| Document | Document Title |
|---|---|
| US11591903B2 |
Systems and methods for imaging a proppant in a hydraulically-fractured oil reservoir
A method for determining a location of a proppant in a subterranean formation includes obtaining a first set of data in a wellbore using a downhole tool. The proppant is pumped into the wellbore after the first set of data is obtained. The proppant is pumped while or after the subterranean formation is fractured. A second set of data is obtained in the wellbore using the downhole tool after the proppant is pumped into the wellbore. The first set of data and the second set of data include a gravitational field measurement. The first and second sets of data are compared, and in response to the comparison, the location of the proppant in the subterranean formation is determined. |
| US11591900B2 |
Method to predict overpressure uncertainty from normal compaction trendline uncertainty
A method for predicting a pressure window for drilling a borehole in a formation includes: obtaining a pore pressure related data value of the formation using a data acquisition tool; predicting pore pressure uncertainty from the pore pressure related data value of the formation using a processor; estimating uncertainty of a pressure window for drilling fluid using the predicted pore pressure uncertainty using a processor; and applying the estimated uncertainty to the pressure window to provide a modified pressure window using a processor. |
| US11591895B2 |
Simulated annealing accelerated optimization for real-time drilling
A system and method for controlling a drilling tool inside a wellbore makes use of simulated annealing and Bayesian optimization to determine optimum controllable drilling parameters. In some aspects, a computing device generates sampled exploration points using simulated annealing and runs a Bayesian optimization using a loss function and the exploration points to optimize at least one controllable drilling parameter to achieve a predicted value for a selected drilling parameter. In some examples, the selected drilling parameter is rate-of-penetration (ROP) and in some examples, the controllable drilling parameters include such parameters as rotational speed (RPM) and weight-on-bit (WOB). In some examples, the computing device applies the controllable drilling parameter(s) to the drilling tool to achieve the predicted value for the selected drilling parameter and provide real-time, closed-loop control and automation in drilling. |
| US11591891B2 |
Helix hub with improved two-phase separation
Pumping of wellbore fluid to a surface may have a detrimental effect on the pump performance due to high gas concentrations in the fluid. A pump system that utilizes a helix gas separator provides greater pump efficiency by effectively removing the gas phase of the fluid. The wellbore fluid received at a pump system is directed from an intake to a gas separator that utilizes a stationary auger. The stationary auger induces rotational motion of the wellbore fluid causing the wellbore fluid to separate into a gas phase and a liquid phase. The stationary auger utilizes a tapered diameter and an opening between one or more helixes or vanes to separate a gas phase more efficiently from a liquid phase of a fluid. |
| US11591890B2 |
Method and apparatus for producing hydrocarbon
A hydrocarbon production system comprises a base pipe; and a separator having a body with an inner surface defining a conduit, the inner surface being coated with a polymer blend comprising a hydrophilic component and a hydrophobic component, an inlet, a water outlet, and an oil outlet fluidly coupled to the base pipe. |
| US11591889B2 |
Hot swappable fracturing pump system
A method, apparatus, and system according to which a discharge manifold is pressurized by at least a first fracturing pump, said discharge manifold being adapted to communicate pressurized fluid to an oil and gas wellbore. |
| US11591888B2 |
Hydraulic fracturing blender system
A multi-blender system for blending liquid and solid particulates together to prepare a fracturing fluid, the blender system can include a plurality of independently operable blender units each having components that can operate with either blender unit. Each component may be a modular blender component mounted to respective independent frames. The independent frames are configured to be independently removable, replaceable and movable to multiple positions in the blender system. In some aspects the multi-blender system can operate at different sand concentrations, instantaneously adjust flow rate to one or more of the components in either blender unit, provide control redundancy, and may continue to operate despite a failure of one of the major components. |
| US11591887B2 |
Chemical injection system for completed wellbores
A resource exploration and recovery system includes a first system and a second system extending into a wellbore. The second system includes a completion having a casing defining a wellbore internal diameter. A chemical injection tubing extends from the first system into the completion. The chemical injection tubing includes a terminal end portion. A chemical introduction system is arranged at the first system and is fluidically connected to the chemical injection tubing. The chemical introduction system is operable to deliver a chemical into the chemical injection tubing. A chemical injector assembly is mounted to the terminal end portion. The chemical injection system includes an anchor and a chemical injector valve. |
| US11591885B2 |
Selective untethered drone string for downhole oil and gas wellbore operations
According to some embodiments, devices, systems, and methods for autonomously or semi-autonomously conveying downhole oil and gas wellbore tools and performing downhole oil and gas wellbore operations are disclosed. The exemplary devices, systems, and methods may include an untethered drone that substantially disintegrates and/or dissolves into a proppant when shaped charges that the untethered drone carries are detonated. Two or more untethered drones, wellbore tools, and/or data collection devices may be connected in an untethered drone string and selectively detonated for efficiently performing wellbore operations and reducing the amount of debris left in the wellbore after such operations. |
| US11591884B2 |
Hydraulic indexing system
A technique provides a desired control over incremental actuation of hydraulic devices. A hydraulically actuated tool is combined with a control module. The hydraulically actuated tool has an actuator piston positioned in a piston chamber and movable between operating positions. The control module comprises a hydraulic indexing circuit arranged to enable incremental movement of the actuator piston in a first direction and full stroke movement in a second direction based on hydraulic input delivered via control lines. The hydraulic indexing circuit comprises an indexing piston system and at least one check valve working in cooperation with the indexing piston system to enable the incremental and full stroke movements. |
| US11591881B2 |
Cone for a downhole tool
A downhole tool for use in a wellbore includes a cone, a cone adapter at least partially disposed in the cone, a shoe member, and a slip assembly disposed between the cone and the shoe member. A mandrel extends through the cone adapter and attached to the shoe member. The cone adapter is retrievable with the mandrel. |
| US11591878B1 |
Fluid containment system and method
The fluid containment system attaches to the wellhead below the rotating control device to catch fluids. The fluid containment system provides a pan below the outlet of the body in which the rotating head assembly is secured. A curtain attaches to the fluid containment system to at least partially enclose the wellhead. The curtain directs the escaped fluids to the pan. An opening in the curtain provides an outlet for the body allowing fluids within the pipe to flow from the body. Conduits attach to outlets of the pan to transfer the fluids from the pan to a tank. |
| US11591869B2 |
Variable flow diverter downhole tool
A downhole tool configured to vary the amount of pressurized fluid delivered to other tools incorporated into a bottom hole assembly, such as a mud motor. The tool comprises an inner element installed within an outer sleeve. The inner element is configured to move between three different positions relative to the outer sleeve. In a first position, pressurized fluid is diverted away from downstream tools within the bottom hole assembly. In a second and third position, pressurized fluid is directed towards downstream tools. Movement of the tool between the different positions is caused by varying external forces applied to the tool. |
| US11591868B1 |
High G force vibratory separator system
A vibrator separator system has a vibrator separator position and a vibratory basket, a screen assembly positioned in the vibratory separator, and a vibration amplifier coupled to the vibratory separator. The vibratory basket has sides arranged in spaced relation to each other. The vibratory separator has at least one motor affixed thereto. The screen assembly extends between an inlet end and a discharge end of the vibratory basket. The motor is cooperative with the screen assembly so as to impart a vibration frequency to the screen assembly. The vibration amplifier is positioned beneath the screen assembly. The vibration amplifier is cooperative with the screen assembly so as to exert a force against a portion of an underside of the screen assembly. |
| US11591866B2 |
Shaker and degasser combination
A system for separating components from a slurry of drilling fluid and drill cuttings on a shaker screen having an upper side and a lower side within a shaker. The system also has a pressure differential generator to pull an effective volume of air through a section of the shaker screen to enhance the flow of drilling fluid through the section of the shaker screen and the separation of drilling fluid from drill cuttings and further maintain an effective flow of drill cuttings off the shaker. A method of separating components of a slurry of drilling fluids and solids has the steps of delivering the slurry to a shaker, flowing the slurry over a first screen and applying an effective amount of vacuum to a first portion of the first screen to remove the drilling fluids from the slurry without stalling the solids on the first screen. |
| US11591858B2 |
Cutting elements with increased curvature cutting edges
A drill bit for cutting formation comprises a bit body, a plurality of cutters, a plurality of blades with pockets to accommodate the cutters respectively. Each of the plurality of cutters has an ultra-hard layer, two side facets extending obliquely inward from the substrate to a top surface of the ultra-hard layer, a convex portion between the two side facets. The convex portion comprises a transition surface and the transitional surface is convex as it extends between adjacent the two side facets. The curvature of the transitional surface varies along the cutter axis with the curvature at the cutting edge larger than the curvature of the cutter circumferential surface. |
| US11591855B2 |
In pool ladder assembly
A pool ladder may have a first and second leg extension, each having a generally continuous profile; a first tread may comprise first and second through-holes, the first through-hole being sized to slidingly receive the generally continuous profile of the first leg extension, and the second through-hole being sized to slidingly receive the generally continuous profile of the second leg extension; and a first and second tread support. The first tread support may be engaged at a tread location on the first leg extension and may be separate from the first leg extension. The second tread support may be engaged at a tread location on the second leg extension and may be separate from the second leg extension. Each of the first and second tread supports may protrude from the respective leg extension a sufficient amount to prevent the first and second through-holes from sliding past the tread locations. |
| US11591854B1 |
Portable staircase
The disclosure relates to portable staircases having a staircase assembly including an outer staircase and an inner staircase that can move in a telescoping relationship with respect to the outer staircase. Portable staircases of the disclosure are particularly useful for accessing an oil drilling rig as they are independently supported with respect to the drilling rig, thus providing numerous safety improvements and advantages. Methods of using the portable staircases of the disclosure are also disclosed. |
| US11591853B2 |
Adjustment screw
An improved roller shade system provides increased support, additional adjustments and/or increased safety. The slip plate allows the brake to slip forward and minimize damage to the clutch spring when a user pulls too hard on the hembar. The center drive mechanism extends through a bracket to allow the drive shaft to distribute power in both directions and drive two shade tube simultaneously. The tube adapter absorbs force from the spinning shade tube to minimize damage to the other components and the bead chain. The sprocket has a back wall supporting the sprocket, allowing the sprocket 130 to rest on the back flange of the sun gear to minimize pressure on the gears. An adjustment arm is adjusted to help level the shade band. The shade bands may be removed without disturbing the other shade bands in the system. A height of a hembar may be adjusted by rotating a rod within the hembar. |
| US11591852B2 |
Support connector lock
An improved roller shade system provides increased support, additional adjustments and/or increased safety. The slip plate allows the brake to slip forward and minimize damage to the clutch spring when a user pulls too hard on the hembar. The center drive mechanism extends through a bracket to allow the drive shaft to distribute power in both directions and drive two shade tube simultaneously. The tube adapter absorbs force from the spinning shade tube to minimize damage to the other components and the bead chain. The sprocket has a back wall supporting the sprocket, allowing the sprocket 130 to rest on the back flange of the sun gear to minimize pressure on the gears. An adjustment arm is adjusted to help level the shade band. The shade bands may be removed without disturbing the other shade bands in the system. A height of a hembar may be adjusted by rotating a rod within the hembar. |
| US11591851B1 |
Free hanging safety bead chain tension device
A free hanging safety bead chain tension device includes a clutch, a bead chain for controlling ascending/descending of a roller shade, a tension rod and more than one restriction seats. The bead chain is connected with the tension rod and the restriction seats are disposed on the rod body of the tension rod. Each restriction seat has one or more restriction tunnels for locating the bead chain adjacent to the tension rod. When pulling the bead chain to control the ascending/descending of the roller shade, the bead chain is positioned by the tension rod and the restriction seats. Accordingly, not only the bead chain can be still smoothly pulled, but also the bead chain is prevented from being pulled out by a space sufficient to twist around a neck. Therefore, a child is prevented from pulling the bead chain to twist the bead chain around the child's neck so that a safety effect is achieved. |
| US11591849B2 |
Draw bar and brake arrangement for a draw bar
A brake arrangement, for a retractable screen arrangement in which the a screen roller applies a retraction force to the screen and brake arrangement, includes a brake arrangement, for providing a braking force between the brake arrangement and a track which guides the brake arrangement, to resist retraction. The brake arrangement provides a brake member with a friction surface for contacting the bearing surface; a brake member support for supporting the brake member; and a forcing arrangement for forcing the friction surface against the bearing surface. The forcing arrangement includes a biasing arrangement for biasing the friction surface onto the bearing surface, and a force-increasing arrangement for increasing the force with which the friction surface engages the bearing surface. The force increasing arrangement converts a frictional force between the friction surface and the track into additional contact pressure force of the friction surface onto the guide track. |
| US11591847B2 |
Lock device having position sensor
A position sensing system and method for detecting the displacement of a door from a reference position, such as, for example, from a closed position. The system includes a magnetometer that may be operably connected to the door, and which measures positional location relative to a reference magnetic field, such as, for example, a magnetic field provided by a magnet of a lock device. The system may also include an accelerometer that detects acceleration of the door, and thereby provides an indication of when location is to be measured by the magnetometer. Measurement information from the magnetometer is used to derive a position indicator that is compared to a reference indicator, the reference indicator being associated with the reference position. Differences between the position and reference indicators may provide an indication that the door has been moved from the reference position. |
| US11591846B2 |
Dosage device for extruding a bicomponent or monocomponent sealant
A dosage device for extruding a bicomponent or a monocomponent sealant, particularly for an automatic machine for sealing a perimetric edge of an insulating glazing unit constituted by at least two glass sheets and by at least one spacer frame, having a finite width, is arranged proximate to the perimeter at a finite distance from the margin of the glass sheets, includes a first dosage assembly and a separate second dosage assembly for the dosage and feeding of the sealant, which can be activated alternately, in a first feeding step and in a third feeding step, so that one of them provides flow continuity to an extrusion nozzle while the other one is in the reloading step. The first and second dosage assemblies are activatable, in a second swapping step that is intermediate with respect to the first and third feeding steps, simultaneously and jointly, one of them having a flow-rate ramp that passes from the steady-state value to zero and the other one complementarily having a flow-rate ramp that passes from zero to the steady-state value. |
| US11591843B2 |
Connective installation structure for modularized windows and doors
The present invention relates to a connective installation structure for modularized windows and doors, the connective installation structure successively arranging and connectively installing, in the horizontal direction, modularized sliding windows, doors, or door windows that form the window and doors of a building, with fixed windows arranged in the spaces between the windows and doors. The present invention provides the connective installation structure for modularized windows and doors so as to provide a simplified double frame support structure in which the connective structure lateral section view of the frame, formed by the elevation view of the elements that form the connective installation structure of windows and doors, comprises just (window glass or door panel)-window sash frame-window frame-(fixed window glass), the connective installation structure for windows and doors successively arranging and connectively installing, in the horizontal direction, the sliding-type windows, doors, or door widows, with fixed windows arranged in the spaces therebetween. |
| US11591841B2 |
System and method for adjusting a vehicle door relative to a vehicle body
A system for adjusting a vehicle door relative to a vehicle body including an adjusting device, a control device for controlling the adjusting device. The control device is configured to receive an operating command and control the adjusting device based on receiving the operating command, and a sensor device for detecting an object. The control device is configured to evaluate for the purpose of collision protection monitoring whether an operating command is received in a near area relative to the vehicle door via an operating device. For collision protection monitoring, the control device is configured to use a first recognition area in a first operating mode upon receiving an operating command via an operating device in the near area, and in a second operating mode to use a second recognition area different from the first recognition area when an operating command is not received in the near area. |
| US11591840B1 |
Power window operators, windows and methods
Power window operators, windows including the power window operators, and methods of using the same are described herein. The power window operators may offer the ability to control the timing and/or speed of the lock/unlock motion relative to the open/close motions of the operator arm of the power window operator and, if provided, a sash being driven by the power window operator. |
| US11591838B2 |
Panel seal systems
A wall panel system may include a bottom drop seal assembly that maintains a constant force relative to a floor portion of an environment through a damper. The wall panel system may include an automatic top seal assembly that seals a gap between the movable wall panel system and a ceiling of the environment. The moveable wall panel system may include multiple panels and a plurality of seals positioned between adjacent panels to seal a gap between the adjacent panels. |
| US11591837B2 |
Refrigerator
The present invention provides a refrigerator, comprising a refrigerator body and a door body. A hinge body is disposed on the refrigerator body. A first hinge shaft and a second hinge shaft are disposed on the hinge body. A first guide groove and a second guide groove are formed in the door body. The first hinge shaft is located in the first guide groove and the second hinge shaft is located in the second guide groove. During opening of the door body, the first guide groove moves relative to the first hinge shaft and the second guide groove moves relative to the second hinge shaft, the first hinge shaft applies an acting force to the first guide groove to drive the end, away from the first guide groove, of the second guide groove to approach the second hinge shaft, so that the door body is displaced in a horizontal direction. |
| US11591832B2 |
Vehicle door lock device
A vehicle door lock device includes: a latch that has a full latch claw portion and a half latch claw portion, engages with a striker attached to a vehicle body during a closing operation of a vehicle door, is rotatable between an unlatch position and a full latch position, and rotates from the unlatch position to the full latch position; a pawl that is rotatable between an engagement position and a disengagement position, is pressed by the full latch claw portion to rotate in a direction from the engagement position toward the disengagement position, and engages with the full latch claw portion by rotating from the disengagement position to the engagement position; a block lever that is rotatable between a restriction position and a non-restriction position; and a half latch lever that is rotatable between an operation position, and a non-operation position. |
| US11591831B2 |
Vehicle door assembly
The invention relates to a vehicle door handle (1), comprising a handle frame (5) to be attached on a vehicle door panel (100), handle lever (3) with a total length L movable with respect to the handle frame (5) between at least one rest position (F, R) and an opening position (O) in rotation around a handle lever axis (A) at one of its longitudinal ends, said handle lever (3) having an axially protruding axial finger (35), characterized in that it further comprises a kinematic lever (37), rotatively mobile with respect to the handle frame (5) around a kinematic lever axis (B) between a rest position and an active position, said kinematic lever (37) comprising a first radial arm (39), adapted to interact with a latch mechanism, configured to unlatch the door when the kinematic lever (37) reaches its active position, and a second radial arm (41), intersecting a path of the axial finger (35) of the handle lever (3) and being pushed by said axial finger (35) during rotation of the handle lever (3), so that when the handle lever (3) reaches the opening (O) position, the kinematic lever (37) reaches its active position, wherein the kinematic lever (37) is set in the handle frame (5) in a position axially above the handle lever (3) and with its rotational kinematic lever axis (B) positioned in a middle section of the handle lever (3), radially apart from the handle lever axis (A) at a distance d, verifying 0.9L≥d≥0.1L. |
| US11591825B2 |
Door latch
A sliding door handle and strike assembly includes a locking member for engaging the strike to prevent the door from opening. The locking member is biased to an unlocked position, until it is moved into a locking position, in which magnetic co-operation acts to hold the locking member in the locking position. |
| US11591821B2 |
Modular closure device for different closure elements
A modular closure device for different closure elements, such as finger levers, plate cylinders, profile cylinders, profile half cylinders, for locking a pivot lever in a recess, is described, wherein the closure elements can be inserted and fastened in a receptacle arranged in the recess or the pivot lever, either from the front or from the rear, characterised in that the closure device, which has an interchangeable insert adapted to the closure device and having a different design for the various receptacles, interacts with a guide in such a way that this can be inserted into the recess or into the pivot lever, and the recess or the pivot lever having the inserted interchangeable insert can be plugged in a door leaf through an opening in the door leaf or the like and can be fastened with a cap. |
| US11591819B2 |
Collapsible structure
Collapsible structures are disclosed. In one embodiment, the collapsible structure includes a plurality of hinges and a plurality of panels. The plurality of panels are swingably connected by the plurality of hinges so as to form at least one arch when the collapsible structure is in an erected state and so as to become at least one stack of the plurality of panels in a collapsed state. The panels allow for the collapsible structure to maintain its structural integrity when erected but to have a compact and transportable configuration when collapsed. |
| US11591817B2 |
Stiff-to-flexible rising-twist-sway split-force-impact structures
This invention improves seismic resistance of structures by transition from stiff to non destructible flexible state at a threshold earthquake level higher than prior art maximum design earthquake level of stiff structures. Functional characteristics of the category of auto-reversing stiff-to-flexible seismic structures comprise: a limited six degree of freedom motion; a laterally-stable limited rising-twist-sway ascent; a self-centering diagonal-untwist auto-descent; a multidirectional flexibility; and a multi-phase split-force-impact seismic protection. Seismic construction technologies of the category of structures comprise: base split-force-impact technology; cluster split-force-impact technology; tuned segment split-force-impact technology; and tuned spine split-force-impact technology. The auto-reversing stiff-to-flexible seismic joints of the structures are low-cost, simple and easy to manufacture, and especially suitable for mass industrial application. |
| US11591816B1 |
Transverse elevator system
A transverse elevator system having generally horizontal and generally vertical components in a building with horizontal pathways guiding first passenger vehicles on each floor that connect to a plurality of vertical pathways guiding second passenger vehicles intersecting the horizontal pathways at stops at the points of intersection, wherein passenger transfer from horizontal to vertical movement is achieved by locking the first vehicles to the second vehicles with passenger chutes defining panels that extend from the vertical pathways and lock the first vehicles to the vertical pathways. In a second embodiment, passengers are carried in a separate enclosed CAPULSEs that shift from the first vehicles to the second vehicles obviating the need for complex horizontal to vertical drive transfer mechanisms. |
| US11591808B2 |
System and method for a vented and water control siding, vented and water control sheathing and vented and water control trim-board
A vented and water control paneling has improved drainage and integrated ventilation air space. The water control paneling may be fabricated with an omnidirectional relief pattern formed on its back surface. The relief pattern spaces the vented and water control paneling away from a structure to which it is secured, thereby providing an omnidirectional drainage plane between the back surface of the paneling and the structure. The omnidirectional drainage plane provides an unimpeded ventilation and drainage path of water and/or water vapor. |
| US11591805B2 |
Panel
A panel having a core, a top side, a bottom side, and edge pairs provided on opposite panel edges. At least one first edge pair has complementary locking elements. One locking element is a locking groove on a groove side of the edge pair and the complementary locking element is a locking tongue on a tongue side of the edge pair. The locking tongue of a first panel can be placed against the locking groove of a second panel of the same kind when the first panel is tilted, and the two panels can be locked to one another interlockingly by a rotating joining movement of the panels relative to one another. The form fit counteracts moving apart of the locked panels specifically in a direction that lies in the plane of the locked panels and is simultaneously perpendicular to the locked panel edges. The locking tongue has, on a top side, a contact surface directed to the panel top side. The top groove wall has a touch surface designed so that when two panels are in the locked state, the touch surface is mated to the contact surface of the tongue top side. At the front of the locking tongue a rounding adjoins the contact surface so that the rounding forms a cross-sectionally round free end of the locking tongue so that a round transition to the tongue bottom side is created. The rounding of the locking tongue has a radius at least equal to the distal extent of the contact surface. |
| US11591787B2 |
Adjustable floor drain and method of installation
A drain assembly comprises a shroud, a shank, and a frame. The drain assembly may further comprise a shim with an angled top surface. The frame may have an angled bottom surface. A rotational orientation of the angled top surface of the shim relative to the shank and a rotational orientation of the angled bottom surface of the frame relative to the shank may be independently adjustable, thereby allowing for the top surface of the frame to be both angularly and rotationally adjusted relative to a central axis of the drain assembly independent of the positional height of the shank. The drain assembly may further comprise a cover having bendable tabs. The bendable tabs may be disposed around a periphery of the cover and may be configured to contact an angled inner surface of an upper bowl of the shroud, such that the bendable tabs bend around the frame, thereby locking the cover onto the frame. |
| US11591785B2 |
Flush toilet
A flush toilet includes a rear storage configured to store a control unit of a toilet main body. The rear storage includes a supporting wall configured to support the control unit so as to divide a storage region of the rear storage into upper and lower regions. In a rear supporting region of the rear storage, a first distance in a horizontal left-right direction from an outer joining portion to an inner joining portion in the supporting wall is shorter than a second distance in the horizontal left-right direction from an outer wall in the double wall of the skirt to an inner joining portion of the supporting wall. The second distance is set to a maximum width dimension in the left-right direction in an internal space of the double wall of the skirt. |
| US11591784B2 |
Sanitary washing device
A sanitary washing device includes a nozzle, a valve unit, a controller, and a casing. The nozzle is configured to discharge water toward an ano-genital region of a human body. The valve unit is provided on a pipe line between a water supply source and the nozzle. The valve unit includes an electromagnetic valve. The controller is configured to control operation of the nozzle and the valve unit. The casing stores the nozzle, the valve unit, and the controller. The valve unit is disposed further frontward than the controller. |
| US11591783B2 |
Toilet ventilation system
A toilet bowl ventilation system exhausts air in and around the toilet bowl to an area adjacent to the room in which the toilet is located. The toilet bowl ventilation system includes an odor exhaust system which is configured to be installed within the interior cavity of a toilet. The odor exhaust system includes a fan positioned within a housing. The system further includes a controller that regulates power to the fan. Upon activation, the system is operable to transport air from in and around the toilet bowl, through the housing, and to an area adjacent to the room in which the toilet is located (e.g. outdoors). |
| US11591782B2 |
Anti-overflow toilet
A toilet configuration that is connectable to a sewer drainage pipe is provided. The toilet configuration includes a water storage tank, a ceramic toilet body including a toilet bowl, and a water supply plenum operable to receive water from the water storage tank and channel the water to the toilet bowl. The toilet configuration further includes a primary drain operable to fluidly connect the waste receiving basin and the sewer drainage pipe and at least one footrest formed unitarily with an outer surface of the ceramic toilet body. The footrest is operable to aid a user in elevating at least one knee while the user is seated upon the toilet configuration. |
| US11591781B2 |
Flush toilet
A flush toilet includes a toilet main body made of ceramics and a control unit. The toilet main body includes a skirt, and a rear storage that can store at least a part of the control unit, the rear storage includes a supporting wall that divides a storage region into upper and lower regions and that supports the control unit, the skirt forms a double wall including an outer wall and an inner wall, the double wall has at least a part that forms an internal space between the outer wall and the inner wall, and the skirt includes a single wall in which the internal space of the double wall is removed in an upper end above a joining portion between the double wall and the supporting wall. |
| US11591777B2 |
Monitoring system for detecting leaks using a system of flow rate sensors and smart valves
Methods, systems, and apparatus, including computer programs encoded on a storage device, for detecting water leaks and mitigating the damage caused by the detected leaks. The system may include a processor and a storage device storing instructions that, when executed by the processor, cause the processor to perform operations. The operations may include obtaining sensor data that is generated by one or more flow rate sensors located at a property, obtaining status data that is generated by one or more connected water shutoff valves located at the property, determining, based on (i) the obtained sensor data and (ii) the obtained status data whether a water leak has been detected at the property, and in response to determining, based on (i) the obtained sensor data and (ii) the obtained status data, that a water leak has been detected at the property, initiating performance of one or more water damage mitigation operations. |
| US11591769B2 |
Work machine
A controller mounted in a work machine limits a velocity at which a work device approaches a design surface to be equal to or lower than a predetermined limiting velocity in such a manner that the work machine is located above the design surface when an operation device is operated. The controller determines whether a work phase of the work device is compaction work on the basis of a posture of a bucket with respect to the design surface in a case in which the operation device instructs the work device to approach the design surface, and sets the limiting velocity when determining that the work phase of the work device is the compaction work to be higher than the limiting velocity when determining that the work phase of the work device is other than the compaction work. |
| US11591766B2 |
Mobile segmental rail foundation system
Various examples are provided related to mobile segmental rail foundation systems, and their assembly, deployment and use. In one example, among others, a mobile rail foundation system includes a segmental rail foundation including a plurality of anchor assemblies and at least one sectional spacer rail assembly configured to detachably attach adjacent anchor assemblies to form the segmental rail foundation. The anchor assemblies can be coupled to soil anchor assemblies and/or hold down assemblies to secure the segmental rail foundation in position. The soil anchor assemblies can include helical pile soil anchor assemblies and the hold down assemblies can include forked hold down plate or brackets secured by anchor bolts. |
| US11591763B2 |
Systems and methods for coastal drainage control
A drainage device includes a conduit extending from a bottom end toward a top end and a valve coupled to the conduit. The valve includes a first stop having an opening and an obstruction within the conduit. The obstruction, in a first configuration, may be spaced apart from the opening, enabling fluid to flow through the first stop and through the conduit. The obstruction, in a second configuration, may block the opening to prevent fluid flow through the first stop and through the conduit. The obstruction may move from the first configuration to the second configuration in response to (1) fluid pressure acting in a direction from the bottom end toward the top end of the conduit, or (2) when a fluid having a higher density than the obstruction is disposed within the valve. |
| US11591762B2 |
Method for tracking, monitoring and evaluating ecological impact of channel project based on long-term time series satellite remote sensing data
The present invention relates to a method for tracking, monitoring and evaluating ecological impacts of a channel project based on long-term time series satellite remote sensing data, belonging to the field of ecological environment protection. Created in view of limitations and deficiencies of existing monitoring and evaluation methods, the method includes: a process for long-term time series satellite remote sensing analysis of an ecological impact of a channel project, an analysis method for respectively evaluating erosion and deposition, shoreline and water area morphological changes at different research scales based on water body information extraction, and an analysis method for respectively tracking and monitoring engineering construction details, comparing engineering impact scope consistency and evaluating engineering implementation effects based on channel project identification. |
| US11591759B2 |
Method to prevent binding in road milling machines
A road milling machine includes a milling drum, an enclosure assembly, an actuator, and a controller. The milling drum may modify surface. The enclosure assembly includes a member moveable between a closed state and an open state. In the closed state, the member at least partially encloses the milling drum to direct materials milled by the milling drum to a conveyor. The actuator is adapted to be actuated between a first state and a second state to correspondingly move the member between the closed state and the open state. Further, the controller is configured to detect the closed state of the member; determine a lowering of the milling drum with respect to the surface; and reverse an actuation of the actuator towards the second state to offset and balance out a weight of the member based on the lowering of the milling drum. |
| US11591757B2 |
System and method for machine control
A method includes receiving information indicative of a first worksite plan, determining a travel path extending along a work surface, causing a mobile machine to traverse the travel path, and receiving first sensor information associated with the work surface from a sensor of the mobile machine. The method also includes generating a second worksite plan based at least partly on the first sensor information, and providing instructions to a slave machine which, when executed by a controller of the slave machine, cause the controller of the slave machine to control the slave machine to perform at least part of the second worksite plan. The method further includes receiving second sensor information determined by the sensor of the mobile machine, and generating at least one of a safety metric and an accuracy metric based at least partly on the second sensor information. |
| US11591756B2 |
Artificial turf suitable for sports fields
The present invention relates to an artificial turf suitable for sports fields consisting at least of a substrate to which first artificial grass fibres are attached and of a granular infill, which is provided between said first artificial grass fibres, wherein said granular infill is made of a foam material comprising polylactic acid or a derivative thereof. |
| US11591753B2 |
Method of producing hydrophobic paper
The present disclosure relates to a method of producing hydrophobic paper, using a sizing additive based on depolymerized lignin and a hydrophobic paper obtainable by such method. |
| US11591752B2 |
Toilet tissue comprising a dynamic surface
Toilet tissue having a dynamic surface comprising a surface material that overlays a textured web material such that the toilet tissue exhibits one or more novel properties and method for making same are provided. |
| US11591747B2 |
Treatment agent for elastic fiber
Provided is an elastic fiber treatment agent, containing; a hydrocarbon resin (A); and a hydrocarbon oil (B). The hydrocarbon resin (A) contains a polymer having a structural unit, as a main structural unit, derived from at least one monomer selected from aromatic olefin and aliphatic diolefin, the polymer being partially hydrogenated or fully hydrogenated. It is preferred that the hydrocarbon resin (A) contains a polymer having a structural unit derived from aromatic olefin as a monomer, the polymer being partially hydrogenated or fully hydrogenated, and the aromatic olefin is at least one selected from indene and methylstyrene. Thus, the elastic fiber treatment agent of the present invention imparts excellent unraveling properties to elastic fibers and has excellent adhesiveness to hot melt adhesives, enables the production of stretchable sheets exhibiting good adhesiveness even when processed at a high draft ratio, and is suitable for obtaining soft feel sanitary products. |
| US11591746B2 |
Clothes care apparatus and control method thereof
A clothes care apparatus includes a chamber, an upper fan provided above the chamber and configured to move air to a lower side of the chamber, and a lower fan provided under the chamber and configured to move air to an upper side of the chamber. A first motor is configured to rotate the lower fan and a steam generating device is configured to generate steam by heating water. A controller is configured to control on-off states of the steam generating device and the first motor, configured to turn on the steam generating device in a first period for supplying the generated steam to the chamber, and configured to turn on the first motor in a second period for allowing the steam to be dispersed by air moving to the chamber. |
| US11591745B2 |
Systems and methods for restoring shrunken garments
Disclosed herein are drying system and method for restoring clothes shrunk after washing and drying of the clothes. The clothes drying system includes: an air injection part for injecting air into the drying system; a drying tube of which the volume is expandable by the air injected through the air injection part; a jig put on the outer surface of the drying tube; and a fixing part attached to the clothes and fixing the clothes and jig so that the clothes put on the outer surface of the jig is not shrunk while being dried. |
| US11591740B2 |
Dispensing system for a laundry treating appliance
A laundry treating appliance with a treating chamber for receiving laundry for treating and a liquid supply system fluidly coupled to the treating chamber. The liquid supply system includes a water supply system and a dispensing system. The dispensing system includes a faucet, a support structure, one or more drawers, and one or more dispenser outlets for providing treating liquid and treating chemistries. Components of the dispensing system can be activated, e.g. for pretreating laundry items, for use as a utility sink, or during an automatic cycle of operation. |
| US11591738B2 |
Optimizing soak time in a washing machine appliance
A method of operating a washing machine appliance is provided. The washing machine appliance includes a rotatable basket and a motor configured to drive the rotatable basket. The method includes sensing an attribute of articles in the basket. The method also includes determining a pause duration for an agitation operation based at least in part on the sensed attribute of the articles in the basket. The method further includes performing the agitation operation for a period of time. The agitation operation includes activating a motor of the washing machine appliance to agitate the articles within the basket for an agitation duration and deactivating the motor of the washing machine appliance for the pause duration. The period of time is equal to the sum of the agitation duration and the pause duration. |
| US11591734B2 |
Cut pile looper and hook tufting improvement
A tufting machine with a needle bar and looper system provides individual loopers which cooperate with needles of the needle bar selectively between an engage and a disengage configuration whereby when in the engage configuration at least some of the loopers hold yarn directed by the needle through the backing as the needle cycles into and out of the backing to form a first loop having a height of a distance of the looper from the backing, but when in the disengage configuration, the looper is spaced from the yarn so that any loop formed is shorter than the first loop. |
| US11591733B2 |
Assemblies for textile manufacturing and related methods
One general aspect of the present disclosure includes an assembly including: a support device having a surface for receiving a textile component; and an actuation device, the actuation device having at least one actuation surface that at least partially surrounds the support device, where the actuation surface is movable with respect to the surface of the support device such that, when the textile component is held by the support device, movement of the actuation surface with respect to the surface of the support device causes movement of the textile component with respect to the surface of the support device. |
| US11591732B2 |
Sewing machine
In a sewing machine, an arm includes, on one side thereof in a first direction, a head. A needle bar is disposed at the head to reciprocally move in a second direction. A feed mechanism feeds a workpiece from one side toward the other side of the head in a third direction. The projection unit disposed at the head projects a projection image toward a bed. The projection unit includes an emitter for projecting image light of the projection image. The photographing unit disposed at the head captures a photographing target. The photographing unit includes an incident portion on which light reflected by the photographing target is incident. The emitter and the incident portion are disposed further toward the one side of the arm in the first direction than the needle bar, and further toward the one side of the head in the third direction than the needle bar. |
| US11591728B2 |
Spunbond nonwoven laminate and method of making same
A spunbond nonwoven laminate has a stack of at least two and at most four spunbond nonwoven layers each formed by or consisting of crimped continuous filaments. A degree of crimping of the filaments in each of the spunbond nonwoven layers is different from a degree of crimping in each of the other spunbond nonwoven layers and each of the crimped filaments of the spunbond nonwoven layers has a crimp with at least two loops per centimeter of length. The crimped filaments of the spunbond nonwoven layers are multicomponent filaments each having at least one first plastic component and at least one second plastic component with each of the plastic components being present in the respective filament in a proportion of at least 10 wt %. |
| US11591720B2 |
Method and device for protein fiber production
A method for producing a protein polymer fiber, the method comprising providing a liquid protein solution in a container for liquid, and repeatedly moving the liquid surface in the container back and forth between a first and a second position. Said movement of the liquid surface is such that the protein polymer solution is allowed to form a film in the interface between the liquid surface of the liquid protein solution and a surrounding fluid. The movement of the liquid surface being performed by respectively raising and lowering the liquid surface relative to the container or by moving an object extending through the liquid surface of the liquid protein solution. Also, a device for performing said method. |
| US11591717B2 |
Vapor phase epitaxial growth device
A vapor phase epitaxial growth device comprises a reactor vessel and a wafer holder arranged within the reactor vessel. The wafer holder includes a wafer holding surface configured to hold a wafer with a wafer surface oriented substantially vertically downward. The device comprises a first material gas supply pipe configured to supply a first material gas and arranged below the wafer holding surface. The device comprises a second material gas supply pipe configured to supply a second material gas and arranged below the wafer holding surface. The device comprises a gas exhaust pipe configured to exhaust gases and arranged below the wafer holding surface. A distance between the gas exhaust pipe and an axis line passing through a center of the wafer holding surface is greater than distances between the axis line and each of the first material gas supply pipe and the second material gas supply pipe. |
| US11591712B2 |
Method and setup for growing bulk single crystals
The invention relates to a method for growing a bulk single crystal, wherein the method comprises the steps of inserting a starting material into a crucible, melting the starting material in the crucible by heating the starting material, arranging a thermal insulation lid at a distance above a melt surface of said melt such that at least a central part of the melt surface is covered by the lid, and growing the bulk single crystal from the melt by controllably cooling the melt with the thermal insulation lid arranged above the melt surface. |
| US11591710B2 |
Crystallization of amorphous multicomponent ionic compounds
A method for crystallizing an amorphous multicomponent ionic compound comprises applying an external stimulus to a layer of an amorphous multicomponent ionic compound, the layer in contact with an amorphous surface of a deposition substrate at a first interface and optionally, the layer in contact with a crystalline surface at a second interface, wherein the external stimulus induces an amorphous-to-crystalline phase transformation, thereby crystallizing the layer to provide a crystalline multicomponent ionic compound, wherein the external stimulus and the crystallization are carried out at a temperature below the melting temperature of the amorphous multicomponent ionic compound. If the layer is in contact with the crystalline surface at the second interface, the temperature is further selected to achieve crystallization from the crystalline surface via solid phase epitaxial (SPE) growth without nucleation. |
| US11591709B2 |
Apparatus for plating
There is provided an apparatus for plating a substrate as an object to be plated. The apparatus comprises an anode and a thief tunnel arranged to be located between the substrate and the anode when the substrate is placed to be opposed to the anode. The thief tunnel comprises a body placed away from the substrate and provided with an opening; a plurality of auxiliary electrodes provided in or to the body; and an ion exchange membrane configured to protect the auxiliary electrodes from a plating solution. The plurality of auxiliary electrodes are arranged along a circumference of the opening. At least one of the auxiliary electrodes is configured such that a voltage to be applied to the at least one of the auxiliary electrodes is controlled independently of a voltage to be applied to one or more auxiliary electrodes other than the at least one of the auxiliary electrodes. |
| US11591707B2 |
Methods for electrolytically depositing pretreatment compositions
Methods for treating a substrate are disclosed. The substrate is deoxidized and then immersed in an electrodepositable pretreatment composition comprising a lanthanide series element and/or a Group IIIB metal, an oxidizing agent, and a metal-complexing agent to deposit a coating from the electrodepositable pretreatment composition onto a surface of the substrate. Optionally, the electrodepositable pretreatment composition may comprise a surfactant. A coating from a spontaneously depositable pretreatment composition comprising a Group IIIB and/or Group IVB metal may be deposited on the substrate surface prior to electrodepositing a coating from the electrodepositable pretreatment composition. Following electrodeposition of the electrodepositable pretreatment composition, the substrate optionally may be contacted with a sealing composition comprising phosphate and a Group IIIB and/or IVB metal. Substrates treated according to the methods also are disclosed. |
| US11591706B2 |
Electrolytic copper foil having excellent handling characteristics in postprocessing, and manufacturing method therefor
The present invention relates to an electrolytic copper foil having excellent handling characteristics in the manufacture of copper foil and in post-processing for manufacturing a secondary battery. The present invention provides an electrolytic copper foil having a first surface and a second surface, wherein the texture coefficient of the (220) plane of the electrolytic copper foil is 0.4-1.32, the difference (|Δ(Rz/Ra)|) between Rz/Ra on the first surface and Rz/Ra on the second surface, of the electrolytic copper foil, is less than 2.42, and the difference (|ΔPD|) in peak density (PD) between the first surface and the second surface, of the electrolytic copper foil, is 96 ea or less. |
| US11591705B2 |
Electrochemical layer deposition
An apparatus and method for electrochemically depositing a unitary layer structure using a reactor configured to contain an electrolyte solution with an anode array containing a plurality of independently electrically controllable anodes arranged in a two-dimensional array, a cathode, an addressing circuit for receiving a signal containing anode address data and for outputting a signal causing an anode array pattern; and, a controller, in communication with the addressing circuit and the anode array, configured to electrically control each anode in the anode array to cause an electrochemical reaction at the cathode that deposits a unitary layer structure according to the anode array pattern signal. |
| US11591703B2 |
Systems and methods for molten oxide electrolysis
Metallurgical assemblies and systems according to the present technology may include a refractory vessel including sides and a base. The base may define a plurality of apertures centrally located within the base. The sides and the base may at least partially define an interior volume of the refractory vessel. The assemblies may include a lid removably coupled with the refractory vessel and configured to form a seal with the refractory vessel. The lid may define a plurality of apertures through the lid. The assemblies may also include a current collector proximate the base of the refractory vessel. The current collector may include conductive extensions positioned within the plurality of apertures centrally located within the base. |
| US11591701B2 |
Pd-comprising electrocatalysts suitable for water splitting
An oxygen evolution reaction catalyst electrode may include: a glass electrode; a first coating, directly upon the glass electrode, comprising a layer of fluorine-doped tin oxide (FTO); and a second coating, directly upon the first coating, comprising a layer comprising at least 95 wt. % palladium, relative to a total weight of the second coating, wherein the palladium in the second coating is in the form of porous, spongy-textured clusters comprising palladium spheroid nanoparticles in cubic crystalline phase. The second coating may have a thickness in a range of from 0.5 to 10 μm, and the clusters may have an average largest dimension in a range of from 500 to nm. |
| US11591697B2 |
Corrosion protection system for heating ventalation air conditioning refrigeration
A corrosion protection system is provided. The corrosion protection system comprises an electrical contact coupled to an apparatus. The electrical contact can apply a negative potential to the apparatus. The corrosion protection system comprises a sensor. The sensor detects moisture with respect to the apparatus. The corrosion protection system comprises a power supply. The power supply is electrically coupled to the electrical contact and provides a negative potential to the electrical contact in accordance with commands of a processor. The processor utilizes the power supply attached to the apparatus via the electrical contact to provide and apply the negative potential to the apparatus based on a sensor signal from the sensor. The sensor signal indicates the detection of the moisture by the sensor. |
| US11591691B2 |
Method of forming a thin film using a surface protection material
Disclosed is a method of forming a thin film using a surface protection material, the method comprising supplying the surface protection material to the inside of a chamber on which a substrate is placed so that the surface protection material is adsorbed to the substrate, discharging the unadsorbed surface protection material from the inside of the chamber by purging the interior of the chamber, supplying a metal precursor to the inside of the chamber so that the metal precursor is adsorbed to the substrate, discharging the unadsorbed metal precursor from the inside of the chamber by purging the interior of the chamber, and supplying a reaction material to the inside of the chamber so that the reaction material reacts with the adsorbed metal precursor to form the thin film. |
| US11591685B2 |
Manufacturing method of galvannealed steel sheet
[Object] What is provided is a manufacturing method of a galvannealed steel sheet capable of further promoting alloying of zinc plating with the steel sheet.[Resolution Means] A manufacturing method of a galvannealed steel sheet, including: forming on a surface of a steel sheet after hot rolling and pickling which contains, by mass %, C: 0.001% to 0.350%, Si: 0.001% to 2.500% or P: 0.001% to 0.100%, or combination thereof, Mn: 0.10% to 3.00%, S: 0.001% to 0.010%, N: 0.0010% to 0.0065%, and sol. Al: 0.001% to 0.800% with a remainder being Fe and impurities, grooves having an opening surface width of 10 μm to 25 μm and a depth of 10 μm to 30 μm at intervals of 20 μm to 500 μm; cold rolling the steel sheet at a rolling reduction of 30% or more; reduction annealing the steel sheet after the cold rolling; immersing the steel sheet in a hot-dip galvanizing bath containing 0.10 mass % to 0.20 mass % of Al with a remainder consisting of Zn and optional components, and adhering a hot-dip galvanized layer to the surface of the steel sheet; and heating the steel sheet to which the hot-dip galvanized layer is adhered, and alloying the steel sheet with the hot-dip galvanized layer. |
| US11591684B2 |
Nickel-cobalt material and method of forming
A nickel-cobalt material and component includes a thermally stabilized nickel-cobalt alloy. The nickel-cobalt alloy disclosed herein includes nanocrystalline grain structures, pinning, such as Zener pinning, and intragranular twinning. The nickel-cobalt alloy disclosed herein exhibits multiple properties including an improved fracture toughness, an increased thermal stability, and an improved ultimate tensile strength. |
| US11591683B2 |
Method of manufacturing nickel based super alloy parts
There is provided a method of treating a nickel base super alloy (NiSa) article. First, the NiSa article having fine grains is obtained. The NiSa article has a uniform distribution of the fine grains and substantially uniform mechanical properties throughout. One or more regions within the NiSa article are mechanically deformed. Then, the NiSa article is heat treated to obtain coarse grains in the one or more regions, the coarse grains having a size that is larger than that of the fine grains of the NiSa article outside of the one or more regions. |
| US11591680B2 |
Optimized steel material
Steel material whose constituent grains comprise a matrix in which precipitates are incorporated, the precipitates comprising at least one metallic element selected from a metallic element M, a metallic element M′, a metallic element M″ or mixtures thereof; the microstructure of the steel being such that the grains are equiaxed and the average grain size being such that the average of their largest dimension “Dmax” and/or the average of their smallest dimension “Dmin” is comprised between 10 μm and 50 μm.The steel material has optimized, stable and isotropic mechanical properties, in particular so that the steel material can best withstand mechanical and/or thermal stresses. |
| US11591679B2 |
Low-temperature steel material having excellent toughness in welding portion thereof and manufacturing method therefor
Provided according to a preferable aspect of the present invention are a low-temperature steel material having excellent toughness in a welding portion thereof and a manufacturing method therefor, the low-temperature steel material comprising, by weight %, 0.02-0.06% of C, 6.0-7.5% of Ni, 0.4-1.0% of Mn, 0.02-0.15% of Si, 0.02-0.3% of Mo, 0.02-0.3% of Cr, 50 ppm or less of P, 10 ppm or less of S, 0.005-0.015% of Ti, 60 ppm or less of N, with a Ti/N weight % ratio of 2.5 of 4, and the balance of iron (Fe) and other inevitable impurities; and having: an effective grain size of 50 micrometers or less, with a boundary angle found to be 15 degrees or greater as measured by EBSD in an area of a fusion line (FL)-FL+1 mm in a weld heat-affected zone of a weld portion welded at a heat input of 5-50 kJ/cm; and an impact toughness of 70 J or higher at −196° C. as measured in an area of fusion line (FL)-FL+1 mm. |
| US11591674B2 |
Aluminum-alloy sheet
An aluminum-alloy sheet has a chemical composition containing Si: 2.3-3.8 mass %, Mn: 0.35-1.05 mass %, Mg: 0.35-0.65 mass %, Fe: 0.01-0.45 mass %, and at least one element selected from the group consisting of Cu: 0.0010-1.0 mass %, Cr: 0.0010-0.10 mass %, Zn: 0.0010-0.50 mass %, and Ti: 0.0050-0.20 mass %. The ratio of the Si content to the Mn content is 2.5 or more and 9.0 or less. The aluminum-alloy sheet exhibits an elongation of 23% or more and a strain hardening exponent of 0.28 or more at a nominal strain of 3%. Such an aluminum-alloy sheet is well suited for press forming (stamping) applications, such as forming automobile body panels. |
| US11591670B2 |
Recycling Li-ion batteries using green chemicals and processes
A process for extracting, recovering and recycling metals and materials from spent lithium ion batteries (LIB) that comprises the contacting battery waste products with a deep eutectic solvent, and leaching the metal from the battery waste product and extracting the metal into the deep eutectic solvent with heat and agitation. After the leaching and extracting, the process further includes recovering the dissolved metals ions from the deep eutectic solvent solution, followed by a step of regeneration of cathode materials. |
| US11591667B2 |
High-strength steel sheet having excellent impact resistant property and method for manufacturing thereof
Provided is a high-strength steel sheet having high impact resistance. The steel sheet includes: by weight %, carbon (C): 0.05% to 0.14%, silicon (Si): 0.01% to 1.0%, manganese (Mn): 1.5% to 2.5%, aluminum (Al): 0.01% to 0.1%, chromium (Cr): 0.005% to 1.0%, phosphorus (P): 0.001% to 0.05%, sulfur (S): 0.001% to 0.01%, nitrogen (N): 0.001% to 0.01%, niobium (Nb): 0.005% to 0.06%, titanium (Ti): 0.005% to 0.11%, and the balance of iron (Fe) and inevitable impurities. The steel sheet has a microstructure comprising ferrite and bainite in a total area fraction of 90% or more. The steel sheet has a value of 0.05 to 1.0 as a shear texture ({110}<112>, {112}<111>) area ratio of a center region (ranging deeper than 1/10t to ½t in a thickness direction, t refers to thickness (mm)) and a surface region (ranging from a surface to 1/10t in the thickness direction). |
| US11591665B2 |
Steel sheet having excellent toughness, ductility and strength, and manufacturing method thereof
A cold-rolled and heat treated steel sheet, has a composition comprising 0.1%≤C≤0.4%, 3.5%≤Mn≤8.0%, 0.1%≤Si≤1.5%, Al≤3%, Mo≤0.5%, Cr≤1%, Nb≤0.1%, Ti≤0.1%, V≤0.2%, B≤0.004%, 0.002%≤N≤0.013%, S≤0.003%, P≤0.015%. The structure consists of, in surface fraction: between 8 and 50% of retained austenite, at most 80% of intercritical ferrite, the ferrite grains, if any, having an average size of at most 1.5 μm, and at most 1% of cementite, the cementite particles having an average size lower than 50 nm, martensite and/or bainite. |
| US11591664B2 |
Hot rolled steel sheet having excellent formability and fatigue properties and manufacturing method therefor
Provided is a hot rolled steel sheet having excellent formability and fatigue properties comprising, in percentage by weight: 0.3-0.8% of C; 13-25% of Mn; 0.1-1.0% of V; 0.005-2.0% of Si; 0.01-2.5% of Al; 0.03% or less of P; 0.03% or less of S; 0.04% or less (excluding 0%) of N; and the balance being Fe and inevitable impurities, wherein, when viewed in a cross section in the thickness direction, the hot rolled steel sheet comprises, by area fraction, 20-70% of a non-recrystallized structure and 30-80% of a recrystallized structure. |
| US11591663B2 |
Paramagnetic hard stainless steel and manufacturing process thereof
A paramagnetic stainless steel with a chemical composition including by weight: 26≤Cr≤40%, 5≤Ni≤20%, 0≤Mn≤5%, 0≤Al≤5%, 0≤Mo≤3%, 0≤Cu≤2%, 0≤Si≤5%, 0≤Ti≤1%, 0≤Nb≤1%, 0≤C≤0.1%, 0≤N≤0.1%, 0≤S≤0.5%, 0≤P≤0.1%, the remainder consisting of iron and any impurities each having a content less than or equal to 0.5%, the steel having a hardness HV10 between 500 and 900. It also relates to a part particularly a horological component made of this steel and to the process for manufacturing the part. |
| US11591662B2 |
Method for operating a metallurgical furnace
A method for operating a metallurgical furnace and a simplified way of providing synthesis gas for a metallurgical furnace, includes the following steps performing a combustion process outside the metallurgical furnace by combusting a carbon-containing material with an oxygen-rich gas to produce an offgas, which offgas is a CO2 containing gas; and combining the offgas, while having an elevated combustion-induced temperature due to the combustion process, with a hydrocarbon-containing fuel gas to obtain a first gas mixture having a temperature above a reforming temperature necessary for a reforming process, preferably a dry reforming process; the first gas mixture undergoing the reforming process, thereby producing a synthesis gas containing CO and H2, the reforming process being performed non-catalytically; and feeding the synthesis gas into the metallurgical furnace. |
| US11591659B2 |
Compositions and methods for detection of Mycoplasma genitalium
Methods for the rapid detection of the presence or absence of Mycoplasma genitalium (MG) in a biological or non-biological sample are described. The methods can include performing an amplifying step, a hybridizing step, and a detecting step. Furthermore, primers, probes targeting the target MG gene, along with kits are provided that are designed for the detection of MG. |
| US11591658B2 |
Methods for sub-typing and treating cancer
This invention relates to a novel approach for the identification and stratification of subtypes of cancer, particularly subtypes of cancer characterized by an increased expression of BCAT1, particularly Acute Myeloid Leukemia (AML). The invention furthermore relates to a novel approach with respect to the treatment of cancer, particularly subtypes of cancer characterized by an increased expression of BCAT1, particularly Acute Myeloid Leukemia (AML). |
| US11591653B2 |
Methods and systems for genetic analysis
This disclosure provides systems and methods for sample processing and data analysis. Sample processing may include nucleic acid sample processing and subsequent sequencing. Some or all of a nucleic acid sample may be sequenced to provide sequence information, which may be stored or otherwise maintained in an electronic storage location. The sequence information may be analyzed with the aid of a computer processor, and the analyzed sequence information may be stored in an electronic storage location that may include a pool or collection of sequence information and analyzed sequence information generated from the nucleic acid sample. Methods and systems of the present disclosure can be used, for example, for the analysis of a nucleic acid sample, for producing one or more libraries, and for producing biomedical reports. Methods and systems of the disclosure can aid in the diagnosis, monitoring, treatment, and prevention of one or more diseases and conditions. |
| US11591652B2 |
System and methods for massively parallel analysis of nucleic acids in single cells
Methods and systems are provided for massively parallel genetic analysis of single cells in emulsion droplets or reaction containers. Genetic loci of interest are targeted in a single cell using a set of probes, and a fusion complex is formed by molecular linkage and amplification techniques. Methods are provided for high-throughput, massively parallel analysis of the fusion complex in a single cell in a population of at least 10,000 cells. Also provided are methods for tracing genetic information back to a cell using barcode sequences. |
| US11591649B2 |
Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR
Methods for non-invasive prenatal paternity testing are disclosed herein. The method uses genetic measurements made on plasma taken from a pregnant mother, along with genetic measurements of the alleged father, and genetic measurements of the mother, to determine whether or not the alleged father is the biological father of the fetus. This is accomplished by way of an informatics based method that can compare the genetic fingerprint of the fetal DNA found in maternal plasma to the genetic fingerprint of the alleged father. |
| US11591646B2 |
Small RNA detection method based on small RNA primed xenosensor module amplification
The present invention may provide a small RNA detection sensor comprising: at one end thereof, a first sensing region comprising nucleotides having a sequence complementary to target small RNA; and a PCR-capable region that is coupled to the first sensing region, the small RNA detection sensor to synthesize a replication region complementary to the PCR-capable region by a DNA polymerase by using the target small RNA as a primer, and amplify the PCR-capable region and the replication region. |
| US11591645B2 |
Evaluation of performance of components using a pair of dimer-forming primers
The present invention relates to the evaluation of the performance of a component using a pair of dimer-forming primers. The method using the pair of dimer-forming primers according to the present invention can be used not only for evaluating the performance of components including a nucleic acid polymerase but also as an internal control in the detection of a target nucleic acid sequence. |
| US11591644B2 |
Nucleic acid detection method
The present invention relates to methods for the detection of nucleic acids of defined sequence and kits for use in said methods. The methods employ nicking agent(s), polymerase and oligonucleotide probes to produce probe fragments in the presence of a target nucleic acid. |
| US11591642B2 |
Molecular analyses using long cell-free fragments in pregnancy
Methods and systems described herein involve using long cell-free DNA fragments to analyze a biological sample from a pregnant subject. The status of methylated CpG sites and single nucleotide polymorphisms (SNPs) is often used to analyze DNA fragments of a biological sample. A CpG site and a SNP are typically separated from the nearest CpG site or SNP by hundreds or thousands of base pairs. Finding two or more consecutive CpG sites or SNPs on most cell-free DNA fragments is improbable or impossible. Cell-free DNA fragments longer than 600 bp may include multiple CpG sites and/or SNPs. The presence of multiple CpG sites and/or SNPs on long cell-free DNA fragments may allow for analysis than with short cell-free DNA fragments alone. The long cell-free DNA fragments can be used to identify a tissue of origin and/or to provide information on a fetus in a pregnant female. |
| US11591635B2 |
Screening method
A method for screening substances for their ability to reduce malodours from emanations from an animal, said method comprising determining the effect of said substances on the C-S lyase activity of bacteria that emit volatile sulphuric compounds (VSCs), by contacting a test substance with a sample comprising said bacteria or a supernatant obtainable from a culture of said bacteria in the presence of a substrate for a C-S lyase, detecting the levels of thiol production from said bacteria, and comparing the results with those obtained from similar bacteria in the absence of said substance. |
| US11591633B2 |
Methods and systems for the rapid detection of bacteria using recombinant bacteriophage to express an indicator subunit
Disclosed herein are methods and systems for rapid detection of microorganisms such as bacteria in a sample. A genetically modified bacteriophage is also disclosed which comprises an indicator gene encoding one subunit of an indicator protein. The specificity of the bacteriophage allows detection of a particular bacteria of interest and an indicator signal may be amplified to optimize assay sensitivity. |
| US11591628B2 |
Biosynthetic heparin
The present disclosure relates to synthesis of heparin, which may be bioequivalent to porcine USP Heparin Sodium. The synthesis may involve three intermediates starting from heparosan. |
| US11591626B2 |
Engineered biocatalysts for the synthesis of gamma-hydroxy amino acids
A DNA expression construct comprising a polynucleotide encoding an unnatural UstD enzyme, the unnatural enzyme itself, and a method of making gamma-hydroxy amino acids by contacting an aldehyde-containing substrate, an amino acid, and the unnatural, purified UstD enzyme under conditions and for a time sufficient to react at least a portion of the aldehyde-containing substrate with at least a portion of the amino acid, to yield a gamma-hydroxy amino acid product. |
| US11591625B2 |
Enzymatic process for production of modified hop products
The present invention relates to a process for producing a beer littering agent via enzyme catalyzed bioconversion of hop-derived isoalpha acids to dihydro-(rho)-isoalpha acids. |
| US11591619B2 |
Modified adenoviruses
Compositions include modified adenoviruses. Nucleotides, cells, and methods associated with the compositions, including their use as vaccines. Viral vectors using a TET promoter system and methods of producing viruses having the same. |
| US11591618B2 |
SynP159, a promoter for the expression of genes
The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 400 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in rod photoreceptors of a gene when operatively linked to a nucleic acid sequence coding for said gene. |
| US11591615B2 |
SynPIII, a promoter for the specific expression of genes in retinal pigment epithelium
The present invention provides an isolated nucleic acid molecule comprising, or consisting of, the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence of at least 1000 bp having at least 80% identity to said sequence of SEQ ID NO:1, wherein said isolated nucleic acid molecule specifically leads to the expression in cells of the retinal pigment epithelium of a gene when operatively linked to a nucleic acid sequence coding for said gene. |
| US11591611B2 |
TolCNDV resistant melon plants
The application concerns melon plants (Cucumis melo) resistant to infection with tomato leaf curl New Dehli virus (ToLCNDV). The resistant melon plants have a genomic introgression fragment on chromosome 5 which confers tolerance to ToLCNDV in a dominant manner. Also disclosed are markers for identifying those fragments, methods for identifying or producing resistant melon plants. |
| US11591609B2 |
Modulating reducing sugar content in a plant
There is described herein a plant cell comprising: (i) a polynucleotide comprising, consisting or consisting essentially of a sequence having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 3 or SEQ ID NO: 9 or SEQ ID NO: 11 or SEQ ID NO: 17 or SEQ ID NO: 19 or SEQ ID NO: 21 or SEQ ID NO: 23; or a polynucleotide comprising, consisting or consisting essentially of a sequence having at least 80% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 7 or SEQ ID NO: 13 or SEQ ID NO: 15; (ii) a polypeptide encoded by the polynucleotide set forth in (i); (iii) a polypeptide comprising, consisting or consisting essentially of a sequence having at least 94% sequence identity to SEQ ID NO: 2; or at least 93% sequence identity to SEQ ID NO: 4; or least 95% sequence identity to SEQ ID NO: 6; or at least 96% sequence identity to SEQ ID NO: 8; or at least 93% sequence identity to SEQ ID NO: 10 or SEQ ID NO: 12; or at least 95% sequence identity to SEQ ID NO: 14; or at least 96% sequence identity to SEQ ID NO: 16; or at least 89% sequence identity to SEQ ID NO: 18; or at least 92% sequence identity to SEQ ID NO: 20; or at least 93% sequence identity to SEQ ID NO: 22; or at least 94% sequence identity to SEQ ID NO: 24; or (iv) a construct, vector or expression vector comprising the isolated polynucleotide set forth in (i), wherein said plant cell comprises at least one modification which modulates the expression or activity of the polynucleotide or the polypeptide as compared to a control plant cell in which the expression or activity of the polynucleotide or polypeptide has not been modified. |
| US11591608B2 |
Programmable epigenetic control of gene expression in plants
Disclosed herein are artificially synthesized nucleic acid constructs to guide an epigenetic modification for at least partially silencing or activating a target gene in an organism such as a plant or seed, and formulations thereof. Also disclosed are methods of applying such nucleic acid constructs to the plant or to the seed. Also disclosed are engineered seeds and plants obtained by the epigenetic modification. |
| US11591605B2 |
Plant genome editing method
A method for editing a plant genome includes coating a microparticle with at least one type of nucleic acid and/or at least one type of protein, introducing a deletion, insertion, or substitution into a target site in the genome of a plant by bombarding a shoot apex of the plant with the coated microparticle using a gene gun, growing the shoot apex bombarded with the coated microparticle to obtain a plant body, and selecting a genome-edited plant body from the plant body. The shoot apex of the plant is selected from the group consisting of a shoot apex of an embryo of a fully mature seed, a shoot apex of a young bud of a tuber, and a shoot apex of a terminal bud or a lateral bud. |
| US11591600B2 |
Long double-stranded RNA for RNA interference
The present technology relates, in part, to long double-stranded RNA (dsRNA) (e.g., 30 or more base pairs) that inhibits gene expression. |
| US11591599B2 |
Method for the diagnosis, prognosis and treatment of cancer metastasis
This study describes a method to determine the likelihood of the development of metastasis in a subject suffering from cancer, in addition to a method to design a customized therapy in a subject suffering from cancer, in particular breast, colon, lung, kidney and thyroid cancer, based on the determination of the expression level of one or more genes whose expression is modulated by an increase in c-MAF expression. It also describes a method for the identification of marker genes with a propensity for metastatic cancer based on inducing the modulation of the c-MAF expression Finally, the use of PTHLH and PODXL inhibitors and RERG activators in the treatment and/or prevention of the cancer, in particular breast, colon, lung, kidney and thyroid cancer. |
| US11591593B2 |
Screening artificial nucleic acids by particle display
The invention provides xeno-nucleic acid particle display libraries, methods for identifying functional non-natural nucleic acid (XNA) aptamers using the particle display libraries, and compositions comprising XNA aptamers identified by screening candidate molecules using the xeno-nucleic acid particle display libraries. |
| US11591587B2 |
Process for plasminogen purification starting from human plasma
The present invention provides a process for the production of human plasminogen starting from human plasma or a fractionation intermediate thereof. The main stages of the process are: a step of virus inactivation, in which human plasma is contacted with a solvent/detergent mixture, a single affinity chromatographic step and a virus removal nanofiltration step. This process is scalable up to industrial level and it provides, without adding any protease inhibitor, a functional and intact finished product suitable to be administered for the treatment of human diseases due to genetic plasminogen deficiency. |
| US11591580B2 |
K85 mutation-containing plant EPSPS mutant, and encoding gene and application thereof
The invention provides a plant EPSPS mutant (i.e. 5-enolpyruvylshikimate-3-phosphate synthase mutant), which is derived from plant, and has glyphosate resistance after mutation. Also provided is an encoding gene, which can encode the above plant EPSPS mutant; and a vector containing the above encoding gene; and a cell containing the above vector. Further provided are uses of the above plant EPSPS mutant. |
| US11591577B2 |
Method for producing hydroxy-L-pipecolic acid
A novel method of producing high-purity hydroxy-L-pipecolic acids in an efficient and inexpensive manner while suppressing the production of hydroxy-L-proline is provided. The method includes allowing an L-pipecolic acid hydroxylase, a microorganism or cell having the ability to produce the enzyme, a processed product of the microorganism or cell, and/or a culture liquid comprising the enzyme and obtained by culturing the microorganism or cell, to act on L-pipecolic acid as a substrate in the presence of 2-oxoglutaric acid and ferrous ion, wherein the L-pipecolic acid hydroxylase has the properties: (1) the enzyme can act on L-pipecolic acid in the presence of 2-oxoglutaric acid and ferrous ion to add a hydroxy group to the carbon atom at positions 3, 4, and/or 5 of L-pipecolic acid; and (2) the enzyme has a catalytic efficiency (kcat/Km) with L-proline that is equal to or less than 7 times the catalytic efficiency (kcat/Km) with L-pipecolic acid. |
| US11591575B2 |
Compositions and methods for pest control management
Disclosed are genetically modified nudiviruses capable of being sexually transmitted by an insect useful for controlling pest populations. The genetically modified nudiviruses are capable of causing sterility in a target population of insects. Also disclosed are insects infected with the disclosed genetically modified nudiviruses, methods of making the genetically modified nudiviruses, and methods of using the genetically modified nudiviruses to control an insect pest population. |
| US11591574B2 |
Optical-quality surface that imparts spatial control of macrophage fusion
Methods to form a surface coating and surface pattern, which are based on adsorption of hydrocarbon chains that can be used with imaging optics to visualize macrophage fusion and multinucleated giant cell formation with living specimens are described. |
| US11591569B2 |
Methods for epicardial differentiation of human pluripotent stem cells
Methods for generating high-yield, high-purity epicardial cells are described. Wnt/β-catenin signaling is first activated in human cardiac progenitor cells, by, for example, inhibiting Gsk-3 to induce differentiation into epicardial cells. Methods for long-term in vitro maintenance of human cardiac progenitor cell-derived epicardial cells and method comprising chemically defined, xeno-free, and albumin-free culture conditions are also provided. |
| US11591566B2 |
Methods for high throughput sperm sorting
This disclosure relates to methods for sorting sperm cells in a microfluidic chip. In particular, various steps are incorporated to align and orienting sperm in flow channels, as well as, to determining sperm orientation and measure relative DNA content for analysis and/or sorting. |
| US11591564B2 |
Peptide conjugated hydrogel substrate for the maintenance and expansion of human pluripotent stem cells
Compositions useful for propagation of pluripotent stem cells are provided. The compositions comprise a polysaccharide hydrogel linked to a peptide fragment of the extracellular domain of epithelial cadherin. Methods of making the composition, and culturing pluripotent stem cells also are provided. |
| US11591559B2 |
Bioreactor insert and biofilm support, related apparatus and related methods
The disclosure relates to bioreactors, for example for biological treatment and, more specifically to bioreactor insert apparatus including biofilms and related methods. The bioreactor insert apparatus provides a means for circulation of reaction medium within the bioreactor, a biofilm support, and biological treatment of an inlet feed to the reactor/insert apparatus. The bioreactor insert apparatus has a high relative surface area for biofilm attachment and is capable of generating complex flow patterns and increasing treatment efficiency/biological conversion activity in a biologically-active reactor. The high surface area structure incorporates multiple biofilm support structures such as meshes at inlet and outlet portions of the structure. The biofilm support structures and biofilms thereon can increase overall reaction rate of the bioreactor and/or perform some solid/liquid separation in the treatment of the wastewater or other influent. |
| US11591557B2 |
Systems for allergen detection
The present invention is drawn to devices and systems for allergen detection in a sample. The allergen detection system includes a sampler, a disposable analysis cartridge and a detection device with an optimized optical system. In some embodiments, the allergen detection utilizes aptamer nucleic acid molecules as detection agents. In some embodiments, the nucleic acids are conjugated to magnetic beads or solid surfaces such as glasses, microwells and microchips. |
| US11591556B2 |
Stirred tank reactor systems and methods of use
A reactor system includes a support housing having an interior surface bounding a chamber, the chamber having a vertically extending central longitudinal axis. A flexible bag is disposed within the chamber of the support housing and has an interior surface bounding a compartment. A mixing element is disposed within the compartment of the flexible bag. A drive element, such as a drive shaft, is secured the mixing element, wherein the mixing element is laterally offset from and/or is angled relative to the vertically extending central longitudinal axis of the support housing. |
| US11591547B2 |
Biodegradable cleaning composition
The present invention is directed to biodegradable cleaning compositions, in particular hard surface cleaning compositions, and their use. The compositions according to the invention comprise one or more biosurfactants(s), one or more sorbitan ester(s) and one or more further surfactant(s), which is/are neither a biosurfactant nor a sorbitan ester. |
| US11591545B2 |
Method of producing biodiesel
The present invention relates to a method of producing fatty acid alkyl ester from an organic oil source containing at least one free fatty acid, wherein the oil source has an acid number of at least 30 mg KOH/g oil source and wherein the method comprises the steps of a) reacting the oil source with glycerol at a temperature, which does not exceed 180° C. during the reaction, in the presence of a catalyst comprising at least one alkyl or aryl sulfonic acid or an homoanhydride thereof; and b) transesterification of the reaction product from step a) with an alkanol; and c) isolating the fatty acid alkyl ester from the reaction product of step b). |
| US11591544B2 |
Ionizable cationic lipids
The present disclosure provides compounds useful as ionizable cationic lipids. The ionizable cationic lipids are useful for preparing lipid nanoparticles for the delivery of therapeutic nucleic acids to cells. Cationic ionizable lipids were engineered with improved stability to oxidative degradation while in storage. |
| US11591543B2 |
Aroma chemical compositions containing 3,5-diethyl-2-propyl-tetrahydropyran and/or unsaturated derivatives thereof
The present invention relates to aroma chemical compositions containing 3,5-diethyl-2-propyl-tetrahydropyran, a 3,5-diethyl-2-propyl-dihydropyran or a 3,5-diethyl-2-propyl-pyran, a mixture of such compounds, a stereoisomer of one of these compounds, or a mixture of stereoisomers of one or more of these compounds. The invention further relates to a method for preparing such compounds, stereoisomers or mixtures thereof, to the composition obtainable by this method, to the use of such compounds as an aroma chemical or for modifying the scent character of a fragranced composition; and to a method for preparing a fragranced composition or for modifying the scent character of a fragranced composition using said compounds. Moreover, the invention relates to 3,5-diethyl-2-propyl-tetrahydropyran, to its stereoisomers and to mixtures of these stereoisomers. |
| US11591540B2 |
Method for the preparation of dried oleosomes
A method for extracting naturally occurring oil bodies (oleosomes) from a material containing naturally occurring oil bodies (oleosomes) includes the steps of dispersing the material containing oleosomes in an aqueous composition to thereby obtain an aqueous dispersion of material containing oleosomes, extracting oleosomes from the aqueous dispersion of material containing oleosomes to thereby obtain a crude oleosome extract and isolating crude oleosomes from the extract by drying the crude oleosome extract. The dried oleosome powder may be used with a personal care product, a pharmaceutical product or a food product. |
| US11591538B2 |
Cooling and flame-retardant lubricating composition for a propulsion system of an electric or hybrid vehicle
The present invention relates to a composition for lubricating a propulsion system of an electric or hybrid vehicle, comprising at least one base oil and at least one fire retardant corresponding to formula (I) RF-L-RH (I) in which RF is a perfluorinated or partially fluorinated group, RH is a hydrocarbon-based group, and L is a linker. The invention also relates to the use of at least one fire retardant of formula (I), in a composition for lubricating a propulsion system of an electric or hybrid vehicle, including at least one battery, to give it ignition-resistance properties.Finally, the invention relates to a process for cooling and fire-protecting a battery of a propulsion system of an electric or hybrid vehicle, comprising at least one step of placing at least one battery, in particular a lithium-ion or nickel-cadmium battery, in contact with a composition according to the invention. |
| US11591536B2 |
(Per)fluoropolyether polymers
The present invention relates to a novel process for the synthesis of (per)fluoropolyether polymers, to certain novel (per)fluoropolyether polymers. The present invention also relates to the use of the (per)fluoropolyether polymers thus obtained as intermediate compounds for the manufacture of further polymers suitable for use as lubricants, notably for magnetic recording media (MRM). |
| US11591529B2 |
Process for C5+ hydrocarbon conversion
In some examples, hydrocarbon feed and a diluent such as steam are mixed, and heated. A vapor phase product and a liquid phase product can be separated from the heated mixture. The liquid phase product can be hydroprocessed to produce a first hydroprocessed product. A pitch and one or more hydrocarbon products can be separated from the first hydroprocessed product. The pitch can be contacted with a diluent to produce a pitch-diluent mixture. The pitch-diluent mixture can be hydroprocessed to produce a second hydroprocessed product. A hydroprocessor heavy product and a utility fluid product can be separated from the second hydroprocessed product. The diluent can be or include at least a portion of the utility fluid product. The vapor phase product can be steam cracked to produce a steam cracker effluent. A tar product and a process gas that can include ethylene and propylene can be separated from the steam cracker effluent. |
| US11591527B2 |
Processes for producing high octane reformate having high C5+ yield
Provided are novel process for upgrading naphtha and increasing the yield of reformate. Olefinic naphtha and light paraffins are combined and fed to a catalytic fluidized bed reactor maintained at a temperature about 775° F. and about 1250° F. and an operating pressure between about 10 psig and about 500 psig to produce a product comprising at least 1 wt. % higher C5+ hydrocarbon than the combined feed and at least 55 wt. % aromatics. |
| US11591524B2 |
Method of separating and extracting raw materials from asphaltic limestone powder
This invention relates to manufacturing briquettes, pellets and shapes from recycled asphaltic limestone powder derived from waste residential roofing products. Briquettes and pellets are manufactured through a densification process at varying temperatures, creating recycled asphalt pellets, asphalt limestone pellets and bio mass and coal fines briquettes. Various shapes, including curbs and posts, are manufactured through heat and pressure in molds. Seawalls, walkways and wall panels are manufactured by blending asphaltic limestone powders with polymer resins and extruded or pultruded into shapes. |
| US11591523B2 |
Distillation system and method using microwave-assisted pyrolysis
A distillation apparatus for use in microwave-assisted pyrolysis includes a microwave, a pyrolysis reactor, a microwave-absorbent bed, and a condenser. The pyrolysis reactor is located within the microwave and configured to receive a liquid input stream and to output a vapor. The microwave-absorbent bed is located within the pyrolysis reactor that converts microwave energy provided by the microwave to thermal energy to initiate pyrolysis within the pyrolysis reactor, wherein the pyrolysis reactor provides a vapor output. The condenser is configured to receive the vapor output of the pyrolysis reactor and to cool and condense the vapor into a recoverable product. |
| US11591521B2 |
Hermetically sealed flow-through reactor for non-oxidative thermal degradation of a rubber containing waste
Disclosed herein is a hermetically sealed flow-through reactor for non-oxidative thermal degradation of a rubber containing waste into a char product, the reactor having an internal cylindrical surface, and the reactor including: an inlet and an outlet; one or more thermal reaction zones arranged between the inlet and the outlet, wherein each thermal reaction zone is provided with: one or more heating elements controllable to heat the thermal reaction zone to an operating temperature for mediating the non-oxidative thermal degradation of rubber in the rubber containing waste, and one or more gas outlets for withdrawing gas or gases evolved during the non-oxidative thermal degradation of the rubber; and a screw auger located within the reactor, the screw augur configured to rotate in both the forward and reverse directions to agitate and transport the rubber containing waste through the one or more thermal reaction zones in both the forward and reverse directions and to the outlet, wherein flighting on the screw auger tracks the internal cylindrical surface of the reactor in close relationship to minimise or prevent the transport of material through a clearance space between outer edges of the flighting and the internal cylindrical surface of the reactor. |
| US11591520B2 |
Alumina hydrate particles, flame retardant, resin composition and electric wire/cable
The present invention provides alumina hydrate particles, a flame retardant and a resin composition that are each for an electric wire/cable covering material improvable in flame retardancy and mechanical properties while the covering material keeps acid resistance; such an electric wire/cable; and producing methods thereof. The alumina hydrate particles of the present invention for electric wire/cable covering material have an average particle size of 0.5 to 2.5 μm, and having a primary particle variation R of 24% or less, the variation R being represented by the following expression: primary particle variation R (%)=“standard deviationσ(μm) of major axis diameters of the primary particles”/“average value(μm) of the major axis diameters of the primary particles”×100. |
| US11591519B2 |
Polymerizable liquid crystal composition and retardation plate
A polymerizable liquid crystal composition containing two polymerizable liquid crystal compounds (A) and (B) is provided. A polymer of compound (A) exhibits a reverse wavelength dispersion property and the phase difference value [R(A,3000,450)] at a wavelength of 450 nm measured after irradiation in an oriented state with ultraviolet ray at 3000 mJ/cm2 varies in a positive sense relative to the phase difference value [R(A,500,450)] at a wavelength of 450 nm measured after irradiation in an oriented state with ultraviolet ray at 500 mJ/cm2. A polymer of compound (B) exhibits a reverse wavelength dispersion property and the phase difference value [R(B,3000,450)] at a wavelength of 450 nm measured after irradiation in an oriented state with ultraviolet ray at 3000 mJ/cm2 varies in a negative sense relative to the phase difference value [R(B,500,450)] at a wavelength of 450 nm measured after irradiation in an oriented state with ultraviolet ray at 500 mJ/cm2. |
| US11591517B2 |
Luminescent material including a rare earth halide and an apparatus including such material
A luminescent material can include a rare earth halide having a chemical formula of RE(1-A-B-C)HTADETBSETCXz, wherein RE is a rare earth element, HT is an element or an interstitial site that provides a hole trap, DET is a dopant that provides a relatively deep electron trap, SET is a dopant that provides a relatively shallow electron trap, X is one or more halides, each of A, B, and C has a value greater at least 0.00001 and at most 0.09, and Z has a value in a range of 2 to 4. In an embodiment, a ratio of B:C is selected so that luminescent material has good linearity performance. In another embodiment, the ratio of B:C can be in a range of 10:1 to 100:1. |
| US11591516B2 |
Luminescent group 1A copper halides and uses thereof
High photoluminescence, high stability, inorganic perovskite compounds comprising an alkali metal selected from potassium (K), rubidium (Rb), and cesium (Cs); copper (Cu); and at least one halogen selected from chlorine (Cl), bromine (Br), and iodine (I). The perovskites may be free of lead (Pb). The inorganic perovskite compound may be used in an optoelectronic device. The optoelectronic device optionally contains a phosphor such as a blue-emitting phosphor. The inorganic perovskite compound may be used as an anti-counterfeiting nanotaggant applied on or within an object that susceptible to counterfeiting to enable confirmation of an authentic object. |
| US11591512B2 |
Using acidic balls for acid stimulation in carbonate reservoirs
A method for acid treatment of a wellbore in a carbonate formation is provided. The method includes dropping spacer solids into the well to fill the wellbore to perforations in a casing, dropping acidic solids into the wellbore on the top of the spacer solids, allowing the acidic solids to dissolve on top of the spacer solids forming an acidic solution, and injecting water into the wellbore to force the acidic solution into the carbonate formation. |
| US11591507B2 |
Drilling fluids that include water-soluble acid catalysts and uses for such
In accordance with one or more embodiments of the present disclosure, a drilling fluid may include a base fluid, one or more formaldehyde-based resins, and one or more water-soluble acid catalysts. The base fluid may include an aqueous or non-aqueous solution. The one or more water-soluble acid catalysts may be present in an amount sufficient to reduce the pH of the drilling fluid to less than or equal to 6. The present disclosure also describes sealed subterranean petroleum formations that include such drilling fluids and methods for sealing subterranean wellbores by utilizing such drilling fluids. |
| US11591506B2 |
Method for making and using a drilling fluid
A drilling fluid and method for drilling in a coal containing formation. The method includes: providing a mixed metal-viscosified drilling fluid including at least 1% potassium salt; circulating the drilling fluid through the well; and drilling into a coal seam. |
| US11591503B2 |
Shape memory material with improved mechanical properties
A composition includes an epoxy-based curable adhesive having at least one an epoxy resin modified acrylonitrile-butadiene copolymer and at least one thermoplastic elastomer. The at least one thermoplastic elastomer is present in the curable adhesive as a penetrating polymer network. Further, an expandable article is composed of the composition, a reinforcing element includes a support and an expandable article, a method for reinforces cavities of structural components, and the composition is used as a shape memory material. |
| US11591500B2 |
Adhesive having a long processing time and stable viscosity
A polymerizable adhesive composition containing an olefinically functionalized carbohydrate, a polymerizable liquid monomer, and optionally at least one polymerization initiator or initiator system is described. The adhesive composition is particularly well suited for adhering plastic components as well as is preferably provided with sufficiently long processing time for adhering artificial teeth on denture bases. The viscosity of the adhesive composition may be adjusted to the respected processing conditions. |
| US11591499B2 |
Anisotropic conductive film
An anisotropic conductive film, capable of connecting a terminal formed on a substrate having a wavy surface such as a ceramic module substrate with conduction characteristics stably maintained, includes an insulating adhesive layer, and conductive particles regularly arranged in the insulating adhesive layer as viewed in a plan view. The conductive particle diameter is 10 μm or more, and the thickness of the film is 1 or more times and 3.5 or less times the conductive particle diameter. The variation range of the conductive particles in the film thickness direction is less than 10% of the conductive particle diameter. |
| US11591493B2 |
Curable compositions
Heterocyclic-functional resins, such as epoxides, oxetanes, cyclic carbonates, lactides and lactones, are used in radiation-curable formulations along with ethylenically unsaturated materials such as (meth)acrylates to achieve improved mechanical properties and/or lower shrinkage in the cured compositions prepared therefrom as compared to formulations containing the ethylenically unsaturated materials but no heterocyclic-functional resin. Polymerizable, ethylenically unsaturated metal complexes, such as Zn and Ca carboxylates prepared using unsaturated carboxylic acids or anhydrides, may be employed to effect thermal cure of the heterocyclic-functional resin component of such formulations, which are particularly useful in the production of 3D-printed articles and the like. |
| US11591490B2 |
Aqueous ink jet ink composition and ink jet recording method
An aqueous ink jet ink composition is for use in an ink jet recording method. The method includes ejecting ink from an ink jet head including nozzles. The nozzles are configured such that a shape of a side wall surface is a scalloped shape in which a scallop width S1 and a notch depth S2 satisfy S1/S2≥4. The aqueous ink jet ink composition includes a pigment and a solvent that contains a specific compound. |
| US11591487B2 |
Curable resin composition comprising a phthalonitrile oligomer and a prepolymer thereof
A curable resin composition includes a phthalonitrile oligomer, and a prepolymer thereof. According to the present invention, a curable resin composition, which has melt viscosity that can be controlled within a wide range, and thus, can be applied in a larger number of fields. |
| US11591486B2 |
Three-dimensional printing
An example of a three-dimensional (3D) printing kit includes a build material composition and a fusing agent to be applied to at least a portion of the build material composition during 3D printing. The build material composition includes a polyamide having a melt enthalpy ranging from greater than 5 J/g to less than 150 J/g. The fusing agent includes an energy absorber to absorb electromagnetic radiation to coalesce the polyamide in the at least the portion. The fusing agent is a core fusing agent and the energy absorber has absorption at least at wavelengths ranging from 400 nm to 780 nm; or the fusing agent is a primer fusing agent and the energy absorber is a plasmonic resonance absorber having absorption at wavelengths ranging from 800 nm to 4000 nm and having transparency at wavelengths ranging from 400 nm to 780 nm. |
| US11591484B1 |
Resin formulations for additive manufacturing of metals, and methods of making and using the same
Some variations provide a composition for additive manufacturing (3D printing) of metals, comprising: from 10 vol % to 70 vol % of a photocurable liquid resin; from 10 vol % to 70 vol % of metal or metal alloy particles, optionally configured with a photoreflective surface; and from 0.01 vol % to 10 vol % of a photoinitiator. Other variations provide a composition for additive manufacturing of metals, comprising: from 1 vol % to 70 vol % of a photocurable liquid resin; from 0.1 vol % to 98 vol % of an organometallic compound containing a first metal; from 1 vol % to 70 vol % of metal or metal alloy particles containing a second metal (which may be the same as or different than the first metal); and from 0.01 vol % to 10 vol % of a photoinitiator. Many examples of metals, photocurable resins, organometallic compounds, photoinitiators, and optional additives are disclosed, and methods of making and using the composition are described. |
| US11591483B2 |
Aqueous based nanoparticle ink
Water-based nanoparticle inks may be formulated to be compatible with printed electronic direct-write methods. The water-based nanoparticle inks may include a functional material (nanoparticle) in combination with an appropriate solvent system. A method may include dispersing nanoparticles in a solvent and printing a circuit in an aerosol jet process or plasma jet process. |
| US11591479B2 |
Primer coating agent system for plastic substrates
The present disclosure relates to a primer coating material composition, obtainable by combining at least two components (A) and (B) of a coating material system, which are different from one another and present separately from one another, with component (B) being nonaqueous and including at least one polyisocyanate having more than two free isocyanate groups, at least one organic solvent, and, further, at least one Si-containing compound which contains at least one hydrolyzable radical and at least one non-hydrolyzable organic radical, for at least partial application to at least one optionally pretreated surface of a plastics substrate, to a method for producing a corresponding coating on such a substrate, and to a method for at least partially coating at least one surface of a plastics substrate with a multicoat paint system. |
| US11591478B2 |
Silicon material and method of manufacture
A silicon material can include a silicon aggregate comprising a plurality of porous silicon nanoparticles welded together. The silicon aggregate can optionally have a polyhedral morphology. A method can include: receiving a plurality of porous silicon nanoparticles and cold welding the plurality of porous silicon nanoparticles into an aggregated silicon particle. |
| US11591474B2 |
Formulations and products to replace single-use plastics and polystyrene with bio-benign materials such as agricultural wastes
The present invention provides methods for preparing the nut waste pot composites from a nut waste component, one or more binders, and an oil using a compounder/extruder. |
| US11591472B2 |
Wax-organic extender emulsion and method for manufacture thereof
A wax-extender emulsion including a plurality of wax-extender complex particles suspended in water is described. A wax-extender complex includes a wax component, an organic extender component and a surfactant that stabilizes the wax component and the organic extender component collectively to form the wax-extender complex. The wax-extender emulsion comprises from 2 wt % to 30 wt % organic extender. During manufacturing, the organic extender and wax component are emulsified and homogenized together to produce the wax-extender emulsion. The wax-extender emulsion can be co-applied as a mixture with adhesive resin during wood-based composite manufacturing. |
| US11591469B2 |
Resin composition and article made therefrom
A resin composition includes a first prepolymer and a second prepolymer, the first prepolymer being prepared from a first mixture subjected to a prepolymerization reaction, the second prepolymer being prepared from a second mixture subjected to a prepolymerization reaction, wherein the first mixture includes a maleimide resin and a benzoxazine resin, and the second mixture includes a maleimide resin and a bis(trifluoromethyl)benzidine. The resin composition may be used to make various articles, such as a prepreg, a resin film, a laminate or a printed circuit board, and at least one of the following properties can be improved, including copper foil peeling strength, dissipation factor, ratio of thermal expansion, cure shrinkage and glass transition temperature. |
| US11591462B2 |
Styrenic copolymer blend with low shrinkage
The invention relates to polymer blends of a styrene copolymer A selected from the group consisting of styrene acrylonitrile copolymers (SAN), styrene acrylonitrile maleic anhydride terpolymers (SMA), styrene acrylic copolymers, acrylonitrile butadiene styrene terpolymers (ABS), acrylonitrile butadiene styrene terpolymers with polyamide (ABS/PA), and acrylonitrile styrene acrylate terpolymers (ASA); and at least one copolymer B selected from the group consisting of styrene-butadiene block copolymers (SBC) and styrene-isoprene block copolymers (SIS); wherein the mold shrinkage of the polymer blend is reduced by at least 5% compared to the mold shrinkage of the pure styrene copolymer A.A process for the preparation of the polymer blends and the uses of the polymer blends in an injection molding process are described. |
| US11591458B2 |
Polyolefins with low ash content and method of making same
A polymerization process includes contacting an olefin or a mixture of the olefin and one or more copolymerizable comonomers under polymerization conditions with a catalyst composition and forming a polymer with a total ash content of less than 15 ppm. The catalyst composition includes one or more polymerization catalysts; and a mixed external electron donor comprising a selectivity control agent comprising at least one silicon-containing compound containing at least one C1-C10 alkoxy group bonded to a silicon atom. |
| US11591457B1 |
Composite material including three-dimensional (3D) graphene and maleated copolymers
A composite material includes a combination including a thermoplastic resin mixed with a polypropylene-graft-maleic anhydride (PPgMA), and a plurality of carbon particles mixed in the combination. The plurality of carbon particles may include a first region having a relatively low concentration of carbon particles, and a second region having a relatively high concentration of carbon particles, at least some of the plurality of carbon particles having exposed carbon surfaces with carbon atoms bonded to molecular sites on adjacent PPgMA molecules and oxidized with one or more oxygen-containing groups. In some aspects, composite material further includes between 80 wt. % and 90 wt. % of the thermoplastic resin, between 0.5 wt. % and 15 wt. % of the PPgMA, and between 0.1 wt. % to 7 wt. % of carbon particles. The composite material may also include a plurality of pores, formed in the combination, and configured to be infiltrated by the PPgMA. |
| US11591452B2 |
Emulsifier particles and methods for making and using same
Emulsifier particles and methods for making and using same. The emulsifier particles can include an alkali metal salt or an alkaline earth metal salt of a carboxylic acid terminated fatty amine condensate, an alkali metal salt or an alkaline earth metal salt of a modified tall oil, or a blend of an alkali metal salt or an alkaline earth metal salt of a carboxylic acid terminated fatty amine condensate and an alkali metal salt or an alkaline earth metal salt of a modified tall oil. The emulsifier particles can have a BET specific surface area of about 0.3 m2/g to about 1 m2/g. The method for making the emulsifier particles can include reducing a size of an emulsifier solid via a mechanical attrition process to produce the emulsifier particles. |
| US11591450B2 |
Method for stabilizing halogen-free thermoplastic recyclates, stabilized plastic compositions, and molding compounds and molded parts produced therefrom
The invention relates to a method for stabilizing halogen-free thermoplastic recyclates or pre-damaged plastics against oxidative, thermal, and/or actinic degradation. In the method according to the invention, at least one alditol or cyclitol is introduced into a halogen-free thermoplastic recyclate as a component, and optionally in addition thereto, at least one primary antioxidant and/or at least one secondary antioxidant is introduced into a halogen-free thermoplastic recyclate. By virtue of the method according to the invention, plastic recyclates can be stabilized against oxidative, thermal, and/or actinic degradation with a high degree of effectiveness and in a very environmentally friendly and inexpensive manner. The invention additionally relates to corresponding recyclate-based plastic compositions, to molding compound and molded parts produced therefrom, to stabilizer compositions, and to the use thereof for stabilizing halogen-free thermoplastic recyclates against oxidative, thermal, and/or actinic degradation. |
| US11591448B2 |
Physical reutilization of siliconized sheets
The method for the physical reutilization of sheet-like siliconized structures comprises treating the sheet-like siliconized structure in a liquid digestion system comprising acetic anhydride and/or an acetoxysiloxane, and at least one Brønsted acid, optionally solvent, preferably with addition of acetic acid, and removing the desiliconized sheet-like structure from the liquid phase. |
| US11591446B2 |
Polymer-based foam compositions comprising inorganic particulate fillers
There is disclosed a polymer-based foam composition comprising a polymer and up to 20 M.-% particles of one or more inorganic particulate materials, based on the total weight of the composition, wherein the one or more inorganic particulate materials comprise less than 20 wt.-% Al, calculated as Al2O3-content. According to one aspect, the one or more inorganic particulate materials comprise phyllosilicates. Also part of the present invention is the use of such polymer-based foam compositions and their method of production. |
| US11591442B2 |
Materials with programmable properties controlled by light
Disclosed are methods, compositions, reagents, systems, and kits to prepare materials with viscoelastic properties that respond to irradiation with light. Various embodiments show that bio-inspired histidine:transition metal ion complexes allow precise and tunable control over the viscoelastic properties of polymer networks containing these types of crosslinks pre and post-irradiation. These materials have the potential to aid biomedical materials scientists in the development of materials with specific stress-relaxing or energy-dissipating properties. |
| US11591437B2 |
Polycarbonate diol, polycarbonate diol-containing composition, polycarbonate diol production method, and polyurethane
Provided is a polycarbonate polyol used as a raw material of a polyurethane that yields a polyurethane solution having good storage stability and exhibits excellent flexibility and solvent resistance. This polycarbonate polyol is a polycarbonate diol that includes structural units represented by the following Formulae (A) and (B), wherein, R1 and R2 each independently represent an alkyl group having 1 to 4 carbon atoms and, in this range of the number of carbon atoms, optionally have an oxygen atom, a sulfur atom, a nitrogen atom, a halogen atom, or a substituent containing these atoms; and R3 represents a linear aliphatic hydrocarbon having 3 or 4 carbon atoms. This polycarbonate diol has a molecular weight of 500 to 5,000, and the value of the following Formula (I) is 0.3 to 20.0: (Content ratio of branched-chain moiety in polymer)/(Content ratio of carbonate group in polymer)×100(%) (I). |
| US11591436B2 |
Polyurethane article and methods of making the same
Articles are provided including at least one polyurethane prepared from: (a) about 1 equivalent of at least one polyisocyanate; (b) about 0.005 to about 0.35 equivalent of at least one polycaprolactone polyol; (c) about 0.01 to about 1.0 equivalent of at least one polyol selected from the group consisting of ethylene glycol, diethylene glycol, triethylene glycol, tetraethylene glycol, 1,2-ethanediol, propanediol, butanediol, pentanediol, hexanediol, heptanediol, octanediol, nonanediol, decanediol, dodecane diol, octadecanediol, cyclopentanediol, 1,4-cyclohexanediol, cyclohexanedimethanol, 1,4-benzenedimethanol, xylene glycol, hydroxybenzyl alcohol, dihydroxytoluene, bis(2-hydroxyethyl) terephthalate, 1,4-bis(hydroxyethyl)piperazine, N,N′,bis(2-hydroxyethyl)oxamide and mixtures thereof; and (d) about 0.01 to about 0.5 equivalent of at least one polyol selected from the group consisting of glycerol, tetramethylolmethane, trimethylolethane, trimethylolpropane, erythritol, pentaerythritol, dipentaerythritol, tripentaerythritol, sorbitan, and mixtures thereof, each based upon the about 1 equivalent of the at least one polyisocyanate, wherein the article has a Gardner Impact strength of at least about 400 in-lb according to ASTM D-5420-04. |
| US11591435B2 |
Polycarbodiimide compound, production method therefor, and resin composition
There are provided a carbodiimide compound excellent in storage stability, and performance as a crosslinking agent, and a method for producing the same, and a resin composition excellent in the film forming properties and solvent resistance of a coating made at low temperature. A polycarbodiimide compound derived from an aliphatic diisocyanate compound having at least one primary isocyanate group, the polycarbodiimide compound having a structure in which all ends are capped with an organic compound having a functional group that reacts with an isocyanate group, carbodiimide group concentration A (%) and weight average molecular weight Mw satisfying the following formula (1), and a resin composition comprising the carbodiimide compound and an aqueous resin having a predetermined acid value at a predetermined ratio. (A/Mw)×1000≥0.55 (1). |
| US11591432B2 |
Aqueous polymer dispersion and preparation method thereof
The present invention relates to an aqueous polymer dispersion containing a multistage emulsion polymer particle. The multistage emulsion polymer particle contains a polysiloxane formed in the first stage; a transition layer formed in the second stage; and a polyacrylate formed in the third stage. The transition layer is made of silane coupling agents. The present invention also relates to a method of preparing the aqueous polymer dispersion and use of the aqueous polymer dispersion for preparing coatings. |
| US11591431B2 |
Milling blank for the production of medical-technical molded parts
This disclosure relates to a milling blank for the production of medical-technical molded parts, in particular dental splints or ear molds, as well as a method for the production of such a blank. |
| US11591426B2 |
Copolymer, wetting agent, medical device, and method for producing same
Disclosed are: a polymer for treating the surface of a medical device such as a contact lens to suppress the reduction in lubricity of the device even when the device is scrubbed; a medical device having the polymer on the surface so that the reduction in lubricity over time is suppressed; and a wetting agent containing the polymer. The polymer for treating the surface is a copolymer which is water-soluble and includes as constitutional units the following monomers A and B: monomer A: a monomer containing a (meth)acryloyl group and an ester or amide structure in a molecule, in which the ester or amide structure is not constituted by including a part of the (meth)acryloyl group; monomer B: a monomer containing a (meth)acrylamide group in a molecule and having a structure different from that of the monomer A. |
| US11591425B2 |
Curable compositions and uses thereof
Curable compositions having desirable attributes such as rapid curing rates and enhanced physical properties are prepared using admixtures of one or more (meth)acrylate-functionalized compounds and one or more reactive comonomers, such as 1,1-diester-1-alkenes (e.g., methylene malonates), 1,1-diketo-1-alkenes, 1-ester-1-keto-1-alkenes and/or icatonates. |
| US11591424B2 |
Method for producing water-absorbing polymer particles by suspension polymerization
A process for producing water-absorbing polymer particles by suspension polymerization and thermal surface postcrosslinking, wherein the base polymer obtained by suspension polymerization has a centrifuge retention capacity of at least 37 g/g and the thermal surface postcrosslinking is conducted at 100 to 190° C. |
| US11591422B2 |
EPDM terpolymer and manufacturing method therefor
A method can be used for manufacturing an ethylene-propylene-diene terpolymer for a fuel cell. A polymerization step includes subjecting an organic chelate compound forming a coordinate bond, a vanadium-based Ziegler-Natta catalyst, an organoaluminum compound, and ethylene, propylene, and diene monomers, together with a solvent, to polymerization in a reactor. A separation step includes recovering residual catalysts and unreacted monomers from the stream discharged from the reactor. An acquisition step includes recovering the solvent from the stream deprived of the residual catalysts and unreacted monomers to acquire the ethylene-propylene-diene terpolymer. |
| US11591418B2 |
POSS-TX nano-photo-initiator synthesis and in situ photochemical Ag nano-particle synthesis with the help of POSS-TX and wrinkled surface formation
The present invention particularly relates to synthesizing photo-initiators having poly-oligo-silsesquioxane (POSS) structure and realizing photo-polymerization by using these photo-initiators and simultaneous and in-situ synthesis of Ag nano-particles in polymer matrix comprising POSS structure and obtaining wrinkled surfaces as a result of self-arranging thereof. |
| US11591417B2 |
Deactivation methods for active components from gas phase polyolefin polymerization processes
Provided herein are methods and systems for at least partially deactivating at least one component of a reactor effluent from gas phase polyolefin polymerization processes utilizing at least one glycol. |
| US11591413B2 |
Swelling of starch suspensions
A methodology useful for predicting the texture of a heated starch suspension by predicting the storage modulus (G′) of the starch suspension resulting from starch granule swelling during heating has been developed. The methodology is based on the physical properties of the starch granules in the starch suspension and the temperature history of the heated starch suspension. |
| US11591404B2 |
Treatment of cancer using a CD123 chimeric antigen receptor
The invention provides compositions and methods for treating diseases associated with expression of CD123. The invention also relates to chimeric antigen receptor (CAR) specific to CD123, vectors encoding the same, and recombinant cells comprising the CD123 CAR. The invention also includes methods of administering a genetically modified cell expressing a CAR that comprises a CD123 binding domain. |
| US11591403B2 |
IL-23R antagonists to reprogram intratumoral T regulatory cells into effector cells
Provided by the disclosure are compositions and methods for modulating differentiation of regulatory T cells. In some embodiments, methods include selectively decreasing IL-23R activity and/or IL-23R expression without significantly decreasing IL-12RP activity and/or IL-12RP expression. |
| US11591400B2 |
B7-H3 directed antibody drug conjugates
The present invention is directed to novel B7-H3-binding molecules capable of binding to human and non-human B7-H3, and in particular to such molecules that are cross-reactive with B7-H3 of a non-human primate (e.g., a cynomolgus monkey). The invention additionally pertains to B7-H3-binding molecules that comprise Variable Light Chain and/or Variable Heavy Chain (VH) Domains that have been humanized and/or deimmunized so as to exhibit a reduced immunogenicity upon administration to recipient subjects. The invention particularly pertains to bispecific, trispecific or multispecific B7-H3-binding molecules, including bispecific diabodies, BiTEs, bispecific antibodies, trivalent binding molecules, etc. that comprise: (i) such B7-H3-binding Variable Domains and (ii) a domain capable of binding to an epitope of a molecule present on the surface of an effector cell. The invention is also directed to pharmaceutical compositions that contain any of such B7-H3-binding molecules, and to methods involving the use of any of such B7-H3-binding molecules in the treatment of cancer and other diseases and conditions. The invention also particularly pertains to a molecule that comprises the human B7-H3 binding domain of a humanized anti-human B7-H3 antibody conjugated to at least one drug moiety (a “B7-H3-ADC”). The invention is also directed to pharmaceutical compositions that contain such B7-H3-ADCs, and to methods involving the use of any of such B7-H3-ADCs in the treatment of cancer and other diseases and conditions. |
| US11591397B2 |
Bispecific antibody molecules binding to CD3 and EGFRvIII
The present invention generally relates to antibodies that bind to CD3, including multi specific antibodies e.g. for activating T cells. In addition, the present invention relates to polynucleotides encoding such antibodies, and vectors and host cells comprising such polynucleotides. The invention further relates to methods for producing the antibodies, and to methods of using them in the treatment of disease. |
| US11591394B2 |
Single domain antibodies targeting CD1d
The invention relates to compounds, in particular polypeptides that specifically bind to the non-classical MHC protein CD1d and modulate CD1d-mediated biological functions. The invention in particular relates to such compounds and polypeptides comprising or consisting of at least one single domain antibody, and wherein at least one single domain antibody specifically binds to CD1d. Also provided is for methods and use employing such compounds, polypeptides and/or single-domain antibodies. |
| US11591390B2 |
SIRP-α binding proteins and methods of use thereof
Provided herein are compositions, methods and uses involving antibodies that specifically bind to signal regulatory protein-α (SIRPα) and modulate the activity of SIRPα. |
| US11591385B2 |
Methods and compositions for the generation and use of humanized conformation-specific phosphorylated tau antibodies
The present disclosure relates generally to conformation-specific antibodies that can bind to and neutralize the activity of phosphorylated-Threonine 231-tau protein (pT231-tau). The antibodies of the present technology are useful in methods for treating a neurological disorder associated with elevated cis-pT231-tau protein expression in a subject in need thereof. |
| US11591383B2 |
Method for selecting polypeptide producing cells
Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31). |
| US11591377B2 |
Heterologous administration of tau vaccines
Methods for inducing an immune response against tau protein in a subject suffering from a neurodegenerative disease, disorder or condition, such as Alzheimer's Disease, are described. The methods include administering a liposomal priming composition containing tau peptides, preferably phosphorylated tau peptides, and a conjugate boosting composition containing tau peptides, preferably phosphorylated tau peptides, conjugated to an immunogenic carrier. |
| US11591376B2 |
Over-expression of AZF1 improves the rate of anaerobic xylose fermentation in engineered yeast strains
The present invention provides an isolated AZF1 gene sequence, recombinant vectors, and recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast with isolated AZF1 gene sequence useful for biofuel production are also provided. |
| US11591374B2 |
Recombinant Escherichia coli and application thereof in screening erythritol-producing strains
The present disclosure discloses recombinant Escherichia coli and application thereof in screening erythritol-producing strains, and belongs to the technical field of microorganisms. The recombinant Escherichia coli used in a method for screening an erythritol-producing strain disclosed by the present disclosure can well perform positive correlation induction on erythritol with different concentrations, so that the method for screening the erythritol-producing strain has the advantage of high sensitivity. High-concentration glucose is usually adopted as a fermentation substrate when erythritol is produced in a fermentation mode in the industry, but the method for screening the erythritol-producing strain disclosed by the present disclosure can overcome the interference of the high-concentration glucose, and under the interference of the high-concentration glucose, the recombinant Escherichia coli used in the method for screening the erythritol-producing strain can still well perform positive correlation induction on erythritol with different concentrations, and the correlation is higher than that without the interference of the glucose. Therefore, the method for screening the erythritol-producing strain has the advantage of strong anti-interference capability. |
| US11591372B2 |
Recombinant human/bovine parainfluenza virus 1 (HPIV1) expressing a chimeric RSV/HPIV1 F protein and uses thereof
Recombinant paramyxoviruses including a viral genome encoding a heterologous gene are provided. In several embodiments, the recombinant paramyxovirus is a recombinant parainfluenza virus, such as a recombinant PIV3 including a viral genome encoding a heterologous respiratory syncytial virus F ectodomain linked to the transmembrane domain and the cytoplasmic tail of the F protein from the PIV3. Nucleic acid molecules including the genome of a recombinant paramyxoviruses are also provided. The recombinant viruses may advantageously be used in vaccine formulations, such as for vaccines against parainfluenza virus and respiratory syncytial virus. |
| US11591369B2 |
Alpha(v)beta(6) integrin-binding peptides and methods of use thereof
The present invention provides peptides and peptide-conjugates that bind to αvβ6 integrin. The peptide-conjugates can be used for a variety of imaging and therapeutic applications. Methods of use and peptide optimization are also provided herein. |
| US11591364B2 |
Saponin purification
Saponin extracts containing at least 93% QS-21 main peak and 0.25-3% 2018 component by UV absorbance at 214 nm, methods for making said extracts, their use as vaccine adjuvants and related aspects. |
| US11591359B2 |
Enzyme-specific intracellularly-retained red fluorescent probe
It is an object of the present invention to provide a fluorescence imaging probe capable of selectively visualizing target cells such as cells expressing β-galactosidase (lacZ expressing cells) at a single-cell level in a red fluorescence region, and of performing co-staining together with GFP.An intracellularly-retainable red fluorescent probe comprising a compound represented by the following formula (I) or a salt thereof: wherein: A represents a monovalent group cleaved by an enzyme; R1 represents a hydrogen atom, or one to four of the same or different substituents bonded to a benzene ring; R3, R4, R5, and R6 each independently represent —CFR10R11, —CF2R12, a hydrogen atom, a hydroxyl group, an alkyl group, or a halogen atom, wherein at least one of R3, R4, R5, and R6 is —CFR10R11 or —CF2R12; R2 and R7 each independently represent a hydrogen atom, a hydroxyl group, an alkyl group, or a halogen atom; R8 and R9 each independently represent a hydrogen atom or an alkyl group; R10, R11, and R12 each independently represent a hydrogen atom, an alkyl group, or an alkenyl group; X represents Si(Ra) (Rb), wherein Ra and Rb each independently represent a hydrogen atom or an alkyl group; and Y is —C(═O)— or —RcC(═O)—, wherein Rc is an alkylene group having 1-3 carbon atoms. |
| US11591357B2 |
Payload and linker designs for platinum-acridine anticancer agents and methods thereof
The present invention relates to payloads containing functionalized platinum-(benz)acridine hybrid agents as cytotoxic warheads and a method of synthesizing the payloads. The payload can be regioselectively conjugated to a biologically active moiety in order to facilitate the delivery and/or enhance the activity of the platinum compound. |
| US11591354B2 |
Thiamine compound, preparation method and pharmaceutical composition thereof
The embodiments of the present invention provide a series of thiamine compounds having a hydrocarbon group or a substituted hydrocarbon group attached at (I), wherein the compounds have an inhibitory effect on Aβ40 and/or Aβ42. |
| US11591351B2 |
Benzyl compound
The purpose of the present invention is to provide a protecting group which improves the solubility of a compound having a functional group protected with the protecting group in an organic solvent and which is easily separated and purified after a reaction with avoiding solidification or insolubilization. Provided is a benzyl compound represented by Formula (1) where X1 represents —CH2OR14 (where R14 represents a hydrogen atom, a halogenocarbonyl group, or an active ester-type protecting group), —CH2NHR5 (where R15 represents a hydrogen atom, a linear or branched alkyl group having 1 to 6 carbon atoms, or an aralkyl group), a halogenomethyl group, a methyl azide group, a formyl group, or an oxime; and at least one of R1, R2, R3, R4, and R5 is a group represented by Formula (2), and the remainders each represent a hydrogen atom, a halogen atom, an alkyl group having 1 to 4 carbon atoms, or an alkoxy group having 1 to 4 carbon atoms, where R6 represents a linear or branched alkylene group having 1 to 16 carbon atoms; X2 represents O or CONR16 (where R16 represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms); and A represents a group represented by Formula (3), (4), (5), (6), (7), (8), (9), (10), (11), (12), or (13). |
| US11591348B2 |
Organogold nonlinear optical chromophores
An organogold nonlinear optical chromophore includes gold(I) complexed with a benzothiazolyl-substituted fluorophore and optionally an organophosphine ligand or an N-heterocyclic carbene ligand. |
| US11591346B2 |
Method of treatment of symptoms of menopause
The present invention generally relates to novel pharmaceutical formulations containing 2-[3,5-Bis(trifluoromethyl)phenyl]-N-{4-(4-fluoro-2-methylphenyl)-6-[(7S,9aS)-7-(hydroxymethyl)hexahydropyrazino[2,1-c][1,4]oxazin-8(1H)-yl]-3-pyridinyl}-N,2-dimethylpropanamide, methods of preparation thereof and their use in medical therapy. |
| US11591345B2 |
Polymorphs and solid forms of (s)-2-((2-((s)-4-(difluoromethyl)-2-oxooxazolidin-3-yl)-5,6-dihydrobenzo[f]imidazo[1,2-d][1,4]oxazepin-9-yl)amino)propanamide, and methods of production
The present invention relates to crystalline polymorph forms of (S)-2-((2-((S)-4-(difluoromethyl)-2-oxooxazolidin-3-yl)-5,6-dihydrobenzo[f]imidazo[1,2-d][1,4]oxazepin-9-yl)amino)propanamide (GDC-0077), having the structure, Formula I: or stereoisomers, geometric isomers, tautomers, and pharmaceutically acceptable salts thereof, and processes of preparing the polymorph forms. |
| US11591344B2 |
Compound with anticancer activity
A compound having anticancer activity, or a pharmaceutically acceptable salt thereof is provided. Used is a compound represented by the following formula (I) or a pharmaceutically acceptable salt thereof: (wherein, L1 and L2 are the same or different and each represents a group represented by one formula selected from the group consisting of formulas (A) to (F), and S represents a group represented by one formula selected from the group consisting of formulas (S1) to (S18)). |
| US11591341B2 |
Bicyclic and tricyclic compounds
Provided herein are compounds of Formula (I), or pharmaceutically acceptable salts thereof, pharmaceutical compositions that include a compound described herein (including pharmaceutically acceptable salts of a compound described herein) and methods of synthesizing the same. Also provided herein are methods of treating diseases and/or conditions with a compound of Formula (I), or a pharmaceutically acceptable salt thereof. |
| US11591336B2 |
Substituted pyrazolo[3,4-b]pyrazines as SHP2 phosphatase inhibitors
The present disclosure relates to compounds of formula (I) and pharmaceutical compositions thereof and methods for inhibiting the activity of SHP2 phosphatase with the compounds and compositions of the disclosure. The present disclosure further relates to, but is not limited to, methods for treating disorders associated with SHP2 deregulation with the compounds and compositions of the disclosure. |
| US11591333B2 |
Substituted pyrrolo[2,3-d]pyrimidines as janus kinase inhibitors
The present invention provides a method for preparing a pyrrolopyrimidine compound and application thereof. Specifically, the present invention provides a compound represented by formula I or pharmaceutically-acceptable salts thereof, a pharmaceutical composition containing the compound or its salts, and a method for preparing the pharmaceutical composition and an application of the pharmaceutical composition as an immunosuppressive drug. |
| US11591328B2 |
Highly active CSF1R inhibitor compound
The present invention relates to a CSF1R inhibitor, and in particular to a highly active CSF1R inhibitor compound having the structure of formula (I). Said compound of the present invention has high inhibitory activity on CSF1R. |
| US11591325B2 |
2-polysubstituted aromatic ring-pyrimidine derivatives, preparation and medical application thereof
The present invention provides a 2-polysubstituted aromatic ring-pyrimidine derivative and an optical isomer thereof, or a pharmaceutically acceptable salt or solvate thereof, the compound, and an optical isomer thereof or a pharmaceutically thereof acceptable salts or solvates can be used in the preparation of anti-tumor drugs. The invention designs and synthesizes a series of novel small molecule Chk1 inhibitors by using N-substituted pyridin-2-aminopyrimidine obtained by structure-based virtual screening as a lead compound, and carries out Chk1 kinase inhibitory activity test. The experiment confirmed that said compounds possess potent anticancer activity, Chk1 kinase inhibitory activity, and are promising Chk1 inhibitors, and can be used as new cancer therapeutic drugs, which can be applied to treat solid tumors or hematologic tumors related to proliferative disease of human or animal. The 2-polysubstituted aromatic ring-pyrimidine derivatives provided by the present invention has the structure of the formula I: |
| US11591316B2 |
Compounds, compositions, and methods
The present disclosure relates generally to LRRK2 inhibitors, or a pharmaceutically acceptable salt, deuterated analog, prodrug, tautomer, stereoisomer, or mixture of stereoisomers thereof, and methods of making and using thereof. |
| US11591312B2 |
Halogenation of pyridine derivatives
The present invention relates to a process for the preparation of pyridine derivatives of the formula (I) comprising two steps, namely, a selective chlorination followed by a selective fluorination. |
| US11591310B2 |
Method for preparing lenalidomide
The present disclosure discloses a method for preparing lenalidomide. The present disclosure provides a method for preparing lenalidomide I, which comprises the following steps: in a solvent, the lenalidomide intermediate II is reduced with a metal in the presence of an organic acid to obtain the lenalidomide I, wherein the metal is one or more selected from zinc, iron, aluminum and manganese. The preparation method of the disclosure has simple and safe operation, simple post-processing steps, environmental friendliness, high total yield. Moreover, the product obtained in the method has a purity of more than 99.90%, maximum single impurity of less than 0.10%, total heavy metal residue of less than 10 ppm and meet the heavy metal residue standard and API standard. Furthermore, the method has a low production cost and is suitable for industrial production. |
| US11591300B2 |
Oxazole containing compounds as activators of IDO1 and AhR
Provided herein are methods and compositions related to a method of stimulating the immune system in a subject in need thereof by administering an agent that increases the level or activity of indoleamine 2,3-dioxygenase (IDO1) and/or aryl hydrocarbon receptor (Ahr). |
| US11591299B1 |
Prodrug compound of levosimendan, preparation method and use thereof
The invention relates to a prodrug compound of levosimendan as shown by the formula below, and solvates, hydrates, N-oxides, stereoisomers, and pharmaceutically acceptable salts thereof, wherein each of Ra and Rb is selected from hydrogen or C1-C6 alkyl; Rp is selected from a basic group containing N atom or an acidic group containing carboxyl group, phosphate group, sulfate group, and sulfonate group. The prodrug compound overcomes the defects of levosimendan such as poor water solubility, and has an ideal pharmacokinetic profile and excellent prospects for medicament development. |
| US11591298B2 |
Bisaminoquinoline compounds, pharmaceutical compositions prepared therefrom and their use
The present invention relates to novel bisaminoquinoline compounds, pharmaceutical compositions comprising these novel compounds and methods for inhibiting autophagy in biological systems. Methods of treating cancer in patients in need using compounds and/or compositions according to the present invention alone or in combination with at least one additional anticancer agent represent additional aspects of the invention. Methods of treating disease states and/or conditions in which inhibition of autophagy plays a favorable treatment role including rheumatoid arthritis, malaria, antiphospholipid antibody syndrome, lupus, chronic urticaria and Sjogren's disease, with compounds according to the present invention represent additional aspects of the invention. |
| US11591297B2 |
Compound having PD-L1 expression-suppressing action
The present invention provides a compound of formula (I): or a pharmaceutically acceptable salt thereof, wherein R1, R2, m and n are as defined in the specification, with an inhibitory effect of PD-L1 expression and an inhibitory effect of reduced production of IL-2 and a medicament useful for the treatment of a disease associated with the reduced immune function caused by the formation of PD-1/PD-L1 binding. |
| US11591295B2 |
Affinity illudofulvene conjugates
In an embodiment of the invention, a composition for treating a cell population comprises a medicant. The medicant moiety can be an illudofulvene analog. In an embodiment of the invention, a composition for treating a cell population comprises an Affinity Medicant Conjugate (AMC). The affinity moiety can be an antibody, an antibody fragment, a receptor protein, a peptidic growth factor, an anti-angiogenic protein, a specific binding peptide, protease cleavable peptide, a glycopeptide, a peptide, a peptidic toxin, a protein toxin and an oligonucleotide. The affinity moiety can be covalently bound to the medicant via a linker. |
| US11591289B2 |
Aromatic compounds
The present invention comprises novel aromatic molecules, which can be used in the treatment of pathological conditions, such as cancer, skin diseases, muscle disorders, and immune system-related disorders such as disorders of the hematopoietic system including the hematologic system in human and veterinary medicine. |
| US11591284B2 |
Compounds for the treatment of neuromuscular disorders
The present invention relates to compounds suitable for treating, ameliorating and/or preventing neuromuscular disorders, including the reversal of drug-induced neuromuscular blockade. The compounds as defined herein preferably inhibit the CIC-1 ion channel. The compounds include phenoxy propanoic acid, phenoxy propanoate, and phenoxy butanoate compounds. |
| US11591283B2 |
Process for the production of dialkyl terephthalate
A process for preparing dialkyl terephalate comprising the following steps:—i) providing furan-2,5-dicarboxylate; ii) esterifying the furan-2,5-dicarboxylate with alcohol to form furan-2,5-carboxylic acid dialkyl ester; iii) reacting the furan-2,5-carboxylic acid dialkyl ester with ethylene under Diels Alder conditions, elevated temperature and pressure and in the presence of a catalyst such that dialkyl terephthalate is produced; wherein the Diels-Alder reaction is free from solvent; wherein the catalyst comprises a clay comprising metal ions and having Lewis acidity. |
| US11591281B1 |
Method of peroxylactic acid production and use for reduction in microbial activity in food product processing
A method for producing an aqueous equilibrium peroxylactic acid solution by reaction mixing lactic acid, hydrogen peroxide, water, one or more optional acid catalysts and one or more optional sequestering agents in a vessel over a period of time while maintaining the temperature of the solution at a temperature below about 100° C. The aqueous equilibrium peroxylactic acid solution can be used for reducing the bacterial count on a protein food product during processing. |
| US11591279B2 |
Composition, organic light-emitting device, display device, photoelectric conversion apparatus, electronic apparatus, and moving object including the composition
A composition contains an organic compound and an anthracene compound different from the organic compound, the anthracene compound having a hydrogen atom at at least one of positions 9 and 10, in which the concentration of the anthracene compound is 100 ppm or less. Additionally, a long-lived organic light-emitting device includes an organic compound layer containing a reduced concentration of the anthracene compound. |
| US11591278B2 |
Integrated processes to produce gasoline blending components from light naphtha
A process for the treatment of a light naphtha feedstock that comprises normal paraffins and iso-paraffins may include separating the feedstock into a first iso-paraffin stream and a normal paraffin stream. The separating may be performed with 5A molecular sieves, a pressure of about 1-3 bars, and a temperature of 100-260° C. A product stream may be provided by subjecting the normal paraffin stream to at least one of steam cracking, isomerizing, and aromatizing. |
| US11591277B2 |
Photochemical separations and compositions
Provided herein are photochemical separations. The methods herein can include exposing a first metal complex and a second metal complex to light to facilitate an irreversible chemical reaction to form a modified first metal complex. The modified first metal complex then may be separated from the second metal complex. Compositions also are provided. |
| US11591274B2 |
Defined microbial compositions
Disclosed herein are compositions including cells of defined sets of microbial species (for example, 3, 16, 18, 19, 21, or 22 microbial species). Also disclosed are methods of using the microbial compositions that include contacting soil, plants, plant parts, or seeds with the composition. The microbial compositions are also used in methods of degrading biological materials, such as chitin-containing biological materials. |
| US11591273B2 |
Micronutrient compositions and systems and methods of using same
An agricultural spray may be produced by admixing citric acid and glutamic acid with a metal salt and a pesticide or other agricultural chemical containing components capable of precipitating with the metal salt in the admixture. The citric acid and the glutamic acid chelate with the metal salt to provide a stability and compatibility-enhancing composition, thereby preventing the metal salt from forming an insoluble solid within the admixture. Such a composition may be produced by admixing citric acid and glutamic acid at a molar ratio of about 6.8:0.5 to about 1:0.29. The composition may include a metal sat, citric acid and glutamic acid in a molar ratio of about 1:6.8:0.5 to about 1:1:0.29 and a pesticide. |
| US11591269B2 |
Coloured fiber cement products and methods for the production thereof
The present invention relates to coloured fiber cement products as well as to methods for manufacturing such products. In particular, the present invention provides coloured fiber cement products, which fiber cement products are coloured in the mass, and at least comprise on at least part of their outer surface one or more cured layers of a coating composition, which composition at least comprises a binder and a pigment and/or a filler and is characterized by a pigment volume concentration (PVC) of between about 1% and about 20%. The present invention further provides processes for producing these coloured fiber cement products. Finally, the present invention provides uses of the coloured fiber cement products as building materials. In particular embodiments, the fiber cement products produced by the processes of the present invention can be used to provide an outer surface to walls, both internal as well as external, a building or construction, e.g. as fagade plate, siding, etc. |
| US11591262B2 |
Cementitious reagents, methods of manufacturing and uses thereof
Described are cementitious reagent materials produced from globally abundant inorganic feedstocks. Also described are methods for the manufacture of such cementitious reagent materials and forming the reagent materials as microspheroidal glassy particles. Also described are apparatuses, systems and methods for the thermochemical production of glassy cementitious reagents with spheroidal morphology. The apparatuses, systems and methods make use of an in-flight melting/quenching technology such that solid particles are flown in suspension, melted in suspension, and then quenched in suspension. The cementitious reagents can be used in concrete to substantially reduce the CO2 emission associated with cement production. |
| US11591260B2 |
Large-size synthetic quartz glass substrate, evaluation method, and manufacturing method
A large-size synthetic quartz glass substrate has a diagonal length of at least 1,000 mm. Provided that an effective range is defined on the substrate surface, and the effective range is partitioned into a plurality of evaluation regions such that the evaluation regions partly overlap each other, a flatness in each evaluation region is up to 3 μm. From the quartz glass substrate having a high flatness and a minimal local gradient within the substrate surface, a large-size photomask is prepared. |
| US11591259B2 |
Article comprising a functional coating and a temporary protective layer made of polyfuranic resin
An article includes a substrate with two main faces defining two main surfaces separated by edges, the substrate carrying a functional coating deposited over at least a portion of a main surface and a temporary protective layer deposited over at least a portion of the coating. The temporary protective layer has a thickness of at least 1 micrometer. The temporary protective layer made of polyfuran resin is obtained from a liquid composition comprising furfuryl alcohol. |
| US11591258B2 |
Glass, glass-ceramic and ceramic articles with graded protective coatings having hardness and strength
An article that includes: a substrate having a glass, glass-ceramic or a ceramic composition and comprising a primary surface; and a protective film disposed on the primary surface. The protective film comprises a thickness of greater than 1.5 microns and a maximum hardness of greater than 15 GPa at a depth of 500 nanometers, as measured on the film disposed on the substrate. Further, the protective film comprises a metal oxynitride that is graded such that an oxygen concentration in the film varies by 1.3 or more atomic %. In addition, the substrate comprises an elastic modulus less than an elastic modulus of the film. |
| US11591247B2 |
Combined furnace
Installation including an industrial glass furnace (1) including a tank (2) for molten glass (3), a combustion heating chamber (4) situated above the tank (2), and a duct for evacuation of flue gases in communication with said heating chamber (4), and a stone furnace including a firing zone (21) for stone to be fired, the flue gas evacuation duct including a flue gas outlet that is connected to the firing zone (21) of stone to be fired and supplying the firing zone (21) of stone to be fired with flue gases at high temperature. |
| US11591246B2 |
Organic sludge treatment device and treatment method
To treat organic sludge while keeping facility costs, cement production efficiency, and a reduction in clinker production amount to a minimum. An organic sludge treatment device includes: a fractionation device 7 that fractionates a preheated raw material R2 from a preheater cyclone 4C excluding a bottommost cyclone of a cement burning device 1; a mixing device 8 that mixes an organic sludge S with the fractionated preheated raw material, and that dries the organic sludge using sensible heat of the preheated raw material; and a supply device (mixture chute 12, double-flap damper 13, shut damper 14) that supplies a mixture M from the mixing device to a calciner furnace 5 of the cement burning device or to a duct disposed between a kiln inlet portion of a cement kiln 2 and the calciner furnace. The treatment device may be provided with an introduction device for introducing an exhaust gas G2 including dust, odor and water vapor from the mixing device to a gas outlet of a bottommost cyclone 4A of the cement burning device. |
| US11591245B2 |
High salinity water purification processes and systems
A high salinity water purification system and process, including a forward osmosis system and a reverse osmosis or nanofiltration system. A concentrated brine of a zinc or iron complex combined with a salt or acid draws pure water across the FO membrane from the influent water. The diluted brine is pumped through a vessel holding an anionic adsorption media to remove the zinc or iron complex and the resultant brine is passed through the RO or nanofiltration system to obtain purified water and a concentrated brine stream. The adsorption media is regenerated by a rinse cycle using fresh water or water from the RO system, removing the zinc or iron complex adhered to the media. The resultant brine is stored and mixed with the output of the RO system. Charged membrane can be used as a standalone membrane in FO process or in combination with resin or resin embedded membrane. |
| US11591244B2 |
Header-equipped air diffusion device, and membrane separation activated sludge device
Header-equipped air diffusion devices includes, in the header, an air storage unit, on its lower end including inlet(s) for water to be treated, and air supply part(s) and air sending part(s) on the air storage unit upper section. The air diffusion device's air sending part and horizontal tube are connected, air sent from the header being diffused by the air diffusion device, and air sending in the air storage unit is above the air supply part's air supply port. The air storage portion's partition portion, with a 50+mm height, partitions the upper portion into an air supply and an air feeding portion side. The partition portion forms a cylindrical portion and an upper plate portion and the air storage portion's trunk portion serves as part of the air supply portion, and an opening end on a lower end side of the partition portion serves as the air supply port. |
| US11591239B2 |
Silicon doped metal oxide particles, and composition for UV absorption comprising silicon doped metal oxide particles
The object of the present invention is to provide silicon doped metal oxide particles for UV absorption, which average molar absorption coefficient in the wavelength range of 200 nm to 380 nm, is enhanced. Provided is silicon doped metal oxide particles in which the metal oxide particles are doped with silicon, wherein an average molar absorption coefficient in the wavelength range of 200 nm to 380 nm, of a dispersion in which the silicon doped metal oxide particles are dispersed in a dispersion medium, is improved as compared with similar metal oxide particles not doped with silicon. |
| US11591237B2 |
Layered compound and nanosheet containing indium and phosphorus, and electrical device using the same
Proposed are a layered compound having indium and phosphide, a nanosheet that may be prepared using the same, and an electrical device including the materials. Proposed is a layered compound represented by K1-xInyPz (0≤x≤1.0, 0.75≤y≤1.25, 1.25≤z≤1.75). |
| US11591234B2 |
Microparticulate hydrotalcite, method for producing same, resin composition of same, and suspension of same
A hydrotalcite is represented by formula (1): (M2+)1-X(M3+)X(OH)2(An−)X/n·mH2O (1), wherein M2+ indicates a divalent metal, M3+ indicates a trivalent metal, An− indicates an n-valent anion, n indicates an integer of 1 to 6, 0.17≤x≤0.36, and 0≤m≤10. The hydrotalcite has (A) a lattice strain in the <003> direction is 3×10−3 or less as measured using an X-ray diffraction method; (B) primary particles with an average width between 5 nm and 200 nm inclusive per a SEM method; and (C) a degree of monodispersity of 50% or greater (degree of monodispersity (%)=(average width of primary particles as measured using the SEM method/average width of secondary particles as measured using a dynamic light scattering method)×100). A resin containing the hydrotalcite, a suspension containing the hydrotalcite and a method for producing the hydrotalcite are disclosed. |
| US11591233B2 |
Process and plant for thermal decomposition of aluminium chloride hydrate into aluminium oxide
The invention relates to a process and its relating plant for thermal conversion of aluminum chloride hydrate into aluminum oxide and gaseous hydrogen chloride. In a first step, aluminum chloride hydrate is fed into a decomposition reactor where it is heated to a temperature between 120 and 400° C. Afterwards, the partially decomposed aluminum chloride hydrate is finally calcined to aluminum oxide at a temperature between 850 and 1200° C. in a second reactor. The aluminum chloride hydrate is admixed with aluminum oxide in an intensive mixer with a mass ratio between 1:1 and 10:1 aluminum chloride hydrate to aluminum oxide for using a fluidized bed reactor as a decomposition reactor. |
| US11591232B2 |
Magnesium oxide for annealing separators, and grain-oriented magnetic steel sheet
An object of the present invention is to provide magnesium oxide for an annealing separator which is useful for obtaining grain-oriented electromagnetic steel sheets with excellent magnetic properties and insulating properties. To resolve the above object, an aspect of the present invention resides in magnesium oxide for an annealing separator having a sulfur content of 0.1 to 0.5 mass % and an aggregation degree RBlaine/RBET of 3.0 to 5.5 wherein RBlaine is the particle size calculated from the Blaine specific surface area and RBET is the particle size calculated from the BET specific surface area. |
| US11591226B1 |
Plasma assisted distributed chemical production
The present development is a process to produce commodity chemicals such as methanol and syngas using an integrated plasma catalysis technology. The method comprises providing a fixed or fluidized bed reactor having a microwave plasma flame and a catalyst bed with a catalyst, wherein the catalyst is an alloyed bimetallic nanowire. In the process, the plasma flame fluidizes the catalyst thereby producing a more effective catalyst than the non-fluidized catalyst. It is anticipated that the reactor can have a throughput capacity of up to 30 Lpm/kW and can be effective for the conversion of CO2, CH4, air, water, and combinations thereof, through reactions such as pure CO2 splitting, reverse water gas shift (RWGS) for CO production, methanol synthesis, and plasma reforming of methane, thereby making a system that would be attractive for small GTL units. |
| US11591224B2 |
Apparatus and method for preparing carbon black
Disclosed are apparatus and method for preparing carbon black, in which the carbon black may be continuously formed and activated. In one embodiment, carbon black powders formed in a combustion reactor are converted into a slurry which in turn is refluxed to the combustion reactor in a repeated manner, thereby to allow successive activation treatments. In this way, a sufficient residence time for the activation of the carbon black may be secured. |
| US11591220B2 |
Nanostructured-carbon-base-material using mantle perido carbon mineralization based activated carbon nanotubes
Mineralization occurs during weathering of silicate materials/rocks rich in CA+ and Mg+, particularly peridotite which composes Earth's upper mantle. The carbon mineralization mantle peridotite is the base activated carbon for nanostructured-carbon-base-material. The nanostructured-carbon-base-material using mantle peridotite carbon mineralization based activated carbon nanotubes is a new catalyst for batteries and fuel-cell use that doesn't use precious metal such as platinum and that performs as effectively as many well-known, expensive precious-metal catalysts. The nanostructured-carbon-base-material using mantle peridotite carbon mineralization based activated carbon nanotubes makes possible the creation of economical lithium-air batteries that could power electric vehicles. The carbon nanotubes have useful qualities such as slim, strong, lightweight, high electronic conductivity, has metallic/semiconductive properties that are useful in (1) electronics i.e. wiring, transistor; (2) material that reinforced resin/metal; (3) energy source i.e. catalysis support, ion adsorption, capacitors; (4) nanotechnology i.e. nanostructure; and (5) biotechnology i.e. cell cultivating, drug delivery system, biosensor. |
| US11591216B2 |
System for processing meats with aqueous ozone
A system for meat processing may include: a conveyor configured to transport animal carcasses or portions of meat through a meat processing facility; and a spray system configured to spray each of the animal carcasses or portions of meat with aqueous ozone when each of the animal carcasses or portions of meat is transported to the spray system by the conveyor. The system may further include a second spray system configured to spray each of the animal carcasses or portions of meat with lactic acid or citric acid when each of the animal carcasses or portions of meat is transported to the second spray system by the conveyor. |
| US11591211B2 |
Semiconductive structure and manufacturing method thereof
A method of manufacturing a semiconductive structure includes receiving a first substrate; disposing an interconnection layer on the first substrate; forming a plurality of conductors over the interconnection layer; filing gaps between the plurality of conductors with a film; forming a barrier layer over the film; removing the barrier layer; and partially removing the film to expose a portion of the interconnection and leave a portion of the interconnection layer covered by the film. |
| US11591210B2 |
Method and apparatus for a transducer assembly with a standoff
A transducer assembly can include a base. The transducer assembly can include a stress isolation standoff located on the base. The transducer assembly can include a MEMS die disposed on the stress isolation standoff. The transducer assembly can include a die attach adhesive disposed between the MEMS die and the base. The die attach adhesive can bond the MEMS die to the base. The stress isolation standoff can be embedded in the die attach adhesive between the base and the MEMS die. |
| US11591209B2 |
Method for operating a capacitive MEMS sensor, and capacitive MEMS sensor
A method for operating a capacitive MEMS sensor. The method includes: supplying a defined electrical potential on a deflectably mounted, seismic mass of the MEMS sensor; capacitively inducing a vibrational motion of the seismic mass with the aid of a clocked electrical control voltage; compensating for fluctuations in the supplied electrical potential on the seismic mass caused by the clocked electrical control voltage, by selectively charging and/or discharging an electrical storage element connected to the seismic mass in accordance with the frequency of the clocked electrical control voltage. |
| US11591208B2 |
Saddle stirrup adjustable strap D-ring
A modified saddle D-ring having a loop of a varying radius for supporting a stirrup strap on a saddle. The stirrup supporting strap is looped around a lower span portion of the D-ring which has an upper span portion anchored to the saddle. The lower span has an upper surface that abuts against the saddle supporting strap and such upper surface includes first and second contiguous portions disposed at a preselected angle to one another with the length being greater than the width of the stirrup supporting strap. The D-ring includes an elongated curved loop extending forward at a varying radius depicting a parabolic curve. The elongated D-ring allows limited pivotal forward movement of the stirrup with respect to the saddle. One or more “T” shaped projections may extend upward from one a selected position at the bottom of the D-ring for adjusting and holding the D-ring in position. |
| US11591206B2 |
Contactless autofill dispensing
A contactless autofill dispenser includes a housing and a dispense area for receiving a cup. The dispenser includes a supply of consumable product disposed within the housing. The dispenser includes an outlet connected to the supply and extending from the housing into the dispense area for dispensing the consumable product into the cup. The dispenser includes a controller disposed within the housing and connected to the supply, wherein the controller is configured to control dispensing of the consumable product from the outlet. The dispenser includes a time of flight sensor attached to or with a direct line of sight into the dispense area and connected to the controller. |
| US11591202B2 |
Beverage dispensing assembly and beverage container
Beverage dispensing assembly (1), comprising a dispenser (2) and a beverage container (3), wherein the beverage container (3) has a neck portion (7) and a shoulder portion (8) adjacent the neck portion (7), wherein the neck portion (7) is provided with at least an outflow opening and at least one gas inlet opening (9) and wherein the dispenser (2) comprises a housing (4), wherein the housing (4) is provided with a receptacle (5) for receiving at least part of the container (3), wherein the container (3) is positioned in the dispenser (2) with the neck (7) and shoulder portion (8) facing downward, such that the neck portion (7) and at least part of the shoulder portion (8) are received in the receptacle (5), wherein part of the shoulder portion (8) extends close to and/or is in contact with a wall of the receptacle (5), wherein preferably a lid (12) is provided over the container (3), enclosing a part of the container (3) extending outside the receptacle (5). |
| US11591198B2 |
Materials handling vehicle having tilting fork carriage assembly with telescopic forks
A materials handling vehicle including a load handling assembly having a mast assembly, and a fork carriage assembly including a fork support and at least one fork assembly, the at least one fork assembly including a first fork member, which is fixed to the fork support, and a second fork member. The vehicle includes a tilt assembly that tilts the fork support relative to the mast assembly such that a central axis of the at least one fork assembly is positionable in a plurality of different positions relative to a horizontal direction. The vehicle includes a fork extension/retraction assembly that moves the second fork member relative to the first fork member in a first direction that is parallel to the central axis such that the fork extension/retraction assembly selectively moves the second fork member toward or away from the fork support in the first direction. |
| US11591194B2 |
Method and system for robotic pick-and-place comprising a container floor mounted to a transformable end of a lift mechanism and a set of container walls to define a container working volume with a working depth extends beyond a picking workspace of a robotic arm
The system can include: a container 110, a set of sensors 120, and a controller 130. The system can optionally include a robot 140. However, the system 100 can additionally or alternatively include any other suitable set of components. The system functions to monitor and/or maintain a fullness level of a container. The system can additionally or alternatively function to enable robotic picking out of the container (e.g., in a pick-and-place setting). The system can additionally function to maintain candidate objects within reach of the robot's end effector to increase robot uptime while minimizing the extent of the robot's required motion (e.g., in the z-axis). |
| US11591189B2 |
Coupling device between an elevator car door and a landing door and elevator system
A linkage device used between an elevator car door and a hall door, and an elevator system. The linkage device includes: a link mechanism; a first door vane and a second door vane that are connected to the link mechanism; and an actuating mechanism for actuating the link mechanism so that the first door vane and the second door vane are switched between a contracted position and an expanded position; wherein the link mechanism includes: a first link and a second link arranged in parallel, each of which includes a link body and a slider; the link body of the first link and the link body of the second link are pivotally connected to the car door, and the slider of the first link and the slider of the second link are each capable of sliding along a passage defined by the corresponding link body. |
| US11591186B2 |
Belt with layered load bearing elements
A load bearing tension member for an elevator system includes a plurality of tension elements arrayed across a tension member width. The tension elements are offset from a tension member central axis, the central axis bisecting a tension member thickness and extending across the tension member width. The tension elements include a plurality of fibers extending along a length of the tension element, and a matrix material in which the plurality of fibers are embedded. A jacket at least partially encapsulates the plurality of tension elements. |
| US11591185B2 |
Remote triggering device, overspeed governor assembly and elevator system
A remote triggering device, an overspeed governor assembly and an elevator system are provided. The remote triggering device includes: an actuator seat mounted on a fixed bracket and rotatable between a first position and a second position; an actuator disposed on the actuator seat and having an action end movable between a retracted position and an extended position; and a reset lever extending from the actuator seat; wherein in a case that the centrifugal mechanism of the overspeed governor assembly rotates in a first direction corresponding to ascending of an elevator car, when the action end of the actuator moves to the extended position, the centrifugal mechanism of the overspeed governor assembly contacts the action end of the actuator and drives the actuator seat to rotate from the first position toward the second position, and the reset lever rotates with the actuator seat. |
| US11591183B2 |
Enhancing elevator sensor operation for improved maintenance
Methods and systems for enhancing sensor operation are provided. Aspects includes obtaining, by a primary sensor, primary sensor data associated with an electrical mechanical system, obtaining, by at least one secondary sensor, secondary sensor data associated with the electrical mechanical system, and analyzing the primary sensor data responsive to a determination of a predetermined state of the electrical mechanical system based on the secondary sensor data. |
| US11591181B2 |
Reel transport, stand and payoff device
A reel transport, stand and payoff device is provided, which operates to maneuver and jack up a reel for payoff. The reel device may include two reel mechanisms coupled together with a first support member and a second support member. Each reel mechanism includes a wheel housing and a wheel coupled to a central portion of the wheel housing. Each reel mechanism includes an arm coupled on an end to a central portion of the wheel housing. An actuator is coupled between the wheel housing and the arm to raise or lower the arm. The reel device may include at least one caster to help support and stabilize the reel device. A shaft is inserted through a reel and coupled on each end to an arm by a bracket. A method of use of a reel transport, stand and payoff device is also disclosed. |
| US11591179B2 |
Multi-core cable core alignment device and multi-core cable core alignment method
A multi-core cable core aligning device is composed of a temporary holding mechanism, which is configured to arrange tips of a plurality of cores exposed at one end of a multi-core cable in a row along a predetermined arranging direction, and temporarily hold each one of the plurality of cores in such a manner as to be movable along the predetermined arranging direction, a transferring mechanism, which is configured to transfer the plurality of cores one by one while separating the plurality of cores held by the temporary holding mechanism one by one from other ones of the plurality of cores, and an aligning mechanism, which is configured to align and hold the plurality of cores with a predetermined space between adjacent ones of the plurality of cores while holding the plurality of cores transferred by the transferring mechanism one by one at spaced intervals. |
| US11591178B2 |
Post-processing device, method for controlling post-processing device, and non-transitory computer-readable storage medium storing program for controlling post-processing device
A post-processing unit includes a stapler, a driving section, and a controller. The stapler is moved in a Y direction and executes a stapling process on a paper sheet. The driving section moves the stapler in the Y direction. The controller controls an operation of the stapler and an operation of the driving section. The controller executes first control to supply a set current or a set voltage to the driving section, second control to supply, to the driving section, the same supply current as the set current or the same supply voltage as the set voltage, and third control to stop the supply of the supply current or the supply voltage. When the stapler executes the stapling process a plurality of times, the controller repeatedly executes the second control and the third control and causes the stapler to execute the stapling process during the execution of the second control. |
| US11591176B2 |
Convertible printed product collecting assembly
A convertible printed product collecting assembly (10) includes a collecting fabric (11) rolled on a rotatable fabric bearing rod. Supporting legs (13) have a lower end tiltably connected to a printer (18) and are tillable in the collecting fabric's longitudinal direction. A tensioning and locking mechanism (15, 16) is arranged to release or to lock the fabric bearing rod to rotate. Stabilizing brackets (14) secure the supporting legs (13) in at least one tilting angle. The tensioning and locking mechanism (15, 16) is operable to tension and to hold the collecting fabric (11) in a flat, tensioned shape when in the locking state so as to provide a receiving desk for the printed product. Further, the collecting fabric (11) forms a collecting bag when unreeled from the fabric bearing rod. |
| US11591174B2 |
Physical property detecting device and image forming system
A physical property detecting device, includes: an insertion part that includes an insertion port through which a sheet is inserted and removed; a first physical property detector that detects a first physical property of the sheet in a non-nipping state; and a second physical property detector that nips the sheet and detects a second physical property of the sheet in a nipping state, wherein the first physical property detector and the second physical property detector are disposed at different positions in an insertion and removal direction of the sheet. |
| US11591163B1 |
Sweep auger shield assembly
A sweep auger shield assembly for inhibiting grain from being spilled over a sweep auger in a grain bin includes a sweep auger that has a back shield which is coupled to the sweep auger. An extension shield is provided that is mountable to the back shield of the sweep auger. Thus, the extension shield increases the overall height of the back shield. In this way the extension shield inhibits grain from passing over the back shield when the sweep auger is removing grain from a floor of a grain bin. |
| US11591161B2 |
Apparatuses, systems, and methods for storage and dispensing of articles
Provided herein is a methods, apparatus, and system for the configuration of customizable trays for the storage and dispensing of articles. Methods may include: receiving an indication of a plurality of articles to be stored in a tray; determining a plurality of bins corresponding to the plurality of articles; generating a layout of the bins on the tray; identifying locations of the plurality of articles within the bins on the tray; and causing the tray to be configured according to the layout of the plurality of bins on the tray. Methods may include: receiving an indication of an article to be loaded into a bin of the plurality of bins; receiving a unique identifier of the bin of the plurality of bins into which the article is loaded; and storing, in a memory, a correlation between the unique identifier of the bin and the article loaded into the bin. |
| US11591145B2 |
Device for packaging two products separately
Device (10) for packaging two products (A, B) separately and dispensing a resulting mixture (M) on a first use, comprising a lower container (12) delimiting a first product cavity (22) containing a first product (A) and an upper container (14) delimiting a second product cavity (24c) containing a second product (B), and being capable of rotating relative to the lower container (12) without moving axially, and a temporary closing member (30) configured to close an opened end (24b) of the upper container (14) before the first use, and comprising a cylindrical skirt (32) surrounding said opened end (24b) and a plug (34) connected to said cylindrical skirt (32), said cylindrical skirt (32) being designed to cooperate by thread engagement with the upper container (14) and being prevented from rotating relative to the lower container (12). The closing member (30) is deprived from any axially retaining members with both containers (12, 14), such that when the upper container (14) is rotated in a first rotation direction (F1), the closing member translates downwardly until falling into the first product cavity (22). |
| US11591140B2 |
Drink cup lid
A liquid container includes a cup having a brim forming an opening into an interior region of the cup. The container also includes a lid configured to mount on the brim of the cup to close the opening. |
| US11591135B1 |
Canister lid with overmolded gasket providing a non-slip surface
A canister including a lid and storage canister. The lid incorporates a gasket that is overmolded onto the lid during its manufacture. The gasket is exposed on both the upper and lower surfaces of the lid in order to provide a non-slip surface at the top portion of the lid and a sealing surface at the bottom of the lid for sealing a storage canister. |
| US11591132B2 |
Perforated collapsible box
A method for collapsing a collapsible box can include pressing inward on a first side panel and a second side panel of the collapsible box along a lateral hinge, the collapsible box defining the lateral hinge extending at least partially across a front panel, the first side panel, the second side panel, and a rear panel of the collapsible box; and pressing a top panel and a bottom panel of the collapsible box together until the collapsible box is substantially flattened, the top panel and the bottom panel being hingedly coupled to the rear panel. |
| US11591130B1 |
Stackable and foldable box
The present invention is directed to securely stackable, box pallet merchandising storage and display box and system for use in storing and displaying clothing or other merchandising goods. The merchandising display box generally includes a bottom panel, U-shaped front panel foldably connected to the bottom panel and defining a display opening and a rear panel also foldably connected to the bottom panel. First and second side panels are further foldably connected to the bottom panel and include securing flaps for securing the first and second side panels to the front and rear panels. Projections extend upwardly from the first and second side panels and cutouts are formed along bottom edges of the first and second side panels. The projections are configured to engage cutouts formed in a second merchandising display box positioned on top of the merchandising display box to secure or lock the merchandising display boxes together to prevent slippage therebetween. |
| US11591125B2 |
Method of storing adhesive material with a container
A foldable container and method of storing adhesive in which a single strip of adhesive material is attached to a single release liner featured on a side surface or a flap of the foldable container. The strips of adhesive material can be peeled off a surface of the container and applied to and used to seal the top and bottom surfaces of the container as needed. The container features one or more release liner(s) each with a single strip of adhesive material attached only to the release liner and not a surface of the container itself. |
| US11591122B2 |
Consumable-material handling device for transporting and/or handling at least one consumable material, in particular packaging material
The invention relates to a consumable-material handling device for transporting and/or handling at least one consumable material (12a; 12b), in particular packaging material, comprising at least one at least partially autonomous handling unit (14a; 14b), which is at least provided for handling the consumable material (12a; 12b). According to the invention, the machine tool comprises at least one, in particular at least partially autonomous, mobility unit (16a; 16b), on which the handling unit (14a; 14b) is arranged and which is at least provided for enabling locomotion, in particular at least partially autonomous locomotion, of the handling unit (14a; 14b). |
| US11591121B2 |
Compact applicating machine
A machine for packaging multiple containers wherein a flexible carrier stock is fed across a jaw drum. A plurality of containers are moved through the machine whereby the carrier is subsequently positioned over the plurality of containers so that flexible carrier stock engages with two or more of the containers to form a package. The jaw drum and other operative components of the machine are preferably vertically adjustable to accommodate a range of container sizes and carrier configurations. |
| US11591118B2 |
Layered food packaging system, temporary placement apparatus, and carrier device
A layered food packaging system includes: a carrier device configured to convey a sandwich in a horizontal posture in which a layering direction of the sandwich is substantially vertical; a temporary placement table configured to temporarily place the sandwich thereon in a vertical posture in which the layering direction of the sandwich is substantially horizontal; a first robot and a second robot configured to grip the sandwich that is conveyed by the carrier device, lift the sandwich from the carrier device, change the posture of the sandwich from the horizontal posture to the vertical posture, and temporarily place the sandwich on the temporary placement table; and a third robot configured to grip the sandwich that is temporarily placed on the temporary placement table, and insert the sandwich into a bag for packaging the layered food. |
| US11591117B2 |
Ruggedized reaction wheel apparatus for use on kinetically launched satellites
Provided is a reaction wheel assembly ruggedized for use in kinetically launched satellites. An example reaction wheel assembly may include a shaft mounted to a body of a satellite, a wheel mounted to the shaft, wherein a center of a gravity of the wheel is co-aligned with the shaft, and a support device mounted to the body of the satellite. The reaction wheel assembly may include bearings for holding the shaft to the body of the satellite and allowing a rotation of the wheel. The support device can be engaged to support the wheel to reduce a load on the shaft and the bearing, the load being caused by an acceleration of the satellite during a kinetic launch of the satellite. After the satellite is launched into space, the support device can be disengaged from supporting the wheel to allow the wheel to spin. |
| US11591116B2 |
Deployable tape spring device having a rollable membrane and casing, and satellite including the same
A deployable device includes a supporting structure, a mandrel able to move in rotation with respect to the supporting structure about a first axis Z, a membrane able to pass from a rolled-up configuration rolled up around the mandrel about the first axis Z to a deployed configuration deployed along a second axis X substantially perpendicular to the first axis Z. The device comprises two fittings secured to the mandrel at their centre, arranged one on either side of the membrane and comprising first stubs on their periphery, a casing extending between the two fittings, the casing comprising second stubs of a shape complementing the shape of the first stubs, the casing being able to pass from a rolled-up configuration at least partially enveloping the membrane in the rolled-up configuration to a deployed configuration at least partially superposed on the membrane in the deployed configuration. |
| US11591115B2 |
Space-based gas supply system
A transfer system for supplying a receiving tank of a receiving spacecraft with a supply gas from a supply spacecraft. A transfer tank is disposed on the supply spacecraft and configured to retain a supply gas. A transfer line is coupled to the transfer tank, and one end thereof may be coupled to the receiving tank. A transfer valve is operatively coupled to the transfer line. A heating system is thermally coupled to the transfer tank. A control system is operatively coupled to the transfer valve and the heating system. The control system is operable to cause a transfer quantity of the supply gas to be heated, and to open the transfer valve, such that a difference between the increased pressure of the supply gas in the transfer tank and a pressure in the receiving tank causes the transfer quantity of the supply gas to flow to the receiving tank. |
| US11591114B2 |
Aircraft loader
An aircraft loader comprises a chassis, a cab, a loading floor and a load lifting apparatus. The load lifting apparatus includes a frame, a first horizontal platform and a second horizontal platform. The frame includes a pair of vertical columns. Each column has a front slider and a rear slider configured to be displaced vertically along the columns. The first platform is displaceable through movement of the rear sliders between a loading floor height and an aircraft loading height. The second platform is displaceable through movement of the front sliders and the first platform between an intermediate height and the aircraft loading height. When the first platform is raised from the loading floor height and reaches the intermediate height, the first and second platforms engage to so as to travel in unison, thus defining a loading deck which is displaceable between the intermediate height and the aircraft loading height. |
| US11591113B2 |
System and method for docking an aerostat, and aerostat and receiving structures equipped for such a purpose
A system for docking an aerostat on a receiving structure, including an unmanned aerial vehicle that can be controlled so as to move between the aerostat and the receiving structure, carrying a first end of a cable that has a second end fixed to the aerostat or the receiving structure, and to attach said first end to the receiving structure or to the aerostat such that the cable connects the aerostat to the receiving structure. |
| US11591112B2 |
Device for catching and launching an unmanned aerial vehicle
A device for catching and launching a guided UAV, the device comprises a supporting post, a horizontal shaft mounted on the post, and a lever is mounted on the horizontal shaft and can make a full revolution around a horizontal axis within a vertical plane, the lever is equipped with an engagement/disengagement device a means for interaction with the UAV catching device and an optical member, preferably arranged on the lever, for determining a location of the lever interaction means by an optical guidance system of the UAV. The lever comprises two coaxial portions, one is the engagement/disengagement device, and the second is a bar, wherein one end of the bar is coupled to the horizontal shaft, while another end thereof is connected to the engagement/disengagement device. The bar and the engagement/disengagement device are connected by a hinge that enables their fixation in a coaxial state and allows offset the axis of the engagement/disengagement device relative to the axis of the bar within a rotation plane of the lever. The horizontal shaft is equipped with a means for accumulating and/or dissipating the kinetic energy of the UAV, the lever is fixed on the shaft and can provide an elastic offset of the interaction means of the engagement/disengagement device within a plane perpendicular to the rotation plane of the lever, the interaction means configured to provide mutual locking/unlocking with the UAV catching device. |
| US11591111B2 |
Apparatus for vehicle launch, recovery, storage and transport
An apparatus for launching, recovering, transporting, and storing vehicles is disclosed. The apparatus stabilizes the vehicle while it is in operation or inactive and has a frame connected to at least one stabilizer. In certain configurations, the apparatus stabilizes the vehicle without using the vehicle's onboard landing gear. The apparatus may also include at least one pad connected to the apparatus. |
| US11591110B2 |
Aerial vehicle safety apparatus and aerial vehicle
An aerial vehicle safety apparatus includes an expandable object and an ejection apparatus. The ejection apparatus includes a container that accommodates the expandable object and has an opening provided on one end side, a moving member provided in the container, the moving member including an emission base carrying the expandable object on a side of the opening, the moving member being movable along an inner wall of the container, and a driver that ejects the expandable object by moving the moving member toward the opening. A space located opposite to the opening when viewed from the emission base and surrounded by the container and the moving member communicates with a space located outside the space through a communication portion. |
| US11591104B2 |
Tanker aircraft comprising a referencing system
A referencing system to assist a receiver aircraft in relative positioning during in-flight refueling operation that includes an array of references congregated on a spot of the tanker aircraft, wherein the array of references provide a distinguishable visual indicator depending on the sector where the receiver aircraft positions. |
| US11591103B2 |
Multi-layer thermoplastic spray coating system for high performance sealing on airplanes
Tunable multi-layer thermoplastic polymer sealants and tunable two-layer conductive thermoplastic polymer sealants, and substrates and assemblies comprising the tunable multi-layer sealants; and edge seals and fillet seals produced comprising such sealants; and substrates, components and objects comprising the tunable edge seals and fillet seals, and methods for making and applying such edge seals and fillet seals are disclosed. |
| US11591101B2 |
Diffuser for rotating detonation engine
A diffuser may comprise an inlet and an outlet. The inlet may comprise an arcuate shape. The outlet may comprise an annular shape. The diffuser may transition from the arcuate shape at the inlet to the annular shape at the outlet. The diffuser may comprise a radially inner wall and a radially outer wall disposed opposite the radially inner wall. The radially inner wall and the radially outer wall may partially define a duct. |
| US11591097B2 |
Aircraft nacelles having adjustable chines
Aircraft nacelles having adjustable chines are described. An example apparatus includes a chine coupled to a nacelle. The chine is oriented along a fore-aft direction. The chine is rotatable relative to the nacelle about an axis of rotation. The axis of rotation is substantially perpendicular to a plane of the chine defined by an outer mold line of the chine. |
| US11591091B2 |
Pinch point free rotatable aircraft armrest
An armrest assembly for seats on an aircraft includes a mount bracket and a leaf that is movable relative to the mount bracket. A hinge pin interacts with at least a portion of the mount bracket and the leaf. The leaf rotates about the hinge pin to raise and lower the armrest assembly. |
| US11591087B2 |
Unmanned aerial vehicle with ducted rotors
The present disclosure provides a system and device for drones with ducted rotors. In some aspects, drones may comprise one or more systems of ducted rotors. In some embodiments, ducted rotors may increase the durability of the drone, limiting exposure of the rotors to external conditions and objects. In some aspects, a drone with ducted rotors may comprise a control vane or cone that may direct airflow within the drone as a mechanism to control flight path. In some implementations, a drone may comprise expandable landing gear than may allow for controlled landing, even in the event of rotor failure. In some aspects, a drone may comprise rotatable ducted rotors. |
| US11591084B2 |
Cycloidal rotor micro-air vehicle
A cycloidal rotor air vehicle includes an airframe, a first cycloidal rotor assembly supported by the airframe and configured to rotate about a first axis of rotation relative to the airframe, the first cycloidal rotor assembly including a blade having a longitudinal axis oriented parallel to the first axis of rotation, a first motor configured to rotate the first cycloidal rotor assembly about the first axis of rotation, a first servo coupled to the blade of the first cycloidal rotor assembly and configured to adjust the pitch of the blade, and a control system supported on the airframe and configured to control the operation of the first motor and the first servo. |
| US11591082B2 |
Apparatus for generating thrust for air transport
An apparatus for generating thrust for air transport includes a main thrust device, and an auxiliary thrust device configured to generate auxiliary thrust so as to enable an aircraft to vertically take off and land. The apparatus further includes: wings fixed to left and right sides of a fuselage of the aircraft, rotors installed on the wings and configured to generate thrust. In particular, the main thrust device provides driving force to the rotors using motors and an engine, and the auxiliary thrust device is installed in the fuselage and has a center of gravity configured to coincide with a center of gravity of the aircraft. |
| US11591070B2 |
Methods and apparatus for a distributed aircraft actuation system
Methods, apparatus, and articles of manufacture for a distributed aircraft actuation system are disclosed. An example apparatus includes a non-responsive component detector to determine a position difference between a first position of a first control surface of an aircraft and a second position of a second control surface of the aircraft, the first position lagging the second position, and a command generator, in response to determining that the position difference satisfies a threshold, the command generator is to cease movement of the second control surface at the second position, attempt to move the first control surface to the second position, and cease movement of the first control surface when moved to the second position. |
| US11591067B2 |
Rotating double trapped roller auxiliary track mechanism
A flap support mechanism includes a track rotatably connected to an aft fitting of a wing. A forward roller and an aft roller extend laterally from a flap structure, the forward roller and aft roller constrained in a slot in the track. The slot has a profile configured to induce both translation and rotation in the flap, in concert with rotation of the track about the aft fitting, thereby passively mirroring motion of the flap induced by an actuator driven primary main flap support. |
| US11591063B2 |
Separating element for a platform cabin, platform comprising such an element and method for using such an element
A separating element for a platform cabin comprises at least one leaf subjected to a return force toward its open position, and, for the or each leaf, a return member for returning the leaf toward its closed position and comprising a first end articulated at an articulation point movable jointly with the leaf. This return member also comprises a second end mounted movably relative to the partition between an active position and an inactive position, such that when the leaf is open and the second end is in the active position, the return member exerts, on the leaf, a return force returning the leaf toward its closed position, and when the leaf is open and the second end is in the inactive position, the return member is in a second configuration in which it does not exert a force returning the leaf toward its closed position. |
| US11591061B2 |
Watertight bulkhead for a boom of an aircraft
A boom for an aircraft, and, more particularly, to a tail boom for a helicopter, whereby the tail boom may comprise a watertight compartment and watertight bulkheads. The watertight bulkheads may close at least one end of watertight compartment. Watertight bulkhead may include attachment device, frame, and watertight fabric. |
| US11591057B2 |
Propulsion devices and methods of making propulsion devices that align propeller blades for marine vessels
A propulsion device for marine vessel. A base is configured to be coupled to the marine vessel, the base having sides that extend downwardly from the marine vessel. A propulsor is pivotally coupled to the base and pivotable into and between a deployed position and a stowed position. The propulsor comprises a propeller having a hub with blades extending away therefrom. The propulsor is configured to propel the marine vessel in water when in the deployed position by rotating the propeller. An alignment device aligns the blades of the propeller between the sides of the base when the propulsor is in the stowed position. |
| US11591056B2 |
Marine vessel
A marine vessel capable of improving propulsion efficiency for the entire operation of the marine vessel. In the marine vessel, which includes a hull and a propeller provided on a stern side of the hull, n2D/√(Bd) is 4 or more and 35 or less, in a case where n is the number of the propeller, D is a diameter of the propeller, B is a water line breadth of the hull, and d is a draft of the hull. |
| US11591054B1 |
Floatation attachment device
A floatation attachment system may include a floatation attachment device configured to be attached to an object. The floatation attachment device may include a floatation material configured to provide buoyancy to the object it attaches and an attachment surface configured to directly attach the object. The floatation material may include a material that expands or generates gas upon contact with water. The system may include a dispenser such as a sheet of pre-cut floatation attachment devices or for manual cutting for customized shapes and sizes. In one instance, the system includes a tape roll dispenser for dispensing floatation attachment devices from a roll. |
| US11591053B2 |
Life raft system for an aircraft
A life raft system for an aircraft, comprising a storage container; an inflatable life raft that is stored in the storage container in normal operation mode, an inflation device for inflating the inflatable life raft in an emergency mode, and a control unit for activating the inflation device in the emergency mode; wherein the control unit comprises a floatable control buoy with an activation member that is operable for activating the inflation device, wherein the floatable control buoy is provided for operation at a predetermined distance remote from an associated aircraft in an emergency mode. |
| US11591052B2 |
Gyroscopic boat roll stabilizer with bearing cooling
A gyroscopic roll stabilizer includes an enclosure, a flywheel assembly, a bearing, a motor, and a bearing cooling circuit. The enclosure is mounted to a gimbal for rotation about a gimbal axis and configured to maintain a below-ambient pressure. The flywheel assembly includes a flywheel and flywheel shaft. The bearing rotatably mounts the flywheel assembly inside the enclosure for rotation about a flywheel axis. The bearing has an inner race and an outer race. The inner race is affixed to the flywheel shaft, and the outer race is held rotationally fixed relative to the enclosure. The motor is operative to rotate the flywheel assembly. The bearing cooling circuit is configured to transfer heat away from the bearing by recirculating cooling fluid along a closed fluid pathway. The gyroscopic roll stabilizer is configured to transfer heat away from the inner and/or outer race of the bearing to the cooling fluid. |
| US11591046B2 |
Safely device for passage of pipes on boats
The present invention concerns in particular the nautical equipment sector, with particular reference to the installation of pipes on board of boats of any size and kind. In particular, the present invention deals with safety devices for routing pipes between different sectors of the hull, passing through the bulkheads separating the various vans/spaces/housings of a boat. More specifically, the present invention describes a device (1) for the passage of pipes (5) for liquids or gases through bulkheads and decks of yachts, mega yachts and naval vessels in general with fireproof characteristics preferably and in a particularly innovative way, even watertight/tight. |
| US11591042B2 |
Power supply device for human-powered vehicle
A power supply device is provided for a human-powered vehicle. The power supply device comprises a base, a first electrical port, a second electrical port and a third electrical port. The first electrical port is provided to the base. The first electrical port has a first connection configuration. The second electrical port is provided to the base, and having a second connection configuration. The third electrical port is provided to the base, and having a third connection configuration. The first connection configuration, the second connection configuration and the third connection configuration have a same shape. |
| US11591039B2 |
Bicycle head and bicycle shift control box
A bicycle head is configured to be mounted on a bicycle frame. The bicycle head includes a vertical tube, a stem, a handlebar, a first brake lever, and a shift control box. One end of the stem is mounted on the vertical tube. The handlebar is fixed to another end of the stem. The first brake lever assembly is mounted on the handlebar. The first brake lever assembly includes a main body, a brake assembly, a shift switch, and a battery. The brake assembly and the battery are disposed on the main body, and the shift switch is disposed on the brake assembly. The shift control box is disposed on one of the vertical tube, the stem, and the handlebar and electrically connected to the battery and the shift switch. |
| US11591038B2 |
Portable conveyance with dual function rack and stand
This specification relates to portable conveyances, and in particular to a dual-function apparatus that functions as a rack in a first attachment position on the portable conveyance when the portable conveyance is in an unfolded position, and that functions as a stand in a second attachment position on the portable conveyance when the portable conveyance is in a folded position. |
| US11591035B2 |
Bicycle cover
A bicycle cover (10) comprising a first material piece (11), a second material piece (12), and a first resilient element, the first resilient element being provided about a periphery (13) of the first material piece, the bicycle cover having a folded configuration in which portions of the first material piece and the second material piece lie adjacent one another and an expanded configuration in which the cover is adapted to receive a bicycle between the first and second material pieces, the first resilient element being biased to urge the cover towards the expanded configuration. |
| US11591033B2 |
Focused light beam alignment apparatus for aligning fixture relative to a vehicle
An apparatus including a focused light beam receptor apparatus configured to be positioned proximate a first end of a vehicle, a focused light beam generator; and wherein the focused light beam receptor apparatus includes a focused light beam receiving surface for receiving a focused light beam from the focused light beam generator to provide alignment of the focused light beam receptor relative to a centerline of the vehicle. A method of aligning a focused light beam receptor, focused light beam generator and a movable alignment stand relative to a centerline of a vehicle is also provided. |
| US11591031B2 |
Rear-end air guide device
A rear-end air guide device for a motor vehicle includes a rear spoiler having a spoiler surface and a rear wing arranged in a vehicle vertical direction above the rear spoiler. The spoiler surface faces toward the rear wing, and the spoiler surface facing toward the rear wing is adjustable in a vehicle longitudinal direction. |
| US11591029B2 |
Railing assembly for trailer
A railing assembly includes at least one ratcheting post and at least one connection post. The at least one ratcheting post includes at least one ratcheting assembly attached to the at least one ratcheting post for selectively engaging a strap and the at least one connecting post including at least one attachment point for engaging an attachment member on the strap. |
| US11591028B2 |
Front end module assembly
A front end module assembly has a front end module structure of a vehicle, a heat exchanger support and a first heat exchanger unit. The heat exchanger support is supported to the vehicle front end module structure. The heat exchanger support has an opening. The first heat exchanger unit is accommodated in the opening of the heat exchanger support so that the transmission cooler is supported to the vehicle front end module structure via the heat exchanger support. |
| US11591026B2 |
Vehicle body joint structure
An embodiment vehicle body coupling structure of a vehicle that includes an underbody and an upper body coupled to the underbody includes a front back beam assembly provided on a front side of the underbody, a first mounting part provided on a front side member of the upper body and coupled with the front back beam assembly, and a first body coupling part provided on the front back beam assembly and engaged with the first mounting part. |
| US11591017B2 |
Pilot neutralizing system
A pilot neutralizing system of a work vehicle may include a pilot neutralizer. The work vehicle may include a first frame portion and a second frame portion. The work vehicle has an actuating assembly used to pivot the first frame portion relative to the second frame portion. The pilot neutralizer is electrically coupled to a controller receiving a signal indicative of an articulation position. The pilot neutralizer is hydraulically coupled between an operator control member and a steering valve to selectively change a pilot signal at the steering valve. The pilot signal is used to switch the steering valve to change a direction of a hydraulic fluid flowing from the steering valve to the actuating assembly. When the articulation position reaches a cushion region during steering, the pilot neutralizer is de-energized or energized by the controller to change the pilot signal at the steering valve to resist the actuating assembly from moving. |
| US11591016B2 |
Three-wheeled tilting vehicle
A tiltable vehicle is configured to transform between an autonomous mode and a rideable mode by pivoting the handlebars and steering column of the vehicle about a pitch axis. In the autonomous mode, the steering column is folded back toward the chassis and a tiltable chassis of the vehicle is prevented from tilting. In the rideable mode, the steering column is unfolded and the chassis is free to tilt. In some examples, a tiltable vehicle includes features beneficial for vehicle-sharing, such as parking devices or a basket. These features may be included on any suitable vehicle and are not limited to use on transforming vehicles. |
| US11591014B2 |
Four-wheel steering system
The four-wheel steering system includes a front-wheel steering system that steers front wheels of a vehicle and a rear-wheel steering system that steers rear wheels of the vehicle in accordance with a steering angle that is a rotation angle of a steering wheel. The rear-wheel steering system includes a second ECU that, when the vehicle speed is equal to or lower than a vehicle speed threshold, performs antiphase control in which the rear wheels are steered in the opposite direction to that in which the front wheels are steered. When the vehicle speed is equal to or lower than the vehicle speed threshold, the second ECU performs in-phase control in which the rear wheels are steered in the same direction as that in which the front wheels are steered, in response to a specific trigger operation that is performed via the steering wheel. |
| US11591012B2 |
Vehicle trajectory prediction using road topology and traffic participant object states
System, method, and device for controlling a vehicle. In one example, the system includes an electronic processor configured to capture, via a camera, a first image, determine, within the first image, a road traffic factor, and generate, based on sensor information from one or more sensors of the vehicle, a second image depicting an environment surrounding the vehicle. The second image includes the road traffic factor. The electronic processor is also configured to, determine, based on the detected road traffic factor and the second image, a predicted trajectory of a traffic participant proximate to the vehicle, and generate a steering command for the vehicle based on the predicted trajectory. |
| US11591011B1 |
Dynamic vehicle steering and/or suspension constraints
This application describes systems and techniques for adjusting one or more setting(s) of a vehicle based on detected condition(s) to avoid damage due to contact of the tires with a body, chassis, or other components of the vehicle. In some instances, the vehicle may determine a ride height of the vehicle, determine a limited range of steering angles based at least in part on the ride height, and control operation of the steering system of the vehicle based at least in part on the limited range of steering angles. In some instances, the vehicle may determine a steering angle of the vehicle, determine a limited range of ride heights based at least in part on the steering angle, and control operation of the suspension system of the vehicle based at least in part on the limited range of ride heights. |
| US11591009B2 |
Power management of permanent magnet synchronous motor (PMSM) drive using machine current limiting
Technical solutions are described for controlling operation of an electric machine such as a permanent magnet synchronous motor (PMSM) drive or motor control system to protect against excessive machine current or voltage in a PMSM drive. Systems and methods employ a torque control algorithm for PMSMs that uses the constraints of both machine current and voltage capability in PMSM drives, and online torque command modification according to the maximum allowed torque under these machine current and voltage constraints. |
| US11591003B2 |
Stowable steering column
A steering column has a housing. A steering spindle jacket is disposed within the housing. An outer steering spindle is disposed within the steering spindle jacket and has a spline hub. An inner spindle is disposed within the outer steering spindle and includes a spline shaft configured to permit axial movement and prevent rotation of the outer steering spindle when the spline hub and the spline shaft are engaged. In a non-stowed state the spline shaft and the spline hub are engaged and in a stowed state the spline shaft and the spline hub are free of engagement. A pin is disposed in the housing engages the spline hub portion in the stowed state and prevents rotation of the outer steering spindle and is free of engagement in the non-stowed state. |
| US11591002B2 |
Steering column impact energy absorber, with loop closed by a breakaway link
An absorber of steering column shock energy includes a plastically deformable part forming a loop, a breakaway link closing this loop on itself, and a first attachment interface and a second attachment interface separate from the breakaway link and arranged on either side of the loop. The part and the fusible link are arranged so that the exertion of forces in opposite directions on the first attachment interface and on the second attachment interface respectively, causes a stress leading to a deformation of the loop, breaking of the breakaway link and further deformation of the loop after this break. |
| US11590997B1 |
Autonomous shopping cart
In an example implementation, a smart cart system may include a cart including a frame and an item holder supported by the frame and configured to transition between an open position and a storage position that is more compact than the open position. The smart cart system may include a motivator configured to provide a motive force to the cart, a power source coupled with the motivator, and a charging interface attached to the frame of the cart and that interacts with a cart charging system of a cart storage rack to charge the power source. The smart cart system may also include a user interface device, a computing device, and a smart cart controller operable on the computing device to receive information describing an attribute of an item and provide information describing the attribute of the item for presentation by the user interface device. |
| US11590996B2 |
Transporting apparatus with shock absorbing elements
The present disclosure provides a transporting apparatus. The transporting apparatus can include the following components: a first frame support configured to support an object; a second frame support configured to roll the transporting apparatus and to move relative to the first frame support; and a plurality of shock absorbing elements positioned between the first frame support and the second frame support. |
| US11590991B2 |
Bogie and rail vehicle
A bogie and a rail vehicle, wherein the bogie includes: a framework, a wheel pair connected to the framework, a braking hanger fixed to the framework, a hanger slider used for fixedly connecting to a vehicle wheel braking clamp, and a transmission member; the hanger slider is connected to the braking hanger, and the transmission member is connected to the hanger slider; a first end of the transmission member extends to a side surface of a vehicle wheel in the wheel pair, and the transmission member is used to drive the hanger slider to move along the lateral direction with respect to the braking hanger when the first end is subjected to a thrust applied in the lateral direction by the vehicle wheel, so that the vehicle wheel braking clamp moves to a position corresponding to the vehicle wheel. |
| US11590990B2 |
Cable transportation system comprising a station and method for operating such cable transportation system
A station for a cable transportation system comprising a plurality of transporting units supported and driven outside the station by at least one cable, the station comprising an inlet and an outlet for the transporting units; a guiding device for guiding the transporting units uncoupled from the cable inside the station; an advancing auxiliary device for moving the transporting units along the guiding device; a control unit configured for controlling the advancing auxiliary device so that the advancing auxiliary device can switch, with no service interruption, from a first configuration, wherein the transporting units are individually arranged equidistant from each other and the boarding and landing occur inside the station without stopping the advancing movement, to a second configuration, wherein the transporting units are arranged in equidistant compact groups of at least two units and the boarding and landing occur inside the station by temporarily stopping the transporting units, and vice versa. |
| US11590988B2 |
Predictive turning assistant
A method for assisting in turning a vehicle, the method may include detecting or estimating that the vehicle is about to turn to a certain direction or is turning to the certain direction; sensing a relevant portion of an environment of the vehicle to provide sensed information, wherein the relevant portion of the environment is positioned at a side of the vehicle that corresponds with the certain direction; applying an artificial intelligence process on the sensed information to (i) detect objects within the relevant portion of the environment and (ii) estimate expected movement patterns of the objects within a time frame that ends with an expected completion of the turn of the vehicle; determining, given an expected trajectory of the vehicle during the turn and the expected movement patterns of the objects, whether at least one of the objects is expected to cross the trajectory of the vehicle during the turn; and responding to an outcome of the determining. |
| US11590979B2 |
Vehicle control device, vehicle, vehicle control method, and storage medium
A vehicle control device that controls traveling of a vehicle, the vehicle control device comprises: an acquisition unit configured to acquire information of a periphery of the vehicle; and a control unit configured to, based on the information that the acquisition unit acquired, determine whether or not another vehicle, which travels in one of a plurality of traffic lanes of a merging path that merges into a traffic lane that the vehicle is traveling in, will merge into the traffic lane, and based on the determination, control travel of the vehicle. |
| US11590966B2 |
System and method for supporting automated valet parking, and infrastructure and vehicle therefor
A system and a method for supporting automated valet parking, and an infrastructure and a vehicle therefor are provided. The method for operating a vehicle which supports automated valet parking includes initializing automated valet parking and receiving, from an infrastructure, a target position which is related to the vehicle and a guide route which guides movement to the target position. Additionally, the method includes performing automated driving by the vehicle along the guide route, and measuring a position of the vehicle based on behavior information of the vehicle and environmental information, while the vehicle performs the automated driving. The environmental information includes at least one among parking lot slot information, road signs, walls, pillars, and floor markings. |
| US11590964B2 |
Method for performing automatic valet parking
A method for performing automatic valet parking, which includes selecting a road scenario applicable to a roadway; notifying a driver to release manual control elements of a motor vehicle and to leave the motor vehicle; checking whether the control elements have been released and the driver has left the motor vehicle and, in this case, entering an EXPLORE mode in which the motor vehicle is slowly driven autonomously and searches for a free car space or a parking space using the vehicle's own environmental sensors, before the motor vehicle is placed in a parking position; and then to change from the EXPLORE mode to a PARKING mode in which the motor vehicle is parked in the car space or in the parking space from the parking position by means of the longitudinal and lateral controllers and using the environmental data previously obtained from the environmental sensors in the EXPLORE mode. |
| US11590963B2 |
Vehicle and method of controlling the same
A vehicle includes a brake device; a storage configured to store a first setting value and a second setting value having a smaller magnitude than the first setting value; a communicator configured to receive an automatic parking signal; a detector configured to detect at least one of an object or whether the vehicle is in contact with the object; and a controller configured to control the brake device based on a detection result of the detector and the first setting value, and to control the brake device based on the detection result and the second setting value when the automatic parking signal is received. |
| US11590960B2 |
Method for a serial driving mode of a motor vehicle
A method for serial operation of a motor vehicle with a transmission having a first electric machine, which is operated as a motor for driving the motor vehicle, and a second electric machine, which is operated as a generator, includes, after a generation of a change-over signal, switching the first electric machine from the operation as a motor to the operation as a generator, and switching the second electric machine from the operation as a generator to the operation as a motor in order to drive the motor vehicle. |
| US11590959B2 |
Hybrid vehicle transmission shift control for electric machine thermal management
A system and method for controlling a hybrid vehicle having an engine, a traction motor, and an automatic step-ratio transmission having a plurality of selectable discrete gear ratios, a torque converter, and sharing a common cooling fluid or oil with the traction motor, include a controller configured to shift the automatic step-ratio transmission to neutral in response to vehicle speed being below a threshold with the engine idling while temperatures of at least two of: the traction battery, the electric machine, and the transmission are above associated thresholds to reduce heat generation by the torque converter due to oil shear with the torque converter stalled. The controller may shift the transmission to drive in response to release of a brake pedal. A neutral shift may also be performed in response to high-voltage accessory loads or on-board generator loads exceeding a threshold. |
| US11590957B2 |
Method for testing a brake fluid sensor
The present disclosure relates to a method for testing a brake fluid sensor of a vehicle braking system, wherein the brake fluid sensor can indicate the fluid level in the fluid reservoir, wherein the method has the following steps: (1) Altering the fluid level in at least one region of the at least one fluid reservoir by means of at least one braking force generating device; and (2) Detecting whether the at least one brake fluid sensor emits a signal indicating the modified fluid level in the at least one region of the at least one fluid reservoir. |
| US11590955B2 |
Electronic brake-integrated in-wheel motor driving device
The present invention relates to an electronic braked-integrated in-wheel motor driving device. According to one embodiment of the present invention, an apparently complicated driving device structure, which is formed due to the installation of a brake, can be avoided, and a product appearance of a wheel-chair, to which the in-wheel motor driving device is applied, can be simplified, whereby the driving device improves the visual appearance as well as the brake function and can thus enhance production competitiveness. |
| US11590952B2 |
Method for controlling ESC integrated braking system
A method for controlling an ESC integrated braking system including: checking, by a control unit, whether a brake is in an on state or a standby state as the braking system is activated; checking, by the control unit, whether a current temperature value is in a low temperature state lower than specified reference temperature; and controlling, by the control unit, a current duty for driving a hydraulic control valve and a current component of a motor for driving a master cylinder according to the state of the brake and whether the current temperature value is in the low temperature state. |
| US11590948B2 |
Fluid reservoir with a stop valve
A fluid container for supplying a consuming device with a working fluid, including at least one connector piece having a shut-off valve arranged therein for preventing undesired escaping of the working fluid from the fluid container. In order to increase safety against undesired emptying of the fluid container, it is provided that the valve closure body, in the closed state of the shut-off valve, is accommodated in the fluid container completely inside a contour formed by an outer edge of the connector piece, and provision is made, for support against the valve closure body, of a support, which, upon insertion of the connector piece into the receiving seat, engages at least regionally into the connecting duct and in this way displaces the valve closure body in the connecting duct. |
| US11590944B2 |
Braking control device
A braking control device of a vehicle in which a braking force generator is connected to a differential mechanism to which a plurality of wheels is connected, and a friction brake is provided for each of the wheels includes a controller configured to control braking forces of the braking force generator and the friction brake. The controller is configured to: detect the wheel having a tendency of locking in which a slip ratio is larger than a predetermined determination value in a state where the braking force is transmitted to each of the wheels from the braking force generator via the differential mechanism; and reduce the tendency of locking by changing the braking force of the friction brake that is provided for the other wheel connected to the differential mechanism. |
| US11590943B2 |
Control system of brake-by-wire device
A control system of a BBW device may include brake-by-wire (BBW) devices provided to each of wheels of a vehicle to perform a braking control or a suspension control of the vehicle, sensors configured for detecting an operating state of each of the BBW devices, and controllers connected to each of the BBW devices to control a corresponding BBW device among the BBW devices, in which the controllers are configured to determine whether the sensors fail according to data received from the sensors, and when determining that any a sensor among the sensors fails, the controllers turn off any a BBW device of the BBW devices which is a target detected by the failed sensor, and perform the braking control or the suspension control of the BBW devices based on a traveling state of the vehicle. |
| US11590942B2 |
Braking force control apparatus for a vehicle
A braking force control apparatus has an upstream braking actuator for generating an upstream pressure common to four wheels, a downstream braking actuator individually controlling braking pressures supplied to braking force generating devices of the wheels using the upstream pressure, and a control unit. When the downstream braking actuator is abnormal and the upstream pressure can be supplied to the braking force generating devices, but a braking pressure of any one of the wheels cannot be normally reduced, the control unit selects higher one of the target braking pressures of the left and right front wheels and higher one of the left and right rear wheels, determines lower one of the two selected target braking pressures as a backup target upstream pressure, and controls the upstream braking actuator such that the upstream pressure becomes the backup target upstream pressure. |
| US11590930B1 |
Vehicle systems for verifying passenger protective equipment and methods for using the same
A vehicle system includes a detection device structurally configured to capture an image, a door lock, where the door lock is positionable between a locked position and an unlocked position, a controller communicatively coupled to the detection device and the door lock, the controller including a processor and a non-transitory computer readable and executable instruction set, which when executed, causes the processor to receive a captured image of a user from the detection device, determine whether the captured image of includes protective equipment worn by the user, and direct the door lock to move into the unlocked position in response to determining that the protective equipment in the captured image meets a configurable protective equipment baseline. |
| US11590929B2 |
Systems and methods for performing commands in a vehicle using speech and image recognition
Systems and methods are disclosed herein for implementation of a vehicle command operation system that may use multi-modal technology to authenticate an occupant of the vehicle to authorize a command and receive natural language commands for vehicular operations. The system may utilize sensors to receive data indicative of a voice command from an occupant of the vehicle. The system may receive second sensor data to aid in the determination of the corresponding vehicular operation in response to the received command. The system may retrieve authentication data for the occupants of the vehicle. The system authenticates the occupant to authorize a vehicular operation command using a neural network based on at least one of the first sensor data, the second sensor data, and the authentication data. Responsive to the authentication, the system may authorize the operation to be performed in the vehicle based on the vehicular operation command. |
| US11590928B2 |
Control device for seat belt of vehicle
A control device for a seat belt of a vehicle includes a retracting unit configured to retract the seat belt, a departure detection unit configured to detect a departure of the vehicle from a lane; a vehicle speed sensor configured to measure a vehicle speed; and an electronic control unit configured to operate the retracting unit when both a first condition and a second condition are satisfied. The first condition is a condition that the departure detection unit detects the departure of the vehicle from the lane, and the second condition is a condition that the vehicle speed is equal to or higher than a prescribed speed, and the electronic control unit is configured not to operate the retracting unit when the first condition is satisfied and the second condition is not satisfied. |
| US11590926B2 |
Drive arrangement for a flap of a motor vehicle
A drive arrangement for adjusting a front hood of a motor vehicle including a first drivetrain for producing a first drive movement between a flap-side drive connection and a body-side drive connection and when the first drivetrain is in a normal state the first drive movement opens the flap from a closed position to an open position. A second drivetrain for producing a second drive movement between a flap-side drive connection and a body-side drive connection to open the flap from the closed position to a collision position so that by means of the second drive movement of the second drive the first drivetrain changes from a normal state to a bypass state, in which a first strand component of the first drivetrain moves relative to a second strand component of the first drivetrain. |
| US11590925B2 |
ADAS-linked active hood apparatus and method of controlling the same
An ADAS-linked active hood apparatus includes an ADAS device that measures information regarding a driving state of a vehicle and an object and a collision sensor unit that is positioned at a front of the vehicle and measures collision with the object. An active hood lift system (AHLS) raises one end of a hood of the vehicle based on a signal from the collision sensor unit. A controller sets a pedestrian detection threshold (PDT) turn, receives information regarding a plurality of front objects from the ADAS device to compensate for a PDT, compensates for an output reference value of the collision sensor unit based on the compensated PDT, and determines whether collision occurs using the collision sensor unit to adjust pop-up of the AHLS when an output value equal to or greater than the compensated reference value is applied. |
| US11590923B2 |
Roof mounted airbag
A roof mounted airbag is proposed. The roof mounted airbag includes: an airbag cushion having an upper portion fixed to a roof of a vehicle and configured to be expanded downward when gas is supplied therein; a vent hole formed on the airbag cushion, and configured to discharge the gas in the airbag cushion to the outside of the airbag cushion during opening of the vent hole; and a closing tether having a first end fixed to the roof of the vehicle, and a second end connected to the vent hole to close the vent hole when tension is applied thereto. |
| US11590922B2 |
Occupant restraint system for a vehicle seat including external tethering
An occupant restraint system for a seat of a vehicle includes at least a first airbag carried by the seat and deployable from the seat and at least a first tether mounted to the seat and deployable from a stowed position to a deployed position such that the first tether extends around a front facing side of the first airbag from a first lateral side of a seatback of the seat to a second lateral side of the seatback. |
| US11590919B1 |
Mounting bracket for curtain airbag
An airbag module for helping to protect an occupant of a vehicle includes a curtain airbag and a mounting bracket. The curtain airbag includes a mounting tab configured to receive a fastener for connecting the curtain airbag to the vehicle. The mounting bracket is configured to cooperate with the mounting tab to facilitate the connection of the curtain airbag to the vehicle via the fastener. The mounting bracket includes a generally planar body portion and a fastening structure that extends transversely from the body portion. The mounting tab includes overlying layers of material that help define a pocket configured to receive the mounting bracket. The mounting tab includes a first fastener opening configured to receive the fastening structure so that the fastening structure extends through the first fastener opening with the body portion positioned in the pocket. The fastening structure is configured for installation in the vehicle structure to initially support the airbag module in the vehicle. The airbag module further includes a fastener configured to extend through the mounting tab and the mounting bracket to connect the airbag module to the vehicle. |
| US11590917B2 |
Rear seat airbag module and vehicle seat
A rear seat airbag module includes: an airbag; and an inflator configured to supply gas for expansion and deployment into the airbag. The rear seat airbag module is attached to a frame of a seat back of a vehicle seat, and is configured to expand and deploy the airbag to a seat rear side of the seat back. The rear seat airbag module is displaceable to the seat rear side or deformable to the seat rear side due to an easily deformable configuration, by being pressed by a back of an occupant seated on the vehicle seat, as a result of the back being sunk in the seat back due to an impact of a rear collision of a vehicle. |
| US11590916B2 |
Steering device assembly and method for installing an airbag module on a steering device of a motor vehicle
The disclosure is directed to a steering device assembly for positioning and fastening an airbag module on a steering device of a motor vehicle. The steering device assembly comprises a first positioning body having a detent lever, a carrier, a spring element, and a second positioning body. The detent lever comprises a first leg and a second leg connected to the first leg at one leg end the detent lever is mounted for pivoting between an initial position and a final assembly position on the carrier. The spring element loads the detent lever into the final assembly position. Each leg extends to an opposite free leg end at a specified angle. The second positioning body has a stop for the free leg end of the first leg for pivoting the detent lever from the initial position into the final assembly position and a detent contour for locking with the free leg end of the second leg in the final assembly position of the detent lever. A method for installing an airbag module on a steering device of a motor vehicle by the steering device assembly. |
| US11590913B2 |
Restraint monitoring system for a vehicle
A vehicle includes a rail-mounted component and a restraint monitoring system. The rail-mounted component can include one or more restraints. The restraint monitoring system includes a restraint control module, an encoder-decoder module, and a rail-mounted component control module. The rail-mounted component control module can include a restraint deployment loop and a restraint diagnostic loop. The restraint deployment loop can include a deployment signal amplifier. The restraint diagnostic loop can include a diagnostic signal amplifier. In examples that include both the deployment signal amplifier and the diagnostic signal amplifier, the deployment signal amplifier and the diagnostic signal amplifier may be wired in parallel. |
| US11590907B2 |
In-vehicle network system, electronic control unit, and gateway device
An in-vehicle network system which is mounted on a vehicle includes an electronic control unit, a plurality of gateway devices, and a plurality of sensor devices that collects ambient information which is information around the vehicle. Each of the sensor devices communicates with the electronic control unit via at least one gateway device. The electronic control unit includes a mode management unit that determines one operation mode in a plurality of operation modes associated with the sensor device to be operated, and a sleep instruction control unit that specifies a gateway device which is the gateway device, in which the connected sensor device does not operate, and does not need to relay sensor information, based on the operation mode determined by the mode management unit, and transitions the gateway device having no need to relay the sensor information to a low power state in which a processing capacity is lowered. |
| US11590904B2 |
Trim element for a pillar of a motor vehicle
A trim element for a pillar of a body of a motor vehicle is described, in particular for an A pillar, having a main body; an outer side of the main body, which faces toward a vehicle interior in an installed state of the trim element on the pillar, an inner side of the main body, which faces toward the body in an installed state of the trim element on the pillar, a textile element covering the outer side having multiple edge sections folded over onto the inner side, and a bending section, which is formed in the main body, extending essentially along the longitudinal direction of the trim element; and a pivoting section of the main body extending along the bending section. |
| US11590902B2 |
Vehicle display system for displaying surrounding event information
An information distribution system obtains event information such as image data about an event in the past or future using a collection server or a creation server, and stores the obtained event information in a storage server. The event information such as the image data is obtained with association to a location of the event and stored. The vehicle includes an image display system. An occupant wears a wearable device which is a display unit. When the location of an event is within the field of view of the occupant, the event image is displayed through the wearable device based on the event information such as the image data. |
| US11590893B2 |
Vehicle electronic mirror system
A rearward camera of a vehicle electronic mirror system images a rearward view of a vehicle, and a lateral rearward camera unit images each of right and left lateral rearward views of the vehicle. A control device compresses at least one of a rearward view picture after imaging by the rearward camera and right and left lateral rearward view pictures after imaging by the lateral rearward camera unit, at least in a vehicle-width direction, and performs display on an inner mirror display. The control device changes the compression ratio of the picture in the control device, depending on at least one of a state and peripheral situation of the vehicle. Accordingly, when a vehicle rearward side including lateral rearward sides contains a site requiring an easy distance-sense grasp, it is possible to easily grasp distance sense by decreasing the compression ratio of the picture corresponding to the site. |
| US11590885B2 |
Method for the operation of a self-driving motor vehicle
A method and a system can include receiving travel direction information representing a planned driving maneuver of the motor vehicle, detecting at least one road user in a path region of the planned driving maneuver based on an evaluation of at least the travel direction information, determining a lamp operation data set for operating at least one lamp of the motor vehicle based on the evaluation of at least the travel direction information when a road user is detected in the path region, and operating the lamp in accordance with the lamp operation data set. |
| US11590884B2 |
Driving control method and system for vehicles
A driving control method for vehicles includes: determining, by a controller, whether virtual guide lines need to be generated, based on a state of turn guide lines disposed at sides of a host vehicle when the host vehicle enters an intersection and drives while turning; and controlling, by the controller, the host vehicle to radiate optical guide lines on a road surface requiring generation of the virtual guide lines, using light, in response to determining that the virtual guide lines need to be generated. |
| US11590883B2 |
Boat loaders for watercraft trailers
Various examples are provided related to boat loaders for trailers. In one example, a boat loader includes a primary tube extending between a first end and a second end and a light tube that can move within the primary tube. The light tube can include light elements extending along a portion of the light tube at a first end and a float attached to the light tube at a second end. The primary tube can be coupled to a trailer at the second end and the first end of the light tube can extend outward from the first end of the primary tube exposing the light elements as the primary tube is submerged in water and can retract into the primary tube as the primary tube is removed from the water. |
| US11590882B1 |
Method and apparatus for vehicular light fixtures
A terrain viewing apparatus is provided to enable greater viewability of environmental conditions around a vehicle. A housing of the terrain viewing apparatus may include a lighting apparatus for emitting light and illuminating environmental conditions during nighttime, dusk, or adverse weather conditions. The housing may further include a reflecting apparatus to increase an operator's ability to view environmental conditions outside the vehicle. One or more joints may enable the housing to be adjustable with respect to the vehicle. An internal joint may enable the reflecting apparatus to be adjustable with respect to the housing. The lighting apparatus may receive power from the vehicle. The lighting and reflecting apparatuses may be electrically coupled to the vehicle and may be controllable therefrom. |
| US11590881B2 |
Motor vehicle having at least one headlight with separately actuated light segments
A motor vehicle having at least one headlight for illuminating the surroundings of the motor vehicle and a control device for controlling the headlight, wherein the headlight comprises a plurality of lighting segments that are arranged in the manner of a matrix and that can be actuated separately by the control device for providing a lighting brightness that can be predefined separately for the individual lighting segments, wherein the control parameter predefining the specific lighting brightness for each of the lighting segments can be calculated by the control device in at least one computing step as a function of input parameters that can be provided by at least one vehicle device, wherein the computing step or at least one of the computing steps may be executed in parallel by the control device for a plurality of the lighting segments. |
| US11590878B1 |
Magnetic fastener for cargo retention
An apparatus, system, and method of using the apparatus and system may generally include a strap or retention device. A first end of a fastener is operatively coupled to the strap that is configured to retain a cargo contactingly adjacent a cargo support surface. A second end of the fastener is operatively coupled to the first end. The second end has a double rod formation. A magnet may be supported in a housing in the second end. The magnet may be held in position within a recess feature of the housing. A support structure 212 may be disposed between the double rod formation to provide additional strength and stability. The support structure may be made of metal, polymer, or other suitable material. The magnet that is configured to support the second end adjacent a side of the cargo support surface, wherein the side does not produce its own magnetic field. |
| US11590874B2 |
Vehicle seat support, seat assembly comprising such a support, and method for mounting in a vehicle
A vehicle seat support comprising two rails extending in a longitudinal direction, a central module slidably mounted on the rails and suitable for supporting the vehicle seat, a footrest slidably mounted on the rails in front of the central module and suitable for receiving the feet of an occupant seated on the seat, a first actuation system able to cause the central module to slide along the rails, and a second actuation system able to cause the footrest to slide along the rails independently of the central module. |
| US11590871B2 |
Seat pad, vehicle seat, vehicle seat controlling method, and seat pad manufacturing method
According to the disclosure, a seat pad 2 includes a bag-contained pad part 250 including a foam body 240 and a bag body 230 arranged inside the foam body 240. |
| US11590869B2 |
Seatback speakers
Various implementations include seats and related loudspeakers. In particular cases, a seat includes: a seat headrest portion; a seat backrest portion; and a loudspeaker assembly. The loudspeaker assembly includes at least one driver for generating an acoustic output; and an acoustic exit fixed in the seat backrest portion and angled to provide the acoustic output to a location below a nominal ear position of an occupant of the seat, wherein a firing angle of the at least one driver provides the acoustic output to achieve a consistent frequency response across a range of positions deviating from the nominal ear position. |
| US11590865B2 |
Insert for a child safety seat
An insert for repositioning at least one of the harness straps of a child safety seat in order to accommodate an occupant smaller than the harness is configured to accommodate, wherein the insert is adapted to locate between the child safety seat and the occupant and includes a pair of waist strap guides, each waist strap guide configured to allow a waist strap of the harness to extend through and exit the waist strap guide at a position narrower than where the waist strap exits the child safety seat. |
| US11590859B2 |
System and method for controlling relay using flip-flop
The present invention relates to a system and a method for controlling a relay using a flip-flop, in which a flip-flop controlling a relay by receiving a signal of a control unit in a battery management system of a vehicle and supply flip-flop operation power to the flip-flop through a monitoring circuit connected to a battery of the vehicle when operation power of the battery management system of the vehicle is interrupted to maintain a closing state of a relay controlling driving power of the vehicle and to conserve power of the vehicle for a predetermined time. |
| US11590857B2 |
Charging method, apparatus, device, medium, battery management system and charging pile
The present application discloses a charging method, an apparatus, a device, a medium, a battery management system and a charging pile. The method includes: acquiring a charging demand parameter set by a user; calculating, according to the charging demand parameter and acquired actual operation state information of a battery, a target charging scheme for charging the battery; transmitting, according to the target charging scheme, a first charging request to a charging device, so that the charging device charges the battery according to the first charging request. According to the charging method, the apparatus, the device, medium, the battery management system and the charging pile provided in the embodiments of the present application, personalized smart charging can be achieved for different users. |
| US11590855B2 |
Electric vehicle fast charging and battery cooling system using a charger cooled fluid-to-battery cooled fluid heat exchange device
A vehicle battery charging system includes a battery charger for charging a battery module of a vehicle. A first coolant circuit conveys a first cooling fluid therethrough. The first coolant circuit includes a chiller unit separate from the vehicle. The chiller unit and the first cooling fluid exchange heat therebetween. A second coolant circuit conveys a second cooling fluid therethrough. The second coolant circuit includes a battery module. The battery module and the second cooling fluid exchange heat therebetween. A heat exchanger exchanges heat between the first cooling fluid and the second cooling fluid. |
| US11590853B2 |
Cable drum for supplying energy to an electrically powered utility vehicle
A cable drum for supplying power to an electrically powered utility vehicle, with an axially running winding body which can be set in rotation about a rotational axis in order to wind up and unwind an electrical cable, wherein on an inside, the winding body carries a plurality of fans which are configured to generate a cooling air stream directed radially outward with respect to a cylindrical drum wall. |
| US11590852B2 |
Hinged flap cover with angled seal for electric vehicle charging inlet
A charging inlet for an electric vehicle (EV) includes a body defining an opening having a conductive terminal arranged therein. A sealing cover is pivotally attached to the body and is moveable between an open position exposing the opening and conductive terminal, and a closed position sealing the opening and the conductive terminal with respect to an external environment. A sealing element of the cover defines a sealing plug including an angled sealing rib defined about an outer periphery thereof. The sealing plug and sealing rib are configured to engage with the opening of inlet body for sealing the opening with the cover in the closed position. |
| US11590851B2 |
Electric vehicle charging system
An electric vehicle (EV) charging system includes a number of output connections (e.g., cables). Each of the output connections is connected to at least one head, and each head can be connected concurrently to an EV. A controller can direct a charging current, delivered over a dedicated circuit from an electric power supply, to a first one of the output connections if a first EV is connected to a head connected to the first one of the output connections. Then, the charging current to the first one of the output connections can be stopped, switched to a second one of the output connections, and restarted if a second EV is connected to a head connected to the second one of the output connections. |
| US11590849B1 |
Wireless powering and control of conveyors on shuttles
Systems and methods are disclosed for wireless powering and control of conveyors on shuttles. An example system may include a track, and a shuttle configured to move along the track, the shuttle having a conveyor, and a first induction coil. The system may include a second induction coil disposed at a first location along the track, where the second induction coil is configured to interact with the first induction coil to power the conveyor. The shuttle may not have an onboard power source coupled to the conveyor. |
| US11590848B2 |
Method and system for controlling the regenerative braking torque of a vehicle
A method for controlling the regenerative braking torque of a vehicle having a data processing unit for detecting a first information representing a deceleration request of the vehicle, detecting a second information representing a speed of the vehicle, and a first moving member of the vehicle and a second moving member of the vehicle. The method includes determining temperatures of different braking components on different axles, as well as the state of a battery module and a traction and regenerative braking module. The method also includes determining a regenerative braking power dynamic distribution ratio between the first and second axles. A regenerative braking torque is provided to one of the modules. |
| US11590846B2 |
Steering wheel indicating paddle for displaying power rotating speed of automobile
The present invention discloses a steering wheel indicating paddle for displaying a power rotating speed of an automobile. The paddle comprises an emitting panel connected with an OBD port of the automobile, a receiving panel mounted on an R paddle or an L paddle of the automobile, a first lamp panel mounted on another paddle and a second lamp panel integrated to the receiving panel. The emitting panel comprises an OBD signal access circuit, a first master control chip, a first power supply circuit and a wireless sending module. The receiving panel comprises a second master control chip, a second power supply circuit and a wireless sending module. According to the present invention, the OBD signal access circuit is connected with the OBD port of the automobile, so that it acquires a rotating speed condition of an engine. |
| US11590845B2 |
Systems and methods for controlling a head-up display in a vehicle
Systems and methods for controlling a head-up display (HUD) in a vehicle are disclosed herein. One embodiment deactivates the HUD in response to a command from a driver of the vehicle; assigns a level of urgency to an item of information associated with a current vehicular context; and activates the HUD to display the item of information to the driver, when the level of urgency exceeds a predetermined threshold. |
| US11590844B2 |
Glass substrate and in-vehicle display device
A glass substrate includes a pair of main surfaces including a first main surface and a second main surface opposed to the first main surface; an edge surface arranged along a direction orthogonal to the pair of main surfaces; and a connecting surface arranged between the first main surface and the edge surface. The connecting surface has a plurality of pores. A difference between a 50% particle diameter of the pores in a portion 20 μm distant from the first main surface and a 50% particle diameter in a portion 20 μm distant from the edge surface is 10 μm or less. |
| US11590842B1 |
Transmission with power take-off
A method and system for operating a transmission that includes two power take off devices is described. In one example, an internal combustion engine and/or an electric machine may supply power to accessory devices via first and second power take off devices. Alternatively, power may be delivered to the transmission via one or both of the first and second power take off devices. |
| US11590840B2 |
Lubricant supported electric motor assembly for compact, power dense wheel-end applications
A lubricant supported electric motor assembly includes an electric motor module, a shifting and first stage module, and a final drive module sequentially operably interconnected with one another for producing drive torque that is ultimately conducted to a wheel of a vehicle. The electric motor module includes a stator and a rotor defining an internal rotor cavity. The shifting and first stage module is disposed within the internal rotor cavity and includes a first planetary gear reducer assembly and an output gear selectively coupleable to said first planetary gear reducer assembly. The final drive module is disposed adjacent the shifting and first stage module and includes a second planetary gear reducer assembly operably coupled with the output gear. A shifting mechanism establishes selective coupling between the first planetary gear assembly and the output gear to transfer adjustable torque from the shifting and first stage module to the final drive device. |
| US11590835B2 |
Electric powered vehicle
An electric powered vehicle includes a motor for driving one or more wheels. The electric powered vehicle may include a body including a dash panel, a cowl disposed along an upper end of the dash panel and at least partly located forward of the dash panel, an electric unit located forward of the dash panel and supported by the body, and a connector connecting the electric unit and an intermediate portion of the cowl to each other. |
| US11590833B2 |
Tonneau cover assembly with a fluid management system
A bed cap configured for placement on a top surface of a bed wall defining a cargo area of a vehicle, the top surface defined between an inside wall and an outside wall, the bed cap covering the top surface between the inside wall and the outside wall at least along a section of a length of the bed wall, wherein the bed cap comprises a channel configured to collect fluid and/or debris and an opening for evacuating the fluid and/or debris from the channel. |
| US11590829B2 |
Functional interlayers for vehicle glazing systems
A glass structure for a vehicle includes an outer layer of glass, an inner layer of glass, and an interlayer stack disposed between opposing surfaces of the outer layer of glass and the inner layer of glass. The interlayer stack includes at least two interlayer substrates and at least one of the interlayer substrates includes a decorative treatment. In another example, the interlayer stack includes at least two interlayer substrates and at least one of the interlayer substrates includes a functional component. |
| US11590828B2 |
Lateral vent stick air freshener
An air freshener has a carrier with a pair of tabs defining a gap. A center tab extends from the pair of tabs and defines a longitudinal axis. At least one scented body is carried by one of the pair of tabs. The pair of tabs and the at least one scented body extend laterally with respect to the longitudinal axis of the center tab in opposite directions. The pair of tabs and the at least one scented body have a lateral width greater than a longitudinal depth. |
| US11590826B2 |
Air vent for a vehicle
An air vent for a vehicle includes a housing (10) and an air-guiding element (30), wherein the air-guiding element (30) is mounted in the housing (10) so as to be pivotable in different directions about at least one centre of rotation (D), wherein a first drive element acts on the air-guiding element (30) at a first engagement point (A1), and a second drive element acts on the air-guiding element (30) at a second engagement point (A2), wherein the second engagement point (A2) defines, with the at least one centre of rotation (D) of the air-guiding element (30), a first pivot axis (S1) about which the first drive element pivots the air-guiding element (30), and wherein the first engagement point (A1) defines, with the at least one centre of rotation (D) of the air-guiding element (30), a second pivot axis (S2) about which the second drive element pivots the air-guiding element (30). |
| US11590825B2 |
Air vents
A gear system for pivoting blades of an air vent, which is releasable or disengageable. For this purpose, one embodiment provides a rack and pinion gear system comprising helical pinions, which engage with a toothed rack as a result of an axial force due to a helical spline when rotational driving, and thereby establish a drive connection with the blades. |
| US11590823B2 |
Vehicle and control method of vehicle
In accordance with an aspect of the disclosure, a vehicle includes an air conditioning device. An input device is provided to receive a selection input of a user with respect to a blowing position of the air conditioning device and including a first input area, a second input area and a third input area for outputting an activation mark or a deactivation mark by the selection input, A controller is configured to control output of an activation mark or a deactivation mark of the first input area, the second input area and the third input area. |
| US11590820B2 |
Hybrid motor vehicle
A hybrid motor vehicle, having an internal combustion engine, an electric motor, an interior climate-control device, a catalytic converter assigned to the internal combustion engine with a catalytic heating device which is operable from a medium-voltage network at a first voltage, particularly 48 V, a high-voltage network to which the electric motor is connected, at a second voltage that is higher than the first voltage, a voltage converter for converting the second voltage into the first voltage, a heat exchange device for heating a temperature-control medium, which is circulating in a temperature-control circuit, of the interior climate-control device by waste heat from the internal combustion engine, and a control device for operating the catalytic heating device as a function of the operation of the internal combustion engine. |
| US11590813B2 |
Apparatus and method for reducing hitch rattle
A silencer assembly for trailer hitches and a method of use thereof. The silencer assembly includes a sheet of material that is durable, abrasion-resistant, wear-resistant, ultra-violet light resistant, and sound dampening. An adhesive is applied to a bottom surface of the sheet which is then placed on a portion of the drawbar that is selectively receivable in a bore of receiver tube of the trailer hitch. The adhesive fixedly secures the sheet to the drawbar. The drawbar is inserted into the receiver bore. The sheet occupies part of a gap defined between an exterior surface of the drawbar and an interior surface of the receiver tube reducing relative movement between the drawbar and the receiver tube, and thereby reducing rattling noises. An additional sheet of material and one or more shims may be used to further reduce the gap between the drawbar and receiver tube, and thereby further reduce rattling. |
| US11590808B2 |
Pneumatic tire
A pneumatic tire includes a tread portion and a pair of sidewall portions each extending inwardly in a tire radial direction from the tread portion. At least one of the pair of the sidewall portions is provided with at least one side protector protruding outwardly in a tire axial direction. The side protector is provided with a groove, a cut-out portion connected with the groove, and a sipe connected with the groove. |
| US11590807B2 |
Method for the detection of a change in the rolling radius of a tire, and associated monitoring
A method for detecting a change in the rolling radius of a tire and a method for monitoring the state of the tire are based on the analysis of signals representing an actual speed of a vehicle on which the tyre is fitted and a speed of rotation of the wheel bearing the vehicle. |
| US11590806B2 |
Motorcycle tyre for off-road
A motorcycle tyre for off-road includes a tread portion including a bottom surface and connected bodies. The block connected bodies each include blocks protruding from the bottom surface and tie-bars protruding from the bottom surface with a height smaller than that of the blocks to connect the blocks with one another. The block connected bodies include a first connected body whose blocks and tie-bars are arranged so as to surround the bottom surface at least partially. The first connected body includes a first end block located on a first end in a longitudinal direction of the first connected body and a second end block located on a second end in the longitudinal direction of the first connected body. The first end block and the second end block are adjacent with one another, and no tie-bar connecting the first end block and the second end block is provided. |
| US11590805B2 |
Tire
A tire has a tread portion 2. The first middle land region 11 is provided with bend grooves 15 each having a first end 15a and a second end 15b. The first end 15a is connected to the first shoulder circumferential groove 5. The second end 15b is connected to one of the bend grooves 15 next in one of two opposite circumferential directions. Each bend groove 15 has two bent portions 16 and 17 at which the groove is bent. The bent angle θ1 at the first bent portion 16 is greater than the bent angle θ2 at the second bent portion 17. |
| US11590801B2 |
Composition for non-pneumatic tire spoke
The present invention relates to a composition for a non-pneumatic tire spoke. In particular, the non-pneumatic tire spoke prepared from the composition for a non-pneumatic tire spoke has excellent mechanical properties. A composition for a non-pneumatic tire spoke includes a thermoplastic polyester elastomer, a silane-based interfacial binder, and silica particles. The silica particles have an average particle diameter of 100 to 300 μm. |
| US11590800B2 |
Non-pneumatic tire
Various example embodiments of a non-pneumatic tires are presented. In one embodiment, a non-pneumatic tire is provided, comprising: a tread; a support ring comprising a plurality of support ring elements, each having the same diameter, wherein the plurality of support ring elements are coupled to one another by at least one strap; a hub, wherein the tread, the support ring, and the hub are concentric; a plurality of base elements oriented between the tread and the support ring, wherein each of the base elements extends along the width of one of the support ring elements. Alternatively, each of the base elements may extend from an axially outer edge of a support ring element to the center of an adjacent support ring element. |
| US11590798B2 |
Retractable guard assemblies
Particular embodiments disclosed herein provide a retractable guard assembly coupled to a caster of a mobile equipment, comprising one or more first guards comprising corresponding one or more guard toeholds and one or more second guards. When the one or more first guards and the one or more second guards are in a fully retracted state, fully compressing any one of the one or more guard toeholds causes the one or more first guards and the one or more second guards to transition into a fully deployed state. When the one or more first guards and the one or more second guards are in a fully deployed state, fully lifting any one of the one or more guard toeholds causes the one or more first guards and one or more second guards to transition into the fully retracted state. |
| US11590795B2 |
Wheel assembly including sidewall cover assembly and related methods
A wheel assembly to be coupled to a hub of a vehicle, may include an inner rim to be coupled to the hub of the vehicle, an outer rim surrounding the hub, and gas springs operatively coupled between the inner rim and the outer rim to provide a gas suspension permitting relative movement between the inner rim and the outer rim. The wheel assembly may also include a sidewall cover assembly that includes an inner sidewall cover coupled to the inner rim and extending radially outward toward the outer rim. The sidewall cover assembly may also include an outer sidewall cover coupled to the outer rim and extending radially inward toward the inner rim and in sliding overlapping relation with the inner sidewall cover permitting relative movement between the inner sidewall cover and the outer sidewall cover. |
| US11590786B2 |
Thermal transfer sheet
An object is to provide a thermal transfer sheet that can prevent the occurrence of layer detachment and has high transferability for preventing the occurrence of transfer defects such as delamination trace and tailing.The thermal transfer sheet of the invention is characterized in that it includes a substrate, a release layer, and a transfer layer in that order, and the release layer contains at least one of alumina and alumina hydrate, and a binder resin. |
| US11590782B2 |
Systems and methods for providing a service station routine
Included are embodiments for providing a service station routine. Some embodiments of a system include a service station for receiving a handheld jet dispensing apparatus and a memory component that stores logic. When the logic is executed by a processor, the logic may cause the system to, in response to the service station receiving the handheld jet dispensing apparatus, identify the handheld jet dispensing apparatus, where identifying the handheld jet dispensing apparatus includes determining a time of a previous maintenance to the handheld jet dispensing apparatus. In some embodiments, the logic causes the system to determine whether the time of the previous maintenance meets a predetermined threshold, in response to determining that the time of the previous maintenance meets a predetermined threshold, determine a desired maintenance routine to execute and execute the desired maintenance routine, and record a current time as the time of the previous maintenance. |
| US11590781B2 |
Printer
A printer configured to perform a printing operation on a printing medium, including: a cylindrically shaped housing including a bottom surface and a cylindrical surface on which an outlet is formed, the housing being configured to be placed on a horizontal table in any of a first posture in which the bottom surface is opposed to the table and a second posture in which a specific portion of the cylindrical surface is opposed to the table, the outlet being formed at a position of the cylindrical surface at which the printing medium stored in the housing is dischargeable from the outlet irrespective of whether the housing takes the first posture or the second posture on the table; and a second-posture keeping structure to keep the housing in the second posture in a state in which the cylindrical surface is opposed to the table. |
| US11590777B2 |
Printing apparatus and printing method
A printing apparatus that includes a holding unit configured to hold a roll sheet performs supplying the sheet by rotating the roll sheet held by the holding unit; nipping and conveying the supplied sheet; performing printing on the conveyed sheet; detecting occurrence of a print medium jam of the sheet; and, if the printing apparatus has detected a print medium jam of the sheet, performing a control process of supplying the sheet in a state in which the conveying is stopped. |
| US11590773B2 |
Sheet conveyor, sheet heater, liquid discharge apparatus, and printer that reduce sheet deformation via multiple supports
A sheet conveyor includes a conveyance belt configured to convey a sheet on a first surface of the conveyance belt in a conveyance direction, a suction device configured to suck the sheet onto the conveyance belt via the conveyance belt, and multiple supports between the conveyance belt and the suction device in a vertical direction, the multiple supports configured to support a second surface of the conveyance belt. A longitudinal direction of each of the multiple supports is parallel to a direction intersecting the conveyance direction, and the multiple supports are arrayed in the conveyance direction. |
| US11590771B2 |
Spot gloss and gloss control in an inkjet printing system
Embodiments of the invention provide a technique that effects spot gloss or gloss control and/or variations on one image without requiring clear inks. This is preferably accomplished by use of a multilayer printing process in which an image is first printed using a first set of color print heads and then cured, and in which the image is again printed using a second set of color print head, but where the image remains uncured for a predetermined interval to allow the ink drops applied to the media to spread and thus introduce a gloss effect. |
| US11590770B2 |
Printing apparatus and printing method
A printing apparatus includes a pattern extracting unit for, based on a comparison between first image data representing a pattern and second image data generated by imaging a fabric transported, extracting a pattern region from the second image data, a printing image generation unit for arranging third image data representing an image to be printed overlaid on the pattern in accordance with a positional relationship between the pattern regions to generate printing image data, and a printing control unit for causing a printing unit to print the printing image data on the fabric transported. |
| US11590768B2 |
Integrated vertical portable inkjet printer
An integrated vertical inkjet printer for printing on a vertical substrate, comprising: a controller; a main trolley carrying a main trolley body; and a printing assembly, comprising: a plurality of inkjet printing head assemblies mounted on a platform; a vertical telescopic tandem beam system comprising: a first printing beam, wherein said platform is slidable along said first printing beam; and a second printing beam detachably insertable between said first printing beam and said main trolley body, a first motor configured to drive said platform vertically; and a second motor configured to drive said first printing beam along said second printing beam. |
| US11590764B2 |
Printing apparatus and printing method for suppressing contamination on recording medium
An image is printed on the front surface M1 by discharging the inks to the front surface M from the discharge heads 321 (first head) facing the front surface M1 (recording surface) of the printing medium M from above. Thus, the inks discharged from the discharge heads 321 partially become mist to possibly produce ink mist. Accordingly, the ink cover 51 (first cover) is arranged between the discharge heads 321 and the front surface M1 of the printing medium M before the discharge heads 321 discharges the inks to the printing medium M. By providing the ink cover 51 for the front surface M1 of the printing medium M before printing in this way, the adhesion of the ink mist to this front surface M1 can be suppressed. |
| US11590763B2 |
Printer recirculation control
An example printing material cartridge includes a reservoir storing printing material to supply a printing apparatus and a storage medium storing process instructions for controlling the recirculation process in the printing apparatus. |
| US11590761B2 |
Print liquid supply
In one embodiment a print liquid supply apparatus is provided to supply liquid to a liquid needle of a receiving station comprising a liquid container including an at least partially collapsible liquid reservoir an interface structure at a side of the container, including a liquid channel that includes a reservoir connecting portion that fluidically connects to the reservoir and a needle receiving portion to allow the liquid to flow from the reservoir to the needle; a liquid interface of the liquid channel adjacent the needle receiving portion and at a distance from the reservoir connecting portion, a front wall and/or edge adjacent the liquid interface including a push area which is disposed between the liquid interface and the container; and at least one key pen base and key pen protruding from the base in a direction parallel and opposite to the needle insertion direction; and a contact pad array next to the needle receiving liquid channel portion. In another example a sub-assembly of such apparatus is provided. |
| US11590759B2 |
Liquid container and liquid ejection apparatus
A liquid container is removably mountable into the apparatus body of a liquid ejection apparatus. The liquid container comprises a liquid storage chamber equipped with an air intake hole and a liquid supply port, for storing liquid and a valve unit having a sealing member and an urging member. The urging member is arranged so as to be at least partly rotationally movable and the urging member has urging force for urging the sealing member in the direction of making the sealing member abut the air intake hole. The sealing member is rotationally movable between a position of abutting and closing the air intake hole and a position separated from the air intake hole so as to open the air intake hole in response to a rotary motion of the urging member. |
| US11590757B2 |
Discharge apparatus and suction unit
A discharge apparatus includes a discharge unit configured to discharge a liquid to a medium, a suction unit, and a supply unit configured to supply a gas to the suction unit. The suction unit includes an opening facing the medium, and a suction groove including an arc-shaped inner wall surface inside the opening and configured to suck mist around the medium. An outlet portion configured to blow out the gas supplied from the supply unit toward the inner wall surface is provided in the opening. |
| US11590756B2 |
Liquid discharge apparatus
A liquid discharge apparatus is provided, which comprises a conveyor, a support member which supports a medium existing in a conveying passage, a head, a maintenance mechanism which has a wiper, and a wiper cleaner. The maintenance mechanism is opposed to a nozzle surface of the head and movable to a wiping position at which the wiper abuts against the nozzle surface and a cleaning position at which the wiper abuts against the wiper cleaner. The wiper cleaner is disposed at a position at which a part thereof is overlapped with the support member in a direction orthogonal to the nozzle surface under or below the support member. |
| US11590755B2 |
Liquid ejection device
A liquid ejection device includes a first head unit that includes a plurality of first ejection portions, a second head unit that includes a plurality of second ejection portions, a head controller that controls the first head unit and the second head unit, and a signal path via which determination information indicating whether or not a liquid ejection state of one first ejection portion among the plurality of first ejection portions is abnormal is transmitted from the first head unit to the second head unit without passing through the head controller. |
| US11590752B2 |
Print component with memory circuit
A memory circuit for a print component including plurality of I/O pads, including a first analog pad and a second analog pad, to connect to a plurality of signal paths which communicate operating signals to the print component, including an analog signal path connected to the first analog pad and the second analog pad, the first analog pad electrically isolated from the second analog pad to interrupt the analog signal path to the print component. The memory circuit further includes a memory component to store memory values associated with the print component, and a control circuit to, in response to a sequence of operating signals received by the I/O pads representing a memory read, provide an analog signal to the analog pad to provide an analog electrical value at the analog pad representing stored memory values selected by the memory read. |
| US11590749B2 |
Flexible packaging material
Described herein is a process for preparing a flexible packaging material. The process may comprise: providing a printed first flexible substrate comprising an ink composition on a surface of a first flexible substrate, the ink composition comprising a first thermoplastic resin; depositing a further composition comprising a cross-linker, a white pigment and a second thermoplastic resin onto the printed ink composition such that the thermoplastic resin of the ink composition is cross-linked; and laminating the first flexible substrate with a second flexible substrate such that the ink composition, the further composition and the cross-linker are disposed between the first and second flexible substrates. |
| US11590748B2 |
Display device and method for bonding the same
A display device includes a window including a planar portion and a bending portion that is bent from the planar portion. A display module is disposed below the window. The display module includes a central portion overlapping the planar portion and an edge portion overlapping the bending portion. An adhesive member including an adhesive layer is disposed between the window and the display module. A lubrication layer overlaps at least a portion of the adhesive layer. |
| US11590744B2 |
Shrink film
Oriented, multilayer shrink films, either clear or opaque, comprise a core layer and at least one skin layer. The core layer has a thickness greater than the thickness of the at least one skin layer. The at least one skin layer comprises at least one cyclic-olefin copolymer as the predominant component thereof. The core layer comprises a blend of a polyolefin polymer and a polybutene-1 copolymer with ethylene, the butene-1 constituting over 75% by weight of the polybutene-1 copolymer. The film has a shrinkage of at least 20% in at least one of the machine and transverse directions of formation when said film is heated to a temperature of between 80 and 100° C. Optionally the films can include a propylene-based elastomer, a styrenic based block copolymer elastomer, reclaim including the components of the film, or combinations thereof. |
| US11590743B2 |
Active polystyrene film
The present invention belongs to the field of active polymer materials. Specifically, it relates to an active polystyrene film that has antimicrobial or antioxidant activity and the method of production of said film. It also refers to wrappers, packages and slice separators (interleavers) that comprise said film. |
| US11590733B2 |
Colorful board structure and manufacturing method thereof
The present invention discloses a colorful board structure comprising a transparent substrate, an adhesive layer, a three-dimensional painted layer and a protective layer. The three-dimensional painted layer includes at least one colored layer and at least one transparent stacking layer including at least one raised part. The aforementioned colorful board structure is made of a multi-layer structure, and has the advantages of enhancing the stereoscopic effect of the pattern and the color expression. In addition, a manufacturing method of the colorful board structure is also disclosed. |
| US11590732B2 |
Display device and optically clear adhesive
The present disclosure discloses an optical clear adhesive and a display device. The display device includes: a flexible display panel having at least one foldable area; and an optical clear adhesive disposed on at least one side of the flexible display panel. The optical clear adhesive includes: a substrate layer, a first adhesive material structure and a second adhesive material structure disposed on two opposite sides of the substrate layer, all of which are transparent materials; a deformation recovery rate of the substrate layer is greater than that of each of the first adhesive material structure and the second adhesive material structure; and in the optical clear adhesive, the first adhesive material structure is closer to an inner folding side of the foldable area of a display panel, and the second adhesive material structure is closer to an outer folding side of the foldable area of the display panel. |
| US11590730B2 |
Coextruded, crosslinked polyolefin foam with KEE cap layers
The present disclosure is directed to a physically crosslinked, closed cell continuous multilayer foam structure comprising at least one foam polypropylene/polyethylene layer with a KEE cap layer. The multilayer foam structure can be obtained by coextruding a multilayer structure comprising at least one foam layer composition layer with at least one cap layer composition layer, irradiating the coextruded structure with ionizing radiation, and continuously foaming the irradiated structure. |
| US11590729B2 |
Composite ultra-high molecular weight polyethylene (UHMWPE) material and method of manufacture of the same
Woven UHMWPE fabric stretches in the bias direction to such an extent that it is unsuitable for many potential applications and is porous, allowing air and water transmission. A composite UHMWPE material includes a single ply of high tenacity woven UHMWPE fabric having warp fibers in a first direction and weft fibers in a second direction orthogonal to the first direction. The UHMWPE fabric has first face and a second face. A stretch resisting axially oriented fusion layer is fused to at least one of the first face or the second face of the UHMWPE fabric with an axis aligned parallel to at least one of the UHMWPE fabric warp and weft axes, such that the stretch resisting fusion layer increases fabric tensile strength and inhibits bias stretch of the UHMWPE fabric, and renders the UHMWPE woven fabric air and water impermeable. |
| US11590726B2 |
Surfaces with embedded information
A surface including: a plurality of visually detectable marks, wherein the visually detectable marks include: a first group of grid marks forming a grid and a second group of information marks encoding information based on positions of information marks of the second group of marks relative to the data page, wherein grid marks are less than 45% of the visually detectable marks on the surface. |
| US11590720B2 |
Method for the simultaneous production of two or more fiber composite components and fiber composite component
A method for the simultaneous production of two or more fiber composite components, to a fiber composite component, to a rotor blade of a wind power installation, as well as to a wind power installation. A method for the simultaneous production of two or more fiber composite components, in particular of two or more substantially identical fiber composite components which have a component contour, the method comprising providing at least one fibrous material, at least one planar separation element, and at least one matrix material, wherein the at least one planar separation element at least in portions is permeable to the matrix material; producing a semi-finished fibrous pack by disposing the fibrous material layer-by-layer so as to form semi-finished fibrous products stacked on top of one another, wherein at least one of the planar separation elements is in each case disposed between the semi-finish fibrous products; infusing the semi-finished fibrous pack with the matrix material; cutting the component contour into the infused semi-finished fibrous pack. |
| US11590717B2 |
Extrudable magnetic ink and novel 3D printing method to fabricate bonded magnets of complex shape
A magnetic ink composition for three-dimensional (3D) printing a bonded magnet is provided. The magnetic ink composition includes magnetic particles, a polymer binder and a solvent. A 3D printing method for fabrication of a bonded magnet using the magnetic ink composition is also provided. |
| US11590716B2 |
Method for manufacturing molded article
A method is described for manufacturing a molded product having a recessed/protruding part from a molded substrate (A) including reinforcing fibers and a matrix resin by press molding, the method comprising: a step (I) of placing the molded substrate (A) between molds including an upper mold and a lower mold and deforming the molded substrate (A) in an in-plane direction by heating and pressing the molds; and a step (II) of deforming the molded substrate (A) in an out-of-plane direction by depressurizing the molds subsequent to the step (I), wherein a deformation rate ratio T represented by the following formula (1) is within a range of 0.1 to 1: T=X/Z (1) where X and Z are as defined. |
| US11590714B2 |
Method for producing a part made of composite material, and so obtained composite part
A method for producing a part made of composite material includes adding a thermoplastic or thermosetting matrix around a preform of a reinforcing fiber mesh made by filament winding around the spurs or the like of a frame. There is winding in addition to the fibers on one or several reels within the matrix, the axes of the spurs or the like and those of the one or more reels having different orientations, so as to provide the mesh of fibers with a three-dimensional shape. |
| US11590712B2 |
Method and system for interlayer feedback control and failure detection in an additive manufacturing process
An additive manufacturing system configured to: during a first build cycle of an additive manufacturing process for manufacturing a first layer of a build, sampling a first set of sensor data streams via the sensor suite; calculate a first likelihood of failure of the build based on the first set of sensor data streams; in response to calculating the first likelihood of failure within a first likelihood range, flag the build to indicate the first likelihood of failure; and in response to calculating the first likelihood of failure within a second likelihood range greater than the first likelihood range, pause the additive manufacturing process, and notify an operator of the additive manufacturing system of the first likelihood of failure. |
| US11590706B2 |
Methods of post-processing photofabricated articles created via additive fabrication
Methods for post-processing photofabricated articles created via additive fabrication processes are described and claimed herein. Such methods include providing a photofabricated article, preferably an article that has been at least partially cured via cationic polymerization mechanisms, optionally, post-processing the photofabricated article, and base-washing the photofabricated article in an alkaline solution or dispersion to create a neutralized photofabricated article. In another embodiment, the methods include treating a photofabricated article having a residual acid or base species with a treatment composition in order to create a neutralized photofabricated article. Also described and claimed are the neutralized photofabricated articles created via the methods herein elsewhere described. Such articles are preferably biocompatible, especially as determined by their lack of cytotoxicity potential. |
| US11590704B1 |
3D drawing arrangement
A 3D drawing arrangement includes a feeding passage, a heater, a filament moving system, and a controller which includes a control circuit and a finger detector electrically connected to the control circuit, wherein when the finger detector detects a presence of a finger of a user which is aligned with the finger detector, the control circuit starts operation of the filament moving system to feed a filament to the heater along the feeding passage, so that the filament is heated and melted by the heater to produce the melted material flow. |
| US11590699B2 |
Method and apparatus for continuous composite three-dimensional printing
A method and apparatus for the additive manufacturing of three-dimensional objects are disclosed. Two or more materials are extruded simultaneously as a composite, with at least one material in liquid form and at least one material in a solid continuous strand completely encased within the liquid material. A means of curing the liquid material after extrusion hardens the composite. A part is constructed using a series of extruded composite paths. The strand material within the composite contains specific chemical, mechanical, or electrical characteristics that instill the object with enhanced capabilities not possible with only one material. |
| US11590696B2 |
Three-dimensional printing
An example of a three-dimensional (3D) printing composition includes a build material composition and a fusing agent to be applied to at least a portion of the build material composition during 3D printing. The build material composition includes one of: (i) a thermoplastic elastomer having a flow parameter characterized by a consolidation resistance value ranging from about 8 to about 30, and a tap density characterized by an n1/2 value ranging from 5 taps to 30 taps; or (ii) a polyamide-like material having a flow parameter characterized by a consolidation resistance value ranging from about 75 to about 120, and a tap density characterized by an n1/2 value ranging from 5 taps to 30 taps. The fusing agent includes an energy absorber to absorb electromagnetic radiation to coalesce the thermoplastic elastomer or the polyamide-like material in the at least the portion. |
| US11590692B2 |
Method for producing an object from a precursor, and use of a radically crosslinkable resin in an additive production method
A process for producing an object from a precursor comprises the steps of:I) depositing a free-radically crosslinked resin atop a carrier to obtain a ply of a construction material joined to the carrier which corresponds to a first selected cross section of the precursor;II) depositing a free-radically crosslinked resin atop a previously applied ply of the construction material to obtain a further ply of the construction material which corresponds to a further selected cross section of the precursor and which is joined to the previously applied ply;III) repeating step II) until the precursor is formed;IV) treating the precursor obtained after step III) under conditions sufficient to at least partially trimerize to isocyanurate groups NCO groups present in the free-radically crosslinked resin of the obtained precursor to obtain the object. |
| US11590691B2 |
Plate-based additive manufacturing apparatus and method
An additive manufacturing apparatus for manufacturing a three-dimensional component includes: a build plate, at least a portion of which is transparent, the build plate defining a build surface; a material depositor operable to deposit a radiant-energy-curable resin on the build surface; a stage positioned facing the build surface of the build plate and configured to hold a stacked arrangement of one or more cured layers of the resin; one or more actuators operable to change the relative positions of the build plate and the stage; a radiant energy apparatus positioned adjacent to the build plate opposite to the stage, and operable to generate and project radiant energy on the resin through the build plate in a predetermined pattern; and a cleaning apparatus operable to remove debris from the build surface. A method is provided for use of the apparatus. |
| US11590689B2 |
Systems and methods for an improved peel operation during additive fabrication
According to some aspects, a method of additive fabrication wherein a plurality of layers of material are formed is provided. The method may comprise forming a layer of material in contact with a container, and subsequent to the forming of the layer of material, actively bending the container around at least one fixed point such that the layer of material separates from the container. According to some aspects, an additive fabrication apparatus configured to form a plurality of layers of material is provided. The apparatus may comprise a container, a build platform, one or more force generators, and at least one controller configured to, subsequent to formation of a layer of material in contact with the container, actively bend the container around at least one fixed point via the one or more force generators, such that the layer of material separates from the container. |
| US11590688B2 |
Imprinting apparatus
An imprinting apparatus includes an imprinting platform, an imprinting roller, a transfer module and a lifting and pressing mechanism. The imprinting roller is disposed above the imprinting platform. The transfer module includes a transfer film, wherein the transfer film is located between the imprinting roller and the imprinting platform. The lifting and pressing mechanism is linked with the imprinting roller, wherein the lifting and pressing mechanism drives the imprinting roller to move along a normal direction of the imprinting platform and selectively pressurizes the imprinting roller. |
| US11590686B2 |
System and methods for thermoforming articles
Systems and processes for thermoforming an article and for preparing an article for thermoforming are disclosed. The system for thermoforming can include one or more heating stations and a cooling station. The system for thermoforming can further include an article movement mechanism that can couple to an article and rotate the article inside a heating chamber, inside a cooling chamber, or both. The system for preparing an article for thermoforming can include a vessel that comprises a port, and a negative pressure generation system coupled to the port. The system for preparing an article for thermoforming can further include a compression material that forms an interior portion for receiving an article. The negative pressure generation system can cause the compression material to expand to allow for insertion of the article into the interior portion of the compression material. |
| US11590685B2 |
Fiber aggregation, short fiber and method of manufacturing the same, and film and method of manufacturing the same
A fiber aggregation contains fiber containing a thermoplastic resin, each of the fiber being mutually joined and aligned. |
| US11590683B2 |
Molding production method, molding die, molding production apparatus, burr removal method, and burr removal device
A molding-forming method, a molding mold, and a molding production apparatus with which efficient burrs removal is possible without requiring a large apparatus. A molding production method includes, in addition to a molding being formed inside a mold, burrs formed around the molding are separated from the molding. After formation of the molding, air is blown inside the mold on at least a portion of the burrs formed around the molding to cool the same, a projecting member is projected toward the cooled burrs, and the burrs are separated from the molding. After pressing the burrs toward the projecting member by the air blowing, the burr is pressed toward the mold surface facing the projecting member by projection of the projecting member to separate the burr from the molding. |
| US11590680B2 |
Method for adjusting the profile of a film in blown extrusion lines, adjusted film and reel
A method for the active adjustment of the profile of a film produced with blown extrusion technology, a film obtained with such method and a reel resulting from the winding of the film. |
| US11590679B2 |
Injection molding mold
The present invention pertains to an injection molding mold that can extrude the entirety of a workpiece from a cavity even when the cavity is enlarged so as to extend further than the outer side of an ejector plate. The injection molding mold may include a mold member having a cavity formed on the front side, a mold frame supporting the mold member from the back side, an ejector plate provided in the space within the mold frame so as to ascend and descend freely therein, a first workpiece extrusion means for extruding the workpiece above the ejector plate, and a second workpiece extrusion means for operating in conjunction with the first workpiece extrusion means and extruding the workpiece formed in the cavity in an area that is further to an outer side than the ejector plate. |
| US11590676B2 |
Guided wave-based system for cure monitoring of composites using piezoelectric discs and fiber Bragg gratings/phase-shifted Bragg gratings
System and method for in-process cure monitoring of a material utilizes one or more sensors such as fiber Bragg gratings (FBGs) or phase-shifted FBGs (PS-FBGs) and at least one optical line fiber connected to the sensor(s). The sensor(s) and the optical line may be embedded in the material prior to curing the material may comprise a fiber reinforced polymer. Waves are excited into the material during curing thereof to form guided waves that propagate through the material. At least one wave metric of the guided waves is measured utilizing the sensor(s). |
| US11590675B2 |
Cutting tool for a ceramic cutting device, a cutting-wheel handle holder, a cutting assembly and a ceramic cutting device
A cutting tool includes a cutting-wheel handle with an uniform cross-section with an outer contour including points arranged following two opposed straight rows and points arranged following one or more curved line segment of the edge of a circle enclosing an area into which the opposed straight rows lie and a cutting wheel mounted on the cutting-wheel handle to rotate along a rotation plane parallel or substantially parallel to the two opposed straight rows. A cutting-wheel handle holder has a body including a through hole for the insertion therethrough of the cutting-wheel handle, to a cutting assembly including the cutting tool and the cutting-wheel handle holder, and to a ceramic cutting device including the cutting assembly pivotably mounted to a support movably mounted on longitudinal guides mounted to a base. |
| US11590671B2 |
Knife holders, cutting heads and slicing machines equipped therewith, and processes of manufacture
A knife holder has a base and a knife support portion extending from the base. The knife support portion includes a distal edge and a knife support surface for supporting a knife. The knife support surface includes a shaped portion and a relieved surface. The shaped portion has a wavy shape and is located adjacent the distal edge. The relieved surface does not have a wavy shape and is located on the knife support surface so that at least part of the shaped portion is between the relieved surface and the distal edge. An abutment surface is between the base and the relieved surface and is defined by the relieved surface. |
| US11590663B2 |
Virtual reality enabled activity allocation
Disclosed embodiments provide techniques for virtual reality enabled activity allocation. A camera system monitors a physical environment from multiple angles, generating real-time video feeds of the physical environment. A real-time virtual reality environment (RTVRE) rendering system utilizes the real-time video feeds as input to create a virtual reality environment that is representative of the physical environment. A user performs an action in the virtual environment that corresponds to a task to be performed in the physical environment. A computer-implemented virtual reality control management system assesses the task and assigns the task to an electromechanical device that is best-suited to perform the task, based on a scoring algorithm. This enables actions such as remote monitoring and control of a premises. Thus, disclosed embodiments improve the technical field of remote monitoring and control of a premises. |
| US11590655B2 |
External parameter calibration method for robot sensors and apparatus and robot with the same
The present disclosure provides an external parameter calibration method for robot sensors as well as an apparatus, robot and storage medium with the same. The method includes: obtaining first sensor data and second sensor data obtained through a first sensor and a second sensor of the robot by collecting position information of a calibration reference object and converting to a same coordinate system to obtain corresponding first converted sensor data and second converted sensor data, thereby determining a first coordinate and a second coordinate of a reference point of the calibration reference object; using the first coordinate and the second coordinate are as a set of coordinate data; repeating the above-mentioned steps to obtain N sets of the coordinate data to calculate the external parameter between the first sensor and the second sensor in response to a relative positional relationship between the robot and the calibration reference object being changed. |
| US11590653B2 |
Method for orienting two workpieces to form a joining connection and manipulator
The invention relates to a method for orientating two workpieces in order to form a joining connection, wherein in a longitudinal orientation step the first workpiece is orientated relative to the second workpiece) along at least one of the workpiece edges by linear movement of at least one of the grippers relative to the other gripper and wherein the longitudinal orientation step is carried out during the transport of the workpieces from the provision station to the processing station. Furthermore, the invention relates to a manipulator which comprises a first gripper and a second gripper. |
| US11590651B2 |
Method and device for training manipulation skills of a robot system
A method of training a robot system for manipulation of objects, the robot system being able to perform a set of skills, wherein each skill is learned as a skill model, the method comprising: receiving physical input from a human trainer, regarding the skill to be learned by the robot; determining for the skill model a set of task parameters including determining for each task parameter of the set of task parameters if a task parameter is an attached task parameter, which is related to an object being part of said kinesthetic demonstration or if a task parameter is a free task parameter, which is not related to a physical object; obtaining data for each task parameter of the set of task parameters from the set of kinesthetic demonstrations, and training the skill model with the set of task parameters and the data obtained for each task parameter. |
| US11590649B2 |
Grip manipulator and method for controlling the same
The present disclosure provides a grip manipulator used in a robot to eliminate an inefficient and power consumable operation caused by the use of multiple manipulators when gripping an object or handling the gripped object. The grip manipulator includes a manipulator body, a support rod of a first group and a support rod of a second group provided to protrude from the manipulator body in a direction, a longitudinal drive unit configured to discharge or introduce the support rod of the first group or the support rod of the second group in the protruding direction, and a transverse drive unit configured to spread or gather the support rod of the first support group or the support rod of the second group in a direction perpendicular to the protruding direction. |
| US11590648B2 |
Robot system, control apparatus, and control method
A robot system includes a robot having an arm including a first arm coupled to a base and pivoting about a first pivot axis and a second arm coupled to the first arm and pivoting about a second pivot axis parallel to the first pivot axis, and a first motor pivoting the first arm about the first pivot axis, and a control apparatus having a first motor control unit that controls the first motor. The robot has an inertial sensor that detects an angular velocity about a roll axis of the arm or an acceleration in a tangential direction of a circle around the roll axis, and the first motor control unit controls the first motor based on the angular velocity or acceleration. |
| US11590647B2 |
Four-bar parallel actuated architecture for exoskeleton
An exoskeleton for interfacing with a joint includes a base configured to be coupled to a user, a platform configured to be coupled to the user proximate the joint, and a plurality of substructures extending between the base and the platform. The substructures are actuated in parallel in order to move the platform. |
| US11590644B2 |
Interchangeable and interconnectable tool organizing device
A custom tool accessory to hold a tool, the custom tool accessory including a body, at least one tongue disposed at a first side of the body, at least one tongue receiving groove disposed at a second side of the body opposite from the first side of the body, and a tool holding portion disposed on the body to hold the tool. At least one magnet is attached to the underside of a metallic base plate that is in turn secured to the underside of the body. A retainer surrounds the at least one magnet and also underlies the area of the bottom of the base plate that is not covered by the at least one magnet. |
| US11590642B2 |
Hydraulic hammering device
A hydraulic hammering device enables an auto-stroke mode and an idle strike prevention mode to coexist with a simple circuit configuration. A first control valve controls advancing and retracting movements of a piston and a second control valve select either the auto-stroke mode and the idle strike prevention mode. To the second control valve, a shared spool is slidably fitted and a mode selection means is disposed. When the mode selection means allows supply of pressurized oil to an auto-stroke setting portion of the shared spool and prohibits discharge of pressurized oil from an idle strike prevention setting portion, the auto-stroke mode is selected. When prohibiting supply of pressurized oil to the auto-stroke setting portion and allowing discharge of pressurized oil from the idle strike prevention setting portion, the idle strike prevention mode is selected. |
| US11590641B2 |
Protective shield for use with a staple gun
A staple gun and a method of using the same. A stapling mechanism in the housing is activated to deliver a staple through an aperture in a housing wall and drive the staple into a surface around a stack of one or more electric cables. The gun includes a reciprocating cable guide for centering the gun on the stack of cables and closing a safety switch to permit the gun's trigger to be activated. A spacer extending outwardly from the housing wall rests on the upper surface of the cable stack. The spacer and a bumper that engages a hammer of the stapling mechanism provide for automatic depth adjustment when driving the staple into the surface. A reciprocating cable guard extending outwardly from the housing wall is positioned between the stack of cables and the staple to aid in preventing the staple from piercing the cable. |
| US11590635B2 |
Hand tool with operating head
The invention is a hand tool with an operating head, which comprises: a main body having two parallel ears spaced apart at a front end; and a working head having a body; a column connected to one side of the body; another side of the body is provided with a pivotal block and two flaps to pivotally connect the two ears of the main body between the pivotal block and the two flaps respectively. The two flaps are capable of assisting in supporting outer sides of the two ears to relatively strengthen a structure of the ear, thereby enhancing a torsion exerted by the column on a workpiece, and enhancing durability and strength of the column. |
| US11590626B2 |
Work tool
A work tool includes a motor, a tool-mounting part, a rotary shaft, a rotating member, a switch, an operation member and a lock mechanism. The rotating member is held rotatably around a rotation axis of the rotary shaft and configured to transmit torque to and from the rotary shaft while being allowed to rotate relative to the rotary shaft. The rotating member is configured to rotate together with the rotary shaft by action of transmitting the torque when the operation member is moved from the OFF position to the ON position and the lock mechanism allows the rotating member to rotate, and configured to apply a braking force to the rotary shaft by action of transmitting the torque when the operation member is moved from the ON position to the OFF position and the lock mechanism non-rotatably locks the rotating member. |
| US11590619B2 |
Scrap removing device for cutting wheel rim
The present invention discloses a scrap removing device for cutting a wheel rim which comprises a main body having a working surface, a wheel rim positioning member, a first blowing member and a second blowing member sequentially disposed on the working surface from a top side thereof. |
| US11590614B2 |
Flux and solder paste
A flux comprising an organic acid; a solvent; and polyoxyethylene behenyl alcohol having an average number of moles of ethylene oxide added of 7 to 40 mol. |
| US11590609B2 |
Laser shock peening apparatuses and methods
Methods and apparatuses for processing materials to enhancing the material's surface strength, improving the material's cyclic and thermal stability of microstructures, and extend the material's fatigue performance. Embodiments include laser shock peening at material temperatures that are moderately elevated (from the material's perspective) above room temperature. Alternate embodiments include laser shock peening at very cold (cryogenic) material temperatures. Still further embodiments include laser shock peening while covering the surface of the material being processed with an active agent that interacts with the laser energy and enhances the pressure exerted on the surface. |
| US11590608B2 |
Sealing method
A sealing method for sealing an opening of a metallic molded body with a resin molded body, the metallic molded body having a cavity therein and an opening connected to the cavity, includes a step of irradiating laser light onto a joining surface on a periphery of the opening of the metallic molded body in an energy density of 1 MW/cm2 or more and at an irradiation rate of 2000 mm/sec or more to roughen the surface, and a step of placing, in a mold, a portion including the joining surface of the metallic molded body roughened in the preceding step and sealing the opening with a resin molded body formed by injection molding or compression molding of a resin. |
| US11590607B2 |
Method and device for machining by means of interfering laser radiation
A method and an apparatus for processing an object by generation of laser radiation as a collimated laser beam, influencing the intensity distribution and/or the phase progression over the cross section of the laser beam, splitting the laser beam into two partial beams, and deflection and focusing of the partial beams so that the partial beams are superimposed in a processing zone in the material of the object. |
| US11590603B2 |
Roll-bonded body and method for producing same
[Problem] To provide: a roll-bonded body which is able to be suppressed in waviness in the surface; and a method for producing this roll-bonded body. [Solution] A roll-bonded body according to the present invention is obtained by bonding a first metal layer and a second metal layer with each other by means of rolling, and is characterized in that the surface of the first metal layer has an arithmetic average waviness (Wa1) 0.01-0.96 and a maximum waviness height (Wz1) of 0.2-5.0 μm. |
| US11590602B2 |
Apparatus for replacing welding tip of welder and apparatus for supplying same
An apparatus for supplying a welding tip of a welder and an apparatus for replacing the same include a fixed bracket secured to a support. The apparatus includes an actuator coupled to the fixed bracket and a first moving member moved by the actuator. A second moving member is coupled to the first moving member and hingedly coupled to the fixed bracket. A third moving member is hingedly coupled to the second moving member. A first welding tip removal member is coupled to the third moving member to separate a welding to tip coupled to a shank. A fourth moving member is disposed opposite to the first moving member. A fifth moving member is coupled to the fourth moving member and hingedly coupled to the fixed bracket. A sixth moving member is coupled to the fifth moving member. A second welding tip removal member is coupled to the sixth moving member. |
| US11590599B2 |
Resistance spot welding method for joining zinc coated steel sheets
A method for resistance spot welding comprising the following successive steps: —providing at least two steel sheets with thickness (th) comprised between 0.5 and 3 mm, at least one of the sheets being a zinc or zinc-alloy coated steel sheet (A) with a tensile strength (TS) higher than 800 MPa and a total elongation (TEL) such as (TS)×(TEL)>14000 MPa %, wherein the composition of the steel substrate of (A) contains, in weight: 0.05%≤C≤0.4%, 0.3%≤Mn≤8%, 0.010%≤Al≤3%, 0.010%≤Si≤2.09%, with 0.5%≤(Si+Al)≤3.5%, 0.001%≤Cr≤1.0%, 0.001%≤Mo≤0.5% and optionally: 0.005%≤Nb≤0.1%, 0.005%≤V≤0.2%, 0.005%≤Ti≤0.1%, 0.0003%≤B≤0.005%, 0.001%≤Ni≤1.0%, the remainder being Fe and unavoidable impurities, —performing resistance spot welding of the at least two steel sheets for producing a weld with an indentation depth (IDepth) on the surface of said steel sheet (A) such as: 100 μm≤(IDepth)≤18.68 (Znsol)−55.1, wherein (IDepth) is in micrometers and wherein Znsol is the solubility of Zn in the steel of sheet (A) at 750° C., in weight %. |
| US11590598B2 |
Systems, methods, and apparatus to preheat welding wire
Systems, methods, and apparatus to preheat weld wire are disclosed. An example contact tip includes: an inner bore configured to conduct current to a consumable welding electrode; screw threads on an exterior of the contact tip; and a head opposite the screw threads on an exterior of the contact tip to enable threading and dethreading of the contact tip. |
| US11590595B2 |
Paste dispensing transfer system and method for a stencil printer
A paste dispensing transfer system of a stencil printer is configured to print an assembly material on an electronic substrate. The transfer system includes a paste cartridge mechanism coupled to a print head assembly of the stencil printer, and a rotary indexing mechanism coupled to a frame of the stencil printer. The paste dispensing transfer system is configured to transfer a used paste cartridge from the print head assembly to the rotary indexing mechanism supported by the frame and to transfer a new paste cartridge from the rotary indexing mechanism to the print head assembly. |
| US11590594B2 |
Lower guide unit of electrical discharge machine
A compact lower guide unit that allows the electrode guide to be attached and detached more easily and reliably. Provided is a lower guide unit including a housing, an electrode guide, and a pull-up mechanism having a guide support, links, and a power cylinder. The guide support includes a biasing member and a displacement member. The biasing member can bias the displacement member, and the displacement member can be displaced between a restriction position and a release position. The links can be rotated by a force applied by the power cylinder. The electrode guide is fixed to the guide support by a biasing force of the biasing member when the displacement member is in the restriction position, and the electrode guide is released from the lower guide unit when the displacement member is displaced to the release position. |
| US11590592B2 |
Table saw
A table saw has a base assembly, a table assembly supported by the base assembly, the table assembly, and a saw assembly supported by at least one of the table assembly and the base assembly. The saw assembly has a saw blade extending through the table assembly. The base assembly has at least one foot having a substantially horizontal surface, a substantially vertical surface, and a curved surface disposed between the substantially horizontal surface and the substantially vertical surface. The substantially vertical surface is substantially coplanar with a surface of the table assembly so that the table saw can be disposed on the substantially vertical surface and the surface of the table assembly. |
| US11590586B2 |
Method and apparatus for forming a hole
An apparatus for drilling out a plug of material, the apparatus comprising: a base plate having a top surface, a bottom surface, and a central longitudinal axis; a circumferentially-extending side wall extending distally from the top surface of the base plate, the circumferentially-extending side wall terminating in a circular distal end surface; a drill bit centered on the central longitudinal axis of the base plate and extending distally therefrom, the drill bit comprising a distal portion, a proximal portion and an intermediate portion extending between the distal portion and the proximal portion; wherein the intermediate portion of the drill bit comprises a first laterally-extending flat comprising a cutting edge disposed a first distance away from the central longitudinal axis towards the circumferentially-extending side wall and a second laterally-extending flat extending a second distance away from the central longitudinal axis towards the circumferentially-extending side wall, and further wherein the first distance is greater than the second distance. |
| US11590577B2 |
Acoustic-energy based material deposition and repair
Various embodiments include an acoustic-energy deposition and repair system that includes at least one Directed Acoustic Energy Deposition (DAED) tool configured to apply acoustic energy to feedstock material in at least one of three vibrational modes; and a drive system to move the DAED tool in at least one of three-coordinate positions. In various examples, the acoustic-energy deposition and repair system further includes at least one in-situ metrology tool mounted proximal to the DAED tool to measure a grain size of deposited material. Other methods, devices, apparatuses, and systems are disclosed. |
| US11590573B2 |
Macro-chip reinforced alloy
Described herein are methods of forming a neutron shielding material. Such material may comprise a powder blend comprising a first component comprising a blend of a first metal particle and a first ceramic particle; and a second component comprising a reinforcing chip, the reinforcing chip comprising a second ceramic particle dispersed within a chip metal matrix. |
| US11590571B2 |
Method for producing a sintered component
The invention relates to a method for producing a sintered component comprising the steps: providing a metallic powder; filling the powder into a powder press; pressing the powder to form a green compact; removing the green compact from the powder press; sintering the green compact into a sintered component with pores; optional redensification of the sintered component; hardening of the sintered component, wherein the pores of the sintered component, prior to hardening at least in that region of the surface of the sintered component which is subjected to a hardening, are at least partially filled with a filling agent. |
| US11590560B2 |
Structure for producing cast
A structure for manufacturing castings, containing an inorganic fiber, a layered clay mineral, and an inorganic particle other than the layered clay mineral and having an organic content of 5 mass % or lower or having a mass loss of 5 mass % or lower when heated at 1000° C. for 30 minutes. The inorganic particle preferably contains one or more selected from obsidian, graphite, and mullite. The inorganic fiber preferably contains carbon fiber. The inorganic fiber preferably has an average length of 0.5 to 15 mm. The layered clay mineral preferably contains one or more selected from bentonite and montmorillonite. |
| US11590559B2 |
Method of manufacturing cast product and forged product with insert joined thereto
An insert including a taper is covered with a molten metal. A metal molded product with the insert joined thereto is generated by semi-cooling the molten metal to a press-fitting temperature which is higher than a recrystallization temperature of the molten metal and lower than a melting point of the molten metal. A fitting hole which is filled with the insert is formed in the metal molded product. The taper is fitted into the fitting hole. An undercut is not formed in front of a tip of the taper. The insert is press-fitted into the fitting hole while pressing and extending the fitting hole with the taper in a thinning direction of the taper at a press-fitting temperature. The metal molded product is further cooled with the press-fitting maintained. |
| US11590558B2 |
End effector
One illustrative embodiment of an end effector generally comprises a tip, a housing, and a main insert. The housing may include a housing neck, one or more housing sections, and an end section. A main insert may be positioned within the housing. One or more intermediate inserts may also be positioned in the housing, as may an end insert. During use, it is contemplated that the end effector will provide a user a more ergonomic and comfortable experience, requiring less effort from the user resulting in a less fatigue during use. Additionally, the illustrative embodiments of the end effector may be adjusted for optimal use in an infinite number of applications. Additionally, the locator ensures that the user properly locates the distal end of a rivet to create a uniform nugget as the distal end of the rivet is spread. |
| US11590555B2 |
Methods of creating bike rack hooks
Methods of creating a hook for a bike rack. The methods include the steps of providing a planar metal material, cutting a two-dimensional shape from the planar metal material where the two-dimensional shape defines a hook precursor, forming the hook precursor into a three-dimensional hook where the three-dimensional hook includes a hook face, and adding a protective layer to the hook face. In some examples, the methods include processing the three dimensional hook to remove sharp edges, cutting a mounting point into the hook precursor, cutting a bevel on an edge of the hook precursor to define a beveled edge, and/or cutting a curve on an edge of the hook precursor to define a rounded edge. |
| US11590552B1 |
Compact hose assembly device
A compact hose assembly device may include a housing defining a cavity and a hingedly attached door to enclose the cavity. Within the cavity, the compact hose assembly device may include at least one sliding drawer or similar storage device. The compact hose assembly device may include an air-over-hydraulic crimping machine on a sliding drawing or substrate, the air-over-hydraulic being in operable communication with an air compressor, hydraulic foot pedal pump, and the like for operation. The compact hose assembly device may be constructed and arranged for convenient, low downtime, on-site hose repair or assembly. |
| US11590551B2 |
Expanding metal with loops in different shapes
A method for producing an expanded metal, the method including producing a sheet of the expanded sheet metal by introducing openings through one expansion blade wherein all the openings are configured as diamond shaped loops without a material loss and defined by a loop width, a loop length and a loop shape; and forming the diamond shaped loops respectively by four linear bars that are defined by a bar width and a bar thickness wherein two of the four linear bars are respectively connected at four nodes; arranging plural of the diamond shaped loops in columns adjacent to one another and in rows adjacent to one another; and forming first columns of first diamond shaped loops different from second columns of diamond shaped second loops in a loop width or in a loop length respectively measured from a node center to a node center. |
| US11590548B2 |
Powered bender
An assembly for bending a conduit and a portable conduit bender. The assembly may generally include a portable bender including a base having a base surface supportable on a work surface, a housing supported by the base and defining a housing axis, the housing including a handle engageable by an operator to carry the bender, and a shoe supported by the housing for pivoting movement about the housing axis, the shoe defining a channel for supporting a conduit to be bent; and a pipe threader removably supported by the housing, the threader being operable to pivotably drive the shoe relative to the housing to bend the conduit. |
| US11590547B2 |
Method of manufacturing variable wall thickness steel pipe and variable wall thickness steel pipe
There is provided a method of manufacturing a variable wall thickness steel pipe with a hollow tubular raw pipe. The method of manufacturing a variable wall thickness steel pipe includes locking the raw pipe in a die by thrusting a plug into the raw pipe from an one end side, so as to expand an outer shape on the one end side in a state, where the raw pipe is disposed inside the die and movement of the raw pipe in a longitudinal direction is restricted; and performing ironing in which an inner shape of the raw pipe is expanded while the outer shape is maintained so that a thin portion is formed by further thrusting the plug toward the other end side of the raw pipe while the locked state of the raw pipe is maintained, whereas the restriction on the raw pipe is relaxed. |
| US11590546B2 |
Method for forming a moulding and moulding
A shaped part and a method for forming the shaped part from a lightweight metal or alloy by extrusion of a slug performed along a pressing axis. The shaped part is formed in at least one region with a deviation from a basic form that is rotationally symmetrical with respect to the pressing axis. The symmetry-deviating region extends over a wall portion of the shaped part that is formed by backward cup extrusion with a normal vector extending predominantly orthogonally in relation to the pressing axis. The same extruding operation forms a structure that surrounds the pressing axis, on a sheet-like base of the shaped part that adjoins the wall portion and has a normal vector extending predominantly in the direction of the pressing axis on the side thereof opposite from the wall portion. In a region of lowest wall thickness of the wall portion at the transition to the base, the quotient of this wall thickness in mm and an average curvature (1/r) in mm−1, formed at the transition, is greater than 0.03 and/or, in an at least predominant region of the base-wall transition when seen in the circumferential direction, the ratio of the wall thickness to the base thickness is less than 1.0. |
| US11590545B2 |
Composite cemented carbide roll, and production method of composite cemented carbide roll
A composite cemented carbide roll comprising an inner layer made of an iron-based alloy, and an outer layer made of cemented carbide which is metallurgically bonded to an outer peripheral surface of the inner layer; the cemented carbide of the outer layer comprising 55-90 parts by mass of WC particles and 10-45 parts by mass of an Fe-based binder phase having a particular composition; a shaft member and a shaft end member being metallurgically bonded to at least one axial end of the inner layer; the inner layer being made of an iron-based alloy containing 2.0% or more in total by mass of at least one selected from the group consisting of Cr, Ni and Mo; and the shaft member and the shaft end member being made of an iron-based alloy containing 1.5% or less in total by mass of at least one selected from the group consisting of Cr, Ni and Mo. |
| US11590543B2 |
Pipeline maintenance and inspection vehicle
A vehicle (10) for performing operations on a subsea pipeline, such as a riser (2), carries one or more interchangeable modules (18) and is configured to translate along the riser (2). The vehicle (10) comprises an elongate support structure (12) for carrying the modules (18). Gripper arms (14, 16) hold the support structure (12) a predetermined distance away from the elongate body and cause translation of the vehicle (10) along the riser (2) using a hand-over-hand action, so as to allow the vehicle (10) to pass protuberances or obstacles, such as a clamp (8), on the riser (2). |
| US11590538B2 |
Bulk material cleaner with integrated air separator, and bulk material cleaner with a hollow support frame
Bulk material cleaner (1) comprising a support frame (2) and a screen housing (3), which can be oscillated and/or vibrated by a drive (5). At least one screen (6) is arranged in the screen housing (3). The screen housing has a feed opening (7) and at least two outlet openings (8, 9), the outlet openings (8, 9) being for a first fraction (F1) and a second fraction (F2), respectively. Moreover, the bulk material cleaner (1) comprises an air separator (10), which is only fastened on the screen housing (3). |
| US11590537B2 |
Powder sieving system using a broad frequency filter
A powder sieving system that is configured as part of a powder reclamation system is provided. The powder sieving system includes a support structure; and a filter housing movable relative to the support structure, the filter housing defining an inlet and an outlet and comprising a broad frequency filter disposed between the inlet and the outlet, the broad frequency filter including: a first filter fixed relative to the filter housing, the first filter being substantially rigid; and a second filter coupled within the filter housing adjacent to the first filter, the second filter being substantially flexible such that the second filter is movable relative to the first filter within the filter housing when the filter housing moves relative to the support structure, the first filter and the second filter configured to restrict a first portion of a powder larger than a predetermined threshold from reaching the outlet. |
| US11590535B2 |
Ultrasonic transducer
A system, method, and apparatus for reducing ringing effects associated with a transducer comprises a transducer body, a transducer cap, a piezoelectric element formed in the cap, and a damping material formed around the piezoelectric element wherein the damping material suppresses a ringing effect associated with the transducer, while an O-ring is used together with damping material to support high pressure applications up to 230 bars. |
| US11590534B2 |
Ultrasonic sensor, ultrasonic device, and method of manufacturing ultrasonic sensor
An ultrasonic sensor includes a vibration plate that includes a vibration portion and is formed of a resin; a wall portion that is provided on the vibration plate, surrounds the vibration portion and is formed of a resin; and a piezoelectric element that is provided in the vibration portion of the vibration plate. Accordingly, the wall portion surrounding the vibration portion can suppress a frequency variation of an ultrasonic wave output from the ultrasonic sensor and can deform the ultrasonic sensor into a shape corresponding to a surface of an object having various shapes. |
| US11590531B2 |
Optical elements
An optical element is provided. The optical element includes a substrate; a plurality of metal grids formed on the substrate; an oxide layer formed on the substrate between the plurality of metal grids; and a plurality of organic layers formed on the plurality of metal grids, wherein the width of the organic layer is greater than the width of the metal grid, and there is at least one gap between the organic layer and the oxide layer. |
| US11590523B2 |
Smart fountain with proximity sensors and a dry closed loop system layout
Proximity triggered water fountains may have proximity sensors configured to detect target(s), a processing unit communicably coupled to proximity sensors configured to transfer data related to the target(s) to the processing unit, nozzles and nozzle controllers, and collectors configured to receive water projected from the nozzles. The nozzle controllers may be controlled based on data received from the sensors. The nozzle controllers may be coupled to the nozzles of a water circulation system configured to adjust a water projection angle from the nozzles with respect to the ground. The water circulation system may use tank(s), pump(s), and supply and return line(s), with the nozzles, tank(s), pump(s), and supply and return line(s), being in fluid communication. The nozzles and collectors may be displaced a horizontal distance from each other such that outlets of the nozzles are not vertically above the collectors. |
| US11590515B2 |
Pusher centrifuge with direct drive transmission
A pusher centrifuge includes a rotatable filter drum having a drum body and a piston that are configured to be reciprocated axially relative to one another, a filter drum drive shaft rigidly connected to the filter drum, a hydraulic push mechanism for generating an axial oscillating push force and connected to the filter drum so as to cause the relative reciprocating movement between the piston and the drum body, a hydraulic pump including a pump input shaft and is in fluid connection with the hydraulic push mechanism, and a drive motor including at least one output shaft connected to the pump input shaft and the filter drum drive shaft to actuate both the pump input shaft and the filter drum drive shaft. The at least one output shaft of the drive motor is connected to the pump input shaft in a manner without an intervening gearbox, thereby forming a direct drive. |
| US11590514B2 |
Collectors for treating tailings
A process for treating and dewatering tailings comprising fine clay minerals, fine rock-forming minerals and water is provided, comprising treating the tailings with a sufficient amount of a collector to modify the surface properties of both the fine clays and rock-forming minerals; subjecting the treated tailings to froth flotation to form a fine clays and rock-forming minerals froth layer; and recovering the froth layer and subjecting it to dewatering. |
| US11590509B2 |
Method for manufacturing polycrystalline silicon fragment and polycrystalline silicon block fracture device
A polycrystalline silicon block fracture device includes a fracturing part mechanically fracturing a polycrystalline silicon block material to produce a polycrystalline silicon fragment including a polycrystalline silicon powder having a particle size of 500 to 1000 μm then discharging from a discharging port; a falling movement part continuous with a downstream of the fracturing part allowing said polycrystalline silicon fragment discharged from the discharging port to fall by gravity; a receiver part positioned at downstream of the falling movement part and receives the polycrystalline silicon fragment after falling through the falling movement part; and the falling movement part includes a suction removing part in which at least part of the polycrystalline silicon powder included in the polycrystalline silicon fragment is removed by suctioning to a different direction from falling direction; the suction removing part suctions at a suction rate of 1 to 20 m3/min. |
| US11590502B2 |
Assessment of micro-organism presence
The present disclosure relates to a consumable sample partition device and it assembly and use. The sample partition device can be used to test a sample for absence of microorganisms (sterility) and/or for concentration of said organisms (bio-burden). The sample partition device partitions the sample input volume into multiple discrete measurement zones with little or no loss of sample (e.g., zero-loss) and with little operator involvement, thereby reducing operator- and environment-based false positives. |
| US11590501B2 |
Methods for isolating pancreatic islets
A microfluidic device can include an upstream passage, a sample passage, a bifurcating passage, and a combining passage. The upstream passage can be configured to provide a focusing stream. The sample passage can be configured to provide a sample stream. The bifurcating passage can include a specified bifurcating flow resistance. The combining passage can be configured to create a combined stream from the focusing stream and the sample stream, where the focusing stream can direct the sample stream away from the upstream passage and toward the bifurcating passage. A first portion of the combined stream can be discharged through the bifurcating passage. The main discharge can be configured to discharge a second portion of the combined stream. The main discharge can include a main discharge resistance that is selectable to vary the main discharge resistance relative to the bifurcating flow resistance. |
| US11590499B2 |
Systems and methods for providing fluidic access to a flow cell
An apparatus includes a fluidic coupler including an opening. A first port is in fluid communication with the opening and is to interface with an inlet of a flow cell of a sensor device. A second port is to interface with an outlet of the flow cell of the sensor device. A third port is in fluidic communication with the second port. The apparatus further includes a mechanical assembly moveable between a first position and a second position. The fluidic coupler is secured to the flow cell of the sensor device in the first position. The fluidic coupler is disengaged from the flow cell of the sensor device in the second position. |
| US11590498B2 |
Arrangement for mixing fluids in a capillary driven fluidic system
There is provided an arrangement (100) which allows for mixing a first fluid with a second fluid at a predetermined volume mixing ratio in a capillary driven fluidic system. The arrangement (100) allows filling an initially empty mixing chamber (110) with the first fluid. The arrangement then allows emptying a predetermined fraction of the first fluid from the mixing chamber (110) such as to form an empty space in the mixing chamber (110). The arrangement then allows filling the empty space of the mixing chamber (110) with the second fluid, thereby allowing a predetermined volume of the first fluid to mix with a predetermined volume of the second fluid over time. |
| US11590496B2 |
Automated microscopic cell analysis
This disclosure describes single-use test cartridges, cell analyzer apparatus, and methods for automatically performing microscopic cell analysis tasks, such as counting and analyzing blood cells in biological samples. A small measured quantity of a biological sample, such as whole blood, is placed in a mixing bowl on the disposable test cartridge after being inserted into the cell analyzer. The analayzer also deposits a known amount of diluent/stain in the mixing bowl and mixes it with the blood. The analyzer takes a measured amount of the mixture and dispenses in a sample cup on the cartridge in fluid communication with an imaging chamber. The geometry of the imaging chamber is chosen to maintain the uniformity of the mixture, and to prevent cells from crowding or clumping as it is transferred into the imaging chamber by the analyzer. Images of all of the cellular components within the imaging chamber are counted and analyzed to obtain a complete blood count. |
| US11590491B2 |
Automatic liquid transfer optimization pipetting apparatus and method
An automatic liquid transfer optimization pipetting apparatus and method is disclosed. Namely, a liquid handling apparatus includes a pump supplying a nozzle (i.e., a pipette tip) via a conduit, one or more pressure sensors, and an electronic controller, and wherein the pipette tip is submerged in a liquid. Further, a method of automatic liquid transfer optimization pipetting includes the steps of actuating the pump to move a designated volume of liquid and then allowing the system to settle to a steady state after completion of pump actuation. |
| US11590490B2 |
Pipette tips
Disclosed here are pipette tips useful for acquiring or dispelling liquids, and include one or more design that may increase fluid delivery precision and/or accuracy, and may reduce certain repetitive motions. |
| US11590486B2 |
Solid phase for mixed-mode chromatographic purification of proteins
A method for manufacturing a mixed-mode chromatography medium is provided. The method can include, for example, oxidizing diol groups on diol-functionalized solid particles having pores of a median diameter of 0.5 micron or greater with substantially no pores of 0.1 micron or less in diameter and having a diol density of from about 200 to about 300 μmol/mL to aldehyde groups, thereby converting said diol-functionalized solid particles to aldehyde-functionalized solid particles; and coupling amine-functionalized ligands to said aldehyde-functionalized solid particles, said amine-functionalized ligands comprising an amine-substituted hydrophobic group joined to an acid moiety selected from the group consisting of a carboxyl group and a sulfo group. |
| US11590479B2 |
Interior material having surface layer having visible light-responsive photocatalytic activity, and method for manufacturing same
The present invention provides: an interior material having a surface layer which has visible light-responsive photocatalytic activity and which contains two types of titanium oxide microparticles, the two types of titanium oxide microparticles comprising first titanium oxide microparticles, in which a tin component and a transition metal component for enhancing visible light responsiveness (excluding iron group components) are in solid solution, and second titanium oxide microparticles, in which an iron group component is in solid solution; and a method for manufacturing the interior material. The present invention makes it possible to provide an interior material in which visible light-responsive photocatalytic titanium oxide microparticles, which make it possible to easily produce a surface layer (photocatalyst thin film) having high transparency and expressing photocatalytic activity even in response to visible light (400-800 nm) only, are applied onto a surface, whereby it is possible to obtain, under indoor illumination, excellent photocatalytic properties such as an antimicrobial property and a property of breaking down chemical substances in indoor air without adversely affecting the design quality of the article in question. |
| US11590475B2 |
Photoluminescent hybrid organic/inorganic materials and method for preparing same
Disclosed is a method for preparing a hybrid organic/inorganic composition including inorganic nanoparticles functionalized by at least one molecule chosen from photoluminescent charged organic molecules, the method including bringing into contact, in a single-phase solvent medium, at least one photoluminescent charged organic molecule and non-swelling phyllosilicate nanoparticles having a thickness of 1 nm to 100 nm, and a larger dimension of 10 nm to 10 μm. Also disclosed are hybrid photoluminescent nanoparticles compositions obtained by this method. |
| US11590474B1 |
Stable solid particulate system for controlling humidity to a selected range
A stable, solid, externally dry particulate system for controlling humidity to a selected range comprising a hydrophobic silica component and a hydrophilic silica component where the hydrophobic component comprises about 4 to 10 wt. % hydrophobic nano silica particles and from about 96 to 90 wt. % of a mixture of a saturated solution of at least one soluble solid and undissolved at least one soluble solid, and the hydrophilic micro silica component comprises from about 20 to 40 wt. % hydrophilic silica particles and about 80 to 60 wt.% of the mixture of the saturated solution of at least one soluble solid and the undissolved at least one soluble solid. The saturated solution is made of at least one soluble solid dissolved into a polar liquid and has an equilibrium relative humidity when a saturated solution in the polar liquid. |
| US11590468B1 |
Method and device for laboratory formulation and chemical vending
An automatic chemical solution formulating device combines and mixes stored solids and liquids into user specified formulations and dispenses those formulations into containers. Chemical solids are stored in cartridges of material separated into predetermined dosages (for example in reeled blister packs), avoiding the need for weighing during formulation. Elements include user interface, computer-controlled automated loading and unloading port for reagent-containing cartridges, cartridge conveyor system, reader for identifying cartridges, blister-pack strip drive system, punching mechanism to release reagents, portioning chamber to mix solvent with solids or liquids with optional portioning, accommodating formulation delivery port, position sensors, liquid flow measuring devices, liquid and gas pumps and valves, and label printer. The combination of these elements allows high-speed formulation and dispensing of user-specified formulations. |
| US11590464B2 |
Bottle capable of mixing powders and liquids
A bottle includes a base, neck that defines an aperture, and a body. The bottle has at least one indent in the body that projects into an interior of the bottle and extends around at least part of a circumference of the body. This at least one indent is configured to agitate a substance contained in the bottle. For example, the bottle may contain a powder, such as protein powder, and the at least one indent helps mix the powder with a liquid. In an example, two indents are used in the bottle. |
| US11590460B2 |
Chemical solution evaporation device and substrate processing device including the same
A chemical solution vaporization device includes a chemical solution tank including chemical solution vaporization rooms, a chemical solution sensing room, and a chemical solution supply room. A first internal wall separating the plurality of chemical solution vaporization rooms from each other includes a first opening at a lower portion thereof. A second internal wall separating at least one of the plurality of chemical solution vaporization rooms from the chemical solution supply room includes a second opening at a lower portion thereof. A third internal wall separating at least one of the plurality of chemical solution vaporization rooms from the chemical solution sensing room includes a third opening at a lower portion thereof. And a lower portion of a fourth internal wall separating the chemical solution sensing room from the chemical solution supply room is combined with the lower wall. |
| US11590459B2 |
Nanoporous membranes for fast diffusion of ions and small molecules
A product includes a nanoporous membrane having a plurality of carbon nanotubes and a fill material in interstitial spaces between the carbon nanotubes for limiting or preventing fluidic transfer between opposite sides of the nanoporous membrane except through interiors of the carbon nanotubes. The longitudinal axes of the carbon nanotubes are substantially parallel, an average inner diameter of the carbon nanotubes is about 20 nanometers or less, and both ends of at least some of the carbon nanotubes are open. Moreover, the fill material is impermeable or having an average porosity that is less than the average inner diameter of the carbon nanotubes. |
| US11590456B2 |
Systems and methods for oleophobic composite membranes
Atomic layer deposition is utilized to deposit a coating on a membrane. The coated membrane exhibits a tightly bound hydration layer upon exposure to water. The resultant coated membrane is oleophobic. |
| US11590449B2 |
Hydrogen purification devices
Hydrogen purification devices and their components are disclosed. In some embodiments, the devices may include at least one foil-microscreen assembly disposed between and secured to first and second end frames. The at least one foil-microscreen assembly may include at least one hydrogen-selective membrane and at least one microscreen structure including a non-porous planar sheet having a plurality of apertures forming a plurality of fluid passages. The planar sheet may include generally opposed planar surfaces configured to provide support to the permeate side. The plurality of fluid passages may extend between the opposed surfaces. The at least one hydrogen-selective membrane may be metallurgically bonded to the at least one microscreen structure. In some embodiments, the devices may include a permeate frame having at least one membrane support structure that spans at least a substantial portion of an open region and that is configured to support at least one foil-microscreen assembly. |
| US11590442B2 |
Systems and methods for providing filtered air to an enclosure for a passenger of a vehicle
Within examples, a system to provide filtered air to an enclosure for a passenger of a vehicle is described that includes a collapsible canopy hood attachable to a support structure of a vehicle, and a filter unit mounted to the support structure of the vehicle and having an output coupled to the collapsible canopy hood. The filter unit includes an air filtration component to filter air that is then output to the collapsible canopy hood. |
| US11590438B2 |
Liquid dispenser for animals
A pet water dispenser may include a water tank, a pump installed inside the water tank, a water supply pipe connected to the pump to transfer water, and a water supply plate provided at a position higher than an upper end of the water tank and through which water supplied from the water supply pipe flows. The water supply plate may be provided to be spaced apart and above a water guide configured to catch water falling from an edge of the water supply plate and to guide the dropped water back into the water tank. |
| US11590430B2 |
Analog DC model train system and method of use
A system for use with an analog DC model train, the system includes a base unit to electronically communicate with a track of the analog DC model train, the base unit having a receiver; one or more microcontrollers; a potentiometer; a digital stepper motor connected to the digital stepper motor and to provide torque to turn the potentiometer; a controller to communicate wirelessly with the receiver, the controller having a control to send a command the base unit to set a first numerical value associated with a position of the digital stepper motor; the first numerical value can be retrieved by the base unit based on commands from the controller to set the position of the digital stepper motor. |
| US11590425B2 |
Information processing system with increased user draw mode strategies, and associated information processing apparatus, storage medium and information processing method
An example of an information processing system is configured to, in a draw mode, display two or more selection candidates. In the draw mode, when a selection instruction to select at least one of unselected selection candidates is given, a game character that corresponds to the selected selection candidate is granted to the user. When the number of unselected selection candidates is equal to a first number, the process decreases an amount by which the predetermined parameter is decreased as compared with a case where the number of unselected selection candidates is equal to a second number greater than the first number. When a cumulative grant count becomes equal to or greater than a reference count, the information processing system permits execution of a designated mode in which a game character designated by the user is granted to the user. |
| US11590423B2 |
Multi-user route tracking in an augmented reality environment
A system provides an augmented reality (AR) experience in a parallel-reality application in which a geography of a virtual world parallels a geography of the real world. The system receives a connection request from a client device and receives a route that the client device traversed in the real world. The route comprises a plurality of locations in the real world. The system determines a plurality of virtual locations to place virtual elements at, where each virtual element corresponds to a location in the real world of the route. The system updates a global state of the AR experience to include the plurality of virtual elements at the plurality of virtual locations. The system provides, to a second client device, AR data including some of the virtual locations for display of some of the virtual elements at the corresponding locations in the real world. |
| US11590422B2 |
Storage medium having information processing program stored therein, information processing system, information processing apparatus, and information processing method
An example of an information processing system executes an application including a plurality of games using characters to each of which at least one of a plurality of skills influencing progress of a game is added. In a first game that is one of the plurality of games, a possessed character that is a character possessed by a user is used. The information processing system adds at least one skill that satisfies a condition for being designated by the user, among the plurality of skills, to the possessed character on the basis of designation by the user. In a second game different from the first game among the plurality of games, a use character prepared to be used in the second game is used. The information processing system adds at least one skill among the plurality of skills to the use character in accordance with progress of the second game. |
| US11590418B2 |
Gaming accessory with sensory feedback device
A method that incorporates teachings of the subject disclosure may include, for example, receiving, by a device comprising a processor, a first signal from a motion-sensitive component of the device; receiving, by the device, a second signal from a touch-sensitive interface of the device, detecting, by the device, from a combined signal comprising the first signal and the second signal, a selection of a portion of the device; and causing, by the device, a sensory feedback generator to provide a feedback signal in accordance with the combined signal. The feedback signal may comprise an audible sound, a visual effect, a tactile effect, or any combination thereof. Additional embodiments are disclosed. |
| US11590417B2 |
Information handling system controller adaptive haptic feedback
A portable information handling system interacts with haptic devices of a game controller though a direct wired interface when the game controller couples to opposing sides of the information handling system and through a wireless interface when the game controller couples to a bridge having a wired interface to communicate with the game controller and a wireless interface to communicate with the information handling system. The haptic devices provide a first haptic response associated with a desired vibration for a weight of game controller and information handling system when the game controller couples directly to the information handling system, and a second haptic response associated with the desired vibration for a weight of the game controller and bridge when the game controller couples directly to the bridge for wireless communication with the information handling system. |