoor illumination lamp An indoor illumination lamp includes a housing to be attached to an interior ceiling of a vehicle and provided with an opening, an interior light lens arranged at the opening of the housing, a chamber provided in the housing and surrounding the opening where the interior light lens is arranged, a light emitting diode arranged at a corner of the chamber and capable of emitting light toward the interior light lens, and a reflector arranged on an inner face in the chamber.
US11299091B2	Vehicle headlight and method for assisting a parking maneuver The invention relates to a vehicle headlamp (1) comprising; a high-resolution lighting apparatus (2) for projecting various light distributions onto a roadway area (4) positioned in front of a vehicle (3); an environmental detection device (5) for detecting at least one parking space (6) located in the environment surrounding the vehicle (3); and a control device (7) for dynamically controlling the lighting apparatus (2); wherein the environmental detection device (5) is designed to issue information corresponding to a detected parking space (6) to the control device (7), wherein the control device (7) is designed, in case the environmental detection device (5) detects a parking space (6), to control the lighting apparatus (2), under consideration of at least the information issued by the environmental detection device (5) related to the parking space (6), in such a manner that the lighting apparatus (2) at least projects a definable ground projection (8), which at least represents the vehicle length, onto the roadway area (4) in front of the vehicle (3).
US11299087B2	Light assembly for attachment to a surface of a vehicle A light assembly for attachment to a surface of a vehicle includes a vehicle base configured to be coupled to the surface of the vehicle, and a light head coupled to the vehicle base and including a plurality of light emitting diodes and a lens. The lens has a plurality of total internal reflection lenses. Each total internal reflection lens has a truncated frustoconical cross-sectional shape.
US11299085B2	Low beam and work light control for a work vehicle Systems, methods, and apparatuses for roadway illumination by an industrial vehicle are disclosed. A work light of the industrial vehicle is operated to provide illumination to an area located between a forward end of the industrial vehicle and an area illuminated by a low beam light. The work light and the low beam light are operated together to provide improved illumination during travel of the industrial vehicle along the roadway while promoting visibility of operators of oncoming vehicles.
US11299083B2	Stowable ramp system for livestock transport, and related methods of use An apparatus has: a livestock transport having a floor, walls, ground engaging members, and an access door opening; a ramp; and side panels that are pivotally connected to the walls of the livestock transport, in which the ramp and the side panels are configured to move between: a deployed position where the ramp extends from the access door opening and the side panels cooperate with the ramp to form a livestock loading chute; and a transport position where the ramp is stowed and the side panels are swung about to lie against the walls of the livestock transport. A kit has the ramp and side panels of the apparatus. A method of using the apparatus involves moving the ramp and side panels between the deployed position and the transport position to load, unload, and transport, respectively, livestock.
US11299081B2	Multifunction footrest apparatus for vehicle A multifunction footrest apparatus for a vehicle is provided in a space in which a passenger seat is positioned so as to be movable in a front-rear direction. The multifunction footrest apparatus may be inserted into and housed in a lower space under a dashboard including a glove box, and it may perform a massage and an acupressure for calves and soles of a back seat passenger by using a lower door including a first massage device and an upper door including a second massage device and an acupressure plate.
US11299079B1	Armrest with cushioned component having an integrated air channeling system An armrest assembly includes a body portion having a cushioned component, wherein the cushioned component includes first and second portions spaced-apart from one another. The cushioned component includes a porous lattice matrix. A duct assembly includes a main inlet and first and second outlets that are operably coupled to the first and second portions of the cushioned component, respectively. The duct assembly further includes first and second channels fluidically coupled to the first and second outlets, respectively. An air diverter member is pivotally supported between first and second positions and includes a channel disposed therethrough. The channel of the air diverter member opens into the first channel when the air diverter member is in the first position, and opens into the second channel when the air diverter member is in the second position for directing airflow to the first and second outlets, respectively.
US11299078B2	Armrest An armrest includes a first branch cable and a second branch cable, a frame, a skin covering the frame, and a foamed resin material. The frame includes a first routing section and a second routing section in which the first branch cable and the second branch cable are arranged, respectively. The foamed resin material is disposed on an inner side of the skin. The first branch cable and the second branch cable are disposed within the foamed resin material in the first routing section and the second routing section.
US11299077B2	Sensor disposition structure in seat A sensor disposition structure in a seat includes a cushion pad and a board-like member which is disposed under the cushion pad. A concave is formed in an upper surface of the board-like member, and a sensor is disposed in the concave.
US11299076B2	Seat A seat has a seat cushion unit including: a seat cushion frame; a seat pad which lies over the seat cushion frame; and a trim which covers the seat pad. The trim includes: a trim main body which mainly covers a top surface of the seat pad; a first trim joiner which extends from the trim main body to a backside of the seat cushion frame at the rear of the seat pad, and is fastened to the seat cushion frame; and a second trim joiner which is connected to a back surface of the trim main body in at least one of left and right end regions of the rear of the seat cushion unit, extends to the backside of the seat cushion frame at the rear of the seat pad, and is fastened to the seat cushion frame.
US11299073B2	Deployable driver station for an autonomous driving vehicle A deployable driver station including a seat utilizing both a front-facing driver seat bottom and a coupled rear-facing passenger seat bottom. In a driver configuration, the driver seat bottom is used in a conventional manner, being disposed behind the steering wheel or other steering control and the interior panel, while the passenger seat bottom is disposed more centrally within the passenger compartment. In a passenger configuration, the passenger seat bottom is used like the adjacent rear-facing passenger seat bottom(s), when used, while the driver seat bottom is disposed under the interior panel such that it does not take up space in the passenger compartment. Likewise, the steering wheel or other steering control is disposed under the interior panel. A common two-sided pivoting seat back is alternately used for the driver seat or the passenger seat by pivoting to an appropriate angle for the configuration.
US11299070B2	Electric seat slide device A screw shaft attached to the upper rail is screwed into a nut member attached to the lower rail. When the screw shaft is rotated with respect to the nut member by a drive unit, the screw shaft is moved rearward and forward with respect to the nut member, and the upper rail is also moved rearward and forward with respect to the lower rail. A fixing nut is fixed to an inner surface of the lower rail behind the nut member, and a stopper bolt is fastened to the fixing nut from below the lower rail. When the upper rail moves forward, a stopper portion provided at a tip of the stopper bolt contacts the stopper plate to restrict an excessive forward movement of the upper rail.
US11299052B2	Industrial truck comprising an electrical plug connector An industrial truck comprises a drive part comprising a battery compartment and a battery having a cladded exterior surface and is positioned within a housing. The housing is configured to be positioned within the battery compartment. An electrical plug connector is configured to be electrically connected to the battery such that the electrical plug connector is configured to supply power to the battery during a charging process. The electrical plug connector has a plug-in direction for an external electrical plug connector and the plug-in direction has an angle of 20° to 70° relative to a horizontal axis.
US11299045B2	Method for operating a display arrangement of a motor vehicle, operator control device and motor vehicle A method for operating a display arrangement of a motor vehicle, which includes at least two display devices each with a display surface. A visible display content can be shifted here three-dimensionally between two display planes. A detection and evaluation device of an operator control device carries out: acquisition of an operator control action by a touch-sensitive operator control surface, preferably a pulling and/or shifting gesture, and of its extension direction, and, on the basis of the determined extension direction, determination of a data set which describes the display content, as well as determination of a predetermined shift of a virtual image of the display content from one of the display planes to the other of the display planes.
US11299038B2	Fuel filler structure A fuel filler structure includes a vehicle body panel, a filler housing, a filler tube cap and a tether. The vehicle body panel defines a fuel filler opening. The filler housing has an outboard side and an inboard side. The outboard side is installed to the vehicle body panel at least partially surrounding the fuel filler opening and is dimensioned to receive and surround a portion of a fuel filler tube. The filler tube cap is configured to removably attach to the fuel filler tube at least partially within the filler housing. The tether is attached at a first end to the filler tube cap and is attached at a second end to the filler housing for pivoting movement about a vertical axis.
US11299032B2	Cooling apparatus and a cooling system provided with the same for autonomous driving controller A cooling apparatus for an autonomous driving controller may include, a chiller fluidically connected to an air-conditioning system through a refrigerant connection line so that a refrigerant circulating in the air-conditioning system provided in the vehicle is introduced into the chiller; a reservoir tank storing a coolant, and fluidically connected to the chiller; and a water pump mounted between the reservoir tank and the autonomous driving controller; wherein coolant pipes connected to the water pump and the chiller may be connected to the autonomous driving controller respectively.
US11299030B2	Smart mobile vehicle The present invention provides a smart mobile vehicle comprising a vehicle body, a chassis, driving wheels, a battery module, a plurality of motors and a vehicle control unit. The chassis has a suspension system, a brake system and a steering system. The two driving wheels are composed of a plurality of circular units, and the driving wheels are embedded in two-wheel frames on two sides of the vehicle body. The battery module provides the smart mobile vehicle with driving power. The plurality of motors disposed between the two circular units or on a surface of any one of the circular units; wherein the motors are electrically connected to the battery module, and the torque and directional outputs of the motors is used to drive the rotation of the two driving wheels. The vehicle control unit is electrically connected to the motors and the battery module to transmit a monitoring signal.
US11299029B2	Power transmission apparatus A power transmission apparatus is used in a vehicle and mounted on a vehicle member via a mount. The power transmission apparatus includes a case. The case includes a motor provided inside the case. The case includes a mount fastening portion for fastening the mount with a plurality of bolts. The mount fastening portion has a plurality of bolt tightening holes. The plurality of bolt tightening holes are provided so that the plurality of bolts are tightened into the plurality of bolt tightening holes. The bolt tightening holes have axial directions parallel to each other. A space isolated from an inside of the case is formed by a wall of the case in a region connecting two adjacent bolt tightening holes when the mount fastening portion is viewed in the axial directions of the plurality of bolt tightening holes.
US11299027B2	Power system for hybrid vehicles The present invention provides a power system for a hybrid vehicle, relating to the field of hybrid vehicles. The power system for a hybrid vehicle adopts a first planetary gear mechanism with two sun gears, the first sun gear rotates with an input shaft, the second sun gear and the input shaft are independent of each other, and the second sun gear achieves different motion states through a second brake or/and a second clutch, and cooperates with a first brake to provide different transmission ratios of four to six gears when an engine and motors are in driving, so that the power system is simple in structure and low in cost, and the fuel economy and acceleration dynamic performance of the power system are improved.
US11299026B2	Hybrid powertrain with two electric machines and an internal combustion engine A drive train for a hybrid motor vehicle comprises a gearbox input shaft, which is operably linked to a first electric machine and an internal combustion engine by a first partial drive train for torque transmission and is operably linked to a second electric machine by a second partial drive train for torque transmission. The second electric machine is permanently connected to the gearbox input shaft for torque transmission. The first electric machine and the internal combustion engine can be connected in a couplable manner to the gearbox input shaft for torque transmission.
US11299020B2	Vehicle-body structure of vehicle There are provided a vehicle-body frame member forming an opening portion for entrance at a vehicle side part and a front side door provided so as to open and close the opening portion. The vehicle-body frame member comprises a side sill, the front side door comprises a door panel portion provided with an inner lower portion which overlaps with the side sill in a vehicle wide view and reinforcement portions provided at three side-portions of a peripheral part of the door panel portion which are continuous and include the inner lower portion such that the reinforcement portions overlap with the vehicle-body frame member in a vehicle side view.
US11299014B2	Refrigeration cycle device A refrigeration cycle device includes a high-temperature side heat exchanger, an expansion valve for decompressing the refrigerant flowing out of the high-temperature side heat exchanger, a low-temperature side heat exchanger that exchanges heat between the refrigerant decompressed by the expansion valve and coolant, a high-temperature coolant circuit in which the coolant circulates to the high-temperature side heat exchanger, a low-temperature coolant circuit in which the coolant circulates to the low-temperature side heat exchanger, a battery and a low-temperature side radiator configured to exchange heat with the coolant in the low-temperature coolant circuit; and a heat transfer portion configured to transfer heat from the high-temperature coolant circuit to the low-temperature coolant circuit such that the coolant dissipates heat in the battery and the low-temperature side radiator.
US11299010B2	Alertness maintenance apparatus An alertness maintenance apparatus includes a stimulation controller that is configured to cause a stimulation device to generate multiple types of temperature stimuli maintaining an alert state of a subject person, the temperature stimuli including a temperature stimulus to a hand of the subject person and also including a temperature stimulus to a face of the subject person or a temperature stimulus to a torso of the subject person via a seat on which the subject person sits.
US11299009B2	Vehicle HVAC system with modular door design A modular door for a vehicle HVAC system includes a door plate, a first shaft, and a second shaft. The door plate has a front surface extending between an upper edge surface and a lower edge surface. The upper edge surface defines a first array of keyed orifices. The lower edge surface defines a second array of keyed orifices. The first shaft has a first keyed protrusion that is disposed within a first keyed orifice of the first array of keyed orifices. The second shaft has a second keyed protrusion that is disposed within a first keyed orifice of the second array of keyed orifices. The first keyed orifice of the first array of keyed orifices and the first keyed orifice of the second array of keyed orifices form a pair of axially aligned keyed orifices.
US11299007B2	Support device and air conditioning system for vehicle A support device secures first tubes and second tubes to a vehicle body. The first tubes and the second tubes extend outward from an air conditioning case of a vehicle air conditioning system. The support device is outside the air conditioning case. The support device includes a first bracket in contact with the first tubes, and a second bracket in contact with the second tubes. The support device includes a common bracket coupled to both of the first bracket and the second bracket. The common bracket and the first bracket are in contact with the first tubes from opposite sides, holding the first tubes therebetween. The common bracket and the second bracket are in contact with the refrigerant tubes from opposite sides, holding the refrigerant tubes therebetween.
US11299006B2	Thermoregulation system for an electrically driven vehicle, and vehicle comprising such a system This thermoregulation system (1) for an electrically driven vehicle (V), the vehicle comprising at least one electric machine (E), at least one battery (30), and at least one power electronics component (37), comprises a coolant circuit (5), a pump (7), coolant heat exchangers, connected to the coolant circuit (5) so that the coolant may circulate through them and comprising a main exchanger (9), configured for exchanging heat between the coolant and air coming from the outside of the vehicle (V), at least one battery exchanger (11), configured for exchanging heat between the coolant and said at least one battery (30), and at least one secondary exchanger (13, 36), configured for exchanging heat between the coolant and said at least one electric machine (E) and/or said at least one power electronics component (37). The coolant circuit (5) is divided in a first branch (B1), which comprises the main exchanger (9) and the at least one battery exchanger (11), a second branch (B2) which comprises the at least one secondary exchanger (13, 36), the coolant being circulated in parallel in the first and second branches (B1, B2), and a pump branch (PB) to which the pump (7) is connected, the pump branch (PB) being connected to the first and second branches (B1, B2) by an upstream and a downstream connection points (P1, P2) so that the coolant circulating in the pump branch (PB) is formed by a mix of the coolant circulating in the first branch (B1) and of the coolant circulating in the second branch (B2), and is directed towards the first and second branches (B1, B2) downstream the pump (7).
US11299004B2	Sway bar linkage assembly A sway bar linkage assembly includes a socket joint, a shank extending from the socket joint, a bolt, and a bushing. The shank has a first bore with a first bore diameter and a second bore extending between the first bore and the socket joint. The second bore has a second bore diameter less than the first bore diameter such that a flange extends between the first bore and the second bore. The bolt has a head, a shaft extending from the head and a stud extending between the shaft is included. The shaft has a first diameter and the stud has second diameter less than the first diameter such that a ledge extends between the shaft and the stud. The bushing is compressed a predefined by the bolt when the bolt extends through the bushing and the ledge of the bolt abuts against the flange of the shank.
US11299001B2	Electrically powered suspension system An electrically powered suspension system includes: an electromagnetic actuator configured to generate a driving force related to vibration damping of the vehicle; an information acquisition unit configured to acquire information on a stroke velocity of the electromagnetic actuator; a target damping force calculation unit configured to calculate a target damping force based on the stroke velocity; a drive control unit configured to control driving of the electromagnetic actuator based on the target damping force; and a filter processing unit configured to perform a filtering process by applying a predetermined filtering characteristic to the stroke velocity. The filter processing unit has a plurality of filtering characteristics set in a second frequency region, which has a frequency higher than that of a first frequency region. The filter processing unit selectively applies, among the plurality of filtering characteristics, one filtering characteristic that is based on the stroke velocity to the stroke velocity.
US11299000B2	Electrically powered suspension system An electrically powered suspension system 11 achieves vibration control of a vehicle without disturbing a vehicle behavior and impairing riding comfort even if an electric motor 31 of an electromagnetic actuator 13 generates excessive heat, wherein the electromagnetic actuator 13 includes the electric motor 31 generating a driving force for vibration damping and extension/contraction; a target damping force setting part 51 setting a target damping force; a target extension/contraction setting part 53 setting a target extension/contraction force; and a drive controller 49 performing the drive control of the electric motor 31 using a drive force based on the target damping force and target extension/contraction force by limiting the motor current not to exceed a current threshold that is an addition of a damping current threshold and extension/contraction current threshold, which thresholds are separately configured considering a priority of riding comfort and steering stability.
US11298996B2	Articulation system for commercial road vehicles An articulation system (1) for interconnecting first and second vehicle units of an articulated road vehicle comprises a central element (2) including a vertical cylinder with left and right arcuate walls (4) extending between two facing openings. First and second interconnecting structures (5) are joined to the central element (2) and are adapted to be respectively attached to the first and second vehicle units on opposed sides of the central element (2). Each interconnecting structure has a pitch joint member (5a) and a yaw joint member (5b). The pitch joint member (5a) has a frame (7) perpendicular to a longitudinal axis of a corresponding one of the first and second vehicle units and a pitch hinge mechanism (6) at a floor level to interconnect with the corresponding one of the first and second vehicle units. The yaw joint member (5b) has a frame (8) perpendicular to the longitudinal axis of the corresponding one of the first and second vehicle units and left and right arcuate walls juxtaposed to the left and right arcuate walls (4) of the vertical cylinder and rotatable therearound. The frame (7) of the pitch joint member (5a) and the frame (8) of the yaw joint member (5b) are juxtaposed and mechanically linked to jointly form a planar roll joint mechanism.
US11298993B2	Detection of trailer detachment from a vehicle A system for monitoring a trailer includes a detection device configured to monitor a connection between a coupler attached to the trailer and a trailer hitch attached to a vehicle and generate data related to the connection, and a processing device configured to receive the data from the detection device, and analyze the data to detect whether a partial detachment condition is present. Based on detecting the partial detachment condition, the processing device is configured to generate a notification to a driver to alert the driver of the partial detachment condition and/or control operation of the vehicle.
US11298988B2	Rotary joint assembly for a tire inflation system A rotary joint assembly for a tire inflation system for a vehicle includes a stationary portion defining a first fluid passage. The stationary portion includes a support portion and having a first annular sealing face. The first fluid passage ending in the first annular sealing face. The assembly also includes at least one bearing and a rotatable portion rotatably mounted on the support portion by way of the at least one bearing. The rotatable portion defines a second fluid passage and has a second annular sealing face, the second fluid passage ending in the second annular sealing face. The rotatable portion defines an axis of rotation of the rotatable portion and a radial direction oriented perpendicular to the axis of rotation. The at least one bearing supporting an inner face of the rotatable portion, wherein the inner face of the rotatable portion faces toward the axis of rotation. An annular seal chamber is radially disposed between the first annular sealing face and the second annular sealing face and provides fluid communication between the first fluid passage and the second fluid passage. The at least one bearing and the annular seal chamber at least partially overlap along an axial direction oriented in parallel to the axis of rotation.
US11298982B2	Tread for a pneumatic tire A tread for a tire includes: a first tread zone extending circumferentially, continuously, and entirely around the tire, the first tread zone being formed of a first compound; a second tread zone extending circumferentially, continuously, and entirely around the tire, the second tread zone being formed of a second compound different from the first compound; and a boundary groove axially separating the first tread zone from the second tread zone, the first tread zone, the second tread zone, and the boundary groove entirely forming the tread, the boundary groove having an axial centerline disposed an axial distance from an equatorial plane of the tire. The first tread zone has a first circumferential groove and a sidewall portion defining an intermediate circumferential rib of the first tread zone and a shoulder circumferential rib of the first tread zone.
US11298979B2	Non-pneumatic tire The disclosed technology generally relates to a tire, and more particularly to a non-pneumatic tire that has handling performance similar to a pneumatic tire, supports the load of a vehicle and improves riding comfort by employing a parametric structure. In one aspect, a non-pneumatic tire includes a tread that comes in contact with the ground, a rim that is connected with an axle, and a spoke unit that functions as a structural support between the rim and the tread, in which the spoke unit is formed by circularly arranging spokes. The spokes have a single closed-loop longitudinal cross-section circumscribed to the rim and around the center of the tire.
US11298976B2	Bearing device for vehicle wheel In a bearing device for a vehicle wheel (1), a large-diameter section (2i) is formed on an outer side of a fitting cylinder section (2h), and a small-diameter section (2j) is formed on an inner side of the fitting cylinder section (2h). A cap member (8) is formed by bending a metal steel plate, and has a cover plate section (81) which closes the inner open end of an outer member (2) and a fitting section (82) which is fitted over the small-diameter section (2j). A tapered portion (83) based on the spring back angle θ of the fitting section (82) is provided at the outer peripheral edge of the outer end section of the fitting section (82).
US11298975B2	Vehicle wheel A vehicle wheel includes: a rim including a well portion and a guide member; and a sub-air chamber member serving as a Helmholtz resonator. The well portion has an outer circumferential surface extending in a wheel circumferential direction of the vehicle wheel. The guide member engages with the sub-air chamber member to guide the sub-air chamber member on the outer circumferential surface in the wheel circumferential direction, thereby to attach the sub-air chamber member to the rim.
US11298969B1	Marking device holder The marking device holder may comprise a body, an instrument holder, and a plurality of touch points. The marking device holder may be operable to move a writing instrument over a writing surface in a straight line. The writing instrument may detachably couple to the instrument holder such that the writing instrument contacts the writing surface. The plurality of touch points may form a stable base for the body that may resist tipping and may reduce friction during forward motion of the body. As non-limiting examples, the writing instrument may be a pen, a pencil, a mechanical pencil, a marker, or a stylus. As non-limiting examples, the writing surface may be paper or a device screen.
US11298968B2	Method for labeling products with a transparent photoluminescent label, and transparent photoluminescent label A method for marking a product (1) with a photoluminescent mark, said mark comprising a photoluminescent portion (10) which is transparent under normal light conditions and revealed by photoluminescence under UV illumination, said mark further comprising a non photoluminescent portion (9) which is transparent under normal light conditions as well s under UV illumination, said method comprising: deposing on said product a stack, said stack comprising alternatively layers (2,4) such as AlN, with a thickness of less than 1 micron and layers (3) of a second material, such as GaN with a thickness of less than 10 nm; raising the transparency of said non photoluminescent portion (10) with a deposition of transparent material (6) or incorporation of ions into said non photoluminescent portions.
US11298960B2	Printer device and control method of printer device A printer device includes a transport mechanism that transports a continuous sheet in which a plurality of printing media are spaced apart from each other by a gap width and attached on a mount, a transmission sensor that detects transmittance of the continuous sheet, and a control unit that adjusts the transmission sensor. The control unit transports the continuous sheet in the +Y direction by using the transport mechanism, performs reverse transport control to transport the continuous sheet in the −Y direction by a reverse-feed distance that is greater than the gap by using the transport mechanism when the head position of a printing medium is detected by the transmission sensor, and adjusts the transmission sensor after the reverse transport control.
US11298959B2	Active energy radiation unit and active energy radiation device An active energy radiation unit includes a light source which radiates ultraviolet rays onto a target object, and a main gas supply mechanism which is disposed to be adjacent to the light source and ejects an inert gas. The main gas supply mechanism includes a receiving part which receives the inert gas, and a main ejection port which is provided at a position between the receiving part and the light source and closer to the target object than the receiving part. A flow path area from the receiving part to the main ejection port is constant.
US11298949B2	Printing agent containers It is disclosed a printing agent container having ink an authenticity detection mechanisms comprising: a receptacle having a top wall a bottom wall opposing such top wall and a sidewall between such top wall and such bottom wall; an internal volume defined by such receptacle that contains a printing agent, and a vibration transducer on one of the side walls, wherein the container is to be mechanically coupled to a carriage so that the printing fluid is disposed on the bottom surface, being the vibration transducer to detect a vibration signal induced by the carriage and wherein the container comprises a communication channel to a controller being the controller to receive through the communication channel a container signature from the vibration transducer and to identify a container identification signal associated to the container signature.
US11298948B2	Liquid consuming apparatus There is provided a liquid consuming apparatus including: a liquid consuming section; a tank having a liquid storage chamber and an inlet port; a cap; and a casing having a cover movable with respect to the tank between a closed position and an open positon. The cover has an inner surface and a projection projected from the inner surface toward the tank. The projection of the cover is provided with a pressing portion facing the outer surface of the cap at a predetermined spacing distance, under a condition that the liquid consuming apparatus is in a normal state in which the cover is in the closed position and that the cap is installed in the inlet port, and the pressing portion abuts firstly against the outer surface, under a condition that the cap is moved in the insertion direction for allowing the cap to be removed from the inlet port.
US11298946B2	Liquid supply apparatus and image recording apparatus A liquid supply apparatus a tank and a cartridge attachable to the tank along an attachment direction crossing a vertical direction. The ink cartridge includes a first storing chamber configured to store liquid therein. The tank includes a second storing chamber configured to store liquid therein, a liquid channel and an air channel, which both communicate with the second storing chamber. When the cartridge is attached to the tank with the first storing chamber of the cartridge communicating with the liquid channel and the air channel, the first storing chamber has a portion located above the liquid channel and the air channel. The second storing portion has a first area located above a lower end of the first storing chamber of the cartridge in the vertical direction and a second area continuous with the first area and located below the first storing chamber of the cartridge in the vertical direction.
US11298945B2	Liquid replenishing system A liquid replenishing system includes a liquid tank and a liquid storage bottle for storing liquid to be replenished to the liquid tank. The liquid tank includes a tank body, a cylindrical adapter, and a needle penetrating into the tank body inside the cylindrical adapter. One end of the needle is located outside the tank body and another end of the needle is located inside the tank body. The liquid storage bottle includes a bottle body, a nozzle having an ejection port for ejecting a liquid stored in the bottle body, and includes a slit valve provided at the ejection port. In a case where the nozzle of the liquid storage bottle and the cylindrical adapter of the liquid tank are fitted to each other, one end of the needle is inserted into the slit valve so that the liquid storage bottle is secured to the liquid tank.
US11298942B2	Liquid jetting apparatus A liquid jetting apparatus includes: individual channels; and a manifold commonly provided for the individual channels. Each of the individual channels has: a nozzle; a pressure chamber arranged away from the nozzle in a predetermined direction to extend along a plane orthogonal to the predetermined direction and connected to the manifold, a connecting channel connected to the pressure chamber to form at least a part of a channel communicating the pressure chamber and the nozzle, and a circulation channel connected to the connecting channel to form a part of a channel communicating the connecting channel and the pressure chamber. The connecting channel has a throttle, and the throttle has a smaller diameter along the plane orthogonal to the predetermined direction than a diameter, of a part of the connecting channel except the throttle, along the plane orthogonal to the predetermined direction.
US11298937B2	Printing apparatus and control method therefor A method for inspecting an ink discharge status based on a temperature change of an energy generating element includes calculating a difference value between a value obtained by statistics of information indicating ink discharge statuses obtained for a plurality of nozzles close to a target nozzle and the information obtained for the target nozzle; comparing the calculated difference value with a predetermined threshold; and judging the ink discharge status for the target nozzle based on a result of the comparison. This enables to appropriately detect a nozzle which is in a discharge failure status due to an ink droplet adhered to a discharge surface of a printhead or the like.
US11298935B2	Wash-up blade Provided is an apparatus suitable for use as a printer wash-up blade. Also provided is a method of cleaning a roller on a rotary printing press using the above apparatus.
US11298924B2	Component with bonded thermoplastic and thermoset layers A component is provided that includes a multi-layer body configured with a thermoplastic layer, a thermoset layer and a scrim at an interface between the thermoplastic layer and the thermoset layer. The thermoplastic layer includes a plurality of reinforcement particles within a thermoplastic matrix. The thermoset layer is configured from or otherwise includes a thermoset matrix.
US11298923B2	Edifice sealing web, and process for manufacturing same An edifice sealing web that includes a sealing web facing away from the edifice, an adjoining barrier layer which extends on the side facing the edifice and is based on mixtures of homopolyamides and/or copolyamides, and a self-adhesive layer.
US11298920B2	Silicone rubber and fiber-resin composite-based laminated product A laminated product (10) comprises at least: a layer (1) of silicone rubber, in particular of the high temperature crosslinking type, such as, for example, a silicone rubber of VMQ or PVMQ grade the said layer (1) of silicone rubber being sandwiched between two layers (2) of fibre-resin composite comprising filaments (3) of an inorganic substance (4), in particular glass, embedded in a thermoset resin (5), such as, for example, a vinyl ester resin. The silicone layer has a thickness, denoted T1, of between 1.5 and 3 times the thickness T2 of each layer of fibre-resin composite, which is between 0.25 and 2 mm. Such a laminate may be used in the manufacture of a finished article, in particular of a non-pneumatic wheel or tire.
US11298919B2	Interlayer for laminated glass, and laminated glass Provided is an interlayer film for laminated glass with which both the reflected double images and the transmitted double images can be suppressed in the laminated glass. An interlayer film for laminated glass according to the present invention is an interlayer film for laminated glass used for laminated glass that is a head-up display, in which the interlayer film includes a region for display corresponding to a display region of the head-up display, the interlayer film has one end and the other end on the opposite side of the one end, the other end has a thickness larger than a thickness of the one end, an absolute value of difference between a maximum value of measured values of variation in thickness and a minimum value of measured values of variation in thickness is 32 μm or less when the variation in thickness is measured in a distance of 80 mm centered at points of every 2 mm intervals in a direction connecting the one end and the other end in the region for display from the one end to the other end, and a region of the other end side from the region for display has a wedge angle that is smaller than a wedge angle of the region for display.
US11298918B2	Visibly transparent broadband infrared mirror films having fluoropolymers and 7:1:1:7:1:1 layer thickness ratio Multilayer infrared (IR) reflecting films are provided. An optical repeating unit of the film include a plurality of optical polymeric layers arranged to reflect light by constructive and destructive interference. Optical layer A is a high refractive index polymeric layer, and optical layer B is a low refractive index isotropic polymeric layer containing fluoropolymers. The film has an average reflectance of about 50% to about 100% in a near infrared wavelength range of about 850 nm to about 1850 nm, and an average transmission of about 70% to about 90% in a visible light range.
US11298910B2	Sheet folding apparatus A sheet folding apparatus includes a sheet folding unit disposed to fold a sheet and a conveyance unit disposed to feed the sheet to the sheet folding unit in a feed direction orthogonal to a fold direction of the sheet folding unit while correcting a skew of the sheet. The conveyance unit includes an elongated reference guide, a conveyance mechanism disposed to convey the sheet in the feed direction while exerting a force on the sheet toward the reference guide, an adjustment mechanism disposed to adjust an inclination of the reference guide with respect to the feed direction. The apparatus further includes an input unit through which a user inputs a folding misalignment amount of the sheet folded by the sheet folding unit. The inclination of the reference guide is corrected by the adjustment mechanism based on at least the folding misalignment amount inputted through the input unit.
US11298906B2	Groove plate platform for vertical press machines A press plate block is provided and has capacity to conduct and transfer heat, a mounting interface for mounting the block onto a press machine, a press surface defining a press footprint the press surface elevated above the rest of the top surface area and having a peripheral edge, a first and second interface for accepting heating and temperature sensing components, a first radiused groove disposed adjacently to the peripheral edge of the press surface and a second radiused groove disposed orthogonally to the first groove, the second groove intersecting the first groove at a lower elevation, the second groove breaking out of the block at one end of the block.
US11298901B2	Article of footwear with fluid-filled element Articles of footwear include an upper and a sole structure having a fluid-filled element in the heel region. The fluid-filled element includes: (a) an upper surface, (b) a lower surface, and (c) an outer peripheral surface extending between the upper surface and lower surface. The fluid-filled element also includes a pair of spaced apart, substantially U-shaped voids that extend through a central region of the fluid-filled element. A first void of the pair of voids is located closer to a forward end of the fluid-filled element than a second void of the pair. Both the first void and the second void have an open portion of its U-shape oriented toward the forward end of the fluid-filled element.
US11298894B2	Method and device for producing a fiber-reinforced plastic component A method for producing a fiber-reinforced plastic component includes inserting a fiber preform, which is arranged on a fluid-filled hollow core, in a mold that has at least two mold parts, closing the mold, the fiber preform and the hollow core being received in a mold cavity defined by the at least two mold parts, filling the cavity with a plastic material and curing the plastic material in the closed, heated mold. The internal pressure in the mold is measured during the curing of the plastic material and the distance between the at least two mold parts is increased when the pressure exceeds an upper threshold value.
US11298893B2	Method for manufacturing structure using composite material Manufacturing structure using a composite material includes: a tapering step for forming a first tapered surface on a first stiffener in an uncured state; a bending step for bending the stiffener such that a second surface is on the inner side; an arranging step for arranging the first stiffener and a skin at prescribed positions; a vacuum suctioning step for vacuum suctioning the first stiffener and the skin; and a bonding step for curing the first stiffener to bond the first stiffener and the skin. In the tapering step, the angle formed between the first tapered surface and the second surface is an acute angle. In the vacuum suctioning step, the first tapered surface is brought into contact with the skin while maintaining contact between the first surface and the skin, and the first stiffener is deformed so that a second tapered surface is formed on the second surface.
US11298889B2	Laminated sealing member for prosthetic heart valve An implantable prosthetic valve that is radially collapsible to a collapsed configuration and radially expandable to an expanded configuration comprises an annular frame having an inflow end and an outflow end, a leaflet structure positioned within the frame and secured thereto, and a laminate sealing member comprising an encapsulating material. The laminate sealing member has a main portion that encapsulates at least a portion of the frame and an end portion extending from the inflow end of the frame, and the end portion of the laminate sealing member is folded to form a cuff adjacent the inflow end of the frame and secured to the main portion of the laminate sealing member.
US11298887B2	Packages configured for improved sealing A package is provided that is formed from a packaging material, such as film, having increased adhesive in critical locations, such as adjacent folds in the end seal and other areas so that that the increased adhesive can at least partially fill voids adjacent such folds. The additional, localized sealant material is applied in a plurality of discrete locations in the end seal or other region adjacent where folds are formed and overlap with a sealant layer so as to provide additional sealant material for at least partially filling the voids without being present throughout the entirety, majority or large portions of the packaging material.
US11298886B2	Method and device for connecting fibre-reinforced webs A process for joining two sheeting articles reinforced with unidirectionally aligned endless-fibres by ultrasonic welding, wherein the fibres are embedded in a matrix of polycarbonate and the sheeting articles have abutting ends that are substantially rectangular and substantially even. The process comprises (1) arranging the sheeting articles next to one another end-to-end in the region of the abutting ends in a welding apparatus between a sonotrode and an anvil, (2) welding the sheeting articles by means of ultrasound, wherein the sonotrode and the anvil exert pressure on the to-be-welded sheeting articles in the melting region between the sheeting articles and perpendicularly to the abutting ends of the sheeting articles, and (3) removing the sheeting articles that are welded to one another from the welding apparatus. Also provided is a second process for joining two sheeting articles, a sheeting article, an apparatus, and a multilayer composite.
US11298885B2	Three-dimensionally article with knock out support defined with build material A method of manufacturing a three-dimensional article includes (1) receiving a data file, (2) analyzing the data file, and (3) defining a support structure. The data file defines a hollow three-dimensional article to be formed from a build material. Analyzing the data file includes identifying an opening that converges to an apex along the sequence of layers. The opening is at least partly defined by an inside edge of the three-dimensional article. The support structure is attached to the edge and closes the opening. The support structure includes a structural sheet portion and an interface web portion. The structure sheet portion defines a majority of an area of the support structure except for a boundary contour between the structural sheet portion and the inside edge. The interface web portion closes the boundary contour and defines a weakness contour for removing the structural portion from the three-dimensional article.
US11298883B2	Determining property mapping resources with property constraints in an additive manufacturing In an example, a method includes receiving, at a processor, a plurality of property parameter sets representing attainable property combinations in additive manufacturing and being associated with print material description. A constraint of a first property of the property parameter sets may also be received and a hull of a property mapping resource for use in determining additive manufacturing instructions for generating an object in which the first property meets the received constraint may be determined.
US11298882B2	Carriage synchronization of a multi-carriage three-dimensional printer An example three-dimensional printing system includes a first carriage, a second carriage, and a synchronization controller. The synchronization controller is coupled to the first carriage and the second carriage to synchronize movements of the first carriage and the second carriage. The synchronization controller is to avoid interference between the first carriage and the second carriage.
US11298880B2	Freezing method for cleaning an additive manufacturing part The present invention relates to a method for removing powder from a component or part produced by a powder bed additive manufacturing system. The method comprises the steps; providing a part, the part having at least one internal cavity with at least one external opening, the at least one cavity being at least partly filled with powder grains, the powder grains being connected to each other and to the walls of the cavity by mechanical, frictional, electrical, physical or chemical forces; adding medium in liquid phase to the at least one cavity of the part, the liquid having the property that it expands in phase transition from liquid to solid phase; transforming added medium to solid phase to loosen and break up at least a fraction of the powder grains connections from each other; and removing powder from the at least one internal cavity.
US11298876B2	Three-dimensional printing An example of a three-dimensional (3D) printing kit includes a build material composition and a fusing agent to be applied to at least a portion of the build material composition during 3D printing. The build material composition includes a polyamide having: an avalanche angle ranging from about 35 degrees to about 55 degrees; a break energy ranging from about 25 kJ/kg to about 57 kJ/kg; and an avalanche energy ranging from about 7 kJ/kg to about 22 kJ/kg. The fusing agent includes an energy absorber to absorb electromagnetic radiation to coalesce the polyamide in the at least the portion.
US11298874B2	3D printing of an intraocular lens having smooth, curved surfaces A continuous additive fabrication system comprises a bath of photopolymer resin and a light source assembly having a light source and a motorized variable aperture. The light source assembly is operable to generate a focus point in the bath of photopolymer resin, the shape of the focus point at a curing plane within the bath of photopolymer resin corresponding to the shape of the motorized variable aperture. The continuous additive fabrication system further comprises a platform configured to support a build object and a drive mechanism (coupled to at least one of the platform and the light source assembly) configured to continuously move the curing plane through the bath of photopolymer resin. A size and/or shape of the motorized variable aperture is changed while the curing plane in continuously moved through the bath of photopolymer resin.
US11298872B2	Removable build plate for three-dimensional printers A removable and replaceable build plate for a three-dimensional printer supports magnetic coupling to a printer and advantageous adhesion for an initial layer of build material.
US11298869B2	Method and apparatus for producing a high aspect ratio nanostructured foil by extrusion coating or extrusion casting A solid nano- or micro-structured thermoplastic foil including a nano- or micro-structured surface area is produced by providing an extrusion casting roller for an industrial polymer extrusion casting process using a thermoplastic material, applying a nano- or micro-structured surface on the extrusion casting roller, maintaining a temperature of the casting roller below a solidification temperature of the thermoplastic material while the casting roller and the counter roller are rotating, and continuously applying a melt of the thermoplastic material between a counter roller and the casting roller while the casting roller and the counter roller are rotating. A rotational velocity of the casting roller may be 10 meters/minute. The melt of the thermoplastic material is moved between the casting roller and the counter roller while the rollers are rolling, and the melt of the thermoplastic material is solidified upon contact with the casting roller to form the thermoplastic foil.
US11298868B2	Manufacturing method of reinforced layer A manufacturing method for manufacturing a reinforced layer constituting a high-pressure tank includes: a first forming step of forming a cylindrical pipe portion and extending in an axial direction of the high-pressure tank, the pipe portion including a first end portion including a first end and a second end portion including a second end, the pipe portion being formed to have a first stepped portion such that the first stepped portion projects outwardly at a position distanced from the first end in the axial direction by a first distance; a first placing step of placing the first end inside a first dome portion by moving at least either of the first dome portion and the pipe portion until a first bottom end portion of the first dome portion abuts with the first stepped portion; and a first joining step of joining the pipe portion to the first dome portion.
US11298860B2	Golf ball and method of manufacture A method for manufacturing a golf ball having a core, an intermediate layer and a cover that is formed of a resin material composed primarily of a polyurethane resin and has a thickness of 0.1 mm to 0.7 mm by injection molding the cover using a vertically separating two-part injection mold having specific gate and support pin configurations. This method enables a relatively soft urethane resin cover that is thin and of high quality to be formed, and has a good golf ball productivity.
US11298854B2	3-D printed master model This disclosure concerns a master model for the production of a mold, comprising: (a) a first part, a second part comprising a textured surface; wherein the first part and the second part are connected.
US11298852B2	Device and method for producing reaction plastics A device and a method for producing reaction plastics, including a first metering device with a first metering unit and a second metering unit, each of which is suitable for receiving and dispensing a first mixing component in a metered manner, a second metering device which is suitable for receiving and dispensing a second mixing component in a metered manner, and a mixing device which is suitable for receiving and mixing the first mixing component dispensed by the first metering unit and/or the second metering unit of the first metering device and the second mixing component dispensed by the second metering device. For this purpose the first metering unit and the second metering unit are connected to the mixing device such that prior to beginning the mixing process, the first mixing component can be brought to an operating state required for the mixing process, in particular an operating pressure, by guiding the first mixing component from the first metering unit to the second metering unit via the mixing device.
US11298847B2	Device and method for cutting an extruded pipe to length A method cuts an extruded pipe to length using a separating device. The separating device includes a separator rotating about an extrusion axis of the extruded pipe, the separator being rotatably mounted in the separating device, and cutting tools being arranged on the separator. The cutting tools are configured to carry out the separation. The method includes transferring energy to move the cutting tools. The energy is transferred from a stationary outer region of the separating device to a movable inner region of the separating device. The energy is transferred continuously or cyclically and the transferred energy is buffered in an energy storage device. The energy is transferred inductively or capacitively. A discharge time of the energy storage device is between 2% and 25% of a total separation cycle.
US11298845B2	Razor docking A shaving razor system includes a razor handle that docks with a razor cartridge. The handle is configured to dock with the razor cartridge using a single hook configured to mate with a cartridge tab. A central pushrod is mounted with a spring into the handle and is configured to exert a pushing force on the mounted cartridge. To eject the cartridge, the single hook may be pushed to pivot to the side of the cartridge tab, and thereby release the razor cartridge by ejecting it with the spring loaded pushrod.
US11298843B2	Shaving cartridges pivotable about two axes A connector for attaching a cartridge to a handle. The connector is adapted to rotate around a rocking axis with respect to the handle. The connector includes a pair of arms adapted to attach the connector to the cartridge, a holder adapted to attach the connector to the handle, and at least a pair of resilient lateral tongues protruding from the connector and positioned symmetrically with regard to a connector axis. One of the lateral tongues is adapted to flex when the connector is rotated in a first direction around the rocking axis, and the other lateral tongue is adapted to flex when the connector is rotated in a second direction around the rocking axis.
US11298841B2	Hair cutting system and attachment There is disclosed an attachment (22) for a cutting head (100) of a hair cutting device (1). The attachment (22) comprises first and second side portions (24, 26) configured to cover, respectively, first and second sides (112, 114) of a stationary cutting member (115) of the cutting head (100), and an intermediate portion (28) interconnecting the first and second side portions (24, 26) and configured to cover an outer surface (120b) of a first wall portion (120) of the stationary cutting member (115). The first and second side portions (24, 26) are configured to protrude relative to the plurality of primary cutter teeth (118) of the stationary cutting member (115), which define a cutting zone of the cutting head. The first and second side portions (24, 26) and the intermediate portion (28) define a recess exposing the primary cutter teeth (118) of the stationary cutting member (115). The recess is non-interrupted over a distance of at least 50% of the length of the cutting zone.
US11298840B2	Rotary electric shaver A rotary electric shaver includes a main body in which a first transmission mechanism, and a connecting portion is disposed; a head unit in which a plurality of blade units each having an outer blade, an inner blade being in sliding contact with an inner surface of the outer blade, and a driven shaft rotating the inner blade are disposed, and a second transmission mechanism that transmits a driving power of the first transmission mechanism to rotate the driven shaft is built, and which is connected to the connecting portion; and a drive shaft for transmitting the driving power of the first transmission mechanism to the second transmission mechanism, wherein a first endless belt is disposed in the first transmission mechanism and a second endless belt is disposed in the second transmission mechanism.
US11298836B2	Folding machete A knife includes a blade defining an aperture and a handle. The handle includes a body pivotably coupled to the blade, a catch movably coupled to the body, and a biasing member coupled to the body. The catch includes a protrusion. The biasing member is configured to apply a biasing force on the catch. The handle is selectively repositionable between a first position and a second position relative to the blade. The biasing force biases the protrusion of the catch toward the blade when the handle is in the first position. The protrusion is received by the aperture to prevent rotation of the handle relative to the blade when the handle is in the first position.
US11298822B2	Robot, method of controlling robot, and robot control device A method of controlling a robot having a plurality of joints includes measuring load torque applied to a driving-force transmission system of each of the plurality of joints while moving a hand of the robot along a predetermined path, comparing a measurement value of the load torque and an allowable range of each of the joints, and controlling a rate of change in acceleration of the driving-force transmission system of each of the joints, depending on a comparison result, in a next operation in which the hand of the robot is moved along the predetermined path.
US11298819B2	Robot control method A robot control method of controlling motion of a robot arm by using a servo motor includes adding d-axis electric current to a motor electric current command (steps 15-6, 15-8) if external temperature is less than or equal to a predetermined value (step 15-3), and if an absolute value of the motor electric current command is less than or equal to a predetermined value (step 15-4), and if a value of detected overload is less than or equal to a predetermined value (step 15-5).
US11298817B2	Planetary gearing for a robot gearing arrangement A planetary gearing for a robot gearing arrangement includes a sun gear, a ring gear, and a planet carrier with at least three planetary gears rotatably mounted thereon. The planetary gears are arranged on planet pins arranged perpendicular to the planet carrier and are in meshing engagement with the sun gear and the ring gear. At least one first planetary gear is biased in a first circumferential direction and/or at least one second planetary gear is biased in a second circumferential direction. A first planet pin of the first planetary gear is at least partially elastically deformable in the second circumferential direction and/or the second planet pin of the second planetary gear is at least partially elastically deformable in the first circumferential direction.
US11298814B2	Link actuating device having a proximal-end-side link hub, a distal-end-side link hub, and three or more link mechanisms A link actuation device includes a proximal-end-side link hub, a distal-end-side link hub, three or more link mechanisms each coupling the link hubs such that a posture of the distal-end-side link hub can be changed relative to the proximal-end-side link hub. Each link mechanism includes a proximal-side end link member, a proximal-side intermediate link member, a distal-side intermediate link member, and a distal-side end link member. Actuators for arbitrarily changing the posture and a distance from the distal-end-side link hub to the proximal-end-side link hub are provided to three or more link mechanisms of the three or more link mechanisms. A control unit calculates a rotation angle of the proximal-side end link member according to a targeted posture of the distal-end-side link hub and a targeted distance between the centers of the spherical links, and controls the respective actuators so as to attain the calculated rotation angle.
US11298813B1	Lug bolt and nut holder device A lug bolt and nut holder device is provided. The holder device includes a main body portion having at least one receiving aperture defined therein, wherein the at least one receiving aperture is configured for receiving at least a portion of a lug bolt. The holder device further includes a flange that extends outwardly from the main body portion, wherein the flange includes an upper surface. Further, at least one post extends from the upper surface, wherein the at least one post is configured for being inserted into an opening defined in a nut.
US11298811B2	Apparatus for installing fasteners and explosive loads for use therewith A bracket for attachment to an overhead substrate to carry a suspending wire or rod is formed from metal plate or strap stock having a bend connecting a first generally rectangular section of the stock with a second generally rectangular section of the stock. The first generally rectangular section of stock has a dimple formed on one side of the stock with a corresponding bulge protruding from the other side. The bulge protrudes alongside the second generally rectangular section of stock. The bulge has a base and an apex, a generally conical outside surface adjacent to the first u) generally rectangular section of stock and a through aperture at the apex. The bracket is applied with a tool that can be provided with a washer system to accommodate different fastener lengths and a safety to deactivate the triggering mechanism.
US11298808B1	Torque structure A torque structure includes a first body provided with a first receiving chamber, a first indicator, and a second receiving chamber, a second body provided with a drive portion, a first elastic member biased against the drive portion, a first locking set received in the first receiving chamber, an adjusting set driven by the first body, an indication unit movable to indicate the torque of the torque structure, a third body assembly covering the indication unit, a second locking set rotatable relative to the first locking set, and a third locking set operable between a locking position where the first body cannot be rotated relative to the second body and an unlocking position where the first body is rotated relative to the second body to adjust the torque.
US11298806B2	Hand tool having a head which is position-adjustable and lockable relative to a handle A hand tool includes a head and a handle. The head is pivotally mounted to the handle, permitting the position of the head to be changed relative to the handle. In addition, the tool includes a primary locking mechanism and a secondary locking mechanism. The primarily locking mechanism primarily fixes the head relative to the handle in a particular position. The secondary locking mechanism can be used to further lock the head and handle. The locking mechanisms are actuated by movement of a sleeve which is located on the handle.
US11298798B2	Polishing delivery apparatus A polishing delivery apparatus, configured to provide slurry and rinse agent to a polishing pad, includes a delivery arm, at least one first nozzle, and at least one second nozzle. The delivery arm is rotatably connected to the polishing pad and has an arc-shaped top surface facing away from the polishing pad, a bottom surface facing away from the arc-shaped top surface, and a recess indenting from the bottom surface. The first nozzle is mounted on the bottom surface of the delivery arm and has a first nozzle head facing toward the polishing pad. The second nozzle is mounted in the recess of the delivery arm and has three second nozzle heads, in which one of the three second nozzle heads faces toward the polishing pad, and the other two of the three second nozzle heads face toward sidewalls of the recess.
US11298794B2	Chemical mechanical polishing using time share control A method of chemical mechanical polishing includes rotating a polishing pad about an axis of rotation, positioning a substrate against the polishing pad, the polishing pad having a groove that is concentric with the axis of rotation, oscillating the substrate laterally across the polishing pad such that a central portion of the substrate and an edge portion of the substrate are positioned over a polishing surface of the polishing pad for a first duration, and holding the substrate substantially laterally fixed in a position such that the central portion of the substrate is positioned over the polishing surface of the polishing pad and the edge portion of the substrate is positioned over the groove for a second duration.
US11298793B2	Compact multi-material cut-off tool A compact multi-material cut-off tool includes a housing, and an arbor rotatably supported by the housing upon which a cutting disk is attachable for co-rotation therewith. A motor is coupled to the arbor to provide torque thereto. A controller is operable to selectively drive the motor in a first rotational direction and an opposite, second rotational direction. A first lighting element is coupled to a first portion of the housing, and a second lighting element is coupled to a second portion of the housing. One of the first lighting element and the second lighting element is configured to be activated by the controller in response to the motor being driven in the first rotational direction. The other of the first lighting element and the second lighting element is configured to be activated by the controller in response to the motor being driven in the second rotational direction.
US11298792B2	Combined additive manufacturing method applicable to parts and molds A combined additive manufacturing method applicable to parts and molds relates to moldless-growth manufacturing of parts and molds, which includes steps of: S1: layering and slicing a three-dimensional CAD (computer-aided design) model of a workpiece to be formed according to shape, thickness and dimensional accuracy requirements of the workpiece, so as to obtain a plurality of layered slice data; S2: planning a forming path according to the layered slice data, and generating layered slice numerical control codes for forming; and S3: deposition-forming a powder material on a substrate layer-by-layer and performing pressure forming or milling forming according to the layered slice numerical control codes in the step S2, which uses a numerically controlled high-speed cold spray gun to spray the powder material to a determined position for deposition-forming. The method of the present invention overcomes thermally induced adverse effects of hot processing and drawbacks of cold spray deposition.
US11298789B2	Method and device for determining and/or monitoring the state of a protective cover A method for determining and/or monitoring the state of a protective cover, includes the steps of a) obtaining a first state value of at least one characteristic physical, mechanical and/or chemical property of the protective cover at a first point in time; and b) obtaining a second state value of the at least one characteristic property of the protective cover at a second point in time, which is to subsequent to the first point in time; and c) comparing the obtained state values; and d) determining the state of the protective cover based on the comparison performed in step c).
US11298788B2	Electric power tool dust collection system An electric power tool dust collection system includes: a hammer drill, to which a dust suction bit is mounted; a dust collection device mounted to the hammer drill and including a suction portion (introduction port), a dust collection motor, a dust collection fan rotated by drive of the dust collection motor to generate a sucking force in the introduction port, and a dust collection portion (dust box) that stores powder dust suctioned from the introduction port; and exhaust flow paths (exhaust flow path and tubular flow path) respectively formed in the hammer drill and the dust collection device to lead exhaust that has passed through the dust box to a high-temperature portion (output portion) of the hammer drill.
US11298787B2	Adjustable workpiece support system and method An adjustable workpiece support system includes an adjustable support apparatus, an analysis support point module, a coordinate post-processing module and a control module. The adjustable support apparatus has a group of support devices for supporting a supported workpiece, the each support device being adjustable in height and angle. The analysis support point module is used to import a computer-aided design file of the supported workpiece, and analyze the computer-aided design file to obtain a group of support points of the supported workpiece. The coordinate post-processing module is configured to calculate the support coordinates of the each support device corresponding to the group of support points. The control module is configured to receive the support coordinates of the each support device, and adjust the height and angle of the each support device to support the supported workpiece, so that the amount of deformation of the supported workpiece is the minimum.
US11298783B1	Method of manufacturing improved crossbar connection for implements A method of constructing an improved attachment or implement for use with equipment connected to a coupler is provided. The implement has a crossbar which is one of machined, cast or extruded to provide a cross section within at least the connection zone which lacks welds while still providing parallel flats for connecting to a channel in the coupler. The cross section in the connection zone is void-free and seam free.
US11298781B2	Workpiece rotating appartus and robot system A workpiece rotating apparatus including a first rotary positioner and a second rotary positioner which are arranged to face each other in a direction along a substantially horizontal rotation axis, which hold, respectively, one end portion and the other end portion of a long workpiece, and which can rotate the workpiece around the rotation axis, a linear motor which linearly moves the second rotary positioner in a direction along the rotation axis, and a motor controller which controls the linear motor to adjust a position of the second rotary positioner in a direction along the rotation axis, and the motor controller controls the linear motor so that magnitude of force acting on the linear motor from the other end portion of the workpiece via the second rotary positioner becomes equal to or smaller than a predetermined threshold.
US11298774B2	Method to eliminate dissimilar metal welds A method of eliminating dissimilar metal welds has been disclosed. The method includes the steps of providing a first part having a first alloy composition; providing a second part having a second alloy composition different from the first part; connecting a containment structure to the first part; pouring a powder into the containment structure such that the powder is in contact with the first part; positioning a portion of the second part in the containment structure such that the second part compresses the powder between the first and second parts; and performing hot isostatic pressing (HIP) to consolidate the powder and join the first and second parts together.
US11298771B2	DSC-based all-digital SiC inversion type multi-function argon arc welding power supply The invention provides a DSC-based full-digital SiC inversion type multi-function argon arc welding power supply, which includes a main circuit and a DSC control circuit; the main circuit includes a common mode noise suppression module, a power frequency rectification and filter module, a SiC inversion and commutation module, power transformer, a SiC rectification and smoothing module and a non-contact arc ignition module connected in sequence and are respectively connected to external arc load; the DSC control circuit includes a DSC minimum system, a human-machine interaction module, a fault diagnosis and protection module, a SiC high-frequency drive module connected to SiC inversion and commutation module, and an electrical load signal detection module connected to the arc load. The argon arc welding power supply has a simple structure, high control accuracy, fast response, small size, high efficiency, low energy consumption and excellent process adaptability, which can improve the quality of welding process.
US11298770B2	Arc welding method and arc welding device An arc welding method alternately generates a short-circuit state and an arc state. In the method, short circuits are generated also in the arc period. This more than doubles the total number of short circuits, which is the sum of the short circuits generated in the short circuit period and those generated in the arc period. This enables a thin plate to be arc welded at a higher speed, while reducing its burn-through.
US11298768B2	Method of preparing a surface for diffusion bonding and method of diffusion bonding A method of preparing a surface for diffusion bonding comprises contacting a binder material with a discontinuous surface comprising surface regions separated by gaps. The binder material is selectively deposited onto the surface regions and has a sufficient viscosity to form a self-supporting layer without flowing into the gaps. The self-supporting layer of binder material comprises a mass density in a range from about 0.001 g/in2 to about 0.050 g/in2. A braze powder is distributed over the self-supporting layer of binder material, and a predetermined amount of the braze powder is attached to the binder material. The discontinuous surface is then heated to remove the binder material and adhere the braze powder to the discontinuous surface. Thus, a prewet surface with a braze deposit thereon is formed.
US11298767B2	Resistive soldering method, assembly of antenna and glass, and resistive soldering system A resistive soldering system, includes a first electrode; a second electrode; a support cylinder; a resistive soldering joint which is adapted to raise or lower the first electrode, the second electrode and the support cylinder; and a power supply unit which is connected with the first and second electrodes and adapted to supply power and a heating current to the first and second electrodes.
US11298765B2	Toothed rack and method for producing a toothed rack for a steering gear of a motor vehicle A rack for a steering gear of a motor vehicle may include a toothed portion having a toothing, and a shaft portion. Separate segments comprising at least one in each case bar-shaped toothed segment and one shaft segment are provided, are aligned on a common longitudinal axis, and are connected to one another at a joint. The method may involve providing a raw material piece having a piece length that is a multiple of a segment length, thermally continuously hardening the raw material piece across a multiple of a segment length to produce a hardened semi-finished segment product, cutting to length a hardened segment from the hardened semi-finished segment product, providing a further segment, and joining the hardened segment to a further segment.
US11298759B2	Rotary tool for lower receiver manufacturing A rotary tool can be adapted for removing material from a workpiece such as a lower receiver. A rotary tool can have an adapter with a major diameter, and a cutter head with a minor diameter. The major diameter of the adapter can reduce deflection and chatter, while the minor diameter of the cutter head can be used to manufacture lower receivers with accuracy. The rotary tool can be adapted to be engaged with a rotary power tool.
US11298749B2	Cutting insert, holder, and cutting tool that includes cutting insert There is provided a cutting insert used for both drilling and turning. The cutting insert includes an insert main body having a front surface and a rear surface, the outline shapes of which are parallelogram shapes, peripheral side surfaces disposed on four sides of the insert main body, cutting edges provided on respective intersecting ridge lines between the front surface and the peripheral side surface and between the rear surface and the peripheral side surface of the insert main body, and a hole provided in the insert main body to incline with respect to the front surface and the rear surface, the hole being usable for attachment.
US11298748B2	Surface coated cutting tool and method for manufacturing the same A surface coated cutting tool comprises a base material and a coating layer that coats the base material, the coating layer including an alternate layer composed of a first unit layer and a second unit layer alternately stacked, the first unit layer being composed of a nitride containing aluminum and zirconium, in the first unit layer, when the total number of metal atoms constituting the first unit layer is represented as 1, a ratio thereto of the number of atoms of the zirconium being not less than 0.65 and not more than 0.95, the second unit layer being composed of a nitride containing titanium and aluminum, in the second unit layer, when the total number of metal atoms constituting the second unit layer is represented as 1, a ratio thereto of the number of atoms of the aluminum being larger than 0.40 and not more than 0.70.
US11298747B2	High fatigue strength porous structure A porous apparatus includes a first layer and a second layer. The second layer has a plurality of struts. At least some of the struts define a porous geometry defining a plurality of faces, at least one of the plurality of the faces at least partially confronting the first layer. Each face is bounded by intersecting struts at vertices. Less than all of the vertices of each face of the porous geometry at least partially confronting the first layer are connected by a strut to the first layer. A process of producing the at least partially porous structure includes depositing and scanning metal powder layers. At least some of the scanned metal powder layers form either one or both of a portion of a first section of the structure and a portion of a second section of the structure formed by at least the struts defining the porous geometry.
US11298745B2	Method for manufacturing metal foam The present application provides a method for manufacturing a metal foam. The present application can provide a method for manufacturing a metal foam, which is capable of forming a metal foam comprising uniformly formed pores and having excellent mechanical properties as well as the desired porosity, and a metal foam having the above characteristics. In addition, the present application can provide a method capable of forming a metal foam in which the above-mentioned physical properties are ensured, while being in the form of a thin film or sheet, within a fast process time, and such a metal foam.
US11298742B2	Hybrid component with cooling channels and corresponding process A component is provided and includes a core including a ceramic matrix composite material, one or more cooling channels formed about the core, an outer metal shell disposed about the core and the one or more cooling channels and a protective material between the core and the outer metal shell. The one or more cooling channels are formed about the core as an array of cooling channels in the protective material.
US11298737B2	Device and method for the autofrettage of a workpiece A method for the autofrettage of a workpiece may involve arranging the workpiece between a first securing means and a second securing means, and applying high-pressure fluid to an internal volume of the workpiece that is formed between the first and second securing means. A die or ram may be driven into the internal volume through an inlet in the first securing means. Consequently, as a result of the ram being advanced, not only is a fluid pressure generated in the internal volume, but also the workpiece is mechanically autofrettaged by way of the ram. A device may be employed to perform such hydromechanical autofrettage of the workpiece.
US11298733B2	Method for calculating plate thickness schedule for tandem rolling machine and rolling plant A plate thickness schedule calculation method includes a plurality of steps. One step acquires a rolling model expression including a roll force model or a motor power model. Another step determines whether or not a parameter restriction has occurred that restricts at least one parameter of roll force, motor power and a reduction rate in each rolling stand. Further another step is to select a first derived function when no parameter restriction occurs and to select a second derived function when the parameter restriction has occurred in accordance with a result of the determination for each rolling stand. Still another step modifies each delivery side plate thickness in each rolling stand using a matrix including the one derived function selected from the first derived function and the second derived function in accordance with the result of the determination.
US11298726B2	Cleaner and cleaning device A cleaner and a cleaning device are disclosed. The cleaner includes: a guide rail; a lifting lever, one end of which is disposed on the guide rail and capable of moving along the guide rail; a feed pipe, disposed inside the lifting lever; and a nozzle, disposed on an end portion of one end of the lifting lever away from the guide rail and communicated with the feed pipe. The lifting lever is configured to allow the nozzle to be away from or close to the guide rail.
US11298718B1	Fog nozzle adapter A nozzle adapter for connecting corrugated tubing to a fog nozzle housing. The nozzle adapter comprises a channel body and a clamp, the channel body having a connector section and defining a flow channel extending through the channel body. The connector section comprises an outlet opening of the flow channel and is adapted and configured to removably connect to a piece of corrugated tubing. The clamp is operatively connected to the channel body and operable to clamp a fog nozzle housing so that an outlet end of the fog nozzle housing faces downstream toward the flow channel.
US11298713B2	Device for dispensing essential oil or tincture A portable liquid dispensing device which includes a liquid cartridge containing a prefilled desired liquid supported within the dispensing device. A dispensing mechanism is positioned within the device for engagement with the liquid cartridge for dispensing a desired amount of liquid from the liquid cartridge to an outlet exiting the device. An actuator button is also provided for actuating the dispensing mechanism and dispensing the desired amount of liquid through the outlet of the dispensing device. The dispensing mechanism includes a central shaft with a first end engaged with the actuator button, a second end is positioned adjacent the outlet, and a plunger assembly is supported on the central shaft intermediate the first and second ends for substantially sealed engagement with an internal surface of the liquid cartridge and central shaft to move the plunger assembly and liquid toward the outlet upon actuation of the actuator button. Upon deactivation of the actuator button, the central shaft slidably moves or retracts through the plunger assembly, without moving the plunger assembly.
US11298710B2	Dual media nozzle A dual media spray nozzle assembly for cleaning an optical viewer or sensor lens is disclosed. The assembly includes two media pathways that terminate in two arrays at the target cleaning area. The nozzle arrays are coplanar. The two media may be activated sequentially or simultaneously. The assembly includes a cover, a spray element, and a media inlet body. The nozzles are formed in a curved, semi-annular opening of the spray element. The spray element includes front and back sides. Formed on the front side is a first media flow path associated with a first media inlet formed on the media inlet body. The first media flow path is associated with the first array of nozzles. Formed on the back side is a second media flow path associated with second media inlets formed on the media inlet body. The second media path is associated with the second array of nozzles.
US11298709B2	Low-pressure spray nozzle assembly A low-pressure spraying equipment for atomizing a working fluid at a low-pressure, includes a spray tip body having a top and a lower end, a handle arranged on the top of the spray tip body, and a chamfer defined at the lower end of the spray tip body. The spray tip body further includes a retaining shoulder and a ring collar, a mounting hole having a channel axis, a pre-atomizing component, and a tip atomizing component. The pre-atomizing component further includes a feeding channel, a pre-atomization channel, and a pre-atomization regulating channel. The feeding channel, the pre-atomization channel, and the pre-atomization regulating channel are three coaxial hollow channels sequentially defined and connected along the channel axis inside the pre-atomizing component.
US11298708B2	Meshes capable of droplet fragmentation, and related systems and uses thereof Meshes capable of droplet fragmentation are generally described. Inventive articles, systems, and uses thereof are also described.
US11298704B2	Stationary waste comminuting device having an energy accumulator The waste shredding device includes at least one shredding shaft, an electric motor for driving the at least one shredding shaft, a mains connection for supplying the electric motor with electrical energy and an energy store for storing energy and for at least partially supplying the electric motor with electrical energy, in particular for covering power peaks. Furthermore, a corresponding method for operating the waste shredding device.
US11298700B2	Feedback system for parallel droplet control in a digital microfluidic device Digital microfluidics apparatuses (e.g., devices and systems) configured to determine provide feedback on the location, rate of movement, rate of evaporation and/or size (or other physical characteristic) of one or more, and preferably more than one, droplet in the gap region of a digital microfluidics (DMF) apparatus.
US11298699B2	Separation and analysis of samples bymicrofluidic free-flow electrophoresis A microfluidic device (11) is provided for separation and analysis of microfluidic samples. The device comprises: a separation channel (10); a first electrolyte channel (12) configured to provide a flow of high conductivity electrolyte solution, in use; and provided with a positive electrode (13) at a downstream outlet of the channel; a second electrolyte channel (14) configured to provide a flow of high conductivity electrolyte solution, in use, and provided with a negative electrode (15) at a downstream outlet of the channel; and wherein the flow of electrolyte through the first and second electrolyte channels removes electrophoresis products and gas bubbles from the device; and wherein the presence of the electrolyte provides a substantially homogenous electric field across the separation channel.
US11298697B2	Method to produce chemical pattern in micro-fluidic structure A flow cell includes: a first substrate; a second substrate; a first resin layer disposed over an inner surface of the first substrate; a second resin layer disposed over an inner surface of the second substrate; a first plurality of biological capture sites located at the first resin layer; a second plurality of biological capture sites located at the second resin layer; and a polymer layer interposed between the first resin layer and the second resin layer, such that the first substrate is attached to the second substrate via at least the first resin layer, the polymer layer, and the second resin layer, wherein the polymer layer defines a plurality of microfluidic channels that extend through polymer layer.
US11298695B2	Pipette tip for an automated pipetting device and production method thereof The present invention relates to pipette tips for connecting to a pipette tube of a pipetting device that is used for taking up and dispensing fluids. A pipette tip is shaped as a long tube that forms a pipette body with an opening on one of its ends and the other end is designed to connect to the pipette tube. The pipette tip is characterised in that it has an electrode as a volume measuring electrode of a measuring capacitor. The present invention further relates to pipetting devices with a pipette tip, methods for determining the volume of a fluid sample in such a pipette tip, methods for recognising such a pipette tip on a pipetting device, methods for producing such a pipette tip, uses for such a pipette tip and a set of pipette tips.
US11298691B2	Prussian blue derived catalysts Prussian blue analog derived catalysts having a composition of highly porous transition metal (“TM”) oxides with nano particle size. Such OER catalysts are synthesized from the PBA, containing cobalt, iron, nickel, copper, manganese, zinc, magnesium etc., as secondary building units (“SBUs”) coordinated by hexacyano-based ligands. Furthermore, the PBA-derived catalysts may also integrated into a highly graphitized carbon network to further improve the conductivity, mass transport and durability against oxidative corrosion.
US11298686B2	Honeycomb catalytic converter The present invention relates to a honeycomb catalytic converter including: a honeycomb structured body in which multiple through-holes are arranged longitudinally in parallel with one another with a partition wall therebetween; and a noble metal supported on the honeycomb structured body, wherein the honeycomb structured body contains a ceria-zirconia complex oxide and alumina, each partition wall includes a first carrier layer defining a surface layer of the partition wall and carrying Pd, and a second carrier layer located more inwardly of the partition wall than the first carrier layer and carrying Rh.
US11298677B2	Lithiated cyclodextrin metal organic frameworks and methods of making and using the same Disclosed herein are lithiated cyclodextrin metal organic frameworks and method of making and using the same. A metal organic framework comprising a coordinated network of repeating units extending in three dimensions, wherein the repeating unit comprises a cyclodextrin, a first coordinating metal cation, and a second coordinating metal cation.
US11298676B2	Porous material for storing of molecules and its use The invention concerns new types of porous coordination polymers (MOF) and a method for their preparation. MOFs have been prepared through synthesis of salts of trivalent cations M3+, the source of which are aluminium, chromium, iron or yttrium salts, it is advantageous if of chlorides, nitrates or sulphates, with linkers carrying two or more phosphinic groups under presence of solvent. Linkers are phenylene-1,4-bis(R phosphinic acid) (PBPA) and biphenylene-4,4′-bis(R phosphinic acid) (BBPA). For the prepared MOFs, the structure has been tested using x-ray powder diffraction, specific surface and porousness which have been characterised through adsorption isotherm of nitrogen and further the stability of prepared MOFs has been determined using thermogravimetric analysis.All the prepared MOFs have been stable around 400° C. and have contained mesopores or micropores where hydrogen or CO2, for example, can be stored.
US11298671B2	Bulk catalyst withdrawal system and methods for the use thereof A method for processing a chemical stream includes contacting a feed stream with a catalyst in a reactor portion of a reactor system causing a reaction which forms a product stream. The method includes separating the product stream from the catalyst, passing the catalyst to a catalyst processing portion of the reactor system, processing the catalyst in the catalyst processing portion, and passing a portion of the catalyst from the catalyst processing portion of the reactor system into a catalyst withdrawal system that includes a catalyst withdrawal vessel and a transfer line coupling the catalyst withdrawal vessel to the catalyst processing portion. Each of the catalyst withdrawal vessel and the transfer line include an outer metallic shell and an inner refractory lining. The method further includes cooling the catalyst in the catalyst withdrawal vessel from greater than or equal to 680° C. to less than or equal to 350° C.
US11298670B2	Compact quench zone reactor internals Hydroprocessing reactor internals height reduction is achieved by placing a mixing chamber above the collection tray. The mixing chamber has spillways on the top (top spillways) and the side of the mixing chamber (side spillways) for fluid entry. The design of the spillways has a significant impact on pressure drop. The pressure drop is reduced by having wide shallow spillways rather than narrow and deep spillways without impacting mixing performance. With both side and top spillways, the height of the mixing chamber can be reduced significantly with minimal impact on fluid mixing and pressure drop.
US11298667B2	Preparation vessel with a cooling device A preparation vessel, in particular for a food processor, has a vessel wall and a preparation area surrounded by the vessel wall. The vessel wall has a cooling device that contacts the vessel wall in a heat-conducting manner for cooling a preparation item present in the preparation area. The vessel wall in at least a partial area has a double-walled design, with an inner wall bordering the preparation area and an outer wall that is formed separately from the inner wall and spaced apart from the inner wall by a gap, wherein the gap has the cooling device and a phase change material located between the cooling device and the outer wall as viewed in a direction from the preparation area to the outer wall.
US11298666B2	Slurry mixer for a battery electrode A slurry mixer for a battery electrode capable of maximally simplifying a configuration of a high-speed stirring body to minimize a rotational load, such that a stirring time of the slurry may be greatly reduced and productivity may be increased, preventing a powdery material from being accumulated on an upper side face and an upper surface of a low-speed stirring body, preventing a deterioration in a performance, failure and a reduction in a life span of a high-speed stirring shaft and bearing, and uniformly stirring mixed materials located at inner corners and a bottom of a container, thereby further increasing stirring efficiency.
US11298665B2	Apparatus and method for mixing paste material with gas An apparatus (1) for mixing a paste material with gas includes: a mixing part (2) that mixes the paste material with the gas using a piston pump (10); and a static mixer (3) that is connected to the mixing part to stir a mixture obtained by mixing the paste material with the gas in the mixing part. The static mixer includes one or a plurality of stirring sections through which the mixture passes, the stirring section has a shape that allows a flow of the mixture passing through the stirring section to be stirred. A ratio of a volume of the piston pump to a volume of at least one of the stirring sections of the static mixer is within a range from 1:0.2 to 1:5.
US11298663B2	Thin metal/ceramic hybrid membrane sheet and filter A thin micro-porous membrane sheet and filtering device using it is presented. The membrane sheet includes a thin porous metal sheet of thickness between 20 and 200 μm with a porous ceramic coating of thickness less than 25 μm on at least one of its surfaces. The porous metal sheet has mean pore sizes at micro and sub-micrometer level and has a surface substantially free of pores greater than 10 micrometers. The ceramic coating layer may be made of particles with a mean particle size in a range of 10 to 300 nm and contains certain sintering promoters. The ceramic coating is sintered with the metal sheet in non-oxidizing environment at lower temperatures than typical ceramic membranes. The thin membrane sheet is used to filter fine particulates from micrometers to nanometers from a liquid or gas stream. The thin membrane sheet may be assembled into a filter device having high surface area packing density and straight mini-flow channels.
US11298655B2	Wall-mounted plant-based air purification system The present disclosure generally relates to plant-based air purification systems and more particularly to wall mounted systems for removing impurities from indoor air using plants.
US11298652B2	Hybrid low dew point compressed air dryer The present disclosure is directed to a dryer system for drying compressed gas discharged from a compressor. The dryer system includes a refrigeration drying system operable for removing moisture from the compressed gas and a desiccant drying system with a desiccant wheel located in series downstream of the refrigeration drying system operable for removing additional moisture from the compressed gas.
US11298648B2	Method and installation for obtaining hydrogen The invention relates to a process for recovering hydrogen (b) from crude gas (a) from a coke oven (110) in which the crude gas (a) produced in the coke oven (110) is initially compressed and in which impurities are subsequently removed from the crude gas (a) by pressure swing adsorption, wherein oxygen is depleted from the crude gas (a) using nonthermal plasma prior to the pressure swing adsorption, and to a plant for recovering hydrogen from crude gas.
US11298647B2	Packing and manufacturing method therefor The packing has one or more thin-layer packing elements that are installed upright, the packing element having a main body portion with a planar liquid film formation surface, and one or more wall portions that are provided upright relative to the liquid film formation surface along a linear direction. The side surface of each wall portion has a curved portion at the base thereof connected to the liquid film formation surface, the curved portion curving so as to continue into the liquid film formation surface.
US11298646B2	Apparatus and method for particulate capture from gas streams and a method of removing soluble particulate from a gas Disclosed is a method for the removal of soluble particulate matter from a gas stream, such as urea dust from the off-gas of a finishing section of a urea production plant. The method comprises subjecting the off-gas to at least two quenching stages an aqueous quenching liquid. The quenching liquid used in a first, upstream quench stage, is allowed to have a higher concentration of dissolved particulate matter than the quenching liquid in the second, downstream quench stage. The quenched gas is led through a particle capture zone, typically comprising one or more of a wet scrubber, a Venturi scrubber, and a wet electrostatic precipitator.
US11298644B2	Drainage medium for gas filter A coalescence filter including an inlet for supplying the gas to a filter element present in the coalescing filter, which filter element includes a coalescence medium for coalescing at least one disperse liquid phase during a displacement of a gas through the coalescence medium in a flow direction. The filter element downstream of the coalescence medium includes a drainage medium for draining the at least one coalesced disperse phase leaving the coalescence medium. The filter element contains a barrier layer positioned downstream of the coalescence medium, where the coalescence medium and the barrier layer are held at a distance from each other by one or more spacers to provide a drainage zone in the drainage layer of a drainage medium between a surface of the coalescence medium facing the barrier layer and the barrier layer for draining the coalesced disperse phase in a drainage direction.
US11298640B2	Expandable threaded adaptor for threadless shell A filter assembly comprising a housing defining an internal volume. The housing comprises a first coupling member formed in a housing first end of the housing. The housing first end is threadless. The filter assembly further comprises a filter head. The filter head comprises a first thread formed on a surface thereof. The filter assembly further comprises an adapter. The adapter comprises a second coupling member formed on an adapter first end of the adapter. The second coupling member engages the first coupling member formed in the housing first end so as to removably couple the adapter and the housing. A second thread is formed on the adapter first end. The second thread engages the first thread formed in the filter head so as to removably couple the adapter and the filter head.
US11298638B2	Automatic clean air filter for air conditioner unit An air conditioner unit includes a blower fan, an inlet grille upstream of the blower fan, and an outlet grille downstream of the blower fan. The air conditioner unit also includes an air filter positioned between the inlet grille and the outlet grille with a belt encircling and enclosing the air filter on four sides. The air conditioner unit further includes a motor operatively connected to the belt. The motor is configured to rotate the belt around the air filter and thereby clean the air filter.
US11298637B2	Exchangeable filter system An exchangeable filter system is provided with an exchangeable filter module that has at least one fluid inlet, at least one fluid outlet, and a fluid path connecting the at least one fluid inlet and the at least one fluid outlet with each other. The exchangeable filter module is provided with at least one filter element for filtering a fluid. A flange element and a counter flange element are provided. The flange element is provided to releasably engage the exchangeable filter module and to releasably engage the counter flange element. A valve device is arranged in the flange element. The valve device blocks the fluid path when the flange element is in engagement with the exchangeable filter module and is disengaged from the counter flange element. An internal combustion engine is provided with such an exchangeable filter system to filter fuel, lubricant or urea.
US11298636B2	Oil monitoring system A filter system has a chamber body, an inlet that extends through the chamber body, and an outlet that extends through the chamber body at a location downstream of the inlet. The filter system has a plurality of fluid flow paths that extend between the inlet and the outlet. The plurality of fluid flow paths including first and second subsets, each including at least a respective one of the fluid flow paths. A plurality of hydrocarbon filters is disposed in the chamber body such that each hydrocarbon filter is disposed in a fluid flow path. The filter system directs the fluid to the first subset, and once each hydrocarbon filter of the first subset becomes saturated with hydrocarbons, the filter systems diverts the fluid to flow to the second subset.
US11298630B2	Snow-themed bottle A snow-themed bottle comprising a middle portion located between a top and a bottom portion is described. An outer surface of the middle portion includes a first transparent viewing window located on a first side. The outer surface includes a slot component affixed to a second side disposed opposite the first side, the slot component housing a theme card. A hollow inner shell is disposed inside the outer surface where the inner shell houses a clear fluid, an ornament affixed to the bottom portion, and a plurality of particles. A second transparent viewing window is affixed to an inside portion of the hollow inner shell at the second side such that a user may view a front of the theme card through the first transparent viewing window and a back of the theme card through the second transparent viewing window.
US11298629B2	Ball toy A ball toy having a solid, resiliently flexible body is disclosed. The body is penetrated by a bore, wherein bearing means are mounted, defining a rotational axis of the body therein. The bore has a bore closure at each end, mechanical connection means connecting each closure to the bearing means. The body is able to spin on said axis relative to the closures, when the closures are held in a pinching manner by a user. The body is made of a thermoplastic rubber of selected hardness properties, giving it excellent bouncing performance, with unpredictability of bouncing direction resulting from the spinning of the body.
US11298615B2	Information processing system, information processing method, information storage medium, and program Methods and apparatus provide for: receiving, at at least one game server, an execution request for execution of a game program from a user terminal over a network and, in response, loading and executing the game program, where the execution request is associated with a play point in a video that shows previously played content of the game program; transmitting the video, by way of at least one of the at least one game server and at least one video server, to the user terminal over the network, where the video is displayed to a user of the user terminal and the execution request is initiated by the user; obtaining, at the at least one game server, certain game situation data that is identified based on the play point associated with the execution request, from a storage unit that stores respective game situation data which indicate respective situations of the game program that are associated with respective play points in the video; starting executing the game program, by the at least one game server, from a situation that is indicated by the certain game situation data obtained; and transmitting game data to the user terminal over the network such that the user may enter into gameplay.
US11298614B2	Browser-based cloud gaming A method for providing gameplay of a cloud video game, including: executing a session of the cloud video game by a cloud gaming machine; establishing, over a network, a peer-to-peer connection between a streaming server and a remote client browser, the peer-to-peer connection being established in accordance with a WebRTC protocol; transmitting, over the peer-to-peer connection from the streaming server to the client browser, gameplay video generated from the executing session of the cloud video game, wherein the gameplay video is encoded in a compressed format, and wherein the gameplay video is rendered for display by the client browser, the gameplay video being rendered in substantial real-time to enable real-time gameplay of the session of the cloud video game through the client browser.
US11298610B2	Adjustable trigger-stops for videogame controllers A video game controller has triggers that can be depressed by a user. The triggers have associated trigger stops actuatable to limit the travel of the trigger when depressed by the user. The trigger stop can be selectively operated by the user to vary the trigger stop location, and therefore the amount of travel of the trigger when depressed, between multiple (e.g., more than 2, more than 3, more than 4, 5, etc.) positions.
US11298609B2	Virtual object movement control method and apparatus, electronic apparatus, and storage medium Embodiments of a method for controlling a virtual object movement performed by an electronic apparatus and a non-transitory computer readable storage medium provided in embodiments of the present disclosure. After detecting that a touch operation on a virtual joystick region meets a specific condition, a target function button is displayed; and in a case that a touch operation on the target function button is detected, the virtual object is controlled to move automatically. In this way, coherent operations are performed on the same region in the same operating manner, so that the virtual object is enabled to move automatically, thereby improving convenience and flexibility of user operations.
US11298606B2	Reflective video display apparatus for interactive training and demonstration and methods of using same A smart mirror can show live or recorded streaming video of an instructor performing a workout in a package that is attractive and unobtrusive enough to hang in a living room. The smart mirror includes a mirror surface with a fully reflecting section and a partially reflecting section. A display behind the partially reflecting section shows the video when the smart mirror is on and is almost invisible when the smart mirror is off. The smart mirror also has a speaker, a microphone, and a camera to enable a user to view the video content and interact with the instructor. The smart mirror may connect to the user's smart phone, a peripheral device (e.g., a Bluetooth speaker) to augment user experience, a biometric sensor to provide biometric data to assess user performance, and/or a network router to connect the smart mirror to a content provider, an instructor, and/or other users.
US11298605B2	System for planning, managing, and analyzing sports teams and events A system for planning, managing, and analyzing sports teams and events. The system may include a content management function for storing data. The data can pertain to a plurality of sports-related statistics and a variety of identifying data. The system and method can also include an event management function for planning and evaluating sports-related events such as practices and games. The system and method can also include a report function which can provide a variety of statistical analyses.
US11298602B2	Portable training device A portable training device includes a first and second elongated members, a coupling device, a base, a holder device, and a member holder. An elongated slot is positioned between a distal end and a proximate end on at least one side of each of the first and second elongated members. The first elongated member and second elongated member are each received by the coupling device to form a post that extends in a system vertical direction. The member holder has an engagement portion and a member receiving portion. The engagement portion includes a resilient member and a trapezoidal portion. The resilient member and the trapezoidal portion are slidably received in the elongated slot of the first and second elongated members such that the member holder is positioned into a plurality of positions within the elongated slots of the first and second elongated members.
US11298589B2	Foot training device and foot training method A training device is provided for training a foot using the device. The training device includes a fulcrum placed at a center and four projections that project in different directions from the fulcrum. Each of the four projections have elastic members that are bendable. The training device is configured to improve foot muscle strength by bending and stretching the elastic members. At least two of the four projections have different degrees of elasticity in flexure as determined when a force is applied to a distal end of each of the at least two projections to bend the elastic members. The four projections project in cross directions from the fulcrum at the center. Each pair of projections that oppose each other across the fulcrum are arranged on a straight line.
US11298587B2	Climber exercise machine Climber exercise machine comprises a frame connected to a base through a base connection, the frame pivotable about the base connection. A right handle and a left handle are connected to respective right and left sides of the frame, the right handle moving within a first range of motion, the left handle moving within a second range of motion. A right pedal and a left pedal are connected to the respective right and left sides of the frame, the right pedal moving within a third range of motion, the left pedal moving within a forth range of motion. The right handle, the left handle, the right pedal, and the left pedal movable generally in the same plane. An angle between the frame and a plane parallel to an underside of the base is adjustable while the climber exercise machine is mounted by a user.
US11298584B2	Training apparatus A training apparatus for the simulation of rowing training includes a rolling seat to be moved linearly back and forth on a guide on a frame. Two handles which can be rotated independently of one another are mounted on an oarlock shaft. The oarlock shafts are connected to a drive mechanism in a force-flow connection. Upon introduction of force to the handles, power is output to a braking device via a drive mechanism, which has a freewheel between the oarlock shafts and the braking device. Upon actuation of the handles in a first direction about the axis of the respective rowlock shafts, power is transmitted to the braking device, and, upon actuation of the handles in the opposite direction the handles return without power being transmitted to the braking device.
US11298583B2	Exercise machine friction brake calibration Improvements in a flywheel friction loading measurement system is disclosed. The measurement system includes combining a rotational system that alters friction on a flywheel combined with a variable resistor or potentiometer. The combination proves a measurable system that can determine the loading on a piece of exercise equipment. The potentiometer is calibrated to provide a repeatable and reliable measurement of the loading system that is placed on a flywheel. Detents can be included to provide finite loading positions. A calibration sequence can also be used to communicate the friction to a display and measurement system. The rotational system is with pulling a cable on a rotational axis or with wrapping a cable chain, belt or equivalent on or around a rotational axis.
US11298580B2	Resistance harness A resistance harness that allows 360° of resistance around the body and in any plane of motion (sagittal, transverse, frontal, oblique). The strap design allows rings to slide from anterior to posterior or medial to lateral. The rings enable concentric, eccentric, or isometric resistance. This sliding ability allows for resistance to be constant in one direction or changeable. As the ring slides under tension, the muscular recruitment needed to resist will change as the force angle of the ring slides and changes position around the body.
US11298579B2	Resistance supplier for weight training A resistance supplier for weight training has two switching assemblies, two planetary gear sets, a one-way output bearing, a spindle, and at least one weight. The two switching assemblies respectively control input, output, and fixing of the sun gear, planet carrier, and ring gear in the two planetary gear sets. The output of one of the two planetary gear sets is used as the input of the other planetary gear set. Therefore, the two planetary gear sets provide three reduction ratios and transmit torque to the spindle through the one-way output bearing to drive the weight to rotate. By using reduction ratios of the planetary gear sets to increase the output requirement of the user and switching gears via switching assemblies to change reduction ratios, the resistance supplier can provide sufficient and diverse training resistances with a single weight, thereby reducing the volume.
US11298578B2	Positionable arm with quick release for an interactive exercise machine An interactive exercise system includes a mechanical support system and a display module held by the mechanical support system. A force-controlled motor is attached to the mechanical support system and a reel is driven by the force-controlled motor. The interactive exercise system also has a handle graspable by a user and includes a cord extending between the reel and the handle. The handle or other accessory can be attached by a quick release mechanism. Force applied through the force-controlled motor is based at least in part on detected user force input.
US11298577B2	Cable and power rack exercise machine Cable and power rack exercise machine. An exercise machine may include a frame, a resistance mechanism supported by the frame, a first pull cable and a second pull cable supported by the frame and linked to the resistance mechanism, and a power rack attached to the frame. The power rack may include a first upright post configured to have a first barbell holder adjustably attached thereto and a second upright post configured to have a second barbell holder adjustably attached thereto. The first barbell holder may be adjusted in various positions between a first highest position and a first lowest position on the first upright post. The second barbell holder may also be adjusted in various positions between a second highest position and a second lowest position on the second upright post.
US11298575B2	Systems and methods for training firefighters Systems and methods for training firefighters and other first responders are provided. The systems include a plurality of sensors configured to detect at least one ambient condition, such as, temperature; a receiver configured to receive the electric signals from the plurality of sensors; and a digital storage device operatively connected to the receiver and adapted to store the electrical signals corresponding to the detected ambient conditions. The data detected by the sensors can be retrieved for later review, analysis, and training. The systems may include at least one video recorder and/or at least one infrared image recorder each configured to detect images that can be stored for later retrieval and a synchronizing device adapted to synchronize the sensor data with the recorded images for later review. Methods of implementing the systems and portable cases enclosing the system are also provided.
US11298568B2	System and method for energy delivery to tissue while monitoring position, lesion depth, and wall motion Systems and methods for ablating tissue include an ablation device having an energy source and a sensor. The energy source provides a beam of energy directable to target tissue, and the sensor senses energy reflected back from the target tissue. The sensor collects various information from the target tissue in order to facilitate adjustment of ablation operating parameters, such as changing power or position of the energy beam. Gap distance between the energy source and target tissue, energy beam incident angle, tissue motion, tissue type, lesion depth, etc. are examples of some of the information that may be collected during the ablation process and used to help control ablation of the tissue.
US11298564B2	Medical, surgical and patient lighting apparatus, system, method and controls with pathogen killing electromagnetic radiation A surgical site infection management lighting system that is effective and safe for human use to reduce or eliminate surgical site infections. The system provides multiple focused electromagnetic radiation frequencies at minimal energy levels for surgical and medical procedures that kills pathogens with electromagnetic radiation sources. The system includes an aiming laser, a distance sensor, a camera for providing images of the surgical site, and a motion sensor for providing control parameters. Fused silica lenses are utilized to focus the visible light for high illumination and selected electromagnetic radiation frequencies at minimal energy levels that are lethal to pathogens. The lighting system can be associated with an articulable arm, a mobile base stand, a handheld unit or a head-mounted unit.
US11298561B2	Method of treating multi-drug resistance biofilm using targeted laser and antibiotics This application describes a method of using gold nanoparticle (GNP)-targeted pulsed laser technology to enhance antibiotic efficacy against multidrug resistant biofilms. The application also teaches a method for treating topic wound infection using GNP-targeted laser therapy combined with antibiotics treatments.
US11298560B2	Light output device for caring for user using artificial intelligence and method of operating the same A light output device for caring for a skin of a user using artificial intelligence includes a plurality of light sources configured to irradiate light, a memory configured to store a skin care model learned using a deep learning algorithm to infer a facial skin state of the user, a camera configured to capture an image of a face of the user, and a processor configured to acquire a skin state of each part of the face based on a first-type face image captured through the camera and the skin care model, and control light output of the plurality of light sources based on the acquired skin state.
US11298554B2	Implantable device having one or more screws An implantable device for mounting to a patient's bone includes a housing and at least one osseointegrating protuberance. The housing includes a surface having an abutting portion configured to abut the bone when the housing is implanted in the patient, the abutting portion defining a housing axis orthogonal to the surface. The at least one osseointegrating protuberance: extends from the surface of the housing; is adapted to abut the patient's bone; and has a substantially smooth shaft.
US11298552B2	Implantable medical device and method for managing advertising and scanning schedules Methods and devices for managing establishment of a communications link between an external instrument (EI) and an implantable medical device (IMD) are provided. The methods and devices comprise storing, in memory in at least one of the IMD or the EI an advertising schedule defining a pattern for advertisement notices. The advertisement notices are distributed un-evenly and separated by unequal advertisement intervals. The method transmits, from a transmitter in at least one of the IMD or the EI the advertisement notices. The advertisement notices are distributed as defined by the advertising schedule. The method establishes a communication session between the IMD and the EI.
US11298542B2	Method and system for suicide risk assessment and intervention A brain mapping system and methods that allow to predict and monitor the risk of suicide and provide personalized therapy. The brain mapping system and methods detect if brain dysfunctions (injuries) are located in suicidal hubs that trigger increased suicidal ideation and high risk of suicide. The brain mapping technology is suited for different technologies and allows to monitor the effects of therapy, provide precise therapy to decrease the risk of suicide.
US11298539B2	Selective high frequency spinal cord modulation for inhibiting pain, including cephalic and/or total body pain with reduced side effects, and associated systems and methods Selective high-frequency spinal cord modulation for inhibiting pain with reduced side effects and associated systems and methods are disclosed. In particular embodiments, high-frequency modulation in the range of from about 1.5 KHz to about 50 KHz may be applied to the patient's spinal cord region from an epidural, cervical location to address at least one of high back pain, mid-back pain, low back pain, and leg pain without creating paresthesia in the patient.
US11298536B2	Electrical-stimulation device and operation method thereof and electrical-stimulation system An electrical-stimulation device includes an electrical-stimulation signal-generating circuit, a first connection unit, a first conductive member and a second conductive member. The electrical-stimulation signal-generating circuit has a first channel for providing a first electrical-stimulation signal. The first connection unit has a plurality of first contact points and a plurality of second contact points, wherein the first contact points and the second contact points are alternately arranged. The first conductive member is connected to the first contact points. The second conductive member is connected to the second contact points. The first conductive member and the second conductive member are electrically connected to the first channel, so that the first electrical-stimulation signal is transmitted through the first contact points and the second contact points corresponding to the first channel.
US11298535B2	Non-invasive vagus nerve stimulation Devices, systems and methods are disclosed that allow a patient to self-treat a medical condition, such as migraine headache, by electrical noninvasive stimulation of a vagus nerve. The system comprises a stimulator that applies an electrical impulse transcutaneously through an outer skin surface of the patient. The electrical impulse includes pulses having a frequency of about 1 kHz to about 20 kHz. The device housing may transmit data to or from a patient interface device, such as a mobile phone or computer, relating to the stimulation parameters. The interface device in turn may communicate with a database contained within other computers, via a network or the internet.
US11298531B2	Elastic neural electrode and method for fabricating the same An elastic neural electrode is provided, having at least one planar metal layer which comprises conductive material and which is placed on an elastomer layer (PDMS), wherein, for reinforcement of the electrode, a high-tensile-strength polymer layer, in particular parylene layer is applied directly onto the at least one metal layer, the high-tensile-strength polymer layer, in particular parylene layer being the outermost layer of the electrode.
US11298530B1	Synergistic therapies for intervertebral disc degeneration A method is provided for treating an intervertebral disc of a subject, the method including delivering cells to a nucleus pulposus of the intervertebral disc. At least one intra-pulposus exposed electrode surface is implanted in the nucleus pulposus. At least one extra-pulposus exposed electrode surface is implanted in a body of the subject outside the nucleus pulposus. The delivered cells are supported by activating control circuitry to drive the intra-pulposus and the extra-pulposus exposed electrode surfaces to electroosmotically drive nutrient-containing fluid into the nucleus pulposus. Other embodiments are also described.
US11298527B2	Autonomous neurostimulation unit An autonomous neurostimulation unit used in the modulation of the nervous system is provided and has: at least one pair of pads, each formed by at least one inner layer of ceramic; an intermediate layer; and a conductive alloy coating. The material of the layer of coating is different and has different conductivity in each of the pads of the pair. The unit can be used in the modulation of the nervous system, with neurostimulation methods that are adapted to each patient.
US11298524B2	Systems and methods for estimating a position of a heart pump Systems and methods are provided herein for estimating a position of a heart pump system in a patient. The system receives first data indicative of a time-varying motor current during a first time period. The motor current corresponds to an amount of current delivered to a motor, while the heart pump system is operating in the patient. The system receives second data indicative of a time-varying differential pressure during the first time period. The differential pressure is indicative of a position of the heart pump system relative to patient's heart. The system receives third data indicative of time-varying motor current during a second time period, and determines an estimate of differential pressure during the second period of time from the third data and a relationship between the first data and the second data. The estimate is usable to predict the position of the heart pump system in the patient.
US11298523B2	Impeller housing Apparatus and methods are described including manufacturing a housing for an impeller of a blood pump by placing an inner lining around a mandrel, placing a cylindrical portion of a frame around the inner lining, and placing a distal portion of an elongate tube around a portion of the frame. While the distal portion of the elongate tube is disposed around the portion of the frame, the inner lining, the frame, and the distal portion of the elongate tube are heated, via the mandrel, and pressure is applied from outside the distal portion of the elongate tube, such as to cause the distal portion of the elongate tube to conform with a structure of the struts of the frame, and to cause the inner lining and the distal portion of the elongate tube to become coupled to the frame. Other applications are also described.
US11298521B2	Methods of manufacturing an impeller Apparatus and methods are described including manufacturing an impeller by coupling a material to a helical elongate element, such that the helical elongate element with the material coupled thereto defines a blade of the impeller. A portion of a structure that includes the helical elongate element is dipped into the material while the material is in a liquid state. The material is dried, while the material is being supported by the at least one helical elongate element. During the drying of material, the structure is rotated about its longitudinal axis, such as to facilitate the formation of a film of the material having a substantially uniform thickness within the impeller blade. Other applications are also described.
US11298517B2	Advanced functional biocompatible foam used as a hemostatic agent for non-compressible acute wounds A sprayable polymeric foam hemostat for both compressible and non-compressible (intracavitary) acute wounds is disclosed. The foam comprises hydrophobically-modified polymers, such as hm-chitosan, or other amphiphilic polymers that anchor themselves within the membrane of cells in the vicinity of the wound. By rapidly expanding upon being released from a canister pressurized with liquefied gas propellant, the foam is able to enter injured body cavities and staunch bleeding. The seal created is strong enough to substantially prevent the loss of blood from these cavities. Hydrophobically-modified polymers inherently prevent microbial infections and are suitable for oxygen transfer required during normal wound metabolism. The amphiphilic polymers form solid gel networks with blood cells to create a physical clotting mechanism that prevent loss of blood.
US11298514B2	Foam applicator for in-ear use A device for dispensing a foam medication into a human or animal ear includes a supply of foamable medicine held within a container. The medicine is advanced through a delivery tube that is configured to engage an ear without entering the ear canal to an extent that it contacts the eardrum. The delivery tube has an enlarged end portion that prevents the device from being inserted too far into an ear, and the enlarged end portion has a series of openings oriented in two different directions to deliver foam into the ear forward of the device and around the circumference of the delivery tube.
US11298512B2	Devices and methods for treating acute kidney injury A catheter devices/systems and methods therefrom are described herein for treating acute kidney injury, especially the contrast-induced acute kidney injury wherein the devices prevent the contrast dyes from entering into kidney and/or facilitate blood flow of kidney by said catheter system.
US11298511B2	Endovascular devices and methods for exploiting intramural space The present disclosure is directed to a device. The device may include a distal shaft defining a central lumen and an orienting element comprising at least one inflatable member. Wherein a first portion of the orienting element extending from the shaft in a first direction and a second portion of the orienting element extending from the shaft in a second direction. Further, wherein the second direction is substantially opposite the first direction.
US11298508B2	Catheter assembly A catheter assembly includes a catheter, a catheter hub, an inner needle, and an inner needle hub. The catheter assembly is disposed in a hollow portion axially extending in the interior of the inner needle, and includes a blunt needle having a distal end portion blunter than a needle tip and a movement mechanism for moving the blunt needle. The movement mechanism is configured separately from the catheter hub and causes the distal end of the blunt needle to protrude beyond the needle tip along with the movement of the catheter.
US11298503B2	Platform insert for bowl, bowl with platform, and methods of using the same A filament platform insert for insertion into a bowl includes a plurality protruding stages and a plurality of recesses that are each formed in arcuate shapes to form a plurality of arcuate filament channels. An access channel extending along the platform insert, between a top and bottom, and between a rear and front, provides access for insertion of a finger or tool for manipulating an endovascular filament stored in the filament channel. The platform insert is dimensioned such that alignment of multiple such platforms will form filament raceways within a bowl for the coiled reception and storage of multiple endovascular filaments, with each filament reliably isolated from one another. In an alternative configuration, an endovascular filament bowl may be made to have the filament platform as a monolithic component thereof.
US11298502B2	Non-pharmaceutical methods of mitigating addiction withdrawal symptoms Non-pharmaceuticals method of treating the effects of addiction withdrawal are described. The method includes providing a person with stimuli include visual and/or auditory stimuli which are pulsed at the rate of various types of brain waves. The use of the method lessens various withdrawal symptoms, such as anxiety, sleepiness, sweating, tearing of the eyes, running of the nose, goosebumps, shaking, hot flushes, cold flushes, bones aching, muscles aching, restlessness, nausea, vomiting, muscle twitching, stomach cramps, pain, the need to use an opioid, the desire to use an opioid, sleep disturbances. and the use of rescue medications.
US11298497B2	Swivel elbow and connector assembly for patient interface systems A patient interface system for delivering a flow of breathable gas to a user includes a patient interface structure configured to sealingly engage the face of the user. The patient interface system further includes an elbow and connector assembly adapted to receive gases from a flow generator and deliver the gases to the patient interface structure. The elbow and connector assembly includes a ring attached to the patient interface, a sleeve, and an elbow. The ring includes an inner flange, an outer flange separated from the inner flange by a channel, and a plurality of vent slots extending through the inner flange, across the channel, and through the outer flange. The sleeve is configured so that inserting the sleeve into the ring forms a plurality of vent paths for the venting of exhalation gases from an interior of the patient interface to an exterior of the patient interface through the vent slots.
US11298494B2	User interface for supplying gases to an airway A user interface convertible between a nasal configuration and an oral configuration. The user interface has a nasal cannula and a mouthpiece. The nasal cannula has a body portion and at least one prong extending from the body portion, the prong being adapted to direct a flow of gas into a nare of a user's nose. The mouthpiece is adapted to engage the mouth of the patient and direct a flow of gas into a user's mouth. In the nasal configuration the prong of the nasal cannula is adapted to direct a flow of gases into a nare of the patient. In the oral configuration, the nasal cannula is engaged with the mouthpiece such that a gases flow is provided to at least the mouth of the user.
US11298491B1	System, device, and arrangement for a manual ventilation assistant In some implementations, a system may receive, from a differential pressure sensor, a differential pressure measurement associated with a differential pressure across an air filter within an airway of a manual ventilator. The system may determine, based on the differential pressure measurement, an air flow rate through the airway. The system may determine timing of a compression cycle of the manual ventilator. The system may determine, based on the timing, a flow threshold associated with a desired breathing cycle. The system may determine a difference between the flow threshold and the air flow rate. The system may provide, via a display associated with the manual ventilator, a representation associated with the difference to indicate whether a compression parameter of the compression cycle is to be adjusted.
US11298478B2	Reset mechanism for an inhaler A valved-container inhaler (150) has a mechanical return assembly with a spring (214) and a transfer (212) configured to transfer stored potential energy from the spring to a canister (51) and a clutch (208, 210) in a load path of the force between the spring and the transfer, the clutch being rotatable between a first condition in which load is transferred from the spring to the transfer, and a second condition in which the spring and the transfer can move relative to one another to interrupt the load path and thereby allow the canister to resile after actuation.
US11298477B2	Methods, devices and systems for pulmonary delivery of active agents Provided herein is a method of pulmonary delivering to a subject at least one pharmacologically active agent being in a plant material, which is effected by pulmonary delivering the agent to the subject using a metered dose inhaler device that is configured to vaporize at least one pre-determined vaporized amount of the agent upon controllably heating the plant material, wherein the pre-determined vaporized amount is selected so as to achieve at least one pre-determined pharmacokinetic effect and/or at least one pre-determined pharmacodynamic effect induced by the agent in the subject.
US11298476B2	Vibrating blister Disclosed is an inhaler and a method for using the inhaler for the inhalation of a formulation from a carrier. The carrier contains the formulation in a receptacle and is set oscillating by an air current. An improved or defined delivery and nebulisation of the preferably powdered formulation is made possible by the fact that the carrier is set oscillating in defined manner, the formulation is dispensed through a cover element having three to five holes and/or the air current flows onto a fin associated with the carrier and flows past at least substantially only one flat side of the carrier.
US11298470B2	Methods and apparatus for improved medication delivery devices Embodiments provide systems, methods, and apparatus for a medication delivery device. The device includes a dose selector for selecting an amount of medication to deliver; a first capacitive sensor adjacent the dose selector and operative to detect linear displacement of the dose selector during medication delivery; a screw coupled to the dose selector; a second capacitive sensor adjacent the screw and operative to detect linear displacement of the screw during medication delivery; and a processor coupled to the first and second capacitive sensors and operative to determine an amount of medication actually delivered by the medication delivery device. Numerous other aspects are provided.
US11298467B2	Syringe with multifunctional needle holder and retainer ring assembly A syringe for medical use, the syringe having a selectively retractable needle and a multifunctional needle holder and retainer ring assembly including a needle holder with a head section having an inwardly tapering frustoconical section of the fluid pathway and a rearwardly facing annular surface surrounding the rear opening, and an elastomeric retainer ring with a substantially unexpanded collar extending rearwardly beyond the rearwardly facing annular surface to increase needle pushout force, reduce activation force and improve fluid flow through the syringe. Annular projections inside the retainer ring and on the outer surface of the head section of the needle holder are also disclosed.
US11298465B2	Communication device for transmitting information from a medicament delivery device A communication device arranged for transmitting information from a medicament delivery device is presented. The communication device includes at least one rotation detection arrangement, the at least one rotation detection arrangement being configured to detect a rotation of at least one physical part of the medicament delivery device. The communication device also includes at least one determination unit configured to determine information related to a medicament delivery performed by the medicament delivery device. The communication device further includes at least one activation unit configured to activate the at least one determination unit based on the detected rotation. Also, the communication device includes at least one transmission unit configured to provide a wireless transmission of the information to an external receiving device.
US11298463B2	Method of assembling and filling a drug delivery device An injector may include a container having a wall with an interior surface and a seal assembly with an interior surface, the interior surfaces of the wall and the seal assembly defining a closed sterile reservoir filled with a drug product. The injector may also include a fluid delivery system comprising a clean, unsheathed, rigid container needle having a point disposed only partially through the seal assembly in a storage state, and disposed through the interior surface of the seal assembly into the sterile reservoir in a delivery state. Further, the injection may include an actuator that is adapted to move the container needle from the storage state to the delivery state.
US11298462B2	Automatic injection system An automatic injection device is provided, where the device includes a syringe carrier and a retraction assembly. The syringe carrier includes two identical parts that are discrete from one another and interlock with one another. The retraction assembly includes a shuttle and a follower, the follower having a moveable latch. The follower has a coupled configuration in which the latch is biasedly coupled to the shuttle, and a decoupled configuration in which the latch is in sliding engagement with a curvilinear surface of the shuttle.
US11298461B2	Basal titration with adaptive target glucose level Systems and methods are provided for adjusting long acting insulin medicament dosages for a subject. A plurality of timestamped glucose measurements of the subject is obtained. A titration glucose level (246) is computed as a measure of central tendency (244, 268, 274) of a titration subset of small glucose measurements (240, 269, 273) identified within the timestamped glucose measurements, wherein the measure of central tendency represents a measure of small glucose measurements for the primary time window. A long acting insulin medicament dosage (216) is adjusted or maintained based upon the obtained titration glucose level (246).
US11298460B2	Automated system for controlling the blood glucose level of a patient An automated system of regulation of a patient's blood sugar, including: a blood sugar sensor; an insulin injection device; and a processing and control unit capable of predicting the future evolution of the patient's blood sugar from a physiological model and of controlling the insulin injection device by taking the prediction into account, wherein: the physiological model includes a differential equation system describing the time variation of a plurality of state variables; and the processing and control unit is capable of implementing a step of automatic calibration of the physiological model including a step of estimation of initial values of the state variables by minimization of a quantity representative of the error, during a past observation period, between the blood sugar estimated based on the physiological model and the blood sugar measured by the sensor.
US11298459B2	Wearable medical device for monitoring intravenous injection A wearable medical device comprising an annular housing configured to attach to a wrist of a patient. The wearable medical device having a first receptacle attached to the annular housing for receiving a first portion of a tube of an intravenous delivery system. The wearable medical device comprising a flow regulator attached to the annular housing and in contact with the first portion of the tube, where the flow regulator is configured to modify a geometric characteristic of the first portion of the tube. The wearable medical device further comprising a wireless transmitter for communicating with a user console.
US11298457B2	Medicament delivery device The present disclosure relates to a medicament delivery device. The medicament delivery device comprises a housing, a dispensing mechanism and an actuator. The housing has first and second portions. The dispensing mechanism comprises a reservoir disposed in the housing. The dispensing mechanism is operable to dispense medicament from the reservoir when the reservoir contains medicament. The first portion of the housing comprises a distal end and the second portion is moveable towards the distal end from an initial position to a primed position. The dispensing mechanism is rendered inoperable when the second portion is in the initial portion. The actuator is actuatable to operate the dispensing mechanism when the second portion is in the primed position.
US11298453B2	Apparatus and method for wound cleansing with actives An apparatus and method for cleansing and applying therapy or prophylaxis to wounds, in which irrigant fluid, which may contain a physiologically active material, and wound exudate from the dressing are moved by a device for moving fluid through a flow path which passes through the dressing. A means for fluid cleansing may also be provided to recirculate fluid back to the dressing. The cleansing means removes materials deleterious to wound healing, and the cleansed fluid, still containing materials that are beneficial in promoting wound healing, is returned to the wound bed. The apparatus may also provide means for distributing such materials in a precise and time-controlled manner over the wound bed. It may also contain a means for providing simultaneous aspiration and irrigation of the wound.
US11298451B2	Hemodialysis catheter sleeve A hemodialysis vascular access device includes a proximal end sized and shaped to sealably couple to a hemodialysis catheter, a movable structure coupled to the proximal end, a fixation structure coupled to the movable region and sized and shaped for fixation on a patient, an elongated sleeve coupled to the fixation structure and sized and shaped for insertion into a patient's vasculature, and a valve at a distal end of the internal lumen. When a hemodialysis catheter is inserted into the device and coupled to the proximal end, distal movement of the proximal end relative to the fixation structure biases a distal end of the hemodialysis catheter from a position inside the elongated sleeve through a valve out of the device and into the patient's blood.
US11298448B2	Filter unit for whole blood and blood derivatives A filter unit for blood and blood derivatives comprises a body defined by two injection-moulded half-shells of thermoplastic polymer material, there being present between said half-shells a cavity containing a filtering element having two opposing flat faces, an inlet opening and an outlet opening made on the opposing outer surfaces of said body communicating with said cavity. Each of said half-shells comprises a projecting perimetral flange, the flanges of the overlapping half-shells being welded together to form a flange of the body of the filter unit and connect the two half-shells together, the filtering element being wholly contained within the cavity of such body and pressed by shelves projecting into such cavity from each half-shell in the vicinity of its perimetral border and on the two opposing faces, said shelves retaining said filtering element in a stable position within cavity, said thermoplastic polymer material being yielding and semi-rigid.
US11298445B2	Breast pump milk flow rate sensor system and apparatus A breast pump milk flow rate sensor system and apparatus for accurately assessing both a flow rate and amount of milk expressed during a pumping session is provided. The breast pump milk flow rate sensor system and apparatus may be contained within a breast pump.
US11298441B2	Biodegradable biomimetics of growth plate cartilage for the treatment of physeal injuries The present invention relates to the unexpected discovery of 3D printed biomimetics of growth plate cartilage and methods using the same for the treatment of growth plate defects. In certain embodiments, the methods prevent the growth of bony bars at the site of growth plate injury, thereby preventing growth arrest and/or deformity.
US11298440B2	Microstructured haptotaxic implant The invention relates to the field of tissue engineering and regenerative medicine, and particularly to a three-dimensional biomimetic tissue scaffold that exploits the use of three-dimensional print technology. Surface energy is controlled by precisely placing polymers with differing surface chemistry, and using surface texture and bulk composition to pattern absorbable and non-absorbable polymers for the purpose of promoting functional healing in a mammalian body.
US11298437B2	Apparatus and method for sterilization of an article An apparatus and method for sterilization of an article which has a first open end, a second open end and a lumen extending therebetween. The apparatus comprises a first chamber for receiving the article. The first chamber has an outlet fluidly connectable to a pump for adjusting an internal pressure in the first chamber; and an inlet fluidly connectable to a sterilant source for supplying sterilant to the first chamber. The apparatus includes a second chamber fluidly connectable to the first chamber by a chamber connector fluidly sealable to isolate the first and the second chamber; and an article connector for fluidly connecting the second open end of the article to the second chamber to form a fluid path from the first to the second chamber through the lumen. Also included is an article connector for connecting an open end of an article to be sterilized to a sterilization apparatus.
US11298434B2	Ultrasonic medical probe with failsafe for sterility and associated method An ultrasonic medical probe has a horn or shaft, a shank at a proximal end of the shaft, a probe head at a distal end of the horn or shaft, opposite the shank, and at least one polymeric component fixed to at least one of the horn or shaft, the shank, and the probe head. The shank is provided at a proximal end opposite the horn or shaft with an externally threaded connector for attaching the probe to a source of ultrasonic vibratory energy. The polymeric component is of a composition that transmits and is essentially impervious to ultrasonic vibratory energy but that degrades or decomposes upon exposure to a source of extreme energy (other than ultrasonic vibratory energy), rendering the probe inoperative for use.
US11298433B2	Radiolabelled antibody fragments for use in treating cancer Provided herein are methods, kits, and compositions for stratifying and treating subjects, e.g., subjects having cancer. In some examples, the methods involve use of a radiolabelled heavy chain variable domain derived from a heavy chain antibody (VHH), or a functional fragment thereof, as both a screening agent and a treatment agent. In some examples, the VHH, or a functional fragment thereof, that is radiolabelled with a radioisotope that is both a γ-emitter and β-emitter.
US11298432B2	Method for preparing a marked purine derivative, said derivative and uses thereof The present invention relates to a method for preparing a 2-fluoropurine marked with the radioisotope 18F comprising a fluorination step for a 2-nitropurine derivative. The present invention comprises a 2-fluoropurine derivative marked with the radioisotope 18F which can be obtained by or during a method according to the invention and its various uses.
US11298431B2	Method for labeling radioisotope radiolabeling compound and kit comprising the same for labeling radioisotope The present disclosure relates to a method for labeling a radioisotope, a radiolabeling compound, a kit including the same, and a method for labeling a radioisotope, including: providing a diaminophenyl compound represented by Chemical Formula I below and including a biomolecule, a fluorescent dye or a nanoparticle compound bound thereto; and reacting the diaminophenyl compound and a radioisotope-labeled aldehyde compound represented by Chemical Formula II below at room temperature; and a related technology: in Chemical Formula I, A is CH2 or O; a is 0 or an integer of 1 to 10; X is CH2 or —CONH—; Y is CH2 or and Z is the biomolecule, the fluorescent dye or the nanoparticle compound, in Chemical Formula II, b is 0 or an integer of 1 to 10; and L is CH2 or —CONH—; and Q is M, M′ and M″ in Q are radioisotopes.
US11298430B2	Magnetic nanocomposite compositions Superparamagnetic nanocomposites are provided. In an embodiment, a superparamagnetic nanocomposite comprises a superparamagnetic core comprising a first, soft superparamagnetic ferrite and a superparamagnetic shell comprising a second, soft superparamagnetic ferrite, the shell formed over the core, wherein the first and second soft superparamagnetic ferrites are different compounds and have different magnetocrystalline anisotropies.
US11298426B2	Recombinant vaccines and use thereof The present invention relates to fusion molecules of antigens, the nucleic acids coding therefor and the use of such fusion molecules and nucleic acids. In particular, said invention relates to fusion molecules, comprising an antigen and the trans-membrane region and cytoplasmic region of a MHC molecule and/or the cytoplasmic region of a MHC or a SNARE molecule.
US11298423B2	Protection and delivery of multiple therapeutic proteins Compositions are provided herein comprising a coacervate of a polycationic polymer, a polyanionic polymer, and platelet-rich plasma and/or serum, or a fraction or concentrate thereof. The composition is useful in wound healing. Compositions also are provided that comprise a hydrogel comprising TIMP-3; and a complex of a polycationic polymer, a polyanionic polymer, FGF-2 and SDF-1α embedded in the hydrogel, which is useful in treating a myocardial infarction.
US11298413B2	Vaccine compositions comprising C—C motif chemokine 22 (CCL22) or fragments thereof The present disclosure relates to CCL22 as a novel T cell target in cancer immunosuppression.
US11298408B2	Methods of treating hypertension Provided are CD4+ T-cell-based compositions and methods for treating hypertension.
US11298406B1	Treatment of connective tissue injuries This disclosure relates to treating a connective tissue injury. The treatment involves injecting, or otherwise administering, a therapeutic composition into an animal, such as a human being, in need thereof. The therapeutic composition may contain transforming growth factor beta 1 (TGF-β1) and/or transforming growth factor β 2 (TGF-β2), connective tissue growth factor (CTGF), and a pharmaceutically acceptable excipient or a secondary agent.
US11298399B2	Carbetocin drug product and process for preparing same The present disclosure includes a method of making an improved carbetocin drug product. The disclosed method for making an improved carbetocin drug product comprises agitating a carbetocin preparation containing an aqueous solution of carbetocin and one or more excipients for a period of time to initiate the formation of aggregate-forming solids and filtering off the aggregates that form before further processing the remaining carbetocin into a final drug product. The present disclosure also relates to an improved carbetocin drug product, wherein the drug product is substantially free of aggregate-forming solids. The disclosed carbetocin drug product can be used for the treatment of a neurodevelopmental disorder, such as Prader-Willi syndrome. Additionally, the disclosed carbetocin drug product shows content uniformity of carbetocin over long periods of time before and after one or more freeze/thaw cycles, provides enhanced convenience and patient compliance, and/or are highly concentrated.
US11298397B2	Hemostatic composition and hemostatic method using hemostatic composition [Problem] To provide a composition for hemostasis that can be applied uniformly to a bleeding site and exerts a high hemostatic effect. [Solution] Provided is a composition to be applied to the subject as a spray, wherein the composition is characterized in that the spray is for hemostasis, and the composition includes a self-assembling peptide, the self-assembling peptide gelling due to self-assembly when the composition is applied to the bleeding site of the subject, and the self-assembling peptide being included in the composition in a concentration having an improved hemostatic capacity in comparison to direct application.
US11298394B1	Supplement, delivery method and device for said supplement A supplement formulation including a combination of vitamins, minerals, amino acids, and stimulants, and a delivery method and device for said supplement formulation. Caffeine is present in the supplement formulation in an amount of about 40-60 mg/ml, of which about 15-30 mg/ml is caffeine from coffee beans and about 15-30 mg/ml is caffeine from green tea extract. About 5-20 mg/ml caffeine from guarana seed extract may also be present. Such a delivery device provides the supplement to a mouth/throat area of a user where it is readily absorbed in the mouth/throat area of the user or ingested by the user.
US11298391B1	Topical skin health improvement compositions and administrations thereof In various implementations, a skin therapeutic may be topically applied to improve skin health. The skin therapeutic may decrease inflammation, decrease redness, and/or decrease health times. The skin therapeutic may include a composition that includes two or more of Brassica olearacea italica Seed Oil, bisabolol, and/or Zingiber officinales.
US11298389B2	Method for preparing non-toxic lacquer, fermented rice bran powder using same, and method for manufacturing powdered grain nutrient food The present invention provides a method for preparing non-toxic lacquer by detoxifying stems or sprouts of lacquer trees using a malt juice and a fermented rice bran, and a method for manufacturing a fermented rice bran enzyme with improved preservability or a powdered grain nutrient food with improved preservability and dietary property by using the non-toxic lacquer prepared thereby.
US11298387B1	Omega-3 containing compositions The present disclosure relates to a bioavailable, oil composition wherein at least 20% by weight % of its total lipids content comprises polar lipids such as glycolipids or phospholipids, at least 30 weight % of its polar lipids comprises glycolipids, and no more than 4% by weight % of the oil composition is made up of chlorophyll species. Formulations containing and methods for producing said oil compositions from algal oils or extracts are also disclosed.
US11298385B2	Microorganism for delivering drug for treatment of gastrointestinal disease, which expresses and secretes P8 protein, and pharmaceutical composition for preventing or treating gastrointestinal disease, which includes the same The present invention relates to a microorganism for drug delivery, which has been transformed with a gene construct comprising a therapeutically active peptide, which can be delivered safely into the intestines through oral administration, and which can express and secrete the therapeutic peptide in the gastrointestinal tract, and also relates to a pharmaceutical composition for prevention or treatment of gastrointestinal disease, which includes the same. The present invention is directed to a lactic acid bacteria drug delivery system capable of overexpressing and secreting a lactic acid bacteria-derived anticancer protein, which is developed by introducing the anticancer protein into a lactic acid bacteria expression and secretion system. It is expected that the lactic acid bacteria drug delivery system will be widely used as a natural protein therapeutic agent against gastrointestinal disease in the medical field.
US11298383B2	Lactobacillus and bacillus based direct fed microbial treatment for poultry and method of use This disclosure relates generally to a microbial treatment for poultry. More particularly, the disclosure relates to a direct fed microbial composition including one or more lactic acid bacteria strains in combination with one or more Bacillus bacteria strains configured to inhibit gastrointestinal pathogens in a bird. A method of use is also disclosed herein.
US11298382B2	Bifidobacterium lactis BL-99 and application thereof A Bifidobacterium lactis BL-99 strain capable of enhancing immunity and the use thereof, which belongs to the technical field of microorganisms, is described. The Bifidobacterium lactis BL-99 provided by the present invention is deposited in China General Microbiological Culture Collection Center CGMCC on Apr. 26, 2018 with the deposit number CGMCC No. 15650. The bacteria have gastric acid resistance and intestinal fluid resistance, can significantly promote the growth of Bifidobacterium and Lactobacillus, significantly increase antibody-producing cells and half hemolysis value HC50, activate NK cell activity, and can be used to prepare foods for immunity enhancement. It also has the effects in preventing osteoporosis, increasing blood calcium and/or phosphorus ions, which has a wide range of application prospects.
US11298381B2	Modulation of immune function by Bacillus coagulans The present invention discloses a composition comprising heat inactivated spores and/or comprising heat inactivated vegetative cells of probiotic bacteria Bacillus coagulans, and a process for preparing the same. The invention also discloses a method of modulating immune function in mammals by activating macrophages, using a composition comprising Bacillus coagulans in the form of live or heat inactivated spore and/or vegetative cells.
US11298379B2	Compositions comprising milk fat globules and methods of making same Compositions including anti-viral compositions, therapeutic compositions, sunscreen compositions, skin treatment compositions, anti-aging compositions, and methods of making the same, are provided. Each composition includes milk fat globules (MFG) and may contain one or more agents encapsulated by the MFG. The unique nature of MFG provides an intact mammalian membrane containing proteins, glycoproteins, and carbohydrates found in mammary cells. By treating an infected patient with MFG, the MFG serve as a surrogate cell and interact with enveloped viruses, such as the COVID-19 coronavirus, the Herpes virus, and the Epstein Barr Virus, rendering them non-infectious. MFG derived from mammals can also be used to deliver pharmaceutical materials into an animal body such that the pharmaceutical materials bypass the venous blood and enter directly into the animal's lymphatic system. MFG allow the delivery of materials orally that could not heretofore have been delivered efficiently.
US11298372B2	Composition for ameliorating loss of hair and graying of hair, and use thereof The present invention provides novel compositions for suppressing or improving hair loss, and compositions for suppressing or improving graying. More specifically, it provides agents that stabilize type XVII collagen expression, preferably agents that suppress the degradation of type XVII collagen by ELANE inhibitors and such, and compositions comprising a DNA repair-promoting agent or a DNA damage-suppressing agent as an active ingredient. Advantageous suppressive effects of hair loss and graying can be obtained when a composition comprising as an active ingredient a suppressive agent of type XVII collagen degradation such as an ELANE inhibitor is administered to a mammal. For the ELANE inhibitors, suppressive agents of type XVII collagen degradation and DNA repair-promoting agents, low-molecular compounds, polypeptides, proteins, antibodies, or nucleic acid medicine such as antisense oligos or siRNAs may be used. A method of screening for effective substances for suppression of hair loss and graying is also provided.
US11298370B2	Prophylactic or therapeutic agent for inflammatory bowel disease The purpose of the present invention is to provide a therapeutic agent which is for inflammatory bowel disease and exhibits superior prophylactic or therapeutic effects on inflammatory bowel disease by using miR-29a and/or miR-29b. The prophylactic or therapeutic agent for inflammatory bowel disease comprises composite particles in which miR-29a and/or miR-29b is/are carried on carbonate apatite particles, and said agent is administered systemically.
US11298369B2	Composition and uses thereof The present invention relates, inter alia, to methods for the prevention or treatment of cancer, and to compositions, combinations and kits for the treatment or prevention of cancer. In one embodiment, the invention provides a method of treating or preventing cancer, comprising administering to a patient in need thereof an immune checkpoint modulator together with a compound of Formula (I): wherein X is SO3M or H, wherein M is any pharmaceutically acceptable cation; and wherein at least 70% of the X groups is SO3M.
US11298368B2	Efficient tobramycin compound conjugate compositions Disclosed herein are compositions comprising tobramycin or a tobramycin derivative that exhibit improvements in permeation of corneal cells, retention in corneal cells, or both. Such compositions can comprise tobramycin or tobramycin derivative(s) complexed to an agent which facilitates improved permeation of corneal cells, retention in corneal cells, or both. The invention also relates to a process of preparing such compositions.
US11298365B2	Bioavailable solid state (17-β)-hydroxy-4-androsten-3-one esters Disclosed are bioavailable solid state (17-β)-Hydroxy-4-Androsten-3-one esters suitable for pharmaceutical uses and administration to mammals in need of (17-β)-Hydroxy-4-Androsten-3-one.
US11298364B2	Methods and products for preventing and/or treating microorganism infections comprising iron chelators and non-iron porphyrins The present disclosure relates to methods and products for reducing the viability of microorganisms, and to methods and products for preventing and/or treating microorganism infections. Certain embodiments of the present disclosure provide a method for reducing viability of a microorganism. The method comprises exposing the microorganism to an effective amount of an iron chelator and subsequently exposing the microorganism to an effective amount of a non-iron porphyrin, thereby reducing the viability of the microorganism.
US11298351B2	Bupropion as a modulator of drug activity Dosage forms, drug delivery systems, and methods related to sustained release of dextromethorphan or improved therapeutic effects are disclosed. Typically, bupropion or a related compound is orally administered to a human being to be treated with, or being treated with, dextromethorphan.
US11298345B2	Compounds that modulates AMPA receptor function The invention provides compounds of the formula (I): (I) wherein A1, A2, R2, R4, B1, B2, X, X1, n, a and b are as defined are defined in the specification, to pharmaceutical compositions comprising the compounds and the compounds for use as medicaments. The compounds potentiate AMPA receptor function and are expected to be useful in the treatment of central nervous system disorders, for example in the treatment of depressive disorders, mood disorders and cognitive dysfunction associated with neuropsychiatric disorders such as schizophrenia.
US11298343B2	Method for treating thalassemia Methods for removing excess free α-globin in erythroid cells and treating a thalassemia using an agent that activates Unc-51 Like autophagy activating Kinase (ULK) are described.
US11298341B2	PSMA binding ligand-linker conjugates and methods for using Described herein are prostate specific membrane antigen (PSMA) binding conjugates that are useful for delivering therapeutic, diagnostic and imaging agents. Also described herein are pharmaceutical composition containing them and methods of using the conjugates and compositions. Also described are processes for manufacture of the conjugates and the compositions containing them.
US11298339B2	Bisdiazabicyclo compound for treatment and/or prevention of hepatitis virus-related diseases or disorders Disclosed are a bisdiazabicyclo compound for treating and/or preventing hepatitis virus-related diseases or disorders, a method for treating and/or preventing hepatitis virus-related diseases or disorders by using the bisdiazabicyclo compound, and a use of the bisdiazabicyclo compound in the preparation of a drug for treating and/or preventing hepatitis virus-related diseases or disorders, and/or eliminating or mitigating hepatitis virus-related diseases or disorders.
US11298338B2	Compositions and methods for cancer therapy The invention provides compositions and methods to treat a hyperproliferative disorder with ascorbate or a pharmaceutically acceptable salt thereof, and one or more anti-cancer therapies.
US11298337B2	Parthenolide and its derivative for use in the treatment of axonal damage The present invention relates to a compound reducing microtubule detyrosination in axonal tips selected from the group consisting of tubulin carboxypeptidase inhibitors and tubulin tyrosine ligase activators and combinations thereof for use in the treatment of axonal damage.
US11298332B2	Compositions for therapy and health containing amino acids with bitter taste This disclosure provides a dry powder formulation of free amino acids with an acceptable and even good taste profile.
US11298331B2	Solid pharmaceutical preparation containing levothyroxine The invention relates to a solid pharmaceutical preparation comprising levothyroxine sodium, gelatine, citric acid and a filler. The solid pharmaceutical preparation has an improved stability.
US11298323B2	Bioerodible drug delivery devices This invention relates to a bioerodible drug delivery device that can be implanted in a patient at or near an area in need of treatment. The bioerodible drug delivery device can be used to deliver a wide variety of different pharmaceutically active agents, and can do so at a controlled rate and over an extended period of time. The bioerodible drug delivery device includes a bioerodible polymeric outer housing with one or more delivery ports for delivering the pharmaceutically active agent(s) contained therein. The polymer used as the bioerodible polymeric outer housing is not substantially degraded during the dosing of the pharmaceutically active agent(s) in the bioerodible drug delivery device. The invention also provides methods of making the bioerodible drug delivery device and using it for the treatment of diseases and disorders.
US11298321B1	Methods for treating metabolic disorder Provided are a self-nanoemulsifying 3D printer ink composition and a method of using such composition to manufacture a 3D-printed tablet having compartmentalized active pharmaceutical ingredients. In particular, the 3D-printed tablet composition includes glimepiride and/or rosuvastatin in a curcuma oil based self-nanoemulsifying drug delivery system (SNEDDS). The disclosure also provides a method of treating a metabolic disorder or disease by administering a therapeutically effective amount of the 3D-printed tablet to a subject in need thereof.
US11298320B2	Liposomal apparatus and manufacturing methods The present invention provides apparatus and processes for producing liposomes. By providing a buffer solution in a first reservoir, and a lipid solution in a second reservoir, continuously diluting the lipid solution with the buffer solution in a mixing chamber produces a liposome. The lipid solution preferably comprises an organic solvent, such as a lower alkanol.
US11298318B2	One-step method for production of ultra-small lipid structures Ultra-small Lipid Structures (USLS) with an average mean particle diameter of less than 100 nm are made using a single step process by diluting a hydro-organic solution containing lipids and passenger compounds. These particles are capable of sequestering the passenger molecules and self-assemble in a single process step into USLS. The USLS have applications in, for example, agricultural, cosmetics, pharmaceutical and food and beverage industries.
US11298317B2	Alcoholic compositions having a lowered risk of acetaldehydemia The present invention provides beverages and pharmaceutical compositions containing a deuterated alcohol according to Formula 1, and provides methods for their manufacture and use. The compositions of the invention are expected to ameliorate some of the negative side effects associated with the consumption of alcohol, such as hangover and facial flushing.
US11298315B2	Triamcinolone and moxifloxacin compositions Provided here are new ophthalmologically suitable pharmaceutical compositions comprising an effective amount of a moxifloxacin compound and an effective amount of a triamcinolone compound. In aspects, the compositions are stable suspensions, which maintain physical stability and chemical stability for extended periods of time (e.g., exhibiting no sustained flocculation, coagulation, or clumping after several months of storage under typical storage conditions). In aspects, the compositions are suspensions that include a suspension component comprising one or more suspension agents. In aspects, the suspension component includes an ionic suspension agent. In aspects, the composition also or alternatively comprises a non-ionic surfactant, non-ionic suspension agent, or both, or an agent that provides both functions. In aspects, such compositions further comprise an effective amount of a chelating agent/component. Further described are related compositions and methods of making and using such compositions, e.g., in the treatment of eye infections.
US11298310B2	Stable silk protein fragment compositions A composition is disclosed that includes pure silk fibroin-based protein fragments that are substantially devoid of sericin, wherein the composition has an average weight average molecular weight ranging from about 17 kDa to about 38 kDa, wherein the composition has a polydispersity of between about 1.5 and about 3.0, wherein the composition is substantially homogeneous, wherein the composition between 0 ppm to about 500 ppm of inorganic residuals, and wherein the composition includes between 0 ppm to about 500 ppm of organic residuals.
US11298304B2	Two component hair treatment kit comprising a hair coloring cream and a developer composition comprising a specific tensioactive compound The present invention relates to a kit, preferably for coloring keratin fibers, the kit comprising in spatially separated form at least two kit components: A) a first kit component comprising at least these constituents: at least one alkaline agent; at least one amino acid; at least one organic phosphate ester compound selected from the group consisting of a monoester of a phosphate of one or more alkoxylated fatty alcohols, a diester of a phosphate of one or more non-alkoxylated fatty alcohols, and a mixture of both; water; and optionally at least an oxidative dye; water; and B) a second kit component comprising at least these constituents: at least one emulsifier; hydrogen peroxide; at least one fatty alcohol; and water. The invention relates also to a process of manufacturing a composition which is the second kit component, a composition obtainable by such process, a ready-to-use composition, a way of preparing such and to a use of an emulsifier as in formula (I) and defined above in combination with the organic phosphate ester compound defined above to reduce the viscosity of haircoloring creams.
US11298302B2	Water-in-oil type emulsion cosmetic The present invention provides a water-in-oil type emulsion cosmetic which has a fresh and smooth feeling to the touch; forms a uniform coating film once applied; can make skin unevenness such as pores look less prominent while covering discolorations such as age spots and freckles; and does not give an impression of thick application. The water-in-oil emulsion cosmetic is characterized by including (A) 0.1-10% by mass of a pigment-grade titanium dioxide and (B) 0.01-2% by mass of sodium acrylate grafted starch. It is preferred that this cosmetic further includes (C) spherical particles and/or (D) a silicone elastomer.
US11298301B2	Oil-in-water emulsified cosmetic An oil-in-water emulsified cosmetic comprising an aqueous medium, an anionic surfactant, an oil agent, an amphiphilic polymer selected from the group consisting of hydrophobic group-modified hydrophilic urethane polymers, (meth)acrylic polymers having a side chain including hydrophilic and hydrophobic groups, and hydrophobic group-modified hydrophilic polysaccharides, and a charge neutralizer, wherein the cosmetic has a viscosity of 10,000 mPa·s or higher at 25° C.
US11298300B2	Stable Pickering-type emulsions The present disclosure provides stable Pickering-type emulsions comprising glycerin and oil, as well as methods of manufacturing the same. In some aspects, such emulsions further comprise magnesium stearate and a non-ionic surfactant as co-emulsifiers.
US11298294B2	Fluid valve and fluid connection system The invention relates to a fluid valve and fluid connection system, comprising a casing having a chamber with a first internal connection element and a first external connection element; comprising a first movable valve element in the chamber; and comprising an actuating element which has a fluid communication system with a second internal connection element and a second external connection element; wherein the first internal connection element cooperates with the second internal connection element and the valve element to establish or block a fluid connection between the first and second external connection elements.
US11298292B2	Emergency wash system Apparatus and method for providing tempered water to an emergency wash system. Various embodiments include simple, reliable, low-cost flow regulators to reliably provide adequate emergency wash flows. Yet other embodiments include one or more features that consider the special needs of a person temporarily blinded, and include those persons having disabilities.
US11298285B2	Ankle exoskeleton system and method for assisted mobility and rehabilitation A powered exoskeleton is designed to provide assistance to a user, where the powered exoskeleton may have power-generating elements in one location and power-applying elements in another location, so that a user can easily wear the powered exoskeleton.
US11298284B2	Motorized recumbent therapeutic and exercise device A device for therapy or exercise includes a frame, a base at least partially supporting and extending from the frame, a user support moveably coupled to the base and positioned adjacent the frame, a foot crank system coupled to the frame, a hand crank system coupled to the frame, and a motor coupled to at least one of the foot crank system and the hand crank system. The motor selectively powers the foot crank system and the hand crank system and is operable in an active mode and a passive mode.
US11298280B2	Wheelchair incorporated with a lift apparatus A wheelchair incorporated with a lift apparatus is disclosed. The wheelchair comprises a pair of seat frame support bars, backrest support bars, and armrest frame support bars for supporting at least one seat cushion, backrest cushion, and armrest cushions. The wheelchair further comprises lower support bars positioned parallel and opposite each other on both sides of the wheelchair. The support assembly includes a plurality of scissor links pivotally connected to each other, and an end of the plurality of scissor links is pivotally affixed with needle bearings to the lower support bars and the seat frame support bars. The lift apparatus includes one or more actuators, positioned between the lower support bars and at least one scissor link on both sides. The actuators are configured to raise and lower the seat cushion by raising at least one scissor link, thereby raising and lowering the seat cushion to a desired adjustable height for the user.
US11298277B2	Adhesive tape assemblies Various fastening tape closure assemblies are described. The closure tapes are useful in the manufacture of disposable articles, and particularly disposable diapers. The closure tapes generally include a fastening component, an extension component, and a bonding component. The tape systems provide a new folding configuration and reduced adhesive along a face of the extension component. Also described are disposable articles utilizing the tape closure assemblies.
US11298268B2	Multiple-wound negative pressure wound therapy using multiple fluid collection volumes A negative pressure wound therapy system is configured for treating multiple wounds on a patient's body. The system preferably includes a source of negative air pressure, an air source, a first fluid collection volume, and a second fluid collection volume. The source of negative air pressure is in fluid communication with the first fluid collection volume, the first collection volume is in fluid communication with the second fluid collection volume, and the second fluid collection volume is in fluid communication with the air source, so that the source of negative air pressure, the first fluid collection volume, the second fluid collection volume, and the air source are fluidly connected in series.
US11298266B2	Depth filter for visual prostheses The present invention is a depth sensing visual prosthesis. By depth sensing objects within an image, items located at a certain depths from the user can be removed to declutter an image. The resulting image presents only objects within a range of depth from the visual prosthesis user. Depth sensing can be accomplished in various ways including structured light, time of flight, or preferably, a stereo camera pair.
US11298265B2	Intraocular lens with tilted optical axis An intraocular lens (IOL) with an optical axis is disclosed. Two or more haptics extend from an optical element defining an anterior plane and a parallel posterior plane. The optical axis is tilted at an angle of about 5 degrees with respect to the anterior and posterior planes.
US11298260B2	Perineal thermal pack with improved liquid containment Devices for providing thermal therapy to the perineal and rectal areas of a patient are described. The device is particularly useful for containing gushing lochia flow. Different embodiments of the device can be used to provide either hot or cold therapy to the patient. The inventive thermal pack of the current invention comprises a thermal pouch, pad and a backing layer.

1 2 3 4 5 6 7 8 9 10