最新美国发明专利第2016-06-07期 - 专利汇|PatentHub专利检索|专利查询网|发明专利查询分析

Document	Document Title
US09359794B2	Method for operating an intelligent door knob A method is provided for operating a door lock system with a knob. An apparatus controls transmission of displacement or rotational mechanical energy. A bolt is coupled to a door and the bolt is coupled to an input rod and an output rod. The bolt locks and unlocks a door in response transmission of displacement or delivery of rotational mechanical energy. At least one of an interior or exterior knob is coupled to the bolt and the apparatus that controls transmission of displacement or rotational mechanical energy. An energy source is used that is coupled to the apparatus that controls transmission of displacement or rotational mechanical energy. A wireless communication device is used to communication with a mobile device. Authorization is provided with the mobile device to engage the apparatus that controls transmission of displacement or rotational mechanical energy and allows a door user to manually open the door.
US09359792B1	Combination of lock with adjustable key and core A combination of a lock and a key includes a cylinder having a housing, multiple index rings and multiple cores. The housing has slot laterally defined through the wall thereof the housing. At least one first post and at least one second post respectively extend radially from the first end and the second end of the housing. The index rings are located in the housing and each have at least one column with a first mark. At least one cap restricts the index rings to the housing. Each index ring has one core received therein. The key has a handle, a shaft and multiple unlocking members mounted to the shaft. Each unlocking members has a second mark and a top portion. The index rings are removed and re-arranged by removing the cap via the slot so as to obtain different combinations by the first and second marks.
US09359790B2	Electronic key for a vehicle An electronic key, e.g., a wireless key for a vehicle, is disclosed. The key has a housing with a housing wall having a semi-transparent display section. An information symbol for representing information to be displayed to a user is further provided. The display section has a housing wall section with reduced wall thickness, wherein a light-impermeable layer, in which recesses representing the information symbol are produced, is applied to an inner side of the housing. The combination of a housing wall section of reduced thickness and the light-impermeable layer on the inner side of the housing as an information symbol provided in the display section creates an information symbol that may be very sharp and bright when backlit and, due to the semitransparent formation of the display section, is not visible when not backlit.
US09359788B2	Clutch driving mechanism and methods of making and using thereof A clutch driving mechanism, comprising a motor, a worm, a torsion spring and a clutch rotating arm, wherein the motor is rotationally coupled with the worm, wherein the worm is operably coupled to at least a portion of the torsion spring, and the torsion spring is operably coupled to at least a portion of the clutch rotation arm.
US09359786B1	Tent wall system A system to elevate an internal object in a tent above the ground is provided. The system includes tent wall structure having tent wall material that is in contact an internal attachment that is in contact with the internal object and the tent wall material is also in contact with an anchor external to the tent. The system provides a means to elevate a hammock or other object inside a tent.
US09359785B2	Metal post reinforcement arrangement and a method of repairing and/or reinforcing damaged metal posts A metal post reinforcement arrangement adapted to be clamped about a broken section of a metal post, including two opposing brackets wherein when a bolt fixes one bracket to the other about the metal post the bolt divides the broken section into upper and lower portions so as to provide support and/or structural integrity when the reinforcement arrangement is clamped about the broken section and wherein each bracket has a substantially semi circular cross-sectional configuration along said bracket length that includes a longitudinal central segment terminating on opposed sides with internally directed curved edges with corresponding upwardly extended rounded shoulders that provide substantially triangular dimples on the internal side of the bracket, and wherein a peripheral flange stems out from a rounded dip from each substantially triangular dimple such that said brackets are adapted to be fixed around metal posts having different shapes.
US09359776B2	Walkable photovoltaic floor Walkable photovoltaic floor, constituted of pieces of laminated glass composed of at least two layers of glass (1 and 2), joined together by an encapsulant (6), by an intermediate layer of photovoltaic material (3), and by a peripheral sealed frame (4).
US09359773B2	Non-vinyl resilient flooring product and methods of making same Described herein are methods for manufacturing resilient floor coverings made from non-vinyl materials.
US09359770B1	System for mounting wall panels to a wall A system for mounting wall panels to an existing wall structure, includes wall panels, each formed by a main wall panel section and at least two bent end sections; fastening extrusions, each including a base section adapted to be secured to the existing wall structure and a rigid wall extending at an angle therefrom; and a latch arrangement for securing the wall panels to the rigid wall, the latch arrangement including a latch housing, a movable latch member mounted in the latch housing for either engaging within through openings of respective ones of the rigid wall and the bent end sections, or applying a force on each bent end section positioned against a respective rigid wall, and a force application member for moving the movable latch member into a position to cause locking of respective ones of the rigid wall and the bent end sections.
US09359768B2	Adjustable all-season window awning/light shelf and operating mechanism therefor An adjustable window awning/light shelf includes a canopy attached to supports on both sides of the window. The supports are engaged with vertical drive screws providing for the possibility of moving the canopy up and down. Each drive screw is connected with a common drive shaft. During the cooling season, the canopy is disposed at the top of the window, shading the window from the sun. During the heating season, the canopy is brought down to the bottom of the window by rotating the drive shaft, which in turn rotates the drive screws and moves the supports with the canopy down. Canopy's angle relative to the window increases. When in the bottom position, the awning performs as a light shelf, reflecting sunlight into the window and increasing the amount of sunlight and solar heat entering the building through the window.
US09359767B2	Z-shaped closure member with filter retention features A Z-closure member for raised seam roofs is formed through bending techniques into a shape having a ventilated central vertical member, an upper mounting flange terminating in an upper tab member, and a lower flange member extending in an opposing direction from the upper mounting flange member and terminating in a flexible locking tab. The lower flange is secured to a raised seam roofing panel with fasteners, while the vent cap formed with a return lip is engaged with the upper flange by capturing the upper flange within the return lip. A fastener can be inserted through the vent cap return lip and the upper flange to secure the vent cap to the Z-closure member. A mesh filter is trapped against the vertical member by the upper tab member and the lower flexible locking tab. A seal can be added to the lower flange to seal against the roofing panel.
US09359766B2	System, method and apparatus for thermal energy management in a roof A roof product has a thermal heat storage layer, a vent layer with channels for transferring excess heat through a length of the roof product, and a flame retardant to suppress fire through the vent layer. These three materials form a unitary structure. The roof product may have a radiant layer, the thermal heat storage layer and the vent layer to form the unitary structure. The roof products are assembled in an abutting configuration on the roof of a building. The vent layer vents excess heat from an eave of the roof up to a ridge of the roof and out to atmosphere. The roof products manage thermal energy in the roof by storing thermal heat with the unitary roof product during a heating cycle; venting excess heat through the unitary product; and releasing the stored thermal heat from the unitary product into or out of the building during a cooling cycle.
US09359762B2	Building product and method of manufacture and use A building product and method for manufacturing a building product made from an oriented polymer composition which can be split to provide a surface of the building product with a plurality of visible fibrils to form an aesthetic representative of split wood.
US09359752B2	Toilet discharge valve assembly having moveable buoyant float therein A toilet flush valve that has a moveable buoyant float therein, wherein the float has an open bottom end to trap air therein and wherein the housing includes controls to selectively release air to allow the float to move upwardly therein to permit flushing. By timing when one or two air vents on the housing are open, the duration and volume of the flush can be controlled, with the buoyancy provided by the water lifting the float to open the flush valve. This provides a flushing system with minimal activation energy.
US09359751B2	Plumbing trap flushing device A plumbing trap flushing device for use in association with one of a drain in a sink, an overflow drain in a basin, a drain in a bathtub, an overflow drain in a bathtub and the like is disclosed. The plumbing trap flushing device includes a connector, a conduit and a nozzle. The connector is releasably attachable to a tap. The conduit is in flow communication with the connector and has an outside diameter and an inside diameter. The outside diameter is dimensioned to fit into the drain, whereby when the conduit is in the drain air and water freely flows around the conduit into the drain. The nozzle is in flow communication with the distal end of the conduit. The nozzle has a nozzle inside diameter less than the inside diameter of the conduit whereby the water exits the nozzle in a stream.
US09359750B1	Method and apparatus for cleaning and clearing P-trap systems Embodiments of an apparatus for draining liquid generally include a liquid inlet, a p-trap, an additive reservoir, a fluid outlet, a float switch, a valve, and a fitting, wherein the liquid inlet allows for introduction of liquid, the p-trap allows for maintenance of a liquid level whereby contact is provided between the liquid and an additive contained in the additive reservoir, the fluid outlet is configured to maintain the liquid level above an additive reservoir bottom interior surface, the float switch provides indication of high liquid level, the valve allows for blockage of fluid flow between the p-trap and the liquid inlet, and the fitting allows for introduction of high-pressure fluid into the apparatus. Embodiments of a method for clearing a liquid draining apparatus generally include ceasing flow of liquid there into, operating a valve to substantially prevent reverse flow of liquid therefrom, and providing high-pressure fluid into the apparatus.
US09359748B1	Shower device with multi-product dispensing capability A two-stage coaxial shower head that allows conventional water flow through the shower head or a mixture of product and water through a product low flow nozzle. The product may be such liquids as soap, moisturizer, shampoo, or hair conditioner. Products are contained within product pressure reservoirs each with a product section and a piston. During a shower, a user rotates a selector dial at the multi-ported spool valve to select a product or conventional water flow for rinsing. When a product is selected water flow through a water supply tube from the multi-ported spool valve to the shower head will cease and pressure to force water down to the lower part of a product reservoir to raise the piston in the product pressure reservoir to reject product that is transported to a shower head section. A version using electronics instead of hydraulics is also presented.
US09359747B2	Sanitary fitting comprising a fitting housing and an electrical control unit A sanitary fitting having a fitting housing with an electrical control unit for controlling the water flow through at least one water line which sanitary fitting can be maintained or repaired with particularly little effort particularly in applications involving vandalism. This is achieved by having a fitting housing that can be firmly fixed at the installation site with an assembly cover, which can be released from the fitting main body and which covers electrical control unit, turbine and hydraulic control elements within the fitting housing main body and which provides direct access for maintenance and servicing purposes.
US09359745B2	Bucket edge protection system An edge protection segment for an edge protection system of a ground engaging implement is disclosed. The edge protection segment includes a first side, a second side, a width, a wedge portion, an exterior leg, and an interior leg. The second side is oppositely disposed and lateral to the first side. The width is up to 6 centimeters and is the distance between the first side and the second side. The exterior leg and the interior leg each extend from the wedge portion. The wedge portion, the exterior leg and the interior leg each extend between the first side and the second side.
US09359744B2	Multipiece wear assembly A multipiece wear assembly including an adapter and a wear part. The adapter has a nose portion with a first predetermined configuration. The wear part is assembled onto the adapter nose portion by relative longitudinal movement and defines a blind cavity opening to a rear thereof. The blind cavity of the wear part has a second predetermined configuration. In one form, the second predetermined configuration defined by the blind cavity is greater than the first predetermined configuration defined by the adapter nose portion such that a relief is provided between the adapter nose portion and the blind cavity when the adapter and wear part are arranged in operable combination relative to each other. Lock structure is provided on one of the adapter nose portion and wear part for maintaining the wear part and adapter nose portion in operable combination. In one form, a modular securement member extends generally perpendicular to a longitudinal axis of the tooth assembly with a portion of the securement member filling the relief defined between confronting surfaces on the blind cavity and the adapter nose portion.
US09359743B2	Control system for hybrid construction machine A control system for a hybrid construction machine includes: a turning motor provided in a turning circuit; a pressure detector for detecting a turning pressure of the turning motor; a variable displacement type of fluid pressure motor for regeneration which is rotated by means of pressurized fluid guided from the turning motor; a motor generator adapted to be rotated integrally with the fluid pressure motor; and a controller adapted to predict a turning regeneration flow from the turning motor on the basis of the turning pressure detected by pressure detector to control a tilt angle of the fluid pressure motor on the basis of the predicted turning regeneration flow.
US09359738B2	Quick coupling for pipe pile The present invention relates to a quick coupling for pipe pile, comprising an upper end plate, a lower end plate and a screw hook made of spring steel for coupling the upper and lower end plate, a plurality of tapped holes are uniformly provided on the upper end plate, a plurality of holes corresponding to the tapped holes are provided on the lower end plate, a lock hole is positioned at the lower portion of the hole, while the cross-section area of the lock hole is bigger than the cross-section area of the hole. One end of the screw hook is provided with a screw end mating with the tapped hole on the upper end plate, while the other end is provided with a hook end mating with the lock hole on the lower end plate, whereby the upper and lower end plate can be coupled firmly.
US09359737B2	Environmentally-friendly safe weir comprising both water way and fishway Disclosed herein is an environmentally-friendly safety weir with both a waterway and a fishway. The safety weir includes a waterway pipe (100), a fishway pipe (200), and a control unit (300). The waterway pipe includes: a horizontal waterway pipe (110) that is provided on an embankment; a vertical waterway pipe (120) that extends from each of opposite ends of the horizontal waterway pipe downward; a bottom waterway pipe (130) that horizontally extends from the vertical waterway pipe outward; and a water entering-and-exiting pipe (140) that extends from the bottom waterway pipe upward. The fishway pipe is provided on the waterway pipe and is configured such that the level of water in the fishway pipe is controlled by adjusting the amount of air in the fishway pipe. The control unit includes: a first air supply pipe that is connected to the waterway pipe; and a second air supply pipe that communicates with the fishway pipe.
US09359735B2	Auger snow blower In an auger snow plow, right and left forward rotating augers and right and left backward rotating augers are disposed on a same axis and aligned in a width direction of an auger housing. A blower housing is disposed at a rear portion of the auger housing and also positioned at a widthwise center of the auger housing. A blower is disposed inside the blower housing. The right and left forward rotating augers are positioned at least in an entire range of a width of the blower housing. The right and left backward rotating augers are separately positioned on both sides of the right and left forward rotating augers and positioned only at a more outer side than the width of the blower housing in the width direction.
US09359732B2	Pet waste collection and disposal apparatus A device for collecting and disposing of pet waste includes a housing containing a vacuum source. The housing is configured to receive a disposable liner bag. When closed, the housing holds the liner bag securely therein. The mouth of the bag is fed through the access port of the device such that the access port is insulated from contact with the waste being picked up. A bail holds the bag in place. A filtered bag is presented for use in the device.
US09359730B2	Bollard coverings and methods of manufacture and use thereof A bollard covering formed from a body, a body connector, a first center, a second center, a bottom, and a top is disclosed. The body connector and bottom further comprise post guide surfaces. In order to secure the bollard covering to the post, one or more holes are provided within the bottom, threaded to accommodate a set screw, or the like. Bollard covering elements are joined by welding, bonding, or mechanical fastening. Bollard coverings may be formed from standard inventory elements in order to create a standard inventory or a customized bollard covering product that may be economically configured on an individual bollard covering basis, or on small or large scale runs, with as much variation in optional components, features, and conveniences as may be required by the marketplace.
US09359728B2	Milling drum comprising a, more particularly replaceable, material guiding device and material guiding device for a milling drum The present invention relates to a milling drum for a ground milling machine, wherein a material guiding device is provided, which diverts the milled material in the direction of stagger of milling devices disposed one behind the other, as regarded in the direction of rotation. For this purpose, in particular, a wear plate is provided, which can be selectively replaced on the material guiding device. A further aspect of the present invention relates to such a material guiding device and also to a wear plate for such a material guiding device.
US09359727B2	Adjustable bolster swing legs for mounting and aligning and reorienting crawlers for slipform paving machines A paving machine for spreading, leveling and finishing concrete having a main frame, center module, bolsters laterally movably, and a crawler track associated with respective aft and forward ends of the bolsters. A bolster swing leg for each crawler track supports an upright jacking column. A worm gear drive permits rotational movements of the crawler track and the jacking column. A hinge bracket is interposed between each swing leg and a surface of the bolsters to enable pivotal movements of the swing leg. A length-adjustable holder engages the pivot pin on the hinge bracket and pivotally engages the swing leg. The holder permits pivotal motions of the swing leg in its length-adjustable configuration and prevents substantially any motion of the swing leg in its fixed-length configuration. A feedback loop cooperates with transducers keeping the crawler tracks position. The paving machine can be reconfigured into a narrowed transport configuration.
US09359726B2	Paver having dowel bar inserter with automated dowel bar feeder A paver for laying down a strip of concrete and inserting therein dowel bars parallel to the strip. A dowel bar inserter orients the bars and places them into the concrete. A pair of transport chains transverse to the travel direction extends across a width of the inserter. Pairs of generally L-shaped opposing cups hold the bars so that they can drop downwardly from the cups towards the strip. The chains move in a single direction. A dowel bar holding magazine, above the chains, stores bars, and gravitationally moves the bars towards the chains for pick-up by cups as the chains move the cups past a bar loading station. Elastic bands extend about a bar engaging surface defined by a wheel and resiliently bias the bars moving along the chain turn-around section against the wheel.
US09359725B2	Stepwise repeated destabilization and stabilization of highly collapsible soil mass by ‘soil nailing technique’ used for construction of railway/road underpass The excavations of side vertical walls for building and underpasses must be shored so that the excavations adjacent to the neighboring properties do not cave in during the constructions. A Soil Nailing system has been used for stabilization of excavations and natural slopes for the last few decades in India and Abroad. Soil Nailing Technique used steel anchor rods inserted directly into the soil mass as a driven nails and when Nails are placed in pre-drilled holes to form grouted nails. In both the cases, it restrained load and the side deformations. In the present study, an innovative technique of ‘Soil Nailing’ has been developed for stepwise vertical de-stabilization and stabilization of compacted collapsible sandy soil for the construction of railway underpasses in live railway loading conditions. This technique is successfully implemented first time in the world for controlled destabilization of vertical cut slope and again stabilization for creating a space for pushing of box for railway underpasses for the length of 22 m and 50 m at two sites, namely Yamuna Bazzar and Apsara border, respectively, in Delhi, India. This Soil Nailing Technique of controlled destabilization of soil and again stabilization in steps has proved a superficial method of stabilization with the other methods for such kind of dynamic loading situations.
US09359720B2	Self-adhesive water-activable glass web The invention relates to a self-adhesive wall covering comprising a glass textile with a closed structure, consisting of glass fibers and of a water-permeable polymer binder, and an adhesive coating comprising both a pressure-sensitive adhesive (PSA) and a water-activable latent adhesive. The definitive attachment to the wall of this repositionable self-adhesive covering takes place, after hanging, by applying one or more coats of water-based paint.
US09359718B2	Aqueous solution composition This invention relates to a composition characterized by containing, as essential components, deacetylated chitin and/or a deacetylated chitin derivative, and glyoxylic acid; a solution-containing gel formed from the composition; a water-insoluble chitosan coating; and a material obtained by treating a base material with the composition. According to the present invention, it is possible to provide a chitosan composition, which in a “one-pack” form, has a pot life. Even when dried at room temperature after coating or impregnation of a base material, the chitosan coating can be water-insolubilized with reduced yellowing.
US09359717B2	Laundry treatment apparatus The laundry treatment apparatus includes a cabinet having a receiving space for reception of laundry, a feeder configured to feed at least one of air or moisture into the receiving space, a support structure placed in the receiving space, the support structure providing a support space to allow a surface of the laundry to be supported by the support space, a guide affixed in the receiving space, the guide being configured to set a movement range of the laundry to prevent the laundry from deviating from the support space, and a press structure separably coupled to the support structure, the press structure being configured to apply pressure to the laundry positioned in the support space.
US09359713B2	Drying apparatus, washing machine having the same and method of controlling the drying apparatus A drying apparatus that is capable of effectively removing foreign substances, such as dead mite bodies and dust adhered to bedding, a washing machine having the drying apparatus, and a method of controlling the drying apparatus. When bedding having a large volume, such as a blanket or a cover, is washed, a bedding-dusting operation using rotation of a drum and high-temperature hot air is performed before and after a bedding washing course is performed, so that foreign substances, such as dead mite bodies or dust, are dusted off bedding and the effects of washing bedding can be improved. In addition, a section in which the bedding-dusting operation is to be performed, is automatically or manually selected as before bedding washing or after bedding washing so that various operations can be performed and the effects of washing bedding can be improved.
US09359705B2	Washing machine and drying machine A washing machine includes a vibration damping device located in an outer casing for damping vibration of a tub using a cylinder enclosing an operating fluid including a functional fluid such as a magnetic viscous fluid changing a viscosity when an electrical energy is applied to the fluid. The vibration damping device includes the cylinder, a shaft inserted into the cylinder, a coil disposed in the cylinder, two yokes disposed between the cylinder and the shaft so as to be located at both axial sides of the coil respectively, the yokes forming a magnetic circuit together with the shaft and cylinder, a sealing member disposed axially outside one of the yokes in the cylinder to seal the operating fluid, and two bearings located axially outside the respective yokes in the cylinder to support the shaft so that the shaft is axially reciprocable.
US09359703B2	Sewing machine The sewing machine has: a base plate that has a guide slit for guiding a bobbin thread that is set on the bottom face side of the throat plate 1; and a bobbin thread guide member that has a guide groove for guiding the bobbin thread supplied from a bobbin and includes a cutting blade provide at the end position of the guide groove to cut the bobbin thread guided along the guide groove to an appropriate length. The bobbin thread guide member is secured to the base plate and has a holding member, which holds the end of the bobbin thread, in the guide groove, so as to maintain the state when the bobbin thread was cut.
US09359700B2	Weft insertion system and weaving machine comprising such a system A weft insertion system includes at least one rapier provided with weft yarn clamping means for drawing a weft and a reed provided with dents made of a magnetic material, and wherein the rapier has at least one permanent magnet whose direction of polarization extends along a direction which is perpendicular to a longitudinal axis of the reed dents when the reed is in a back position and to a translation direction of the rapier, the at least one permanent magnet exerts an attractive magnetic effort (E, E′) between the rapier and the dents of the reed and the reed has a variable magnetic permeability along its longitudinal axis, and the rapier has a lateral face oriented towards the reed and the at least one permanent magnet has a direction of polarization perpendicular to the direction of travel of the rapier and secant with the lateral face.
US09359699B2	Industrial two-layer fabric The object of the present invention is to provide an industrial two-layer fabric which exhibits excellent air permeability with good wear resistance to prevent the wire mark or the hydration mark, while exhibits high rigidity. The present invention includes at least one upper surface side fabric constituted by upper surface side warps and upper surface side wefts, at least one lower surface side fabric constituted by lower surface side warps and lower surface side wefts, and lower surface side warps serving as binding weft yarns, and includes three upper surface side warps arranged to be adjacent to each other in the upper surface side fabric, whereby the upper surface side wefts pass over three consecutive upper surface side warps, and then, pass under one upper surface side warp to pass over another upper surface side warp, and then, passes under three consecutive upper surface side warps.
US09359697B2	Adjustable spinning wheel A spinning wheel assembly, including a collapsible frame and a spinning assembly connectable thereto. The spinning assembly includes a first grooved pulley and a plurality of differently sized second grooved pulleys, each pulley being rotatably connectable to the frame. A spindle is removably connectable to a respective grooved second pulley, and an endless belt is operationally connected to the first and second pulleys. Each respective grooved second pulley has at least one circumferential groove defining an effective diameter and at least one unique effective diameter.
US09359696B2	Method for manufacturing poly(ethyleneterephthalate) drawn fiber, poly(ethyleneterephthalate) drawn fiber and tire-cord Disclosed are a method for manufacturing a drawn fiber, which is suitable for manufacturing a poly(ethylene terephthalate) drawn fiber showing superior strength and dimensional stability and having a high fineness of 2000 denier or more without breakage or reduction in physical properties during the manufacturing process, and a poly(ethylene terephthalate) drawn fiber and a tire-cord obtained therefrom.
US09359695B2	Lignin-based active anode materials synthesized from low-cost renewable resources A method of making an anode includes the steps of providing fibers from a carbonaceous precursor, the carbon fibers having a glass transition temperature Tg. In one aspect the carbonaceous precursor is lignin. The carbonaceous fibers are placed into a layered fiber mat. The fiber mat is fused by heating the fiber mat in the presence of oxygen to above the Tg but no more than 20% above the Tg to fuse fibers together at fiber to fiber contact points and without melting the bulk fiber mat to create a fused fiber mat through oxidative stabilization. The fused fiber mat is carbonized by heating the fused fiber mat to at least 650° C. under an inert atmosphere to create a carbonized fused fiber mat. A battery anode formed from carbonaceous precursor fibers is also disclosed.
US09359693B2	Gallium-nitride-on-diamond wafers and manufacturing equipment and methods of manufacture A method for integrating wide-gap semiconductors, and specifically, gallium nitride epilayers, with synthetic diamond substrates is disclosed. Diamond substrates are created by depositing synthetic diamond onto a nucleating layer deposited or formed on a layered structure that comprises at least one layer of gallium nitride. Methods for manufacturing GaN-on-diamond wafers with low bow and high crystalline quality are disclosed along with preferred choices for manufacturing GaN-on-diamond wafers and chips tailored to specific applications.
US09359684B2	Methods of fabricating self-aligned metal layer structure and optic A method of fabricating a self-aligned metal layer structure is disclosed. The method includes: providing a substrate including a conductive layer; forming a pattern in the conductive layer; and electroplating the conductive layer to form thereon an electroplated metal layer such that the pattern is directly transferred in the electroplated metal layer in a self-aligned manner. Methods of fabricating optics are also disclosed. The methods are capable of high accuracy in alignment, and the optics can be used in the production of a lens module.
US09359680B2	Ruthenium or osmium complexes and their uses as catalysts for water oxidation The present invention provides ruthenium or osmium complexes and their uses as a catalyst for catalytic water oxidation. Another aspect of the invention provides an electrode and photo-electrochemical cells for electrolysis of water molecules.
US09359679B2	Methods for cyclically etching a metal layer for an interconnection structure for semiconductor applications Embodiments of the present disclosure provide methods for etching a metal layer, such as a copper layer, to form an interconnection structure in semiconductor devices. In one example, a method of patterning a metal layer on a substrate includes supplying a first etching gas mixture comprising a hydro-carbon gas and a hydrogen containing gas into a processing chamber having a substrate disposed therein, the substrate having a metal layer disposed thereon, supplying a second gas mixture comprising the hydrogen containing gas to a surface of the etched metal layer disposed on the substrate, and supplying a third gas mixture comprising an inert gas into the processing chamber to sputter clean the surface of the etched metal layer.
US09359677B2	Method for inhibiting corrosion A method for inhibiting corrosion comprises the steps of providing a fluid; adding a corrosion inhibitor comprising at least one amphiphilic chemical to the fluid; and monitoring micelles presence in the fluid. A method for determining the amount of corrosion inhibitor that is sufficient to inhibit corrosion, a method for monitoring the activity of an amphiphilic chemical and a system for inhibiting corrosion in a conduit are also disclosed.
US09359675B2	Producing two-dimensional sandwich nanomaterials based on graphene Two-dimensional nanomaterials are produced in a process comprising the steps of (a) providing (a1) a mixture comprising graphene oxide particles, water and at least one cationic surfactant and/or nonionic surfactant or (a2) a mixture comprising graphene particles, at least one solvent useful for solution exfoliation of graphite and at least one cationic surfactant and/or nonionic surfactant, (b) adding at least one sol precursor compound to the mixture from step (a), (c) reacting the mixture from step (b) in a sol/gel process to form gel from the at least one sol precursor compound on the graphene oxide particles or, respectively, the graphene particles, (d) removing the at least one surfactant, and (e) optionally heating the gel-coated graphene oxide particles for at least 1 min to at least 500° C. under inert gas atmosphere to reduce the graphene oxide to graphene.
US09359674B2	Apparatus and method for dielectric deposition The disclosed invention includes apparatus and methods that may be used for plasma-based deposition of thin layers of material on separate or continuous web substrates at very low temperatures with very low defect density. It achieves superior control of gas phase chemistry by controlling the sequence of introduction of gaseous components. It also has substantially independent control over the rate of chemical processes in the gas and of the amount of power and energy of ion bombardment. Such control enables high quality single and multi-layer films to be deposited cost effectively and uniformly over larger areas under very low temperature conditions.
US09359671B2	Coating a substance with graphene Technologies are generally described for a system and process effective to coat a substance with graphene. A system may include a first container including graphene oxide and water and a second container including a reducing agent and the substance. A third container may be operative relationship with the first container and the second container. A processor may be in communication with the first, second and third containers. The processor may be configured to control the third container to receive the graphene oxide and water from the first container and to control the third container to receive the reducing agent and the substance from the second container. The processor may be configured to control the third container to mix the graphene oxide, water, reducing agent, and substance under sufficient reaction conditions to produce sufficient graphene to coat the substance with graphene to produce a graphene coated substance.
US09359659B2	Method for recovering valuable material from lithium-ion secondary battery, and recovered material containing valuable material A method for recovering a valuable material from a lithium-ion secondary battery, the method contains: roasting a lithium-ion secondary battery containing a valuable material in a metal battery case thereof to obtain a roasted material; stirring the roasted material with liquid to separate contents containing the valuable material from the inside of the metal battery case; and sorting the contents separated by the separation and the metal battery case to obtain a recovered material containing the valuable material.
US09359655B2	Metallurgical composition for the manufacture of ferrochrome The invention relates to a pelletizing feed containing chromite ore, at least one nickel salt, and silicon carbide as the only carbonaceous material and the only reducing agent. The invention also relates to process for manufacturing the pelletizing feed comprising the steps providing chromite, at least one nickel salt and silicon carbide, and mixing chromite, at least one nickel salt and silicon carbide. The invention also relates to use of the pelletizing feed as a starting material for the manufacture of sintering feed. The invention also relates to a sintering feed in the form of pellets containing the pelletizing feed. The invention also relates to sintered pellets containing the sintering feed. The invention also relates to process for manufacturing the sintered pellets. The invention also relates to use of the sintered pellets as a component of smelting feed. The invention also relates to smelting feed comprising sintered pellets. The invention also relates to process for manufacturing ferrochrome alloy. The invention also relates to ferrochrome alloy obtainable by the method.
US09359652B2	Thermal treatment method for micromechanical horological parts Thermal treatment method for a micromechanical horological component derived from the LIGA method and exhibiting very low thermal inertia, said method including the step which consists in locally heating one area of the micromechanical horological component to increase hardness by local phase modification, the component being heated for a sufficiently short time that only the locally heated area is affected by the thermal treatment, the phase of the untreated portions of the component remaining unchanged.
US09359649B2	Methods for collection, storage and transportation of biological specimens The present invention provides methods for collecting, storing or transporting liquid suspension of biological specimens containing analytes of interest in a dry state. The dried biological specimens containing analytes of interest are reconstituted and released for subsequent analysis by compressing or centrifuging the matrix. Also provided are method of using kits for collecting, storing, transporting and recovering biological specimens containing analytes of interest.
US09359646B2	Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene The present invention relates to a kit and nucleic acid chip for diagnosing bladder cancer using a bladder cancer-specific marker gene. More particularly, the invention relates to a kit and nucleic acid chip for diagnosing bladder cancer, which can detect the promoter methylation of a bladder cancer-specific gene, the promoter or exon region of which is methylated specifically in transformed cells of bladder cancer. The use of the diagnostic kit or nucleic acid chip of the invention enables diagnosis of bladder cancer at an early stage of transformation, thus enabling early diagnosis of bladder cancer, and can diagnose bladder cancer in a more accurate and rapid manner compared to a conventional method.
US09359641B2	Method and system for accurate alignment and registration of array for DNA sequencing In a genome sequencing system and methodology, a protocol is provided to achieve precise alignment and accurate registration of an image of a planar array of nanoballs subject to optical analysis. Precise alignment correcting for fractional offsets is achieved by correcting for errors in subperiod x-y offset, scale and rotation by use of minimization techniques and Moiré averaging. In Moiré averaging, magnification is intentionally set so that the pixel period of the imaging element is a noninteger multiple of the site period. Accurate registration is achieved by providing for pre-defined pseudo-random sets of sites, herein deletion or reserved sites, where nanoballs are prevented from attachment to the substrate so that the sites of the array can be used in a pattern matching scheme as registration markers for absolute location identification. Information can be extracted with a high degree of confidence that it is correlated to a known location, while at the same time the amount of information that can be packed on a chip is maximized.
US09359638B2	Multi-nucleic-acid amplification reaction tool According to one embodiment, a multi-nucleic-acid amplification reaction tool includes a support and a plurality of types of primer sets. The support is configured to be able to support a reaction field of a liquid phase. A plurality of types of primer sets are fixed in a releasable state, for each type, on mutually independent fixing regions of at least a surface of the support, which is in contact with the reaction field, when the liquid phase forms the reaction field. A plurality of types of primer sets are configured to amplify the respectively corresponding target sequences.
US09359634B2	Fast reaction kinetics of enzymes having low activity in dry chemistry layers The present invention concerns a method for determining an analyte as well as a diagnostic element suitable therefore. In one particular form, a method for determining an analyte includes contacting a sample containing the analyte with a diagnostic element comprising a dry reagent layer. The dry reagent layer contains a mutated dehydrogenase which is specific for the analyte and an artificial coenzyme. The method also includes determining at least one of analyte presence and an amount of the analyte.
US09359633B2	Biochemical markers for CVD risk assessment A method of bioassay for the quantification of peptide fragments comprising a neo-epitope formed by cleavage of a protein of an atherosclerotic plaque such as lumican, versican, perlecan, decorin, biglycan, collagen type III, CRP, ApoE, or elastin, by a proteinase, said comprises contacting a sample such as urine or serum with an antibody reactive with the neo-epitope and determining the level of binding of said immunological binding partner to peptide fragments in said sample. The assay is predictive of risk of cardiovascular disease events.
US09359632B2	Devices, systems and methods for sample preparation Devices, systems and methods including a sonicator for sample preparation are provided. A sonicator may be used to mix, resuspend, aerosolize, disperse, disintegrate, or de-gas a solution. A sonicator may be used to disrupt a cell, such as a pathogen cell in a sample. Sample preparation may include exposing pathogen-identifying material by sonication to detect, identify, or measure pathogens. A sonicator may transfer ultrasonic energy to the sample solution by contacting its tip to an exterior wall of a vessel containing the sample. Multipurpose devices including a sonicator also include further components for additional actions and assays. Devices, and systems comprising such devices, may communicate with a laboratory or other devices in a system for sample assay and analysis. Methods utilizing such devices and systems are provided. The improved sample preparation devices, systems and methods are useful for analyzing samples, e.g. for diagnosing patients suffering from infection by pathogens.
US09359628B2	Protein glycosylation modification in methylotrophic yeast The present invention provides genetically engineered strains of Pichia capable of producing proteins with reduced glycosylation. In particular, the genetically engineered strains of the present invention are capable of expressing either or both of an α-1,2-mannosidase and glucosidase II. The genetically engineered strains of the present invention can be further modified such that the OCH1 gene is disrupted. Methods of producing glycoproteins with reduced glycosylation using such genetically engineered stains of Pichia are also provided.
US09359625B2	Chemical engineering processes and apparatus for the synthesis of compounds The present invention provides methods for producing cannabinoids and cannabinoid analogs as well as a system for producing these compounds. The inventive method is directed to contacting a compound according to Formula I or Formula II with a cannabinoid synthase. Also described is a system for producing cannabinoids and cannabinoid analogs by contacting a THCA synthase with a cannabinoid precursor and modifying at least one property of the reaction mixture to influence the quantity formed of a first cannabinoid relative to the quantity formed of a second cannabinoid.
US09359622B2	Method for biotechnological production of dihydrochalcones A method for production of a dihydrochalcone, especially of phloretin, using a transgenic microorganism, containing a nucleic acid section (a), comprising or consisting of a gene coding for a bacterial chalcone isomerase, and/or a nucleic acid section (a′), comprising or consisting of a gene coding for a plant chalcone isomerase, and a nucleic acid section (b), comprising or consisting of a gene coding for a bacterial enoate reductase, corresponding transgenic microorganisms, containing a nucleic acid section (a), comprising or consisting of a gene coding for a bacterial chalcone isomerase, and/or a nucleic acid section (a′), comprising or consisting of a gene coding for a plant chalcone isomerase, and/or a nucleic acid section (b), comprising or consisting of a gene coding for a bacterial enoate reductase, and host cells, containing one or more identical or different such vectors.
US09359619B2	Biomass liquefaction processes, and uses of same Described are processes for the liquefaction of lignocellulosic biomass under the digestive action of dicarboxylic acid(s). Such digests can exhibit enhanced flowability, reduced volume, and significant biomass conversion to dissolved components, and can in some embodiments be further liquefied by contact with an enzyme. Products resultant of these steps can be used for their sugar content to manufacture biofuels or other products.
US09359611B2	Recombinant microorganism and methods of production thereof The invention relates, inter alia, to novel genetically modified microorganisms capable of using CO to produce 1-butanol and/or a precursor thereof, novel methyltransferases and nucleic acids encoding same, methods for producing genetically modified microorganisms using said novel methyltransferases, and methods of producing 1-butanol and/or a precursor thereof by microbial fermentation.
US09359610B2	Method for purifying GLA-domain coagulation proteins A method for purifying GLA-domain coagulation proteins, includes the following steps: a) bringing a sample containing one or more GLA-domain coagulation proteins into contact with an affinity substrate on which nucleic aptamers which bind specifically to the GLA-domain coagulation proteins are immobilized, in order to form complexes between (i) the nucleic aptamers and (ii) the GLA-domain coagulation protein(s), b) releasing the GLA-domain coagulation protein(s) from the complexes formed in step a), and c) recovering the GLA-domain coagulation protein(s) in a purified form.
US09359606B2	Anti-clusterin monotherapy for cancer treatment The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
US09359605B2	Method of treating cancer by inhibition of DNA repair proteins Methods of treating cancer using antisense oligonucleotides directed against DNA double-strand break repair proteins such as BRCA2 or RAD51 are provided. The antisense oligonucleotides can be used alone, in tandem or in combination with other cancer therapies, in particular with therapies that lead to DNA damage, inhibition of DNA repair or inhibition of DNA synthesis, such as radiation, platinum drugs, alkylating agents, PARP inhibitors, or inhibitors of thymidylate synthase.
US09359603B2	Modulation of pre-mRNA using splice modulating oligonucleotides as therapeutic agents in the treatment of disease The present invention encompasses a class of compounds known as splice modulating oligonucleotides (SMOs) that modulate pre-mRNA splicing, thereby affecting expression and functionality of a specific protein in a cell. The present invention further provides compositions and methods for modulating pre-mRNA splicing using a SMO of the invention to abrogate disease-causing mutations in a protein. Accordingly, the present invention provides compositions and methods of treating a subject at risk of, susceptible to, or having a disease, disorder, or condition associated with aberrant or unwanted target pre-mRNA expression or activity.
US09359593B2	Xeno-free generation of tissue-specific progenitor cells The invention relates to purified, tissue-specific progenitors, methods of making and using such tissue-specific progenitors.
US09359590B2	Derivation and culture of human embryo-derived cells The present invention concerns methods for deriving and culturing embryonic cells and in particular to methods for maintaining the undifferentiated state of stems cells and cell lines in culture. The invention also concerns cells and cell lines derived by the methods of the invention.
US09359589B2	Use of at least one chelating agent introduced into the culture medium of magnetotactic bacteria in order to stimulate the growth thereof The invention relates to the use of at least one chelating agent, including an iron chelating agent, in order to stimulate the growth of magnetotactic bacteria.
US09359587B2	Yeast strains and methods of use thereof The present invention relates to yeast strains and, in particular, to yeast stains for use in fermentation processes. The invention also relates to methods of fermentation using the yeast strains of the invention either alone or in combination with other yeast strains. The invention thither relates to methods for the selection of yeast strains suitable for fermentation cultures by screening for various metabolic products and the use of specific nutrient sources.
US09359583B2	Fabric care compositions The present invention is directed to fluid fabric enhancing compositions and processes of making and using same. Such fluid fabric enhancing compositions have a desirable fabric enhancer active efficiency that is, at least in part, due to the particle index of such fluid fabric enhancing compositions. Certain chemical processing and physical processing methods are not required to produce such compositions.
US09359580B2	Method for extraction and purification of oils from microalgal biomass using high-pressure CO2 as a solute The present invention provides methods for the isolation of oils from intact or lysed microorganisms in aqueous media with pressurized carbon dioxide as a solute. Such oils may be used for the production of biofuels. Also provided for are methods for harvesting and rupturing whole cell microorganisms in aqueous media with pressurized carbon dioxide as a solute.
US09359575B2	Nanoparticle macro-compositions Embodiments of the present invention may include a macro-composition with a special structure. The structure includes a layered macro-composition made of a nanoparticle as an inner nucleus, an intermediate layer around the nucleus, and an outer layer intercalated with the nucleus or encapsulating the nucleus and the intermediate layer. A plurality of the layered macro-compositions is bonded together by bonds, so that each layered macro-composition is bonded to at least one other such layered macro-composition. Embodiments include a macro-composition made of three 3-layered macro-compositions joined in a chain by two bonds. These macro-composition assemblies may take the shape of layered macro-compositions bonded together in chains, or forming other shapes, such as rings. The layered macro-composition may be no more than about 100 nanometers in size, for example. The bonds of the complex macro-composition may have an average length of no more than about 100 nanometers, for example. Embodiments may be added to lubricants such as oil or grease, to increase their performance.
US09359574B2	Lubricating oil composition To provide is a lubricating oil composition capable of exerting an improved fuel-saving performance and having an improved shear stability.The lubricating oil composition comprises (A) a mineral base oil having kinematic viscosity at 100° C. of no more than 5 mm2/s and % CP of no less than 90; and (B) a polymer having weight average molecular weight of no more than 15000.
US09359572B2	Modified vegetable oil lubricants Lubricants based on renewable feedstocks and methods of making them.
US09359570B2	Polytetrahydrobenzoxazines and bistetrahydrobenzoxazines and use thereof as a fuel additive or lubricant additive Polytetrahydrobenzoxazines and bistetrahydrobenzoxazines, obtainable by (A) reacting at least one diamine of the formula H2N-A-NH2 with a C1- to C12-aldehyde and a C1- to C8-alkanol at 20 to 80° C. with elimination and removal of water, (B) reacting the condensation product from (A) with a phenol which bears a long-chain substituent at 30 to 120° C., and optionally (C) heating the reaction product from (B) to 125 to 280° C. The resulting polytetrahydrobenzoxazines and bistetrahydrobenzoxazines are suitable as fuel or lubricant additives, especially as detergent additives for diesel fuels.
US09359558B2	Carbon to liquids system and method of operation A method of operating a carbon to liquids system is provided. The method includes receiving a flow of syngas and reacting, in a reactor, the syngas and a catalyst in a Fischer-Tropsch reaction to produce a product including steam, wherein the reactor includes a polymeric material that is configured to permit the permeation of the steam therethrough. The method also includes recycling the permeated steam to a vessel positioned upstream from the reactor.
US09359557B2	Process for producing volatile organic compounds from biomass material Embodiments of the present invention provide for efficient and economical production and recovery of ethanol or other volatile organic compounds, such as acetic acid, from solid biomass material, particularly on a larger scale, such as on the commercialization or industrial scale. According to one aspect of the invention, the method comprises (a) generating at least about 10 tons of prepared biomass material by adding a microbe, optionally an acid, and optionally, an enzyme to a solid biomass; (b) storing the prepared biomass material for at least about 24 hours in a storage facility to allow production of at least one volatile organic compound from at least a portion of the sugar in the solid biomass; and (c) capturing the at least one volatile organic compound by using a solventless recovery system.
US09359551B2	Phosphor, manufacture thereof; light-emitting device, and image display device utilizing phosphor Provided is a chemically and thermally stable phosphor having different emission characteristics than the conventional phosphor and exhibiting high emission intensity if combined with an LED of 470 nm or less. The phosphor of the present invention is represented by a composition formula: MdAeDfEgXh (d+e+f+g+h=1; M is one or more kinds of elements selected from Mn, Ce, Pr, Nd, Sm, Eu, Tb, Dy, and Yb; A is one or more kinds of elements selected from Mg, Ca, Sr, and Ba; D is one or more kinds of elements selected from Si, Ge, Sn, Ti, Zr, and Hf; E is one or more kinds of elements selected from B, Al, Ga, In, Sc, Y, and La; and X is one or more kinds of elements selected from O, N, and F) and parameters d, e, f, g, and h satisfy the predetermined condition.
US09359549B2	Organic electroluminescent materials and devices Compounds comprising a metal complex having novel ligands are provided. In particular, the compound is an iridium complex comprising novel aza DBX ligands. The compounds may be used in organic light emitting devices, particularly as emitting dopants, providing improved efficiency, low operating voltage, and long lifetime.
US09359545B2	Branched viscoelastic surfactant for high-temperature acidizing A treatment fluid for use in a subterranean formation penetrated by the wellbore of a well includes: (i) water; (ii) a strong acid; and (iii) a branched viscoelastic surfactant having a hydrophobic portion with a total of 16 to 20 carbons; wherein the pH of the treatment fluid is less than 0.5; and wherein the viscosity of the treatment fluid is less than 5 cP at 40 sec−1. A method of treating a zone of a subterranean formation penetrated by a wellbore includes the steps of; (A) forming the treatment; (B) introducing the treatment fluid through the wellbore into the zone; and (C) allowing time for the strong acid in the treatment fluid to spend in the formation.
US09359543B2	Wellbore servicing methods and compositions comprising degradable polymers Methods of servicing a wellbore and/or a subterranean formation including introducing a wellbore servicing fluid into the wellbore and/or the subterranean formation to degrade a degradable polymer therein by contacting the degradable polymer with a liquid neutralized degradation accelerator. The wellbore servicing fluid comprises a particulate salt degradation accelerator and a neutralizer activator. The particulate salt degradation accelerator is formed by reacting a degradation accelerator solution with an acid, the neutralizer activator is capable of dissociating the acid by neutralization from the particulate salt degradation accelerator so as to form the liquid neutralized degradation accelerator.
US09359539B2	Vehicle lamp Provided is a vehicle lamp 1 using a lamp body 3 formed using a resin composition containing a base resin and plant fiber, in which the lamp body 3 and a front cover 2 have good adhesiveness therebetween and there is no separation in the bonding between the lamp body 3 and the front cover 2 even after some time. The lamp body 3 is formed using a resin composition containing a base resin and plant fiber, and in a bonding part between the lamp body 3 and the front cover 2, the bonding is performed using a moisture curing adhesive.
US09359538B2	Sealant for use in ink jet recording heads and ink jet recording head Provided is a sealant for use in ink jet recording heads, comprising a cationically polymerizable resin; a fluorine-containing compound that is liquid at a temperature in a range of 20° C.±15° C.; and a cationic polymerization initiator.
US09359534B2	Hot-melt adhesives with improved adhesion on low-energy surfaces A hot-melt adhesive composition, the use thereof, and a composite body including the hot-melt adhesive composition. The hot-melt adhesive composition includes a polyolefin P, which is solid at 25° C., a soft resin WH with a softening point between −10° C. and 40° C., and a polar modified polyolefin wax PW.
US09359532B2	Pulverulent adhesive which is dispersible in water The invention relates to a pulverulent adhesive for textile reinforcing plies which is dispersible in water, comprising: a) 85 to 97% by weight of at least one at least partially capped, low-molecular isocyanate, b) 15 to 3% by weight of an alkyl naphthalene sulphonate as wetting agent, and also c) 0 to 10% by weight of additives, binders being excluded, with the proviso that the formulation components a+b+c produce 100% by weight.
US09359531B2	Temporarily repositionable pressure sensitive adhesive blends Temporarily repositionable pressure sensitive adhesive compositions which are blends of a silicone-modified pressure sensitive adhesive component, a high Tg polymer component and a crosslinker are presented. The silicone-modified pressure sensitive adhesive includes a copolymer that is the reaction product of an acidic or basic monomer, a (meth)acrylic or vinyl monomer, and a silicone macromer. The high Tg polymer component contains acid or base functionality such that when mixed, the silicone-modified pressure sensitive adhesive component and the high Tg polymer component form an acid-base interaction.
US09359530B2	Release liner for pressure sensitive adhesives and method of use A double-sided adhesive tape assembly that includes a double-sided tape having a pressure sensitive adhesive (“PSA”) on each side thereof and a delaminatable release liner in contact with the pressure sensitive adhesive (“PSA”) on one or both sides of the double-sided tape is disclosed. A roll of the double-sided adhesive tape assembly is also disclosed. Methods of making and using the double-sided adhesive tape assembly are also disclosed.
US09359518B2	Aqueous binder for granular and/or fibrous substrates The invention provides an aqueous binder for granular and/or fibrous substrates, said binder comprising, as active constituents, a polyamine and a saccharide compound.
US09359514B2	Ink jet recording water-based ink and method for producing the same Disclosed are an ink jet recording water-based ink having excellent long-term storage stability and ejection stability at a pigment concentration greater than or equal to a certain level and a simple and efficient method for producing such a water-based ink. The present invention provides an ink jet recording water-based ink in which the total content of polyvalent metals as impurities in the water-based ink is not more than 1.2 ppm in terms of 1 mass % of a pigment concentration. Furthermore, the present invention provides a method for producing an ink jet recording water-based ink; the method enables efficient production of the above-mentioned ink jet recording water-based ink through a contact treatment with a particulate chelating resin in which each resin particle contains both an alkali metal-bonded chelating group and a hydrogen-bonded chelating group.
US09359513B1	Dopant inks, methods of making dopant inks, and methods of using dopant inks Printable dopant formulations, methods of making such dopant formulations, and methods of using such dopant formulations are disclosed. The dopant formulations provide a printable dopant ink with a viscosity sufficient to prevent ink spreading when deposited in a pattern on a substrate. Furthermore, an ion exchange purification process provides the dopant formulation with a reduced metal ion concentration, and thus a relatively high purity level. Consequently, the dopant residue remaining on the substrate after curing and/or dopant activation process is relatively uniform, and therefore can be easily removed.
US09359512B2	Aqueous dispersible siloxane-containing polymer inks useful for printing A siloxane-containing ink composition for variable data lithographic printing includes a nano-particle polymer or blend of nano-particle polymers, wherein the polymer or polymers of the blend are water dispersible at temperatures below 100 degrees Celsius; and solids content is in an amount of greater than 25 percent by total weight.
US09359507B2	Ambient curable corrosion resistant sol-gel coating and composition and process for making the same A coating composition and a method for coating metallic substrates for corrosion resistance. In at least one embodiment, the coating composition comprises acid, metal acetate, epoxy silane, aminosilane and water.
US09359505B2	Gas barrier film, process for production of gas barrier film, and electronic device The present invention provides a gas barrier film having high barrier properties, folding/bending resistance and smoothness and excellent cutting suitability, and also provides an organic photoelectric conversion element equipped with the gas barrier film. The gas barrier film is characterized by having a gas barrier layer unit (5) on a side face of at least one surface of a base material (2), wherein the gas barrier layer unit (5) comprises a first barrier layer (3) formed by a chemical vapor deposition method and a second barrier layer (4) formed by applying a silicon compound onto the first barrier layer (3) to form a coating film and modifying the coating film, and wherein the second barrier layer (4) has an unmodified region (4B) on a side facing the base material and a modified region (4A) on a side facing the front layer of the film.
US09359504B2	Sintering-assisted deposition of uniform titania nanocrystalline coatings over Al flakes in aqueous solution A process of forming a multi-layered pigment comprising the steps of: providing a metal core material; treating the metal core material with an acid, depositing a passivation layer onto the metal core material; densifying the metal core material having the passivation layer reducing a pore size of the passivation layer; and depositing a high refractive index material onto the sintered material wherein the high refractive index layer is uniform and crack free.
US09359497B2	Method for polymerisation of (meth)acrylic acid in solution, polymer solutions obtained and their uses The present invention relates to a new solvent-free preparation method of a (meth)acrylic acid polymer in solution, where said polymer has a molecular weight less than 8,000 g/mol and a polydispersity IP index between 2 and 3 by radical polymerization, the polymers obtained by this means, and their applications in industry.
US09359495B2	Rubber composition for heat resistant conveyor belts, and heat-resistant conveyor belt A rubber composition for heat-resistant conveyor belts according to the present technology contains an ethylene-butene copolymer and an ethylene-propylene-diene copolymer. The mass ratio of the ethylene-butene copolymer to the ethylene-propylene-diene copolymer [(ethylene-butene copolymer)/(ethylene-propylene-diene copolymer)] is from 5/95 to 95/5; and the amount of diene units in the ethylene-propylene-diene copolymer is 2.0% by mass or less per 100 parts by mass of the total of the ethylene-butene copolymer and the ethylene-propylene-diene copolymer.
US09359486B2	Plasticized polymeric compositions The present invention provides plasticized polymer compositions comprising an 7V-allcyl-2-pyrrolidone and a fatty acid ester. These compositions exhibit enhanced hardness, tensile strength, and/or elongation at break without the use of phthalate-based plasticizers. The plasticized polymeric compositions can be employed in a wide variety of applications, such as in sheeting, tubing, and coatings.
US09359484B2	Processes for making polyolefin nanocomposites A process for making a silica-polyolefin composite. The process has the steps of (a) reacting silica particles and an alkyl halosilane in the presence of a solvent and a catalyst to form silane-functionalized silica particles and (b) reacting the silane-functionalized silica particles with a vinyl-terminated polyolefin. There are other processes for making a silica-polyolefin composites. There are other processes for making metal phosphate-polyolefin composites.
US09359482B2	Methods for reducing contamination in plastics recovered from durable goods A process for reducing the content of residual organic substances in mixtures of plastics from durable goods can include separating a feed stream into two or more mixtures of flakes and preforming a cleaning process to remove a portion of one or more of the absorbed organic substances from one or more of the mixtures. Each mixture can contain one or more plastic types and at least one organic substance absorbed into the one or more plastic types. The flakes in the mixtures can have an average particle diameter of less than 10 millimeters.
US09359476B2	Polyamide resin, preparation method therefor, and molded product including same The polyamide resin of the present invention is a polyamide resin containing an amine group and a carboxyl group, wherein the amine group concentration is about 200 to 300 μeq/g and two to six times as high as the carboxyl group concentration. The polyamide resin has excellent long-thermal stability.
US09359465B2	Polyisobutylenes and process for making same The present invention generally relates to alcohol-terminated polyisobutylene (PIB) compounds, and to a process for making such compounds. In one embodiment, the present invention relates to primary alcohol-terminated polyisobutylene compounds, and to a process for making such compounds. In still another embodiment, the present invention relates to polyisobutylene compounds that can be used to synthesize polyurethanes, to polyurethane compounds made via the use of such polyisobutylene compounds, and to processes for making such compounds. In yet another embodiment, the present invention relates to primary alcohol-terminated polyisobutylene compounds having two or more primary alcohol termini and to a process for making such compounds. In yet another embodiment, the present invention relates to primary terminated polyisobutylene compounds having two or more primary termini selected from amine groups or methacrylate groups.
US09359464B2	Stable formaldehyde-free microcapsules The present invention relates to water-dispersible core-shell microcapsules essentially free of formaldehyde. In particular it concerns oligomeric compositions comprising, and the microcapsules obtained from, particular reaction product between a polyamine component and a particular mixture of glyoxal and a C4-6 2,2-dialkoxy-ethanal. The present invention comprises also the invention's core-shell microcapsules as part of a perfuming composition or of a perfuming consumer product.
US09359463B2	Amphiphilic and non-water soluble (meth)acrylic comb polymers Non water-soluble polymers with a comb structure and a (meth)acrylic skeleton on which are grafted side chains containing at least one hydrophobic monomer of the styrene or (meth)acrylic ester type on C1 to C4, and at least one hydroxy or methoxy polylakylene glycol monomer. The levels of monomers are such that the polymer is amphiphilic because it is both rich in hydrophobic monomer and polylakylene glycol monomer. These products, used in paper coating dispersions, enable an increase in their Brookfield™ viscosity, a reduction in their ACAV viscosity, and an improvement in their water retention, which makes them particularly well suited for dry extract and/or high deposit speed coatings.
US09359456B2	Catalytic hydroformylation of vinyl terminated polyolefins This invention relates to a polyolefin composition comprising one or more of the following formulae: wherein the PO is the residual portion of a vinyl terminated macromonomer (VTM) having had a terminal unsaturated carbon of an allylic chain and a vinyl carbon adjacent to the terminal unsaturated carbon; and wherein the VTM is preferably a vinyl terminated polymer having greater than 30% allyl chain ends with an Mn of greater than 10,000.
US09359453B2	Phosphonate and phosphonic acid RAFT agents and monomers, along with methods of their manufacture and use An intermediate compound for forming a RAFT agent is provided that can have the formula: where n is an integer from 1 to 20; m is an integer from 0 to 20; R1 is H, an alkyl group, or a cyano group; R2 is H, an alkyl group, or a cyano group; Y is OH, COOH, or NH2; and X is OH, COOH, NH2, a nitrobenzyl, benzyl, or para-methyl benzyl group. A RAFT agent is also provided that comprises a thiocarbonylthio-containing organic compound having a phosphonic end group. A method is also provided for forming a polymer chain on a surface of a nanoparticle utilizing the RAFT agent, along with nanoparticles and nanocomposites formed therefrom.
US09359448B2	Anti-BAFF-anti-IL-17 bispecific antibodies Bispecific antibodies are provided that specifically bind B-cell Activating Factor of the TNF Family (BAFF) and Interleukin-17A (IL-17) and are characterized as having high affinity and strong neutralizing properties to both BAFF and IL-17. The bispecific antibodies of the invention are expected to be useful in treating Lupus Nephritis (LN), Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), Psoriasis (Ps), Ankylosing Spondylitis (AS), Psoriatic Arthritis (PA), primary Sjögren's Syndrome (pSS), or Multiple Myeloma (MM).
US09359446B2	Antibody to a carbonic anhydrase The present invention relates to an antibody binding to a carbonic anhydrase, wherein the antibody comprises (a) the amino acid sequences SEQ ID NOS. 1 (CDR 1), 2 (CDR 2) and 3 (CDR 3) determining the CDRs of the VH region, and the amino acid sequences SEQ ID NOS. 4 (CDR 1), 5 (CDR 2) and 6 (CDR 3) determining the CDRs of the VL region; or (b) the amino acids sequences of (a), wherein at least one amino acid is conservatively substituted in any one of the amino acid sequences SEQ ID NOS. 1 to 6.
US09359442B2	Anti-CD33 antibodies and methods for treatment of acute myeloid leukemia using the same The present invention relates to antibodies that bind CD33. More particularly, the invention relates to anti-CD33 antibodies, fragments and homologues of these antibodies, humanized and resurfaced versions of these antibodies, functional equivalents and improved versions of these antibodies, immunoconjugates and compositions comprising these antibodies, and the uses of same in diagnostic, research and therapeutic applications. The invention also relates to a polynucleotide encoding these antibodies, vectors comprising the polynucleotides, host cells transformed with polynucleotides and methods of producing these antibodies.
US09359439B2	Fab-glycosylated antibodies The present invention pertains to a method for controlling the circulation half-life of antibodies by adjusting the amount of sialic acid in the carbohydrates attached to the Fab part of the antibodies. Furthermore, the present invention provides antibodies having an increased circulation half-life.
US09359438B2	Human neonatal Fc receptor antibodies and methods of use thereof The disclosure relates to antibodies that bind FcRn and methods of using these antibodies.
US09359437B2	Antibodies comprising chimeric constant domains Antibodies, antigen-binding proteins and Fc-fusion proteins that comprise recombinant polypeptides containing a chimeric heavy chain constant region sequence are provided that bind to certain Fc receptors however have reduced effector functions. Methods of making constructs for expression of such chimeric Fc-containing antibodies, antigen-binding proteins and Fc-fusion proteins in cell systems, and methods of producing and isolating the chimeric Fc-containing proteins are provided.
US09359433B2	FGF modulation of in vivo antibody production and humoral immunity The invention provides methods for increasing or decreasing antibody production in vivo by inhibiting or promoting the activity of fibroblast growth factor-2 (FGF2) respectively.
US09359427B2	Methods for culturing human myeloid leukaemia cells and cells derived therefrom The present invention pertains to a method for culturing a suspension of immortalized human blood cells, preferably cells of myeloid leukaemia origin or cells derived therefrom, wherein said method provides a high productivity, a high cell viability and growth rate and a high batch-to-batch consistency, and can be scaled up without altering these parameters.
US09359424B2	Multimeric polypeptides of HLA-G including alpha1-alpha3 monomers and pharmaceutical uses thereof Multimeric polypeptides and pharmaceutical uses thereof; multimers comprising alpha3 and alpha1 peptides of an HLA-G antigen and methods of producing such multimers, pharmaceutical compositions comprising the same, as well as their uses for treating various diseases including organ/tissue rejection. Said multimers comprise at least two monomers, each of said monomers being selected in the group consisting of a peptide P2 of formula P1-X3 or X2-X3, wherein P1 is of formula X1-X2, wherein X1 represents a peptidic linker including a cysteine amino acid and X2 represents an alpha1 domain (or alpha1 peptide) of HLA-G and X3 represents an alpha3 domain of HLA-G.
US09359422B2	Single chain relaxin polypeptides The present invention relates to biologically active single chain relaxin polypeptides comprising a relaxin B chain derived from relaxin-3, the polypeptides being truncated by one or more amino acids at the C-terminus of the relaxin-3 B chain. Typically the single chain relaxin polypeptides are antagonists of the RXFP3 receptor, and in some embodiments are selective antagonists of the RXFP3 receptor.
US09359421B2	Suppressor of the endogenous interferon-gamma The invention relates to suppressors of endogenous human interferon-gamma (INF-γ) applicable in treatment of diseases associated with impaired activity of endogenous IFN-γ. The suppressors of the invention are useful in treating autoimmune diseases and for prevention of graft arteriosclerosis and rejection of organs in allograft transplanted patients. The invention includes inactive analogues or variants of IFN-γ having preserved affinity to the IFN-γ receptor, genetically modified in the domain responsible for triggering the signal transduction pathway.
US09359420B2	Single chain trail fusion polypeptides and encoding nucleic acids The present invention refers to single-chain fusion proteins comprising three soluble TNF superfamily (TNFSF) cytokine domains and nucleic acid molecules encoding these fusion proteins. The fusion proteins are substantially non-aggregating and suitable for therapeutic, diagnostic and/or research applications.
US09359412B2	OprF/I fusion proteins, their preparation and use The present invention relates to a novel trimeric OprF/I fusion protein comprising a portion of the Pseudomonas aeruginosa outer membrane protein F which is fused with its carboxy terminal end to a portion of the amino terminal end of the Pseudomonas aeruginosa out membrane protein I, wherein said portion of the Pseudomonas aeruginosa outer membrane protein F comprises the amino acids 190-342 of SEQ ID NO: 1 and wherein said portion of the Pseudomonas aeruginosa outer membrane protein I comprises the amino acids 21-83 of SEQ ID NO: 2, and further to a novel Opr F/I fusion protein which contains a disulphide bond pattern, preferably selected from the group consisting of (a) Cys18-Cys27-bond, (b) Cys18-Cys27-bond and Cys33-Cys47-bond, and (c) Cys18-Cys47 and Cys27-Cys33-bond, and to immunogenic variants thereof having at least 85% identity to the amino acid sequence of SEQ ID NO: 3. The present invention also relates to a novel method for producing said OprF/I fusion proteins and to their use for the preparation of a pharmaceutical composition and for the preparation of antibodies or antibody derivatives which specifically bind said novel OprF/I fusion proteins.
US09359404B2	Methods and products for treating preeclampsia and modulating blood pressure The invention relates to methods for altering biological parameters in a subject, such as reducing blood pressure in a subject, by displacing CLIP, using a CLIP inhibitor. The methods are useful for treating disorders such as preeclampsia and high blood pressure.
US09359402B2	EphA2 T-cell epitope agonists and uses therefore EphA2 T-cell epitope are provided herein. The epitopes include peptides corresponding to specific fragments of human EphA2 protein containing one or more T-cell epitopes, and conservative derivatives thereof. The EphA2 T-cell epitopes are useful in an assay, such as an ELISPOT assay, that may be used to determine and/or quantify a patient's immune responsiveness to EphA2. The epitopes also are useful in methods of modulating a patient's immune reactivity to EphA2, which has substantial utility as a treatment for cancers that overexpress EphA2, such as renal cell carcinoma (RCC). The EphA2 epitopes also can be used to vaccinate a patient against EphA2, by in vivo or ex vivo methods.
US09359397B2	Method for manufacturing protein drug The present invention provides a method for manufacturing a virus-free protein drug, comprising (a) a filtration step of filtering a virus-containing protein solution through a small-pore size virus removal membrane to obtain a virus-free protein solution, the filtration step (a) comprising (q) a low-pressure filtration step of filtering the solution through the small-pore size virus removal membrane at a filtration pressure of 0.30 kgf/cm2 or lower to obtain the virus-free protein solution, wherein the solution prior to filtration in the low-pressure filtration step (q) has a pH (X) and a salt ionic strength (Y (mM)) that satisfy the following equations 1 and 5: 0≦Y≦150X−590 (Equation 1) and 3.5≦X≦8.0 (Equation 5) or the following equations 4 and 5: Y=0 (Equation 4) and 3.5≦X≦8.0 (Equation 5).
US09359396B2	Material for supported synthesis and method for growing oligonucleotides or peptides The invention concerns a material composed of a porous support on which functionalized nanoparticles are grafted by covalent bonding, characterized in that at least part of the nanoparticles grafted by covalent bonding is housed inside surface pores of the support, and in that the support is silica-based and is in the form of porous particles of heterogeneous shape and size, the size of the particles being larger than 1 μm and preferably within the range of 5 to 200 μm.The invention further concerns a growth method for oligonucleotides or peptides characterized in that growth is performed on a material formed of a porous support on which functionalized nanoparticles are grafted by covalent bonding, characterized in that at least a part of the nanoparticles grafted by covalent bonding is housed inside surface pores of the support.
US09359395B2	Prodrugs of steroidal CYP17 inhibitors/antiandrogens Prodrugs of C-17-heterocyclic-steroidal drugs providing improved oral bioavailability and phamacokinetics are described. The drugs are inhibitors of human CYP 17 enzyme, as well as potent antagonists of both wild type and mutant androgen receptors (AR), and are useful for the treatment of urogenital and/or androgen-related cancers, diseases and/or conditions, such as human prostate cancer, breast cancer, and prostate hyperplasia. The disclosure describes methods of synthesizing and using the prodrugs in cancer therapy.
US09359394B2	Stereoselective glycosylation reactions Disclosed is a method for selective synthesis of 1,2-cis-α-linked glycosides which does not require the use of the specialized protecting group patterns normally employed to control diastereoselectivity. Thioglycoside acceptors can be used, permitting iterative oligosaccharide synthesis. The approach eliminates the need for lengthy syntheses of monosaccharides possessing highly specialized and unconventional protecting group patterns.
US09359393B2	Photoresponsive nucleic acid manufacturing method The present invention provides a manufacturing method that can easily manufacture a compound known as photoresponsive (photocoupling) nucleic acids at high yield in a shorter period of time than that of the conventional technology. The present invention relates to a method of manufacturing a photoresponsive nucleic acid which includes a step of reacting a nucleic acid having groups represented by the Formula I, the Formula III, the Formula IV, or the Formula V and a compound represented by the Formula II, or reacting a nucleic acid having groups represented by the Formula VI, the Formula VIII, the Formula IX, or the Formula X and a compound represented by the Formula VII by heating them by microwaves in the presence of a metal catalyst, a basic substance, and a solvent.
US09359391B2	Selective C—O bond cleavage of oxidized lignin and lignin-type materials into simple aromatic compounds A method to cleave C—C and C—O bonds in β-O-4 linkages in lignin or lignin sub-units is described. The method includes oxidizing at least a portion of secondary benzylic alcohol groups in β-O-4 linkages in the lignin or lignin sub-unit to corresponding ketones and then leaving C—O or C—C bonds in the oxidized lignin or lignin sub-unit by reacting it with an organic carboxylic acid, a salt of an organic carboxylic acids, and/or an ester of an organic carboxylic acids. The method may utilize a metal or metal-containing reagent or proceed without the metal or metal-containing reagent.
US09359387B2	Organosilicon compound having conjugated diene structure and making method The invention provides a conjugated diene structure-containing organosilicon compound having formula (1): R1nX3-nSi-A-CR2═CR2—CR2═CH2 (1) wherein R1 is a monovalent hydrocarbon group, X is halogen or organoxy, n is 0, 1 or 2, R2 is hydrogen or a monovalent hydrocarbon group, and A is a divalent hydrocarbon group. The organosilicon compound is prepared by reacting a conjugated diene structure-bearing olefin compound with a hydrogensilyl-containing compound in the presence of a platinum catalyst and an acid amide compound, organic amine salt compound, nitrile compound, aromatic hydroxy compound, or carboxylic acid compound.
US09359384B2	Organohalosilane and use thereof in electrolytes of non-aqueous lithium ion batteries An organohalosilane represented by formula I, where R1, R2, and R3 independently, at each occurrence, represent —(CH2)xCH3 where x is an integer from 0 to 5, or a halogen substituent where the halogen is F or Cl, and at least one substituent from R1, R2, and R3 is the halogen substituent; R4 is a C1-C5 alkoxyl or a tertiary amine represented by —NR5R6, where R5 and R6 independently, at each occurrence, represent a same or different C1-C5 alkyl; m is an integer from 1 to 20; and n is an integer from 0 to 5. The organohalosilane is used for preparation of an electrolyte solution of a non-aqueous lithium ion battery.
US09359383B2	β-ketoimine ligand, method of preparing the same, metal complex comprising the same and method of forming thin film using the same The β-ketoimine ligand is represented by the following formula 1: wherein R1 and R2 are each independently a C1-C5 alkyl group. A metal complex compound includes the β-ketoimine ligand. A method of forming the β-ketoimine ligand and a method of forming a thin film using the metal complex compound including β-ketoimine ligand are provided.
US09359376B2	Substituted methylformyl reagents and method of using same to modify physicochemical and/or pharmacokinetic properties of compounds The present invention relates to the synthesis and application of novel chiral/achiral substituted methyl formyl reagents to modify pharmaceutical agents and/or biologically active substances to modify the physicochemical, biological and/or pharmacokinetic properties of the resulting compounds from the unmodified original agent.
US09359374B2	Polymorphic forms of rifaximin Provided for in the instant application are two additional forms of rifaximin, namely rifaximin polymorphic forms APO-III and APO-IV. Also provided are allegedly novel processes for preparing the previously disclosed rifaximin polymorphic forms APO-I and APO-II. Rifaximin is a non-aminoglycoside antibiotic that has previously been found to be useful for the treatment of traveller's diarrhea caused by Escherichia coli bacteria, as well as in the treatment of irritable bowel syndrome, diverticular disease, hepatic encephalopathy, pyogenic skin infections and as an antibacterial prophylactic prior to colon surgery.
US09359371B2	Bicyclic substituted pyrimidine compounds Disclosed are bicyclic group substituted pyrimidine compounds, pharmaceutical acceptable salts thereof or stereoisomers thereof. Also disclosed are preparation methods, pharmaceutical formulations, and pharmaceutical compositions of the compounds, and use of the compounds, pharmaceutical formulations, and pharmaceutical compositions for preparing a medicament for treating and/or preventing sexual dysfunction diseases and diseases with lower urinary tract symptoms.
US09359369B2	Tricyclic sulfonamide compounds and methods of making and using same The invention provides tricyclic sulfonamide compounds and their use in treating medical disorders, such as obesity. Pharmaceutical compositions and methods of making various tricyclic compounds are provided. The compounds are contemplated to have activity against methionyl aminopeptidase 2.
US09359366B2	Intermediate of Ticagrelor and preparation method therefor, and preparation method for Ticagrelor Disclosed are intermediates of Ticagrelor and a preparation method therefor, and a preparation method for Ticagrelor. Specifically, disclosed is an intermediate, namely, a compound of Formula (VI), for preparing Ticagrelor. Further disclosed is a method for preparing the intermediate and a method for preparing Ticagrelor by using the intermediate. Ticagrelor is prepared by using the intermediate, so that the synthesis process is simple, and a defect that long reaction times under high temperature that are required in the existing methods are avoided. The method is suitable for mass production in industry, energy consumption is reduced, pollution of the environment is reduced, and discharge of waste is reduced.
US09359364B2	Pharmaceutical formulations, processes, solid forms and methods of use relating to 1-ethyl-7-(2-methyl-6-(1H-1,2,4-triazol-3-yl)pyridin-3-yl)-3,4-dihydropyrazino[2,3-b] pyrazin-2(1H)-one Provided herein are formulations, processes, solid forms and methods of use relating to 1-ethyl-7-(2-methyl-6-(1H-1,2,4-triazol-3-yl)pyridin-3-yl)-3,4-dihydropyrazino[2,3-b]pyrazin-2(1H)-one.
US09359363B2	Identification of compounds that disperse TDP-43 inclusions Herein, methods of modulating inclusion formation and stress granules in cells are described. The methods comprise contacting a cell with an inclusion inhibitor. Methods for screening for modulators of TDP-43 aggregation are also described.
US09359362B2	Triazolo and tetrazolo pyrimidine derivatives as HNE inhibitors for treating COPD The present invention relates to novel heterocyclically fused diaryldihydropyrimidine derivatives, to processes for their preparation, to their use alone or in combination for the treatment and/or prevention of diseases and also to their use for preparing medicaments for the treatment and/or prevention of diseases, in particular for the treatment and/or prevention of disorders of the lung and the cardiovascular system.
US09359361B2	Immune system modulators The present invention relates to a compound of Formula I: or a pharmaceutically acceptable salt thereof, wherein the symbols are as defined in the specification; a pharmaceutical composition comprising the same; and a method for treating or preventing autoimmunity disease using the same.
US09359357B2	Forms of rifaximin and uses thereof The present invention relates to Rifaximin amorphous forms, to their use in medicinal preparations and to therapeutic methods using them.
US09359351B2	Cap/endo dual inhibitors and their use in the treatment, amelioration or prevention of a viral disease The present invention relates to a compound having the general formula (V), optionally in the form of a pharmaceutically acceptable salt, solvate, polymorph, codrug, cocrystal, prodrug, tautomer, racemate, enantiomer, or diastereomer or mixture thereof, which are useful in treating, ameloriating or preventing a viral disease. Furthermore, specific combination therapies are disclosed.
US09359350B2	Ring-fused compound The present invention relates to a compound that has URAT1 inhibitory action, and a URAT1 inhibitor, a blood uric acid level-reducing agent and a pharmaceutical composition comprising the compound. More specifically, the present invention relates to a compound represented by Formula (I) below. [in the formula, R1 is -Q1-A1 and the like; is a double bond or a single bond; when is a double bond, W1 is a nitrogen atom or a group represented by the general formula: ═C(Ra)—, and W2 is a nitrogen atom or a group represented by the general formula: ═C(Rb)—; when is a single bond, W1 is a group represented by the general formula: —C(Raa)(Rab)— or a group represented by the general formula: —(C═O)—, and W2 is a group represented by the general formula: —C(Rba)(Rbb)—, a group represented by the general formula: —(C═O)— or a group represented by the general formula: —N(Rbc)—; W3, W4 and W5 are each independently a nitrogen atom or a methine group and the like that may have a substituent; X is a single bond, an oxygen atom and the like; Y is a single bond or (CRYiRYi′)n; and Z is a hydroxyl group or COOR2 and the like.
US09359349B2	Substituted quinazolines as kinase inhibitors The present invention provides compounds of Formula I that modulate PI3 kinase activity and methods of treatment of diseases and conditions associated with PI3 kinase activity.
US09359347B2	Inhibitors of Akt/PKB with anti-tumor activity The subject invention concerns materials and methods for inhibiting the Akt/PKB pathway. In one embodiment, a compound of the invention inhibits kinase activity and/or phosphorylation levels of Akt proteins. The subject invention also concerns methods for inhibiting or killing a cancer cell or other cell in which expression of an Akt protein is elevated or constitutively active, comprising contacting the cell with an effective amount of a compound of formula I. The subject invention also concerns methods for treating cancer or a tumor in a person or animal comprising administering an effective amount of a compound of formula I to the person or animal.
US09359346B2	Benzamide derivative and use thereof Disclosed are a novel benzamide derivative and pharmaceutical use thereof, and more particularly, a novel benzamide derivative having a structure of Formula 1 or pharmaceutically acceptable salts thereof, and a composition for prevention or treatment of pain or itching including the above material. The novel benzamide derivative and pharmaceutically acceptable salt thereof according to the present invention exhibit excellent pain-suppressive effect and, in particular, pain-suppressive effect in not only a neuropathic animal model but also other models such as a formalin model, and therefore, may be used in suppression of different pains such as nociceptive pain, chronic pain, etc. Further, since it was demonstrated that the present invention displays anti-pruritic efficacy even in an itching model, to which a mechanism and treatment concept established with respect to pain is applied, the present invention may also be effectively used in radical treatment of atopic dermatitis by applying the inventive product to an anti-pruritic composition in order to suppress an initial itching stage and treat symptoms thereof, thus preventing skin damage or inflammation after the scratching stage.
US09359345B2	Thiazole derivatives as inhibitors of Bruton's tyrosine kinase This application discloses compounds according to generic Formula I: wherein all variables are defined as described herein, which inhibit Btk. The compounds disclosed herein are useful to modulate the activity of Btk and treat diseases associated with excessive Btk activity. The compounds are further useful to treat inflammatory and auto immune diseases associated with aberrant B-cell proliferation such as rheumatoid arthritis. Also disclosed are compositions containing compounds of Formula I and at least one carrier, diluent or excipient.
US09359343B2	Fluorine atom-containing disulfide compound A disulfide compound represented by formula (1): (in formula (1), R1 and R2 each independently represent a hydrogen atom or an alkyl group; R3 and R4 each independently represent a hydrogen atom or a substituent; Y represents a single bond, —CO— or —COO—; Rf represents a linear or branched perfluoroalkylene group having 1 to 20 carbon atoms or a linear or branched perfluoroether group having 1 to 20 carbon atoms; when Y is a single bond or —CO—, n represents 0 and m represents an integer of 0 to 6; when Y is —COO—, n represents 1 or 2 and m represents an integer of 1 to 6; and p represents an integer of 2 or 3 and 1 represents an integer of 0 or 1 such that p+1=3).
US09359342B2	Protein disulfide isomerase inhibiting anticancer agents Protein disulfide isomerase inhibitors according to formula I are described, wherein R1 is an aryl or cycloalkyl group, R2 is selected from the group consisting of CN, SO2CH3, NO2, CO2R3, CONHR3, NMe2, and CF3, R3 is selected from H or lower alkyl, R4 is H, halogen, CN, or COOH, and X and Y are C—H or heteroatoms selected from the group consisting of N, O, and S. The protein disulfide isomerase inhibitors can be used for the treatment of cancer in a subject.
US09359341B2	Aldehyde derivative of substitute oxazolidinones The present invention relates to the prodrug of 5-chloro-N-({(5S)-2-oxo-3-[4-(3-oxo-morpholin-4-yl)phenyl]-1,3-oxazolidin-5-yl}methyl)thiophene-2-carboxamide, rivaroxaban per se; processes for their preparation, and the application in treatment and/or prophylaxis of diseases, especially of thromboembolic disorders. The prodrug of a compound of formula (B) is chemically designated as 5-chloro-N-formyl-N-({(5S)-2-oxo-3-[4-(3-oxomorpholin-4-yl)phenyl]-1,3-oxazolidin-5-yl}methyl)thiophene-2-carboxamide.
US09359340B2	Hydroxylated and methoxylated pyrimidyl cyclopentanes as Akt protein kinase inhibitors The present invention provides compounds, including resolved enantiomers, resolved diastereomers, solvates and pharmaceutically acceptable salts thereof, comprising the Formula I: Also provided are methods of using the compounds of this invention as AKT protein kinase inhibitors and for the treatment of hyperproliferative diseases such as cancer.
US09359339B2	Glucagon receptor antagonist compounds, compositions containing such compounds and methods of use Glucagon receptor antagonist compounds are disclosed. The compounds are useful for treating type 2 diabetes and related conditions. Pharmaceutical compositions and methods of treatment are also included.
US09359337B2	Acetamide derivatives The invention is concerned with a compound of formula (I) and pharmaceutically acceptable salts thereof wherein R1 to R3, X and Y are as defined as in the description and in the claims. The compound of formula (I) can be used as a medicament.
US09359336B2	Heterocycle-substituted pyridyl benzothiophenes as kinase inhibitors This invention is directed to a compound of Formula I or a pharmaceutically acceptable salt thereof, wherein R1, R2, R3, R4 and X are as defined herein. The compounds of Formula I are useful as receptor tyrosine kinase (RTK) inhibitors and can be used to treat such diseases as cancer, blood vessel proliferative disorders, fibrotic disorders, mesangial cell proliferative disorders and metabolic diseases.
US09359332B2	Processes for the preparation of substituted quinazolines The present disclosure provides compounds for modulating receptor kinase activity, particularly ephrin and EGFR, and methods of treating diseases mediated by receptor kinase activity utilizing the compounds and pharmaceutical compositions thereof. The compounds are generally of formula (I): Diseases mediated by receptor kinase activity include, but are not limited to, diseases characterized in part by abnormal levels of cell proliferation (i.e. tumor growth), programmed cell death (apoptosis), cell migration and invasion and angiogenesis associated with tumor growth. Compounds of the invention include “spectrum selective” kinase modulators, compounds that inhibit, regulate and/or modulate signal transduction across subfamilies of receptor-type tyrosine kinases, including ephrin and EGFR.Also disclosed are methods of making compounds for formula 8: comprising introducing group E2 into a compound of formula 7: wherein Ar, Z, P, and E2 are defined herein.
US09359329B2	Derivatives of 2-pyridin-2-yl-pyrazol-3(2H)-one, preparation and therapeutic use thereof The invention relates to compounds corresponding to formula (I), in the form of the base or of an acid-addition salt: in which n is equal to 0, 1, 2, 3 or 4; m is equal to 0, 1 or 2; o is equal to 0 or 1; X represents a group —CH2, —CH(R′)—, —NH(R′)— or a heteroatom chosen from O and S, it being understood that R′ represents a group —(C1-C5)alkyl, —(C1-C5)alkoxy, —CH2-aryl, —C(O)R5 or —COOR5; R1 represents an oxo group, —COOR5, —W—OH or —W—NR5R6; R2 represents an H atom or a group chosen from the groups (i) —(C1-C5)alkyl, (ii) —(C1-C5)alkoxy, (iii) —COOR5, (iv) —NR5R6, (v) —C(O)—NR5R6, (vi) —SO2—NR3R4, (vii) heteroaryl optionally substituted with a group —(C1-C5)alkyl, (viii) —W-aryl, (ix) —W-heteroaryl, (x) —O—W-aryl, (xi) —O—W-heteroaryl and (xii) —O—W—NR5R6; it being understood that R3 and R4, (i) which may be identical or different, represent, independently of each other, an H atom, a group —(C1-C5)alkyl, —(C3-C6)cycloalkyl, aryl, heteroaryl, —CH2-heteroaryl, —(C1-C5)alkyl-NR5R6, —W—OH or —W—NR5R6; or (ii) form, together with the nitrogen atom that bears them, a heterocycloalkyl group optionally substituted with one or more groups chosen from the groups —(C1-C5)alkyl and —CH2-aryl; W is a group —(C1-C5)alkylene, optionally substituted with one or more hydroxyl groups; R5 and R6, which may be identical or different, represent, independently of each other, a hydrogen atom or a group chosen from the groups —(C1-C5)alkyl and the groups —(C3-C6)cycloalkyl, and also the process for preparing them and the therapeutic uses thereof.
US09359328B2	2-[[[2-[(hydroxyacetyl)amino]-4-pyridinyl]methyl]thio]-N-[4-(trifluoromethoxy)phenyl]-3-pyridinecarboxamide benzenesulfonate, crystal of same, crystal polymorph thereof, and methods for production thereof In the course of developing 2-[[[2-[(hydroxyacetyl) amino]-4-pyridinyl]methyl]thio]-N-[4-(trifluoromethoxy) phenyl]-3-pyridinecarboxamide(compound A), there are the multiple problems: 1) compound A or its salt is difficult to be recrystallized, the storage stability largely differs depending on the kind of the salt, and it is very difficult to obtain a salt of compound A having excellent storage stability; 2) in a crystallization process of compound A, it is very difficult to control a crystal polymorph, and 3) compound A (free body) causes mineral deposition in the stomach when it is orally administered repeatedly. For solving these problems, we made examination focusing on the kind of the salt and, as a result, found that 1) benzenesulfonate of compound A does not decompose by light, humidity and other factors in a 1-week preliminary stability test (severe test), and has no problem in its storage stability, 2) a method of selectively producing two kinds of crystal forms of benzenesulfonate of compound A, and that 3) no mineral deposition in the stomach is observed even after a 4-week repeated oral administration.
US09359327B2	Process for the preparation of substituted pyrimidine derivatives The present invention is directed to processes for the preparation of substituted pyrimidine derivatives, useful as intermediates in the synthesis of histamine H4 receptor modulators, and to intermediates in H4 modulator synthesis.
US09359323B2	Compound The present invention provides compounds of the formula Formula I or a salt thereof: and the uses of such compounds for the treatment of a disease or disorder involving oxidative damage, for preventing UV damage to the skin of a mammal and for preventing or reversing the effects of ageing, or for treating or preventing dry skin.
US09359319B2	Hydrogenation of biomass-derived substrates The α,β-unsaturated ketone moiety of a substrate representative of non-food based biomass was hydrogenated to the corresponding saturated alcohol moiety using a composition including (1) a copper salt; (2) a phosphine; (3) a polar aprotic solvent such as acetonitrile, and (4) a compound suitable for providing hydrogen for the hydrogenation, such as a suitable silane material or a suitable siloxane material.
US09359313B2	Use of metformin in combination with a glucokinase activator and compositions comprising metformin and a glucokinase activator The present invention provides uses of a glucokinase activator in combination with metformin. Uses include treating type 2 diabetes, lowering blood glucose, improving insulin sensitivity, enhancing phosphorylation of glucose, and improving the therapeutic effectiveness of metformin. The invention also provides pharmaceutical compositions that comprise a GK activator and metformin. The invention also provides a salt formed between metformin and a GK activator.
US09359306B2	Process for preparing pan-CDK inhibitors of the formula (I), and intermediates in the preparation The invention relates to a novel process for the preparation of pan-CDK inhibitors of the formula (I), and intermediates of the preparation.
US09359304B2	Process for the preparation of 3-haloalkylpyrazoles The present invention provides a process for the preparation of a compound of formula (I) wherein R1 is C1-C4 haloalkyl; R2 is optionally substituted alkyl, optionally substituted aryl or optionally substituted heteroaryl; and R3 is methyl or ethyl; comprising reacting a compound of formula (IV) wherein R1, R2 and R3 are as defined for the compound of formula I; with an alkylating agent in the presence of an amide.
US09359303B2	Octahydrobenzoisoquinoline modulators of dopamine receptors and uses therefor Octahydrobenzoisoquinoline modulators of dopamine receptors are described herein. Methods for using octahydrobenzoisoquinoline modulators of dopamine receptors in the treatment of dopamine dysfunction are also described herein.
US09359301B2	Ethynyl derivatives The present invention relates to ethynyl derivatives of formula I wherein Y is N or CH R1 is fluoro or chloro or to a pharmaceutically acceptable acid addition salt, to a racemic mixture, or to its corresponding enantiomer and/or optical isomer and/or stereoisomer thereof. It has now surprisingly been found that the compounds of general formula I are metabotropic glutamate receptor antagonists (negative allosteric modulators) for use in the treatment of anxiety and pain, depression, Fragile-X syndrom, autism spectrum disorders, Parkinson's disease, and gastroesophageal reflux disease (GERD).
US09359295B2	Sulfoperoxycarboxylic acids, their preparation and methods of use as bleaching and antimicrobial agents The present invention relates to novel sulfoperoxycarboxylic acid compounds, and methods for making and using them. The sulfoperoxycarboxylic compounds of the invention are storage stable, water soluble and have low to no odor. Further, the compounds of the present invention can be formed from non-petroleum based renewable materials. The compounds of the present invention can be used as antimicrobials, and bleaching agents. The compounds of the present invention are also suitable for use as coupling agents.
US09359294B2	Electrophilic reagents for monohalomethylation, their preparation and their uses The invention provides a compound of formula A, B, C or D, methods for making them, intermediates therefor, and their use in making organic biologically active compounds: Wherein: X=F, Cl, Br, I, sulfonate esters, phosphate esters or another leaving group R1, R2, R3, R4, R5, R6, R7, R8, R9, R10 are each individually selected from H, alkyl, aryl, alkynyl, alkenyl, cycloalkyl, cycloalkenyl, alkoxy, nitro, halogen or amino; or are selected from H, C1-C10 alkyl, aryl, C1-C10 alkynyl, C1-C10 alkenyl, C1-C10cycloalkyl, C1-C10 cycloalkenyl, C1-C10 alkoxy, nitro, halogen or amino R11=tetrafluoroborate, triflate, halogen, perclorate, sulfates, phosphates or carbonates Excluding the case when: X=F and R1=R2=R3=R4=R5=H and R6=R7=R8=R9=methyl, R10=H and R11=triflate or tetrafluoroborate; or Wherein: X=F, Cl, Br, I, sulfonate esters, phosphate esters or other another leaving group; and R1, R2, R3, R4, R5 are each individually selected from H, alkyl, aryl, alkynyl, alkenyl, cycloalkyl, cycloalkenyl, alkoxy, nitro, halogen or amino; or are selected from H, C1-C10 alkyl, aryl, C1-C10 alkynyl, C1-C10 alkenyl, C1-C10 cycloalkyl, C1-C10 cycloalkenyl, C1-C10 alkoxy, nitro, halogen or amino and R11=tetrafluoroborate, triflate, halogen, perclorate, sulfates, phosphates or carbonates; and R12=resin, naphthalene or substituted naphthalene Excluding the case when: X=F and R1=R2=R3=R4=R5=H and R6=R7=R8=R9=methyl, R10=H and R11=triflate or tetrafluoroborate and when X=F and R1=R2=R3=R4=R5=H and R12=poly(styrene-co-divinylbenzene) and R11=triflate or tetrafluoroborate; or Wherein: X=F, Cl, Br, I, sulfonate esters, phosphate esters or another leaving group R13=naphthalene or substituted naphthalene R6, R7, R8, R9, RIO are each individually selected from H, alkyl, aryl, alkynyl, alkenyl, cycloalkyl, cycloalkenyl, alcoxy, nitro, halogen or amino; or are selected from H, C1-C10 alkyl, aryl, C1-C10 alkynyl, C1-C10 alkenyl, C1-C10 cycloalkyl, C1-C10 cycloalkenyl, C1-C10 alkoxy, nitro, halogen or amino R11=tetrafluoroborate, triflate, halogen, perclorate, sulfates, phosphates or carbonates; or X=F, Cl, Br, I, sulfonate esters, phosphate esters or another leaving group R13=naphthalene or substituted naphthalene R11=tetrafluoroborate, triflate, halogen, perclorate, sulfates, phosphates or carbonates R12=resin, naphthalene or substituted naphthalene.
US09359291B2	Non-natural amino acids This invention relates in one aspect to non-natural desamino alkyl amino acid compounds, methods of making these compounds, and peptides containing these compounds. In one embodiment, the peptide is neurotensin (8-13) in which the N-terminus is an alpha-desamino, alpha-methyl-N,N-dimethyl-homolysine residue of the invention.
US09359288B2	Preparation of 18F-fluciclovine The present invention provides a method for the production of [18F]-FACBC which has advantages over know such methods. Also provided by the present invention is a system to carry out the method of the invention and a cassette suitable for carrying out the method of the invention on an automated radiosynthesis apparatus.
US09359286B2	Bicyclic compounds Disclosed are compounds of Formula (I) and/or a salt thereof; wherein R is —OH or —OP(O)(OH)2. Also disclosed are methods of using such compounds as selective agonists for G protein-coupled receptor S1P1, and pharmaceutical compositions comprising such compounds. These compounds are useful in treating, preventing, or slowing the progression of diseases or disorders in a variety of therapeutic areas, such as autoimmune diseases and vascular disease.
US09359285B2	Androgen receptor modulator compounds and methods Provided herein are compounds having a structure selected from among Formula (I), Formula (II), Formula (III), Formula (IV), Formula (V) and Formula (VI) that are androgen receptor modulators and/or androgen receptor binding agents. Also disclosed are methods of making and using such compounds, including, but not limited to, using such compounds for treating various conditions.
US09359282B2	Functionalized nanodiamonds as delivery platforms for nucleic acids The present application relates to functionalized nanodiamonds, to complexes comprising a functionalized nanodiamond reversibly bound to a nucleic acid and to compositions comprising such functionalized nanodiamonds and complexes. In particular, the functionalized nanodiamonds comprise at least one naturally occurring basic amino acid, or analogs or derivatives thereof, covalently linked to a nanodiamond. The present application also includes methods and uses of the complexes and compositions, for example for delivering a nucleic acid to a cell.
US09359281B2	Enantiomers of 2-hydroxy derivatives of fatty acids This invention refers to the synthesis and purification of 2 hydroxide derivatives of fatty acids, as well as to the separation method of its enantiomers (or optic isomers) [−] y [+], to the enantiomers themselves, to pharmaceutical compositions which include them, and to their use as medicines, as well as to an in vitro method of diagnosis/prognosis and evaluation of the potential use of the molecules of the invention in different pathologies, as well as their use for the regulation of certain enzymes and the study of their activity and effects.
US09359280B2	Process for preparing a carboxylic acid from a diol or from an epoxide by oxidative cleavage A process for preparing a carboxylic acid, by oxidative cleavage of at least one vicinal diol, or an epoxide, wherein the reaction is carried out in the presence of a catalyst and of an oxidizing agent and in the absence of solvent.
US09359276B2	Monomer for hardmask composition, hardmask composition including monomer, and pattern forming method using hardmask composition Disclosed are a monomer for a hardmask composition represented by the Chemical Formula 1, a hardmask composition including the monomer, and a method of forming a pattern.
US09359268B2	Method for producing negative carbon fuel A method and process is described for producing negative carbon fuel. In its broadest form, a carbon-containing input is converted to combustible fuels, refinery feedstock, or chemicals and a carbonaceous solid concurrently in separate and substantially uncontaminated form. In an embodiment of the invention, biomass is converted via discrete increasing temperatures under pressure to blendable combustible fuels and a carbonaceous solid. The carbonaceous solid may be reacted to synthesis gas, sold as charcoal product, carbon credits, used for carbon offsets, or sequestered.
US09359266B2	Systems and methods for converting and processing organic sludges for multi-nutrient single accreted granule enhanced efficiency fertilizer production Convening dewatered heterogeneous sludge containing organic waste materials into a homogenous extract of carbon and amino acids for fertilizer production by adding sulfuric acid to the sludge; pumping the mixture through a blending mixer to mix the sludge with the sulfuric acid; adding conditioning chemicals to the mixture: pumping the mixture through a shearing mixer to mix the conditioning chemicals into the mixture; and mechanically agitating the mixture to create the homogenous extract. Optionally, the extract is pumped into a pipe reactor for reaction with an acid and a base to form a melt, which is rolled onto fertilizer particles to form accreted granules. The accreted granules are dried to form a granular fertilizer. Also described is an organically-enhanced granular nitrogen-phosphorous-sulfur fertilizer having at least about 0.5% by weight total carbon and amino acids, and accreted granule size greater than or equal to about 1.7 mm. The fertilizer is noncombustible.
US09359265B2	Plant nutrient coated nanoparticles and methods for their preparation and use Embodiments described herein provide for nanofertilizers having at least one plant nutrient coated onto a metal nanoparticle. Some embodiments provide for a method of making a nanofertilizer including providing a metal nanoparticle and coating the metal nanoparticle with at least one plant nutrient or precursor thereof. In some embodiments, a method of making a nanofertilizer may include mixing a metal salt and a plant nutrient in an aqueous medium to form a solution and adding a reducing agent to the solution to form a coated metal nanoparticle. Some embodiments provide for a boron nanofertilizer and methods of making the same. Some embodiments provide for a method of treating a plant nutrient deficiency, such as, for example, a boron deficiency. Some embodiments also provide for a kit for making a plant nutrient coated nanoparticle.
US09359262B2	Compositions and methods for plugging honeycomb bodies with reduced plug depth variability A composition for applying to a honeycomb body includes a refractory filler, an organic binder, an inorganic binder, and a liquid vehicle, wherein the refractory filler, the particle size distribution of the refractory filler, the organic binder, and the inorganic binder are selected such that, when the composition is applied to plug a plurality of channels of the honeycomb body, the plug depth variability is reduced.
US09359258B2	Shrinkage-compensating concrete A shrinkage compensating concrete does not require restraint. The expansive forces developed during hydration compensate for concrete shrinkage, obviating the need for any added internal or external restraint element. Using this new shrinkage compensating concrete, substantially crack-free slabs may be built without using restraining steel bars, fibers, or other separate restraining element. The shrinkage compensating concrete includes a cement that develops internal expansive forces that never exceed the tensile strength of the concrete, such that the internal expansion compensates for the concrete shrinkage. The expansive cement may be an ASTMS, M or S cement, or other expansive cements may also be used.
US09359231B2	Electrolytic bath for manufacturing acid water and using method of the water An electrolytic bath for manufacturing acid water capable of securing sufficient conductivity even in pure water or deionized water without separately using a catalyst or an ion exchange resin, electrolyzing the pure water or deionized water as well as tap water, and particularly minimizing a reaction between ions and a gas through a deaeration effect and an electrolytic effect in one electrolytic process, increasing conductivity of acid water, and enhancing reduction potential and maintenance time of dissolving power, to obtain acid water (hydrogen water) as stable acid reduced water.
US09359230B2	Nanofabricated membrane using polymerized proteoliposomes The present invention generally related to a nanofabricated membrane including polymerized proteoliposomes. The nanofabricated membrane is a bio-nano fused selective membrane using protein-incorporated uv-crosslinkable liposomes with a chemical reactive biocompatible interstitial matrix. In the present invention, internally UV-crosslinked protein-incorporated proteolipsomes are used because the proteoliposomes made by natural lipids have a short life time and a weak resistance to the circumstantial stresses such as a high and low temperature, pressure, ionic strength etc. Furthermore, the proteo-vesicles made by amphiphilic block copolymers provide less consistency in accomplishing proper functionality batch to batch because of the inevitable polydiversity of the polymer.
US09359229B2	Device for recovering floating materials on the liquid surface A device has a gate portion for recovering floating materials on liquid surfaces and for following vertical movement of the liquid level. Gate floats around and rotatable about the gate portion retain the gate portion near the liquid level. Main floats outside the gate floats support a recovery portion. A blade-shaped projection on an outer circumferential part will rotate along the liquid level. A driving device rotates the gate float, with loads of the driving device being supported by the main floats.
US09359226B2	Regenerable filter unit, regenerable filter system including the same, and method of operating regenerable filter system A filter unit may include an electrode structure, a fluid-purifying flow path, and a pH adjusting chamber. The electrode structure may include a cathode, a cation exchange membrane, an anion exchange membrane, and an anode in that order. The fluid-purifying flow path may be at least one of a path in the cathode, between the cathode and the cation exchange membrane, between the anion exchange membrane and the anode, and in the anode. The fluid-purifying flow path may include an adsorption function. The pH adjusting chamber may be between the cation exchange membrane and the anion exchange membrane. The pH adjusting chamber may be configured to control the pH of the fluid in the fluid-purifying flow path.
US09359221B2	Carbon dioxide sequestration involving two-salt-based thermolytic processes The present invention relates to an energy efficient carbon dioxide sequestration processes whereby Group 2 silicate minerals and CO2 are converted into limestone and sand using a two-salt thermolytic process that allows for the cycling of heat and chemicals from one step to another.
US09359219B1	Surface-modified cyanide-based transition metal compounds A system, method, and articles of manufacture for a surface-modified transition metal cyanide coordination compound (TMCCC) composition, an improved electrode including the composition, and a manufacturing method for the composition. The composition, compound, device, and uses thereof according to AxMn(y-k)Mjk[Mnm(CN)(6-p-q)(NC)p(Che)rq]z. (Che)rw(Vac)(1-z).nH2O (wherein Vac is a Mn(CN)(6-p-q)(NC)p(Che)rq vacancy); wherein Che is an acid chelating agent; wherein: A=Na, K, Li; and M=Mg, Al, Ca, Sc, Ti, V, Cr, Fe, Co, Ni, Cu, Zn, Ga, Pd, Ag, Cd, In, Sn, Pb; and wherein 0
US09359218B2	Chemical production system Systems and methods of producing chemical compounds are disclosed. An example chemical production system includes an intake chamber having intake ports for entry of a gas mixture. An igniter ignites the gas mixture in the intake chamber. A nozzle restricts exit of the ignited gas mixture from the intake chamber. An expansion chamber cools the ignited gas with a cooling agent. The expansion chamber has an exhaust where the cooled gas exits the expansion chamber. A chemical compound product is formed in the expansion chamber.
US09359215B2	Precipitated silica having particular morphology, grading and porosity, preparation thereof and reinforcing of polymers therewith Precipitated silicas including clusters of large primary silica particles having at the surface thereof small primary silica particles, have a specific surface area CTAB (SCTAB) ranging from 60 to 400 m2/g; a cluster average size d50, as measured by XDC grading after ultrasound deagglomeration, such that d50 (nm)>(6214/SCTAB (m2/g)+23; a pore volume distribution such that V(d5-d50)/V(d5-d100)>0.906−(0.0013×SCATB (m2/g)); and a pore size distribution such that Mode (nm)>(4166/SCTAB (m2/g))−9.2; such silicas are useful reinforcing fillers for polymers.
US09359207B2	Augmented reactor for chemical vapor deposition of ultra-long carbon nanotubes Apparatus to produce carbon nanotubes (CNTs) of arbitrary length using a chemical vapor deposition (CVD) process reactor furnace is described, where the CNTs are grown axially along a portion of the length of the furnace. The apparatus includes a spindle and a mechanism for rotating the spindle. The spindle located within a constant temperature region of the furnace and operable to collect the CNT around the rotating spindle as the CNT is grown within the furnace.
US09359201B2	Hydrogen production by an autothermal heat exchanger packed-bed membrane gas reformer A process for producing hydrogen from natural gas, said process comprises the steps of: (i) providing an autothermal heat exchanger packed-bed membrane reformer (APBMR) comprising: (a) an elongated external gas oxidation compartment comprising an inlet, an outlet and packed oxidation catalyst particles, said inlet and outlet being located each at one extremity of said external gas oxidation compartment; (b) an elongated internal gas steam-reforming compartment comprising an inlet, an outlet and packed steam-reforming catalyst particles, said inlet and outlet being located each at one extremity of said internal gas steam-reforming compartment; (c) one or more hydrogen-separating membrane(s) positioned in said steam-reforming compartment substantially parallel to the longitudinal axis of said steam-reforming compartment; (d) one insulation layer surrounding said external compartment; and, optionally, (e) one or more elongated internal gas oxidation compartment(s) positioned in said steam-reforming compartment substantially parallel to the longitudinal axis of said gas steam-reforming internal compartment, and comprising an inlet, an outlet and packed oxidation catalyst particles, said inlet and outlet being located each at an extremity of said internal gas oxidation compartment(s); (ii) supplying a mixture comprising said natural gas and air to said gas oxidation compartment(s) of said reformer; and (iii) supplying a mixture comprising said natural gas and water to said gas steam-reforming compartment, wherein the water-to-gas molar ratio is of between 2 and 4, and wherein the water may be pre-vaporized before being supplied into said gas steam-reforming compartment; thereby producing hydrogen suitable to be directly fed into a power generating device (PGD) to generate an electrical power, or to be stored into a suitable container before further use.
US09359197B2	Method of diagnosing, prognosing and monitoring parkinson's disease The present invention provides a system and method for diagnosing, monitoring, prognosing or staging Parkinson's disease using at least one sensor comprising carbon nanotubes coated with cyclodextrin or derivatives thereof or metal nanoparticles coated with various organic coatings in conjunction with a learning and pattern recognition algorithm.
US09359196B2	Antiproliferative compositions comprising curcumin analogs and methods of producing and using same Antiproliferative compositions that include CLEFMA, as well as liposomal compositions containing said antiproliferative compositions, are disclosed. Also disclosed are methods of making and using the antiproliferative compositions and liposomal compositions.
US09359191B2	Reversible top/bottom MEMS package Methods and systems for a reversible top/bottom MEMS package may comprise a base substrate comprising metal traces, an opening through the base substrate, a die coupled to a first surface of the substrate and positioned over the opening, a frame member coupled to the first surface of the substrate wherein the die is positioned interior of the frame member, a cover substrate coupled to the frame member, and conductive plating on the frame member that electrically couples the base substrate to the cover substrate, wherein the conductive plating is exposed. The conductive plating may couple a ground plane in the base substrate to a ground plane in the cover substrate. The conductive plating may be exposed at an outer surface of the frame member and/or at an inner perimeter of the frame member. Conductive vias within the frame member may be coupled to the metal traces in the base substrate.
US09359190B2	MEMS package structure and method for fabricating the same A MEMS package structure is disclosed. The MEMS package structure includes a first glass substrate on a micro-electromechanical systems (MEMS) structure, a sealant adhered between the first glass substrate and the MEMS structure; and a first moisture barrier on the sidewalls of the first glass substrate, the sealant, and the MEMS structure.
US09359189B2	Micro electro mechanical device, method for manufacturing the same, semiconductor device, and method for manufacturing the same A micro electro mechanical device includes: a semiconductor layer; a source/drain region formed on both sides of a channel region within the semiconductor layer; a gate insulating film formed on the semiconductor layer; a cavity formed on the gate insulating film; and a gate electrode formed on the cavity, the gate electrode being movable so as to contact with the gate insulating film. In the device, a pressure applied on the gate electrode is detected by a contact area of the gate electrode and the gate insulating film.
US09359177B2	Lifting device efficient load delivery, load monitoring, collision avoidance, and load hazard avoidance A method of lifting device collision avoidance is disclosed. In one embodiment, the method comprises determining a three dimensional position of a collision avoidance sensor unit coupled with a load line of a first lifting device, the determining performed by a first global navigation satellite system (GNSS) receiver coupled with a housing of the collision avoidance sensor unit, generating a geofence for the first lifting device based at least in part on the collision avoidance sensor unit position, monitoring for a collision related hazard indicated by encroachment between the first geofence and a second geofence associated with a second lifting device and initiating at least one collision hazard avoidance action in response to a monitored occurrence of the collision related hazard.
US09359170B2	Coding device and position-determining device and position-determining method In order to increase safety, a computer-implemented method is proposed for determining the position of a lift cabin in a lift shaft with the aid of a coding device, in which method a section of a code band and/or of the bearing device is/are recorded with an optical detection device as a pixel image consisting of pixels, a reference marking analysis is carried out, the pixel image is processed, in particular is assigned to a detection grid, pixels of the pixel image are preferably combined with the aid of their color and/or position in order to be able to read out the barcode and/or 2D code of the marking, the barcode and/or 2D code is converted to a binary code, the binary code is decoded by means of an algorithm and is converted into a position indication and/or into information as to whether a bearing device has been detected.
US09359169B2	Elevator group control system that controls hall destination calls for assigned and non-assigned elevator calls There is provided an elevator group control system, in which even after an assigned car has been determined, the assigned car can be changed as necessary, and therefore comfortable service can be offered to a user. This group control system includes a call registration device by the use of which a user registers a hall destination call before getting into a car, a car position detection part for detecting the car position of each elevator, and a call registration storage part for storing, for each elevator, a hall destination call having been registered. When a hall destination call having the same contents as those of an already registered hall destination call stored in the call registration storage part is registered newly from the call registration device, if a non-assigned car has already arrived at the floor on which the call registration device is installed, the newly registered hall destination call is assigned to the non-assigned car.
US09359159B2	Sheet feeding apparatus and image forming apparatus A sheet feeding apparatus includes a stacking portion, a feed portion, a moving amount detecting portion provided downstream of the feed portion and configured to detect a moving amount of the sheet, and a control portion. The control portion is configured to change a timing for starting a sheet feed operation by the feed portion in feeding a n+1th sheet by the feed portion based on a detection result of the moving amount detecting portion detected when a nth sheet has been fed by the feed portion in feeding the sheets consecutively by the feed portion.
US09359158B2	Sheet feeding device, image forming apparatus, and image forming system A sheet feeding device includes: a sheet stacking member; an air blowing unit configured to blow air onto the sheet bundle placed on the sheet stacking member to suspend multiple sheets of the sheet bundle; a lifting/lowering unit configured to lift/lower the sheet stacking member; an optical reflection sensor configured to detect a suspended sheet suspended by the air blowing unit; and a control unit configured to control the lifting/lowering unit based on an output value of the optical reflection sensor. The optical reflection sensor is configured to be capable of detecting an area corresponding to multiple sheets in a sheet suspension zone extending between a non-suspended sheet bundle and a conveying member configured to convey an uppermost sheet of the multiple suspended sheets. The non-suspended sheet bundle is made up of sheets not suspended during a period when air is blown by the air blowing unit.
US09359157B2	Sheet feeding device and image forming apparatus A sheet feeding device includes: a sheet feeding tray attached to a casing in a manner slidable into and out from the casing and including a stacking plate on which sheets are stacked; a conveying unit configured to convey the sheets in a direction orthogonal to both a sliding direction of the sheet feeding tray and a stacking direction of the sheets; an optional extension unit configured to be removably attached to an upstream side of the stacking plate in a conveying direction, and including an extension plate configured to extend the stacking plate; and a first locking unit configured to be capable of being held in a first lock position where the sheet feeding tray cannot be slide when the optional extension unit is attached while, when the optional extension unit is removed, held in a first unlock position where the sheet feeding tray can be slid.
US09359147B2	Pipe belt orientation monitoring As a tubular conveyor belt advances through a conveyor system longitudinal rips can be detected and the orientation of the belt can be monitored, wherein the tubular conveyor belt has a width, a length, a longitudinal centerline, a first longitudinal edge, an opposing second longitudinal edge, and a load bearing region, wherein during use the first longitudinal edge and the second longitudinal edge overlap to form an overlap region forming the belt into a tube-like shape, wherein the load bearing region is located evenly about the belt longitudinal centerline throughout the length of the belt; this method comprising monitoring the position of the centerline by detecting the position of a plurality of equally spaced magnetically permeable elements embedded therein, wherein the magnetically permeable elements are situated across the width of the load bearing region of the tubular conveyor belt.
US09359144B2	Multi-piece shaft A method of manufacturing a multi-piece shaft for an idler roller. The method includes providing a tube having a first end and a second end, mechanically crimping the first end of the tube to a first stub to secure the first stub to the first end of the tube with a mechanical interlock, and mechanically crimping the second end of the tube to a second stub to secure the second stub to the second end of the tube with a mechanical interlock. The first stub extends from the first end of the tube and the second stub extends from the second end of the tube.
US09359137B2	Tunneled gas storage A system for high-pressure natural gas storage includes at least one underground bored tunnel, suitable for holding natural gas under pressure and a process for storing natural gas under pressure.
US09359136B2	Pharmacy picking device comprising a universal supply- and- control module A pharmacy picking device including a housing with a plurality of shelf bases disposed one above the other, at least one operating device, a conveyor device, a housing-coupling interface, and a universal supply-and-control module is described herein. This universal supply-and-control module includes a feed device, an identification and measurement device, operator input/output devices, an electronic controller and a voltage supply assembly, as well as a housing-coupling interface and an electrical interface, the supply-and-control module being arranged adjacent to the housing such that a mechanical coupling is produced by said housing-coupling interface and module-coupling interface, in such a manner that drug packages in or on the supply-and-control module, which are to be deposited, are delivered to a position on the conveyor device which is known to the electronic controller.
US09359133B2	Tanks and methods of constructing tanks There is provided a method of constructing a tank which provides an improvement in the strength of the tank. Therefore, tanks can be constructed from thinner materials providing lighter tanks which are more capable of withstanding explosions or other trauma.In addition, the tank is more suited for use in vehicles as it effectively controls unwanted movement of fluid within the tank.
US09359126B2	System, method and capsule for preparing a beverage A system, method and capsule for preparing a predetermined quantity of beverage suitable for consumption using an extractable product includes an exchangeable capsule, and an apparatus including a receptacle for holding the exchangeable capsule, and a fluid dispensing device for supplying a fluid to the exchangeable capsule. The exchangeable capsule includes a circumferential wall, a bottom, and a lid. The wall, bottom and lid enclose an inner space including the extractable product. The bottom includes an entrance layer for supplying an amount of a fluid by the fluid dispensing device through the entrance layer to the capsule. The lid includes an exit layer for supplying a prepared beverage through the exit layer from the capsule to a container. The capsule includes an additional wall element extending towards the inner space for providing additional stiffness.
US09359117B2	Container closure A canister includes a container and a closure. The container is formed to include a product-storage region to receive products and the closure is configured to seal off a brim of the container to block access to the product-receiving container when the closure is rotated in a clockwise direction. The closure includes a lid-retainer ring and a floating lid that covers a mouth of the container.
US09359115B1	Push pull container closure In one embodiment there is provided a push-pull closure having a shell and a cap movable in relation to the shell to an opened and closed position. The shell includes an annual body surrounding a central opening in fluid communication with the container opening and further includes a stem suspended within the central opening and connected to the annual body by radial ribs. The cap includes an inner skirt extending from a pouring edge and having a lower section configured to cooperate and seal against the stem, against an outside radial rib surface, and against an inside surface of the annual body when the cap is in the closed position.
US09359111B2	Reusable envelope A reusable envelope has one or more spaces thereon where address, return labels and/or postage can be removably placed or permanently affixed such as for finite number of shipments using a permanently affixed postage area, for example. The reusable envelope also includes a resealable closure allowing the interior of the envelope to be closed and reopened multiple times for multiple uses (shipments, receiving) or optionally to use a finite number of times by exposing the permanent adhesive to the flat and mating surface depending on user preference.
US09359104B2	Configurable shipping container Shipping containers for porous masses may include a bottom lid having a rectangular lid bottom and four bottom rims that are each continuous with the lid bottom; a tray comprising a tray bottom and four tray sidewalls that are each continuous with the tray bottom defining an interior with an open top; and a top lid having a rectangular lid top and four top rims that are each continuous with the lid top, wherein the tray is configured to be placed on a bottom lid with the bottom rims surrounding a portion of the tray with a top lid placed over the top of the tray with the top rims surrounding a portion of the tray.
US09359103B2	Two-piece shipping container with frangible overlapping glued retainer areas A shipping and display container and a method of disassembling the same, having a first and second blanks configured to form respective first and second sections of the container when nested. The blanks are affixed to one another at least one cooperating fixation area. When a force is applied, the at least one fixation area of the first section is separated from the first section, and the at least one fixation area of the second section is disengaged from a portion of the second section as to rotate about a hinge. The fixation area of the second section remains affixed to the fixation area of the first section, and allows the first section of the container to be separated from the second section of the container. The second section of the container is retained to display the contents of the container.
US09359096B2	Method for sterilizing cuboid-shaped cardboard/plastic combipacks in an autoclave and pack suitable for this A method for sterilizing cuboid-shaped cardboard/plastic combipacks in an autoclave, with the packs including product and packing are subjected to heat treatment at a certain temperature over a certain period of time, the product including a liquid and chunky portions, and mechanisms are provided inside the autoclave to drive the packs rotationally about a rotational spindle, and a cuboid-shaped cardboard/plastic combipack for use in such a device.A plurality of packs are arranged closely adjacent to one another in parallel rows, to be arranged on support floors and for a plurality of support floors loaded with packs to be arranged one above the other and fixed in their mutual positions. The cardboard for the pack used therewith is made water-repellent by means of glue to reduce the intake of water.
US09359094B2	Gripping mechanism A gripping mechanism for securing an end of a wire during tying with a wire tying system is provided. The gripping mechanism may secure a first end of a wire strap around a bale of recycled material during knotting of the wire strap. As such, the gripping mechanism includes a gripping lever having a contact region adjacent the first end of the wire strap. In embodiments, the contact region includes at least one surface feature configured to secure the first end of the wire based on pivoting of the gripping lever. In further embodiments, the contact region of the gripping lever disengages the wire based on rotation of the gripping lever in a first direction. Further, the contact region of the gripping lever may engage against the first end of the wire based on rotation of the griping lever in a second direction, during actuation of the gripping mechanism.
US09359092B2	Device and method for packaging products A device for packaging preferably two-dimensional products is designed for forming a bag-like tube by way of a longitudinal connection device, from a web of packaging material. The bag-like tube, with respect to a conveying direction of the packaging material, is open in a region in front of the longitudinal connection device and is closed in the region after the longitudinal connection device. The device includes a suction device which leads into the still open bag-like tube, and in the closed region includes a suction opening, through which gas can be sucked out of the region after the longitudinal connection device, out of the bag-like tube and through the suction device.
US09359091B2	System and method of providing artificial gravity An artificial gravity system and method for a spacecraft including a least one pair of rotatable stages wherein each stage is capable of rotating about at least one structural support in the spacecraft and wherein the rotatable stages in each pair of rotatable stages counter-rotate one another wherein each stage is capable of accommodating a plurality of occupants. The stages may be circular and deployable. The system may also include dynamic balance equipment in each stage consisting of a fluid redistribution design utilizing fluid pumping systems, storage- and reserve-volume tank pairs to redistribute fluid throughout each stage for optimal mass balance, stage- and spacecraft-mounted laser-tracking equipment for redundant speed measurement, drive assembly and a brake motor and wheel assembly, foldable structural support arms capable of reducing the radial space of each stage during takeoff, and an inertial measurement unit capable of detecting overall vehicle rotational rates.
US09359087B2	Vehicle condition monitoring and reporting A method includes receiving, at a computing device, vehicle condition data from a vehicle monitoring system of a vehicle. The method also includes analyzing the vehicle condition data based on a trigger table, and based on a determination that the vehicle condition data satisfies a particular trigger condition specified in the trigger table, adding an entry in an alert evaluation queue.
US09359083B2	Rotorcraft fitted with a mounting structure for jointly mounting a control panel and avionics rack previously fitted with a unitary cabling assembly A rotorcraft fitted with means for mounting at least one front avionics rack (3, 3′) and man-machine interface instruments (2) on board a fuselage structure (4). A mounting structure (1) comprises a slotted body forming compartments for receiving interface instruments (2), the avionics rack (3, 3′), and a unitary cabling assembly (12) suitable for incorporating as a block with the mounting structure (1). The mounting structure (1) is installed as a block on the fuselage structure (4) after its functioning has been verified. The unitary cabling assembly (12) may also include separation connectors (14) segregating communications of the front avionics rack (3, 3′) respectively with remote computers (5) by means of a primary communications bus of the multiplexed, unidirectional, or bidirectional type, and with ancillary equipment (6) and/or with on-board instruments (7) by means of a secondary fieldbus.
US09359082B2	Aircraft and an aircraft power plant having a connection device for connecting together a main gearbox and an engine A power plant comprising a fuel-burning engine, a main gearbox, and a drive train. The power plant includes two connection bars extending respectively along a first direction and a second direction, which directions are not parallel and intersect a common pivot axis, each connection bar being hinged by a ball joint to the main gearbox and to the engine in order to eliminate relative movements along the longitudinal direction between the main gearbox and the engine, and in order to allow limited pivoting of the main gearbox and of the engine relative to the axis.
US09359081B2	Icing condition detection system A method and apparatus for detecting an icing condition. The apparatus comprises a piezoelectric material and a vibration detector. The piezoelectric material has a surface proximate to a surface of a vehicle. The piezoelectric material is configured to vibrate. The vibration detector is configured to detect a change in vibrations in the piezoelectric material that indicates a presence of an icing condition on the surface of the piezoelectric material.
US09359078B2	Aircraft galley monument structure An improved monument structure combining an integrated construction system with carbon fiber reinforced composites to form an exoskeleton chassis. The chassis includes an above work deck subassembly, a below work deck subassembly, and a rear service wall subassembly, each respective subassembly is formed using carbon fiber reinforced composites (CFRC) pre-impregnated panel skins. The subassemblies are reinforced with a unidirectional carbon fiber.
US09359075B1	Helicopter-mediated system and method for launching and retrieving an aircraft Various embodiments of the present disclosure provide a helicopter-mediated system and method for launching and retrieving an aircraft capable of long-distance efficient cruising flight from a small space without the use of a long runway.
US09359074B2	Methods, systems and devices for delivery drone security Methods, systems and devices are provided for securing a drone delivering a package of goods to a delivery destination. A notification may be provided to a device of the purchaser that the drone has arrived near the delivery destination. The drone may hover at a secure altitude from a landing zone at the delivery destination. The drone may receive a purchase code associated with a purchase of the package of goods. The drone may authenticate the purchase code as a condition for landing. The drone may land in the landing zone at the delivery destination when the purchase code is authenticated. The drone may abort the landing when the purchase code is not authenticated. The drone may receive a delivery code associated with completing delivery the package of goods. The drone may require the delivery code as a condition for releasing the package of goods.
US09359073B2	Aircraft tail rotor system An aircraft tail rotor system is provided and includes a rotating element, a translating element and a structure including a first bearing in series with a second bearing, the first bearing including a component rotatable with and movable within the rotating element in accordance with translational movement of the translating element. The structure is configured to selectively use the second bearing to prevent transmission of rotational energy from the rotating element to the translating element in an event of a seizing of the first bearing.
US09359072B2	Rotor blade for a rotor of an aircraft designed to minimize noise emitted by the rotor A blade (20) of a rotor (5), the blade (20) having a suction side (21) and a pressure side (22) extending transversely from a leading edge (23) towards a trailing edge (24) and extending spanwise from a root section (31) towards a free end section (41). The blade (40) comprises, going from the root section (31) towards said free end section (41): a root zone (30); followed by rounded zone (35); said rounded zone (35) presenting rounded pressure and suction sides (22″, 21″) departing from said main plane (P1) in a direction (Z) parallel to the axis of rotation (AXROT) of said blade.
US09359071B2	Aerodynamic blade attachment for a bearingless rotor of a helicopter An aerodynamic blade attachment (1) for a bearingless rotor, particularly a main rotor, of a helicopter, comprising: an airfoil blade (2) having a tip end and a root end and having a pitch axis from said tip end to said root end; a flexbeam (3); a control cuff (4, 22) enclosing and extending along said flexbeam (3) and a separable junction arrangement between said flexbeam (3), said control cuff (4) and said root end of said airfoil blade (2). Said junction arrangement is mechanical between said flexbeam (3), said control cuff (4) and said root end of said airfoil blade (2). Removable fasteners (5, 6) connect said root end of said airfoil blade (2) and said control cuff (4) with said flexbeam (3). Said junction arrangement comprises fairing means (10, 27, 28, 31, 32 and 39) encompass the removable fasteners (5, 6) and said flexbeam (3).
US09359069B2	Apparatus and system for aircraft park brake systems An electro-mechanical actuator including an aircraft parking brake may include a motor shaft, a park brake disk, and a voice coil assembly. The voice coil assembly may include a bobbin configured to translate between an engaged position and a disengaged position. An engagement feature may be coupled to the bobbin. The engagement feature may contact the park brake disk in the engaged position. The engagement feature may be magnetically coupled to a voice coil magnet and washer in the disengaged position.
US09359068B2	Drive unit for aircraft running gear wheels A drive unit (16) for an aircraft running gear (2) having at least a first wheel (4) and a second wheel (6) on a common wheel axis (A), wherein the drive unit (16) is drivingly coupleable to at least one of the first and second wheels (4, 6), is characterized in that the drive unit (16) comprises at least one power output assembly (122, 124) for driving at least one of the first and second wheels (4, 6), with each of the at least one power output assembly (122, 124) comprising a power transmission chain (136) selectively engageable with a sprocket element (108, 110) coupled to one of the first and second wheels (4, 6).
US09359066B2	Apparatus and method for maintaining a tension in a cable control system A cable support apparatus for an aircraft cable control system comprises at least one cable support unit. The cable support unit includes a pulley adapted to carry a cable of the aircraft cable control system, a support link with a first joint between the pulley and the support link and a second joint between the support link and the structure of the aircraft, and a compensation link connected with the structure of the aircraft. The thermal expansion of the compensation link causes a displacement of the support link. An aircraft and a method for maintaining a tension of a cable of a cable control system of an aircraft are also provided.
US09359065B2	System and method for optimizing performance of an aircraft A system for optimizing performance of an aircraft may include a flight control computer for computing an optimum flap setting based on aircraft data. The system may further include a flap control system having a flap control device. The system may additionally include a flap actuation system coupled to the flap control system for positioning the trailing edge device at the optimum flap setting.
US09359063B2	Multi-dimensional extending protective arm An extendable protective arm is disclosed. The arm may protect an air, fuel, oil, or electrical conduit from harsh environments or the atmosphere during use. The arm may also connect the conduit between a moveable structure adapted to reciprocate relative to a fixed structure. The arm may extend in any number of dimensions.
US09359061B2	Compliant stiffener for aircraft fuselage In accordance with the present invention an aircraft stringerless fuselage structure is provided comprising an impact compliant outer skin having a plurality of resin impregnated skin fibers forming an outer skin surface, an inner stringerless skin surface, and a skin thickness. A plurality of stiffeners is included, each comprising a plurality of resin impregnated stiffener fibers integrated into the inner stringerless skin structure. The plurality of resin impregnated skin fibers are not aligned with the plurality of resin impregnated stiffener fibers.
US09359060B2	Laminated composite radius filler with geometric shaped filler element and method of forming the same A laminated composite radius filler for a composite structure has a stacked ply assembly having a plurality of stacks of laminate radius filler plies cut to a desired width and having a desired ply orientation. The laminated composite radius filler further has a geometric shaped filler element positioned at a desired location on a first portion of the stacked ply assembly. The geometric shaped filler element deforms a second portion of the stacked ply assembly stacked over the geometric shaped filler element, such that the laminate radius filler plies of the second portion of the stacked ply assembly change direction and have a component of direction including a horizontal direction and a vertical direction. The laminated composite radius filler having a shape substantially corresponding to a radius filler region of the composite structure.
US09359059B1	Outboard marine engines having gearcase struts with flow separators An outboard marine engine comprises an anti-ventilation plate; a torpedo housing that is disposed below the anti-ventilation plate; and a gearcase strut that extends from the anti-ventilation plate to the torpedo housing. The gearcase strut has a leading end, a trailing end, and opposing outer surfaces that extend from the leading end to the trailing end. A flow separator is on each outer surface. The flow separator is located closer to the trailing end than the leading end and causes flow of water across the gearcase strut to separate from the outer surface.
US09359050B2	Underwater craft having an electrochemical battery Disclosed is an underwater craft having an electrochemical battery activated by an electrolyte, including: an electrochemical cell; a tank (13) intended to contain the electrolyte; a seawater flow rate regulator (37) arranged upstream of the tank (13). The flow rate regulator includes: a fixed housing (60) including first ports (64); a slide (62) including second ports (66); the slide (62) being movable, in relation to the fixed housing (60), under the effect of the pressure of the seawater entering the regulator (37), to a balanced position in which the first and second ports (64, 66) define outlet openings (70) for seawater to flow to the tank (13), the slide (62) being movable between a maximum opening position, in which the area of the openings is at a maximum, and a maximum restriction position, in which the area of the openings (70) is at a minimum.
US09359049B1	Flotation-hydration system A flotation-hydration system to be worn by a user, particularly in a water borne environment, includes a vest assembly dimensioned to at least partially surround the user's upper torso while donned by the user in an operative manner. The vest assembly comprises a plurality of panels securely attached to one another, and a flotation assembly comprising at least one flotation member having a buoyant material of construction disposed in one of the panels of the vest assembly. A hydration support assembly is disposed substantially within the vest assembly and includes a chamber support unit, wherein the chamber support unit is dimensioned and configured to receive a hydration chamber in a supported relation therein. A dispensing tube is routed from the hydration chamber to the front of the vest assembly, for ready access by the user, through a dispensing tube retention channel.
US09359045B2	Marine vessel winch equipped with hermetically sealed clutch The present invention relates to a marine vessel winch equipped with hermetically sealed clutches including: a support plate on which a plurality of support frames is disposed; a rotary shaft rotatably coupled to the support frames; a rope drum having a first fixing clutch mounted on one side thereof; a chain drum having a second fixing clutch mounted on one side thereof; a first moving clutch and a second moving clutch coupled slidably movably to the rotary shaft and selectively engaged with the first fixing clutch and the second fixing clutch; and sealing members having one side surfaces coupled in circumferential directions to predetermined positions of the outer peripheral surfaces of the rope drum and the chain drum and having the lower portions of the other side surfaces brought into contact with the outer peripheral surfaces of the first moving clutch and the second moving clutch.
US09359044B2	Weight-shift controlled personal hydrofoil watercraft A passively stable personal hydrofoil watercraft that has a flotation device, wherein a user can ride in a prone, kneeling, or standing position. The watercraft includes a strut having an upper end interconnected with the flotation device and lower end connected with a hydrofoil. The hydrofoil greatly reduces the power required to travel at higher speed. The watercraft also includes a propulsion system connected to the hydrofoil. Both longitudinal and directional control of the watercraft is via weight shift, eliminating the need of any movable surfaces. The flotation device, strut, and hydrofoil may be permanently interconnected or may be detachable.
US09359042B2	Bicycle crank assembly A bicycle crank assembly is provided with a crank arm that includes a first outer shell, a second outer shell, and a pedal attachment structure. The first outer shell is a one-piece, pressed sheet metal member with the projecting part being a bent portion that defines the first pedal axle opening. The first outer shell has a projecting part projecting from the first outer shell in an axial direction. The first and second outer shells are adhesively attached together to form an interior cavity. The pedal attachment structure includes an abutment face with a recess formed in the abutment face such that the abutment face contacts the first outer shell adjacent the first pedal axle opening and the projecting part of the first outer shell is disposed in the recess of the pedal attachment structure.
US09359040B2	Electric bike retrofit for disc brakes bicycle An apparatus and method for an electric bike retrofit for a disc brakes vehicle include an electric motor coupled with a rotor brake. The apparatus and method provide advantages in that the drive gear for the electric motor may be integrated with the brake rotor decreasing weight and minimizing necessary parts. The electric motor may mount to the existing brake caliper mounts and drive the brake rotor without the use of a chain, belt, or the like. Multiple gear ratios may be incorporated into the brake rotor allowing for shifting and increased efficiency of the electric drive system.
US09359037B2	Front suspension structure for saddle riding type vehicle A front suspension structure includes a head pipe; an upper arm portion having a front end portion connected to the head pipe rockably about a first coupling axis and a rear end portion connected to a vehicle body frame rockably about a second coupling axis; and a lower arm portion disposed below the upper arm portion, and having a front end portion connected to the head pipe rockably about a third coupling axis and a rear end portion connected to the vehicle body frame rockably about a fourth coupling axis. The structure includes a cushion unit making a lower end portion perform a stroke as the lower arm portion rocks; the lower end portion supported in front of a middle point of a segment connecting the third coupling axis to the fourth coupling axis, and an upper end portion supported in a rear of the second coupling axis.
US09359032B2	Vehicle light apparatus A vehicle light apparatus is described herein that can be used to increase the visibility profile of a vehicle. The apparatus includes a base adapted to connect to a vehicle frame; a power supply; and an elongated light source supported by the base and coupled to the power supply. The elongated light source can extend above the vehicle frame with respect to a surface the vehicle is to traverse thereon. The elongated light source can also be configured to move upon experiencing pressure (e.g., from a rider's leg) and, upon removal of said pressure, return to its original position.
US09359027B2	Traction robot A traction unit has carrier sections on which suction cups are mounted that are connected to a vacuum source. The carrier units are driven around the frame by a chain driven by a motor. The frame has sections which move relative to one another in order to permit turning control of the traction unit.
US09359026B2	Rubber crawler A rubber crawler includes a rubber belt, a main cord layer that is incorporated within the rubber belt and includes a main cord configured from plural twisted strands covered with rubber, the main cord extending around the crawler circumferential direction, and a bias cord layer incorporated within the rubber belt at the crawler circumferential outside of the main cord layer configured by at least one bias ply and configured from at least one bias ply that is formed from a plurality of bias cords extending at an angle with respect to the crawler circumferential direction, disposed side-by-side around the crawler circumferential direction and covered in rubber such that bias cords of the bias ply at the circumferential outermost side of the crawler are, as viewed from the crawler circumferential outside, angled toward an opposite side, with respect to the crawler circumferential direction, from the angled side of the strands.
US09359024B2	Track link A track link has a link body. The link body of the track link may include a first substantially planar side surface, a second substantially planar side surface opposite the first substantially planar side surface, a shoe face extending between the first and second substantially planar side surfaces, and a roller rail extending between the first and second substantially planar side surfaces opposite the shoe face.
US09359023B2	Undercarriage assembly An undercarriage assembly includes a link assembly, including a plurality of laterally spaced pairs of track links pivotally connected to one another at pivot joints to form an endless chain. The assembly may also include an idler, the idler including a solid disk with substantially planar sides and an outer tread surface engaging an inner portion of the endless chain.
US09359018B2	Modular intelligent transportation system A modular intelligent transportation system, comprising an environmentally protected enclosure, a system communications bus, a processor module, communicating with said bus, having a image data input and an audio input, the processor module analyzing the image data and/or audio input for data patterns represented therein, having at least one available option slot, a power supply, and a communication link for external communications, in which at least one available option slot can be occupied by a wireless local area network access point, having a communications path between said communications link and said wireless access point, or other modular components.
US09359014B1	Thermoplastic olefin building materials The present disclosure relates, in some embodiments, to thermoplastic-olefin-based roofing membrane comprising a polymer blend. The polymer blend may comprise a thermoplastic olefin elastomer at about 30% to about 75% by weight of the polymer blend and a thermoplastic vulcanizate at about 10% to about 40% by weight of the polymer blend. The polymer blend may further comprise a thermoplastic polyolefin copolymer at about 5% to about 10% by weight of the polymer blend. In some embodiments, the thermoplastic olefin-based roofing membrane may be a single ply membrane configured to remain substantially free of swelling when exposed to an elastomer polymer compound. The thermoplastic olefin-based roofing membrane may be about 20 mils to about 40 mils thick. The thermoplastic-olefin-based roofing membrane may comprise a stretchability of about 14 lbf to about 30 lbf.
US09359013B2	Resin vehicle part and method for manufacturing same A resin part for a vehicle provided with: a panel body having a design surface; and stepped reinforcing ribs, which are vertically arranged on the inside surface of the panel body, in which the wall thickness of the base end portion is formed to be thinner than the wall thickness of the leading end portion, and in which the side ends at the end in the direction in which the ribs extend (arrow (X) direction) are open. Resin supply ports, to which molten resin is supplied prior to the base end portion, are formed in the leading end portion.
US09359008B2	Stability control device A stability control device is provided that is capable of reducing an unpleasant sensation imparted to a driver in a steer-by-wire vehicle. The stability control device includes a steer-by-wire controller that controls a turning amount of the turning part based on a steer-by-wire turning amount that corresponds to a steering amount of the steering unit, a turning amount for suppressing the yaw angle, which is an angle formed by a white line and a traveling direction of a host vehicle, and a turning amount for returning the host vehicle to the center of a lane when the host vehicle has departed from the center of the lane. The controller controls a steering reaction force based on the steering amount without the yaw angle-suppressing turning amount and the lane-center-returning turning amount being reflected in the steering reaction force imparted to the steering unit.
US09359007B2	Suspension system for vehicle A suspension system for a vehicle may include a knuckle assembled to a wheel, and a tie rod having one end assembled to a rack bar moving by operation of a steering wheel, another end assembled to the knuckle, and a linkage apparatus changing a pivot trajectory of the knuckle by moving a rotation center of a pivot trajectory of the tie rod when the vehicle bumps.
US09359006B2	Electric power steering system There is provided an reliable electric power steering system. The electric power steering system includes a torque sensor that outputs a detection signal corresponding to a steering torque, and a controller. The controller computes a detected steering torque value based on the detection signal, and a torque differential value, which is a first-order time differential value of the detected steering torque value. The controller computes a current command value by providing compensation to a basic current command value based on the detected steering torque value with the use of a compensation value based on the torque differential value. When the detected steering torque value is held for a predetermined period, the controller holds the torque differential value at a value computed before the detected steering torque value is held, during the period in which the detected steering torque value is held.
US09359000B2	Telescopic connecting steering rod The telescopic connecting steering rod includes a mutually telescopically arranged main steering rod, a middle adaptor, and an upper extension. A lower end of the main steering rod is adapted to enable its mounting in a vehicle steering system. An upper extension is fitted with a connecting element adapted to connect the steering rod to the tailgate part of the vehicle and to connect it to the control element of the vehicle steering mechanism. An above-open bushing on the upper end of the main steering rod and a connecting element include a head. The outline shape of the head conforms to the inner hollow of the bushing. Both of these mutually insertable parts are fitted with fittings to connect the main steering rod and the connecting element with zero lash.
US09358999B2	Control bar for traction mechanisms A control bar for removable attachment to a traction mechanism is formed by a plurality of elongated bar segments connected end to end, such that the control bar can be formed in a plurality of shapes, and is thereby adapted to be more easily manipulated by a user shifting their body weight to steer and maneuver the propulsion system.
US09358996B2	Blade cart for a wind turbine blade A blade cart for a wind turbine blade for use during the manufacturing of such a blade is described. The cart presents an adjustable and adaptable support for the tip end of a blade after the blade is removed from the mold. The cart is rotatable, and comprises selectively actuatable and/or removable support surfaces to provided easy access to the surfaces of the molded blade for the performance of post-molding operations, e.g. blade surface grinding, coating, etc.
US09358991B2	Multi-car vehicle A multi-car vehicle with a first car of the multi-car vehicle and a second car of the vehicle and having a connection device having an elongated body for transmitting the pushing force required to push the first car in front of the second car, when the second car is moving, the elongated body having a longitudinal axis, a connection to connect the elongated body to the first car or the second car and suitable to transmit the pushing force from the second car to the elongated body or from the elongated body to the first car, the first car and/or the second car having an underframe that comprises at least one longitudinal beam and/or at least one cross beam, wherein the elongated body is arranged approximately at the same vertical level as the longitudinal beam and/or the cross beam and/or is arranged in such a manner that with regard to the vertical direction the elongated body at least partially overlaps with the beam.
US09358988B2	Automatic hopper car gate opening and closing system A hopper car gate with a frame, a door supported by the frame and horizontally moveable between open and closed positions, a rack mounted to the door, and first and second shafts supported by the frame. A first gear mounted to the first shaft engages the rack. Second and third mating gears are mounted to the first and second shafts, respectively. A hopper car with first and second hopper car gates mounted to first and second hoppers, respectively. Doors of the gates move horizontally to an open position in opposite directions from each other with shaft rotation in the same direction. A hopper car gate opening and closing system including a hopper car gate with a pair of shafts, a gear mounted on each shaft, and racks that are positioned to engage the gears as the gate moves with respect to the racks.
US09358985B2	Method and device for controlling a drive unit of a vehicle A method and a device for controlling a drive unit of a vehicle are provided in which, starting from the comparison of a first acceleration variable, which is calculated at least from the operating state of the drive unit, and a second acceleration variable, an error is detected. The second acceleration variable includes a first component, in the direction of the vehicle longitudinal axis, and a second component, perpendicular to the vehicle longitudinal axis.
US09358982B2	Method for processing data in a device for power assistance of uphill maneuvers of a motor vehicle A method for processing data recorded during a data acquisition, the data defining a correspondence between values representing torque transmitted by a clutch and values representing a position of a clutch control member. The processing method includes modifying the recorded data to define a modified correspondence between the values representing the torque transmitted by the clutch and the values representing the position of the clutch control member, the modified correspondence to be used in a hill start assist device of a motor vehicle including a power train connected to drive wheels by a transmission system including the clutch and a braking system, whereby the release of the braking system is automatically controlled by the assist device.
US09358979B2	Vehicle speed control apparatus and method The present disclosure describes systems and methods for controlling the speed of a vehicle comprising: during a pulse phase of cruise control, applying engine torque to raise speed, the amount and duration of which being responsive to engine speed; and during a glide phase of cruise control, discontinuing engine combustion. In this way cruise control may maintain a mean speed equivalent to a desired, threshold speed while reducing fuel consumption, and NVH effects felt by the end user compared to traditional cruise control methods.
US09358978B2	Vehicle speed control apparatus and method using an image A vehicle speed control apparatus is provided. In particular, a storage configured to store a table (hereinafter, referred to an area table) recording an area corresponding to a speed of a vehicle and a condition of a road; an imaging device configured to take a front image of the vehicle; an image processor configured to calculate an area of a shape made by a driving lane of the vehicle and a preceding vehicle in the driving lane from the front image of the vehicle taken by the imaging device; a road information collector configured to collect condition information of the road; and a controller configured to set a speed corresponding to the condition information collected by the road information collector and the area calculated by the image processor as a driving speed of the vehicle, based on the area table.
US09358977B2	Vehicle control apparatus A vehicle control apparatus includes one or more approach sensors, one or more collision detection sensors, an approach determination portion, a collision determination portion, and a braking determination portion. The approach determination portion determines whether a vehicle and an object are approached based on an output signal of one of the approach sensors, and generates a first information. The collision determination portion determines whether the vehicle collides with the object based on an output signal of at least one of the collision detection sensors, and generates a second information. The braking determination portion determines whether the vehicle is braked based on the first information and the second information.
US09358975B1	Virtual moving safety limits for vehicles transporting objects Example systems and methods are disclosed for implementing vehicle operation limits to prevent vehicle load failure during vehicle teleoperation. The method may include receiving sensor data from sensors on a vehicle that carries a load. The vehicle may be controlled by a remote control system. The load weight and dimensions may be determined based on the sensor data. In order to prevent a vehicle load failure, a forward velocity limit and an angular velocity limit may be calculated. Vehicle load failures may include the vehicle tipping over, the load tipping over, the load sliding off of the vehicle, or collisions. The vehicle carrying the load may be restricted from exceeding the forward velocity limit and/or the angular velocity limit during vehicle operation. The remote control system may display a user interface indicating to a remote operator the forward velocity limit and the angular velocity limit.
US09358973B2	Apparatus and method for controlling torque reduction of hybrid electric vehicle A method for controlling torque reduction of a hybrid electric vehicle including a motor and an engine includes determining whether a demand torque of a traction control system (TCS) is generated. When the demand torque of the TCS is generated, the demand torque of the TCS and a motor output torque is compared. Based on a result of the comparison, torque reduction is performed by using only one of a motor torque. Also disclosed are an apparatus configured to perform the method for controlling torque reduction and a computer readable storage medium causing performance of torque reduction through the use of only one of a motor torque and an engine torque.
US09358966B2	Hydraulic accumulator pre-charge pressure detection for hydraulic braking system A system and method for detecting a pre-charge pressure of a hydraulic braking system are disclosed. A controller receives pressure readings from a pressure sensor indicative of the pressure of a hydraulic brake accumulator or the lower pressure of more than one accumulator. In response to fluid being provided to the hydraulic accumulator, the controller determines a first rate of pressure change, a second rate of pressure change different than the first rate, and a transition pressure between the first and second rates. The controller determines an approximate pre-charge pressure of the hydraulic brake accumulator based on the transition pressure. A warning can be provided to the operator or another when the determined pre-charge pressure is lower than a reference pressure.
US09358963B2	Motor vehicle safety arrangement and method A safety arrangement and method are described for controlling automatic travel of a fully automated vehicle. One or more forward-looking detection systems are provided for detecting objects in a future path of the vehicle. A control unit is configured to determine a detection confidence for the detected objects. The control unit is further operable to, upon low confidence for existence of a detected object, control a brake system of the vehicle to apply a predetermined limited amount of braking until high confidence is obtained for existence or non-existence of the previously detected object. Thereafter the control unit is further operable to apply full braking if high confidence is obtained for existence of the previously detected object and to discontinue braking if high confidence is obtained for non-existence of the previously detected object.
US09358961B2	Disc brake, in particular for a commercial vehicle, and brake pad for a disc brake A disc brake, in particular for a commercial vehicle, including a brake caliper, which reaches over a brake disc and in which brake pads are positioned that can be pressed against the brake disc on both sides by at least one brake application device and that each have a lining carrier plate and a friction lining fastened thereto. The brake application device has at least one brake piston that acts on the lining carrier plate at the end face of the brake piston. The disc brake is designed such that at least one of the brake pads is supported in an articulated, pivotable, manner in the radial direction of the brake disc.
US09358960B2	Wiping device A wiping device is provided. The wiping device includes a cartridge. In addition, wiping yarns are disposed on an outer circumference of the cartridge. The wiping yarn includes core yarns substantially perpendicular to the cartridge and sub-yarns disposed extraneous to the core yarns and configured to gather contaminants from a vehicle body.
US09358957B2	Windscreen wiper device A windscreen wiper device includes an elastic, elongated carrier element, as well as an elongated wiper blade, which can be placed in abutment with a windscreen to be wiped. The wiper blade includes an upper holding part holding at least one longitudinal strip of the carrier element disposed in at least one longitudinal groove of the upper holding part, as well as a lower wiping part, which windscreen wiper device includes a connecting device for an oscillating arm. The oscillating arm is pivotally connected to a rod of the connecting device about a pivot axis near one end thereof, with the interposition of a joint part, wherein the connecting device includes limitation means for limiting the maximum rotation angle of the pivotal movement of the oscillating arm.
US09358953B2	Seat belt presenter fault indication A vehicle system includes a seat belt buckle configured to receive a seat belt. The seat belt buckle is moveable between a first position and a second position. A timer is configured to determine an amount of time that the seat belt buckle is in the second position. If the seat belt buckle is in the second position for longer than a predetermined amount of time, the timer outputs an alert signal representing a potential fault.
US09358947B1	Heavy equipment seat restraint The heavy equipment seat restraint is a four point belt in seat restraint system for use in heavy equipment such as forklifts or bulldozers. The heavy equipment seat restraint provides a chest strap worn horizontally across the chest, a lap strap worn horizontally across the lap, and a torso strap worn diagonally across the torso. The heavy equipment seat restraint comprises chest straps, torso straps, lap straps, a chest buckle, a torso buckle, a lap buckle, a first tension adjustment device, a second tension adjustment device, a third tension adjustment device, a fourth tension adjustment device, a first anchor, a second anchor, a third anchor, and a fourth anchor.
US09358944B1	Active bolster with hot-weld rivets An active bolster for an automotive vehicle includes a plastic-molded outer trim panel with a welding track on an inside surface and a plastic-molded expandable bladder member with a welding flange along a peripheral edge with a first surface facing the trim panel inside surface and a second opposed surface. The welding track and the welding flange are joined by a hot weld to form a sealed chamber. A plurality of counterbores are distributed over the welding flange in order to form rivets that mechanically strengthen the weld. Each counterbore is comprised of a neck portion penetrating the first surface and a head portion penetrating the second surface. Each head portion includes an internal ledge extending laterally from the neck portion. The hot weld includes plastic-molded material that flows from the welding track through each neck portion and spreading onto the internal ledge in each head portion.
US09358942B1	Automobile bumper protector and method of use A bumper protector and method for protecting a bumper of an automobile. The protector includes a main body that has oppositely-disposed upper and lower ends and oppositely-disposed lateral ends. The upper end of the main body is adapted to be secured to an automobile portion above the bumper, so that the main body covers at least a portion of an outer surface of the bumper. The protector further includes wing extensions that are deployable from the main body by extending each wing extension from a stowed position thereof to a deployed position in which the extensions are deployed from the lateral ends of the main body. The wing extensions are securable to the automobile so that at least portions of the lateral surfaces of the bumper are covered with the wing extensions.
US09358940B2	System and method for configuring an interior of a vehicle based on preferences provided with multiple mobile computing devices within the vehicle In response to detecting the entry condition, a determination is made as to when multiple mobile computing devices are present within the vehicle. An occupancy zone is determined for each multiple mobile computing device that is determined as being present within the vehicle. Profile information is determined for each mobile computing device. At least one of an operational or usage facet of the vehicle can be configured at each occupancy zone in which one of the mobile computing devices is determined to be present. The operational or usage facet of the vehicle at a location of each occupancy zone can be based at least in part on the profile information determined from the mobile computing device that is deemed to be present at that occupancy zone.
US09358935B2	Roof drip molding attachment An improved attachment assembly for attaching a trim piece to a vehicle body panel. The trim assembly for attachment to a body panel of a vehicle including a trim piece having an inner surface, a mounting portion connected to the inner surface, the mounting portion having at least one indentation, an engagement clip adapted to securely connect to the mounting portion of the trim piece, the mounting portion adapted to slide into the clip into a secured portion, the engagement clip connected to the body panel of the vehicle and at least one engagement arm connected to the engagement clip, the at least one engagement arm having an inwardly facing protrusion adapted to connect with the indentation of the mounting portion as the mounting portion slides into an installed position.
US09358934B2	Retractable speaker structure for use in a vehicle A retractable speaker structure for use in a vehicle is provided. The retractable speaker structure includes: a case formed with a chamber; a driving member installed in the chamber and including a stepping motor and a transmission shaft connected to the stepping motor; a retracting mechanism disposed in the chamber and including a screw rod and a retractable rod fitted with the screw rod. The screw rod is driven by the transmission shaft to rotate, thereby enabling the retractable rod to perform a protruding/retracting movement relative to the screw rod; and a speaker secured at an end section of the retractable rod and moved with the retractable rod. Accordingly, the retractable speaker structure is able to be adjusted for being protruded or retracted according to the actual needs, thereby effectively simplifying components and lowering production cost.
US09358929B1	Interior trim electronic device holder An electronic device holder includes a vehicle pillar in which a vertical track assembly is disposed. First and second pivoting arms are pivotally coupled to the track assembly and are vertically adjustable along a length of the track assembly between release and cinched positions. The first and second pivoting arms are configured to be unfolded from a stowed position to an extended position. The first and second pivoting arms are configured to retain an electronic device between inner surfaces of the first and second pivoting arms, when the first and second pivoting arms are in the cinched position around the electronic device.
US09358926B2	Managing the camera acquiring interior data A system for managing a camera is comprises an input interface configured to detect a change in state; a processor configured to block transfer of data from an inward facing video camera; and an output interface configured to indicate that transfer of data is blocked.
US09358925B2	Warning device for vehicle In a warning device for a vehicle, a basic target current value setting unit sets a basic target current value based on a steering torque and a vehicle speed. When a lane deviation determining unit determines that there is a high possibility that a vehicle will deviate from a lane, a warning vibration wave generator generates a warning vibration wave containing a plurality of frequency components. A target current value is computed by adding the warning vibration wave to the basic target current value. A motor current to be applied to an electric motor is controlled so as to approach the target current value.
US09358922B2	Illumination system for the interior of a motor vehicle An illumination system for an interior of a motor vehicle includes a sensor, with which an environmental lighting situation is able to be detected, as well as an illumination device for illuminating the motor vehicle interior. The illumination system has a controller that is subordinate to the sensor and is superordinate the illumination device. The controller adjusts an interior lighting situation depending on the environmental lighting situation that is influenced by actual objects located in the environment of the motor vehicle, by lights of the illumination device.
US09358920B2	Vehicular lighting apparatus A vehicular lighting apparatus includes a front detection sensor, a driving support ECU, a headlight ECU, a leveling motor and a headlight. When a subject vehicle is determined as being in an automatic following state with respect to a forward vehicle or a vehicle-to-vehicle distance between the subject vehicle and the forward vehicle is determined by a vehicle-to-vehicle distance determining portion as being short, the vehicular lighting apparatus changes. If a high-beam lamp or a low-beam lamp is illuminating, the illumination state changes such that the low-beam lamp illuminates more downward than normal. Consequently, it becomes possible to lower the degree of dazzling an occupant of the forward vehicle. Moreover, if a daytime running lamp is illuminating, the vehicular lighting apparatus turns the daytime running lamp off. Consequently, it becomes possible to lower a battery load of the subject vehicle.
US09358914B2	Seatbelt anchor systems for aircraft and other vehicles, and associated methods of manufacture and use Apparatuses, devices and systems for attaching seatbelts to anchoring structures in aircraft and other vehicles, are described herein. In some embodiments, such apparatuses include a modular connector having a base configured to be attached to an anchoring structure, a body configured to be attached to a seatbelt, and an annular lock configured to releasably couple the body to the base. In these embodiments, the body carries the lock adjacent to an aperture configured removably receive the base. When the body is pressed over the base, the base passes into the aperture and contacts the annular lock, expanding the lock outwardly around the base. The base continues moving though the aperture in the body until the lock retracts into a groove in base, thereby releasaby locking the body to the base.
US09358911B2	Controllable comfort shell for vehicle seat A vehicle seat includes a seat back having a backrest, a backrest support, and a linkage arranged to interconnect the backrest and the backrest support. The linkage is configured to support the backrest for movement relative to the backrest support.
US09358908B2	Vehicle occupant support Arrangements for safety and comfort in vehicles.
US09358907B2	Apparatus for back-folding standup seat of vehicle An apparatus for back-folding a standup seat of a vehicle may include a standup associated back-folding unit that is installed between a hook mounted to a lower frame of a seat cushion to be locked to or unlocked from a striker of a floor panel, and a recliner mounted to a side frame of a seatback such that a forward folding operation of the seatback and a forward folding operation of a headrest that is automatically performed by operating the recliner during a standup operation.
US09358906B2	Slouch rear seat A slouch rear seat includes a seat bottom, a seat back pivotally mounted to the seat bottom, and a driver for moving the slouch rear seat between a design position and a fully forward position. Characteristically, the seat bottom moves from the design position to the fully forward position by the seat bottom moving upward and forward in a manner that avoids a vehicle occupant contacting the top of the vehicle cabin.
US09358905B2	Hydraulic chair lift A hydraulic chair lift in a vehicle includes a rod that is attached to the floor and the roof of the vehicle, a piston that is arranged around the rod in a middle zone of the rod, a barrel that envelopes the piston, and two heads, each of which is arranged on an end of the barrel. Further, the two heads are provided with a channel for the passage of the rod. Additionally, a rod gland is arranged in each of the two heads surrounding the channel. Relative to the rod gland, the channel includes a first inner channel part with a first diameter and a second inner channel part with second diameter. The first diameter is smaller than the second diameter and the ratio of the length and the diameter of the first channel part is less than 3/5.
US09358904B1	Vehicular seat adjustment apparatus and methods of use and manufacture thereof Some embodiments are directed to a vehicular seat adjustment mechanism for facilitating positional adjustments of a vehicular seat along a longitudinal direction of a vehicle. The vehicular seat adjustment mechanism includes a pair of rails that extend substantially parallel to a longitudinal direction of the vehicle. Each of the rails defines an opening that faces a lower surface of the vehicle. A pair of support legs are configured to be secured to a vehicular frame. Each of the support legs is secured to and supports one of the rails. A mounting plate supports the vehicular seat and is configured to be movable along the pair of rails. A pair of supports are each secured to one of the rails and configured to support the mounting plate and facilitate longitudinal movement of the mounting plate along the rails.
US09358897B2	Electric motor vehicle and redox flow module and cartridge therefor An electric motor vehicle with a drive motor, a first rechargeable battery with a first design and a second rechargeable battery with a second design. Electrical energy may be transferred bidirectionally between the drive motor and the first rechargeable battery, and at least unidirectionally from the second rechargeable battery to the drive motor or the first rechargeable battery. The second rechargeable battery in this case includes at least one redox flow cell. Furthermore, a redox flow module is provided with at least one redox flow cell, which includes an electrical coupling for connection to a circuit of a vehicle and a fluid coupling for connection to an electrolyte circuit of said vehicle.
US09358896B2	Energy management system An energy management system that achieves minimization of electric power costs and leveling of an electric power demand while securing necessary battery residual quantity. The energy management system includes a charging stand that supplies electric power to an electric vehicle (EV) as an electric power supply part, a reservation information acquisition unit that acquires reservation information on electric power reception of the EV in the charging stand before the EV arrives at the charging stand, a charging plan preparation unit that predicts an electric power demand in the charging stand and prepares a charging plan for the EV based on the reservation information, and a charging controller that controls electric power supply for the EV in the charging stand based on the charging plan.
US09358891B2	Vehicle brake system A vehicle brake system for braking a vehicle including a braking-mode switching mechanism configured to selectively effectuate, depending upon situations of the vehicle brake system, one of (A) a regulated-pressure-dependent braking mode in which is generated a regulated-pressure-dependent braking force having a magnitude that depends on a regulated pressure of a working fluid and (B) a braking mode depending on an operation force and the regulated pressure in which are generated both of an operation-force-dependent braking force having a magnitude that depends on the operation force by a driver and the regulated-pressure-dependent braking force.
US09358886B2	Method for configuring user interface of head unit of vehicle dynamically by using mobile terminal, and head unit and computer-readable recording media using the same The present invention relates to a method for configuring a user interface of a head unit of a vehicle by using a mobile terminal. The method includes steps of: (a) allowing the head unit of the vehicle to acquire information on at least one application stored at an executable state in the mobile terminal, if the mobile terminal is connected to the head unit; (b) allowing the head unit to decide a specific template interoperable with the application among multiple templates stored in the head unit by referring to the acquired information on the application; and (c) deciding a display mode of the specific template by referring to at least one piece of information on the number of acquired application and the driving state of the vehicle and displaying the acquired application on a screen of the head unit by using the decided display mode of the specific template.
US09358885B2	Variable ratio throttle pedal A pedal assembly includes a one-piece accelerator pedal without moving linkages that is mounted to a pin for rotational movement relative to a mounting stay. The throttle cable is operatively connected to the accelerator pedal for movement thereby as the pedal rotates, at least one of the pedal and mounting stay configured to provide a first ratio of pedal stroke movement relative to cable stroke movement at initial depression of the accelerator pedal, and a different, second ratio of pedal stroke movement relative to cable stroke movement upon further depression of the accelerator pedal.
US09358884B2	Vehicle and method of controlling a vehicle A vehicle having: a prime mover; first and second groups of wheels; and a driveline operable by a controller to connect the first group of wheels to a torque transmission path when the driveline is in a first mode, and the first and second groups of wheels thereto when in a second mode. The driveline is operable to connect the second group of wheels to the torque transmission path via an auxiliary portion comprising first and second releasable torque transmitting means and a prop shaft, the first and second torque transmitting means are respectively operable to connect the prop shaft to the torque transmission path and the second group of wheels. The controller is operable to control the driveline to transition from the first mode to the second mode at a connect rate that is responsive to the identity of a trigger condition that is met.
US09358874B2	Electric motor or generator system An electric motor or generator system comprising a stator, a rotor, a first bearing, a first coupling device and a second coupling device, wherein the second coupling device includes a first coupling element arranged to be coupled to a vehicle and a second coupling element coupled to the rotor with a second bearing mounted between the first coupling element and the second coupling element to allow the rotor to rotate relative to the vehicle, wherein the first bearing is mounted between a surface of the stator and a surface of the rotor or the second coupling element to allow the rotor to rotate relative to the stator and the first coupling device is arranged to substantially preventing movement of the stator relative to the first coupling element in a first degree of freedom while allowing movement of the stator relative to the first coupling element in at least a second degree of freedom.
US09358872B2	Controlling a powertrain and a clutch of a vehicle A vehicle includes an engine and is at least partially propelled by a fraction battery and a traction motor. A clutch is configured to be coupled to the traction motor. An electrical and/or mechanical pump provides pressure to control the clutch. At least one controller determines if the clutch is slipping. In response to the clutch slipping, the at least one controller commands an increase in speed of an input of the clutch such that the available line pressure to control the slipping of the clutch is increased. The line pressure is then applied to the clutch in order to control the slipping of the clutch.
US09358871B2	Control apparatus for a hybrid vehicle drive system A control apparatus for a hybrid vehicle drive system, which permits effective reduction of deterioration of the drivability of the hybrid vehicle. The control apparatus includes a drive mode switching portion 60 configured to switch the hybrid vehicle drive system from a hybrid drive mode to a first EV drive mode if an electric energy amount stored in a battery is smaller than a predetermined threshold value α or if a vehicle drive force required to be generated by the hybrid vehicle drive system is smaller than a predetermined threshold value β, and to a second EV drive mode if the electric energy amount stored in the battery is equal to or larger than the threshold value α and if the drive force required to drive the hybrid vehicle is equal to or larger than the threshold value β, when the drive mode switching portion has determined that the hybrid vehicle drive system should be switched from the hybrid drive mode to the first or second EV drive mode.
US09358854B1	Air suspension control system for a vehicle An air suspension control system for a vehicle such as an ambulance, a bus or a semi-truck. The control system includes an air supply, such as a compressor, which is configured to pneumatically communicate with a lift mechanism for moving the lift mechanism between a ride height position and a kneeling position and vice versa. The controller is configured to return or recover the lift mechanism to its ride height position during the time the lift mechanism is moving from its ride height position to its kneeling position by only deactivating the kneel input. The controller is configured to return or recover the lift mechanism to its ride height position after the lift mechanism has reached kneeling position by both deactivating the kneel input and activating the recover trigger input by pressing the brake pedal. The control system also has a transmission park feature and an ignition timer feature.
US09358852B2	Wheel suspension for motor vehicles The invention relates to a wheel suspension for motor vehicles, with at least one upper transverse arm and two lower separated transverse arms per wheel, which are each arranged at a defined angle to one another and are articulated to the body of the vehicle and also to a wheel carrier, furthermore with a track rod which acts on the steering lever of the wheel carrier and with a McPherson strut unit which, aligned at a defined angle to the vertical, is coupled to the body of the vehicle and to the forward lower transverse arm via a rubber-metal sleeve bearing. To achieve improved driving comfort of the motor vehicle it is suggested that at least the forward lower transverse arm (12) is arranged such that the coupling point (12c) of the McPherson strut unit (20) on the transverse arm (12) when the wheel is deflected viewed in the transverse direction of the vehicle (30) runs parallel to the longitudinal axis (28) of the McPherson strut unit (20).
US09358848B2	Device for adapting the tire pressure during travel A device for adapting actual tire pressure of a tire of a wheel of a vehicle axle to a current setpoint tire pressure during travel includes a chassis-side central device and a wheel-related pneumatic pressure-control device. The pressure control device includes a second connection which is at the actual tire pressure. A control valve with an open position connects a first connection to the second connection, and with a blocking position blocks this connection. A pilot control valve performs pilot control of the control valve. The pressure control device also has a bypass line, which bypasses the control valve and the pilot control valve, connects the first connection to the second connection, and has a non-return valve which opens in the inflation direction of the tire and blocks in the deflation direction of the tire.
US09358846B2	Vehicle weight and center of gravity estimation system and method A load estimation system and method for estimating vehicle load includes a tire rotation counter for generating a rotation count from rotation of a tire; apparatus for measuring distance travelled by the vehicle; an effective radius calculator for calculating effective radius of the tire from the distance travelled and the rotation count; and a load estimation calculator for calculating the load carried by the vehicle tire from the effective radius of the tire. A center of gravity height estimation may be made from an estimated total load carried by the tires supporting the vehicle pursuant to an estimation of effective radius for each tire and a calculated load carried by each tire from respective effective radii.
US09358843B2	Tire In a pneumatic tire 10, inclined grooves 120, 170 are formed, the groove 120 with groove depth becoming larger and groove width in circumferential-direction becoming smaller as the groove 120 extends toward the inner side in width-direction, the groove 170 with groove depth becoming larger and groove width in the circumferential-direction becoming smaller as the groove 170 extends toward the outer side in the width-direction. An outer end portion of the groove 120 in the width-direction is continuous with a land portion 110 and an inner end portion of the groove 120 in the width-direction extends toward circumferential groove 22 along an end portion of a land portion 160 in the circumferential-direction. An inner end portion of the groove 170 in the width-direction is continuous with the land portion 160 and the groove 170 extends along an inner end portion of the land portion 110 in the width-direction.
US09358840B2	Tire for a vehicle carrying heavy loads Tire carrying heavy loads comprising a tread band having a plurality of grooves of transverse overall orientation, formed of at least three rubber materials: —a first material M1, in the median part of the tread band, having a secant modulus at 10% elongation measured at a temperature of 23° C. at least equal to 4.0 MPa and hysteresis losses tan(δ)max greater than 0.19, —a second material M2, on the edge parts, having a secant modulus at 10% elongation, at 23° C., lower than the first material, and a hysteresis losses value tan(δ)max lower than the first material and at least 0.15, —a third material M3, radially below the materials M1 and M2, having a hysteresis losses value tan(δ)max lower than 0.12, —wherein first material M1 has a resistance to wear at least 15% better than the second and third materials, which have substantially the same resistance to wear.
US09358836B2	Axle and vehicle comprising at least one such axle An axle mounted on a vehicle chassis includes a central box section, a first support arm connected to a first wheel and slideably mounted inside the central box section, and a second support arm connected to a second wheel and capable of longitudinal translational movement inside the first support arm, a guiding box section fixed to the central box section, including a rectangular tube and defining an external annular volume included between the central box section and the tube, and an internal volume included inside the tube, the first support arm being housed inside the external annular volume and able to be guided by the guiding box section along a first longitudinal translational path, the second support arm being housed inside the internal volume and able to be guided by the guiding box section on a second longitudinal translational path. A vehicle equipped with such an axle is described.
US09358833B2	Drip element sealing device, in particular for rolling bearings A sealing device including a first annular rotating shield, a second annular shield, fixed and arranged in front of the first shield for delimiting therebetween a first annular chamber and a sealing ring provided with at least a first and a second annular lips that extend axially and radially project from a flange portion of the second shield and towards a flange portion of the first shield, inside the annular chamber. At least one of the first and second lips cooperates with the flange portion of the first shield without touching it for defining a first dynamic labyrinth seal therewith. The first shield integrally supports a third annular lip that extends projecting from the first shield towards one of the first and second lips without touching it for defining a second dynamic labyrinth seal between the first and second shield and inside the annular chamber.
US09358832B2	Hubometer mounting arrangement for use with tire inflation system An axle assembly includes an axle member having a first end and a second end opposite the first end, a first axle hub assembly operably coupled to the first end of the axle member, and a second hub assembly operably coupled to the second end of the axle member and including an axle hubcap coupled to the second end of the axle member by a first coupling arrangement located at a first position. The axle assembly further includes a mounting bracket coupled to the second hub assembly by a second coupling arrangement located at a second position that is at least a select one of inwardly and outwardly radially spaced from the first position, and a hubometer attached to the mounting bracket.
US09358831B2	Safety device for a vehicle wheel A safety device (10) for a vehicle wheel (12), the device securing the attachment elements (16) of the rim (18) of the wheel onto a hub (14), wherein the device (10) includes elements (20) for blocking the rotation of the attachment elements and elements (21) for supporting the blocking elements on the attachment elements, the rotation-blocking elements including female parts (24) and at least one peripheral wall (26, 26I, 26E) against which the female parts abut when rotating, wherein at least a portion of the attachment elements receives a female part, the supporting elements (21) include an upper wall (36) that covers the attachment elements provided with the female parts, and the upper wall (36) blocks the translation of the female parts along the attachment elements, wherein the device includes elements (22) for rigidly connecting to the wheel, and the rigid connection is mechanically locked.
US09358829B2	Ruler A ruler having an arch member on an upper surface of a ruler body for allowing the ruler body to closely contact a target object by being pressed from above. The ruler has a pair of parallel standing walls facing each other on the upper surface of the ruler body in a longitudinal direction, and the arch member is fitted along the longitudinal direction of the standing walls. In addition, bending pieces which bend inward towards each other are formed on upper end edges of the standing walls, projections which are positioned below the bending pieces project on both of outer side surfaces of the arch member, and the projections are guided by the bending pieces and are inserted between the standing walls.
US09358825B1	Gravure printing plate and method of manufacturing multilayer ceramic electronic component In a gravure printing plate, a ratio of an area ratio of part of a second portion excluding second protrusions to the second portion, to an area ratio of a part of a portion excluding first protrusions to a portion that is part of a first portion that is located closer to the second portion than a line-shaped portion of a first protrusion located closest to the second portion ((an area ratio of the part of the second portion excluding the second protrusions to the second portion)/(an area ratio of the part of the portion excluding the first protrusions to the portion, the portion being a part of the first portion that is located closer to the second portion than the line-shaped portion of the first protrusion located closest to the second portion)) is about 0.3 or more and about 0.9 or less.
US09358824B2	Matte film having a printable polyalkylimine condensation product Disclosed herein is a multi-layered matte film comprising at last one layer of a coating comprising the condensation reaction product of the combination of a polyalkylimine and an acetoacetonate (“AcAc”)-functional material or an oxirane-functional material, each comprising an ethenic unsaturation group, the coating adhered to a sealant film layer; a sealant layer comprising a polyolefin and having a Tm within the range of from 120° C. to 170° C.; and a Flexural Modulus within the range from 500 to 1200 MPa; a core polypropylene layer; and a matte layer between the sealant layer and core layer, the matte layer comprising a blend of at least two incompatible polymers such that the Haze is at least 50%.
US09358821B2	Tape cartridge A tape cartridge is detachably installed on a cartridge installation portion of a tape printing apparatus having the cartridge installation portion and a press switch. The cartridge installation portion has an installation base portion and an installation peripheral wall portion surrounding the installation base portion and allows the tape cartridge to be installed on the cartridge installation portion. The press switch has a stem projecting in a direction crossing an installation direction of the tape cartridge and provided on the installation peripheral wall portion. The tape cartridge includes a detected portion that is provided on an outer peripheral surface of the tape cartridge and corresponds to the stem when the tape cartridge is installed on the cartridge installation portion. The detected portion has an installation guide slant surface that presses the stem when the tape cartridge is installed on the cartridge installation portion.
US09358820B2	System for detecting inoperative inkjets in printheads ejecting clear ink using thermal substrates An apparatus detects inoperative inkjets during printing. The apparatus operates the printhead or printheads in the printer to form test pattern on a thermal substrate. The heat of the materials used to form the test pattern change the optical density of the areas where the materials land. The area where the test pattern is formed is imaged and the image data are analyzed to identify inoperative inkjets.
US09358817B2	Image forming apparatus including reading unit to read back surface of print medium opposing belt member An image forming apparatus includes an image forming unit and a conveyance unit. The image forming unit forms an image on a print medium. The conveyance unit has a belt member to convey the print medium in a state in which an end of the print medium in a width direction perpendicular to a conveyance direction of the print medium is placed outside an end of the belt member in the width direction.
US09358815B2	Arrangement for capturing an image of a printing substrate web An arrangement for capturing an image of a printing substrate web in a printing machine, includes a camera that has a sensor field extending parallel to the printing substrate web, and an objective lens an optical axis of which runs at right angles to the sensor field, a light source that is arranged relative to the printing substrate web such that the light emitted therefrom is reflected by reflective surface portions of the printing substrate web mainly into the camera, and the objective lens is arranged to be offset from the sensor field such that a straight line extending through the center of the sensor field and the center of the objective lens and a straight line extending from the center of the light source to the center of the light incident on the image field on the printing substrate web form equal angles with the axis of incidence.
US09358813B2	Medium identification device, image forming apparatus, method of identifying medium, and computer program product A medium identification device identifies a type of a recording medium used for image formation. The medium identification device includes: a two-dimensional image sensor that captures an image of the recording medium; and an identifying unit that obtains a glossiness evaluation value indicating glossiness of the recording medium, a surface roughness evaluation value indicating surface roughness of the recording medium, and a coloring evaluation value indicating coloring of the recording medium, using image data of a specular reflection region reflecting specular reflection light from the recording medium and image data of a diffused reflection region reflecting diffused reflection light from the recording medium, the regions being in the image of the recording medium, and identifies the type of the recording medium by combining determination using the glossiness evaluation value, determination using the surface roughness evaluation value, and determination using the coloring evaluation value.
US09358809B2	Microwave drying of ink for an ink jet printer An ink jet printer includes a microwave transparent substrate, a microwave emitter, and at least one cavity. The microwave transparent substrate is operationally movable along a first direction and is adapted to receive an ink jetted material thereon. The microwave emitter is configured to emit microwave energy at a wavelength (λ). The at least one cavity has an outlet disposed adjacent the microwave transparent substrate and is adapted to receive and output an amount of the microwave energy at the outlet to reduce a moisture content of the ink jetted material. The amount of microwave energy output to the ink jetted material is substantially constant as measured along a second direction transverse to the first direction.
US09358807B2	Optical print head and image forming apparatus An optical print head performs optical writing onto target, and includes: current-driven light-emitting elements arranged in rows in a predetermined direction; driving transistors that are each electrically series-connected with the light-emitting elements in one-to-one correspondence, and each supply a driving current to a corresponding light-emitting element; a current control unit that controls, for each light-emitting element, a driving current amount in accordance with variation in light-emitting properties of the light-emitting element that indicate relation between the driving current amount and a light amount emitted by the light-emitting element; an application unit that, upon receiving electrical power supplied from an external power source, applies application voltage to circuits each consisting of a light-emitting element and a corresponding driving transistor; and a voltage control unit that suppresses variation in divided voltage applied to each driving transistor by controlling the application unit to apply increased application voltage of the driving current amount increases.
US09358806B2	Laser reactive media and apparatus and method for writing an image onto such media An optical disk label writing method for writing a label on an optical disc uses a similar writing operation to that used to write data to the disc. The disc has a label side including a laser reactive material for forming the label image, and a tracking format that can be tracked by a writing laser in a similar way to a writing operation. A computer program is provided for converting a label image to a disk image file for writing to the label side.
US09358804B2	Fine wiring pattern, manufacturing method thereof, and thermal print head According to the present disclosure, a manufacturing method of a fine wiring pattern is disclosed. The manufacturing method includes preparing a support member, forming a first layer on the support member by thick-film printing, and forming a second layer including Ag on the first layer by the thick-film printing. The method also includes forming a predetermined fine wiring pattern by performing an etching process upon the first layer and the second layer.
US09358803B2	Liquid supplying apparatus, liquid ejecting apparatus, and liquid supplying method In the present invention, an air bubble residing in a filter chamber is purged at a high speed without inducing liquid ejection deficiency at a liquid ejection head. A filter chamber is divided into a first filter chamber and a second filter chamber via a filter. A pump circulates ink through an ink tube and a bypass path between an ink tank and the first filter chamber. A valve capable of regulating a flow of the ink is provided at the ink tube that allows the second filter chamber and a print head to communicate with each other.
US09358800B2	Fluid level sensing apparatus and method of using the same for inkjet printing systems An inkjet printing system is disclosed and comprises at least one fluid reservoir containing a fluid, a fluid line that fluidly couples the at least one fluid reservoir with an imaging device, and a fluid level sensing apparatus fluidly coupled with the at least one fluid reservoir. The fluid level sensing apparatus comprises: a bottom portion having a fluid volume VB; an intermediate portion vertically adjacent the bottom portion and having a fluid volume VI, the intermediate portion including a first fluid sensor spaced vertically from a second fluid sensor; and an upper portion vertically adjacent the intermediate portion and having a fluid volume VU, wherein VU>VI>VB. The inkjet printing system also comprises a pump fluidly coupled with the at least one fluid level sensing apparatus and configured to exert fluid pressure along the at least one fluid level sensing apparatus.
US09358799B2	Flow path member, ink jet head, and ink jet printer A flow path member includes a first space which is opened by a first liquid flow path, and into which liquid flows from the first liquid flow path; a second space which is opened by a second liquid flow path on a bottom surface at the opposite side to the first space, and out of which liquid flows from the second liquid flow path; a filter which filters liquid passing therethrough, and which is included between the first space and the second space; and a support which protrudes from the bottom surface of the second space toward the filter side, in which the support is a point-form projection.
US09358798B2	Printing fluid cartridge, printing apparatus, and use of printing fluid cartridge A printing fluid cartridge includes a front face oriented toward a first direction, a printing fluid supply portion positioned at front face, a rear face positioned opposite the front face and oriented toward a second direction opposite the first direction, at least one electrical interface positioned between the front face and the rear face, and an engagement surface facing in the second direction. The at least one electrical interface is offset from the printing supply portion with respect to a third direction perpendicular to the first direction and the second direction. The at least one electrical interface is positioned closer to front face than the engagement surface is, and the at least one electrical interface and the engagement surface intersect a plane which is parallel with the first direction, the second direction, and the third direction.
US09358797B2	Liquid tank and liquid ejecting apparatus A liquid ejecting apparatus informs a user when an ink tank is substantially mechanically attached so as to prevent an attaching operation from being stopped by a user before completion of attachment of the ink tank. A board is provided with a light emitter, and a control unit for controlling the light emitter according to a conductive state between an electrode and a counterpart electrode. The liquid tank is moved by force P, a second engaging portion is locked to a second locking portion, and then, the liquid tank is attached to a holder at an attachment completion position. The non-conductive state between the electrodes is changed to a conductive state before the second engaging portion engages with the second locking portion, and then, the liquid tank is fixed at the attachment completion position during movement in a reverse direction after the liquid tank passes the attachment completion position.
US09358796B2	Liquid supply apparatus A liquid supply apparatus includes: a plurality of liquid containers, each including a liquid container part that is capable of storing a liquid, and a liquid supply part that is in communication with the inside of the liquid container part and is capable of supplying the liquid in the liquid container part to a recording head of a liquid ejection recording apparatus; and a casing that detachably houses therein the plurality of liquid containers and that is supported by the liquid ejection recording apparatus. At least two of the plurality of liquid containers are arranged along a top-to-bottom direction within the casing.
US09358795B2	Liquid container and liquid ejection system A liquid container for supplying a liquid to a liquid ejection apparatus comprises: a liquid chamber provided to store the liquid; an air chamber connected with the liquid chamber to introduce the outside air into the liquid chamber with consumption of the liquid in the liquid chamber; an open-air hole provided to introduce the outside air into the air chamber; and a liquid inlet provided to fill the liquid into the liquid chamber, wherein the liquid inlet is located at a lower position than the open-air hole, in a filling attitude of the liquid container in which the liquid is filled into the liquid chamber.
US09358794B2	Liquid ejecting apparatus A liquid ejecting apparatus includes a liquid flow path connecting a liquid containing unit that contains a liquid to a liquid ejecting unit that ejects the liquid. The liquid flow path includes a supply flow path which connects the liquid containing unit to the liquid ejecting unit and a return flow path which connects the liquid ejecting unit to the liquid containing unit. When the liquid is not ejected by the liquid ejecting unit, the liquid contained in the liquid containing unit is circulated between the liquid containing unit and the liquid flow path by allowing the liquid to flow in order of the supply flow path, the liquid ejecting unit, and the return flow path. When the liquid is ejected, the liquid contained in the liquid containing unit is supplied to the common liquid chamber via both of the supply flow path and the return flow path.
US09358784B2	Liquid ejecting head, liquid ejecting apparatus, and method for manufacturing liquid ejecting head A liquid ejecting head includes a nozzle opening that is formed on one face of a silicon substrate, and ejects liquid, a first concave portion that is provided on the other face of the silicon substrate, and configures a pressure generating chamber which communicates with the nozzle opening, and a second concave portion that is provided on one face of the silicon substrate, and configures a flow path which communicates with the first concave portion and supplies the liquid, in which the first concave portion and the second concave portion overlap each other in an in-plane direction when seen in a direction which is orthogonal to the face of the silicon substrate.
US09358781B2	Liquid discharging apparatus, head unit, and control method of liquid discharging apparatus Provided is a liquid discharging apparatus which includes a modulation circuit which generates a modulation signal which is obtained by pulse-modulating a source signal, a transistor which generates an amplified modulation signal by amplifying the modulation signal, a low pass filter which includes an inductor and a capacitor and generates a drive signal by smoothening the amplified modulation signal, a piezoelectric element which is displaced by receiving the drive signal, a cavity of which the internal volume changes in accordance with the displacement of the piezoelectric element, a nozzle through which liquid in the cavity is discharged in accordance with change in the internal volume of the cavity, and a circuit substrate on which the modulation circuit, the transistor, and the low pass filter are mounted, in which the capacitor is a leadless type capacitor.
US09358780B2	Method and device for imaging and/or varnishing the surfaces of objects A method and a device for imaging and/or varnishing the surfaces of objects or vehicles, etc. includes adapting a time lag between an application of fluid and further treatment thereof, such as drying ink or varnish, to a spreading behavior of the fluid during the application thereof. The fluid may be applied to the surface of the object in sections, firstly drying the fluid in individual sections before applying it to the next section.
US09358778B2	Inkjet imaging methods, imaging methods and hard imaging devices Hard imaging methods and devices are described. In at least some examples, a method includes ejecting a plurality of droplets of a liquid marking agent corresponding to the image to be formed, wherein the droplets of the liquid marking agent individually comprise a plurality of ink particles. The droplets are received upon a transfer member, and after the receiving, at least the ink particles are transferred from the transfer member to media to form a hard version of the image using the media.
US09358775B2	Apparatus and methods for micro-transfer-printing In an aspect, a system and method for assembling a semiconductor device on a receiving surface of a destination substrate is disclosed. In another aspect, a system and method for assembling a semiconductor device on a destination substrate with topographic features is disclosed. In another aspect, a gravity-assisted separation system and method for printing semiconductor device is disclosed. In another aspect, various features of a transfer device for printing semiconductor devices are disclosed.
US09358770B2	System and method for automated initial separation of composite ply backing A method for initial separation of an adhered backing film from an uncured pre-impregnated composite lamina having an edge includes exposing and supporting the edge of the composite lamina, and applying an impact force to the exposed edge with an automated tool. The impact force is sufficient to cause delamination of the backing film from the composite lamina without damaging the lamina.
US09358769B2	Method for manufacturing a multi-layer composite, arrangement for positioning a sheet-like element onto a backing in a laminating unit A method and an arrangement for manufacturing a multi-layer composite (13) by laminating a sheet-like element (6) onto a backing (2) in a laminating unit (1), having steps, in this order, of conveying the element (6) in a longitudinal direction, detecting a position of the element (6), correcting the position of the element (6) on the basis of the detected position and on the basis of a reference position (15), and bonding said element (6) onto the backing (2). The detection step comprises the phases of measuring the lateral position, an angle of pivoting, and a longitudinal position of the element (6), and the correction step includes phases of lateral movement (T), pivoting (P), and longitudinal movement (L) of the element (6), apparatus elements perform the steps.
US09358768B2	Polarizing plate, method of preparing the same, and liquid crystal display apparatus including the same A polarizing plate, a method of preparing the same and a liquid crystal display apparatus including the same are disclosed. The polarizing plate includes a polarizer and a polyester film formed on a surface of the polarizer, wherein the polyester film has a ratio of an elongation ratio in a machine direction to an elongation ratio in a transverse direction of about 1:0.8 to about 1:1.2, an in-plane retardation (Re) of about 500 nm or less at a wavelength of 550 nm, and an out-of-plane retardation (Rth) of about 10,000 nm or less at a wavelength of 550 nm.
US09358766B2	Applying biaxially oriented polyester onto a metal substrate The invention is a laminating process which is directed toward economical production methods for scalable amounts of production which develop properties suitable for a broad based product line. In particular, the product is capable of important key components of commercial properties such as adhesion, scratch resistance, chemical inertness, and bending without failure.
US09358765B2	Method for coating and bonding substrates A method for coating of a first substrate with a first diffusion bond layer by deposition of a first material which forms the first diffusion bond layer on a first surface of the first substrate such that the first diffusion bond layer forms a grain surface with an average grain diameter H parallel to the first surface smaller than 1 μm. The invention further relates to a method for bonding of a first substrate which has been coated as described above to a second substrate which has a second diffusion bond layer, the method of the bonding comprising the following steps: bring a first diffusion bond layer of a first substrate into contact with a second diffusion bond layer of a second substrate, pressing the substrates together to form a permanent metal diffusion bond between the first and second substrates.
US09358760B2	Prestretched agricultural stretch wrap film The present invention relates to a prestretched agricultural stretch wrap film which is used for baling applications when packaging for example grass, maize, sugar beet pulp, malt, straw, household refuse and the like. The prestretched agricultural stretch wrap film according to the present invention is produced by prestretching a polyethylene-containing co-extruded blown film, which comprises at least two layers joined to one another, in the longitudinal direction by at most 70%, so that it still retains an elongation capability in the longitudinal direction of at least 310% or so that a force is to be exerted on said film of less than 6 N in order to stretch the film by 75% in the longitudinal direction.
US09358755B2	Waterproof breathable composite materials for fabrication of flexible membranes and other articles A waterproof breathable material has a higher strength-to-weight ratio and higher tear resistance-to-weight ratio than traditional materials, and may be applied in a wide field of potential uses. A non-woven composite material comprises at least one waterproof breathable (W/B) membrane, a first unidirectional non-woven composite layer having multiple fibers enclosed by adhesive in parallel to each other, a second unidirectional non-woven composite layer having multiple fibers enclosed in adhesive in parallel to each other. The first unidirectional non-woven composite layer is positioned such that the fibers are oriented 90° relative to the fibers of the second unidirectional non-woven composite layer, and a space is formed between the first and second multiple fibers. No adhesive is present in the space.
US09358753B2	Substrates and methods of forming a pattern on a substrate Substrates and methods of forming a pattern on a substrate. The pattern includes a repeating pattern region and a pattern-interrupting region adjacent to the repeating pattern region. A mask is formed on the substrate, with the mask including the repeating pattern region and the pattern-interrupting region and which are formed using two separate masking steps. The mask is used in forming the pattern into underlying substrate material on which the mask is received. Substrates comprising masks are also disclosed.
US09358749B2	Tubular, continuous, seamless, compressible, resilient mounting articles and pollution control devices comprising the same Tubular, continuous, seamless, compressible, resilient mounting article comprising inorganic fibers, and having an inner curved surface, a central longitudinal axis, and a uniform internal cross-sectional area along the central longitudinal axis. The mounting articles are useful, for example, in mounting pollution control elements in pollution control devices.
US09358748B2	Back seam welder and method of operation A thermal welder is configured to weld a back seam of a bag formed of thermoplastic sheet material, which may be a polywoven material. The welder typically includes a weld heater and a compression mechanism downstream of the weld heater to compress the sheet material to form the back seam. The welder also includes a weld breaker downstream of the compression mechanism to break apart incidental welds which are formed adjacent the back seam.
US09358739B2	Method for production of heat-resistant container An invention of a method for production of a heat-resistant container, in which a raised bottom portion is displaced inwardly by reduction in internal pressure, is disclosed. The method is characterized by forming a raised bottom portion 11 smaller in wall thickness than a surrounding wall portion 12a by first blow molding using a heat-treating blow mold; and pushing up the raised bottom portion 11 by a secondary bottom mold, in performing second blow molding using a final blow mold, to increase the wall thickness of the surrounding wall portion 12a (ground portion 12) relative to the raised bottom portion.
US09358738B2	Aseptic blow, fill and seal methods of fabricating test sample containers and associated systems and containers Methods of fabricating a culture container include: (a) forming a parison; (b) introducing flowable (e.g. colorimetric) sensor material into the parison; (c) blow molding the parison into a container body; and (d) curing the sensor material so that it attaches to an inner surface of the container body. The methods can also include adding sterile growth media into the container and sealing the container shut with an elastomeric stopper and crimped seal/cap. The process can be aseptic so that autoclaving the container is not required.
US09358737B2	3D mold for manufacturing of sub-micron 3D structures using 2-D photon lithography and nanoimprinting and process thereof A process to manufacture a 3D mold to fabricate a high-throughput and low cost sub-micron 3D structure product is disclosed. The process integrates use of 2-photon laser lithography and 3D write technology to make a 3D mold of each layer of the 3D structure product, and then use nanoimprinting to form a sheet of polymer film of each layer of the 3D structure from the said 3D mold of that layer. Each layer of the sheet of polymer film is then fabricated into the sub-micron 3D structure product. The 3D mold of each layer of a high-throughput and low cost sub-micron 3D structure product, is further used to make master molds which is then used to form a sheet of polymer film of each layer of the 3D structure to fabricate the sub-micron 3D structure product. Applications using this process are also disclosed.
US09358735B2	Method of treating a lens forming surface of at least one mold half of a mold for molding ophthalmic lenses A method of treating of a lens forming surface (2) of at least one mold half (1) of a mold for molding an ophthalmic lens, in particular of the lens forming surface of a glass mold half for molding a contact lens, especially a soft contact lens, includes the steps of: providing a plasma (10) under atmospheric pressure, and exposing the lens forming surface (2) to the plasma (10) under atmospheric pressure thereby hydrophilizing the lens forming surface (2) without depositing any material on the lens forming surface (2).
US09358732B2	Bond assembly jig and method A method for forming a composite structure on an assembly jig includes assembling an anchor member and block member on a support plate, arranging composite materials on the support plate adjacent to the anchor member, placing a shroud over the anchor member and block member, and applying heat and pressure to the bond assembly jig to cure the composite materials.
US09358730B2	Dynamic strain hardening in polymer nanocomposites The present invention provides methods of strengthening composites. In some embodiments, such methods generally comprise a step of applying a dynamic stress to the composite in order to increase at least one of the stiffness or strength of the composite. In some embodiments, the composite comprises: a polymer matrix; nanomaterial fillers; and an interphase between the polymer matrix and the nanomaterial fillers. In some embodiments, the stiffness or strength of the composite increases permanently in response to the applied stress. In some embodiments, the increase in the stiffness or strength of the composite may be associated with an increase in the storage modulus of the composite, a decrease in the loss modulus of the composite, and a decrease in the loss tangent of the composite. In some embodiments, the applied stress results in a rearrangement of the interphase.
US09358724B2	Method for producing dialysis tank chamber frame There is provided a method for producing a chamber frame for a dialyzer, which is readily produced, has a stable quality, is inexpensive and is excellent in sealing property and heat resistance.A cut frame 1 is set on an unshown table of an impulse welder 30, distributors 13 are fitted into communicating passage 9 and communicating passages 11, and a net 15 is positioned so as to cover a central opening 3. Welded portions A and B, and the welded portions C and D are subjected to impulse welding. Mounting of the net 15 as a spacer and mounting of the distributors 13 are carried out simultaneously by a single pressing operation. After that, the welded portions of the net are deburred, and correction work is performed on defects.
US09358722B2	Method of protecting an electrical component in a laminate A method for protecting an electrical component in a support layer of a functional laminate comprises the steps of providing the support layer with a first hole, a second hole and an opening connecting the first and the second holes together, positioning an electrical component inside the first hole, placing a patch of plastic material in the second hole, and causing the material of the patch to flow through the opening from the second hole to the first hole, flowing around the electrical component in order to surround it.
US09358721B2	Method for the manufacture of a hole in a component consisting of a composite material A method for the manufacture of a hole in a component consisting of a composite material, such as a fiber reinforced plastic part or a fabric reinforced plastic part, which is characterized in that the component having first and second oppositely disposed sides is placed with its first side on a support having an iris diaphragm, in that a tip which diverges in the axial direction is pressed coming from the second side of the component through the component, which optionally has a pre-piercing, for the formation of the hole or for the enlargement of the pre-piercing and in that the iris diaphragm has a smaller starting opening which receives a narrower region of the tip and opens into a larger opening with increasing penetration of the component by the tip, whereby the component is supported during the hole formation over an as large as possible area from the first side. A piercing aid in the form of an iris diaphragm or a corresponding die button is likewise claimed.
US09358720B2	Method and device for blow-molding containers The invention relates to a method and device used to blow-mold containers. After thermal conditioning, a preform is shaped into the container inside a blow mold by the effect of blowing pressure. Required blowing gas is introduced into an interior of the preform through a connecting element. After the blow-molding, a purging gas is conducted through the interior of the container. A plurality of blowing stations are used, and, for at least one of the blowing stations, at least part of the required amount of the purging gas is stored in a storage volume associated only with said blowing station.
US09358718B2	Shielding structure of a through-hole formed in a wall of a plastic hollow product An improved structure for sealing a through-hole formed in a plastic hollow product when mounting a component such as a sensor on the product is provided. A cylindrical section is provided in a peripheral wall of the plastic hollow product as projecting radially outwardly from the peripheral wall and an inner circumferential surface of the cylindrical section defines the through-hole for communication between the interior and the exterior of the product. A sensor component is mounted with its sensor portion extending through the through-hole and an O-ring is disposed between the sensor portion and the inner circumferential surface of the cylindrical section which is backed by a component mounting member.
US09358712B2	Device and method for operating a machine equipped with a handling device A device for operating a machine equipped with a handling device, particularly an injection molding machine, includes a first stationary operating device secured to the machine, and a second mobile operating device. The operating devices can be designed to be touch screen. The stationary operating device is designed for operating both the machine and the handling device and the mobile operating device is likewise designed for operating both the handling device and the machine. Each operating device is fully equipped for comprehensive configuration or programming and for operating the machine and the handling device. The screen of the mobile operating device is smaller than the screen of the stationary operating device, and predefinable regions of a screen page of the screen of the stationary operating device can be shown successively on the screen of the mobile operating device.
US09358711B2	Apparatus for injection molding Apparatus for actuation of split locking nuts of a two platen injection molding machine. Each split locking nut has opposed mating nut halves movable in translation relative to a strain rod therebetween to selectably engage the strain rod. Mating nut halves of two split locking nuts are interconnected by connecting rods to define a pair of split nuts: a master split locking nut driven by an actuator; and a slave split locking nut to which motion is transferred by the connecting rods. Motion of a driven nut half of each master split locking nut is coupled to the opposed mating nut half by at least one coupling mechanism, each comprising a pivot arm and two pivot links interposed between the pivot arm and the opposed mating nut halves whereby translation of a driven nut half is coupled to effect equal and opposite translation of the opposed mating nut half.
US09358707B2	Device for locating a first aerospace component relative to a second aerospace component A device for locating a first aerospace component relative to a second aerospace component, comprising a bladder with a flexible membrane which defines a fluid receiving space such that, when a hardenable hydraulic fluid is injected into the bladder, said membrane is urged to deform into abutment with said first and second aerospace components to locate said components relative to each other when the hydraulic fluid hardens.
US09358705B2	Absorbent core for disposable absorbent article A method of making an absorbent core for use in an absorbent article. The method comprising the steps of: a. providing a first absorbent fibrous web material; b. providing a second absorbent fibrous web material; c. providing a pair of rolls forming a nip through which the first and second absorbent fibrous web materials can be processed, the pair of rolls being selected from the processes consisting of, ring rolling, SELF, micro-SELF, and rotary knife aperturing; d. deforming portions of the first absorbent fibrous web material by processing through the pair of rolls; e. deforming portions of the second absorbent fibrous web material by processing through the pair of rolls; and f. combining the first and second absorbent fibrous web materials to form the absorbent core.
US09358698B2	Power tool with an indicator A power tool is provided with an indicator with a light source for generating a marking. A holding device is secured on the power tool by positive fit. The indicator is releasably secured on the holding device, wherein the holding device is secured to a grip pipe. The holding device has a geometry that is matched to the geometry of the grip pipe such that the holding device is securable in only one position on the grip pipe.
US09358696B2	Low and high pressure proximity sensors A fluid proximity sensor for surface measurements having a measurement chamber (210) with a measurement nozzle (205), a reference chamber (220) with a reference nozzle (225), and a diaphragm (215) forming an interface between the reference chamber and the measurement chamber. A shroud (280) that encloses the measurement nozzle and reference nozzle provides a peripheral gap (295) between the shroud and a work surface (290) being measured. By connecting either a partial vacuum supply or a partial fluid supply to the shroud, the internal shroud pressure can be raised or lowered and thus the gain-frequency operating regime of the proximity sensor optimized. Movement of the diaphragm in response to differential pressure changes can be sensed by optical, capacitive or inductive means (275).
US09358695B2	Trimmer apparatus A trimming apparatus trims by cutter blades running from one end of a sheet bundle to the other end thereof, includes a bed surface for the sheet bundle, cutter blades for cutting the sheet bundle supported on the bed surface, a drive device for running the cutting blades from one end of the sheet bundle to the other end thereof, a support member having a support face, and a shift device for moving the support member between a working position for the support member supporting cut sheet dust pieces and a retreating position not to hinder the cut sheet dust pieces from dropping. The shift device displaces the support face from the working position to a retreating position after the cutter blades move at a predetermined distance toward the other end of the sheet bundle from one end thereof.
US09358690B2	Robot device, method of controlling robot device, computer program, and program storage medium Provided is an excellent robot device capable of preferably detecting difference between dirt and a scratch on a lens of a camera and difference between dirt and a scratch on a hand.A robot device 100 detects a site in which there is the dirt or the scratch using an image of the hand taken by a camera 305 as a reference image. Further, this determines whether the detected dirt or scratch is due to the lens of the camera 305 or the hand by moving the hand. The robot device 100 performs cleaning work assuming that the dirt is detected, and then this detects the difference between the dirt and the scratch depending on whether the dirt is removed.
US09358686B2	Robot system A robot system includes: a robot including a hand configured to hold a thin plate-shaped workpiece and an arm configured to move the hand; and a robot controller configured to control the robot. The robot controller controls the robot to perform a transfer of the workpiece at a predetermined workpiece transfer position in such a way that the hand is moved in a horizontal direction while being moved in a vertical direction after the hand has reached the workpiece transfer position.
US09358685B2	Apparatus and methods for control of robot actions based on corrective user inputs Robots have the capacity to perform a broad range of useful tasks, such as factory automation, cleaning, delivery, assistive care, environmental monitoring and entertainment. Enabling a robot to perform a new task in a new environment typically requires a large amount of new software to be written, often by a team of experts. It would be valuable if future technology could empower people, who may have limited or no understanding of software coding, to train robots to perform custom tasks. Some implementations of the present invention provide methods and systems that respond to users' corrective commands to generate and refine a policy for determining appropriate actions based on sensor-data input. Upon completion of learning, the system can generate control commands by deriving them from the sensory data. Using the learned control policy, the robot can behave autonomously.
US09358680B1	Wall-mounted tool organizer A hand tool organizer adapted to be mounted on a wall or door and configured to retain a plurality of tools via profile recesses, where each slidably received tool matches a corresponding recess. The organizer is further provided with side-pivoting doors and slide-out drawers.
US09358678B2	Telescopic ratchet wrench A ratchet wrench includes a telescopic handle that includes a shank, a tube and a positioning unit. The shank includes bores. The tube is movably supported on the shank and includes an aperture. The positioning unit includes a shell, a button, a spring and a ball. The shell is supported on the tube and includes a pocket. The button is movably inserted in the pocket and includes a shallow recess and a deep recess. A first portion of the ball enters one of the bores via the aperture when a second portion of the ball is placed in the shallow recess as the button is kept in an upper position by the spring. The button can be pushed to allow the second portion of the ball to enter the deep recess so that the first portion of the ball can escape from any of the bores.
US09358675B2	Lubricating pump with double-acting drive piston The invention relates to an automatic lubricating pump (1) for a machine having a hydraulically actuated striking tool (4), such as a hydraulic hammer for example. The lubricating pump (1) is designed such that it can be connected to a pressure line (P) of the hydraulic circuit (2). The lubricating pump (1) has a drive piston (8), designed such that it can be driven by the hydraulic circuit, and a feed piston, connected to the drive piston in a motion-transmitting manner, of a feed pump (9), by means of which lubricant is fed to a lubricating point. The service life of the lubricating pump can be prolonged compared with conventional pumps if the drive piston (8) is designed to be double-acting with two drive chambers (8c, 8d) and a hydraulically operable changeover member (16) is provided which can be engaged in the hydraulic circuit and by means of which the drive chambers (8c, 8d) can be alternately and automatically connected to the pressure line (8) during operation.
US09358674B2	Hand tool for removing nails Herein is disclosed a hand tool for removing nails. The tool includes an elongated handle having opposite first and second ends with a blade projecting transversely from a side of the elongated handle at the first end thereof. The blade is sickle shaped and curved towards the second end. The blade has a front edge contiguous with the first end. The blade has a width which tapers from the elongated handle to a pointed tip opposite the elongated handle. Finally, a nail hooking notch is formed on a back edge of the blade opposite the front edge.
US09358670B2	Tool for fine machining of surfaces A surface fine machining tool has a working medium carrier with a bottom side and a top side. Grooves extend from the top side to the bottom side completely through the working medium carrier and have a narrowed portion at the bottom side but do not narrow upwardly toward the top side. The working medium carrier is an injection-molded plastic part. Lamellas with a holding rim and a lamella body are inserted with the holding rim in the grooves. The lamella body extends downward away from the holding rim, passes through the narrowed portion, and extends away from the bottom side. The lamellas are uniformly distributed about the bottom side. The grooves have an open end at a carrier rim of the working medium carrier. The open end has a cross-section matching the groove cross-section. A cover is connected to the top side and covers grooves and holding rims.
US09358665B2	Hand sander that is selectively attachable to a dust-vacuum system A sponge sander configured for selective attachment to a dust-collection system includes a housing having a housing-interior surface defining a sponge cavity and a sponge seat configured for removably retaining a determinately-dimensioned sanding sponge. The sponge has an abrasive sanding surface, a back surface opposite the sanding surface and a sponge periphery defined between the sanding and back surfaces. The sponge is retained within the sponge cavity such that (i) the abrasive sanding surface can engage a work surface to be sanded, (ii) fluid-flow channels are maintained between the sanding sponge and the housing-interior surface and (iii) the spaces are in fluid communication with a fluid port defined in the housing so that when a negative pressure is applied across the fluid port by a vacuum system external to the housing, dust created by sanding is drawn into the fluid-flow channels and out of the housing through the fluid port.
US09358663B2	System and methods of removing a multi-layer coating from a substrate A system for use in removing a multi-layer coating from a substrate is provided. The multi-layer coating includes a first coating applied to the substrate and a second coating applied over the first coating. The first coating is formed from a first material and the second coating is formed from a second material different from the first material. The system includes a grinding mechanism configured to remove the multi-layer coating from the substrate, and a controller coupled in communication with the grinding mechanism. The controller is configured to position the grinding mechanism against the multi-layer coating, initiate a first removal mode that directs the grinding mechanism to traverse across the substrate, monitor a variable operating parameter of the grinding mechanism during the first removal mode, and evaluate a value of the variable operating parameter against a predetermined threshold to determine whether the second coating has been removed from the substrate.
US09358660B2	Grinding wheel design with elongated teeth arrangement A grinding wheel includes a base disk, and a plurality of teeth protruding beyond a surface of the base disk. The plurality of teeth is aligned to an elongated ring encircling a center of the grinding wheel.
US09358654B1	Sharpening a cutting tool using multiple abrasive belts Method for sharpening a cutting tool. In some embodiments, a first abrasive belt is advanced along a belt path between first and second rollers. A cutting tool inserted into a v-shaped slot is drawn across the belt as a cutting edge is supported by a limit stop of the slot. The first abrasive belt is deflected at a first radius of curvature in relation to a first linear stiffness of the belt and a tension applied to the first roller. The first abrasive belt is replaced with a second abrasive belt, and the cutting tool is again inserted into the v-shaped slot and drawn across the belt as the cutting edge is supported by the limit stop of the slot. The second abrasive belt is deflected at a second radius of curvature in relation to a second linear stiffness of the belt and the tension applied to the first roller.
US09358653B2	Double-spindle machining apparatus An apparatus for machining a workpiece has a housing having a vertical front wall and a first vertical side wall generally perpendicular thereto, respective first front and side vertical guides on the front and first side walls, and a first vertical slide extending along the front and first side walls. First front and side formations on the first vertical slide engage the first front and side guides for vertical movement of the first vertical slide relative to the housing. A first spindle unit adapted to hold the workpiece is carried on the first vertical slide, and a tool holder adapted to hold tools in a first work station is provided below the first vertical slide so that the spindle unit can engage the workpiece with a one of the tools in the work station.
US09358652B2	Tool turret A tool turret includes a tool disk (2) swivelable about a support column (32) that defines a swivel axis (26) into positions in which at least one machining tool fastened to the tool disk (2) is in a machining position. A drive device (14) includes drives (10, 8) connected by a controllable coupling device (18) to outputs (20, 22) used to drive the tool disk (2) or the machining tool. The drive device (14) is arranged inside the tool disk (2) together with the drives (8, 10) and the output (22) used to drive the machining tool. The output used to drive the tool disk (2) in a swiveling manner has a gear train arrangement (34) outside the tool disk (2) on the support column (32). The gear train arrangement has an output shaft (70) that extends along the support column (32).
US09358645B2	Adaptive machining method for smelted blades A method for finishing a shape of a component by machining, in which one area is produced by smelting with a thickened portion forming a first surface with a surrounding profile and a theoretical profile defined by a second surface, the method including: defining, on the second surface, a grid forming nodes and squares; defining each point over which the machining tool is to pass according to weighting coefficients equal to weight to be given to the nodes of the square in which the tool is located, to be the barycenter of assigned nodes of the coefficients; measuring, for each node located outside an outer limit, the delta between the first surface at the node and the theoretical position of the node; calculating deltas for each node within the outer limit by interpolation from already known deltas; using the weighting coefficients, defining the delta to be applied at each point.
US09358643B2	Method for building a gas turbine engine component A method, including: providing a layer of powder material (106) on a substrate (12) having protruding rib material (26); and traversing an energy beam (100) across the layer of powder material to form a cladding layer (10) around and bonded to the protruding rib material, wherein the cladding layer defines a layer of an airfoil skin (94).
US09358640B2	Laser cutting device and laser cutting method A laser cutting device for cutting an original product includes a laser device which is movable along a first direction and a second direction perpendicular to the first direction, and rotatable reflecting mirrors. The original product includes a stub bar, optical lenses, and connection portions corresponding to the optical lenses. The rotatable reflecting mirrors correspond to the connection portions and are positioned above the original product and aligned with the connection portions. At least two rotatable reflecting mirrors are arranged in a straight line. The laser device is located on the straight line and is configured for emitting laser beams. Each of the rotatable reflecting mirrors is configured for reflecting laser beams from the laser device toward the corresponding connection portion and is configured for rotating so as to allow the laser beams from the laser device to reach the next rotatable reflecting mirror on the straight line.
US09358634B2	Friction stir welding apparatus A friction stir welding apparatus has a probe rotatable and vertically movable with respect to a processing target member, a welding tool having an interposed member that covers a part of an outer periphery of the probe and is rotatable relative to the probe, a mounting member on which the processing target member is mounted, a movement mechanism having an arm fitted with the welding tool that can move the welding tool with respect to the processing target member by moving the arm, and a correction mechanism having a correction member that can correct a moving direction of the welding tool so as to be matched with a predetermined processing direction, by bringing the interposed member into contact with the processing target member when the welding tool is moved with respect to the processing target member by moving the arm, and fixed to the mounting member.
US09358631B2	Coarse hard-metal particle internal injection torch and associated compositions, systems, and methods Internal coarse particle injection plasma transferred arc torch nozzles comprising: a heat-resistant nozzle body; at least one coarse hard-metal particle internal injection port; at least one fine hard-metal particle and matrix internal injection port; at least one gas port; and a cathode. Related systems, apparatus, compositions, and methods involving such arc torch nozzles are also disclosed.
US09358628B2	Railroad rail head repair A multi-pass gas metal arc weld (“GMAW”) approach is used for in-situ repair of railhead defects. A defect is removed via machining a perpendicular slot or grove in the railhead leaving the web and base unaltered. A sufficient number of GMAW passes are used to fill the slot using a weld material suitable for the particular type of parent steel, and excess weldment can be removed. Optionally, for pearlitic steel rails post-weld heat treatment can be used to cause austenization and/or quenching of the weld. The weld heat inputs and other parameters are controlled to avoid ductile and brittle fracture related morphologies.
US09358626B2	Manufacturing of holemaking tools A process for producing a tool having a main body which extends in a longitudinal direction and at least one blade for machining a workpiece includes providing a base coating on the tool; grinding the at least one blade in a manner that removes the base coating in the region of the at least one blade; and providing a second, fine coating, to the at least one ground blade.
US09358625B2	Hack saw with integrated retainer for blade pin holder and related method A hack saw comprises a proximal end, a proximal handle located at the proximal end, and a distal end spaced from the proximal handle for mounting a hack saw blade therebetween. The handle includes a proximal cavity at a base end thereof, dimensioned to allow a portion of a proximal pin holder therethrough, and a proximal pin holder retaining member within the proximal handle proximally spaced from the proximal cavity, defining a slot therebetween for retention of a pin holder therein. The pin holder retaining member is positioned to form an interference with the proximal pin holder when the pin holder is located in the handle and prevents the proximal pin holder from dislodging or being removed therefrom.
US09358624B2	Motor-driven machine tool For a machine tool designed in particular as a saber saw, a configuration including a carrying frame is provided, via which the lifting rod and the support element are joined to form a unit that can be rotated about the longitudinal axis of the power tool, is mounted on the casing side, and guides a drive part of the lift drive on the lifting rod side.
US09358621B2	Cutting insert and a milling tool A milling tool for the milling of a slot in a workpiece includes a plurality of cutting inserts, which comprise an under side; an opposite upper side, which forms a chip surface and extends parallel to an extension plane; and an edge side between the upper side and the underside. A cutting edge, which extends between the edge side and the chip surface, includes a primary main cutting edge; a front cutting edge, which extends along an edge line; and a primary corner cutting edge, which extends between and connects the primary main cutting edge and the front cutting edge. The primary corner cutting edge has a convex shape and extends, with respect to a rear portion of the cutting insert, forward from the front cutting edge to a position on the other side of an imaginary line, which forms an extension of the edge line and extends in a tangential direction to a point on the primary corner cutting edge.
US09358620B2	Guide pad A guide gib (500) for a deep drilling tool of a substantially rectangular shape with a longitudinal direction (L) and a width (B) and with at least one sliding surface (540) is characterized in that at least one lubricating groove, preferably a plurality of lubricating grooves (501, 502), is/are arranged at least in the region of a contact zone of the sliding surface.
US09358619B2	Hole cutter with chip egress aperture A hole cutter has a substantially cylindrical blade body defining a blade body circumference, a cutting edge formed on one end of the blade body, and an axially-elongated slot formed through the substantially cylindrical blade body. The axially-elongated slot is configured to receive chips flowing from the cutting edge within the interior of the blade body and (i) into the slot, and/or (ii) through the slot, to prevent the collection of such chips within the interior of the blade body and/or at an interface between the blade body and work piece. The axially-elongated slot defines a first end adjacent to the cutting edge, a second end axially spaced further from the cutting edge, and a slot area. The hole cutter further defines a total slot area to blade body circumference ratio within the range of about 0.1 to about 0.3 depending on the size of the hole cutter.
US09358618B2	Implementing reduced drill smear A method is provided for implementing reduction of drill smear in drilling a multilayer substrate such as a rigid printed circuit board or flex to minimize or eliminate the need to remove drill smear and for improved via and interconnect reliability. An inert liquid is applied to the multilayer substrate and a drill bit prior to and during the drill process to cool and lubricate the multilayer substrate and the drill bit to reduce drill smear.
US09358613B2	Hydrophobic porous hard coating with lubricant, method for making and use of same A composite includes a porous matrix that includes a molybdenum-silicon-boron (Mo—Si—B) alloy that has a plurality of pores with a lubricant in contact with the Mo—Si—B alloy, a hydrophobic compound in contact with the Mo—Si—B alloy, or a combination thereof. A method for preparing a porous composite includes disposing a porous matrix comprising a Mo—Si—B alloy on a substrate, the Mo—Si—B alloy comprising a plurality of pores; disposing a lubricant on a surface of the porous matrix; and disposing a hydrophobic compound on a surface of the porous matrix to form the porous composite.
US09358610B2	Device for supporting molten metal container A device for supporting a molten metal container is provided, wherein the device has first and second support units for supporting the weight of the molten metal container in connection with a ring member, taken alone or in combination according to a rotary position. According to one embodiment of the present invention, the device for supporting the molten metal container comprises: a ring member which encloses the outside of a rotatable molten metal container; and first and second support units which are configured to support the weight of said molten metal container in connection with said ring member, taken alone or in combination according to a rotary position of said molten metal container.
US09358604B2	System for compression relief shaping Methods and apparatus for reshaping a shoulder and/or neck portion of a metallic container are provided. A shoulder shaping or reshaping tool comprises a generally annular device with relief features provided on an internal surface. The tool is adapted to engage the exterior surface of a container to be shaped to provide outwardly extending ornamental features.
US09358603B2	Feeding apparatus for metal strips and manufacturing apparatus for heat exchanger fins A feeding apparatus for a wide metal strip, wherein a plurality of through-holes are formed with predetermined gaps in a length direction and a width direction, into a cutter and pulls narrow metal strips formed by cutting the wide metal strip between the through-holes in the length direction so that through-holes are formed along only the length direction. The feeding apparatus includes a feeding-in apparatus that is provided on an entrance side of the cutter that feeds the wide metal strip into the cutter and a pulling-out apparatus that is provided on an exit side of the cutter that pulls out the narrow metal strips, which have been cut out by the cutter. A linking member drives the feeding-in apparatus and the pulling-out apparatus in concert so that the wide metal strip is fed into the cutter together with the narrow metal strips out being pulled out from the cutter.
US09358600B1	Gun barrel manufacturing methods A method of forming a gun barrel includes providing a gun barrel with a desired wall thickness, and cold gas-dynamic spraying the gun barrel with a titanium powder to form an outer layer. The method may further include contouring the outer layer, applying a ceramic top coating to the contoured outer layer of the gun barrel, and sealing the gun barrel with a liquid metal sealer. The method may further include spraying the gun barrel with a bonding coating to form a bonding layer before cold gas-dynamic spraying the gun barrel.
US09358598B2	Method and apparatus for cooling and drying a hot-rolled strip or a metal sheet in a rolling mill A method for drying a strip (3) or sheet metal that runs through a rolling mill is characterized in that the strip (3) or the sheet metal is cooled to a lower temperature in a cooling section by means of a coolant, in particular a cooling liquid, down-stream of a hot strip mill (1) or, in case of sheet metal, after passing through at least one roll stand (2), and in that the coolant, in particular the cooling liquid, and subsequently the moisture remaining on the strip (3) or the sheet metal is removed from the strip (3) or sheet metal by means of a drying apparatus (10).
US09358595B2	Rolling stand roll neck seal A rolling mill roll neck is sealed by interposing a seal between a roll flinger having a first axial surface and an opposing second axial surface of a roll housing retaining plate. The seal is biased into contact against one of the axial surfaces with a pressurized fluid source, such as compressed air. As the seal wears during roll neck operation the pressurized fluid maintains biasing contact between the seal and the axial surface. The remainder of the intact seal is remains pressed into contact with the mating, opposing axial surface, for example that of a roll flinger or a retaining plate. Advantageously the seal is housed in a stationary retaining plate that is in opposed axial relationship with a rotating flinger.
US09358590B2	Electroadhesive surface cleaner An electroadhesive cleaning device or system includes electrode(s) that produce electroadhesive forces from an input voltage to adhere debris against an electroadhesive surface, from which the debris is removed when the forces are controllably modified. Controlling the input voltage may designate the size of debris to be cleaned. A power source provides the input voltage, and the electroadhesive surface can be a continuous track across one or more rollers to move the device across a dirty foreign surface. Electrodes can be arranged in an interdigitated pattern having differing pitches that can be actuated selectively to clean debris of different sizes. Sensors can detect the amount of debris adhered to the electroadhesive surface, and reversed polarity pulses can help repel items away from the electroadhesive surface in a controlled manner.
US09358588B2	Substrate cleaning method, substrate cleaning system and program storage medium The present invention provides a substrate cleaning method capable of removing particles from the entire surface of a substrate to be processed at a high removing efficiency. In the substrate cleaning method according to the present invention, a substrate to be processed W is immersed in a cleaning liquid in a cleaning tank 12. Then, ultrasonic waves are generated in the cleaning liquid contained in the cleaning tank 12, so that the substrate to be processed W is subjected to an ultrasonic cleaning process. While the substrate to be processed is being cleaned, a dissolved gas concentration of a gas dissolved in the cleaning liquid contained in the cleaning tank is changed.
US09358587B2	Substrate treating apparatus A substrate treating apparatus includes a loading section 1, a treating tank 2, a rinsing tank 4, a drying tank 5, an unloading section 6, and a pair of endless belt members 7 for transporting substrates successively through the loading section 1, treating tank 2, rinsing tank 4, drying tank 5 and unloading section 6. The substrate treating apparatus further includes a fixing mechanism for fixing a pair of side edges of each substrate parallel to a transport direction of the substrate to the endless belt members 7. In the loading section 1, a plurality of substrates are fixed, each with the pair of edges thereof parallel to the transport direction fixed at constant intervals to the pair of endless belt members 7. The substrates having undergone the treatment are removed from the pair of endless belt members 7 in the unloading section 6.
US09358584B2	Sifting device A sifting device for workpieces includes a box, an electric cabinet, a sifting assembly, an air blower, and an collector. The box receives the workpieces. The sifting assembly is received in the box, and includes a baffle and a guiding board, the guiding board defines a plurality of gaps, and a slit is formed between the baffle and the guiding board, and communicates with the plurality of gaps. The air blower is directed by the electric cabinet and communicates with the gap to adjust a direction of the workpieces to allow the workpieces to pass through the gap and the slit. The collector communicates with the slit to output the workpieces.
US09358583B1	Portable powered sifter A portable, powered sifter is sized and constructed to be portable by a single individual. The sifter includes a plurality of side members each having end portions and a middle portion between the end portions, the plurality of side members being connected together at the end portions to define a sifter frame enclosing a frame opening. A wire mesh extends across the frame opening. A support leg is attached to and extending from the middle portion of at least three of the plurality of side members. A means for driveshaft rotation is attached to the sifter frame and a driveshaft extending along a longitudinal axis is coupled to the means for driveshaft rotation. An offset weight is connected to the driveshaft, where operating the means for driveshaft rotation rotates the driveshaft about the longitudinal axis, thereby rotating the offset weight and causing the sifter frame to vibrate.
US09358580B1	Method for preparing and top coating a powder coated wood substrate The invention includes a method for preparing and top coating an item made of powder coated MDF (or other substrate containing wood) with the end result of improved visual and tactile smoothness; the invention includes the steps of cutting and machining the part, pre-powder preparation and sanding of the part, powder coating the part, post-powder preparation and sanding, and applying the liquid top coat to the part, resulting in a smoother finish than is currently available in any other powder coated MDF finish while requiring less coats than similar liquid paint finishes.
US09358578B2	Printing An image article comprises a substrate having a security image coated on at least a portion thereof, which security image effects less than 50% reflectance of radiation of a wavelength between 800 and 900 nm, wherein the security image comprises a defined infrared-absorbing compound, for example Pigment Green 8, wherein said infrared-absorbing compound does not create a strongly colored security image.
US09358574B2	Method for coating metal surfaces with an activating agent prior to phosphating This invention relates to a method for phosphating metal surfaces in which the metal surfaces are treated with an aqueous phosphate and titanium-based colloidal activating agent prior to phoshating, wherein the activating agent comprises at least one water-soluble silicon compound having at least one organic group. The invention also relates to a corresponding activating agent.
US09358572B2	Motorized viscous material dispenser A motorized viscous material dispenser (1), especially a caulking gun, comprises a drive unit (11) with a cylindrical pinion gear, a holder (15) attachable to a front side of the drive unit (11) for receiving at least one container containing viscous material, at least one piston (19), and at least one rack (17) meshing with the cylindrical pinion gear to drive said piston (19). A rear piece (51) attachable to a rear side of the drive unit (11) opposite the front side and a guide piece (45) attachable to the front side of the drive unit (11) comprises guiding apertures (55) through which the rack (17) is extending, whereby the guiding apertures (55) determine the position of the rack (17) relative to the cylindrical pinion gear, when the motorized viscous material dispenser (1) is assembled.
US09358571B2	Device for holding and centering elongated objects during rotational surface treatment The invention is a device for holding elongated objects such as fishing rod parts in conjunction with surface treatment. The device includes one first inner part and one outer second part which are pivotally arranged relative to one another between a first position where the object can be inserted into the device and a second position where the object can be fixed temporarily to the device with at least three elastic bands. Each elastic band is connected to a fastening device on the first inner part and a fastening device on the outer second part. Each elastic band's distance from the device's center of rotation changes during the relative turning of the first inner part with respect to the second outer part, causing the object to be held or released from the device depending on the relative rotational orientation of the first inner part and the second outer part.
US09358564B2	Painting stand for vehicle body panels A painting stand for supporting vehicle body panels during the painting operation includes a base moveable upon a plurality of rolling casters and having a vertically extending upright member which in turn supports a generally T-shaped member. The T-shaped member is pivotally joined to the upper end of the vertical upright member and includes a plurality of horizontally disposed telescoping sliders and attachment arms. The upwardly extending portion of the T-shaped member includes a moveable sleeve supporting a further attachment arm. The attachment arms engage the vehicle body panel.
US09358555B2	Threaded dispense nozzle and alignment method and device for photoresist and other fluid coaters Provided is a fluid dispensing system with a dispense nozzle with a threaded outer surface and a fluid dispensing apparatus with a movable dispenser arm with an opening that includes threaded inner walls that receive the dispense nozzle therein. Also provided is a method for aligning a dispense head in a coating tool. Horizontal alignment is achieved by rotating the dispense nozzle until its tip is in contact with the chuck then laterally adjusting the dispenser arm position so that the tip is positioned over a center of the chuck. Vertical alignment is achieved by rotating the dispense nozzle until an indicia of the dispense nozzle is at the same vertical location as a designated physical feature of the dispenser arm.
US09358554B2	Hermetic centrifugal separator with an outlet pumping configuration A hermetic centrifugal separator includes a centrifuge rotor, which is arranged to rotate around a center axis and includes a casing which defines an inner separation space, a set of separation discs in the inner separation space, two or more channels which connect to the separation space and include one or more inlet channels for supply of a liquid mixture of components to be separated to the separation space and one or more outlet channels for discharge of a component. The separator includes a torque transmitting part around the center axis and fixedly connected to the centrifuge rotor and an outlet seal between the outlet channel and the rotating centrifuge rotor preventing entrainment of unwanted substances. The separator includes a pump arranged to provide pressure to feed the separated liquid through the outlet channel.
US09358551B2	Bead manipulation techniques The invention provides a method of redistributing magnetically responsive beads in a droplet. The method may include conducting on a droplet operations surface one or more droplet operations using the droplet without removing the magnetically responsive beads from the region of the magnetic field. The droplet operations may in some cases be electrode-mediated. The droplet operations may redistribute and/or circulate the magnetically responsive beads within the droplet. In some cases, the droplet may include a sample droplet may include a target analyte. The redistributing of the magnetically responsive beads may cause target analyte to bind to the magnetically responsive beads. In some cases, the droplet may include unbound substances in a wash buffer. The redistributing of the magnetically responsive beads causes unbound substances to be freed from interstices of an aggregated set or subset of the magnetically responsive beads.
US09358546B1	Multi-connector hammer and protective arm The various embodiments disclosed and pictured illustrate a multi-connector hammer for comminuting various materials. The illustrative embodiments pictured and described herein are primarily for use with a rotatable hammermill assembly. The multi-connector hammer includes a connection portion having a rod hole therein, a contact portion for delivery of energy to the material to be comminuted, and a multi-connector neck portion affixing the connection portion to the contact portion. In other embodiments, a shoulder is positioned around the periphery of the rod hole for added strength. In still other embodiments, a neck reinforcement is positioned along a portion of the neck for increased strength. A weld or plurality of welds may be affixed to various surfaces of the contact portion to aide in comminuting and/or longevity of the multi-connector hammer.
US09358545B2	Gyratory crusher spider arm shield A gyratory crusher spider arm shield is configured for releasable attachment to a spider arm. The shield includes a main body having an underside foot for engaging onto an upper region of the arm. The secure attachment is provided by cooperation between an attachment element that extends radially inward from an outermost end of the shield and a mount guide provided at sidewalls of the shield that extend laterally each side of the spider arm.
US09358542B2	Magnetic tube rack A system for holding sample tubes used in immunoprecipitation and similar laboratory techniques. A rack comprises top and bottom plates spaced apart from each other and defining rows of holes to receive the sample tubes and hold the sample tubes in a pair of spaced-apart rows. A magnet holder is configured to slide between the top and bottom plates and between the two parallel rows of sample tubes such that when the magnet holder is fully inserted between the rows of sample tubes, magnets held by the magnet holder align with the sample tubes in the two parallel rows.
US09358540B1	Systems and devices for isothermal biochemical reactions and/or analysis An isothermal reaction and analysis system may include a receiver to receive sample holders, a thermal control subsystem to control a temperature of the receiver, an excitation subsystem, a detection subsystem and an analysis subsystem. Excitation sources and/or detectors are positioned to enhance data collection. Sample holders may include filters, selectively blocking and passing wavelengths or bands of electromagnetic radiation.
US09358539B2	Valves and other flow control in fluidic systems including microfluidic systems Articles and methods for controlling flow in fluidic Systems, especially in microfluidic Systems, are provided. A microfluidic System includes a configuration such that the actuation of a single valve can allow the switching of fluids from a first fluid path (e.g., a first channel section) to a second fluid path (e.g., a second channel section). This may be achieved by incorporating a valve (38) with a first channel section (24), which may have a lower hydrodynamic resistance than a second channel section (28) prior to actuation of the valve. Actuation of the valve (38) can cause only the hydrodynamic resistance of the first channel section (24) to increase, thereby redirecting fluid flow into the second channel section (28) (which now has a relatively lower hydrodynamic resistance). The valve comprises a control channel (40) for introducing a positive or reduced pressure, and is adapted to modulate fluid flow in an adjacent channel section by constricting or expanding the channel section (24).
US09358528B2	Selective ammoxidation catalysts A catalytic composition useful for the conversion of an olefin selected from the group consisting of propylene, isobutylene or mixtures thereof, to acrylonitrile, methacrylonitrile, and mixtures thereof. The catalytic composition comprises a complex of metal oxides comprising bismuth, molybdenum, iron, cerium and other promoters, wherein the ratio of bismuth to cerium ratio in the composition is greater than or equal to 0.45 and less than or equal to 1.5.
US09358521B1	Robust high temperature sulfur sorbents and methods of making the same A sulfur sorbent composition includes a support structure and a double oxide sulfur scavenger that is supported on the support structure. The support structure may be diatomaceous earth or a zeolitic-type mineral, and the sulfur scavenger a metal and/or a metal oxide and/or a combination of two or more metal and/or oxides. The sulfur sorbent composition can be used either as a stand-alone device or in conjunction with a fuel reformer to provide a sulfur-free stream.
US09358520B2	Sugar alcohol split injection conversion A method of hydrotreating liquefied biomass feedstock with diesel feedstock to produce alkanes is demonstrated that prevents damage to the reactor catalyst, reduces coke production, and converts nearly all of the polyols to alkanes. In order to mitigate the potential coking issue and to moderate the temperature of the catalyst bed while maintaining high conversion for sugar alcohol to hydrocarbon via a hydrotreating process, a diesel feedstock is fed over the reactor catalyst with multiple injections of polyol feedstock along the reactor.
US09358519B2	Plasma generating device The present invention aims to provide a plasma generation device including: a plasma generation part which generates plasma; diluent gas supply means which supplies a diluent gas for diluting the plasma generated by the plasma generation part; and a spray port through which a plasma gas resulting from the dilution of the plasma with the diluent gas is sprayed, in which the characteristics of the plasma gas are changed and controlled so as to enlarge the plasma gas and enhance the activity of the plasma gas, without controlling the power input from a power source to the plasma generation part. The plasma generation device of the present invention includes an electromagnetic wave production device which irradiates at least one of a region where the plasma is generated and a region where the plasma gas passes with an electromagnetic wave from an antenna.
US09358515B2	Compressible liquid diluent in polyolefin polymerization Embodiments of the present application provide a method for manufacturing a polyolefin and a system for implementing the method. The method comprises combining a catalyst with a diluent mixture containing a diluent and an olefin monomer in a polymerization reactor. The diluent may comprise propane, butane, or isobutane, or a combination thereof. The polymerization reactor is operated at a pressure above a critical pressure of the diluent, but below the critical temperature of the diluent.
US09358509B2	Particle size breakup apparatus having a rotor and a stator A mixer of the rotor-stator type that includes a stator having a plurality of openings and a rotor disposed on the inner side of the stator and spaced by a predetermined gap away from the stator is described, wherein the mixer that is capable of improving the shearing stress applied upon the liquid being processed and provides the higher performance is proposed. The stator includes a plurality of stators each having a different circumferential diameter, and the rotor is disposed on the inner side of the plurality of stators and spaced by the predetermined gap away from the stators so that the stators and the rotor can be brought closer to or farther away from each other in the direction in which the rotary shaft of the rotor extends.
US09358505B2	Gas sparger for an immersed membrane A gas sparger produces an intermittent flow of bubbles even if provided with a continuous gas flow. The sparger has a housing to collect a pocket of gas and a conduit to release some of the gas from the pocket when the pocket reaches a sufficient size. Optionally, a cover over an outlet from the conduit may break up or distribute the released gas. A large sparger for use with a commercial membrane module can comprise a plurality of smaller units.
US09358499B2	Modular dispensing devices for informing a user of a numeric amount of consumables and a schedule for dispensing the consumables A dispensing device is improved through the inclusion of modular components, for example, mechanical interfaces to couple to a container and a base. The modular dispensing device may also include communication systems related to the container and the base. Specifically, the modular dispensing device may receive information such as the contents of the container (e.g., quantity, identity, etc.) and a schedule for dispensing the contents. Using this information, the modular dispensing device may control the dispensing of the contents of the container.
US09358497B2	Ionic liquid solvent and gas purification method using the same An ionic liquid solvent and gas purification method using the same are provided. The ionic liquid solvent consists of a main absorbent, a regulator for the main absorbent, an auxiliary absorbent, an activator, an antioxidant and water. The ionic liquid involves a low synthetic cost, low viscosity and high absorption capacity, and can be easily regenerated and recycled. The method, compared with traditional processes, has advantages such as a greater absorption capability and lower operation cost.
US09358496B2	Adsorption bed structure and process An adsorbent bed structure and process is disclosed for use in an adsorption based gas separation process. A conventional adsorbent bed in a gas separation process is replaced with a one or more modular compact adsorbent bed units which are connected to make an adsorbent bed structure. The modular design requires lower fabrication and maintenance costs; is easier to transport; and is easier to load with adsorbent material.
US09358495B2	Method of purification by means of adsorption with regeneration using a gas containing an undesired component in the purified gas TSA method for purification by means of adsorption of a synthetic gas including hydrogen, CO and/or methane, implementing at least one adsorber having at least one adsorbent and subjected to a pressure cycle comprising at least an adsorption step, a step of producing a flow enriched with a main component and a regeneration step, characterized in that the regeneration step includes: regenerating the adsorbent using a regeneration gas including more than 95 mol of nitrogen; and scavenging the adsorbent using a scavenging gas corresponding to a fraction of the synthetic gas to be purified or a fraction of the purified synthetic gas.
US09358493B2	Apparatus and systems having an encased adsorbent contactor and swing adsorption processes related thereto Provided are encased parallel channel adsorbent contactor apparatus and systems and swing adsorption processes related thereto. Encased parallel channel adsorbent contactors are useful in swing adsorption processes. A plurality of the encased adsorbent contactors are loaded and sealed together in a swing adsorption vessel such that substantially an entire feed stream must pass through the channels of the contactors and not through stray gaseous stream paths between contactors.
US09358489B2	Air filter system, air filter element and method for exchanging an air filter element A filter (1) for filtering air, in particular an air filtering element (30), is provided for releasably fitting into a housing (10) which has a housing upper part (11) and in particular a central tube (20) fastened to the housing upper part (11), and also the housing for the filtering element (30) is provided. The filtering element has a seal (33, 34) for holding the filtering element (1) on the housing upper part (11) and the central tube (20) and for sealing the space (111) between the filtering element (30) and housing upper part (11) when the filtering element (30) is releasably fitted in the housing (10). The seal (33, 34) is connectable in a form-fitting manner to a sealing receptacle (111) of the housing upper part (11) and/or of the central tube (20).
US09358486B2	Method for characterizing fibers with shape and size used for coding Disclosed is a method of characterizing a fiber sample comprising standard fibers and identification fibers which can be used for tracking and tracing fibers through at least part of the supply chain. Each identification fiber exhibits at least one distinct feature. Each group of distinguishable identification fibers can exhibit a taggant cross-section shape, a taggant cross-section size, or combination of the same taggant cross-section shape and same taggant cross-section size. The distinct features and the number of fibers in each group of distinguishable identification fibers can represent at least one supply chain component of the fibers. The fiber sample can include a portion of an acetate tow band or a filter made from the acetate tow band, and the supply chain information can include the manufacturer of the acetate tow band and the customer of the acetate tow band.
US09358484B2	Rotating separator A separator for separating solids from a slurry has a vibrating rotating container, rotatably connected to a support. The rotating container is provided with at least a first inlet and at least a first outlet and has at least one opening. A screw press is at least partly provided inside said rotating container. The screw press is arranged through said first outlet. The screw press has at least one hole. The at least one hole and a feed screw are provided inside said rotating container in continuation of said screw press. At least one lift paddle is provided inside said rotating container. A first part of the lift paddle is arranged along an inner surface of a side wall of said rotating container. A second part of said lift paddle is in contact with a part of the feed screw. A new method for separating slurry uses a separator.
US09358483B2	Sieve cloth and method of using same This invention relates to a sieve cloth and a method of connecting the sieve cloth to a sieve apparatus having an endless sieve cloth supported by a support belt which, in operation, is structured to rotate around at least two spaced-apart turning rollers. The method includes the steps of providing at least one sieve cloth sheet having an upper side, a lower side, two side portions and a first end portion and a second end portion extending between the side portions; bringing at least a portion of the sieve cloth sheet into engagement with a portion of the support belt; positioning the sieve cloth sheet against the support belt by moving the support belt around the turning rollers; bringing at least two adjoining end portions into engagement with each other until the at least one sieve cloth sheet forms an endless sieve cloth.
US09358480B2	Water filter system A modular water filter system includes a plurality of media filter tank modules including an underdrain disposed within the filter tank module at the bottom side of the filter tank module, a controller, and a plurality of back flush valves associated with corresponding ones of the plurality of media filter tank modules, respectively.
US09358475B2	Robot A robot is disclosed. The robot can comprise a body comprising a curved base and a multi-directional center of mass shifter assembly positioned within the body. The multi-directional center of mass shifter assembly can comprise a weight, a first actuator drivingly coupled to the weight, and a second actuator drivingly coupled to the first actuator. Actuation of the first actuator can be configured to rotate the weight relative to a first axis, and actuation of the second actuator can be configured to rotate the weight relative to a second axis, which is transverse to the first axis. The robot can comprise an inertial measurement unit, a controller, and/or an eye movable relative to the body. The position of the eye can be adjusted by an eye actuation assembly.
US09358469B1	System and method for providing an inter-sport fantasy sports challenge Systems and methods are provided for an inter-sport fantasy sports challenge. According to one aspect, a set of players is provided to each user, where each player competes in one of a plurality of sports. A roster selected from the set of players is received from each user. Rosters include players selected without regard to a respective sport and a respective position, and can include players from multiple sports. In another aspect, rosters include prescribed numbers of players and positions, and the respective rosters as between at least two users include players from multiple sports. Performance data for each player is received. A player point value for each player is calculated and converted into normalized values using one or more piecewise-defined non-linear functions for each sport. A roster score is calculated by aggregating normalized values for each player on the roster, and users are ranked based on roster scores.
US09358467B2	Game load management Technologies are generally described for a load balancing scheme. In some examples, a method performed under control of a load balancing system may include associating a candidate client device with a lower-resolution client device; measuring resource usage of a game server; determining that the measured resource usage has exceeded a predetermined threshold; and transmitting, to the candidate client device and/or the associated lower-resolution client device, a message that instructs a user of the candidate client device to perform a predetermined task using the associated lower-resolution client device.
US09358465B2	Video game processing apparatus and video game processing program A display device is caused to selectably display panels in a predetermined area of a display screen in a predetermined arrangement pattern. When selection of at least one displayed panel is received from a user of a video game processing apparatus, the selected panel and the number of panels are specified. It is determined whether the number of panels satisfies a skill activating condition of a player character or not by referring to skill related information. The skill related information is stored in a skill related information memory. The skill related information contains player character information indicating the player character, skill information indicating a skill, and the skill activating condition indicating an activating condition of the skill. In a case where it is determined that the number of panels satisfies the skill activating condition, action processing for the skill by the player character is carried out.
US09358462B2	Systems and methods for roster management in fantasy sports contest applications The fantasy sports contest application of the present invention alerts the user of necessary roster changes before an upcoming fantasy sports competition. The fantasy sports contest application may evaluate the user's team roster before an upcoming fantasy sports competition to ensure that all roster spots on the team roster are filled with athletes available for real-life competitions. The fantasy sports contest application may also identify roster changes and roster transactions that may be beneficial to a user's fantasy sports contest team roster.
US09358459B2	Information processing device, display device, and information processing system Provided is an information processing device including a communication unit for transmitting content data to a plurality of display devices connected, a request check unit for causing other display devices to display a check screen for an arbitrary request upon reception of the request from one of the plurality of display devices, and determining whether to permit the request in accordance with a user operation in the other display devices which display the check screen, and a control unit for performing a response control for the request when the request check unit permits the request.
US09358458B2	System and method for providing optional commitments to players within a videogame Optional commitments may be provided to players within a videogame. The optional commitments commit players to perform and/or abstain from certain actions within the videogame. The players may be rewarded for accepting commitments. The players may be penalized for failing to fulfill commitments. This model for rewarding optional behaviors may provide an alternative for incenting actions within a videogame to conventional models in which players are rewarded and/or penalized only after attempting an activity or activities.
US09358453B2	Trajectory-based 3-D games of chance for video gaming machines Trajectory-based games of chance are described that are, in certain embodiments, implemented on a video gaming machine. In one embodiment of a trajectory-based game of chance, a trajectory of a game object is generated in a 3-D gaming environment. A wager is made on an aspect of the game object's trajectory in the gaming environment such as a termination location for the trajectory of the game object. The aspect of the game object's trajectory occurs according to a known probability. Hence, an award for the trajectory-based game of chance is proportional to the probability of the aspect of the game object's trajectory occurring.
US09358450B2	Interactive education systems and methods An interactive education system includes a database storing a common question database and a plurality of user-specific question inventories, a memory storing computer instructions, and a processor configured to execute the computer instructions to perform operations including presenting a game environment between a first user and a second user where the first and second users can throw questions from their respective question inventories or common question database at each other with or without offensive power-ups, and answer the questions thrown by each other with or without defensive power-ups; rewarding the first and second users with credits and points when the first and second users answer the questions correctly; determining which one of the first and second users wins the game based on the respective total number of points achieved by the first and second users; and enabling the first and second users to purchase additional offensive or defensive power-ups with their respective credits.
US09358448B1	Pool game A playing surface for a pool or billiards style game that includes variable margins. The playing surface includes a first end and second end. The second end includes a scoring hole. A first ball is struck by a second ball in order to roll the first ball along the playing surface, in between the variable margins, in order to sink the first ball in the scoring hole.
US09358443B2	Contact sensing device and system A contact sensing device and system includes all the required sensing components, including a capacitive sensor and an elongate portion configured to generate at least one sense signal upon contacting at least one substance. All necessary sensing components are contained in a handheld device and do not require conductive contact surfaces to detect contact with a target area. The sport of fencing benefits in particular from this contact sensing device and system.
US09358440B1	Ball tee The invention is directed to a ball tee for supporting a ball. The ball tee includes a base, a telescoping post, a clamp, and a ball holder. The base presents a plurality of laterally extending arms and an opening. The telescoping post includes a static segment and a first telescoping segment. The clamp is configured to secure the telescoping post to the base. The clamp is disposed at least partially within said opening of the base and at least partially around said static segment of the telescoping post. The ball holder is disposed atop the telescoping post configured to support a ball. The ball holder includes a rolled flexible sheet and an outer holder (and in some embodiments an inner holder). The rolled flexible sheet presents a generally conical shape oriented with a large end upward for supporting the ball, and is at least partially disposed within the outer holder.
US09358438B2	Golf tee bag device A golf tee bag device includes a main body constructed from a single piece of fabric material having a front surface, a back surface and a plurality of edges. The device includes a main pocket area, an elongated horizontal tee pocket, a pair of vertical tee pockets, a marker engagement unit, and a pair of connectors for engaging the back surface of the main body in order to attach the device to a belt.
US09358435B2	Vibration modes of faces for golf club heads or other ball striking devices A ball striking device, such as a golf club head, includes a face having a ball striking surface configured for striking a ball and a body connected to the face and extending rearward from the face. The head further has an indicator associated therewith, the indicator identifying a golf ball based on a vibration mode of the golf ball, such that the club head is configured to be used to strike the golf ball on the ball striking surface. In one embodiment, the face and the identified golf ball(s) may have the same or substantially the same vibration mode at one or more different swing speeds. The indicator may be positioned on the body or elsewhere on the club head, or may be alternately be positioned on a shaft connected to the head or separately from the ball striking device, such as in a written manual associated with the head.
US09358430B2	High loft, low center-of-gravity golf club heads A golf club head includes a body defining an interior cavity. The body includes a sole positioned at a bottom portion of the golf club head, a crown positioned at a top portion, and a skirt positioned around a periphery between the sole and crown. The body has a forward portion and a rearward portion. The club head includes a face positioned at the forward portion of the body. Embodiments include golf club heads having high static loft angles, low centers of gravity, or both high static loft angles and low centers of gravity.
US09358427B2	Golf ball having windings containing a highly neutralized acid polymer A golf ball having windings of strands made of a highly neutralized acid polymer is disclosed. The presence of a high acid content may cause the highly neutralized acid polymer to exhibit certain material properties. For example, the high acid content may cause an increased hardness and an increased flexural modulus. A high hardness may result in a golf ball exhibiting increased distance off the tee, or increased COR, among other desirable play characteristics. The hardness of the golf ball corresponds with the feel of the golf ball. The construction of a golf ball including wound strands may provide a soft feel. Thus, providing windings of bands made from a highly neutralized acid polymer may provide a golf ball with an increased distance off the tee and a soft feel.
US09358422B2	Treadmill system with rotatable exercise platform A treadmill system, comprises: a sidewall member comprising a rim member extending around at least a portion of an upper edge of the sidewall member and a hatch member that provides access to an area enclosed by the sidewall member; a base member; a support pole member; a handle member coupled to the support pole member that extends from an upper portion of the support pole member and that is removably coupled to the rim member of the sidewall member; a rotatable platform member comprising an exercise surface, a peripheral sidewall and an interior sidewall, configured to rotate around the support pole member; and a particulate substrate disposed on the exercise surface. The exercise surface of the rotatable platform member is configured to evenly distribute the particulate substrate between the peripheral sidewall and the interior sidewall.
US09358420B2	Portable exercise device providing constant force output The exemplary embodiments herein provide an exercise device having a frame, comprising a first and a second arm, a first end of each arm meeting in fixed angular relationship at a vertex and a second end of each arm extending away from the vertex; a lever arm, having a first and a second end, the first end constrained to rotate about a pin located near the vertex; and a resistance arrangement, configured to convert rotation by a user of a first rotational assembly about an axis on the second end of the first arm into rotation of a second rotational assembly about an axis on the second end of the lever arm, which is converted into rotation of a third rotational assembly about an axis on the second end of the second arm, with the rotation of the third rotational assembly being resisted by a resistive element, the resistance arrangement providing a substantially constant resistance against the rotation of the first rotational assembly by the user over the entire range of the rotation.
US09358419B1	Physical fitness device An exercise utilizes roller ball transfers for many embodiments, and those without, as well as an ability to add and remove weights thereto from above and possibly rotate in order to perform various exercises.
US09358418B2	Exercise bicycle frame with bicycle seat and handlebar adjustment assemblies An indoor cycling device including a unique frame arrangement with fore and aft adjustable seat and handlebar assemblies. The assemblies support a seat and handlebars for fore and aft movement. The assemblies may include a receiver with an elongate aperture with a slider positioned therein. The slider defines a first channel receiving a moveable member. A handle is operably coupled with the member to move the member within the channel in a first direction or a second direction such that a frictionally coupling is caused between the slider and the receiver when the slider is moved in the first direction and releases the coupling when the slider is moved in the second direction.
US09358415B2	Spinal therapy device The invention provides a spinal therapy device that can be used by an individual to self-apply overpressure, spinal decompression, spinal joint mobilization or a combination thereof to the spine, as well as methods for using a spinal therapy device to self apply overpressure, spinal decompression, spinal joint mobilization or a combination thereof.
US09358410B2	Liquid drainage installation for a rotorcraft engine compartment An installation for draining liquid away from an aircraft engine compartment. Said drainage installation comprises a collector for collecting said liquid and provided with an opening putting the collector into fluid flow communication with an upstream inlet of a drainage line that is open to the outside via a downstream outlet. The drainage line includes an obstacle to the flow of the liquid that allows the liquid to flow towards the downstream outlet of the drainage line when there is a predefined quantity of liquid retained by said obstacle. The opening of the collector is provided with a firebreak grille arranged as a cap extending in elevation over the opening and including a plurality of orifices distributed at the periphery of the firebreak grille going from its base towards its top.
US09358407B2	Ultrasonic actuated unit and ultrasonic treatment device An ultrasonic actuated unit includes an intermediary portion continuous with an ultrasonic transmitting portion or connected to the ultrasonic transmitting portion at a node position of a longitudinal vibration, and a noncontact vibrating portion extending in directions parallel to a longitudinal axis without contacting the ultrasonic transmitting portion, an imprecise vibration being transmitted to the noncontact vibrating portion from the ultrasonic transmitting portion via the intermediary portion. The ultrasonic actuated unit includes a vibration absorbing portion absorbing the imprecise vibration transmitted to the noncontact vibrating portion.
US09358404B2	Effective volume filling with templates A method and a dose planning module for planning a treatment session of a patient by means of a radiation therapy system includes a radiation therapy unit having a fixed radiation focus point. The method includes obtaining a target volume of a region of a patient to be treated during a treatment of a patient in a radiation therapy unit, the target volume being modeled as a three-dimensional voxel representation; selecting an isodose level for the planned treatment; determining shots to be delivered during the treatment, each shot being modeled by a spatial dose volume distribution of radiation represented by a three-dimensional voxel representation, the shape of the spatial distribution depending on the specific collimator setting and the selected isodose level; and selecting shots in a decreasing volume order for the dose planning.
US09358401B2	Intravascular catheter to deliver unfocused energy to nerves surrounding a blood vessel In some examples, nerves surrounding arteries or leading to organs are targeted with energy sources to correct or modulate physiologic processes. In some examples, different types of energy sources are utilized singly or combined with one another. In some examples, bioactive agents or devices activated by the energy sources are delivered to the region of interest and the energy is enhanced by such agents or the agents are enhanced by the energy sources.
US09358395B2	Neural modulation devices and methods A system for designing a therapy or for treating a gastrointestinal disorder or a condition associated with excess weight in a subject comprising at least one electrode configured to be implanted within a body of the patient and placed at a vagus nerve, the electrode also configured to apply therapy to the vagus nerve upon application of a therapy cycle to the electrode; an implantable neuroregulator for placement in the body of the patient beneath the skin layer, the implantable neuroregulator being configured to generate a therapy cycle, wherein the therapy cycle comprises an on time during which an electrical signal is delivered, the electrical signal comprising: a) a set of pulses applied at a first selected frequency of about 150-10,000 Hz, wherein each pulse of the set of pulses has a pulse width of at least 0.01 milliseconds and less than the period of the first selected frequency.
US09358391B2	Neurostimulation system having increased flexibility for creating complex pulse trains A neuromodulation system comprises electrical terminals configured for being respectively coupled to electrodes. The system further comprises modulation output circuitry configured for respectively outputting individual electrical pulse trains in timing channels to the electrical terminals, wherein each of the pulse trains has a modulation pulse, and at least one of the pulse trains has a charge recovery pulse associated with the modulation pulse of the respective pulse train. The neuromodulation system further comprises control circuitry configured for controlling the modulation output circuitry in a manner that sequentially outputs the modulation pulses of the respective pulse trains to a common set of the electrical terminals without an intervening charge recovery pulse, and outputting the charge recovery pulse(s) to the common set of the electrical terminals subsequent to the sequential modulation pulses, thereby creating a combined electrical pulse train at the common set of electrical terminals.
US09358387B2	Leadless pacemaker Leadless pacemaker, including a hermetic housing, a pacing electrode on a distal portion of the housing, an electronics package in the housing and configured to generate/deliver pacing pulses to the electrode, and a fixation mechanism on the housing distal portion. The fixation mechanism includes at least one deformable hook-shaped thin fixation wire having an attachment portion fixedly attached at the distal portion of the housing and a free end portion which is angled or bent with respect to the attachment portion such that it extends essentially in conformity, but with a small spacing, to a neighbored surface portion of the housing such that the free end portion engages with heart tissue onto which the distal portion is pressed upon rotation of the pacemaker in the direction in which the free end portion extends from the attachment portion, and disengages upon rotation of the pacemaker in the opposite direction.
US09358386B2	Medical device for insertion into the human or animal body A medical device according to the invention for insertion into a human and/or animal body comprises an elongated tubular lead probe including a proximal end portion and a distal end portion, an opening which opens into a lumen extending in the axial direction being formed on the proximal end of the lead probe, and the distal end of the lead probe being closed. The medical device further comprises an elongated core which is constructed in such a manner that it can be inserted into the lead probe and removed again via the lumen, and the core is made from non-metallic filaments and a matrix material.
US09358384B2	Implantable lead with flexible paddle electrode array A neurostimulation system is disclosed herein. The neurostimulation system includes an implantable pulse generator and an implantable therapy lead configured to be electrically coupled to the implantable pulse generator. The implantable therapy lead includes a flexible paddle electrode array with flexible electrodes. Each flexible electrode has a segmented configuration having first and second electrode segments and a flexible bridge or living hinge joining together the first and second electrode segments.
US09358382B2	Method for reducing hypertension using an implantable electroacupuncture device Disclosed is an implantable, coin-sized, self-contained, leadless electroacupuncture (EA) device having at least two electrode contacts attached to the surface of its housing. The electrodes include a central cathode electrode on a bottom side of the housing, and a circumferential anode electrode that surrounds the cathode electrode. In one embodiment, the anode annular electrode is a ring electrode placed around the perimeter edge of the coin-shaped housing. The EA device is adapted to be implanted through a very small incision, e.g., less than about 2-3 cm in length, directly adjacent to a selected acupuncture site known to moderate or affect a hypertension condition of a patient. Appropriate power management circuitry within the device allows a primary battery having a relatively high internal impedance to be used without causing unacceptable dips in battery voltage when the instantaneous battery current surges. Stimulation pulses are generated during a stimulation session that has a duration of T3 minutes and which is applied every T4 minutes. The duty cycle, or ratio of T3 to T4, is very low, not greater than 0.05. This low duty cycle, along with careful power management, allows the EA device to perform its intended function for several years.
US09358380B2	Methods and systems combining AC electroosmosis with dielectrophoresis to enhance delivery of active agents into intraoral structures Methods and systems for delivering an active agent into an intraoral structure are disclosed. One embodiment of a method for implementing the subject matter described herein includes generating an electrical signal that includes a first frequency, a second frequency, and a third frequency, and supplying the electrical signal to an embedded circuit contained in an intraoral delivery tray, wherein the embedded circuit includes at least one electrode that includes projections positioned proximally to a surface of an intraoral structure. The method further includes providing the first frequency and the second frequency to the at least one electrode to generate an electrical field that electrically motivates the active agent suspended in a fluid medium contained in the intraoral delivery tray toward the intraoral structure via dielectrophoresis and providing the third frequency to the at least one electrode to increase the uptake of the active agent into intraoral structure via alternating current electroosmosis.
US09358377B2	Brachytherapy devices and related methods and computer program products A low-dose-rate (LDR) brachytherapy device having a spatiotemporal radiation profile includes an elongated body having a radioactive material in a spatial pattern to provide a spatial radiation profile with a radiation intensity that varies along a length of the elongated body. The radioactive material includes at least first and second radioisotopes having at least first and second respective decay profiles that together provide a temporal radiation profile that is different from the first and second decay profiles. The spatial radiation profile and the temporal radiation profile form a net spatiotemporal radiation profile configured to provide a radiotherapy plan for a patient.
US09358371B2	Intra-atrial implants made of non-braided material Several unique intra-cardiac pressure devices, placement catheters, methods of placement and methods of treating heart failure are presented. The intra-cardiac pressure devices presented allow sufficient flow from the left atrium to the right atrium to enable the relief of elevated left atrial pressure and resulting patient symptoms. The intra-cardiac pressure devices are made of a non-braided material.
US09358363B2	Multiple lumen assembly for use in endoscopes or other medical devices An endoscope or other medical device includes a number of lumens positioned in an outer shaft. The lumens are formed as a multiple lumen assembly. In one embodiment, individual lumens are connected to each other with a sheet or webbing material. The lumen assembly is rolled or folded along its length for incorporation into the outer shaft of the endoscope or the medical device. The sheet or webbing material may be notched or perforated to facilitate folding the lumen assembly and/or separating the individual lumens from the lumen assembly.
US09358362B2	Strip lined catheters and methods for constructing and processing strip lined catheters Apparatus and methods are provided for making one or more tubular components of medical catheters or other tubular bodies using a strip of polymer material including a length, a width, and a first surface including a lubricious or other coating or surface modification. The strip is directed adjacent an elongate mandrel, such as beading, such that the length of the strip extends along the mandrel and the coating is disposed towards the mandrel. The strip is rolled at least partially around the mandrel such that the coating or surface modification is disposed inwardly towards the mandrel, and one or more strip-constrainment members are wrapped around the rolled strip. The directing, rolling, and wrapping steps may be substantially continuous to create one or more strip-mandrel-constrainment member subassemblies.
US09358360B2	Illumination apparatus In an illumination apparatus, a control unit starts lighting of a light source at a first time before a wake-up set time and executes a first control pattern to increase a dimming ratio of the light source from the first time to a second time determined based on the wake-up set time and a second control pattern to further increase the dimming ratio of the light source from the second time to a third time determined based on the wake-up set time. When a change curve of the dimming ratio in the first control pattern and the second control pattern is applied to a function represented by the equation: Y(t)=d+(a−d)/(1+(t/c)b), the time c becomes closer to the second time than the first time in the first control pattern, and becomes closer to the second time than the third time in the second control pattern.
US09358357B2	Tracheostomy tube collar and method A collar for a tracheostomy tube, a method of securing a tracheostomy tube to the neck of a patient, and a medical device including a collar for the tracheostomy tube. In one exemplary embodiment, the collar includes a securing portion, a protection portion, and an attachment portion. The securing portion secures the tracheostomy tube to the neck of the patient. The protection portion extends from the securing portion and covers a portion of a flange of the tracheostomy tube. The protection portion is also positioned between the tracheostomy tube flange and the neck skin of the patient when the securing portion is attached to the tracheostomy tube. The attachment portion attaches the securing portion to the tracheostomy tube.
US09358354B2	Apparatus and method for monitoring an airway device such as an endotracheal tube An airway device (14), that is used to maintain a clear airway in a patient, e.g. for artificial ventilation during surgery, comprises an inflatable cuff (26), which is inflated when in position in a patient's airway (24). The inflated cuff (26) provides a seal to maintain the device (14) in position in a patient's airway (24), and to prevent leakage of infected oropharangeal secretions into the patient's lungs. A method and apparatus (10) for monitoring and controlling the pressure in the inflatable cuff (26) is described, which, in one embodiment, controls the pressure about a setpoint pressure, whilst preventing loss of sealing pressure during a patient's respiratory cycle. In other embodiments, the method and apparatus monitors for: leaks in the pressure system of the device (14) that includes the cuff (26); blockage in the pressure system, and/or malpositioning of the airway device (14) during use.
US09358352B2	Dry powder drug delivery system and methods A pulmonary drug delivery system is disclosed, including a breath-powered, dry powder inhaler, and a cartridge for delivering a dry powder formulation. The inhaler and cartridge can be provided with a drug delivery formulation comprising, for example, a diketopiperazine and an active ingredient, including, small organic molecules, peptides and proteins, including, insulin and glucagon-like peptide 1 for the treatment of disease and disorders, for example, endocrine disease such as diabetes and/or obesity.
US09358349B2	Guiding assembly for intradermal injection Described is a guiding assembly for an injection device comprising a mount adapted to receive an injection device, a first gripping member rotatably coupled to the mount, a first lateral stop member coupled to the first gripping member, and a spring biasing the first gripping member in a first angular position.
US09358347B2	Safety syringe having an automatic activated retractable needle A syringe assembly for fluid collection includes a housing having a sidewall defining a hollow bore therein, and an elongate plunger with the distal end of the plunger forming a chamber within the hollow bore for containing a fluid therein. The plunger is adapted for slideable movement within the hollow bore between an initial position and a retracted position. The assembly includes a hub disposed at least partially within the hollow bore and at least partially supporting a cannula therewith. The hub is adapted to automatically transition from an initial position in which at least a portion of the cannula is disposed external to the housing, to a retracted position in which the cannula is fully shielded by the housing, upon transition of the elongate plunger from the initial position to the retracted position.
US09358344B2	Injection device with plural dosage setting windows An injection device (100) including a body (108, 332) for containing and dispensing a medicament, the body (108, 332) having a plurality of dosage indicator windows (120, 124; 336, 340, 344) for indicating a desired dosage of medicament, and a dose set sleeve (192, 326, 352) rotatably connected with the body (108, 332) for setting the desired dosage, the dose set sleeve (192, 326, 352) having a plurality of dosage numbers (196, 348) disposed thereon. Upon rotating the dose set sleeve (192, 326, 352) to set the desired dosage, the dosage numbers (196, 348) are consecutively visible through alternating ones of the plurality of dosage indicator windows (120, 124; 336, 340, 344).
US09358343B2	Medicament delivery device A medicament delivery device includes a housing having proximal and distal ends; a hollow piston plunger within the housing; a telescopic dose drum concentric between the housing and the plunger; and a plunger driver to drive the plunger toward the proximal end having a hollow drive drum sleeve movable within and coupleable to the piston plunger and fixed to the dose drum; an actuator operably connected to the drive drum sleeve; and a stop body for inhibiting rotation of the dose drum and drive drum sleeve when a set dose equals a remaining dose in a medicament container. The drive drum sleeve and piston plunger are operatively coupled such that axial movement of the actuator toward the proximal end forces the drive drum sleeve and piston plunger to couple, whereby the piston plunger and dose drum are displaced toward the proximal end for delivering the set dose.
US09358335B2	Puncture device A puncture device is provided that does not allow an outer needle to collapse or rise at the time of puncture and exhibits small puncture resistance.A puncture device 1 includes: a hollow outer needle 2; an outer needle hub 3 provided at a proximal end portion of the outer needle 2; a hollow inner needle 4 inserted into the outer needle 2 for use; and an inner needle hub 5 provided at a proximal end portion of the inner needle 4. The inner needle 4 includes, from the distal side, a sharp needlepoint 41, a small diameter portion 42 having an almost uniform outer diameter; an intermediate portion 43 formed as a tapered portion which is progressively increased in outer diameter as it goes toward the proximal end; and a larger diameter portion 44 having inner and outer diameters larger than inner and outer diameters, respectively, of the small diameter portion 42. If the puncture device 1 is assembled, the needlepoint 41 is most projected from the distal opening 24 of the outer needle 2 and the proximal end of the small diameter portion 42 and the distal end of the large diameter portion 4 are located inside the outer needle 2. The inner diameter of the outer needle 2 at a portion L1 where the outer needle 2 covers the small diameter portion 42 of the inner needle 4 is smaller than the large diameter portion 44 of the inner needle 4.
US09358334B2	Integrated glucose monitor and insulin injection pen with automatic emergency notification An insulin injection pen and blood glucose monitoring device is integrated into a single unit that fits in a user's clothing pocket or handbag. The device includes a blood glucose monitoring system for detecting the user's blood glucose level, an insulin injection mechanism, and a microprocessor that calculates an insulin dosage appropriate to the detected blood glucose level of a particular user and sets the insulin injection mechanism to administer the calculated insulin dosage. The device automatically informs a remote emergency service provider if the microprocessor determines that the detected blood glucose level presents a potential danger to the user. The microprocessor also calculates treatment regimens based on the detected blood glucose level and displays the treatment regimens on an LCD display. The device can include a GPS receiver that detects the location of the device, which is transmitted by the device to the remote emergency service.
US09358333B2	Systems and methods of administering fluids at high flow rates A medical connector for delivering a liquid at a high flow rate to a patient. The connector includes a gas inlet passage that is configured for connecting to a source of pressurized gas, a spike configured for piercing a stopper of a container, and a liquid outlet passage in fluid communication with the spike. The liquid outlet passage is configured for connecting to tubing through which the liquid in the container can be administered to a patient. The spike has a shield having a first closed end and a second open end such that the first closed end is breakable by the spike when the spike is inserted through the stopper of the container, and the second open end has an annular elastomeric member that attaches to the spike via compressive pressure applied by the annular elastomeric member.
US09358332B2	Pump cassette and methods for use in medical treatment system using a plurality of fluid lines A fluid handling cassette, such as that useable with an automated peritoneal dialysis (APD) cycler device or other infusion apparatus, may include a generally planar body having at least one pump chamber formed as a depression in a first side of the body and a plurality of flowpaths for a fluid that includes a channel. A patient line port may be arranged for connection to a patient line and be in fluid communication with the at least one pump chamber via at least a first one of said flowpaths, and an optional membrane may be attached to the first side of the body over the at least one pump chamber. In one embodiment, the membrane may have a pump chamber portion with an unstressed shape that generally conforms to the depression of the at least one pump chamber in the body and is arranged to be movable for movement of the fluid in a useable space of the at least one pump chamber. One or more spacers may be provided in the at least one pump chamber to prevent the membrane from contacting an inner wall of the at least one pump chamber. The patient line, a drain line, and/or a heater bag line may be positioned to be separately occludable in relation to one or more solution lines that are connectable to the cassette.
US09358330B2	Pump device having a detection device The invention relates to a pump device having a pump (8) and an energy supply device (5, 18), wherein the pump has a conveying element (9, 11) which conveys a fluid by means of supplied energy, wherein the pump has a transport state and an operating state, and wherein at least one first element (9, 9a, 10, 10′, 11) of the pump has a different shape and/or size in the transport state than in the operating state. The operating safety of such a pump device is increased by a detection device (12, 20, 21, 22, 23, 24, 25, 27, 28, 29) which detects whether at least the first element is in the operating state with respect to shape and/or size by means of a sensor.
US09358325B2	Stents with radiopaque markers Various embodiments of stents with radiopaque markers arranged in patterns are described herein.
US09358320B2	Multi-layer tissue patches Embodiments of the present invention encompass anti-adhesion wound dressings including patches made from amnion tissue obtained from human birth tissue. Exemplary amnion patches can be fabricated by folding a section of amnion over on itself with the epithelial layer on the outside of the folded patch and the fibroblast layer on the inside of the folded patch. Optionally, individual amnion tissue pieces can be sandwiched together to provide a multi-layer patch. Sufficient pressure is applied to the layered amnion to cause adherence between opposing faces of the fibroblast layers. The pressed fibroblast layers provide mechanical strength to hold the amnion patch together with the epithelial layers on the outsides of the amnion patch.
US09358317B2	Acidic processes to prepare antimicrobial contact lenses This invention relates to antimicrobial lenses containing metals and methods for their production.
US09358314B2	Antimicrobial peracid compositions with selected catalase enzymes and methods of use in aseptic packaging The present invention relates to specially selected catalase enzymes and their use in reducing hydrogen peroxide in applications, and particularly in aseptic packaging applications.
US09358310B2	EGCG stabilized gold nanoparticles and method for making same The invention provides stabilized, biocompatible gold nanoparticles that are stabilized with material from epigallocatechin Gallate (EGCg), which is a polyphenols- or flavonoids-rich plant material that can be obtained from green tea. The EGCg is an antioxidant reducing agent derived from green tea. The gold nanoparticles of the invention can be radioactive or non radioactive and are formed via a simple room temperature fabrication method. In preferred embodiment method of making, an aqueous solution containing gold salts is provided. The aqueous solution is mixed with EGCg in a buffer, such as deionized water. The gold salts react to form biocompatible gold nanoparticles that are stabilized with a coating of EGCg. The thermodynamically feasible redox couple of AuCl4-/EGCg leading to the reduction of AuCl4- by EGCg to form gold nanoparticles. In another embodiment, pre-cooled gold salt and EGCg solutions form multi-layered EGCg coated particles.
US09358309B2	Radioimunoconjugates and uses thereof The present invention relates to a radioimmunoconjugate that binds human CD37. Pharmaceutical compositions and uses thereof for the treatment of cancer and in particular B cell malignancies are aspects of the present invention.
US09358307B2	Targeting of innate immune response to tumor site The invention provides microparticles or nanoparticles for treatment of tumors comprising: (i) a targeting agent to the tumor or the tumor environment; and (ii) at least one inducer that stimulates a desired immune response in the tumor environment, leading to tumor apoptosis, wherein components (i) and (ii) are non-covalently or covalently attached to the surface of said microparticles or nanoparticles. The targeting agent is an agent that recognizes and binds to an antigen, a receptor or other molecules found on the surface of tumor cells or in the tumor environment and are preferably antibodies.
US09358306B2	Photosensitizing antibody-fluorophore conjugates The present disclosure relates to compositions and methods of killing cells. In particular examples, the method includes contacting a cell having a cell surface protein with a therapeutically effective amount of an antibody-IR700 molecule, wherein the antibody specifically binds to the cell surface protein, such as a tumor-specific antigen on the surface of a tumor cell. The cell is subsequently irradiated, such as at a wavelength of 660 to 740 nm at a dose of at least 1 J cm−2. The cell is also contacted with one or more therapeutic agents (such as an anti-cancer agent), for example about 0 to 8 hours after irradiating the cell, thereby killing the cell. Also provided are methods of imaging cell killing in real time, using fluorescence lifetime imaging. Also provided are wearable devices that include an article of clothing, jewelry, or covering; and an NIR LED incorporated into the article, which can be used with the disclosed methods.
US09358304B1	Methods of making DLL3 antibody drug conjugates Novel modulatators, including antibodies and derivatives thereof, and methods of using such modulators to treat proliferative disorders are provided.
US09358301B2	Reverse thermal gels and uses therefor Biodegradable triblock copolymer compositions are provided which are useful in tissue engineering and drug delivery. The copolymers are reverse thermal gels in that when heated from a lower temperature to a higher temperature, they gel. These gels are useful in drug delivery when complexed with an active agent. For example the compositions can be used for intraocular injection of active agents, such as anti-angiogenic agents for treatment of a maculopathy or retinitis.
US09358298B2	17-hydroxyprogesterone ester containing oral compositions and related methods The present invention provides for bioavailable oral dosage forms containing esters of 17-hydroxyprogesterone as well as related methods. The oral dosage forms can be formulated for pregnancy support and can include a therapeutically effective amount of an ester of 17-hydroxyprogesterone and a pharmaceutically acceptable carrier. In another embodiment, a pharmaceutically acceptable oral dosage form for pregnancy support is provided. The pharmaceutically acceptable oral dosage can include a therapeutically effective amount of an ester of 17-hydroxyprogesterone and a pharmaceutically acceptable carrier. The oral dosage form can, when measured using a USP Type-II dissolution apparatus in 900 mL of deionized water with 0.5 (w/v) of sodium lauryl sulfate at 50 RPM at 37° C., release at least 20 wt % of the dose of the ester of 17-hydroxyprogesterone after 60 minutes, or in the alternative release at least 20 wt % more after 60 minutes than an equivalently dosed oral dosage form without the carrier.
US09358297B2	Posaconazole intravenous solution formulations stabilized by substituted β-cyclodextrin The present invention relates to aqueous solutions useful as pharmaceutical compositions of posaconazole for intravenous administration. These compositions include a solubilizing agent, such as a modified β-cyclodextrin in an acidified solution, which can also include a chelating agent such as disodium edetate (EDTA). In clinical trials, a 200 mg posaconazole dose of the selected composition was found to achieve acceptable pharmacokinetic properties.
US09358296B2	Transmucosal drug delivery system Disclosed are preparations and formulations of high thermodynamic activity lipophilic associations (LA), in which there is pairing between an ionizable pharmaceutical agent and a lipophilic species having ionic characteristics opposite to that of the pharmaceutical agent. Such lipophilic associations manifest high thermodynamic activity, as evidenced by their being predominantly in a liquid phase at room temperature or solvated in a lower-than-water dielectric solvent. Further the pharmaceutical agent being solubilized means that dissolution is not rate limiting to transmucosal absorption. This LA or LA-solvate is formulated into a low dielectric dosage form, from whence, upon the dosage form's hydration, the pharmaceutical agent is driven through the mucosal tissue and into systemic circulation. The invention therefore provides an enhanced transmucosal drug delivery system for ionizable pharmaceutical agents at or near physiological pH.
US09358291B2	Treatment utilizing hydrophobic weak bases chemotherapeutic agents and illumination Hydrophobic weak base compounds such as hydrophobic weak base chemotherapeutic agents (which are not an anthracycline) for use in the treatment of medical conditions such as proliferative disease or disorder in a subject, in combination with illumination of a region in a body of the subject which is characterized by the presence of proliferating cells, are disclosed. The hydrophobic weak base compound and a wavelength of illumination are selected such that the hydrophobic weak base compound acts as a therapeutically effective photosensitizer when exposed to the illumination.
US09358289B2	Methods for treating cancer using anti-PD-1 antibodies in combination with anti-CTLA-4 antibodies The present invention provides isolated monoclonal antibodies, particularly human monoclonal antibodies, that specifically bind to PD-1 with high affinity. Nucleic acid molecules encoding the antibodies of the invention, expression vectors, host cells and methods for expressing the antibodies of the invention are also provided. Immunoconjugates, bispecific molecules and pharmaceutical compositions comprising the antibodies of the invention are also provided. The invention also provides methods for detecting PD-1, as well as methods for treating various diseases, including cancer and infectious diseases, using anti-PD-1 antibodies. The present invention further provides methods for using a combination immunotherapy, such as the combination of anti-CTLA-4 and anti-PD-1 antibodies, to treat hyperproliferative disease, such as cancer. The invention also provides methods for altering adverse events related to treatment with such antibodies individually.
US09358287B2	Method of treating stress hyperglycemia with human antibodies to the glucagon receptor The present invention provides antibodies that bind to the human glucagon receptor, designated GCGR and methods of using same. According to certain embodiments of the invention, the antibodies are fully human antibodies that bind to human GCGR. The antibodies of the invention are useful for lowering blood glucose levels and blood ketone levels and are also useful for the treatment of diseases and disorders associated with one or more GCGR biological activities, including the treatment of diabetes, diabetic ketoacidosis, long-term complications associated with diabetes, or other metabolic disorders characterized in part by elevated blood glucose levels, including stress hyperglycemia.
US09358286B2	Methods and means for the production of IG-like molecules The invention provides means and methods for producing one or more Ig-like molecules in a single host cell. Novel CH3 mutations enabling the production of monospecific and/or bispecific Ig-like molecules of interest are also provided.
US09358285B2	Granulysin in immunotherapy Methods of stimulating or enhancing an immune response in a host are disclosed. The methods include contacting a monocyte with 15 kD granulysin thereby producing a monocyte-derived dendritic cell. In one example, the method further includes contacting the monocyte or monocyte-derived dendritic cell with a target antigen, such as a tumor antigen or an autoimmune antigen. In another embodiment, the method includes contacting the monocyte with an additional agent that enhances maturation of dendritic cells or induces immunological tolerance. The methods are of use in vivo, in vitro and ex vivo. In another aspect, the disclosure relates to compositions and methods for the treatment of tumors.
US09358283B2	Diatom-based vaccines This invention provides diatom-based vaccines.
US09358282B2	Re-directed immunotherapy The invention provides an agent for preventing or treating a condition characterized by the presence of unwanted cells, the agent comprising: (i) a targeting moiety that is capable of targeting to the unwanted cells; and (ii) a T cell antigen, wherein the T cell antigen can be released from the targeting moiety by selective cleavage of a cleavage site in the agent in the vicinity of the unwanted cells.

1 2 3 4 5 6 7 8 9 10