Document | Document Title |
---|---|
US10512587B2 |
Method and apparatus for scalp thermal treatment
A head wrap includes a body. A first arm extends from the body. A second arm extends from the body oppositely from, and shares a common axis with, the first arm. A center section extends from the body generally perpendicular to the first arm and the second arm. A first panel and a second panel extend from the first arm. A third panel and a fourth panel extending from the second arm. A fluid bladder is defined by the body, the first arm, the second arm, the center section, the first panel, the second panel, the third panel, and the fourth panel. A compression bladder is disposed outwardly of the fluid bladder and coextensive with the fluid bladder. A first fluid port is fluidly coupled to the fluid bladder and a second fluid port is fluidly coupled to the fluid bladder. |
US10512582B2 |
Supporting module and motion assistance apparatus including the same
A supporting module and a motion assistance apparatus including the same, the supporting module including a supporting frame including a sliding guide, a sliding joint configured to slide along the sliding guide, and an elastic module provided in the supporting frame, and configured to provide an elastic force to the sliding joint, are provided. |
US10512581B2 |
Shoulder joint rehabilitation assistive device
A shoulder joint rehabilitation assistive device has an exoskeleton base, an actuating mechanism, a spherical mechanism, and an upper limb connecting mechanism. The actuating mechanism is mounted on the exoskeleton base and has a yaw spring actuating assembly and a pitch spring actuating assembly. The spherical mechanism is connected with the actuating mechanism and has a linking rod, a spherical yaw linking assembly, and a spherical pitch linking assembly. The linking rod is pivotally connected with the exoskeleton base. The spherical yaw linking assembly has two ends respectively provided with a first yaw actuating portion and a second yaw actuating portion. The spherical pitch linking assembly has two ends respectively provided with a first pitch actuating portion and a second pitch actuating portion. The upper limb connecting mechanism is connected with the linking rod and the second yaw actuating portion of the spherical yaw linking assembly. |
US10512578B2 |
Patient stabilization device and methods of use
Devices, systems and methods for patient stabilization are disclosed. |
US10512575B2 |
Dynamic support apparatus
A dynamic support apparatus. The dynamic support apparatus includes a cushion, at least one actuator wherein the at least one actuator defines an interior volume and wherein the interior volume may be configured to be at least partially filled with a fluid, and a support disposed in the interior volume wherein the support configured to support an occupant when the interior volume is not filled with the fluid such that the support is sufficient to support the occupant. |
US10512569B2 |
Wearable absorbent hygiene article comprising a magnetic switch
A wearable absorbent hygiene article includes an electronics unit, a power source and a magnetic switch. The magnetic switch operably couples the electronics unit to the power source. The magnetic switch is configured such that the power source supplies power to the electronics unit when the magnetic switch is in an ON state and such that the power source does not supply power to the electronics unit when the magnetic switch is in an OFF state. The magnetic switch is further configured such that a movement of a magnet relative to the magnetic switch switches the magnetic switch from the OFF state to the ON state. |
US10512567B2 |
Soft absorbent sandwich web comprising high concentrations of superabsorbent material, cellulosic fibers and surface applied binder
The present invention is a liquid absorbent sandwich web as can be used in absorbent products such as in disposable absorbent articles such as diapers, feminine hygiene articles or incontinence devices, and to the manufacturing of such webs. The liquid absorbent sandwich web provides high absorbent capacity without compromising softness. |
US10512566B2 |
Absorbent article with flat-back protection feature
An absorbent article includes a base-structure and an elevatable structure known as a flat-back protection feature, that is capable of rising above the base-structure during article use. The flat-back protection feature utilizes either differences in material length compared with the length of the adjacent base-structure, or elastic materials, to maintain the feature elevation above the base-structure, while the article is in an extended condition. The flat-back protection feature extends into the intergluteal cleft of a wearer during use. Embossment features on the absorbent article are used to facilitate folding of the absorbent article, enhance the functionality of the protection feature, and/or improve the ease of manufacture. |
US10512565B2 |
Scleral marker for surgical procedures
A surgical instrument for marking spots at locations on the scleral limbal surface of a human eye. The instrument includes an elongated handle dimension to be handheld. A first elongated pointer extends substantially axially outwardly from one end of the handle. This pointer has a pointed free end which, when pressed against the scleral limbal surface, creates a depression in the scleral surface having a first area. A second elongated pointer also extends substantially axially outwardly from the end of the handle. The second pointer has a blunt free end which, when pressed against the scleral limbal surface, creates a depression in the scleral surface having a second area which is several times in magnitude the area of the first area. |
US10512564B2 |
Combination treatments
A method of treating a subject in need thereof, is carried out by (a) administering said subject a therapeutic intervention (e.g., an active agent) in a treatment effective amount; and concurrently (b) administering said subject caloric vestibular stimulation in a treatment effective amount, said caloric vestibular stimulation administered so as to enhance the efficacy of said active agent. In some embodiments, the caloric vestibular stimulation is administered as an actively controlled time varying waveform. |
US10512561B2 |
Arm support
An arm support for transferring and supporting a force corresponding to at least a portion of the weight of a supported arm. The arm support including a force distribution portion and a support portion. The force distribution portion adapted to conform to the shoulder of the unsupported arm and to distribute the force to the shoulder girdle, while the support portion supports the affected arm. The force distribution portion extends from a first end portion to a second end portion. The support portion extends from a first end portion to a second end portion. The support portion first end portion is located adjacent the force distribution portion second end portion and the support portion second end portion is configured to be adjustably couplable to the force distribution portion first end portion. |
US10512560B1 |
Transferring a state of user interaction with an online content item to a computer program
A computer-based method for transferring a state of user interaction with an online content item to a computer program accessible by a user device is provided. The method is implemented using an application server in communication with a memory. The method includes hosting a first session associated with a computer program. The first session includes a session state. The method also includes associating a first session token with the first session of the plurality of sessions, receiving from a user device one or more user interactions with an interactive online content item, updating the session state for the first session based on the one or more user interactions, receiving a request for the session state for the first session after the computer program becomes accessible for use by the user device, and transmitting the session state for the first session to be applied to the computer program. |
US10512559B2 |
Cervical collar having height adjustment
A cervical collar has an anterior component including a lower support that is adjustable in angle relative to a main support. The lower support is hingedly connected to the main support at first and second end portions. An elongate element engages the first and second end portions. A lock mechanism is operatively connected to the elongate element, and is arranged for locking rotation of the lower support relative to the main support, by moving the elongate element between locked and unlocked conditions. An upper support is received by the main support at least at a front section of the main support, and is arranged to be fitted against a user's chin. |
US10512551B2 |
Methods and apparatus for implanting an interbody device
An interbody implant comprises one or more elongate members that have superior and inferior surfaces with a height, and medial and lateral surfaces having a width. The height is set so the implant fits into the intervertebral space. The width is less than the height. The interbody implant has a first configuration, a second configuration, and a third configuration. The interbody implant is inserted into the intervertebral space in the first configuration such that medial and lateral surfaces contact the vertebral bodies, and the interbody implant is then actuated into the second configuration such that superior and inferior surfaces engage the vertebral bodies. Actuation of the implant from the first configuration to the second configuration distracts the vertebral bodies. The implant is actuated into the third configuration where the width of the implant is greater than width of the implant in the first or the second configuration. |
US10512549B2 |
Implant with structural members arranged around a ring
An implant for use in a spine includes a body and a plurality of structural members. The superior and inferior surfaces each include a ring and structural members arranged in a web-like pattern around the ring. Bone contacting members are arranged radially away from the ring and support members are arranged in a circumferential direction around the ring. |
US10512545B2 |
Interbody spacer for spinal fusion
An interbody spacer for spinal fusion surgery includes first and second opposite side walls that have open-cell metal foam at upper and lower faces, and a three-dimensional lattice disposed between open-cell metal foam at the upper and lower faces. The open-cell metal foam is in communication with the three-dimensional lattice so that bone growth can enter the three-dimensional lattice from the open-cell metal foam. The interbody spacer may be formed by additive manufacturing. |
US10512542B2 |
Device, system, and method for transcatheter treatment of valve regurgitation
The invention relates to a device for use in the transcatheter treatment of mitral valve regurgitation, specifically a coaptation enhancement element for implantation across the valve; a system including the coaptation enhancement element and anchors for implantation; a system including the coaptation enhancement element, catheter and driver; and a method for transcatheter implantation of a coaptation element across a heart valve. |
US10512536B2 |
Collapsible cardiac implant and deployment system
A collapsible device, such as an annuloplasty ring or prosthetic heart valve, is configured to be collapsed prior to being introduced into a patient via minimally-invasive access points such as port holes or intercostal incisions. A holder is configured to hold the collapsible device, and to selectively collapse the device for introduction into the patient and then re-enlarge the device at the desired deployment site. Collapsible devices include devices that can hingedly fold about hinge lines, and devices that can elongate to form substantially spiral forms with reduced diameters. |
US10512532B2 |
Therapeutic device for the treatment methods and inguinal hernia
Provided is a method of treating inguinal hernia, in which a burden applied to a patient during treatment can be reduced. There is provided a method of treating inguinal hernia, in which a bowel is prevented from being exposed to an outside through a fascia. The method of treating inguinal hernia includes an introduction step of introducing a member configuring a structural body which restricts deformation of the bowel, through an anus toward a hernial site by using a transportation member; and a configuration step of configuring the structural body with respect to the bowel which stays medial to the fascia. |
US10512530B2 |
Electric toothbrush
An electric toothbrush including a handle, a head movable with respect to said handle, and a rotating working element having at least one brush located out of the geometric axis of said handle. The electric toothbrush further includes an electric motor for driving the working element in a rotary movement in a clockwise/counterclockwise direction, and a motor rotation direction switch coupled functionally with the head and the handle. The head and the handle are coupled with resilient technical means that enable, after exertion of the torque to the head, to rotate the head with respect to the handle into the left or right positions, where the motor rotation direction switch turns on the motor in the clockwise/counterclockwise rotation direction. After releasing said torque, the resilient technical means enable to maintain the head in a standby position relative to the handle, where the motor rotation direction switch turns off the motor. |
US10512529B2 |
Use of resonant systems to automatically modify power (amplitude) of an oral care appliance upon use in-mouth
An oral care appliance (100), such as an electric toothbrush, utilizing non-linear resonant systems is described herein. In one exemplary embodiment, the oral care appliance includes a longitudinal shaft (102), a brush head (130), and a handle (190). The handle includes a motor (140) that generates a first amplitude (404) for the brush head based on the brush head being outside of the user's mouth, when no mass is applied to the brush head. In response to the brush head being inside of the user's mouth, when mass is applied, such as by pressing the brush head against the teeth, the motor causes a second amplitude (410) to be generated for the brush head that is larger than the first amplitude. |
US10512522B2 |
Method and apparatus for virtual endoscopy
A surgical instrument navigation system is provided that visually simulates a virtual volumetric scene of a body cavity of a patient from a point of view of a surgical instrument residing in the cavity of the patient. The surgical instrument navigation system includes: a surgical instrument; an imaging device which is operable to capture scan data representative of an internal region of interest within a given patient; a tracking subsystem that employs electro-magnetic sensing to capture in real-time position data indicative of the position of the surgical instrument; a data processor which is operable to render a volumetric perspective image of the internal region of interest from a point of view of the surgical instrument; and a display which is operable to display the volumetric perspective image of the patient. |
US10512520B2 |
Methods and apparatus for coupling an optical input to an illumination device
A surgical illumination apparatus comprises a fiber optic input, and illuminated surgical instrument, and an optical coupling bracket for coupling the fiber optic input to the illuminated surgical instrument. The coupling bracket comprises an elongate frame having a proximal end, a distal end, and a central channel extending therebetween, wherein the central channel is sized to receive and support optical fibers of the fiber optic input. The proximal end of the bracket is coupled to the fiber optic input, and the distal end of the bracket is coupled to an illumination element of the illuminated surgical instrument. The apparatus may further comprise a shroud disposed around the illumination element that is coupled to the bracket. |
US10512519B2 |
Illuminated medical devices
A surgical retractor comprising a handle and a blade extending at an angle from the handle; an illumination assembly having a plurality of direct light sources provided on the blade, at least one of the light sources being angled differently relative to the blade than another one of the light sources; and a cover configured to enclose the illumination assembly, wherein the cover comprises a plurality of openings, each opening corresponding in position to a respective light source of the illumination assembly when the cover is attached to the blade. |
US10512518B2 |
Illuminated telescoping cannula
The illumination system includes an arthroscope, endoscope or other surgical tool and an attachable cannula including a transparent or semi-transparent material capable of carrying light from the proximal end to the distal end of the cannula, illuminating the surgical field through components that do not occupy space that may otherwise be used for the optics of an arthroscope. The arthroscopic illumination system further includes one or more illumination sources at the proximal end of the cannula. The illumination source may be optically coupled with the cannula at the hub or other location. The cannula includes a sterilizable polymer which functions as a waveguide, which is a material medium that confines and guides light. When in use, the light source connected to the hub provides light which may be guided to the distal end of the cannula or any other location. Thus, the sheath provides structure-guided illumination of the surgical site. |
US10512515B2 |
Systems and methods for steerable elongate device
Systems and methods for controlling an elongate device include a console. The console includes a first recess and a removable first input control for controlling motion of the medical device. The console also may include one or more first sensors located about the first recess that detect motion of the first input control and detect operator contact with the first input control. The console also may include an integrated display screen arranged to display status information for the medical device. In some embodiments, the first input control controls an insertion depth or steering of the medical device, and may be in the form of a scroll wheel forming a part of a removable control assembly. |
US10512507B2 |
Method and system for automatic estimation of utility of adaptive radiation therapy re-planning
A method and system determines a utility of performing a re-planning on a patient during a radiation therapy planning. Quality improvements which may be made possible by re-planning the patient are automatically estimated, independent of clinician bias. This enables the clinician to make an informed decision regarding whether to re-plan the patient in a fast and efficient manner. This achieves more uniformity and predictability in the adaptive re-planning. |
US10512506B2 |
Stabilization apparatuses and methods for medical procedures
The present invention teaches minimally invasive apparatuses and methods for stabilizing and/or guiding medical instruments used in a variety of medical procedures, including (a) introducing one or more substances into a subject's body, (b) removing one or more substances from a subject's body, (c) manipulating a region of a subject's body, or (d) combinations thereof. Among the many advantages of the inventive apparatuses are their simplicity and adaptability to attach to a variety of retractors. |
US10512502B2 |
Tissue scissors for biological tissue
The invention relates to tissue scissors (10) with improved stability and improved handling that have two structurally and electrically different branches (11, 12). While the sliding surface (25) of the first branch (11) has a metal-ceramic hard material layer (30), such as, for example, titanium nitride, the second sliding surface (34) of the second branch (12) has an electrically non-conductive ceramic layer (33). The material mating produces great mechanical resistance to abrasion in the bearing (17) and on the cutting edges (28, 35). At least one of the branches, in particular branch (12), can have a cermet body (36) to improve the cooling of the cutting edge (35 (28)) and/or keep it sharp, to prevent heating of the branches (11, 12) during coagulation and sticking of the tissue. |
US10512501B2 |
Electrosurgical apparatus
An electrosurgical forceps includes a first member including a first housing and a first jaw member with a tissue contacting surface. A second member includes a second jaw member with a tissue contacting surface configured to communicate electrosurgical energy with the tissue contacting surface of the first jaw member a fluid receptacle at least partially disposed within the first housing. The fluid receptacle defines first and second receptacle sections, the first receptacle section defining a first internal dimension and the second receptacle section defining a second internal dimension less than the first internal dimension. A fluid is disposed within the fluid receptacle. A trigger plunger is mounted within the fluid receptacle. A knife shaft is at least partially disposed within the fluid receptacle distal of the trigger plunger and the fluid. A knife blade is disposed adjacent the first and second jaw members. |
US10512499B2 |
Systems and methods for detecting opening of the jaws of a vessel sealer mid-seal
Disclosed are systems, devices, and methods for operating an electrosurgical generator, comprising an RF output stage configured to output an electrosurgical waveform through at least one pair of electrodes, sensing circuitry configured to measure an impedance between the at least one pair of electrodes configured to grasp tissue, and a controller configured to determine whether the impedance of the tissue disposed between the at least one pair of electrodes exceeds an impedance threshold, determine whether a change in the impedance is greater than an upper change in impedance threshold, and output an alarm indicative of the at least one pair of electrodes being at least partially open based on at least one of the impedance exceeding the impedance threshold or the change in impedance exceeding the change in impedance threshold. |
US10512498B2 |
Apparatus and methods for treating rhinitis
Apparatus and methods for treating conditions such as rhinitis are disclosed herein where a distal end of a probe shaft is introduced through the nasal cavity where the distal end has an end effector with a first configuration having a low-profile which is shaped to manipulate tissue within the nasal cavity. The distal end may be positioned into proximity of a tissue region having a post nasal nerve associated with a middle or inferior nasal turbinate. Once suitably positioned, the distal end may be reconfigured from the first configuration to a second configuration which is shaped to contact and follow the tissue region and the post nasal nerve may then be ablated via the distal end. Ablation may be performed using various mechanisms, such as cryotherapy, and optionally under direct visualization. |
US10512495B2 |
Method for fabricating medical device and applications thereof
A method for fabricating a medical device includes steps as follows: A degradable powder including at least one metal element is firstly provided on a target surface. A focused energy light bean is applied to sinter/cure the biodegradable powder within an oxygen-containing atmosphere; wherein the oxygen concentration of the oxygen-containing atmosphere is adjusted to provide a first oxygen concentration and a second concentration when the focused energy light is driven to a first location and second location of the target surface respectively. The aforementioned processes are then repeatedly carried out to form a three-dimensional (3D) structure of the medical device. |
US10512491B2 |
Surgical assembly for placing a pedicle-screw cap
The invention relates to a surgical assembly which comprises: a cap (2) comprising an outer thread (2c) and a central recess for inserting a screw bit; a cap-holder in the form of a hollow sleeve (10) comprising a connection end (11) for connecting with the cap (2), and a locking pin (15) slidably mounted in the hollow sleeve (10) between a neutral position and a locking position of the cap; the cap (2) comprises at least two diametrically opposed radial notches (7), arranged away from an outer side wall of said cap (2), each of the notches (7) comprising at least one side groove (8); the connection end (11) is extended longitudinally by two diametrically opposed lugs (12) capable of being inserted into the notches (7) and each including a side shoulder (12a) which complements the groove (8) of the notch (7) capable of being inserted into said groove in order to lock the sleeve (10) axially onto the cap. |
US10512490B2 |
Device and method for correcting a spinal deformity
A method for correcting a spinal deformity is provided. A spinal implant for correcting a spinal deformity includes a multipoint connector that connects to at least one vertebra of a spine at a plurality of locations and a force directing device that applies a force to the vertebra through the multipoint connector. The force directing device may include a rod which extends generally along an axis of the spine and a force directing member which is adjustably coupled to both the rod and the multipoint connector and which applies a corrective force to the at least one vertebra. |
US10512482B2 |
System and method for scoring the left ventricular endocardium to increase left ventricular compliance
In some embodiments, a system for scoring human endocardium tissue may include a first conduit and an activation system. The first conduit may include a first opening, a second opening, and a cutting device. The first opening may be positioned at a proximal end of the first conduit. The second opening may extend from adjacent to a closed distal end portion of the first conduit. The cutting device, when activated, may cut through a portion of a depth of endocardium tissue positioned adjacent the second opening. The cutting device may selectively cut or score the endocardium to a specified depth and length in the endocardium of a left ventricle of a human heart. |
US10512480B2 |
Tools for a tongue manipulation system
A connection tool for a tongue manipulation system includes a connector configured to be coupled to a tongue advancer tether, a connection tool body, and a separable removal cannula part. The separable removal cannula part is configured to follow a tongue advancer tether line in order to enable a removal sleeve located at least partially within the separable removal cannula part to contact the tongue advancer. The separable removal cannula part is configured to be separated from the connection tool body following the removal sleeve contacting the tongue advancer and to expose a proximal end of the removal sleeve. |
US10512479B2 |
Axial lengthening thrombus capture system
Systems and methods can remove material of interest, including blood clots, from a body region, including but not limited to the circulatory system for the treatment of pulmonary embolism (PE), deep vein thrombosis (DVT), cerebrovascular embolism, and other vascular occlusions. |
US10512478B2 |
Clot-engulfing mechanical thrombectomy apparatuses
Mechanical thrombectomy systems including an elongate catheter configured as an elongate inversion support, a flexible tractor configured to roll and invert over the distal end of the elongate inversion support, and a clot engaging member on the distal end of an elongate manipulator are described herein. These systems may capture a clot using the clot engaging member and draw the clot and clot engaging member and roll the flexible tractor into the catheter to remove the clot and clot engaging member from a vessel. |
US10512475B2 |
Cross pinning guide devices and methods
Methods and devices are provided for implanting a cross-pin through a bone tunnel, such as in an arthroscopic surgical procedure. In general, the methods and devices allow a cross-pin hole to be formed in a medial side of a knee bone such that it intersects a bone tunnel formed in the knee bone. In one embodiment, a cross-pinning guide device is provided that can be configured to angularly position the cross-pin hole relative to the bone tunnel to allow the cross-pin hole to intersect the bone tunnel without passing through another side, e.g., a lateral side, of the knee bone. The knee bone can be a femur or a tibia such that the cross-pin hole and the bone tunnel can each be entirely formed in the femur or in the tibia. |
US10512473B2 |
Surgical tool
A hand-held surgical tool having at least one pad of vibration-absorbent material thereon, the pad being of hydrophobic polyurethane foam made from a polyol and isocyanate composition in which the weight ratio of polyol to isocyanate is from 2.5:1 to 1.5:1. Also a hand-held surgical tool having at least one pad of vibration-absorbent material thereon, the pad having an irrigation duct therethrough connected to means for supplying irrigation fluid to the duct. Also a pad for a hand-held surgical tool, wherein the pad has an irrigation duct therethrough connected to means for supplying irrigation fluid to the duct. |
US10512472B2 |
Surgical cutting instruments
Surgical cutting instruments and methods of use are described. The surgical cutting instrument (100) comprises an instrument body (102) with a first attachment mechanism (106) at a distal end. A cutter (104) has a central core (110), a plurality of cutting formations (130, 136) and a plurality of lobes (112, 114, 116) extending from the central core. The central core has side walls (118, 120, 122) which define an entirely open mouth and the side walls include a second attachment mechanism (140, 142, 144) which can interact with the first attachment mechanism to releasably attach the cutter to the distal end of the instrument body. At least one cutting formation (136) is provided on an end outer face (138) of the cutter opposite the entirely open mouth. |
US10512470B1 |
Osteotomy procedure for correcting bone misalignment
An osteotomy procedure may be performed to correct a misalignment of a bone, such as a bunion deformity. In some examples, the osteotomy procedure involves making a first crescentic-shaped cut transecting a first metatarsal, thereby forming a concave-shaped end and a convex-shaped end on opposed bone portions. The method further involves making a second crescentic-shaped cut across the concave-shaped end of one bone portion and thereafter moving the bone portions relative to each other in multiple planes to correct an anatomical misalignment. |
US10512467B2 |
Motor driven rotary input circular stapler with modular end effector
A surgical stapling device comprises a handle assembly, a shaft assembly, and a stapling head assembly. The shaft assembly comprises a rotary drive shaft that translates between two longitudinal positions to alternate between a tissue clamping mode and a tissue cutting/stapling mode. The stapling head assembly includes a first set of rotary drive elements that convert rotary motion of the drive shaft into a tissue clamping action when the drive shaft is in a distal position. The stapling head assembly also includes a second set of rotary drive elements that convert rotary motion of the drive shaft into a tissue cutting/stapling action when the drive shaft is in a proximal position. The drive shaft may be driven manually or by a motor. The stapling head assembly may be provided in a cartridge form that is removable from the shaft assembly. |
US10512466B2 |
Adapter assembly for surgical device
An adapter assembly for connecting an end effector to a surgical instrument includes first and second drive assemblies configured for converting rotational motion into linear motion, and an actuation assembly. The second drive assembly includes a pair of push/pull cables for longitudinally advancing and retracting a drive member. |
US10512460B2 |
Surgical method and system for performing the same
A system (10) including an helicoidal member (16); an elongated guide (26) positionable at least partially through the helicoidal member (16) along the longitudinal axis of helicoidal member (16), the guide (26) defining a longitudinally extending peripheral surface cooled portion (32); a cooling subsystem (33) for cooling the peripheral surface cooled portion (32); and a driver (34) for mounting the helicoidal member (16) thereto and rotating the helicoidal member (16) along the helicoidal member longitudinal axis while allowing the helicoidal member (16) to advance along the guide (26) in a distally oriented direction. |
US10512455B2 |
Apparatus and methods for sealing a vascular puncture
Apparatus and methods for sealing a puncture through tissue includes an introducer sheath sized for introduction into a puncture, cartridge sized for insertion into the introducer carrying a sealant, and a locking element for coupling the introducer sheath to the cartridge. When the cartridge is advanced into the introducer sheath, the locking element couples the introducer sheath to the cartridge such that subsequent retraction of the cartridge causes the introducer sheath to retract, thereby deploying the sealant from the cartridge within the puncture beyond the introducer sheath. |
US10512454B2 |
Needle and snare guide apparatus for passing suture
A trocar wound closure system includes a suture passing needle and a guide for directing the needle through the wound site. A distal portion of the needle includes a capture rod with a slot. An obturator tube with a cutout section can be axially actuated to align the cutout section with the slot, and then moved out of alignment so as to capture the suture. The guide includes at least two tracks for directing the needle through the tissue track. A snare loop is located adjacent to the exit of each track, and configured to be actuated from a radially extended configuration to a retracted configuration so as to capture the suture section inserted through each loop. Radially expandable arms at distal section are movable between an expanded configuration and a slender configuration. |
US10512452B2 |
Tissue characterization in medical diagnostic ultrasound
For estimating attenuation in ultrasound imaging, displacements at different locations along an acoustic radiation force impulse (ARFI) beam are used measured. The on-axis displacements and displacements from a phantom using a same ARFI focus as a reference are used to cancel out focusing effects. A single ARFI beam may be used to estimate the attenuation for a location. |
US10512450B2 |
Shear wave estimation from analytic data
Shear wave characteristics are estimated from analytic data. Measures of displacement are converted into complex representations. The magnitude and/or phase components of the complex representation may be used for estimating various characteristics, such as velocity, center frequency, attenuation, shear modulus, or shear viscosity. The zero-phase of the phase component represents an occurrence of the shear wave at that location. |
US10512447B2 |
Probe holding table and medical device
The disclosure provides a probe holding table and a medical equipment. The probe holding table comprises a faceplate and a fixing plate for supporting the faceplate. The faceplate is rotatably connected to the fixing plate. A plurality of probe placement units for installing probes are disposed on the faceplate, and each of the probe placement units is in electrical communication with an external power. The user may turn the faceplate to take the probes on the corresponding position, in particular, when more probes need to be used, the structure of the probe holding table is simpler than the normal fixed table, and easier to take the probes. Therefore, the medical equipment adopted the above probe holding table provides with the above advantages. |
US10512444B2 |
Ultrasonic color flow map for analysis of mitral regurgitation
An ultrasonic diagnostic imaging system is described which assesses regurgitant flow through a mitral valve by color-flow imaging. A Doppler processor produces Doppler velocity measurements of blood flow around a regurgitant valve to identify an iso-velocity surface to be used in the PISA method of regurgitant flow quantification. The velocity measurements are used to color pixels in the colorflow image and are mapped to a plurality of colors for a color bar used with the image. The color bar exhibits distinct color transitions at one or more velocities in the velocity range of the color bar which distinctively identify an iso-velocity surface in the colorflow image. The color bar may be formed with an aliasing velocity in the middle of the bar, between a zero velocity reference color of the bar and an end of the bar, and the aliasing velocity aligned with a desired iso-velocity and used to create the color transition. |
US10512440B2 |
Radiography system, image processing method, and image processing program
A radiography system includes: a radiography apparatus including a first radiation detector and a second radiation detector which is provided so on a side of the first radiation detector from which the radiation is transmitted and emitted, and a grid that is configured to remove scattered radiation included in the radiation transmitted through a subject; and an acquisition unit that is configured to acquire, using the grid, a first radiographic image captured by the first radiation detector and a second radiographic image captured by the second radiation detector; and a removal unit that is configured to detect and remove a first grid image, which is an image of the grid, from the first radiographic image acquired by the acquisition unit, and to remove the image of the grid from the second radiographic image acquired by the acquisition unit, using the first grid image. |
US10512437B2 |
Tomography apparatus and method of reconstructing tomography image thereof
A tomography apparatus that may reduce partial scan artifacts includes: a data acquirer configured to acquire tomography data when X-rays are emitted as a cone beam to an object while rotating by one cycle angular section that is less than one rotation; and an image reconstructor configured to reconstruct a tomography image by using corrected tomography data that is obtained by applying to the tomography data a weight that is set based on at least one of a view that is included in the one cycle angular section and a cone angle in the cone beam. |
US10512433B2 |
Correction data generation method and correction data generation apparatus
Provided is a correction data generation method that includes acquiring captured image data by imaging an indicator that is related to a predetermined illness; plotting a real imaging data point that corresponds to the acquired captured image data in a predetermined color space that is associated with the predetermined illness in accordance with a color component of the data point; calculating a correction value for correcting the values of pixels that make up a captured image captured by an electronic endoscope based on the distance between the data point and a predetermined target point in the predetermined color space; and storing the calculated correction value. |
US10512430B1 |
Animal health tracking assembly
An animal health tracking assembly for tracking the physiological condition of an animal includes a collar that is wearable around a neck of an animal thereby placing the collar in physical contact with the animal. A control circuit is coupled to the collar and an electronic memory is coupled to the collar for storing a database. An allergen detector is coupled to the collar for detecting airborne allergens thereby tracking the animal's exposure to the airborne allergens. The allergen detector is electrically coupled to the control circuit and the control circuit communicates an identity of the airborne allergens to the electronic memory for storage in the database. In this way the electronic memory can track all of the airborne allergens to which the animal was exposed. |
US10512429B2 |
Discrimination of cheyne-stokes breathing patterns by use of oximetry signals
Methods and apparatus provide Cheyne-Stokes respiration (“CSR”) detection based on a blood gas measurements such as oximetry. In some embodiments, a duration, such as a mean duration of contiguous periods of changing saturation or re-saturation occurring in an epoch taken from a processed oximetry signal, is determined. An occurrence of CSR may be detected from a comparison of the duration and a threshold derived to differentiate saturation changes due to CSR respiration and saturation changes due to obstructive sleep apnea. The threshold may be a discriminant function derived as a classifier by an automated training method. The discriminant function may be further implemented to characterize the epoch for CSR based on a frequency analysis of the oximetry data. Distance from the discriminant function may be utilized to generate probability values for the CSR detection. |
US10512426B2 |
Biological information acquisition device and biological information acquisition method
A storage unit stores a cumulative light emitting frequency or a cumulative light emitting time of a light emitting element. In a case where the cumulative light emitting frequency is greater than a predetermined light emitting frequency or the cumulative light emitting time is longer than a predetermined light emitting time, a control unit causes the light emitting element to emit light toward a living body by increasing the light emitting frequency or the light emitting time at which the light emitting element emits the light in order to acquire a light receiving result once, compared to a setting light emitting frequency or a setting light emitting time. A light receiving unit acquires information of the living body, based on a light receiving result obtained by receiving the light which is emitted toward the living body and transmitted through the living body. |
US10512422B2 |
Location detection systems and methods
A location detection system identifies the locations of medical devices such as patient support apparatuses and/or patient care devices within a medical facility. The devices communicate via a wired connection to one or more medical facility systems (e.g. nurse call system, computer network, etc.), and/or via a wireless connection to such systems. The location detection system automatically determines location information of the devices and communicates the location information so that the recipient of any outgoing alerts and/or other information sent from the devices is apprised of the location of the particular device sending the alert or other information. Caregivers are thereby able to respond to the correct location of an alert, and software systems such as EMR systems, admission discharge and transfer (ADT) systems, etc. are able to correlate transmitted device data with the location and/or patient assigned to that location. |
US10512416B2 |
Estimation of blood flow rates
Disclosed are various embodiments for estimating the flow of blood through a blood vessel in a region of interest. Passage of a bolus of fluid through an imaged blood vessel over a period of time is tracked by a computing device. The computing device fits the tracked passage of the bolus of fluid to a modeled passage of the bolus of fluid. The computing device then estimates a volume of blood flow through the imaged blood vessel based at least in part on a fit of the tracked passage of the bolus of fluid to the modeled passage of the bolus of fluid. |
US10512415B2 |
Multi-phase flow decomposition using electrical capacitance volume tomography sensors
The present invention provides a system and method for multi-phase flow decomposition using electrical capacitance imaging techniques. The present invention provides a system and method to obtain permittivity distributions at a plurality of frequency markers using volume tomography image reconstruction to determine volume fraction of each phase and to produce images of the volume fraction for each phase. |
US10512411B2 |
Brain mapping system and method thereof
A brain mapping system includes a brain signal acquisition device for collecting brain signals corresponding to different locations of the brain, a stimulator for generating a stimulus based upon a pseudorandom sequence, and a processor for segmenting the brain signals into a plurality of epochs and correlating features extracted from the epochs with the pseudorandom sequence to generate correlation functions, wherein a brain map is constructed by the correlation functions. |
US10512408B2 |
System and method for characterizing circulatory blood flow
A computer-implemented method for characterizing circulatory blood volume is disclosed. The method has the steps of acquiring a biological signal that emulates the arterial pulse wave from a sensor. Two derived parameters, circulatory stress, which reflects a harmonic of heart rate, and circulatory blood flow, which reflects the amplitude of the unprocessed biological signal, are extrapolated from the biological signal, and are each compared to a threshold value and assessed to determine an adequacy of circulatory blood volume. In embodiments, the assessment of circulatory blood volume is used to manage a patient's cardiovascular autoregulatory function or the adequacy of transfer of fluids to and from the circulatory system, with the ultimate goal of achieving a circulatory blood volume that adequately supplies the demands of the patient's tissues and organs. |
US10512406B2 |
Systems and methods for determining an intensity level of an exercise using photoplethysmogram (PPG)
Disclosed systems and methods relate to determining an intensity level of an exercise using a photoplethysmogram (PPG) sensor. A method of determining an intensity level of an exercise for a user according to one embodiment of the present disclosure includes detecting, by a device, body signals from the user using a PPG sensor. The method includes determining, by the device, a heart rate of the user based on the body signals. The method includes determining, by the device, an error in the heart rate. The method also includes determining, by the device, the intensity level of the exercise for the user based at least on the error. |
US10512396B2 |
Ocular tear film peak detection and stabilization detection systems and methods for determining tear film layer characteristics
Ocular surface interferometry (OSI) devices, systems, and methods are disclosed for peak detection and/or determining stabilization of an ocular tear film. Embodiments disclosed herein also include various image capturing and processing methods and related systems for providing various information about a patient's ocular tear film (e.g., the lipid and aqueous layers) and a patient's meibomian glands that can be used to analyze tear film layer thickness(es) (TFLT), and related characteristics as it relates to dry eye. |
US10512394B2 |
Endoscopic-enabled mouth gag and associated method of use
The present invention discloses a new and improved endoscopic-enabled mouth gag for routine ENT procedures, such as adenoidectomy and nasopharyngeal biopsy. The invention modifies the existing mouth gag, provides a stable and adjustable placement for an endoscopic device potentially employed during an ENT procedure, and is to replace the outdated surgical method where the surgical field is visualized indirectly via a handheld mirror (with or without the preexisting mouth gag). The inventive endoscopic-enabled mouth gag not only provides enhanced visualization of the surgical field for a clinician, assistants, and trainees, but also enables a clinician to perform the procedure bimanually (with both hands). |
US10512391B2 |
Flexible-rigid hybrid endoscope and instrument attachments
The disclosure describes a flexible-rigid hybrid design for an endoscope and attachment mechanisms for removably coupling and decoupling the endoscope to a handle portion and/or a tool portion of a variety of different instruments. Some implementations describe designs for instruments that may be coupled to the flexible-rigid endoscope described herein or other endoscopes. Such instruments may include sinus and laryngeal forceps, a laryngeal syringe gun, an endoscopic Eustachian tube balloon dilator, an endoscopic tracheal dilator, and an endoscopic trans-oral esophageal balloon dilator. Some implementations describe an endoscope that may be removably coupled to a portable control box using a connector cable. |
US10512389B2 |
Image processing device, image processing method, and endoscope system
The present technology relates to an image processing device, an image processing method, a program, and an endoscope system that can reduce a burden on a user. A parallax amount adjustment unit adjusts the parallax amount of a three-dimensional (3D) biological image of an imaged living organism, depending on whether the parallax of the 3D biological image puts a burden on a user. The present technology can be applied to an endoscope system or the like that captures an image of a living organism with an endoscope, for example. |
US10512386B2 |
Dishwasher appliance and filter
A dishwasher appliance includes a tub defining a wash chamber with a sump positioned at a bottom of the wash chamber for receiving fluid from the wash chamber. A filtering system is positioned between the wash chamber and an outlet of the sump portion. The filtering system includes a first filter and a second filter. The second filter includes a hollow annular base portion and a filter body extending between the base portion and the first filter. The second filter also includes a plurality of nozzles circumferentially arranged about the hollow annular base portion, each nozzle of the plurality of nozzles in fluid communication with the hollow annular base portion and oriented towards the filter body for cleaning the filter body. An inlet in fluid communication with the hollow annular base portion may also be provided. |
US10512381B2 |
System comprising a vacuum cleaner and a base station, vacuum cleaner, base station, and method for emptying a dust chamber of a vacuum cleaner
A system comprising a vacuum cleaner and a base station, wherein the vacuum cleaner has a suction opening for sucking up dirt and/or dust from a floor by a suction air flow, a fan for producing the suction air flow, a dust chamber for holding dirt and/or dust, and an air outlet opening such that air sucked in together with the dirt and/or dust can be discharged again. The base station can be connected to the vacuum cleaner in such a way that the dust chamber can be emptied into the base station by means of an air flow. The air flow used to empty the dust chamber can be produced and blown into the dust chamber by the fan for producing the suction air flow. The base station has a return channel, through which the air flow exiting the dust chamber can be guided back into the vacuum cleaner. |
US10512372B2 |
Toilet accessory holder
A toilet system includes a toilet accessory and an accessory holder means. The toilet accessory is adapted for use with a toilet. The toilet accessory includes a head and a grip sized to be held in the hand of a user. The accessory holder means is configured to mount the toilet accessory to a water tank of the toilet. |
US10512369B2 |
Toilet paper roll holder attachment system
A toilet paper roll holder attachment system is disclosed for supporting the holding of at least two toilet paper rolls in either horizontal or vertical configuration or for supporting the holding of large or jumbo toilet paper rolls. The toilet paper roll holder attachment system has a hollow cylindrical body with two substantially round apertures which are adapted for holding a toilet paper roll spindle. There is a vertical support arm or support bracket extending perpendicularly downward from the hollow cylindrical body. At the lower end of the vertical support arm or support bracket is a horizontal rod for holding the toilet paper rolls. There is(are) stopper(s) at the end(s) of the horizontal rod for the purpose of preventing the toilet paper rolls from sliding out of the horizontal rod. |
US10512367B2 |
System for washing and treating newborn infants
A system for washing and treating infants includes components for keeping an infant under controlled sterile and warm conditions. The system also includes a device for washing the infant, which has a support frame and a flexible laminar element adapted to be secured thereto. The frame and the laminar element define a housing for receiving the infant while he/she is being washed and/or treated. The housing is adapted to be introduced into the washing and treating components and is accessible from outside. The frame has a single-unit structure composed of tubular members made of a medical-grade sterilizable metal or non-metal material. |
US10512366B1 |
Multiple food ingredient dispensing device
Multiple food ingredient dispensing device that include a body having a dispensing opening and an internal orifice plate that supports a release mechanism. The device either includes a carousel unit on a central axle or a carrier that turns on a bearing. The carousel unit or carrier hold a plurality of ingredient pods that contain food ingredients, and which rotate relative to the body. Rotating the ingredient pods can cause a selected one to rotate over the release mechanism. The release mechanism can then cause a controlled volume of the food ingredient to fall from associated ingredient pod. Also included are a viewing window with measurement indicia and a measurement adjust knob that adjusts the amount that falls when the release mechanism is opened. A dispensing opening then allows the food ingredient to fall out of the dispensing device. |
US10512360B2 |
Temperature homogenization, protection, and grease guide structure of barbecue grill
Disclosed is a temperature homogenization, protection, and grease guide structure of a barbecue grill, including at least one burner, a grate, and a grease guide and temperature barrier board. The burner includes a heat generation section and is arranged in an inclined, upward-facing manner in a barbecue grill. The grate is arranged in a top opening of the barbecue grill. The grate includes ribs that are provided with at least one temperature homogenization protection section, which is located above and corresponds to the heat generation section. The grease guide and temperature barrier board is configured in an M-shape and is arranged below the burner. |
US10512357B2 |
Liquid flow control and beverage preparation apparatuses, methods and systems
Apparatuses, methods and systems for liquid flow control and beverage preparation are disclosed. The apparatuses, methods and systems of the present invention include liquid flow control and beverage preparation capsules, pods, cartridges, pouches, systems, and modules for controlling and directing flow streams of liquid through a beverage preparation process. The apparatuses, methods and systems of the present invention may be used in combination with or included as an integral assembly of any apparatus, method or system for liquid dispension. |
US10512356B2 |
Apparatus and method for controlling the taste of coffee, and a coffee maker comprising the apparatus
An apparatus for controlling the taste of coffee, a method of controlling the taste of coffee and a coffee maker including the apparatus. The apparatus includes a control unit, configured to determine a target pH value of water corresponding to a desired coffee taste, and a corresponding adjustment control signal; and a pH adjustment unit, configured to adjust, in response to the adjustment control signal applied to the pH adjustment unit, the pH value of water to be fed into a brewing unit of a coffee maker to the target pH value. In accordance with embodiments of the present disclosure, the pH value of water to be fed to a brewing unit of a coffee maker may be adjusted for a desired coffee taste. |
US10512354B2 |
Modular tree with electrical connector
A lighted artificial tree, including a first tree portion having a first electrical connector having a first electrical terminal positioned in line with a central vertical axis, and a second electrical terminal. The tree also includes a second tree portion that includes a second electrical connector having a first electrical terminal and a second electrical terminal, the second electrical terminal defining a ring shape that encircles the first electrical terminal. When the first tree portion is coupled to the second tree portion, the first electrical connector is coupled to the second electrical connector, such that the first electrical terminal of the first electrical connector is electrically connected to the first electrical terminal of the second electrical connector, and the second electrical terminal of the first electrical connector is electrically connected to the second electrical terminal of the second electrical connector. |
US10512349B2 |
Electric wine decanter
An electric wine decanter comprises a housing, an air pump, a spout, the retaining base and a control switch. The retaining base is provided with a vent hole for communicating with the air in the wine container and a wine guide tube for extending to a bottom of the wine container. The housing further includes a directional control valve therein for controlling an air flow switch of the air pump and a drive device for controlling the operation of the directional control valve. The directional control valve includes a valve body and a valve seat mounted to a bottom of the valve body. It is only necessary to install the electric wine decanter on the mouth of the wine container. By the opening and closing of the different valve mouths, the flow path of the air flow is changed to realize the functions of pressure-holding, vacuumizing and decanting. |
US10512347B1 |
Dual-dispensing lid
A dual-dispensing lid includes a pour orifice, a pour spout corresponding with the pour orifice, and a pour cap selectively detachable from direct contact with the pour spout. The pour cap seals the pour spout from fluid exiting the fluid container through the pour spout. The lid also includes a sip orifice and an elongated and resilient sip spout inserted through the sip orifice. A sip cap is selectively releasable from compression against the sip spout and selectively compressible against the sip spout in a manner that seals the sip spout from fluid exiting the fluid container through the sip spout. |
US10512346B2 |
Supporting base of drinking container
A supporting base of a drinking container is connectable with a bowl, wherein the bowl has an opening and an outer periphery circumferentially provided with an annular groove adjacent to the bottom side of the bowl. The supporting base includes a connecting portion, whose top and bottom ends are provided with a top portion and a bottom portion respectively. The top portion includes a coupling portion for coupling with the annular groove of the bowl. The bottom portion can be placed flat on a flat surface and has a bottom side concavely provided with an upwardly extending receiving room. The receiving room includes a positioning portion configured to press against and thereby secure in position the rim of the opening of the bowl. |
US10512344B2 |
Ventilation and temperature adjustment opening for sleeping bags
A sleeping bag with one more ventilation/temperature adjustment openings. The sleeping bag includes a length and width and the one more ventilation/temperature adjustment openings extend along a length of the front or upper side of the sleeping bag. A first more ventilation/temperature adjustment opening is located on a first side of a central opening access and a second more ventilation/temperature adjustment opening is located on a second side of the central opening access. Each more ventilation/temperature adjustment openings includes a fastening mechanism that when opened, a crevice is formed in the outer layer and insulative material of the sleeping bag, allowing the sleeping bag to vent better, thereby cooling an occupant of the sleeping bag and offering temperature regulation. |
US10512342B2 |
Apparatus for moving articles
Apparatus for moving articles comprising a conveyor member, a shelf provided with a guide cavity defining at least partly a movement path and a drive unit associated with the conveyor member and configured to move the conveyor member along the movement path. The conveyor member is provided with a support zone, a drawing zone, and an intermediate zone. |
US10512341B2 |
Museum showcase having drawers with a motorized actuation system
This showcase (10) for conserving and displaying objects in a protective environment comprises a frame (20), at least one drawer (30), a pair of sliding guides (40) for each drawer (30), and a motorised actuation system (50) formed by a first arm (51) and an actuator (52). The showcase (10) with this motorised actuation system (50) makes it possible to minimise the vibrations and the sudden movements of the drawers (30) when opening and closing, hence it limits accelerations at any point of the travel, thus allowing the correct conservation of the objects displayed in the drawers (30). |
US10512340B2 |
Pocketed spring assembly comprising strings of springs with tabs
A pocketed spring assembly comprises a plurality of parallel strings of springs held together with tabs. Longitudinal seams joining overlapping tabs extend generally the same direction as the strings of springs. Pockets are formed along a string of springs by aligned separating seams. At least one spring is positioned in each pocket. Each separating seam joins opposed plies of the string and keeps the spring in its pocket. Ends of aligned separating seams are spaced from each other, thereby improving airflow between pockets. |
US10512339B2 |
Electric support system for headrest
An electric support system for headrest includes a linear drive device and at least one connecting rod assembly. The connecting rod assembly includes a first fastener, a second fastener, a first connecting rod, a second connecting rod, a curved third connecting rod, and a curved fourth connecting rod between the two fasteners. The linear drive device is connected to the first fastener. An output end is connected to the third connecting rod and movable to drive the connecting rod assembly to expand to make the second fastener to a topmost position where an middle part of the third connecting rod coincides with the fourth connecting rod, or drive the connecting rod assembly to fold to make the second fastener to a bottommost position. Thus, the connecting rod assembly will be hidden between the sofa body and the headrest, which makes sofa more beautiful and in line with consumer aesthetic. |
US10512338B1 |
Furniture assembly with metal seat stretcher
A metal seat stretcher that is configured for easy mounting to the seat box, and furniture items including the same. The disclosed stretcher may be mounted in such a way so as not be directly mounted to the forward or rearward rails, thus preserving the strength and integrity of the rails by not subjecting them to perforation from a multitude of staples. Instead, the front end of the metal seat stretcher mounts to a clip rail that is secured to the inside of the front rail, and back end of the stretcher is secured to a seat back upright. In some embodiments, securing of the disclosed seat stretcher is done with a single screw at the front end and a single self-tapping bolt at the back end (though more fasteners may also be utilized). This provides for rapid and easy assembly of the furniture item. |
US10512337B2 |
Sofa bed
A sofa bed includes a mattress frame, a back frame, two arm frames and two cross beams, two arm frames are connected by the two cross beams, wherein the mattress frame and the back frame are rotatably pivoted. The inner side of the arm frame is disposed with a linking mechanism. The linking mechanism has a front connecting piece, rear connecting piece and a bridge connecting piece. Two ends of the bridge connecting piece are respectively pivoted to the front connecting piece and the rear connecting piece. The bottom end of the front connecting piece is pivoted to the arm frame. The bottom end of the rear connecting piece is pivoted to the arm frame. The linking mechanism has a front connecting piece, rear connecting piece and a bridge connecting piece. |
US10512334B1 |
Furniture height adjustment device
A height adjustment device used on furniture includes an inner tube having multiple clamp portions and multiple contact portions extending from the inner periphery thereof. Multiple grooves are defined in the outer periphery of the inner tube. A pneumatic tube is inserted into the inner tube and clamped by the contact portions. The inner tube is located in an outer tube that has a bottom cap and a top cap. Multiple ridges extend from the inner periphery of the outer tube. Each reduced opening accommodates the ridge corresponding thereto. The pneumatic tube has a piston rod and is connected to the bottom cap of the outer tube. The piston rod drives the inner tube to move relative to the outer tube. Multiple roller units are connected to ridges and roll the grooves of the inner tube to reduce friction between the inner tube and the outer tube. |
US10512332B2 |
Recliner and legrest mechanism for a furniture member
A furniture member may include a stationary base frame, a seat bottom frame, a seat bottom cushion, a seatback frame, and a seatback cushion. The base frame may include a forward support, an aft support, and a pair of armrests that extend between the forward support and the aft support. The forward, aft and lateral supports are stationary and fixed relative to each other. The seat bottom frame may be supported by the base frame. An upper end of the seatback frame may be pivotably coupled to the aft support such that the seatback frame is rotatable relative to the aft support and the seat bottom frame between a first position and a second position. A lower end of the seatback cushion has a greater range of motion than an upper end of the seatback cushion when the seatback frame moves between the first and second positions. |
US10512330B2 |
Furniture member with compliant legrest mechanism
A legrest mechanism including a seat base rail, a mechanism rail, a drive assembly, a pivot plate link, a pivot plate, a main drive link, and a parallelogram legrest link assembly. The drive assembly moves the mechanism rail relative to the seat base rail, which drives movement of the parallelogram legrest link assembly between a retracted position and an extended position. The parallelogram legrest link assembly includes first and second legrest links, footrest and legrest drive arms, and a legrest bracket. The main drive link has a pin that is slidingly received in a slot in one of the first legrest link, second legrest link, or main drive link such that movement of the parallelogram legrest link assembly is decoupled from movement of the main drive link when the legrest and/or parallelogram legrest link assembly encounters an obstruction while moving from the extended position to the retracted position. |
US10512326B2 |
Stackable storage rack
A stackable storage rack, which includes a base with multiple sockets for connecting a respective pair of vertical support members in a manner that permits multiple storage racks to be stacked on-site with their respective vertical support members attached and in a standard shipping container without their respective vertical support members attached. The storage rack also maximizes the storage capacity in a standard shipping container when it is loaded in a standard shipping container with its vertical support members attached. |
US10512324B2 |
Scrubbing brush head assembly
A scrubbing brush head assembly for cleaning an animal includes a shell. A wall coupled to the shell defines an upper chamber and a lower chamber. A pipe is coupled to the shell and is in fluidic communication with the lower chamber. A connector is configured to couple the pipe to a water source. A valve is configured to control a flow of water. A regulator fluidically couples the upper chamber to the lower chamber and the pipe. Tubes extend from a bottom of the shell and are in fluidic communication with the lower chamber. An actuator selectively actuates the regulator to fluidically couple the upper chamber to the lower chamber and the pipe. The water is partially directed to the upper chamber to dispense shampoo from the upper chamber to the lower chamber. The tubes direct the shampoo and the water to a body of an animal. |
US10512323B2 |
Oral care implement
A toothbrush includes a handle and a head mounted to the handle. In one aspect, the head may extend from a proximal end to a distal end along a longitudinal axis, the head having a base portion formed of a rigid plastic material and a flexible portion formed of an elastomeric material, a first longitudinal section of the flexible portion spaced apart from the base portion by a gap. The flexible portion of the head may have an upper surface and an opposing lower surface such that within the first longitudinal section of the flexible portion the upper surface and the lower surface are substantially planar and parallel to one another. Furthermore, tooth cleaning elements may be secured to the flexible portion of the head by in-molded technology to extend from the upper surface of the flexible portion. |
US10512317B2 |
Mobile device containing bag
Disclosed is a mobile device containing bag having a flat first baffle member and a flat second baffle member extending in parallel. A connector is configured to connect opposite edges of the first and the second baffle members together, so that a mobile device accommodation space is defined by the first baffle member, the second baffle member, and the connector. The mobile device containing bag can effectively prevent mobile device from vibrating or shaking in the mobile device accommodation space. |
US10512312B2 |
Slider for slide fastener
A slider may include a slider body, a pull-tab attachment portion provided at the slider body, and a resin-made pull tab attached to the pull-tab attachment portion. The pull tab may include an axial portion and a pair of bars extending from respective ends of the axial portion. The pull-tab attachment portion may include a pair of claws that axially support the axial portion of the pull tab. Each claw may be held by and between the respective paired bars while the pull tab pivots. A width of a terminal end of each claw in an axial direction of the axial portion may be less than a width of a base end of each claw in the axial direction. |
US10512310B2 |
Noise dampening tongues for use in a seat belt restraining system and methods of making the same
A noise dampening tongue assembly for use as part of a seat belt restraining system includes a base plate, a cover material, and a soft touch material. The base plate has a surface with a lower portion for engagement with a clamping member and an upper portion with a slot through which a belt webbing extends. The lower portion defines a bottom perimeter for the tongue assembly. The cover material contacts the base plate, such that it defines at least a portion of a top perimeter, a front-side, and a back-side of the tongue assembly. The soft touch material contacts the surface of the cover material, such that the soft touch material defines at least a portion of a right perimeter and left perimeter of the tongue assembly and extends horizontally across the surface of the cover material to connect the soft touch material located at right and left perimeters. |
US10512306B2 |
Sole structure with visual effects
A multi-colored effect for a sole structure for an article of footwear is disclosed. The sole structure comprises a sole member having a first color and an exterior layer having a second color that is different from the sole member. A plurality of slots are formed in the sole structure and the second color is visible on an outer surface of the sole structure through the plurality of slots. |
US10512304B2 |
Lace adjuster with interchangeable covers
A lace adjuster (14) includes an adjuster assembly (16); and a first cover (18) that is selectively attachable to the adjuster assembly (16). The first cover (18) is selectively movable between (i) an attached position, wherein the first cover (18) is attached to the adjuster assembly (16), and (ii) a detached position, wherein the first cover (18) is detached from the adjuster assembly (16). The first cover (18) can be moved between the attached position and the detached position without damaging the first cover (18) and the adjuster assembly (16). Additionally, the lace adjuster (14) can further include a second cover (18) that is alternatively, selectively attachable to the adjuster assembly (16). |
US10512301B2 |
Cushioning assembly for an article of footwear
A cushioning assembly for an article of footwear includes a first bladder wall and a second bladder wall disposed opposite the first bladder wall. At least one of the first bladder wall and/or the second bladder wall defines a plurality of domes defining a fluid-filled cavity between the first bladder wall and the second bladder wall. The domes include a base portion defining a generally hemispherical segment having a base radius, and a cap portion defining a generally hemispherical cap having a cap radius. The cap radius is less than the base radius. The cushioning assembly may include a load distribution structure positioned adjacent the cap portions of the domes to distribute an applied load across the domes. |
US10512296B2 |
Article of footwear incorporating a trimmed knitted upper
An upper for an article of footwear associated with one of a first foot size and a second foot size. The upper includes a knitted component including a trim region that defines a trimmed outer edge of the knitted component. The trimmed outer edge is associated with a first dimension of the upper that corresponds to the first foot size, and the trim region includes a trim line that is spaced from the trimmed outer edge in an inboard direction on the knitted component. The trim line defines a second dimension of the upper that corresponds to the second foot size. The second foot size is smaller than the first foot size. The knitted component includes a knit element having a first layer and a second layer. |
US10512288B2 |
Male undergarment with self-adjusting pouch
Disclosed is a male undergarment that has an expandable pouch. The pouch expands as needed depending on the male's genitalia. The pouch has a horizontal elastic band one and two-third inches below the garment's waistband which enables the pouch to adjust as needed. This horizontal elastic band is to be a half an inch long and one cm width depending on the size of the pouch. This pouch also has a four technique fold of material to increase comfort in the pouch. The two components combined creates a pouch that expands to the male's need. |
US10512287B2 |
Smoking article for selective delivery of an aerosol precursor composition, a cartridge, and a related method
A smoking article for on-demand delivery of an increased quantity of an aerosol precursor composition, a cartridge, and a method are disclosed. In some aspects, the cartridge includes a housing, and a reservoir disposed within the housing and defining two or more chambers each having an aerosol precursor composition therein. The reservoir is in fluid communication with an aerosol forming arrangement configured to form an aerosol from any of the aerosol precursor compositions, with the respective aerosol precursor compositions of the two or more chambers being directed to the aerosol forming arrangement in substantially equal normal quantities. The cartridge further includes an actuator configured to selectively and operably engage any one of the chambers and to direct an increased quantity of the aerosol precursor composition from the chamber engaged therewith to the aerosol forming arrangement, the increased quantity being greater than the normal quantity of the aerosol precursor compositions. |
US10512280B2 |
Method and apparatus for shaping substantially flat continuous material
The apparatus for shaping substantially flat continuous material comprises a shaping device (500) for gathering substantially flat continuous material transverse to a longitudinal direction of the continuous material to form a gathered continuous material. The apparatus further comprises a cooling device (75) for cooling the gathered continuous material. The shaping device and the cooling device are combined such as to immediately cool the gathered continuous material. |
US10512278B2 |
Inline mixing injector for liquid products
An apparatus for reducing the temperature of a liquid product in a processing line includes a polymer member having a passageway formed therein for receiving a liquid product in the passageway; an inlet and an outlet each in fluid communication with a corresponding opposed end of the passageway; a plurality of delivery channels formed in the polymer member, each one of the plurality of delivery channels having an opening in fluid communication with a different location of the passageway and constructed to provide a chilling medium into the passageway; and a support member for the polymer member, the support member constructed to mount the polymer member in the processing line. A related method is also provided. |
US10512275B2 |
Baked goods-like texture without baking
Compositions and methods for preparing a multi-texture, non-baked foodstuff having a first component with a first soluble solids ratio; and a second component with a second soluble solids ratio, wherein the second component is a non-baked foodstuff having at least 1% weight fraction of particulate matter having a particle size of about at least 100 μm, including at least one setting agent and at least one texture-modifying particulate ingredient and having a gel strength of about at least 100 and a liquid weight fraction of about at least 35%. |
US10512274B2 |
Apparatus for filling tubular cases
An apparatus for filling tubular cases with a pasty material, such as gathered sausage skin casings with sausage meat, is provided. The apparatus includes at least one filling tube, which is rotatable and drivable about its longitudinal axis and on to which a case which can be filled with the material can be pulled, a receiving portion at which the filling tube is rotatably received, and a drive unit for driving the filling tube. The apparatus advantageously includes a magnetic coupling for making and breaking an at least force-locking torque transmission between the drive unit and the filling tube, which has a drive rotor and a driven roller that is displaceable relative to the drive rotor in the longitudinal direction of the filling tube. Thus, the positioning during filling is reliable and performed with simplified structure. A filling machine including the apparatus is also provided. |
US10512271B2 |
Method for preventing or treating microbial growth on a manufactured product
The invention provides a method for preventing or treating microbial growth on a manufactured material or product. A composition comprising a cyclic decapeptide which is a tyrocidine, trypocidine, phenycidine or gramicidin S having an amino acid sequence of cyclo(valine-X1-leucine-D-phenylalanine-proline-X2-X3-X4-X5-X6) (SEQ ID NO: 1) is applied to the product and the cyclic decapeptides are adsorbed onto the product. Suitable products include medical devices (e.g. a catheter), wound dressings, food packaging, containers, wrappings, surfaces or devices used in the processing, transport or storage of food, filters, composites, paper, wrapping materials, walls, work surfaces, floors, pipes or the like. The composition could be used to disinfect or sterilise a material, surface or product or to inhibit formation of biofilms and/or biofouling on the surface of the product to which it is applied. |
US10512270B2 |
Acid tablet composition and methods of preparing and using the same
Compositions, tablets, prills and granules are provided including (a) about 95 to about 99.999 weight percent of at least one alkali metal hydrogen sulfate; and (b) about 0.001 to less than 0.08 weight percent of at least one alkali metal salt of a fatty carboxylic acid and/or at least one alkaline earth metal salt of a fatty carboxylic acid; wherein the composition includes less than 1 weight percent of chlorite and/or hypochlorite and less than 1 weight percent of alkali metal salt and/or alkaline earth metal salt that is chemically different from the at least one alkali metal hydrogen sulfate, the at least one alkali metal salt of a fatty carboxylic acid and the at least one alkaline earth metal salt of a fatty carboxylic acid, on a basis of total weight of the composition. Methods of use also are provided. |
US10512269B2 |
Herbicidal compounds
The present invention relates to herbicidal heteroaryl-alkyl-oxy-substituted heteroaryl/phenyl derivatives of formula (I), as well as to processes and intermediates used for the preparation of such derivatives. The invention further extends to herbicidal compositions comprising such derivatives, as well as to the use of such compounds and compositions in controlling undesirable plant growth; in particular the use in controlling weeds in crops of useful plants. |
US10512265B2 |
Pesticidally active heterocyclic derivatives with sulphur containing substituents
Compounds of formula (I) wherein the substituents are as defined in claim 1, and the agrochemically acceptable salts, stereoismers, enantiomers, tautomers and N-oxides of those compounds, can be used as insecticides and can be prepared in a manner known per se. |
US10512264B2 |
Herbicidal mixtures
The present invention provides a composition comprising (A) a compound of formula (I) wherein R1 is methyl, methoxy or chloro, R2 is methyl or chloro and A is a substituted heteroaryl group, or an N-oxide or salt form thereof, and (B) one or more further herbicides; as well as the use of such compositions in controlling plants or inhibiting plant growth. |
US10512263B2 |
Aqueous suspension agrochemical composition
An aqueous suspension agrochemical composition is provided containing fenpyrazamine and an acid component. The composition has no problem of emission of odor and has excellent storage stability. The composition has a pH at 25° C. in a range of 2.5 to 6.5. |
US10512261B2 |
Containers for liquid nitrogen storage of semen straws
Designs of improved canisters for animal semen straw storage in Dewars with cryogenic liquid are described. In some embodiments, the canisters include a layer of cryogen-absorbent material and an inner layer of thermally conductive material including apertures oriented and positioned to direct cryogen vapor into the interior of the container. |
US10512260B2 |
Method and apparatus for automated animal trapping
Methods and apparatuses are shown for selectively capturing a targeted animal that are directed to capturing an animal in a capture module having a one way capture mechanism and, using instructions executing in a controller, sensing the animal in an identification module and, responsive thereto, capturing an image of the animal, analyzing the captured image to identify whether the animal is a targeted animal, if the animal is the targeted animal, processing the animal, and releasing the animal. Additional examples involve performing chromatic or pattern analysis on the captured image, using the chromatic or patent analysis results, searching a database for machine recognized animal colors or patterns, generating a probabilistic assessment based on color or pattern of whether the animal in the identification module is the targeted animal, and generating a target determination indication based on the probabilistic assessment based on color or pattern. Processing the animal may include injecting the animal using a syringe. |
US10512258B2 |
Animal trap with animal entrance encouraging means
An animal trap features entrance encouraging mechanism for urging an animal into an enclosure of the trap. The mechanism features a pushing unit pivotally supported outside the interior space of the enclosure adjacent an access-way that opens into same. The pushing unit is pivotal about an axis generally parallel to a plane of the access-way for movement between a withdrawn position in which the access-way is unobstructed and a working position in which the pushing unit substantially obstructs the access-way. An actuator coupled to the pushing unit is triggered by an animal detection device at an approach area outside the enclosure within a travel path followed by the pushing unit, whereby the pushing unit urges the animal toward and through the access-way into the interior space of the enclosure. A one way gate prevents exit of the trapped animal after return of the pushing unit to the withdrawn position. |
US10512255B2 |
Furniture protector against crawling arthropods
A barrier device to prevent crawling arthropods such as bedbugs from accessing an item of furniture, said barrier device comprising a furniture riser, a deep fluid-filled moat, and a smooth wall around the moat. |
US10512254B2 |
Multi-function fishing tool
A multi-function tool includes a body, a clearing pin fastener, and a line holder assembly. The body includes a through-hole extending from a first surface to a second surface and defined by a threaded sidewall. The clearing pin fastener includes a head, a pointed end portion, and a threaded shank that is located between the head and the pointed end portion. The line holder assembly includes a line holder including a slit formed between a top portion and a bottom portion and configured to receive a line and a frame including a pair of opposing surfaces configured to hold the line holder in compression. The threaded shank is removably attached to the threaded sidewall so that the head is adjacent the first surface and the pointed end portion extends outward from the second surface. The line holder assembly is configured to rotate relative to the body about a pivoting axis. |
US10512253B2 |
DNA sequence that increases odorant receptor representation in the olfactory system
A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA. |
US10512251B2 |
Methods and compositions for inducing hygienic behavior in honey bees
The presently disclosed subject matter provides tritriacontene compositions for inducing hygienic behavior in honey bees; mite-infested brood extract compositions for inducing hygienic behavior in honey bees; methods of inducing hygienic behavior in honey bees; methods of selecting one or more honey bee(s) exhibiting hygienic behavior, and methods for assessing the degree of hygienic behavior within a honey bee colony. |
US10512248B1 |
Dog waste collection assembly
A dog waste collection assembly includes a handle that has a downward angle between a grip and a head. Thus, the head can be positioned beneath a dog when the dog is defecating and the grip being gripped. A pair of jaws is each pivotally coupled to the head. Each of the jaws is positionable between a closed and an open position. A pair of bag openers is each coupled to a respective one of the jaws and a bag can be positioned around each of the bag openers. An opening unit is movably coupled to the handle and the opening unit is in mechanical communication with the jaws. The opening unit urges the jaws into the open position when the opening unit is manipulated. Thus, the jaws open the bag for receiving the dog waste. |
US10512247B2 |
Systems and methods for a light-up object with enhanced features for animals
A light-up object includes a rubberized outer body; a plug in a cavity of the outer body; and a lighting device located in the plug. The light-up object further includes a first inner capsule piece, the first inner capsule piece located in the plug, and a second inner capsule piece located in the cavity of the outer body, the second inner capsule piece shaped to engage with the first inner capsule piece. The first and second inner capsules are threaded to fit together. The outer body includes grooves, running around multiple circumferences of the outer body. The outer body has a size of approximately a baseball; the outer body is shaped approximately like a sphere; and the grooves are at least 5 mm deep in the outer body. |
US10512246B2 |
Nail or claw trimmer for use with pets
An improved trimmer is structured to be held in the palm of a user's hand. The trimmer has a grinding drum that is advantageously structured to be situated in a palmar region of the user's hand that can be said to extend from the palm and to be generally bounded by the fingertips. When the trimmer is held in the palmar region, the thumb and certain fingers can support the trimmer, and other fingers that are not necessarily employed in supporting the trimmer are usable to operate a control switch of the trimmer. The control switch controls operation of a drive motor that is connected with a grinding drum which provides abrasive surfaces that are engageable with the animal nail or claw. |
US10512243B2 |
Automated cluster remover
A system includes a cylinder and a piston that moves within the cylinder from a retracted position to an extended position. A vacuum port facilitates application of a vacuum pressure to the cylinder that results in a vacuum force being applied to the piston, which causes the piston to move toward a top end of the cylinder to the retracted position. A spring member applies a spring force to the piston when the piston is in the retracted position. The spring force offsets at least a portion of the vacuum force. A sensor generates a displacement signal in response to detecting movement of the piston from the retracted position toward the extended position. A control unit receives the displacement signal generated by the sensor and generates a valve control signal to be communicated to a valve located on a vacuum line connecting a vacuum source to the vacuum port. |
US10512242B1 |
Soybean variety 01077436
The invention relates to the soybean variety designated 01077436. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01077436. Also provided by the invention are tissue cultures of the soybean variety 01077436 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01077436 with itself or another soybean variety and plants produced by such methods. |
US10512241B1 |
Soybean variety 01072232
The invention relates to the soybean variety designated 01072232. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01072232. Also provided by the invention are tissue cultures of the soybean variety 01072232 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01072232 with itself or another soybean variety and plants produced by such methods. |
US10512239B1 |
Soybean variety 01072273
The invention relates to the soybean variety designated 01072273. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01072273. Also provided by the invention are tissue cultures of the soybean variety 01072273 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01072273 with itself or another soybean variety and plants produced by such methods. |
US10512237B1 |
Soybean variety 5PFDN24
A novel soybean variety, designated 5PFDN24 is provided. Also provided are the seeds of soybean variety 5PFDN24, cells from soybean variety 5PFDN24, plants of soybean 5PFDN24, and plant parts of soybean variety 5PFDN24. Methods provided include producing a soybean plant by crossing soybean variety 5PFDN24 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PFDN24, methods for producing other soybean varieties or plant parts derived from soybean variety 5PFDN24, and methods of characterizing soybean variety 5PFDN24. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PFDN24 are further provided. |
US10512234B1 |
Maize hybrid X03M278
A novel maize variety designated X03M278 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X03M278 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X03M278 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X03M278, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X03M278 are provided. Methods for producing maize varieties derived from maize variety X03M278 and methods of using maize variety X03M278 are disclosed. |
US10512231B2 |
Catnip cultivar ‘CR3’
The disclosure provides seed, tissue cultures, essential oil extracts, and plants of catnip hybrid ‘CR3’, as well as methods for producing a catnip plants by crossing ‘CR3’ plants with themselves or with another catnip plant, such as a plant of another genotype, variety, or cultivar. The disclosure further provides seed, tissue cultures, essential oil extracts, and plants produced by such crossing. Methods of using the plants and extracts as insect repellents and in pet toys, are also provided. |
US10512230B1 |
Soybean cultivar S170055
A soybean cultivar designated S170055 is disclosed. The invention relates to the seeds of soybean cultivar S170055, to the plants of soybean cultivar S170055, to the plant parts of soybean cultivar S170055, and to methods for producing progeny of soybean cultivar S170055. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar S170055. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar S170055, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar S170055 with another soybean cultivar. |
US10512225B2 |
Tree sap line connector and assembly
A tree sap line connector having a fluid transfer body with interconnected walls defining a hollow inner chamber. The inner chamber is in fluid communication with a plurality of sap conduits, each of which extends from one of the walls. Each sap conduit is engageable with a sap collection line to convey sap to and from the inner chamber. At least one of the walls has a groove therein, which extends a depth into the wall and is accessible from an exterior of the fluid transfer body. The groove removably receives therein a connector piece of a sealing member. The sealing member is removably mounted to the line connector when the connector piece is received in the groove. |
US10512222B1 |
Steam treatment of soil
A soil treatment system, including heat treatment apparatus configured to travel in a forward direction along a plot of ground having a soil surface and configured for disturbing the soil surface and treating associated soil with steam as the heat treatment apparatus travels to provide steam treated soil, and a source of steam in flow communication with the heat treatment apparatus for supplying steam to the heat treatment apparatus. The heat treatment apparatus includes a first heat treatment section having a plurality of rotating blades configured to contact the soil surface and lift and circulate the soil and return the soil to the ground, and a plurality of first steam outlets proximate the rotating blades configured to expose the soil lifted and circulated by the rotating blades to steam from the first steam outlets. The heat treatment apparatus also includes a second heat treatment section having a conveyor configured to receive soil and to return the soil to the ground, a plurality of second steam outlets proximate the conveyor and a blade configured to contact the soil surface and lift the soil onto the conveyor for exposure of the soil on the conveyor to steam from the second steam outlets. |
US10512219B2 |
Rotary plant stripper and related methods
Disclosed is a plant stripper for separating buds or fruit from the stems or branches of a plant. In one embodiment, the plant stripper is defined by a housing that contains a face plate, bladed rollers, and motor and gear system for counter turning the rollers. In operation, a plant stem bearing buds or fruit may be provided through a plant hole in the face plate and gripped by the counter turning rollers so that continued counter turning of the rollers pulls the stems or plants through the plant hole of the face plate. Suitably, the plant hole is gauged so that only the stem may pass through the hole but not the buds or fruit whereby the buds or fruit of the plant are stripped from the plant via action of the stem through the plant hole. In one embodiment, the plant stripper features a guide tray for catching stripped buds or fruit and guiding the same to a collection bin. |
US10512218B2 |
Mower having collection system with quick connect vacuum hose adapter
A quick connect hose adapter connects a flexible transfer hose from a mower deck to an inlet tube on a container for storing debris. The adapter includes a first cylindrical portion fixed in the discharge end of the flexible hose, and a second portion with a clamp assembly that clamps to the inlet tube. The clamp assembly has first and second semi-cylindrical segments connected together on one side by a continuous hinge, and at least one latch for latching the other side of the semi-cylindrical segments together to cause the clamp assembly to be clamped to the inlet tube. When the latch is released, the second semi-cylindrical segment can be moved from a closed position to an open position. In the open position, the adapter is easily removable from the inlet tube. A seal ring provides a smooth inner surface and seal between the adapter and the inlet tube. |
US10512216B2 |
Combine harvester with grain culm sensor
The combine harvester includes a harvest frame that receives grain culms cut by a reaping device and a rake-in auger disposed within the harvest frame so as to be rotatable about a rotary axis extending in a right/left direction of the harvester body. The rake-in auger conveys the grain culms inside the harvest frame in a right/left direction of the harvester body and rakes in the grain culms toward the rear of the harvester body. The combine harvester further includes a feeder that is communicatively connected to a rear wall of the harvest frame, and that conveys the grain culms raked in by the rake-in auger toward the rear of the harvester body. A grain culm sensor that detects the presence of the grain culms when coming in contact with the grain culms is disposed at a grain culm feed port in the feeder. |
US10512214B2 |
Lawn mower with waterproofed driving source
A lawn mower includes a driving source mounting portion formed in a traveling frame, a driving source mounted in the driving source mounting portion, and a lawn mowing unit attached to the driving source. A bottom surface of the traveling frame includes a frame-side seal surface surrounding the lower end of the driving source mounting portion, and a lawn mowing unit peripheral surface surrounding the frame-side seal surface. A waterproof member is in tight contact with the frame-side seal surface. The lawn mowing unit peripheral surface is formed over a range from an outer circumferential edge of the frame-side seal surface to an outer circumferential edge of the lawn mowing unit. A boundary between the frame-side seal surface and lawn mowing unit peripheral surface is formed into the shape of a step. |
US10512213B2 |
Double deck boots
A double deck boot attachment for a lawn maintenance tool includes a smaller deck boot and a larger deck boot including an interior volume. The smaller deck boot is an attachment for at least one first lawn maintenance tool and the larger deck boot is an attachment for at least one second lawn maintenance tool. At least a portion of the smaller deck boot is configured to slide within the interior volume of the larger deck boot from a separated position to an assembled position and the double deck boot is configured to be stored and shipped as one deck boot with one stock keeping unit code. |
US10512210B2 |
Agricultural row unit systems, methods, and apparatus
A row unit for an agricultural planter having features for releasably operably coupling a seed meter of the row unit to a seed deposition apparatus of the row unit such as a seed conveyor, seed tube or the like. Apparatus may be used for tipping a seed meter of the hopper for disengagement from the seed deposition apparatus or for biasing the seed deposition apparatus into operative engagement with the seed meter. The row unit includes features such as latches for releasably operably coupling the row unit to crop input and vacuum supply lines. Apparatus may also be used for tipping a seed meter of the hopper for disengagement from the crop input and vacuum supply lines. Systems are used for supplying vacuum and crop inputs to the seed meter via the releasably engageable apparatus. |
US10512205B2 |
Agricultural tillage implement wheel control
An agricultural tillage implement includes a main section including a hitch extending in a travel direction, a plurality of foldable wing sections coupled with the main section, a plurality of ground engaging tilling elements, a plurality of wheel assemblies and a control system. The tilling elements are coupled to the main section and wing sections. Each of the wheel assemblies include an actuator. The wheel assemblies include a first plurality of wheel assemblies associated with the main section and a second plurality of wheel assemblies associated with the plurality of wing sections. The actuators of the first plurality of wheel assemblies being independent of the actuators of the second plurality of wheel assemblies. The control system is configured to actuate the actuators to effect a profile minimizing operation of the foldable wing sections when the implement is being transitioned into a transport mode. |
US10512203B2 |
Vehicle control system
A tractor control system, which controls an operating condition of an implement attached to the tractor. The control system includes a sensing means providing a force signal which indicates the pull force necessary to pull an implement in a desired position; a control which receives the force signal; and means for measuring at least one parameter associated with the tractor mode and/or the implement mode and the implement position is adjusted to a new position when the force signal varies. The control system includes pre-determined values associated with certain tractor and/or implement modes. A measured parameter is compared with a pre-determined parameter value and if the measured parameter would result in an undesired movement of the implement, the force signal is deactivated, or the response to the force signal is deactivated to prevent undesired movement of the attachment. |
US10517199B2 |
Methods of positioning a component in a desired position on a board, pick and place machines, and sensors for such pick and place machines
A method of positioning a component in a desired position on a board is provided. The method includes the steps of: (a) picking up the component with a nozzle of a movable placement unit of a pick and place machine; (b) transporting the component towards the board as a function of the desired position; (c) obtaining sensor data about an orientation of the component with respect to the nozzle with a sensor of the placement unit; (d) obtaining in the sensor rotational data about the orientation of the nozzle with respect to the placement unit; (e) combining in the sensor the sensor data and the rotational data into a data set; (f) sending the data set from the sensor to a stationary computer and computing a correction instruction in the stationary computer; and (g) placing the component on the board as a function of the correction instruction from the stationary computer. |
US10517196B2 |
Flexible display device
A flexible display device includes a flexible display panel and a heat dissipating layer. The flexible display panel includes a bending region and a non-bending region. The heat dissipating layer includes a first heat dissipating sublayer and a second heat dissipating sublayer. The first heat dissipating sublayer is disposed on the non-bending region and the second heat dissipating sublayer is disposed on the first heat dissipating sublayer. |
US10517191B2 |
Liquid immersion server
A liquid immersion server includes a processor, a heat sink to which heat generated by the processor is transferred, a flow channel through which a first refrigerant liquid that has absorbed heat from the heat sink flows, and a cooling bath that stores a second refrigerant liquid that is inactive in a lower section thereof and that stores the first refrigerant liquid in an upper section thereof, wherein when the liquid immersion server is in operation, the processor, the heat sink, and the flow channel are immersed in the second refrigerant liquid, the flow channel has a supply port to which the first refrigerant liquid is supplied from a first pipe and a first discharge port that discharges the first refrigerant liquid that has absorbed heat into the cooling bath. |
US10517189B1 |
Application and integration of a cableless server system
The present disclosure provides a system and method for enabling cableless connections within a server system. The server system comprises a motherboard (MB) module, a power distribution board (PDB) module, power supply unit (PSU) modules, network interface controller (NIC) modules, fan modules, graphic process unit (GPU) modules, and a hyperscale GPU accelerator (HGX) platform. These components of the server system are interconnected by a plurality of circuit boards. The plurality of circuit boards includes, but is not limited to, a main board, linking boards (BDs), a PDB, a fan board, a power linking board, peripheral-component-interconnect-express (PCIe) expander boards, a plurality of NVLink bridges, and HGX base boards. |
US10517185B2 |
Modular device
A modular device, including a base unit with a plurality of module sockets and a number of modules that can be detachably connected to the module socket as well as a control unit for the connected modules, and the module sockets have manually actuatable locking devices for the modules. The locking devices include a manually actuated actuating device, which can be pivoted around a pivot axis from a first end position through an intermediate position into a second end position and which locks the module in the first end position and release the module in the second end position, and have a detector for detecting at least the first end position and the intermediate position of the actuating device. |
US10517179B2 |
Material composition and methods thereof
Provided is a material composition and method that includes forming a patterned resist layer on a substrate. The patterned resist layer has a first pattern width, and the patterned resist layer has a first pattern profile having a first proportion of active sites. In some examples, the patterned resist layer is coated with a treatment material. In some embodiments, the treatment material bonds to surfaces of the patterned resist layer to provide a treated patterned resist layer having a second pattern profile with a second proportion of active sites greater than the first proportion of active sites. By way of example, and as part of the coating the patterned resist layer with the treatment material, a first pattern shrinkage process may be performed, where the treated patterned resist layer has a second pattern width less than a first pattern width. |
US10517177B2 |
On-vehicle electronic circuit mounting board
An on-vehicle electronic circuit mounting board includes: a surface mount type package component including a plurality of electrode pads disposed along an outer periphery of a component bottom surface; and a printed wiring board having a plurality of lands disposed along the plurality of electrode pads on a top surface of the printed wiring board opposed to the component bottom surface, and in which each land is disposed to be opposed to the corresponding electrode pad and electrically connected to the electrode pad by soldered connection. An outer soldering slope and an inner soldering slope are formed between a land of the plurality of lands and an electrode pad corresponding to the land, and the land is shifted with respect to the corresponding electrode pad such that one of the outer soldering slope and the inner soldering slope faces the wiring board side and the other faces the component side. |
US10517169B2 |
Characterization vehicles for printed circuit board and system design
A characterization vehicle may include a first test circuit and a second test circuit located on separate panels of a panelized printed circuit (PC) board. The first test circuit may be fabricated in accordance with a first plurality of design parameters. The second test circuit may be fabricated in accordance with a second plurality of design parameters. The first plurality of design parameters and the second plurality of design parameters may be chosen in accordance with a design of experiment (DOE) concerning one or more design rules or design trade-offs such that at least two corresponding design parameters from the first and second test circuits have identical values, and at least two corresponding design parameters from the first and second test circuits have different values. |
US10517165B2 |
Plasma cutting apparatus
The present invention is a plasma cutting apparatus (A) configured such that a starting gas is switched to plasma gas at the stage when current is applied to an electrode provided to a plasma torch, and a plasma arc is produced at a preset current value on a material (B) to be cut, so as to extend the life of the electrode, wherein the apparatus is configured to have: a starting gas supply unit (2) having a starting gas solenoid valve (2b) provided with a starting gas supply source (2a) and a starting gas pipeline (2c); a plasma gas supply unit (3) having a plasma gas solenoid valve (3b) provided with a plasma gas supply source (3a) and a plasma gas pipeline (3c); a plasma gas connection part (8) for connecting the downstream-side end part of the starting gas supply unit and the downstream-side end part of the plasma gas supply unit; a gas pipeline part (5) for connecting the plasma gas connection part (8) and a torch body (1a); a flow retention member (4) provided to the gas pipeline part; and a control device (10) for controlling the opening and closing of the solenoid valves, and controlling the flow retention member. |
US10517164B1 |
Universal phase control dimmer for wireless lighting control
Embodiments of the present disclosure provide multi-mode phase control dimmers for lighting devices, particularly for use with wireless lighting control systems. The disclosed universal dimming devices include a load-type detection circuit for determining whether the load for connected lighting devices has an inductive characteristic. The system automatically detects the load characteristic and self-adjusts its phase-cut dimming mode in response. The disclosed solutions require minimal additional components to provide load-type detection beyond those components already included in typical phase dimming applications, particularly in a wireless lighting control environment, thereby minimizing cost. The disclosed solutions have improved reliability by detecting multiple characteristics detected for each of a plurality of AC cycles in order to reliably distinguish between load types. |
US10517161B2 |
Connected device system
The present invention provides a connected device system, comprising a master network device (2) and a device (5) to be integrated into the connected device system (1). The connected device system is adapted to connect the master network device and the device via a wireless network (4). When being added to the wireless network, the device announces itself in the wireless network and provides an upgrade server in the wireless net-work. The upgrade server makes available for retrieval a digital asset indicative of a characteristic of the device. The master network device detects the device in the wireless network based on the announcement, searches for the upgrade server of the device in the wireless network in response to the detection of the device, and retrieves the digital asset from the upgrade server of the device. This leads to an improved way of integrating the device into the connected device system. |
US10517159B2 |
Control device
A control device for controlling an electronic device includes: a switch, and a remote controller being operable to separate from or be in combination with the switch, wherein the switch and the remote controller each are configured to control the electronic device, and the remote controller is in combination with the switch when the control device is in a first usage state, or separates from the switch when the control device is in a second usage state. |
US10517157B2 |
Control system for controlling LEDs in multiple LED computer fans
A data distributer device for controlling the lighting effects of a series of LEDs associated with a plurality of LED computer fans is disclosed. According to certain embodiments, the data distributer device comprises a printed circuit board, a plurality of LED fan data connectors on the printed circuit board, a controller data input connector on the printed circuit board and at least one power input connector on the printed circuit board. The plurality of LED fan data connectors is electrically arranged serially on the printed circuit board. |
US10517156B1 |
Hybrid driving scheme for RGB color tuning
A device includes an analog current division circuit configured to divide an input current into a first current and a second current, and a multiplexer array including a plurality of switches to provide the first current to a first of three colors of LEDs and the second current to a second of three colors of LEDs simultaneously during a first portion of a period, the first current to the second of three colors of LEDs and the second current to a third of three colors of LEDs simultaneously during a second portion of the period, and the first current to the first of three colors of LEDs and the second current to the third of three colors of LEDs simultaneously during a third portion of the period. |
US10517155B2 |
Methods and apparatus for vertically stacked multicolor light-emitting diode (LED) display
A method of fabricating a multicolor light-emitting diode (LED) display includes forming a first LED layer on a first release layer comprising a first two-dimensional (2D) material disposed on a first substrate. The first LED layer is configured to emit light at a first wavelength. The method also includes transferring the first LED layer from the first release layer to a host substrate and forming a second LED layer on a second release layer comprising a second 2D material disposed on a second substrate. The second LED layer is configured to emit light at a second wavelength. The method also includes removing the second LED layer from the second release layer and disposing the second LED layer on the first LED layer. |
US10517153B2 |
Method and system for controlling functionality of lighting devices
A lighting device control system for controlling one or more lighting devices includes a first lighting device comprising an optical radiation source, and a portable electronic device. The portable electronic device includes a processor, a user interface, and a memory device. The memory device includes programming instructions to cause the processor of the portable electronic device to: cause the user interface to output a plurality of candidate optical characteristics for the optical radiation source and a user-selectable setting for at least some of the candidate optical characteristics, receive a selection of at least one of the candidate optical characteristics and an associated setting for each of the selected optical characteristics, generate a light operation request that comprises each of the one or more selected optical characteristics and its associated setting and an account identifier, and transmit the light operation request to the first lighting device. |
US10517138B2 |
Managing MBMS membership at the service capability exposure function
The present application is directed to an apparatus on a network including a non-transitory memory having executable instructions for configuring membership of a group, and a processor that is operably coupled to the non-transitory memory. The processor is configured to receive a request from a server to add a device to the group. The processor is also configured to send a reply to the server that the device is authorized to join the group. The processor is further configured to receive a query request from the server. Further, the processor checks the status of the device based on the query request. The present application is also directed to a networked system including a server and an apparatus in communication with the server. The present application is also directed to a method for configuring membership of a group. |
US10517136B1 |
Wireless communication system to detect a sleepy-cell condition
A wireless communication system to detect a sleepy-cell condition. The wireless communication system comprises a remote radio head that receives network data comprising user data and beamforming instructions from a baseband unit. The remote radio head transfers the user data to wireless communication devices over wireless column beams responsive to the beamforming instructions. The remote radio head further detects a loss of the beamforming instructions for a time threshold and responsively transfers a sleepy-cell alarm indicating the baseband unit. |
US10517134B2 |
Method and system for managing communication between external and implantable devices
Systems and methods for managing bi-directional communication between an external device (ED) and an implantable medical device (IMD) are provided. The method comprises receiving an active ED configuration and a request for communications parameters to be used with the active ED configuration. The method further comprises identifying a pre-existing configuration, from a collection of pre-existing configurations that match the active ED configuration, the collection of pre-existing configurations having an associated collection of predefined parameter sets. The method further determines a resultant parameter set from the collection of predefined parameter sets based on the pre-existing configuration identified and returns the resultant parameter set in connection with the request, the resultant parameter set to be utilized by the ED for bi-directional communication with the IMD. |
US10517131B2 |
Communication control device, communication control method, communication system and communication device
Provided is a communication control device controlling communication of multiple secondary usage nodes providing second communication services using a part of a frequency band assigned to a first communication service, including a communication unit receiving service area information for estimating service areas of the second communication services provided by the secondary usage nodes and access technique information indicating radio access techniques usable by the secondary usage nodes, a storage unit storing information on the service area and access technique received by the communication unit, an estimation unit estimating service areas of multiple second communication services, and a control unit notifying a secondary usage node providing one of the multiple second communication services of a radio access technique or a channel recommended to the at least one second communication service on the basis of a location relationship between the service areas estimated by the estimation unit and the access technique information. |
US10517122B2 |
Methods and network nodes for managing establishment of a radio session
A radio network node (110) manages (A010) establishment of a current radio session between a user equipment (120) and the radio network node (110), wherein the current radio session is associated with a current set of characteristics relating to the radio network node (110) and/or the user equipment (120). During establishment of the current radio session, a core network node (130) retrieves (A080), based on the current set of characteristics, an indication about the MCS offset from a memory (141, 142) accessible by the core network node (130). Then, the core network node (130) sends (A090), to the radio network node (110), the indication about the MCS offset. The indication is derived from a previous radio session, wherein the previous radio session is associated with a previous set of the characteristics, wherein the previous set of the characteristics matches the current set of the characteristics. The radio network node (120) determines (A130) a MCS based on the MCS offset and on a Channel Quality Indicator, “CQI”. Furthermore, the radio network node (110) transmits (A140) a data packet according to the MCS. Corresponding computer program sand carriers therefor are also disclosed. |
US10517114B2 |
Efficient signaling over access channel
An apparatus and method for transmitting an indicator of channel quality while minimizing the use of a broadcast channel is described. A metric of forward link geometry of observed transmission signals is determined. An indicator of channel quality value is determined as a function of the observed transmission signals. An access sequence is selected, randomly, from one group of a plurality of groups of access sequences, wherein each of the plurality of groups of access sequences correspond to different ranges of channel quality values. |
US10517113B2 |
Radio-network node, wireless device and methods performed therein
Embodiments herein relate to method performed by a radio-network node for handling a data transmission, from a wireless device to the radio-network node, in a wireless communication network. The radio-network node schedules one or more resources for carrying an uplink data transmission from the wireless device over a channel, and for carrying a feedback transmission, of a downlink data transmission from the radio-network node, over the same channel. The radio-network node transmits a control message to the wireless device, which control message indicates the one or more resources scheduled for carrying the uplink data transmission and the feedback transmission over the same channel. |
US10517112B2 |
Uplink subframe shortening in time-division duplex (TDD) systems
A guard period for switching between uplink and downlink subframes is created by shortening an uplink subframe, i.e., by not transmitting during one or more symbol intervals at the beginning of the subframe interval. A grant message includes signaling indicating when a shortened subframe should be transmitted. An example method is implemented in a first wireless node configured to transmit data in transmit subframes occurring at defined subframe intervals and having a predetermined number of symbol intervals. This example method includes determining (1620) that a transmit subframe is to be shortened, relative to the predetermined number of symbol intervals and, in response to this determination, shortening (1630) transmission of the transmit subframe by not transmitting during a beginning portion of the subframe interval for the transmit subframe and transmitting during the remainder of the subframe interval. |
US10517111B2 |
Mitigating scheduling conflicts in wireless communication devices
Exemplary embodiments include a method performed by a wireless device configured as a slave in a first piconet and configured as a master in a second piconet. The method includes determining whether the wireless device has data to transmit over the second piconet to an other wireless device, determining an availability of a full slot in a first piconet schedule, selecting a data transmission scheme based on the availability of the full slot in the first piconet schedule and transmitting the data via the second piconet to the other wireless device in accordance with the selected data transmission scheme. |
US10517107B2 |
Methods, base station, infrastructure node and communications terminal
A method of transmitting data from a first communications terminal to one or more second communications terminals includes receiving from an infrastructure equipment forming part of a wireless communications network an indication identifying a predetermined pattern of communications resources of a wireless access interface. The wireless access interface provides plural communications resources divided into time divided units. The method also includes transmitting the data in some or all of the predetermined pattern of communications resources to one or more of the second communications terminals in accordance with device to device communications. The predetermined pattern of communications resources is one of plural patterns of communications resources of the wireless access interface for plural of the time divided units. The plural patterns of communications resources are predetermined for a reduction in latency when transmitting the data from the first communications terminal and/or reducing in signalling overhead required to transmit the data. |
US10517105B1 |
Enhanced LTE retainability when roaming
A device is configured to establish a first roaming network connection to a first roaming network and a second roaming network connection to a second roaming network. The first roaming network has a higher priority than the second roaming network, the second roaming network configured to support a first radio access technology (RAT) and a second RAT, the first RAT having a higher priority than the second RAT. When a current network connection is the second roaming network connection, determining a current RAT used for the second roaming network connection. When the current RAT is the first RAT, determining between an active use state and a non-active use state. When the device is in the active use state, deactivating a capability to reselect to the first roaming network. |
US10517102B2 |
Methods, network nodes, user equipment, and computer program products for adaptive radio link monitoring
A method for adaptive radio link monitoring RLM) includes a network node obtaining configuration information about a user equipment (UE) receiver configuration associated with a UE, where the UE receiver configuration is implemented by the UE for receiving signals from the network node. The method further includes the network node adapting, based on the obtained configuration information, at least one radio transmission parameter associated with at least one downlink (DL) signal used by the UE for performing the RLM. The method also includes the network node transmitting the at least one DL signal with the adapted at least one parameter to the UE enabling the UE to perform the RLM. |
US10517101B2 |
Method and apparatus for mitigating signal interference in a feedback system
A system that incorporates the subject disclosure may include, for example, a process that includes adjusting a filter in electrical communication between an input terminal and a demodulator. The filter is applied to an information bearing signal, e.g., to mitigate interference, received at the input terminal, resulting in a filtered signal. An error signal is received, indicative of errors detected within information obtained by demodulation of a modulated carrier of the filtered signal. A modified filter state is determined in response to the error signal and the filter is adjusted according to the modified filter state, e.g., to improve mitigation of the interference. Other embodiments are disclosed. |
US10517098B2 |
Interference coordination for peer-to-peer (P2P) communication and wide area network (WAN) communication
Techniques for supporting peer-to-peer (P2P) communication in a wide area network (WAN) are disclosed. In an aspect, interference coordination between P2P devices engaged in P2P communication and WAN devices engaged in WAN communication may be performed based on a network-controlled architecture. For the network-controlled architecture, P2P devices may detect other P2P devices and/or WAN devices and may send measurements (e.g., for pathloss, interference, etc.) for the detected devices to the WAN (e.g., serving base stations). The WAN may perform resource partitioning and/or association for the P2P devices based on the measurements. Association may include selection of P2P communication or WAN communication for a given P2P device. Resource partitioning may include allocation of resources to a group of P2P devices for P2P communication. The WAN may send the results of association and/or resource partitioning to the P2P devices, which may communicate in accordance with the association and/or resource partitioning results. |
US10517097B2 |
Position information assisted network control
A network controller including processing circuitry may be configured to receive dynamic position information indicative of a three dimensional position of at least one mobile communication node, compare fixed position information indicative of fixed geographic locations of respective access points of a network to the dynamic position information to determine a relative position of the at least one mobile communication node relative to at least one of the access points based on the fixed position information and the dynamic position information, and provide network control instructions to at least one network asset based on the relative position. |
US10517095B2 |
Communications device, infrastructure equipment, wireless communications network and methods
A user terminal configured to perform communication with an infrastructure equipment of a mobile communications network. The user terminal including a receiver configured to receive signals transmitted by the infrastructure equipment in accordance with a wireless access interface and a transmitter configured to transit signals to the infrastructure equipment in accordance with the wireless access interface. The user terminal is configured to receive an indication on a downlink of the wireless access interface of one of a plurality of different subcarrier spacing which the communications device should use to transmit or to receive the signals representing the data. |
US10517094B2 |
Acknowledgement for multiple user communication in a WLAN
An access point generates and transmits, to first client stations and a second client station, a downlink multi-user (MU) physical layer (PHY) data unit having respective media access control (MAC) data units for i) the first client stations and ii) the second client station. The downlink MU PHY data unit includes an indication that the first client stations are to acknowledge the downlink MU PHY data unit in an uplink MU PHY data unit, and indicates that the second client station is to acknowledge the downlink MU PHY data unit in another uplink PHY data unit separate from the uplink MU PHY data unit. The access point receives, from the multiple first client stations, the uplink MU PHY data unit, and polls the second client station to prompt the second client station to acknowledge, in another uplink PHY data unit, that the second client station received the downlink MU PHY data unit. |
US10517092B1 |
Wireless mesh data network with increased transmission capacity
A method for transmitting node data in a wireless meshed network from a plurality of wireless nodes to at least one consolidating node includes assigning each of the plurality of wireless nodes to one of a plurality of node pools and causing each of the plurality of wireless nodes to transmit node data to one or more other wireless nodes and/or the at least one consolidating node during the assigned time slots. Each wireless node transmits its node data during timeslots which are adjacent to timeslots during which a wireless node from another node pool transmits its node data. The node data for each wireless node includes data originating at the wireless node and node data received from another wireless node of the same node pool which are linearly aggregated using network coding. |
US10517085B2 |
Method and apparatus for allocating and acquiring ACK/NACK resources in a mobile communication system
A method and apparatus are provided for receiving acknowledgement information by a base station in a wireless communication system. The method includes transmitting control information for uplink transmission of acknowledgement information, the control information including at least one of information associated with a cyclic shift of a sequence or information for identifying a first resource block (RB) to be used for the uplink transmission of the acknowledgement information; and receiving the acknowledgement information from a user equipment based on the control information. |
US10517079B2 |
Radio base station and user equipment and methods therein
Embodiments herein include a method in a user equipment (UE) for transmitting uplink control information in time slots of a subframe over a radio channel to a radio base station. The uplink control information is comprised in a block of bits. The UE maps the block of bits to a sequence of complex valued modulation symbols. The UE block spreads the sequence across Discrete Fourier Transform Spread—Orthogonal Frequency Division Multiplexing (DFTS-OFDM) symbols. This is performed by applying a spreading sequence to the sequence of complex valued modulation symbols, to achieve a block spread sequence of complex valued modulation symbols. The UE further transforms the block-spread sequence, per DFTS-OFDM symbol. This is performed by applying a matrix that depends on a DFTS-OFDM symbol index and/or slot index to the block-spread sequence. The UE also transmits the block spread sequence, as transformed, over the radio channel to the radio base station. |
US10517077B2 |
Method and apparatus for implementing mobile broadband device service
A method and an apparatus for implementing a mobile broadband device service. The method includes the following steps: obtaining, service information of a mobile broadband device according to a rule set on the host or by calling an application programming interface (API) of a Web server on the mobile broadband device; and when to use a corresponding function of the host for implementing a mobile broadband device service corresponding to the service information, executing, the corresponding function of the host by calling an API provided by an operating system (OS) of the host, to implement the mobile broadband device service. In the embodiments of the present disclosure limitations when the mobile broadband device is managed in the Web manner are reduced, and a capability of managing the mobile broadband device is improved. |
US10517075B2 |
Angiopoietin-like 4 and a method of its use in wound healing
A method and a pharmaceutical composition for increasing wound healing in an individual in need thereof, the method comprising administering an angiopoietin like 4 (ANGPTL4) polypeptide or a therapeutically active fragment thereof. |
US10517072B2 |
Autonomous resource selection for vehicle-to-vehicle communications
Various aspects related to selecting a resource selection procedure for V2V communications are described. In an aspect of the disclosure, a method, a computer-readable medium, and an apparatus for selecting a resource selection procedure for V2V transmissions, is described. The apparatus, e.g., a UE, may be configured to identify that recent sensing history information at the UE is unavailable for a sensing based resource selection procedure. The UE may be further configured to select, in response to identifying that the recent sensing history information is unavailable, a resource selection procedure based on configuration information obtained from a network entity. In various configurations, the UE may select a resource for a V2V transmission based on the resource selection procedure selected based on the configuration information. |
US10517069B2 |
System information scheduling in machine type communication
The present disclosure relates to an apparatus for receiving system information in a wireless communication system including a receiver that receives system information configuration information and receives system information in predetermined subframes of a radio interface, and a controller that determines the predetermined subframes according to the received system information configuration information and controls the receiver to receive the system information in the predetermined subframes, wherein the system information configuration information includes a subframe scheduling field with a plurality of bits, each bit being associated with a subframe and representing whether or not system information is to be received in that subframe. The present disclosure further relates to a corresponding apparatus for transmitting system information and to the respective receiving and transmitting methods. |
US10517065B2 |
Notifications
A notification of a received communication relating to a communication chain is presented. An input is received in response to that notification. Until a predetermined event occurs, the presentation of at least one type of notification of further received communications relating to that communication chain is suspended in dependence on said input. |
US10517064B2 |
Data package preparation
Disclosed in this specification is a method comprising inserting an anti-whitened data portion into a data packet that is to be whitened by whitening to yield a whitened data packet for transmission (44) from a first radio communications apparatus (30) to a second radio communications apparatus (10), the anti-whitened data portion having been determined based on anti-whitening data received (43) from the second radio communications apparatus (10) at the first radio communications apparatus, wherein the anti-whitened data portion is obtainable from a specific data block by anti-whitening, the anti-whitening compensating for the whitening so that the whitened data packet comprises the specific data block in non-whitened form. |
US10517062B2 |
Method for measuring location of user equipment in wireless communication system, and apparatus for performing same
According to an embodiment of the present invention, a method for measuring a location of a user equipment in a wireless communication system may comprises the steps of: measuring a magnetic field strength at a plurality of points on a trajectory along which the user equipment moves; transmitting, to a network, information including information on the measured magnetic field strength and displacement information indicating a relative location change among the plurality of points; and receiving information associated with the location of the user equipment from the network, wherein the location of the user equipment may be obtained by extracting a location where a magnetic field pattern corresponding to the feedback information appears, from magnetic field data of a three-dimensional space stored in the network. |
US10517059B2 |
Wireless communication system and method for establishing a connection between user equipment and a mobility management entity thereof
The present invention relates to a wireless communication system and method for establishing connection between a User Equipment (UE) and a Mobility Management Entity (MME) in the wireless communication system in which the data-centric terminal requests the mobility management entity for attachment and checks, when the mobility management entity responds, data-centric features supported by the mobility management entity. According to the present invention, it is possible to connect the data-centric terminal to the mobility management entity supporting the data-centric features of the corresponding data-centric terminal efficiently in the wireless communication system. |
US10517055B2 |
Communication device and communication method
[Object] To provide innovation with respect to which synchronization signal a communication device uses to conduct a synchronization process.[Solution] Provided is a communication device including: a selection unit configured to select a synchronization signal from respective synchronization signals received from two or more other devices on a basis of origin information that is acquired by communication with another device and that indicates an origin of a synchronization signal used for acquisition of synchronization timing in the other device; and a synchronization processing unit configured to acquire synchronization timing using the synchronization signal selected by the selection unit. |
US10517053B2 |
Radio (NR) wideband sync detection
A network sync signal with unknown frequency location is detected by sampling the received signal over a band of interest in frequency, and over the repetition period of the sync signal in time. The signal is converted to the frequency domain. Sub-bands of the frequency-domain signal, corresponding to different possible sync locations and frequency offsets, are extracted and converted to the time domain, where the sync signal is searched over the reception window length using time-domain matched filtering. |
US10517052B2 |
Wireless communication equipment and wireless communication method
A wireless communication equipment and a wireless communication method. The wireless communication equipment used for a user equipment side includes one or more processors. The processors are configured to determine indication information about a type of another user equipment carried in a synchronizing signal from the user equipment, the type including a first type and a second type. The processors are also configured to determine, based on the indication information, corresponding device-to-device communication operation of a user equipment aiming at another user equipment. |
US10517051B2 |
Method for receiving downlink signal by terminal in wireless communication system, and device therefor
Disclosed herein is a method for transmitting a signal to or receiving a signal from a base station by a terminal in a wireless communication system. Specifically, the method comprises the steps of: receiving a first packet from the base station; transmitting, to the base station, a negative-ACK(NACK) response to the first packet; receiving a second packet from the base station and determining whether an error has occurred in the NACK response to the first packet; and transmitting, to the base station, information on whether an error has occurred in the NACK response to the first packet. |
US10517045B2 |
Techniques for power control using carrier aggregation in wireless communications
Methods, systems, and devices for wireless communications are described that provide for managing transmissions using multiple component carriers (CCs) in which transmissions using one or more of the CCs may span less than a full transmission time of a slot or other transmission time interval. A UE may signal a capability to transmit such transmissions, and one or more capabilities related to carrier aggregation that may be used by a base station for scheduling of transmissions on different CCs. In the event that overlapping transmissions on two or more CCs exceed a maximum power threshold, various techniques for dropping at least a portion of one or more transmissions of one or more CCs are described. |
US10517042B2 |
CMAS alert procedures over Wi-Fi for low power devices
Distributing indications of emergency messages via Wi-Fi. A cellular device may temporarily disable its cellular modem. The cellular device may receive an indication over Wi-Fi that an emergency message has been broadcast. In response, the cellular device may activate its cellular modem and retrieve the emergency message via a cellular network. |
US10517038B2 |
Method and device for generating access point attribute information of wireless access point
A method and device for generating access point attribute information about a wireless access point is provided. The method includes obtaining an attribute operation by a user on a wireless access point, and determining access point attribute information about the wireless access point according to the attribute operation. Based on an attribute operation submitted by UGC of a large number of users on a wireless access point, and then by determining access point attribute information about the wireless access point according to the attribute operation, such as an acceptation/correction/complaint operation on an attribute of an access point, lots of accurate and reliable access point attribute information can be automatically accumulated, without the work of collecting the access point attribute information offline in a labor-consuming and time-consuming manner, constructing, without any costs, an accurate, comprehensive and valuable vast-hotpot-information library for big data mining, and enhancing the user experience. |
US10517037B2 |
Network access method and mobile communications terminal
Disclosed are a network access method and a mobile communications terminal. The method comprises: determining a network standard supported by a mobile communications terminal; adding to an equivalent public land mobile network (EPLMN) the network identifier of a public land mobile network (PLMN) of the determined network standard supported by the mobile communications terminal; if a PLMN matching the network identifier of the EPLMN is discovered by searching, then establishing a communications connection between the mobile communications terminal and the matching PLMN. |
US10517036B2 |
Method and user equipment for blocking network access by ACDC
A disclosure of the present specification provides a network access blocking method performed by a user equipment. The method may comprise the steps of: receiving application specific congestion control for data communication (ACDC) blocking information and access class barring (ACB) blocking information; determining the category of an application being executed according to a network access attempt by the application; performing an ACDC blocking check on the basis of the determined category and the received ACDC blocking information. Here, when the network access attempt by the application is not blocked as a result of the ACDC blocking check, an ACB blocking check on the basis of the ACB blocking information may be skipped. |
US10517035B2 |
Connectivity using a geographic phone number
Techniques for connectivity using a geographic phone number are described. According to various implementations, techniques described herein enable various policies pertaining to the use of telephone numbers at different locations to be enforced. For instance, techniques described herein enable a client device that is outside of a permitted geographic area for a geographic phone number to use a non-geographic phone number to connect a call, while the call can be routed using the geographic phone number. |
US10517034B2 |
Uplink-aware serving cell selection
An example method comprises receiving an event notification from a cell in a current set of a user equipment, the event notification indicating an uplink signal strength from the user equipment to the cell relative to a threshold; and designating the cell as being either a viable candidate or not a viable candidate to be a serving cell based on the uplink signal strength relative to the threshold. |
US10517031B2 |
User apparatus, base station, cell selection control method, and parameter transmission method
A user apparatus in a mobile communication system including a base station and the user apparatus, including: reception means that receives, from the base station, a parameter for all symbols that is used when performing cell selection processing or cell reselection processing based on all symbol signal reception quality that is signal reception quality based on measurement in all OFDM symbols; and cell selection control means that performs measurement of the all symbol signal reception quality, and performs cell selection processing or cell reselection processing by using a result of the measurement and the parameter for all symbols received by the reception means. |
US10517028B2 |
Method and system of managing voice call and IP media sessions in a wireless network environment
A user equipment (UE) and an operating method of the UE in a communication system are provided. The method includes registering the UE through a first cell using a first access technology; detecting a second cell using a second access technology; receiving a first data through the first cell using the first access technology; and receiving a second data through a second cell using the second access technology, wherein the first cell and the second cell are simultaneously active for the UE, and at least one of the first data and the second data is selectively received through at least one of the first cell and the second cell. |
US10517018B2 |
Load balancing for a cloud-based Wi-Fi controller based on local conditions
Load balancing for cloud-based monitoring of Wi-Fi devices on local access networks is based on local conditions. Requests for connection are received from Wi-Fi devices of the plurality of WLANs exceed a threshold. An indication of at least one condition for each of the WLANs is also received either with the connection request or separately. Example conditions include, without limitation, a number of local connections, network security breaches, guaranteed service levels, local latency or congestion, power outages or reboots, and the like. In response, at least one Wi-Fi device is prioritized and scheduled based on a corresponding at least one condition. |
US10517016B2 |
Method for determining size of transmission block of uplink signal in wireless communication system and apparatus therefor
A method for transmitting, by a terminal, a high-speed uplink signal to a base station in a wireless communication system is disclosed. Specifically, the method for transmitting a high-speed uplink signal comprises the steps of: setting a plurality of resource blocks as a resource pool for transmitting a high-speed uplink signal through an upper layer signal; selecting at least one resource block from the resource pool; and transmitting the high-speed uplink signal including a transmission block on the selected resource block to a base station, wherein the size of the transmission block is determined on the basis of the number of the selected resource blocks. |
US10517014B2 |
Controlling performance of a wireless device in a heterogeneous network
A method of controlling performance of a wireless device is performed by a node that is in electronic communication with a cellular network. The node includes a processor, a non-transitory memory, and a network interface. The method includes receiving a performance value characterizing a performance of a communication channel between a wireless device and a wireless access point. In some implementations, the wireless device and the cellular network are associated with different radio access technologies (RATs). The method includes determining whether the performance value breaches a performance criterion for the wireless device. The method includes adjusting a first amount of data transmitted to the wireless device from a base station of the cellular network and a second amount of data transmitted to the wireless device from the wireless access point. In some implementations, the combined first and second amounts of data satisfy the performance criterion for the wireless device. |
US10517008B2 |
Apparatus
To make it possible to increase opportunities for terminal apparatuses to receive multicast signals. There is provided an apparatus, including: a first control unit configured to select a first frequency band which is a frequency band for a cellular system and a second frequency band which is not the frequency band for the cellular system when a terminal apparatus is in an idle mode; and a second control unit configured to control the terminal apparatus such that, when the terminal apparatus is in the idle mode, the terminal apparatus receives a paging message transmitted in the first frequency band and receives a multicast signal transmitted in the second frequency band. |
US10517002B2 |
User equipment (UE) indication of coverage mismatch between common search space (CSS) and user-specific search space (USS) for remaining minimum system information (RMSI) delivery
Certain aspects of the present disclosure provide techniques for identifying a mismatch between a user's common search space (CSS) and user-specific search space (USS). A base station (BS) may receive an indication that a user equipment (UE) decoded at least one beamformed signal transmitted by the BS in a USS and did not decode at least one beamformed signal transmitted by the BS in a CSS. The BS may take one or more actions based, at least in part, on the indication. Similarly, a UE may decode at least one beamformed signal transmitted by a BS in a USS, transmit to the BS an indication that the UE decoded the at least one beamformed signal transmitted in the USS and did not decode at least one beamformed signal transmitted by the BS in a CSS, and take one or more actions based, at least in part, on the indication. |
US10517001B2 |
Single radio switching between multiple wireless links
A computing device (such as a computer gaming console) uses only a single radio to concurrently communicate with a wireless network access point and wireless client devices such as game controllers or peripherals. To establish and maintain both a high-throughput link with the access point, and a low-latency link with the client device(s), the single Wi-Fi radio of the computing device is configured to periodically switch between a channel used for the high-throughput link and a different channel that is used for the low-latency link—thus implementing a combination of frequency division multiplexing (FDM) and time division multiplexing (TDM). The console may use aspects of the Wi-Fi protocol standard to ensure that periodically switching its single radio between the two channels is accomplished while maintaining reliable communication on both channels. |
US10517000B2 |
Apparatus and method for performing beamforming operation in millimeter wave communication system
An apparatus and a method for performing a beamforming operation in an access point (AP) in a millimeter Wave (mmWave) communication system are provided. The method includes transmitting a directional reference signal (RS) in an RS transmission (Tx) interval, and transmitting a training signal in an interval different from an interval during which the directional RS is transmitted in the RS Tx interval based on beamforming patterns supported in the AP, wherein a length of the training signal is shorter than a length of the directional RS. The apparatus and the method relate to a pre-5th-generation (5G) or 5G communication system to be provided for supporting higher data rates beyond 4th-generation (4G) communication system such as a long term evolution (LTE). |
US10516999B1 |
Systems and methods for self-organizing network provisioning based on signal path image
A computer system may include a memory storing instructions and processor configured to execute the instructions to obtain image data relating to a path of Fifth Generation (5G) New Radio (NR) wireless signals sent or received by a base station; analyze the obtained image data to identify sources of interference for the 5G NR wireless signals; and estimate a quality of the 5G NR wireless signals along the path based on the identified sources of interference. The processor may be further configured to determine that the estimated quality of the 5G NR wireless signals is less than a quality threshold; generate a recommendation for a self-organizing network (SON) action relating to the base station, based on determining that the estimated quality of the 5G NR wireless signals is less than the quality threshold; and perform the SON action relating to the base station based on the generated recommendation. |
US10516995B2 |
Communication apparatus
A communication apparatus may receive a first specific signal including a specific wireless identifier from an external apparatus; determine whether the specific wireless identifier is a first wireless identifier; in a case where it is determined that the specific wireless identifier is the first wireless identifier, shift an operating state of the communication apparatus to one state of a first parent state and a child state, and form the first wireless network to which both the communication apparatus and the external apparatus belong. In a case where it is determined that the specific wireless identifier is not the first wireless identifier, the communication apparatus is maintained in a first non-belonging state. The communication apparatus may receive specific wireless setting information from the external apparatus by using the first wireless network; and belong to the specific wireless network by using the specific wireless setting information. |
US10516991B2 |
Wireless device, network node, and methods and computer programs for the same
There is provided a method of a wireless terminal arranged to operate in a communication network including communication capabilities according to a first radio access technology, RAT, and a second RAT with the wireless terminal. The method comprises transmitting data to a network node of the communication network or connected to the communication network via a connection using the first RAT. The data enables the network node to determine information about a position of the wireless terminal. The method further comprises receiving a set of parameters from the network node via the connection using the first RAT. The set of parameters is related to any of cell search and system information search for the second RAT. The method further comprises performing cell search or system information search for the second RAT based on the set of parameters. A network node for providing the set of parameters is also disclosed, as well as such wireless device, network node, and computer programs for implementing the methods in such wireless device and network node. |
US10516987B2 |
Discovery method and device
The present invention discloses a discovery method and device, and relates to the field of wireless communications technologies, to resolve a problem that existing two communication parties cannot accurately discover each other, and then it cannot be ensured that the two communication parties perform service communication in a Prose manner. The method provided in the present invention includes: sending a discovery message, where the discovery message includes application layer identifier information of a discovery target, and the discovery target is at least one target user or at least one communications group of a first user that uses the first MCPTT UE; and receiving a response message sent by second MCPTT UE, where the response message includes a layer 2 identifier of the second MCPTT UE and an application layer identifier of a user that uses the second MCPTT UE. |
US10516983B2 |
Systems, devices, and methods for emergency responses and safety
Systems, devices, and methods for emergency responses are provided. A client device can be provided with a response to an emergency via a networked system that can determine that the client device is located with a defined area of coverage, and can route a call session to a answering platform associated with answering station device that can facilitate a facilitate a safety service. Client devices located outside the coverage area can be directed to communicate via a call to 911. |
US10516978B1 |
Network based carrier managed long-term evolution advanced device indication for long-term evolution or other next generation network
Tracking areas that comprise service cells capable of providing advanced long-term evolution (LTE-A) features, can be utilized to indicate to a mobile device that the mobile device can access the advanced features. For example, an LTE-A capable mobile device can display an LTE-A icon if the mobile device is in a geographic area that qualifies as an LTE-A tracking area. However, if the mobile device is not capable of receiving LTE-A services, then the mobile device can display an LTE icon instead of an LTE-A icon. |
US10516976B2 |
Mobile device with applications that use a common place card to display data relating to a location
Some embodiments provide a mobile computing device that includes a number of applications having a common display area to display data relating to a location. In some embodiments, the common display area is a unified display area to display different types of data. The different types of data can include information regarding the location, multimedia associated with the location, user feedbacks regarding the location, a catalog associated with the location, social network data, etc. In some embodiments, the unified common display area is also referred to as a place card because it presents data relating to a place. |
US10516975B2 |
Enhanced messaging using environmental information
Techniques for acquiring, sending, receiving or using status information from a remote location over a network are disclosed. The status information is transmitted over the network between or among electronic devices. The status information can be provided by one or more sensors associated with the electronic device that is transmitting the status information. The status information can be transmitted with messages so as to enhance the messages. On receipt, the status information can be presented in an audio manner. The electronic devices include at least computing devices, such as computers, personal digital assistants, pagers, and mobile telephones. |
US10516974B2 |
Method for equipment networking and outputting by equipment, and equipment
Disclosed are methods for equipment networking, and equipment. Equipment acquires at least one of first information indicating a state of the equipment or second information indicating a state of peer equipment. The equipment determines whether a pre-set condition is met by at least one of the first information or the second information. When the pre-set condition is met by at least one of the first information or the second information, the equipment forms a group with the peer equipment. The equipment monitors data characterizing a signal transmitted by the peer equipment. When a first pre-set condition is not met by the data characterizing the signal transmitted by the peer equipment, the equipment quits the group formed with the peer equipment. |
US10516972B1 |
Employing an alternate identifier for subscription access to mobile location information
Access to location information related to mobile devices is disclosed. A component can receive a subscription request comprising an alternate identity corresponding to a primary identity and related to returning location related data associated with a set of network event locating system (NELOS) information. NELOS information can be received from a NELOS component and can be derived from timed fingerprint location (TFL) information associated with a user equipment (UE). TFL information and NELOS information can be distinct from location information determined from conventional techniques that can provide for additional benefit. The subscription request can indicate continuing access to location information without subsequent requests. Moreover, access can be via a push of information to a subscribing device. |
US10516969B2 |
Mobile application for an amusement park or waterpark
A mobile application for execution upon an electronic device for an amusement park or waterpark. The mobile application provides information, entertainment or other convenience data to the user while the user is within the park. The mobile application may be configured to determine a position of the electronic device within the park and display notifications including discounts at nearby vendors or restaurants, menus of nearby eateries, or ride recommendations based upon wait times. The mobile application may allow the user to make reservations at nearby restaurants within the park. The mobile application may generate an efficient ride sequence for the user based upon characteristics of either the user or the user's participation within the park and navigate the user around the park according to the ride sequence. Puzzles, games, or other entertainment or educational activities may be displayed to the user for providing rewards based upon their participation. |
US10516968B2 |
Techniques for determining a position fix of an object using one or more mobile devices co-located with the object
Disclosed are devices, systems and methods for combining observations obtained at two different mobile devices attached to a human user for performing a navigation operation. For example, observations of a signal acquired at a first mobile device may be selected for computing a position fix based, at least in part, on a utility indicator associated with the observations. |
US10516967B2 |
Method for requesting transportation services
A method for safely and efficiently requesting transportation services through the use of mobile communications devices capable of geographic location is described. Individual and package transportation may be provided. New customers may be efficiently serviced, and the requester and transportation provider locations may be viewed in real time on the mobile devices. |
US10516963B2 |
Adjusting the perceived elevation of an audio image on a solid cinema screen
Techniques are disclosed for an audiovisual system having a display screen that is solid and/or otherwise non-transparent to sound. The sound output from a loudspeaker is oriented to intersect with a portion of the display screen, and a reflection of the sound off of the display screen is directed toward a viewing position in the audiovisual system. Further signal processing techniques to generate sound for output by a loudspeaker oriented at the display screen and other loudspeakers are disclosed. Additionally, other signal processing and control techniques are disclosed that affect audio and video output in the audiovisual system. |
US10516960B2 |
Automatic speaker relative location detection
An audio speaker system for a home theater including a number of microphones, a number of speakers, each speaker located at a different location in a room, and a processor electrically connected to the plurality of microphones and wirelessly connected to the plurality of speakers. The processor is configured to generate an audio signal to send to each speaker of the plurality of speakers, output audio from each speaker of the plurality of speakers based on the audio signal, receive the audio at each microphone from each speaker of the plurality of speakers, determine a location of each speaker relative to the plurality of microphones based on the received audio at each microphone, and assign an audio channel to each speaker based on the determined location. |
US10516959B1 |
Methods and systems for extended reality audio processing and rendering for near-field and far-field audio reproduction
An exemplary extended reality audio processing system (“processing system”) and an exemplary extended reality audio rendering system (“rendering system”) are disclosed to interoperate with one another to perform near-field and far-field audio reproduction. The processing system accesses audio data representative of virtual sound presented, within an extended reality world, to an avatar of a user experiencing the extended reality world. Based on the audio data, the processing system generates complementary first and second multi-channel audio data streams configured, in combination, to represent the virtual sound. The processing system directs the rendering system to concurrently render the complementary multi-channel audio data streams for the user by directing a near-field rendering system included within the rendering system to render the first multi-channel audio data stream, and directing a far-field rendering system included within the rendering system to render the second multi-channel audio data stream. Corresponding methods and systems are also disclosed. |
US10516956B2 |
Failure detection device, failure detection system, and failure detection method
A failure detection device for detecting a failure of a sound generating device outputting a sound based on sound data from a speaker includes: an electronic watermark signal generating unit configured to generate an electronic watermark signal including collation data used for collation of whether or not a sound is output from the speaker; the speaker configured to output the electronic watermark signal as a sound; a microphone configured to collect the sound output from the speaker; a collation data detection unit configured to detect the collation data from the electronic watermark signal included in the sound collected by the microphone; and a failure determination unit configured to determine the presence or absence of the failure of the sound generating device by collating the collation data detected by the collation data detection unit with the collation data included in the electronic watermark signal. |
US10516954B2 |
Hearing aid for placement at an ear of a user
This disclosure relates to a hearing aid for placement on head of a user comprising a first second part. The first part may comprise an acoustic input transducer adapted to convert ambient sound picked up at the ear of the user to an electric signal, a signal processor adapted to process the electric signal according to specifications of user into a processed electric signal, and an output transducer adapted to covert the processed electric signal into a transmission signal, The second part may comprise an anchor adapted to fixate said second part under the skin to skull bone of the user, and a receiver adapted to receive the transmission signal and convert the transmission signal to an output signal perceivable as sound by the user. The first part may comprise an inner recess adapted to receive an insert element, where the insert element may comprise a first magnet adapted to in cooperation with the second part to cause the first part to attach to the head of the user. |
US10516949B2 |
Optical electro-mechanical hearing devices with separate power and signal components
A device to transmit an audio signal comprises at least one light source configured to transmit the audio signal with at least one wavelength of light. At least one detector is configured to detect the audio signal and generate at least one electrical signal in response to the at least one wavelength of light. A transducer is supported with and configured to vibrate at least one of an eardrum, an ossicle or a cochlea. Active circuitry is coupled to the transducer to drive the transducer in response to the at least one electrical signal, so as to provide the user with high quality sound. |
US10516944B2 |
Sound output apparatus and sound output method
A sound output apparatus includes a touchscreen, a vibrator and a controller. The vibrator produces sound by causing vibration of the touchscreen based on a sound signal. The controller (a) performs a predetermined control of the sound signal while contact of an operation body with the touchscreen is being detected by the touchscreen, and (b) does not perform the predetermined control of the sound signal while contact of an operation body with the touchscreen is not detected by the touchscreen. |
US10516943B2 |
Microelectromechanical device, an array of microelectromechanical devices, a method of manufacturing a microelectromechanical device, and a method of operating a microelectromechanical device
Aspects of a microelectromechanical device, an array of microelectromechanical devices, a method of manufacturing a microelectromechanical device, and a method of operating a microelectromechanical device, are discussed herein. The microelectromechanical device may include: a substrate; a diaphragm mechanically coupled to the substrate, the diaphragm comprising a stressed region to buckle the diaphragm into one of two geometrically stable positions; an actuator mechanically coupled to the diaphragm, the actuator comprising a piezoelectric layer over the diaphragm; a controller configured to provide an electrical control signal in response to a digital sound input; wherein the actuator is configured to receive the electrical control signal to exert a mechanical piezoelectric force on the diaphragm via the piezoelectric layer to move the diaphragm to create a sound wave. |
US10516942B2 |
Electronic circuit for a microphone and microphone
An electronic circuit for a microphone and a microphone are disclosed. In an embodiment, the electronic circuit includes a sigma-delta modulator having a configurable resolution and a mode selector, wherein the sigma-delta modulator is selectively operable in at least two operation modes and the mode selector is configured to determine a desired operation mode dependent on an externally provided control signal and to select the resolution of the sigma-delta modulator according to the determined operation mode. |
US10516941B2 |
Reducing instantaneous wind noise
Wind noise reduction is provided by obtaining a first signal from a first microphone and a contemporaneous second signal from a second microphone. A level of the first signal is compared to a level of the second signal, within a short or substantially instantaneous time frame. If the level of the first signal exceeds the level of the second signal by greater than a predefined difference threshold, a suppression is applied to the first signal. |
US10516938B2 |
System and method for assessing speaker spatial orientation
System and method for assessing speaker spatial orientation are provided. For example, audio data, as well as input from other sensors, may be analyzed to assess speaker spatial orientation. For example, the audio data may be analyzed to determine that two speakers are engaged in conversation. relative direction of one speaker with respect to the other may be obtained. Spatial orientation of at least one of the speakers may be obtained. The spatial orientation may be assessed according to the relative direction and the determination that the two speakers are engaged in conversation. Feedbacks and reports may be provided based on the assessed speaker spatial orientation. |
US10516935B2 |
Hybrid transducer
A first acoustic transducer has an armature, and the armature moves within a magnetic field. The first transducer also comprises a first coil. A second acoustic transducer has a first outer circumferential edge and an inner circumferential edge. A housing includes at least portions of the first transducer and the second transducer. The first transducer is disposed at least partially within the cavity and within the inner circumferential edge of the second transducer. The first coil is fixed in space relative to the housing. |
US10516934B1 |
Beamforming using an in-ear audio device
A beamformer system includes an in-ear audio device, such as an earbud, that has three microphones. Two microphones may be disposed on an external face of the audio-device; one microphone may be disposed in or near the ear canal of a user. Data from two microphones is phase-adjusted and combined; a reference signal is generated by phase-adjusting and removing data from the two microphones from data from a third microphone. The combined data is filtered using the reference signal to remove any residual echo, and the resulting data may be used for communications, speech processing, or other uses. |
US10516933B2 |
Headset with optical microphone signal transmission
A headset for voice communication is provided comprising an earphone unit having a speaker, a microphone boom comprising one or more microphones wherein the microphone boom is rotatably interconnected with the earphone unit to allow for 360 degrees rotation. The microphone signals are transmitted from the microphone boom to the earphone unit via an optical transceiving unit having a transmitter and a receiver, wherein the microphone boom comprises the transmitter and the earphone unit comprises the receiver. The transmitter comprises a clock generator configured to generate a clock signal and a first processor configured to receive the microphone signals and to encode the clock signal into the microphone signals to form a first communication signal, and wherein the receiver comprises a clock re-generating unit for regenerating the clock signal, and a second processor for decoding the first communication signal according to the re-generated clock signal, and wherein the decoded microphone signals are provided to an electronic circuit in the earphone unit. |
US10516927B2 |
Acoustic parabolic mirror ring apparatus
An apparatus for enhancing microphone performance of a voice-controlled smart home device is disclosed. The apparatus generally comprises a lower ring having a first diameter an upper ring having a second diameter and a reflective surface. The reflective surface is disposed along the perimeter of the apparatus so as to directionally alter incoming sound waves and focus them toward an array of microphones. |
US10516924B2 |
Torsion spring ceiling grill
A torsion spring ceiling grill that is reconfigurable to adapt smoothly to various thicknesses of ceiling tiles. The ceiling tile has an opening to which a grill plate and a backing plate correspond. The grill plate attaches to the backing plate via the torsion springs, clamping the ceiling tile in between. The torsion spring assemblies can be reconfigured by repositioning an axle of each torsion spring assembly in its respective slot in vertical spring support panels of the grill plate. The torsion spring assemblies can be releasably secured at any position along the slot. The backing plate has spring-receiving openings on a top horizontal panel that extends out over the opening in the ceiling tile to receive arms of the torsion springs. Arms of the torsion springs may be bound by a severable connector which is severed by a blade above the top horizontal panel during installation. |
US10516921B1 |
Optical line terminal for providing management function emulating virtual chassis switch for fiber local area network system
Disclosed is a new advance in a network management function of an optical time terminal (OLT). A virtual switch management program is running on the disclosed OLT. The virtual switch management program provides a switch management environment for a single chassis-based Ethernet switch with a plurality of port extender cards corresponding to the optical network terminals and being mounted thereon through a management terminal. The virtual switch management program receives a switch management command for each port extender through the management terminal and outputs a fiber LAN management command corresponding to the switch management command to an optical network terminal corresponding to each port extender. |
US10516920B2 |
Power tool and method for wireless communication
A power tool having multiple wireless communication states and a method of wirelessly communicating by a power tool. The power tool includes a motor, a battery pack interface that selectively receives a battery pack, a backup power source, and a wireless communication controller coupled to the backup power source and the battery pack interface. The wireless communication controller operates in a connectable state when coupled to a battery pack and transmits tool operational data to the external device and receives tool configuration data from the external device. The wireless communication controller operates in an advertisement state when the wireless communication controller is coupled to and powered by the backup power source. In the advertisement state, the wireless communication controller is configured to transmit the unique tool identifier. The external device may also display an indication of the communication state of the power tool. |
US10516918B2 |
System and method for audio visual content creation and publishing within a controlled environment
Methods and systems for providing content creation and content publishing in a controlled environment are disclosed herein. A media management device receives an audio track including lyrical content. Further, the media management device performs speech recognition analysis on the audio track to determine lyrical text corresponding to the lyrical content. Additionally, the media management device determines whether the audio track contains prohibited content based on comparing the lyrical text to a blacklist of prohibited information. When the audio track does not include prohibited content, the media management device publishes the audio track to a media library accessible to devices within the controlled environment. |
US10516916B2 |
Method of processing video data, device, computer program product, and data construct
The invention relates to a method of processing video data, a device (102) and a computer program product for implementing said method, and a data construct including video data processed by said method. The method processes unprocessed video data into processed video data, said unprocessed video data being provided by picking up (112) sequential images of a situation or scene (100), and includes the steps of: applying a motion and gesture recognition technology (114) in real time to said situation or scene; identifying undesirable image contents contained in said unprocessed video data, based on a result of said motion and gesture recognition, said undesirable image contents preferably including inappropriate body expression (128-132) such as obscene gestures or indecent exposures, and providing content information relating to any identified undesirable image contents; and using said content information to produce said processed video data. |
US10516904B2 |
Controlling delivery of requested content based on delivery bandwidth limitations
A device, computer readable medium, system and method for overcoming bandwidth limitations is disclosed for determining that a bandwidth limitation is related to preventing delivery of content, identifying a version of the content capable of being transmitted over a lower bandwidth, querying a device requesting delivery of the content for an indication of acceptability of a lower bandwidth version of the content instead of a higher bandwidth version, and based on an affirmative response to the querying, causing delivery of the lower bandwidth version. |
US10516901B2 |
Method and apparatus for advanced audio/video stream management to increase advertising opportunity
A system includes a processor configured to store a buffer of accelerable broadcast content. The processor is also configured to determine that a predefined condition exists, defining a situation where content acceleration is appropriate. The processor is further configured to determine a broadcast content playback point where content should be accelerated and playback a predetermined portion of the buffer at a predefined accelerated pace, responsive to reaching the playback point. |
US10516899B2 |
Television with interactive portal and system and method for use of same
A television with an interactive portal and system and method for use of the same are disclosed. In one embodiment of the television, the television is deployed to provide an interactive portal in a hospitality establishment having multiple rooms, such as a hotel. The television is associated with a room and includes a housing that secures a processor, memory, tuner, panel, and audio driver in an interconnected architecture. The television generates a guest interactive portal as well as a housekeeping interactive portal for a guest and housekeeper, respectively. Each of the portals provides relevant feedback on the condition of the room to a server associated with the hotel. |
US10516897B2 |
Image encoding/decoding method using prediction block and apparatus for same
According to the present invention, an image encoding/decoding method comprises the steps of: performing an intra prediction on a current block so as to generate a prediction block; performing filtering on a filtering target pixel in the prediction block on the basis of the intra prediction mode of the current block so as to generate a final prediction block; and generating a reconstructed block on the basis of a reconstructed differential block corresponding to the current block and on the final prediction block. According to the present invention, image encoding/decoding efficiency can be improved. |
US10516896B2 |
Encoding device, encoding method, and storage medium
An encoding device that performs an encoding process on a moving image by using motion estimation according to the present invention includes: an acquisition unit that acquires a framerate of the moving image; a setting unit that performs setting of the number of reference frames on each frame of the moving image in accordance with the framerate; and an estimation unit that performs the motion estimation by using a frame to be encoded and a reference frame acquired based on the setting, and the setting unit performs the setting such that the number of reference frames is smaller when the framerate is higher. |
US10516892B2 |
Initial bandwidth estimation for real-time video transmission
A method for initial estimation of bandwidth for real-time video transmission is disclosed herein. The method comprises determining a round trip delay between a video sender and a video receiver, transmitting, by the sender starting from a first point in time, a series of data packets having a packet size based on a predetermined encoder bitrate, receiving, by the sender and at a second point in time, a message from the receiver, wherein the received message comprises a parameter indicative of a total number of bits received by the receiver, determining, by the sender using a processor, an initial estimated bandwidth, based on the received parameter, the first and second points in time, and the round trip delay, and transmitting, to the receiver, a video bitstream using the initial estimated bandwidth. The method can be implemented during a process of establishing a call between the sender and the receiver. |
US10516890B2 |
Accelerating machine optimisation processes
A method for training learned hierarchical algorithms, the method comprising the steps of receiving input data and generating metrics from the input data. At least one hierarchical algorithm is then selected from a plurality of predetermined hierarchical algorithms based on comparing the generated metrics from the input data and like metrics for each of the plurality of predetermined hierarchical algorithms. The selected hierarchical algorithm is developed based on the input data and the developed hierarchical algorithm is outputted. |
US10516889B2 |
High precision up-sampling in scalable coding of high bit-depth video
The precision of up-sampling operations in a layered coding system is preserved when operating on video data with high bit-depth. In response to bit-depth requirements of the video coding or decoding system, scaling and rounding parameters are determined for a separable up-scaling filter. Input data are first filtered across a first spatial direction using a first rounding parameter to generate first up-sampled data. First intermediate data are generated by scaling the first up-sampled data using a first shift parameter. The intermediate data are then filtered across a second spatial direction using a second rounding parameter to generate second up-sampled data. Second intermediate data are generated by scaling the second up-sampled data using a second shift parameter. Final up-sampled data may be generated by clipping the second intermediate data. |
US10516878B1 |
Stereoscopic viewer
Features for a lightweight stereoscopic viewing client are described. The client can generate accurate ground point coordinates from selections within the lightweight viewer by accumulating the transformations from original image sources to the images used to render the stereoscopic scene to accurately predict error for a point selection. The viewer may also be decoupled from a permanent image store allowing on-demand retrieval of images via a network for stereoscopic viewing. |
US10516872B2 |
Digital enveloping for digital right management and re-broadcasting
An apparatus includes a memory storing a digital envelope and a wavefront demultiplexing (WFD) device which receives M input streams concurrently, M being an integer greater than 1, performs a WFD transformation on the M input streams, and generates M output streams concurrently. A first input stream includes wavefront multiplexed digital identifiers for digital right management. A second input stream is the digital envelope. The first input stream presented in a digital format appears to human perception as having identical features to the digital envelope presented in the digital format. Each output stream is a linear combination of the M input streams such that the digital identifiers are recovered from at least one of the M output streams. The digital envelope is a data file used by a sender to send the M input streams and is scaled with a magnification factor greater than 1 in the WFD transformation. |
US10516867B2 |
Color conversion device, display device including the same, and method of converting color
A color conversion device includes a conversion determination module which receives input image data including a plurality of pixel data, and to determine whether a dominant color of an input image represented by the input image data is within a predetermined color conversion region, a color conversion module which performs color conversion on pixel data representing a color within the color conversion region among the plurality of pixel data when the dominant color of the input image is within the color conversion region, and a luminance conversion module which performs luminance conversion on pixel data representing a luminance within a predetermined middle luminance region among the pixel data on which the color conversion is performed. |
US10516865B2 |
Endoscopic image enhancement using contrast limited adaptive histogram equalization (CLAHE) implemented in a processor
Systems and methods of enhancing images use a contrast limited adaptive histogram equalization (CLAHE) algorithm in a field programmable gate array (FPGA). The images may be obtained by the imaging elements of a multiple imaging elements endoscope of an endoscopy system. |
US10516864B2 |
Projector system
Cameras that are four imagers that form an imaging system are so configured as to be capable of acquiring parallax information based on two sets of parallax images that differ from each other in terms of imaging range for acquisition of the parallax information with the inter-camera distance reduced. The acquired parallax information is used to detect a pointing element on an irradiated region that is a projection screen to achieve interactive image projection. |
US10516861B2 |
Image sensor for improving depth of field of image, and method for operating same
An image sensor included in a camera system comprises: a plurality of photodiodes for processing optical signals which have passed through a lens included in the camera system; and at least one mask, disposed on the top of at least one photodiode among the plurality of photodiodes, for enabling the optical signals which have passed through an inner region of the lens included in the camera system to enter the at least one photodiode. |
US10516860B2 |
Image processing method, storage medium, and terminal
The present disclosure provides an image processing method, device, terminal, and storage medium. The method includes: obtaining an RGB-NIR image sensor replacing a G component in a Bayer RGGB mode with an NIR component; using the RGB-NIR image sensor to obtain an RGB-NIR RAW image; and obtaining an RGB image and a near-infrared (NIR) image by demosaicing the RGB-NIR RAW image based on a vector median method. |
US10516859B2 |
Solid-state image sensor and electronic device
The present technology relates to a solid-state image sensor and an electronic device that can expand a dynamic range while suppressing degradation of image quality.A solid-state image sensor includes a pixel unit in which basic pattern pixel groups are arranged, each of the basic pattern pixel groups having output pixels of a plurality of colors arranged according to a predetermined pattern, the output pixel being a pixel based on an output unit of a pixel signal, the output pixel of at least one color among the output pixels having three or more types of sizes, and a signal processing unit configured to perform synthesis processing for a plurality of the pixel signals from a plurality of the output pixels having a same color and different sizes. The present technology can be applied to, for example, a CMOS image sensor. |
US10516858B2 |
Monitoring system, monitoring method, and program
A plurality of fixed cameras installed in a driving area on a highway and a server device are connected via a network NW. The server device displays the captured images of the fixed cameras on the fixed camera monitor and requests camera position information and zooming position information to respective fixed cameras in response to occurrence of a traffic accident or the like in the driving area. In response to this request, the fixed cameras transmit the camera position information and the zooming position information to the server device. Based on camera position information and zooming position information, the server device derives the occurrence position of a traffic accident or the like, instructs a predetermined drone to capture the image around the occurrence position such as a traffic accident, and displays the captured image transmitted from the drone on a drone monitor. |
US10516854B2 |
Underwater camera assembly
An underwater camera assembly is configured to be dragged behind a boat underwater. The camera assembly includes a housing having a hollow interior that is configured to hold a camera in waterproof manner. The camera assembly includes at least one rail disposed along an outer surface of the housing and being configured to slidingly receive and interlockingly engage a first accessory (camera positioning fin). The camera assembly can further include a second accessory (trolling fin) that is also interlockingly, yet releasably, engaged to the housing. |
US10516850B2 |
Method and system for recalling and replaying content during a communications session
Methods and apparatus for recalling and replaying content during a communications session are provided herein. In some embodiments, methods for replaying content during a communications session may comprise detecting a real-time communications session between two or more participant devices, storing content of the communications session transmitted between the two or more participant devices as the real-time communications session persists, receiving a control request from a first participant device of the two or more participants devices to replay a portion of the content; and transmitting the portion of the content to at least one of the participant devices as the real-time communications session persists. |
US10516845B2 |
Sensors and systems for the capture of scenes and events in space and time
Various embodiments comprise apparatuses and methods including a light sensor. In one embodiment, an integrated circuit includes an image sensing array region, a first photosensor having a light-sensitive region outside of the image sensing array region, and control circuitry. The control circuitry is arranged in a first mode to read out image data from the image sensing array region, where the data provide information indicative of an image incident on the image sensing array region of the integrated circuit. The control circuitry is arranged in a second mode to read out a signal from the first photosensor indicative of intensity of light incident on the light-sensitive region of the first photosensor. Electrical power consumed by the integrated circuit during the second mode is at least ten times lower than electrical power consumed by the integrated circuit during the first mode. Additional methods and apparatuses are described. |
US10516842B2 |
Driving method of semiconductor device and electronic device
A driving method of a semiconductor device that takes three-dimensional images with short duration is provided. In a first step, a light source starts to emit light, and first potential corresponding to the total amount of light received by a first photoelectric conversion element and a second photoelectric conversion element is written to a first charge accumulation region. In a second step, the light source stops emitting light and second potential corresponding to the total amount of light received by the first photoelectric conversion element and the second photoelectric conversion element is written to a second charge accumulation region. In a third step, first data corresponding to the potential written to the first charge accumulation region is read. In a fourth step, second data corresponding to the potential written to the second charge accumulation region is read. |
US10516839B2 |
Image sensor, imaging method, and electronic apparatus
The present technology relates to an image sensor, an imaging method, and an electronic apparatus that are capable of improving the image quality. It includes a plurality of signal lines for reading signals from pixels including a photoelectric conversion element, each of the plurality of signal lines being provided for one column of pixels, and a fixing unit configured to fix the potential of the plurality of signal lines to a predetermined potential, is started. The fixing unit fixes the potential of the plurality of signal lines before an operation of resetting the pixel. It is possible to fix the potential of the signal line to a predetermined potential before reading of the signal from the pixel, and to prevent the image quality from degrading due to the discrepancy in the potential when reading is started. |
US10516837B2 |
Shading correction apparatus and method for operating shading correction apparatus
A correction plate has the same plane size as a small region obtained by equally dividing an image detection region. In addition, the correction plates whose number is equal to the number of small regions are prepared. In a maintenance mode, a plurality of correction plates are laid in the image detection region such that the entire image detection region is covered with the plurality of correction plates. In this state, scanning is performed and a correction image signal obtained by detecting fluorescent light from the correction plate is output. An acquisition unit of a console acquires a correction image signal and a creation unit creates a correction image on the basis of the correction image signal. A correction unit performs shading correction on the basis of the correction image. |
US10516836B2 |
Imaging device
An imaging device includes a light splitting unit which splits first light from a subject into second light and third light, first and second imaging units, and an arithmetic unit. The first light includes the second light having infrared light and at least one of green light and blue light, and the third light having red light or the green light. The first imaging unit includes a first and a second light reception regions. The first light reception region generates at least one of the group consisting of a B signal according to the blue light and a G signal according to the green light. The second light reception region generates an IR signal according to the infrared light. The arithmetic unit generates a visible light image signal from the R signal, the G signal, and the B signal and generates an infrared light image signal from the IR signal. |
US10516829B2 |
Mobile terminal and method for controlling same
The present invention relates to a mobile terminal which can be implemented by allowing a user to use the terminal more conveniently, and a method for controlling the same. The present invention may comprise a camera, a display, and a control unit which enlarges a partial region of an original image photographed by the camera at a predetermined magnification and displays the original image and the enlarged image simultaneously on the display, wherein the control unit, upon receiving a magnification photographing input from a user input unit, can activate the camera for photographing, enlarge a partial region of the original image photographed by the camera at a predetermined magnification and display the original image and the enlarged image simultaneously on the display. |
US10516827B2 |
Imaging apparatus, control method, and non-transitory storage medium
According to an aspect of the invention, an imaging apparatus includes: a focal point detection unit configured to perform focal point detection on the basis of a phase difference between a plurality of image signals obtained by photoelectric conversion of light fluxes each passing through different pupil partial regions of an imaging optical system; an image blur compensation unit configured to compensate for image blur; and a control unit configured to set a position at which a vignetting amount occurring in a light flux passing through the imaging optical system is equal to or less than a predetermined value during a period in which the focal point detection is performed by the focal point detection unit as a center position of a driving amplitude to perform drive control of the image blur compensation unit. |
US10516823B2 |
Camera with movement detection
An omnidirectional camera is presented. The camera comprises: at least one lens coupled to an image sensor, a controller coupled to the image sensor, and a movement detection element coupled to the controller. The movement detection element is configured to detect a speed and direction of movement of the camera, the camera is configured to capture images via the at least one lens coupled to the image sensor, and the controller is configured to select a digital viewpoint in the captured images. A central point of the digital viewpoint is selected on the basis of direction of movement, and a field of view of the digital viewpoint is based on the speed of movement. A system and method are also presented. |
US10516819B2 |
Electronic device with multiple lenses and lens switching method
An electronic device able to automatically select one of a plurality of lenses includes a lens module, an image sensor, a focusing module, and a processor. The lens module includes a standard lens, a macro lens, and a telephoto lens. The image sensor captures images and the focusing module controls the lenses to automatically focus on the object. The processor selects the standard lens as a current lens, obtains a first focusing distance at a first moment and a second focusing distance at a second moment, and determines to switch the current lens or not to switch according to a comparison of the first and second focusing distances. The second moment is later than the first moment. A lens switching method is also provided. |
US10516814B2 |
Camera assembly and electronic device
The present disclosure provides a camera assembly and an electronic device. The camera assembly includes a camera module, a motor and a transmission module. The transmission module is connected between the camera module and the motor. The motor is configured to drive the transmission module so as to drive the camera module to move. The transmission module defines at least one concave part set on a lateral wall of the transmission module. Thus, an empty space may be formed above the concave part. In the electronic device, the empty space may be utilized as the clearance area of the antenna radiator inside the electronic device. Therefore, the performance of the antenna installed close to the camera module may be improved. |
US10516806B2 |
Processing color image of first color space into renderable image of second color space
A color image is processed into a renderable image. The color image comprises a plurality of pixels. Each pixel has colorimetry defined in a first color space. The renderable image comprises a plurality of renderable pixels defined by a device-vector in a second color space. For each pixel: a device-vector defined in the second color space is selected (301) based on the colorimetry defined in a first color space of the pixel. The device-vector comprises a plurality of elements. Each element includes an identifier and an accumulated weighting. An element of the selected device-vector is reselected (303) until the accumulated weighting (a) is greater than a threshold value (t) associated with the pixel (305). The levels for each color of the second color space (or mappings) for the currently selected (307) element of the selected device-vector is determined (309) to convert the pixel into a renderable pixel. |
US10516794B1 |
Image reading apparatus and image forming apparatus with document width detection
An image reading apparatus includes an image reading unit, a document pressing unit, a first position detection unit, a second position detection unit, and a controller. The image reading unit reads an image of a document. The document pressing unit presses the document against a document placement component. The first position detection unit detects a first closed position at which the document pressing unit is not in contact with the document placement component. The second position detection unit detects a second closed position that is closer to the document placement component than the first closed position is. The controller performs first width detection on the document and further performs second width detection. The first width detection is performed in accordance with detection performed by the first position detection unit on a closing operation of the document pressing unit. The second width detection is performed after elapse of a predetermined time in accordance with detection performed by the second position detection unit on the closing operation of the document pressing unit. If the controller receives an image reading instruction before the elapse of the predetermined time, the controller performs the second width detection without waiting for the elapse of the predetermined time and starts an image reading process. |
US10516793B2 |
Image forming apparatus capable of customizing operation screen based on personal setting information and method for controlling image forming apparatus
An image forming apparatus includes an obtaining unit that obtains personal setting information about a user who logs into the image forming apparatus from a server apparatus and a display control unit that controls a display unit to display a customized operation screen customized for the user based on the obtained personal setting information. If the personal setting information has been obtained from the server apparatus within a predetermined time, the customized operation screen is displayed. If the personal setting information has been obtained from the server apparatus after the predetermined time elapses, the customized operation screen is not displayed. |
US10516792B2 |
Setting conditions for image processing in an image forming apparatus
An image forming apparatus includes: an image acquiring section configured to acquire an image formation target page image; a display control section configured to perform processing for displaying the page image in a preview display area; an operation-input acquiring section configured to acquire a first operation input for designating a first position in a designatable area and a second operation input for designating a second position in the preview display area; a determining section configured to determine which allocation setting area corresponding to which number of page images is designated as an area where processing for setting a number of page images allocated to one sheet is executed; and a setting section configured to apply setting of a number of page images allocated to one sheet to the page image for which the first operation input is performed. |
US10516791B2 |
Information processing system, information processing apparatus, and information processing method for executing an iteration of one or more processes
An information processing system includes a memory and processors. The memory stores flow information and flow identification information for each process sequence performed by using electronic data. The flow information defines program identification information identifying programs for executing the process sequence, and an execution order of the programs. The processors execute computer-executable instructions stored in the memory to execute a process including receiving information relating to the electronic data and the flow identification information, from a device coupled to the system; acquiring the flow information stored in association with the received flow identification information; and executing the process sequence based on the information relating to the electronic data, by executing the programs identified by the program identification information defined in the acquired flow information, in the execution order. When the process sequence includes an iteration of processes, the processes are repeatedly executed according to a condition of the iteration. |
US10516785B2 |
Methods and systems for controlled distribution of data transfer capacity between mobile devices
Systems and methods enable distribution of data transfer capacity in a WWAN between mobile devices. The data transfer capacity is given by a data plan for the respective mobile device. The systems and methods register first and second mobile devices with a transaction service as acquirers and providers, respectively, of data transfer capacity. The systems and methods detect when a first mobile device indicates a desire to acquire data transfer capacity, identify one or more second mobile devices that are located within reach for short-range communication with the first mobile device, and connect the first mobile device by short-range communication to one of the second mobile devices such that the first mobile device is tethered to the WWAN by this second mobile device. The systems and methods may also distribute authentication data to enable the first mobile device to be authenticated by the second mobile device. |
US10516784B2 |
Systems and methods for classifying phone numbers based on node profile data
The present disclosure relates to methods, systems, and storage media for classifying phone numbers based on node profile data. Exemplary embodiments for classifying phone numbers based on node profile data may maintain a plurality of node profiles and generate a plurality of activity field-value pairs from an electronic activity. Each activity field-value pair of the plurality of activity field-value pairs corresponding to at least one participant of the electronic activity. Exemplary embodiments may further parse the electronic activity to identify a string corresponding to an electronic activity phone number, determine a type of phone number to which the electronic activity phone number corresponds using a data structure, identify a node profile of the plurality of node profiles corresponding to a participant of the electronic activity to which the electronic activity phone number corresponds, and update the identified node profile by the determined phone number type. |
US10516783B2 |
Method and device for processing PCC rule
Provided herein are a method and device for processing a PCC rule. The method comprises: receiving first internet protocol (IP) stream mapping information transmitted by a UE and used for requesting the processing of an IP stream; determining, on the basis of the first IP stream mapping information, first routing rule information comprising a first PCC rule identification of a first PCC rule corresponding to the IP stream or first filter identifier of a first filter corresponding to the IP stream, where the first filter is a filter that the first PCC rule comprises; transmitting the first routing rule information to a policy and charging rules function entity (PCRF), thus instructing the PCRF to process the first PCC rule according to the first routing rule information. |
US10516781B1 |
Originating calls in a contact center either in a voice dialing mode or a text dialing mode
A dialing list comprising call records can be processed by a call handling component(s) in a contact center in various dialing modes. A call record may be processed to originate a voice call, where the agent manually dials the call as a voice telephone call. In another embodiment, the call record can be processed to originate a SMS text call, where the agent also determines when the call originates. In each embodiment, the agent is presented with a graphical user interface tailored to the dialing mode. The dialing mode used may be defined by the dialing list the call record is retrieved from, information from within the call record itself, application of a rule, or input from the agent. Once the dialing mode is selected, it may be altered under certain conditions. When the call is originated, various compliance oriented tests, including calling windows and call attempts, are performed. |
US10516779B2 |
Escalation to a human operator
Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, relating to synthetic call initiations and bailouts. In some implementations, a method includes analyzing, by a call initiating system, a real-time conversation between a first human and the bot during a phone call between the first human on a first end of the phone call and the bot on a second end of the phone call. The call initiating system can determine, based on the analysis of the real-time conversation, whether the phone call should be transitioned from the bot to a second human on the second end of the phone call. In response to determining that the phone call should be transitioned to a second human on the second end of the phone call, the call initiating system transitions the phone call from the bot to the second human. |
US10516777B1 |
Enhanced user experience for voice communication
Methods, systems and devices are provided to enable voice activity following a call interruption or when a call experiences or will experience interruption or diminished quality such that call experience is affected to be relayed to the communication device of the other party to the call. When an indication that an active voice call with another communication device is or will experience interruption or diminished quality such that call experience is affected, audio received from a microphone of the communication device may be recorded. A message may be generated from recorded audio and the generated message may be transmitted to the other communication device. Generation and/or transmission of the message may be performed in response to user inputs. |
US10516775B1 |
Method and system for communication
Provided is a computer implemented method and system for delivering text messages, emails, and messages from a messenger application to a user while the user is engaged in an activity, such as driving, exercising, or working. Typically, the emails and other messages are announced to the user and read aloud without any user input. In Drive Mode, while the user is driving, a clean interface is shown to the user, and the user can hear announcements and messages/emails aloud without looking at the screen of the phone, and use gestures to operate the phone. After a determination is made that a new text message and/or email has arrived, the user is informed aloud of the text message/email/messenger message and in most instances, and if the user takes no further action, the body and/or subject of the text message/email/messenger message is read aloud to the user. All messages can be placed in a single queue, and read to the user in order of receipt. |
US10516774B2 |
Method for configuring a wireless device
A method for configuring a first electronic device that includes first and second wireless communication systems. A first wireless connection is established between the first electronic device and a second electronic device using the first wireless communication system. Configuration information pertaining to the second wireless communication system is transmitted from the first electronic device to the second electronic device using the first wireless connection. Configuration instructions are transmitted from the second electronic device to the first electronic device over the first wireless connection. The configuration instructions are used to configure the first electronic device to communicate using the second wireless communication system, and the first wireless connection can then be terminated. |
US10516771B2 |
Apparatus for transmitting broadcast signal, apparatus for receiving broadcast signal, method for transmitting broadcast signal and method for receiving broadcast signal
A method and apparatus for transmitting or receiving a broadcast signal are discussed. The method for transmitting includes generating service data of a broadcast service, first signaling information for signaling the service data and second signaling information including information for locating the first signaling information, wherein the second signaling information further includes information for identifying the broadcast service and uniform resource locator (URL) information for obtaining the first signaling information, wherein the URL information to which additional information is appended is used for generating a request for obtaining the first signaling information, and wherein the additional information includes information for indicating which type of the first signaling information is requested; generating a broadcast signal including the service data and the second signaling information; and transmitting the broadcast signal. |
US10516770B2 |
Transmitting entity and method performed thereby for transmitting one or more data packets to a receiving entity
A transmitting entity and a method performed thereby for transmitting one or more data packets to a receiving entity is provided. The transmitting entity and the receiving entity are operable in a communication network. The method performed by the transmitting entity comprises receiving, from an application, a user layer packet, ULP, to be transmitted by means of a transport layer packet, TLP, to the receiving entity. The method further comprises bundling the received ULP together with one or more additional received ULPs in a TLP when a rate of incoming data, bytes or ULPs from the application meets a threshold; and transmitting the TLP to the receiving entity. |
US10516768B2 |
Methods and systems for switching vehicle data transmission modes based on detecting a trigger and a request for a vehicle data message
A vehicle interface device (VID) switches to a first vehicle data transmission mode (VDTM) from a prior VDTM based on a trigger for transmitting vehicle data messages (VDMs) and which VDMs have been requested at a vehicle data receptor (VDR). A decreased data transfer rate may result from selecting the first VDTM such that some portions of VDMs received while the VID is operating in the other VDTM are transmitted to the VDR from the VID and other portions of those VDMs are not transmitted to the VDR from the VID. An increased data transfer rate may result from selecting the first VDTM such that some portions of VDMs received while the VID is operating in the first VDTM are transmitted to the VDR from the VID whereas those same portions would not have been transmitted to the VDR from the VID if the VID was still operating in the prior VDTM. |
US10516767B2 |
Unifying realtime and static data for presenting over a web service
A method of presenting data over a Web service interface includes: establishing, by a first computer process, a persistent transmission control protocol (TCP) network connection between the first computer process and a second computer process; dynamically allocating, by the second computer process, memory in response to receipt of static data over the persistent TCP network connection from the first computer process; updating, by the second computer process, the memory in response to receipt of dynamic data received over the persistent TCP network connection from the first computer process; and enabling, by the second computer process, a Web server to access the updated data for presentation by the Web service interface. The static data identifies a given entity and the dynamic data includes metric data provided for the entity. |
US10516764B1 |
Efficient modification of compressed data
A computing device may receive a compress data streams which may then be decompressed to generate decompressed data. The computing device may then determine if the decompressed data includes a flag indicating that the decompressed data should be modified. If the decompressed data is to be modified, the computing device may add padding values to the compressed data stream until a boundary block of the compressed data stream is reached. The modified compressed data stream may then be transmitted to an endpoint. |
US10516761B1 |
Configuring and managing network devices using program overlay on Yang-based graph database
In one example, a network management system (NMS) device manages a plurality of network devices. The NMS device includes one or more processing units, implemented using digital logic circuitry, configured to receive configuration data for a plurality of network devices managed by the NMS device, construct a graph database representing the configuration data, wherein to construct the graph database, the one or more processing units are configured to construct a plurality of vertices representing respective elements of the configuration data, and connect related vertices of the plurality of vertices with edges. The one or more processing units are further configured to manage the plurality of network devices using the graph database. |
US10516759B2 |
System and method for centralized management of software services
Software services are managed from a single machine performing a service. Service providers offering SaaS applications solicit the single machine. Each service provider provides roles and device requirements for performing the corresponding SaaS. The single machine maintains a database that logs the software services offered by the service providers. Whenever a software service is needed, the single machine inventories its client devices for their resource capabilities and compares to the device requirements in the database. The database reveals the client machine(s) that best performs the role for the corresponding SaaS. Software services are thus integrated and managed from the single machine, thus allowing software services to be efficiently and quickly selected as network resources emerge. |
US10516758B2 |
Method for providing personal information
A method for providing personal information is proposed. A server unit receives preference information of a user from a terminal device, and matches the preference information with another user's preference information in a database according to a matching condition. The server unit provides the another user's preference information to the terminal device when the matching condition is satisfied by the preference information of the user and the another user. |
US10516756B1 |
Selection of a distributed network service
A technology is described for selecting a distributed network service based at least in part on consistency, availability, and partition tolerance (CAP) metrics. An example method may include receiving a client request for a listing of distributed network services and associated CAP metrics that are within a range of at least one CAP specification included in the client request. In response to the client request, a directory service may be queried for a set of distributed network services having the CAP metrics that are within the range of the least one CAP specification included in the client request. A listing of distributed network services that includes the CAP metrics for the distributed network services may be generated from the set of distributed network services, and the listing of distributed network services and CAP metrics may be returned in response to the client request. |
US10516747B2 |
Method and system for tracing end-to-end transaction, including browser side processing and end user performance experience
A system is provided for tracing end-to-end transactions. The system uses bytecode instrumentation and a dynamically injected agent to gather web server side tracing data, and a browser agent which is injected into browser content to instrument browser content and to capture tracing data about browser side activities. Requests sent during monitored browser activities are tagged with correlation data. On the web server side, this correlation information is transferred to tracing data that describes handling of the request. This tracing data is sent to an analysis server which creates tracing information which describes the server side execution of the transaction and which is tagged with the correlation data allowing the identification of the causing browser side activity. The analysis server receives the browser side information, finds matching server side transactions and merges browser side tracing information with matching server side transaction information to form tracing information that describes end-to-end transactions. |
US10516739B2 |
Method for communicating between asset health monitoring devices
An extensible computing system integrates asset health data and user control of devices made by different manufacturers, using a common computer platform application structure and a common platform services structure. A services bus communicates device signals in a standardized format from the common platform services structure to a proprietary extension services structure, which converts the device communication signals from the standardized format to a proprietary communication format. A data highway bus communicates asset health and reliability data in a standardized data format from the proprietary extension services structure to the common extension services structure. The proprietary services structure converts asset health data from a proprietary data format as received from the proprietary device into the standardized data format. An input communicates data in the proprietary data format from the proprietary device to the computer, and an output sends communication signals in the proprietary communication format to the proprietary device. |
US10516729B2 |
Dynamic graph adaptation for stream processing over hybrid, physically disparate analytics platforms
Dynamic graph adaptation for stream processing over hybrid, physically disparate analytics platforms, by means of a computer-implemented method that includes obtaining a streaming application graph, generating a partitioned graph by partitioning the streaming application graph in response to a topology descriptor and a partitioning algorithm, compiling the partitioned graph into a plurality of subgraphs for deployment to a plurality of respective runtimes that are described by the topology descriptor, and deploying the plurality of subgraphs to the plurality of respective runtimes. |
US10516726B2 |
Data partitioning in internet-of-things (IOT) network
A method for data partitioning in an internet-of-things (IoT) network is described. The method includes determining number of computing nodes in the IoT network capable of contributing in processing of a data set. At least one capacity parameter associated with each computing node in the IoT network and each communication link between a computing node and a data analytics system can be ascertained. The capacity parameter can indicate a computational capacity for each computing node and communication capacity for each communication link. An availability status, indicating temporal availability, of each of computing nodes and each communication link is determined. The data set is partitioned into subsets, based on the number of computing nodes, the capacity parameter and the availability status, for parallel processing of the subsets. |
US10516722B2 |
Mobile application system
A method includes accessing a webpage at a web server from a mobile application executing at a mobile device. A mobile application tag may be identified in the webpage, where the mobile application tag is independent of a device type of the mobile device. The method also includes determining that the mobile application tag corresponds to a native device function of the mobile device and accessing the native device function. |
US10516719B1 |
Wearable device registration system and method
Disclosed is a system and method for searching and registering a wearable Bluetooth device in a surrounding area. The searching Bluetooth device broadcasts a session description protocol (SDP) request message by executing the SDP. When the SDP request message broadcast by the searching Bluetooth device is received, a surrounding Bluetooth device executes the SDP, generates an SDP response message, and transmits the SDP response message to the searching Bluetooth device. When the SDP response message is received, the searching Bluetooth device requests that the server provide the detailed information file of the surrounding Bluetooth device, based on server access information included in the SDP response message. When the detailed information file of the surrounding Bluetooth device is received from the server, the searching Bluetooth device stores the detailed information file. |
US10516718B2 |
Platform for multiple device playout
Provided is a platform for data devices in which the architecture and runtime parameters of the platform are adaptively updated based on real-time data collected about a network on which the platform operates, the source type (e.g., codec selection) for data being communicated between devices, the grouping/architecture of the devices, or any combination thereof. The platform is thus able to support multiple different types and configurations of data devices under varied, constantly-changing conditions. The platform offers a flexible architecture for a content management and rendering system in which multiple data devices connected via the network each play a unique role in the operation of the system. The data devices are capable of dynamically switching between different roles while the system is in active operation. The platform also includes adaptive delay capabilities as well as adaptive codec selection capabilities. |
US10516717B2 |
Network-initiated content streaming control
Methods and systems are described for enabling network-initiated control of streaming of segmented content from a content delivery node to at least one client, the client being configured to access at least part of the segmented content on the basis of a manifest file. A first manifest file is received identifying one or more segments and location information for locating one or more content delivery nodes configured to transmit one or more segments to at least one client. In response to reception of the first manifest file, channel set-up information is provided. At least one streaming control channel is established between at least one client and a control channel server function associated with the content delivery node on the basis of the control channel set-up information. The at least one client is configured for receiving at least one manifest file update message via the streaming control channel. |
US10516712B2 |
Streaming media data transmission method, client and server
A streaming media data transmission method, client and server are used to solve the problem of long time delay of decoding because the client waits a segment with a higher code rate. The client includes: a first processing module configured to determine whether a server distributes a plurality of segments with same content and different code rates; and a second processing module configured to determine whether the server transmits a segment with a high code rate first or transmits a segment with a low code rate first when the first processing module determines that the server distributes a plurality of segments with same content and different code rates. When the client determines that the server transmits the segment with a high code rate first, a received segment is decoded directly, thereby shortening time delay of decoding at the client. |
US10516711B2 |
Routing data over wireless communication links
Certain examples accommodate data routing optimizations. An example method comprises receiving, by a first playback device, data to be directed to at least a second playback device, the data comprising: i) audio data and ii) non-audio data. The method comprises transmitting, by the first playback device, the non-audio data to the second playback device via a third playback device according to a network protocol for communication between the first playback device and at least the second playback device via a wireless communication link. The method further comprises determining, by the first playback device, that a signal strength of the wireless communication link is above a threshold, and in response to the determination, transmitting the audio data to the second playback device via the wireless communication link, wherein transmitting the audio data comprises transmitting the audio data over the wireless communication link not according to the network protocol. |
US10516709B2 |
Files automatically shared at conference initiation
The present technology automatically shares materials at the start of a videoconference without requiring a participant to find the materials or instruct the videoconferencing application to share the materials. The conference materials can be automatically shared without any conference participant involvement. The present technology automatically associates materials included in a calendar invitation to the conference or in a shared space referenced in the calendar invitation. These materials can be automatically shared when the conference launches. |
US10516708B2 |
Method for providing conference service and apparatus thereof
Methods for providing conference service and apparatus thereof are provided, one of methods comprises, receiving identification information of a first user and identification information of a first terminal of the first user from the first terminal of the first terminal, receiving identification information of the first user and identification information of a second terminal of the first user from the second terminal of the first terminal, transmitting first contents to the first terminal of the first user and receiving at least one first reaction information about the first contents from the second terminal of the first user. |
US10516702B2 |
Managing mid-dialog session initiation protocol (SIP) messages
Processing mid-dialog SIP messages by receiving a mid-dialog SIP message from a SIP user agent client, creating a new SIP session, associating the new SIP session with the mid-dialog SIP message, identifying an application that is associated with the mid-dialog SIP message, providing to the application the mid-dialog SIP message in the context of the new SIP session, receiving an acknowledgement from the application that the application will accept the mid-dialog SIP message, and responsive to receiving the acknowledgement, providing to the application the mid-dialog SIP message in the context of the new SIP session. |
US10516693B2 |
Cyber security
Disclosed herein is a method for use in detection of abnormal behavior of a group of a plurality of entities of a computer system. The method is arranged to be performed by a processing system and includes: creating a model of normal behavior of the group of entities; and determining, in accordance with the model of normal behavior of the group of entities, a parameter indicative of abnormal behavior of the group of entities. Also disclosed is an equivalent computer readable medium and anomalous behavior detection system. |
US10516689B2 |
Distributed data surveillance in a community capture environment
Data surveillance techniques are presented for the detection of security issues, especially of the kind where privileged data may be stolen by steganographic, data manipulation or any form of exfiltration attempts. Such attempts may be made by rogue users or admins from the inside of a network, or from outside hackers who are able to intrude into the network and impersonate themselves as legitimate users. The system and methods use a triangulation process whereby analytical results pertaining to data protocol, user-behavior and packet content are combined to establish a baseline for the data. Subsequent incoming data is then scored and compared against the baseline to detect any security anomalies. The design incorporates deployment in a distributed network so that the devices of the network participate in the detection of anomalies as a community. |
US10516686B2 |
Malware and anomaly detection via activity recognition based on sensor data
A system for malware and anomaly detection via activity recognition based on sensor is disclosed. The system may analyze sensor data collected during a selected time period from one or more sensors that are associated with a device. Once the sensor data is analyzed, the system may determine a context of the device when the device is in a connected state. The system may determine the context of the device based on the sensor data collected during the selected time period. The system may also determine if traffic received or transmitted by the device during the connected state is in a white list. Furthermore, the system may transmit an alert if the traffic is determined to not be in the white list or if the context determined for the device indicates that the context does not correlate with the traffic. |
US10516685B2 |
Analysis method, analysis device and analysis program
In order to detect an attack to a web application accurately by accurately correlating different types of events having occurred in the same server, an event acquiring unit acquires a log of events containing a HTTP request to a server, an event correlator creates a set of the request and events relevant to the request as an event block by using process IDs of processes having processed events contained in the log, and an attack detector contrasts the event block that is created from the log of events in which an attack is to be detected with an event block that is created from normal events to calculate a degree of similarity and, when the degree of similarity is equal to or lower than a threshold, detects the event block as an event block containing an event that is abnormal due to an attack. |
US10516684B1 |
Recommending and prioritizing computer log anomalies
Computer log entries are processed to determine a plurality of baseline rank values associated with a ranking dimension. An overall baseline rank indicator is computed using the determined baseline rank values. For each log data component value combination included in a group of log data component value combinations, a comparison rank value associated with the ranking dimension is determined. Each of the comparison rank values is compared with the overall baseline rank indicator. Based at least in part on the comparisons, one or more log data component value combinations included in the group of log data component value combinations are identified as more anomalous than other log data component value combinations included in the group of log data component value combinations. |
US10516683B2 |
Systems and methods for security breach detection in vehicle communication systems
Systems and methods for detection of security breaches in intravehicular communication systems are disclosed. In some embodiments, this may include intravehicular communication using messages sent with a checksum and a dynamic mathematical operator field. Errors in the checksum may be interpreted as ordinary transmission errors, whereas errors in the dynamic mathematical operator field may be interpreted as potential threats. Repeated errors in the dynamic mathematical operator, and/or unexpected messages in the intravehicular communications, may be interpreted as confirmed hacking. Upon confirmation of hacking, a warning may be issued to an operator and a vehicle safe mode may be entered, including restricting vehicle functionality. |
US10516680B1 |
Systems and methods for assessing cyber risks using incident-origin information
A computer-implemented method for assessing cyber risks using incident-origin information may include (1) receiving a request for a cyber-risk assessment of an entity of interest, (2) using an Internet-address data source that maps identifiers of entities to public Internet addresses of the entities to translate an identifier of the entity into a set of Internet addresses of the entity, (3) using an incident-origin data source that maps externally-detected security incidents to public Internet addresses from which the security incidents originated to translate the set of Internet addresses into a set of security incidents that originated from the entity, and (4) using the set of security incidents to generate the cyber-risk assessment of the entity. Various other methods, systems, and computer-readable media may have similar features. |
US10516679B2 |
Authenticated data streaming
A data-collecting device acquires data associated with a real-time data stream and transmits the data to a data-consuming service hosted on a server computer system in the form of a multipart response. The multipart response includes one or more data content parts and at least one authentication content part. Each of the one or more data content parts contains data representing part of the real-time data stream. Each authentication content part includes authentication information usable to verify the integrity of the data transmitted in the data content parts transmitted prior to the authentication content part. |
US10516676B2 |
Verification of geolocation of devices in a cloud data center
A processor-implemented method alters a computer resource based on its new geolocation. One or more processors receive a message that a computer resource has moved from a first geolocation to a new geolocation. The processor(s) receive an identifier of the new geolocation for the computer resource. In response to receiving the identifier of the new geolocation for the computer resource, the processor(s) request and receive encrypted data from the new geolocation. The processor(s) apply decryption information to the encrypted data from the new geolocation, where the decryption information is specifically for decrypting encrypted data from the new geolocation. In response to the decryption information failing to decrypt the encrypted data from the new geolocation, the processor(s) determine that the identifier of the new geolocation is false and apply a geolocation based resource policy to alter the computer resource at the new geolocation. |
US10516675B2 |
Altering application security to support just-in-time access
A method and a computing system for allowing just-in-time (“JIT”) access to a machine is provided. A system receives a request to allow JIT access to the machine. The system directs a port of the machine to be opened for a JIT access period. The system also directs the machine to alter security relating to applications allowed to execute on the machine for the JIT access period. During the JIT access period, the machine can be accessed via the port with the altered security relating to applications. After the JIT access period, the system directs the port to be closed and directs the security to return to the unaltered security. |
US10516671B2 |
Black list generating device, black list generating system, method of generating black list, and program of generating black list
A blacklist generating device acquires a malicious communication log and a normal communication log. A malicious communication profile extracting function calculates statistics on communication patterns included in the malicious communication log and outputs a communication pattern satisfying a certain condition to a potential blacklist. A normal communication profile extracting function calculates statistics on communication patterns included in the normal communication log and outputs a communication pattern satisfying a certain condition to a whitelist. A blacklist creating function searches the potential blacklist for a value with the value on the whitelist, excludes a coincident communication pattern from the potential blacklist, and creates a blacklist. |
US10516670B2 |
Genome sharing
Sharing data is disclosed. In some cases, sharing data includes receiving a request to share data from a first account to a second account, receiving an indication of a plurality of first account profiles associated with the first account to share with the second account, and establishing sharing from the plurality of first account profiles to the second account, wherein sharing comprises the second account having read access to a subset of nonpublic data associated with the plurality of first account profiles. |
US10516668B2 |
Security module and method within an information handling system
A security module and method within an information handling system are disclosed. In a particular form, a processing module can include a local processor configurable to initiate access to resources of a host processing system. The processing module can also include a security module configured to enable use of the resources of the host processing system using a security metric. According to an aspect, the security module can be further configured to detect the security metric, and enable access to a resource of the host processing system in response to the security metric. The security module can further be configured to disable access to another resource of the host processing system in response to the security metric. |
US10516663B2 |
Systems and methods for variable-length encoding and decoding for enhancing computer systems
A method including: parsing a first portion of data into at least one first data word having a default first word length; outputting, in a default word length mode, the at least one first data word; outputting a transition word indicative of transitioning to a variable word length mode; outputting, after the transition word, a first word length word indicative of a second word length; parsing a second portion of the data into at least one second data word having the second word length; and outputting, after the first word length word, the at least one second data word having the second word length. |
US10516658B2 |
Systems and methods for verifying attributes of users of online systems
For sharing of information in a virtual or online environment, methods and systems are provided which enable verifying attributes of an individual. An individual registered for participation in a virtual or online environment may provide evidence of the attributes from a verification source that exists outside the virtual or online environment. An administrator associated with the virtual or online environment verifies the attributes by receipt of the evidence. Alternatively, the attribute for the individual may be verified after receipt of one or more signals indicating individuals registered for participation in the virtual or online environment have corroborated the attributes. A verification indication for an attribute may be shared with other individuals in the virtual or online environment. |
US10516656B2 |
Device, method, and computer program product for secure data communication
The invention relates to devices, methods, and computer program products for secure data communication according to a network protocol having a plurality of communication layers layered into a protocol stack. Said device comprises a processor system, in which a processor, controlled by a task scheduler, executes a plurality of autonomous software modules, which each run a communication layer of the protocol stack. The software modules are linked via communication channels to the protocol stack and the protocol stack is connected to an interface framework for data communication with an external network. At least one software module uses an assigned cryptographic key for secure data communication in its communication layer. The task scheduler is configured to obtain said key from the external network via the interface framework and to distribute said key to the assigned software module. |
US10516653B2 |
Public key pinning for private networks
Disclosed are various approaches for validating public keys pinned to services or servers on private networks. A client device can request a first certificate from a trust service. The client device can then validate that the first certificate from the trust service is signed by a preinstalled certificate stored on the client device. Subsequently, the client device can receive a uniform resource locator identifying a network location of an secure sockets layer (SSL) pinning service, wherein the SSL pinning service is configured to provide a hash value for a first public key issued to a computing device. Finally, the client device can receive a second public key from the trust service, wherein the second public key is configured to encrypt network traffic sent to the SSL pinning service. |
US10516651B2 |
Securely routing sensor data from sensors to a trusted execution environment (TEE)
Various configurations and methods for providing a secure transfer of data from computing device sensors to a Trusted Execution Environment (TEE) are disclosed. As disclosed, various data flows, data sequences, and configurations are provided to allow sensor data to maintain integrity and confidentiality while being accessed by trusted agents of a TEE. In an example, a microcontroller-based TEE is operated to communicate with a sensor hub via a secure hardware channel. The microcontroller-based TEE is configured to receive the sensor data via the secure hardware channel, and communicate the sensor data to other trusted agents in the computing system via secure communications. Other variations of secure communications among multiple sensors, trusted agents, TEEs, and third party services are also disclosed. |
US10516648B2 |
Address translation
A system may include a first network having a first communications protocol, a second network having a second communications protocol and at least one edge device in communication with the first network and the second network. The edge device may include a translator to translate a first address associated with the first network and based on the first communications protocol into a second address associated with the second network and based on the second communications protocol. The second address may include a first address portion based on a first fragment of the first address, a second address portion having a translation key based on a second fragment of the first address and a third address portion having a locator address. |
US10516647B2 |
Method for establishing data connection on mobile network, mobile network, and policy control entity
A method for establishing data connections on a mobile network, a mobile network, and a policy control entity are disclosed. The method includes: establishing a data channel between a user equipment (UE) and a gateway (GW), and allocating an Internet Protocol (IP) address to the UE according to an address allocation request or a data channel setup request sent from the UE; and triggering the policy control entity to establish or update a policy control session according to the IP address. By using the mobile network and the policy control entity under the present disclosure, after the data channel is established between the UE and the GW, the GW may trigger the policy control entity to establish or update a policy control session. |
US10516640B2 |
Group message updating and displaying method, apparatus, and terminal
A message update method includes: displaying a group message reminding identifier on a session entry of a specified group on a session list interface when it is detected that a message in the specified group is updated. The updated message of the specified group is obtained from a server when it is detected that an operation on either of the group message reminding identifier and the specified group meets a message update condition. The number of updated messages of the specified group on the session entry is displayed when it is detected that the operation on either of the group message reminding identifier and the specified group does not meet the message update condition. |
US10516639B2 |
Aggregated notification feeds
Embodiments are described for generating an aggregated notifications feed that organizes notifications into groups of notification thread types. Various notifications in a social media network can be associated with a notification thread, and notification threads can be assigned a thread category. An aggregated notifications feed can be used to provide a user interface with notifications grouped under a corresponding thread category. Grouped notifications can be ordered in several ways such as in reverse chronologic order providing for more relevant notifications to be presented first. This notification ordering can be within a group or can be among groups based on the most recent notification within that group. In some implementations, grouping notifications or ordering notifications can be based on additional parameters such as user preferences, rules obtained for machine learning, or administrator settings. |
US10516638B2 |
Techniques to select and prioritize application of junk email filtering rules
Techniques to select and prioritize the application of spam filtering rules in a way that reduces processing time may include receiving an email message for a recipient at a spam filter and extracting email characteristics from the message. Global filtering rule statistics and a profile for the recipient may be retrieved. The technique may include selecting a subset of rules from a set of filtering rules according to the email characteristics, the global filtering rule statistics, and/or the recipient characteristics. The subset of rules may be prioritized and applied to the message from highest priority to lowest until a determination of whether the message is spam is reached. Other embodiments are described and claimed. |
US10516637B2 |
Smart communications assistant with audio interface
Methods, systems, and computer programs are presented for a smart communications assistant with an audio interface. One method includes an operation for getting messages addressed to a user. The messages are from one or more message sources and each message comprising message data that includes text. The method further includes operations for analyzing the message data to determine a meaning of each message, for generating a score for each message based on the respective message data and the meaning of the message, and for generating a textual summary for the messages based on the message scores and the meaning of the messages. A speech summary is created based on the textual summary and the speech summary is then sent to a speaker associated with the user. The audio interface further allows the user to verbally request actions for the messages. |
US10516633B2 |
Method, system, and storage medium for message processing
The present disclosure is related to the field of communication technologies and provides a method, system, and storage medium for message processing. The method includes the following steps: configuring, by an initiator, a serial number for a message, and sending the message having the configured serial number to a target end; extracting, by the target end, a serial number of a message that a user chooses to reply to, and adding the serial number to a corresponding reply message; and displaying, by the initiator according to the serial number carried in the reply message, the reply message next to a message corresponding to the serial number carried in the reply message. In the present disclosure, the serial number is configured for each message, and the reply message is displayed next to the corresponding message according to the serial number carried in the reply message, thereby improving pertinence between a reply message and its original message. |
US10516632B2 |
Switchable modes for messaging
Techniques for switchable modes for messaging are described. In various implementations, a software application for messaging includes a conversation mode and an engagement mode each representing different respective modes for presenting a message. The engagement mode, for instance, provides a larger portion of an available display area for the message than the conversation mode. According to one or more implementations, switching between the conversation mode and the engagement mode is based on a user behavior indicating a level of engagement of a user relative to the application. |
US10516618B2 |
Preamble design on a shared communication medium
Techniques for managing preamble transmission and processing on a shared communication medium are disclosed. An access point or an access terminal, for example, may generate a preamble for silencing communication on a communication medium with respect to an upcoming data transmission, configure the preamble to identify one or more target devices for the silencing, and transmit the preamble over the communication medium in advance of the data transmission. Conversely, the access point or the access terminal may receive a preamble (as a receiving device) over a communication medium, identify one or more target devices for silencing communication on the communication medium with respect to an upcoming data transmission based on the preamble, and selectively silence communication over the communication medium based on itself (as the receiving device) being among the one or more target devices. |
US10516617B2 |
Network throughput
A technology is provided for improving computer network throughput. Data located in memory of a processing device may be identified. The data packets located in the memory may be sent through a tunneling interface to encapsulate the data packets using a tunneling protocol on a first computing device. Alternatively, the data packets can be sent through a split proxy interface system. The data packets received in the interface may also be encoded using random linear network coding (RLNC) to form encoded packets, using a processor. Further, the encoded packets may be sent across a packet network to a second computing device. |
US10516615B2 |
Network traffic congestion control
Technologies are described to control network congestion in packet-based networks. In some examples, a method may include receiving an Interest packet requesting content, and returning the content from a local data store if the content is in the local data store. The method may also include determining whether a previous request has been made for the requested content if the content is not in the local data store, and creating a record of the Interest packet and discarding the Interest packet if a previous request has been made. The method may further include determining whether a local IP routing table includes an entry that matches a destination IP address specified by the Interest packet if a previous request has not been made, and forwarding the Interest packet if the destination IP address is in the local IP routing table. |
US10516614B2 |
Methods and apparatus for multiple user uplink
Methods and apparatus for multiple user uplink are provided. In one aspect, a method of wireless communication is provided. The method includes transmitting a quality of service (QoS) message to a device. The QoS message includes a request for a transmission opportunity for sending uplink data to the device. The QoS message includes at least one of a sequence control field or a QoS control field. The method further includes receiving a clear to transmit (CTX) message in response to the QoS message. The method further includes transmitting data to the device in response to the CTX message. |
US10516611B2 |
Preferential selection of IP protocol version with domain name matching on proxy servers
Systems and methods for the preferential selection or blocking of Internet Protocol (IP) version addresses, e.g., IPv4 and IPv6 addresses, are provided. During a process where address or domain name resolution is performed, an entity may access a domain bypass list to ascertain whether or not to proceed with requests utilizing an IPv4 address, an IPv6 address, or neither. Such a list may be dynamically or manually created and/or updated such that known issues associated with the use of a particular type of IP version address can be avoided for subsequent resolution requests to access network resources such as web pages, DNS entries, etc. |
US10516610B2 |
Segment routing packet policies and functions providing processing signaling and packet forwarding efficiencies in a network
In one embodiment, segment routing network processing of packets is performed, including using segment routing packet policies and functions providing segment routing processing signaling and packet forwarding efficiencies in a network. A segment routing node signals to another segment routing node using a signaled segment identifier in a segment list of a segment routing packet with the segments left identifying a segment list element above the signaled segment identifier. A downstream segment routing node receives the segment routing packet, obtains this signaled segment identifier, and performs processing of one or more packets based thereon. In one embodiment, a provider edge node replaces its own segment identifier in a received customer packet, with a downstream customer node using the replaced (signaling) segment identifier (of a provider edge node/segment routing function) for accessing a return path through the provider network. |
US10516608B2 |
Systems and methods for directly responding to distributed network traffic
Systems and methods are disclosed for directly responding to distributed network traffic received from a plurality of client devices. One method includes receiving, at a source device, client requests including a packet having a reserved portion, a source portion, and a destination portion; determining, for each client request, a target device from a plurality of target devices to respond to the client request; modifying, for each client request by the source device, the destination portion of the packet to an address of target device; modifying, for each client request by a switching layer prior to the target device receiving the modified client request, the destination portion; and responding directly to each client request by the target device without traversing the source device. |
US10516607B2 |
Layer 3 service implementation in cloud servers and method
A method, computer environment and cloud server configured to facilitate communication among plural networks established in the cloud server. The cloud server (400) includes hardware components (802) configured to process and store information; a hypervisor (430) configured to run on the hardware components (802) and also configured to provide a virtual platform in a kernel space (404); a first virtual machine (410) running on the virtual platform in a user space (402); a first L2aaS network (414) connected to the first virtual machine (410), the first L2aaS network (414) being located in the kernel space (404); a second virtual machine (416) running on the virtual platform in the user space (402); a second L2aaS network (418) connected to the second virtual machine (416), the second L2aaS network (418) being located in the kernel space (404); and a virtual router (424) located in the kernel space (404) and connected to the first L2aaS network (414) and the second L2aaS network (418). The virtual router (424) is configured to provide router functionality between the first and second L2aaS networks (414, 418). |
US10516603B2 |
Interfaces to manage inter-region connectivity for direct network peerings
Methods and apparatus for interfaces to manage inter-regional connectivity for direct network peerings. A system may include a connectivity coordinator, a first resource collection in a first geographical zone and a second resource collection in a second geographical zone. The coordinator implements a programmatic interface defining connectivity operations. The coordinator receives a request via the interface to establish a logically isolated network path to the second resource collection on behalf of a client that has a dedicated physical link set up to connect to the first resource collection. In response to the request, the coordinator performs one or more configuration operations to enable traffic to flow from the client's network to the second resource collection over a logically isolated network path using the dedicated physical link. |
US10516602B2 |
Systems, methods, and devices for adaptive communication in a data communication network
A method for communicating data that includes a computing device receiving a first message and a second message, where the first message is generated in accordance with a first application session protocol and the second message is generated in accordance with a second application session protocol. The method continues with the computing device extracting a first data payload portion and second data payload portion, where the extracting utilizes the first application session protocol and the second application session protocol. The method continues with the computing device generating a common message to include the first data payload portion and the second data payload portion, where the common message is generated in accordance with a common application session protocol. The method continues with the computing device sending the common message to a receiving entity. |
US10516601B2 |
Method for prioritization of internet traffic by finding appropriate internet exit points
The systems and methods discussed herein provide for faster communications, particularly for high priority traffic, across a distributed network with multiple exit points to a Wide Area Network. Rather than simply routing traffic based on internal or external destination, an intelligent router may measure latency to an endpoint destination via multiple paths, both external and internal, and direct traffic accordingly. Steering high priority traffic via the internal connection to an exit point near the destination server, and then to the server via the external network, may be faster than simply forwarding the connection via the external network from the exit point closest to the source device. Additionally, to reduce bandwidth requirements of the nearby exit point and provide capability for higher priority traffic, low priority traffic may be redirected back via the internal connection and transmitted via a distant exit point. |
US10516598B2 |
Detecting and preventing network loops
Systems, methods, and non-transitory computer-readable storage media for detecting network loops. In some embodiments, a system can identify a network path having multiple hops associated with respective nodes which are configured in a forwarding mode. The system can traverse the network path to identify, for each node from the respective nodes, a respective next hop. Based on the respective next hop for each node, the system can determine whether two or more nodes from the respective nodes have a same respective next hop. When the two or more nodes have the same respective next hop, the system can determine that the network path has a network loop. |
US10516597B2 |
Selective data transmission in networks
Implementations generally relate to data transmission in networks. In some implementations, a method includes determining communication paths in a network, where the communication paths connect a plurality of network nodes, and where the network nodes include one or more edge devices and one or more core devices. The method further includes determining if a forwarding information base (FIB) is permitted at at least one network node. The method further includes filtering one or more packets at the at least one network node if the FIB is not permitted. The method further includes enabling traffic flow of one or more packets at the at least one network node if the FIB is permitted. |
US10516592B2 |
Communication system, bus load monitoring device, and bus load monitoring method
An object of the present invention is to monitor the load of a bus with high accuracy.A bus load monitoring device includes a determination circuit that determines whether the bus load monitoring device is in a bus-off state or a normal state, a first monitoring circuit that monitors the load of a bus when the bus load monitoring device is in the normal state, a second monitoring circuit that monitors the load of the bus when the bus load monitoring device is in the bus-off state, and a switching circuit that switches a monitoring circuit monitoring the load of the bus to the first monitoring circuit or the second monitoring circuit on the basis of the determination result of the determination circuit. |
US10516588B2 |
Apparatus, system, and method for obtaining quality of service parameter of voice over internet protocol service
An apparatus, a system, and a method for obtaining a quality of service parameter of a voice over Internet Protocol (VoIP) service is presented. The apparatus obtains a quality of service parameter of a VoIP service, and the apparatus sends a quality parameter report of the VoIP service to a centralized processing device. The quality parameter report of the VoIP service includes the quality of service parameter of the VoIP service, so that a network system obtains quality of service of the VoIP service according to the quality of service parameter of the VoIP service, further helping an operator control and adjust the network system based on the quality of service of the VoIP service. |
US10516580B2 |
Physical infrastructure management system
Systems and methods of the present invention allow for the discovery of physical location information about network assets and the delivery of that information to network administrators. In addition, environmental and other information about network asset locations can be provided to an administrator. Intelligent patch panels and power outlet units are installed in network cabinets to facilitate the acquisition and reporting of physical infrastructure information, including information about network resource availability. |
US10516579B2 |
Techniques for reconciliation of planned network with deployed network
Techniques are disclosed herein for reconciling planned data for a network (such as a fiber optic network) with data describing the deployed network. Network probing and planning components obtain a snapshot of the deployed network and organize the snapshot into three “layers”: the “link layer,” which represents the physical links that underlie the network, the “digital layer,” which includes optical channel groups that divide the total capacity of the physical links, and the “service layer,” which includes the services delivered over the network. The techniques involve comparing the planned data to the deployed data in the order of link layer, digital layer, and service layer. Differences considered to be “minor” are reconciled automatically. Differences that are “major” are reconciled after receiving instructions from a planner or administrator regarding whether to update the planned data based on what was originally in the planned data or what is in the deployed network. |
US10516578B2 |
Inferring a network topology
In a method for inferring a topology of components in a network, at least one operation parameter is provided for each of a plurality of components in a network, and a similarity measure is computed between at least two of said components based on values of said operation parameters. Based on said similarity measure, it is determined whether said two components are topologically connected, wherein said similarity measure is computed in terms of a normalized mutual information between said operation parameters pertaining to said two components. |
US10516577B2 |
Graceful scaling in software driven networks
Provided are methods and systems for graceful scaling of data networks. In one example, an indication of removal of a node from a plurality of nodes of the data network is received. A service policy is generated to reassign service requests associated with the node to another node in the plurality of nodes. The service policy is then sent to each of the plurality of nodes of the data network. To scale out a data network, an indication of presence of a further node in the data network is received, and a further node service policy is generated and sent to each of the plurality of nodes of the data network and to the further node. Additional actions can be taken in order to prevent interruption of an existing heavy-duty connection while scaling the data network. |
US10516571B2 |
Server load management
System and method for collecting values of one or more parameters of one or more clients that are communicatively connected to a server. A model is constructed based on the collected values of the one or more parameters to thereby model as a function of time the probability that the values of the one or more parameters of the one or more clients will change by an amount that is considered significant, e.g. at the server. An update of the one or more parameters is received from one of the clients. Responsive to receiving the update, the model is used to calculate a timing for the next update of the values from the one of the clients. The calculated timing for the next update is sent to the one of the clients. |
US10516570B1 |
Systems and methods for tagging client devices
The disclosed computer-implemented method for tagging client devices may include (i) receiving from a router at least one network packet that indicates that a client device has attempted to connect to the router and that includes device information identifying the client device, (ii) prompting, automatically in response to receiving the network packet indicating that the client device has attempted to connect to the router, a user to tag the client device with a descriptive name to facilitate management of the client device, (iii) receiving, in response to prompting the user to tag the client device, a tag that indicates a specific descriptive name for the client device, and (iv) transmitting, automatically in response to receiving the tag, the specific descriptive name to at least one of the router and a cloud security server. Various other methods, systems, and computer-readable media are also disclosed. |
US10516566B2 |
System and method for efficient network reconfiguration in fat-trees
Systems and methods are provided for supporting efficient reconfiguration of an interconnection network having a pre-existing routing comprising. An exemplary method can provide, a plurality of switches, the plurality switches comprising at least one leaf switch, wherein each of the one or more switches comprise a plurality of ports, and a plurality of end nodes, wherein the plurality of end nodes are interconnected via the one or more switches. The method can detect, by a subnet manager, a reconfiguration triggering event. The method can compute, by the subnet manager, a new routing for the interconnection network, wherein the computing by the subnet manager of the new routing for the interconnection network takes into consideration the pre-existing routing and selects the new routing for the interconnection network that is closest to the pre-existing routing. The method can reconfigure the interconnection network according to the new routing. |
US10516562B2 |
Communication device and method for performing radio communication
A communication device is provided that includes a modulation circuit configured to modulate a signal comprising a first signal portion of a first data type and a second signal portion of a second data type. The modulation circuit is configured to modulate the first signal portion in accordance with a first modulation scheme and the second signal portion in accordance with a second modulation scheme. At least one of the first data type is different from the second data type or the second modulation scheme is different from the first modulation scheme. The communication device further includes a modification circuit configured to modify the modulated first signal portion based on a first modification scheme and the second signal portion based on a second modification scheme. The communication device further includes a transmitter configured to transmit the modified first signal portion and the modified second signal portion. |
US10516559B2 |
Prefixing of OFDM symbols to support variable subframe length
The present disclosure relates to a first radio node configured for orthogonal frequency division multiplexing (OFDM), comprising a receiver, a transmitter, a processor and a memory storing instructions executable by the processor for causing the transmitter in a first mode of operation with a first subcarrier spacing f1: to transmit a sequence of prefixed OFDM symbols, and in a second mode of operation with a second subcarrier spacing f2: to transmit a sequence of prefixed OFDM symbols, wherein the sequence of transmitted OFDM symbols is aligned with a predefined repeating radio frame, which is common to both the first and second modes of operation, or with an integer multiple of the predefined repeating radio frame; and the first and second subcarrier spacings are related by an integer factor, f1/f2=p or f1/f2=1/p, with p≠1 integer. |
US10516555B2 |
Methods and apparatus for creating interstitial areas in a cable
In accordance with one or more embodiments, a system can include a plurality of cables, wherein each cable of the plurality of cables includes an insulation layer comprising a helix structure. The helix structure of each cable of the plurality of cables can facilitate formation of a plurality of interstitial pathways between the plurality of cables. The system can further include communication device coupled to the plurality of cables, where the communication device facilitates generating electromagnetic waves that propagate along the plurality of interstitial pathways without requiring an electrical return path. Other embodiments are disclosed. |
US10516541B2 |
Nonce to message binding in digital signature generation
Various embodiments relate to a method for producing a digital signature using a white-box implementation of a cryptographic digital signature function, including: receiving a input message; hashing the input message; generating a nonce based upon the input message and the white-box implementation of the cryptographic digital signature function; and computing a digital signature of the input using the nonce. |
US10516539B2 |
Devices, systems, and methods for authenticated intravascular device use and reuse
Devices, systems, and methods for reconditioning an intravascular device for reuse are provided. The method includes reading first security data from a memory of the intravascular device; determining if the intravascular device is authentic; generating second security data, when the intravascular device is authentic; and writing the second security data to the memory of the intravascular device. Devices, systems, and methods for authenticating an intravascular device for use are also provided. The method includes bringing an intravascular device into communication with a computing device, the intravascular device including a memory; determining if first security data is authentic; determining, when the first security data is authentic, if the intravascular device has been reconditioned; determining, when the intravascular device has been reconditioned, if the second security data is authentic base; and permitting, when second security data is authentic, use of the intravascular device in the clinical procedure. |
US10516536B2 |
Method and apparatus for logging into medical devices
The invention relates to a method for logging a service technician into an electrical device (20), comprising the following steps: production (3, 4) of a secret key (SKY) as an encrypted login password (LPW) by the electrical device (20), displaying (5) of the secret key (SKY) on a display unit (23) of the electrical device (20) as a QR code (QRC), optical sensing (6) of the QR code (QRC) by means of a mobile device (22), decryption (9) of the login password (LPW) from the secret key (SKY) of the sensed QR code (QRC) by the mobile device (22), displaying of the login password (LPW) on a screen unit (24) of the mobile device (22), entering of the login password (LPW) into the electrical device (20) by the service technician, comparison (10) of the entered login password (LPW) with the produced login password (LPW) by the electrical device (20), release of the login by the electrical device (20) if the two login passwords (LPW) match. The invention further relates to an associated apparatus. The advantage of the invention lies in the combination of the high strength of the cryptographic security with the user friendliness of the QR code and of the relatively short login password to be entered. |
US10516528B2 |
System and method for managing secret information using virtualization
A distributed computer system and method for managing secret information for virtual entities in the distributed computer system utilizes multiple secret storage service entities to provide secret information to a virtual entity to be hosted in a host computer in the distributed computer system. At least one piece of the secret information for the virtual entity is distributed to the multiple secret storage service entities to provide the secret information to the virtual entity using the at least one piece of the secret information from one of the multiple secret storage service entities. |
US10516526B2 |
Data transmitting method, server and client
Embodiments of the invention disclose a data transmitting method, a server and a client. The method embodiments of the invention include: obtaining a client application list file uploaded by a client; determining whether a file in a object application list file exists in the client application list file, and determining whether a hash value sha2 of the file in the object application list file is identical to a hash value sha2 of a file in the client application list file; adding the non-existed file into an incremental file list when the file in the object application list file does not exist in the client application list file; adding a file which is not identical into the incremental file list when the hash value sha2 of the file in the object application list file is different from the hash value sha2 of the file in the client application list file; packaging and compressing the object application list file, a signature file of the object application list file and the file in the incremental file list to create an incremental upgrade package such that the client can upgrade the application package through the incremental upgrade package. |
US10516525B2 |
System and method for detecting anomalies in examinations
The disclosure provides systems and methods for maintaining integrity of documents and activities associated with examinations. The systems and methods store such activities and documents in a distributed blockchain such that integrity is maintained through transparency and redundancy of the records and activities. The systems monitor for any anomalies and notify appropriate individuals when an anomaly is detected, as well as maintaining a log of such anomalies. |
US10516519B2 |
Method and apparatus for transmitting response frame based on type in a high efficiency wireless LAN
The present disclosure relates to a method and apparatus for transmitting a response frame based on a type in a High Efficiency Wireless Local Area Network (WLAN) (HEW). According to an aspect, a method for transmitting an uplink frame by a station (STA) to an access point (AP) in a WLAN may be provided. The method may include receiving, from the AP, a downlink frame including information related to a type of the uplink frame, the type of the uplink frame including a single-user (SU) type and a multiple-user (MU) type; and transmitting, to the AP, the uplink frame having a type determined based on the information related to the type of the uplink frame, wherein, when the type of the uplink frame corresponds to the MU type, the uplink frame is simultaneously transmitted by a plurality of STAs including the STA and at least one other STA. |
US10516516B2 |
Precoding information obtaining method, and device
Embodiments of the present invention provide a precoding information obtaining method and a device. The method includes: separately precoding, by a network device by using N sub-codebooks, a pilot group including K pilots to obtain N precoded pilot groups, where the sub-codebooks are subsets of a precoding codebook, the precoding codebook includes M precoding vectors, each sub-codebook includes K precoding vectors; sending, by the network device, a precoded pilot group to a terminal device in each of W RB groups; and receiving, by the network device, precoding information fed back by the terminal device for any one of W precoded pilot groups. According to the precoding information obtaining method and the device, a quantity of pilot signals sent by the network device in each RB group is reduced, and pilot overheads in each RB group are reduced. |
US10516515B2 |
Method and apparatus for use with a radio distributed antenna system having an in-band reference signal
Aspects of the subject disclosure may include, for example, receiving, by a network element of a distributed antenna system, a reference signal, a control channel and a first modulated signal at a first carrier frequency, the first modulated signal including first communications data provided by a base station and directed to a mobile communication device. The instructions in the control channel direct the network element of the distributed antenna system to convert the first modulated signal at the first carrier frequency to the first modulated signal in a first spectral segment. The reference signal is received at an out of band frequency relative to the control channel. Other embodiments are disclosed. |
US10516512B2 |
Method and apparatus for configuring control information indicating resource unit in wireless local area network system
The present specification proposes a method of configuring and transmitting a PHY protocol data unit (PPDU) including first to fourth resource unit (RU) areas corresponding to at least first to fourth frequency bands. The first frequency band corresponds to a lowest frequency band, and the fourth frequency band corresponds to a highest frequency band. In the PPDU, a center RU area is arranged between the second RU area and the third RU area. In this case, the PPDU includes a second signal field corresponding to the second frequency band and a third signal field corresponding to the third frequency band. The second signal field may include a control field for the center RU area, and control information for a user allocated to the center RU area may be included a last field of a user-specific control field of the third signal field. |
US10516497B2 |
Reception apparatus, transmission apparatus, and data processing method
The present technology relates to a reception apparatus, a transmission apparatus, and a data processing method that permit downloaded reproduction of non-realtime content by reducing load associated with implementing resident applications.The reception apparatus acquires a first application, included in a digital broadcast signal, that handles a download of content reproduced in non-realtime, acquires metadata, included in the digital broadcast signal, that includes information for controlling the content download in response to operation of the first application, and handles the download of the content included in the digital broadcast signal by controlling the operation of the first application on the basis of the metadata. The present technology is applicable, for example, to a TV receiver. |
US10516495B2 |
Method for measuring inter-device interference in wireless communication system supporting FDR transmission, and apparatus therefor
The present invention relates to a wireless access system supporting a full duplex radio (FDR) transmission environment. A method for a terminal to measure interference in a wireless communication system supporting FDR according to an embodiment of the present invention comprises the steps of: receiving an interference measurement resource at a measurement subframe; and measuring, at the interference measurement resource, interference from a neighboring terminal on the basis of an interference reference signal transmitted from the neighboring terminal. In addition, data is not transmitted or is transmitted with zero-power in the interference measurement resource. |
US10516492B2 |
Remote apparatus of distributed antenna system
A remote apparatus includes: a plurality of sub amplification units amplifying radio frequency (RF) signals of different frequency bands, respectively; a test signal generation unit generating test signals of a frequency band for any one sub amplification unit among the plurality of sub amplification units; a conversion unit converting intermodulation (IM) signals generated in response to the test signals into a plurality of conversion IM signals by using a conversion signal of which a frequency is swept; and a control unit determining a degree of an intermodulation distortion by the any one sub amplification unit based on signal levels of the plurality of the conversion IM signals. |
US10516491B2 |
Method for calibrating an antenna system, control device, computer program and computer program products
A method of calibrating an antenna system comprising a number of antenna elements is provided. The method comprises transmitting and measuring at least for first and second reference antenna elements, thereby obtaining first and second sets of corresponding number of measurement values; calculating, for a first type of beamforming and for each calibration antenna element j a correction value—ΔRijk,Type 1, thereby obtaining a first part of a correction matrix; calculating, for a second type of beamforming and for each branch j a correction value ΔRi,jType 2, thereby obtaining a second part of the correction matrix; performing an optimization procedure using as input the correction matrix thereby obtaining, for each row of the correction matrix, a respective optimized constant, and calculating a compensation value Δri for each antenna element based on the respective optimized constant. |
US10516490B2 |
Optical free air transmit and receive interconnect
An apparatus comprises a substrate; a laser emitter arranged on the substrate, wherein laser energy emitted by the laser emitter includes a center frequency; a photodiode arranged on the substrate; and a laser bandpass filter arranged above the photodiode, wherein the bandpass filter has a passband that excludes the center frequency of the laser energy. |
US10516489B1 |
Underwater wireless communication apparatus and communication method thereof
An underwater communication apparatus includes a light transmitting device to transmits a first communication light and a light receiving device to receive a second communication light. Further, a light identification device is used to detect a reference pattern in two dimensions, which is set on a node communication apparatus, to obtain a detection pattern. The light transmitting device and the light receiving device respectively corresponding to the light identification device are set at two relative locations. A power apparatus is used to drive the underwater communication apparatus. A control/monitor apparatus obtains the detection pattern from the light identification device and analyze a difference state between the reference pattern and the detection pattern. According to the difference state, it controls the power apparatus to move the underwater communication apparatus to a location for the detection pattern and the reference pattern being two dimensionally aligned. |
US10516488B2 |
Decoding a combined amplitude modulated and frequency modulated signal
The present disclosure relates to a method for decoding a combined AM/FM encoded signal, comprising the steps of: combining said encoded optical signal with light from a local oscillator configured with a local oscillator frequency; converting the combined local oscillator and encoded optical signal into one or more electrical signals by means of at least one opto-electrical converter having a predefined frequency bandwidth, thereby providing an amplified and encoded electrical signal having one or more encoded signal current(s), where one type of states have a higher oscillation frequency than other type of states; rectifying the encoded signal current(s), thereby obtaining an encoded power spectrum, wherein said power spectrum has different states, such as “0”-states and “1”-states, with different power levels such that they can be discriminated, said local oscillator frequency is defined by a positive local oscillator frequency-offset from the frequency of one of the states in said encoded optical signal, and said local oscillator frequency-offset is selected to be dependent on said frequency bandwidth. |
US10516487B1 |
Optical transmitting module
An optical transmitting module includes: light sources configured to output optical signals, an optical multiplexer configured to multiplex the optical signals output from the light sources, a collimating lens configured to convert an optical signal output from the optical multiplexer to a form of parallel beam, a package inside which the light sources, the optical multiplexer, and the collimating lens are provided, and an optical isolator disposed on one inner surface of the package, in which the optical signals output from the light sources are multiplexed into a single optical signal through the optical multiplexer disposed inside the package, and the single optical signal passes through the collimating lens and is then optically coupled to an optical fiber stub in a receptacle through a focusing lens disposed outside the package to be output externally. |
US10516485B2 |
VCSEL based optical links in burst mode
Devices and methods are provided to reduce the wake-up time of a Vertical Cavity Surface Emitting Laser (VCSEL) used in a data communication link. For example, in one aspect, a method for optical communications includes, in an optical communication device including a light-emitting device, applying a bias current to the light-emitting device and transmitting a pulse to the light-emitting device before transmitting a preamble signal or data signal to the light-emitting device, wherein the pulse has a voltage greater than a highest voltage of the preamble signal or data signal. |
US10516481B2 |
Upstream failure recovery in an RFoG FFTP network
Devices and methods for bypassing a defective component in a combining network relaying respective upstream and downstream signals between a head end and a plurality of subscribers. The devices and methods may preferably redirect the upstream signal without redirecting the downstream signal using a wavelength-dependent filter. |
US10516478B2 |
Controller based path estimation and path provisioning using optical impairment data
A method implemented by a domain controller in a network comprises transmitting, by a transmitter of the domain controller to a super controller, an update message comprising path information for one or more parallel paths having a common wavelength from a source to a destination, wherein the one or more parallel paths are free of optical impairments when the update message is transmitted to the super controller, receiving, by a receiver of the domain controller from the super controller, an initiate message comprising an identifier of a path selected from the one or more parallel paths, and provisioning, by a processor of the domain controller, the path based on a verification that the path selected by the super controller is free of optical impairments. |
US10516476B2 |
Systems and methods for managing multilayer communication networks
A system for mapping a multilayer network having a server layer and a client layer is provided. The system includes a framework configured for comparing information obtained from a first traffic counter of a client port to information obtained from a second traffic counter of a server port to thereby determine if the client port and the server port are linked. |
US10516465B2 |
Harmonized operation between radio link monitor and beam failure recovery
A method for harmonized operation between radio link monitor and beam failure recovery is proposed. In one example, upon indication of unsuccessful recovery from beam failure, a counter is initiated to count a configured number of OOS indication before RLF is declared due to beam failure. In another example, upon indication of successful recovery from beam failure, a counter is initiated to count a configured number of IS indication before starting over RLM procedure on its previous observations on failed beams. As a result, either early RLF declaration or RLM reset may be triggered based on BFR procedure to more accurately maintain the link quality. |
US10516463B2 |
Method for indicating a transmission time offset of a feedback message
A method performed by a radio-network node for handling a data transmission in a number of subframes from the radio-network node to a wireless device in a wireless communication network. The radio-network node transmits data over the number of subframes to the wireless device. Each subframe comprises a control part associated with the data of the subframe. Each respective control part comprises a feedback index indicating a transmission time offset of a feedback message. The feedback message is to comprise a respective feedback indication of the number of subframes to be transmitted simultaneously from the wireless device to the radio-network node in the feedback message. |
US10516462B2 |
Precoding and channel state information acquisition for multi-stream transmissions in massive MIMO systems
A radio access node (RAN) and method of operation of the RAN are provided. The RAN includes a massive multiple-input-multiple-output (MIMO) antenna array. The RAN includes a processing hardware configured to carry out a communication method that includes receiving a digital data stream for transmission on a time-frequency resource. The RAN precodes the digital data stream using a digital beamforming stage to render a precoded digital downlink data stream for downlink data stream signal transmission to a user equipment. The digital beamforming stage includes a first precoding stage configured according to a long-term matrix, and a second precoding stage configured according to a short-term matrix. The RAN is further configured to generate a downlink data stream transmission signal to the user equipment in accordance with the precoded digital downlink data stream. |
US10516460B2 |
Method and apparatus for transmitting and receiving wireless signal in wireless communication system
The present invention relates to a wireless communication system, and specifically to a method and an apparatus therefor, the method comprising the steps of: identifying static resource in a subframe set; and transmitting and receiving data using the remaining resource, excluding the static resource, in the subframe set, wherein the remaining resource is used for downlink (DL) reception of used for uplink (UL) transmission according to an instruction by a base station. |
US10516449B2 |
Multi-user MIMO-OFDM system
The present invention discloses various improvements to multi-user multiple-input multiple-output orthogonal frequency division multiplexing (MU-MIMO-OFDM) wireless communication systems. In one aspect there is disclosed an efficient and accurate channel estimation method and system using locally consecutive pilot sub-carriers. In another aspect there is disclosed an efficient channel feedback method and system by applying a discrete cosine transform to channel coefficients. In another aspect there is disclosed an efficient method and system to calculate a part of the channel inverse by interpolation. These aspects can be used in combination to improve the MU-MIMO-OFDM system. |
US10516448B2 |
Beam operation device and method in communication system supporting hybrid multiple-input multiple-output mode
The present invention relates to a 5th-generation (5G) or pre-5G communication system to be provided for supporting a data transmission rate higher than that of a 4th-generation (4G) communication system, such as long term evolution (LTE), and subsequent systems. The present invention provides a method by which a mobile station (MS) operates a beam in a communication system supporting a hybrid multiple-input multiple-output (MIMO) mode, the method comprising the steps of: receiving, from a base station (BS), information related to the number of beams to be used, by the BS, for a beam training process; receiving, from the BS, a downlink reference signal (RS); performing a channel estimation process on the basis of the downlink RS; and transmitting, to the BS, information related to the number of beams to be used by the MS, after performing the channel estimation process. |
US10516446B2 |
Wireless power transmitter and method of controlling the same
A wireless power transmitter includes a switch circuit including switches connected to a transmission resonator; a current detector configured to detect a transient current induced in the transmission resonator; and a controller configured to control the switch circuit and adjust an output of the wireless power transmitter based on an amplitude of the transient current. |
US10516443B2 |
Method and apparatus for configuring a communication interface
Aspects of the subject disclosure may include, for example, a system for exchanging electrical signals and guided electromagnetic waves between customer premises equipment and service provider equipment to provide uplink and/or downlink communication services. Other embodiments are disclosed. |
US10516442B2 |
Configurable, power supply voltage referenced single-ended signaling with ESD protection
A single-ended data transmission system transmits a signal having a signal voltage that is referenced to a power supply voltage and that swings above and below the power supply voltage. The power supply voltage is coupled to a power supply rail that also serves as a signal return path. The signal voltage is derived from two signal supply voltages generated by a pair of charge pumps that draw substantially same amount of current from a power supply. |
US10516436B2 |
Spread-spectrum-signal reception apparatus and spread code initialization method
A spread-spectrum-signal reception apparatus includes a controller to obtain a phase comparison value that is a phase of a spread code at a time at which initialization of a phase of the spread code is performed and which corresponds to a timing of a top of a frame of a received signal, and to output an initialization instruction including the phase comparison value when having determined that a current time is within a range of a time window; and a signal processor to demodulate the received signal in accordance with the spread code, to perform a frame synchronizing process on the demodulated signal to detect a frame timing, and to perform the initialization at a timing determined in accordance with a result of comparison between the phase comparison value included in the initialization instruction and a phase of the spread code at the frame timing. |
US10516432B2 |
Communication system with switchable devices
According to at least one aspect, a communication system is provided. The communication system includes a first switch device configured to receive a first plurality of radio frequency (RF) signals detected by an antenna array and provide an RF signal selected from among the first plurality of RF signals to a receiver circuit, the first plurality of RF signals comprising a first RF signal in a first frequency range and a second RF signal in a second frequency range that is different from the first frequency range; and a second switch device configured to receive a second plurality of RF signals detected by the antenna array and provide an RF signal selected from among the second plurality of RF signals to the receiver circuit, the second plurality of RF signals comprising a third RF signal in the first frequency range and a fourth RF signal in the second frequency range. |
US10516431B2 |
Mobile device case for receiving wireless signals
A wireless case for use with a mobile electronic device can include a back wall, a top wall, a bottom wall, a right side wall, a left side wall. The case can include a wireless receiver configured to receive wireless signals. The case can further include a device interface that can be electrically coupled to the wireless receiver. The device interface can move between an engaged position and a disengaged position. In the engaged position, the device interface can be configured to engage a corresponding interface on the mobile electronic device to deliver the electrical signals from the wireless receiver to the mobile electronic device. In the disengaged position the device interface can be configured to disengage from the corresponding interface on the mobile electronic device to facilitate insertion of the mobile electronic device into the case or removal of the mobile electronic device from the case. |
US10516426B1 |
Systems and methods for wideband image-rejecting receivers
A wideband receiver includes an active splitter that splits an electronic signal into first and second signals, first and second reconfigurable RF filters, and first and second reconfigurable IF filters. The first reconfigurable RF filter filters the first signal responsive to a first control signal and mixes the first filtered signal and an in-phase LO signal component to output a first IF signal. The second reconfigurable RF filter filters the second signal responsive to a second control signal to generate a second filtered signal and mixes the second filtered signal and a quadrature phase LO signal component to output a second IF signal. The first reconfigurable IF filter filters the first IF signal responsive to a third control signal to generate a first filtered IF signal. The second reconfigurable IF filter filters the second IF signal responsive to a fourth control signal to generate a second filtered IF signal. |
US10516421B1 |
Apparatuses and methods involving radio configurability for adapting to radio-frequency systems
Embodiments in accordance with the present disclosure are directed to communications apparatuses and methods thereof that includes a radio frequency (RF) front-end circuitry and RF back-end circuitry. The RF front-end circuit receives sets of RF signals concurrently and as transmitted from at least two disparate communication networks. The front-end circuitry includes a tunable radio having at least one antenna feeding signal conditioning and down conversion circuitry, and decimation circuitry. The decimation circuitry filters and decimates data associated with the RF signals into a plurality of digital data streams. The RF back-end circuitry includes a plurality of digital-signal processors (DSPs) that extract raw data packets from the digital data streams and a microprocessor. The microprocessor transmits the plurality of digital data streams to the plurality of DSPs and transmits the extracted raw data packets, received from the plurality of DSPs, to an end-user device. |
US10516417B2 |
Polar code encoding method and encoding apparatus
The present invention discloses a polar code encoding method and encoding apparatus. The method includes: mapping M reserved bits of a broadcast signaling respectively to M low-reliability information bits in K information bits of a polar code, and mapping remaining bits of the broadcast signaling to remaining information bits of the K information bits, to obtain bits after mapping, where M |
US10516413B2 |
Digital-to-time converter and information processing apparatus
A digital-to-time converter has an oscillator; and count circuitry that starts counting a number of oscillations of the oscillator when an activation signal is input, and outputs a first delay activation signal obtained by delaying the activation signal during a period from a timing when the activation signal is input to a timing when a counted number of oscillations reaches a reference number set based on a digital input signal. |
US10516412B1 |
Image calibration for time-interleaved digital-to-analog converter
An interleaved digital-to-analog converter (DAC) system may include a first sub-DAC and a second sub-DAC and may be configured to provide both a converter output signal and a calibration output signal. The converter output signal may be provided by adding the first sub-DAC output signal and the second sub-DAC output signal. The calibration output signal may be provided by subtracting one of the first and second sub-DAC output signals from the other. The calibration output signal may be used as feedback to adjust the phase of one of the sub-DACs relative to the other, to promote phase matching their output signals. |
US10516409B2 |
High-speed, high-resolution, photonic-based analog-to-digital converter
A photonic feedforward analog-to-digital converter (ADC) is provided. According to one aspect of the invention, the signal to be digitized is applied to only one electro-optic modulator. High speed is achieved by taking advantage of the fundamental property of a Pockels Cell to control wave polarization using the electro-optic effect. In a further aspect, once a bit is determined, its state is fed forward to the next least significant bit to aid in determination of the next lower bit. This nonlinear feedforward aspect of the ADC provides simplicity of its architecture. |
US10516407B2 |
Signal processing device
According to embodiments, a signal processing device includes an AD converter, a memory, a prediction logic circuit, an error amount detection circuit, and a selector. The AD converter converts an input signal to an AD conversion value at a certain sampling frequency. The memory stores an AD conversion output result. The prediction logic circuit predicts a prediction value by using the AD conversion output result at the sampling frequency. The error amount detection circuit determines that there is no error in error determination of the AD conversion value when an error amount between the prediction value and the AD conversion value is smaller than a predetermined amount, and that there is an error in the error determination when the error amount is equal to or larger than the predetermined amount. The selector outputs one of the AD conversion value and the prediction value as an AD conversion output result, on the basis of the error determination. |
US10516404B2 |
Voltage controlled oscillator using variable capacitor and phase locked loop using the same
A variable capacitor is provided. The variable capacitor includes a plurality of capacitor segments. The plurality of capacitor segments are connected in parallel within the variable capacitor. When a plurality of candidate capacitances allowable to the variable capacitor according to a connection state of the plurality of capacitor segments connected in parallel are sorted in a magnitude sequence, the plurality of candidate capacitances form a geometric series. The variable capacitor is used for a Voltage Controlled Oscillator (VCO), and the VCO is used for a Phase Locked Loop (PLL). |
US10516403B1 |
High-order phase tracking loop with segmented proportional and integral controls
Clock circuits, components, systems and signal processing methods enabling digital communication are described. A phase locked loop device derives an output signal locked to a first reference clock signal in a feedback loop. A common phase detector is employed to obtain phase differences between a copy of the output signal and a second reference clock signal. The phase differences are employed in an integral phase control loop within the feedback loop to lock the phase locked loop device to the center frequency of the second reference signal. The phase differences are also employed in a proportional phase control loop within the feedback loop to reduce the effect of imperfect component operation. Cascading the integral and proportional phase control within the feedback loop enables an amount of phase error to be filtered out from the output signal. |
US10516399B2 |
Circuit device, oscillator, electronic apparatus, and vehicle
A circuit device includes a first oscillation circuit, a second oscillation circuit, a clock signal output circuit adapted to output a clock signal based on an output signal of the first oscillation circuit, and an output control circuit adapted to perform output control of the clock signal output circuit. The output control circuit includes a counter circuit adapted to perform a counting process based on an output signal of the second oscillation circuit, and the counter circuit outputs an output enable signal of the clock signal to the clock signal output circuit based on a result of the counting process. |
US10516397B2 |
System level interconnect with programmable switching
In an example embodiment, a digital block comprises a datapath circuit, one or more programmable logic devices (PLDs), and one or more control registers. The datapath circuit comprises structural arithmetic elements. The one or more PLDs comprise uncommitted programmable logic. The one or more control circuits comprise a control register configured to store user-defined control bits, where the one or more control circuits are configured to control both the structural arithmetic elements and the uncommitted programmable logic based on the user-defined control bits. |
US10516390B2 |
Circuit to mitigate signal degradation in an isolation circuit
A circuit includes an isolator that provides isolated signal communications between a host-side circuit and a converter-side circuit. The isolated signal communications include a conversion start signal generated in the host-side circuit passing through the isolator to become an isolated conversion start signal in the converter-side circuit. The isolated signal communications includes an isolated system clock generated in the converter-side circuit passing through the isolator to become a system clock in the host-side circuit. A sampling clock generator in the host-side circuit generates the conversion start signal based on the system clock. A logic circuit in the converter-side circuit re-clocks the isolated conversion start signal through the logic circuit. |
US10516387B2 |
Signal level converter and display driving device
A signal level converter includes a bias generating circuit that generates a bias voltage, and a level shifter circuit that converts a lower voltage signal into a higher voltage signal in response to the bias voltage. The bias generating circuit includes a replica circuit that controls an on-current of the level shifter circuit in response to the bias voltage output from an operational amplifier. |
US10516386B1 |
Circuit for controlling shape of a driver signal waveform
Briefly, embodiments of claimed subject matter relate to controlling a voltage across a circuit element utilized in a pre-driver for a bidirectional communications bus. In embodiments, a voltage control circuit may be utilized to reduce electrical stress across a capacitor coupled to the pre-driver to the communications bus. The voltage control circuit may operate to provide a voltage to a middle point between two capacitors, of a plurality of capacitors, which may operate to limit voltage across one or more capacitors to below a predetermined limit. |
US10516382B2 |
Piezoelectric vibration member, method of manufacturing the same, and piezoelectric vibrator
There is provided a piezoelectric vibration member including: a vibration substrate including a vibrating portion and a surrounding portion which is thinner than the vibrating portion; and vibrating electrodes disposed on one surface and the other surface of the vibrating portion in a thickness direction, wherein the vibrating portion includes protrusion portions protruding in relation to one surface and the other surface of the surrounding portion in the thickness direction, and at least one side surface of the protrusion portion has two or more crystal planes. |
US10516381B2 |
3D-printed protective shell structures for stress sensitive circuits
In one aspect of the disclosure, a semiconductor package is disclosed. The semiconductor package includes a lead frame. A semiconductor die is attached to a first side of the lead frame. A protective shell covers at least a first portion of the first surface of the semiconductor die. The protective shell comprises of ink residue. A layer of molding compound covers an outer surface of the protective shell and exposed portion of the first surface of the semiconductor die. A cavity space is within an inner space of the protective shell and the first portion of the top surface of the semiconductor die. |
US10516376B2 |
Signal processing apparatus and signal processing method
A signal processing apparatus includes a control section, a signal processing section connected with a plurality of signal processing elements and performs signal processing for enhancing or attenuating an input signal in a specific frequency band, and a crossfade signal section including a crossfade signal processing element capable of replacing at least one of the signal processing elements, wherein the control section controls any one of the signal processing elements among the plurality of signal processing elements, and the crossfade signal processing element, to crossfade to the crossfade signal processing element having the signal processing element as a new characteristic, to perform processing for replacing any one of the signal processing elements by the crossfade signal processing element, and to perform the processing on remaining signal processing elements of the plurality of signal processing elements in the signal processing section. |
US10516371B2 |
Power converting system
A power converting system that includes: a rectifier configured to convert an input voltage into a output voltage and including an output node that is coupled to floating ground; a radio frequency (RF) power amplifier coupled to the rectifier and configured to generate a load voltage based on an RF clock and the output voltage; a detector coupled to the RF power amplifier and configured to detect the load voltage of the RF power amplifier; an integrator coupled to the detector and configured to generate a direct current (DC) voltage based on the detected load voltage; and a controller coupled to the integrator and configured to, based on the DC voltage, generate a control signal to adjust one or more features of the RF power amplifier is disclosed. |
US10516369B2 |
Amplifier and radiation detector
In a preamplifier (amplifier) for the radiation detector, an interconnection layer connected to the bonding pad forms one electrode of a feedback capacitor. Since there is no wiring for connecting the bonding pad and capacitor, a parasitic capacitance caused by the wiring will not be generated. Moreover, the capacitor is arranged below the bonding pad with a conductive layer serving as the other electrode, so that the feedback capacitance of the capacitor is included in the parasitic capacitance between the interconnection layer and the substrate. Compared to the conventional case, an amount of capacitance corresponding to the parasitic capacitance caused by wiring and the feedback capacitance for the capacitor is reduced from the input capacitance. Thus, the input capacitance for the amplifying circuit is reduced. |
US10516368B2 |
Fast envelope tracking systems for power amplifiers
Fast envelope tracking systems are provided herein. In certain embodiments, an envelope tracking system for a power amplifier includes a switching regulator and a differential error amplifier configured to operate in combination with one another to generate a power amplifier supply voltage for the power amplifier based on an envelope of a radio frequency (RF) signal amplified by the power amplifier. The envelope tracking system further includes a differential envelope amplifier configured to amplify a differential envelope signal to generate a single-ended envelope signal that changes in relation to the envelope of the RF signal. Additionally, the differential error amplifier generates an output current operable to adjust a voltage level of the power amplifier supply voltage based on comparing the single-ended envelope signal to a reference signal. |
US10516359B2 |
Identification of a secondary part during use in a linear-motor-based system
A method for identifying a secondary part during use in a linear-motor-based system, wherein a primary part includes primary-part coils in the linear-motor-based system, the secondary part has a magnetic active part and the primary-part coils can be actuated via a drive current such that an advancing force acting on the secondary part and movement of the secondary part along the primary part is achievable, where at least one secondary-part winding in a circuit is provided on the secondary part, selected primary-part coils are energized via a primary current at one or more test signal frequencies to induce a secondary current in the secondary-part winding to identify the rotor, a characteristic property of the secondary-part winding or the circuit is representative of the secondary part, and where the secondary current influences a current response of the primary-part coils and the characteristic property is measured using the current response. |
US10516357B2 |
Generator and method for controlling a generator
A switched reluctance generator and devices and methods for its control are concerned with generators and controls which can operate in an aerospace environment. The generator may have: a rotor having rotor poles; a stator having stator poles; and a controller. Either the rotor or stator poles each have windings to which current can be supplied to energise the poles and from which current can be drawn to a load; and the controller is arranged to: periodically excite each of the windings in turn to a pre-determined level of current; measure the current generated in each winding; cease the excitation when the current generated in each winding exceeds the excitation current; and direct the generated current in each winding to the load. The generator may thereby avoid the need to determine the position of the rotor poles relative to the stator poles to provide the commutation of the generator. |
US10516354B2 |
Motor control device
To provide a motor control device capable of determining a rotor position with high accuracy not only in normal control but also in flux-weakening control. The motor control device includes: a first rotor position determining unit 28 that determines a rotor position of a synchronous motor by using a rotor position calculation formula with, as parameters, current electrical angle or induced voltage electrical angle, and first current phase or first induced voltage phase obtained based on current peak value and [(induced voltage electrical angle)−(current electrical angle)]; a second rotor position determining unit 29 that determines a rotor position of the synchronous motor by using a rotor position calculation formula with, as parameters, current electrical angle or induced voltage electrical angle, and second current phase or second induced voltage phase obtained based on current peak value and flux linkage of a rotor of the synchronous motor; and a selecting unit 30 that selects the first or second rotor position determining unit 28, 29. |
US10516352B2 |
Brushless electric motor
A brushless electric motor of a motor vehicle, in particular an ancillary unit, including a first phase winding, which is connected in series to a first semiconductor switch, and including a second phase winding, which is connected in series to a second semiconductor switch. The brushless electric motor includes a test circuit, which is connected in parallel to the first semiconductor switch and the second semiconductor switch. A method is also provided for operating a brushless electric motor, and also provided is a drive train actuator of a motor vehicle. |
US10516351B2 |
Electrical drive for an industrial robot
Provided is an electrical drive for an industrial robot, wherein each driver circuit for the associated power switches of the first half-bridge is designed, in the case of a voltage-free or current-free state of the associated control input, to put the power switch associated with the control input into a non-conductive state, each driver circuit for the associated power switches of the second half-bridge is designed, in the case of a voltage-free or current-free state of the associated control input, to put the power switch associated with the control input into a conductive state, and a switching device is provided, which is designed, with the safety signal for the forced switch-off of the rotating-field voltage, to simultaneously switch the control inputs of the driver circuits for all power switches of the inverter into a voltage-free and/or current-free state. |
US10516349B2 |
Method of driving vibration actuator with enhanced sliding efficiency, vibration drive device, and mechanical apparatus
A vibration actuator includes a vibration element including a piezoelectric element as an electromechanical energy conversion element and an elastic body which is joined to the piezoelectric element, and a driven element which is brought into pressure contact with the elastic body. Driving vibration is excited in the vibration element by applying a drive signal to the piezoelectric element, whereby the vibration element and the driven element are moved relative to each other. The driving vibration is a vibration in which at least n-th-order vibration and 2n-th-order vibration are combined, n being a natural number. |
US10516345B2 |
Power conversion controller for electric train
A power conversion controller for electric train in one aspect of the present disclosure includes an active current command value generator, an overhead line voltage detector, an initial value calculator, an adjustment value calculator, an upper limit value setter, and an output limiter. The output limiter outputs a reactive current command adjustment value calculated by the adjustment value calculator as a reactive current command value when the reactive current command adjustment value is equal to or lower than an upper limit value set by the upper limit value setter, and outputs the upper limit value as the reactive current command value when the reactive current command adjustment value exceeds the upper limit value. |
US10516338B2 |
Voltage converter controller, voltage converter and method for operating a voltage converter
Voltage converter controllers, voltage converters and methods are discussed regarding the adjustment of an on-time of an auxiliary switch of a voltage converter. First and second voltages are measured before a primary switch of the voltage converter is turned on and while the primary switch is turned on, and the on-time is adjusted based on the voltages. |
US10516337B2 |
DC voltage conversion circuit
A DC voltage conversion circuit in which the miniaturization of the inductor is attained and the frequency of control band can be widened, by suppressing the ripple current which flows into the inductor using a general magnetic core without using a special multi-leg magnetic core. A DC voltage conversion circuit is provided with two sets of magnetic flux cancellation conversion circuits each of which is provided with two sets of series circuits of two semiconductor circuits, a first magnetic flux cancellation type transformer, and a inductor; a second magnetic flux cancellation type transformer connected to the two sets of magnetic flux cancellation conversion circuits; and a control circuit which controls switching devices of semiconductor circuits. |
US10516333B2 |
Slew control for high-side switch
A circuit for slew rate control for a high-side switch is disclosed. The circuit comprises a sample and level-shift circuit. The sample and level-shift circuit is connected to the high-side switch. The circuit further comprises a sampling capacitor, and the sampling capacitor is configured to sample an input voltage corresponding to the sample and level-shift circuit. Additionally, the circuit includes a charge-limiting circuit. The sampling capacitor is configured to charge a gate capacitance of the high-side switch. The charge-limiting circuit is configured to limit a rate of charge transferred to the gate capacitance of the high-side switch per unit of time. |
US10516327B2 |
System and method for controlling switching device in power converter
A method for controlling a power converter includes receiving an input signal through an input node and generating an intermediate signal using a capacitor, generating a control signal in response to the input signal and the intermediate signal, coupling or decoupling the input node and the capacitor in response to the control signal, and generating an output signal in response to the intermediate signal. A circuit for controlling a power converter includes an input node receiving an input signal, a first capacitor providing an intermediate signal, a detection circuit generating a control signal in response to the input signal and the intermediate signal, a switching device coupling the input node and the first capacitor in response to the control signal, and a regulator generating an output signal in response to the intermediate signal. |
US10516326B2 |
Voice coil motor
A VCM is disclosed, the VCM including a rotor including a bobbin arranged at an upper surface of a base formed with an opening, and a driving coil wound on the bobbin, a stator including a driving magnet opposite to the driving coil, and a yoke secured by the driving magnet at an inner surface of a lateral plate, and a tilting unit including a tilt magnet arranged at an outer surface of the lateral plate, a housing fixing the tilt magnet, and a tilt coil unit opposite to the tilt magnet. |
US10516323B2 |
Segmented switched reluctance motor for powertrain electrification
The present disclosure relates to a transmission system having a transmission subsystem, a transmission housing for housing the transmission subsystem, and a rotor operably associated with the transmission subsystem. The rotor has a weight and dimension to act as a flywheel. At least one stator pole segment is housed within the transmission housing and has at least one stator winding thereon positioned in proximity to a surface of the rotor. An inverter communicates with the stator winding and electrically energizes the winding to cause rotation of the rotor. |
US10516322B2 |
Method and apparatus for maintenance of electric motor
An electric motor is disclosed having a detachable stator tooth. In some implementations, coil windings of the electric motor may be coupled to one or more drivers independently of other coil windings. A method of repairing and manufacturing an electric motor having a detachable stator tooth is also disclosed. |
US10516320B2 |
Cooling system for an electric motor
A stator housing has an annular wall including a first end, a second end, an outer surface and an inner surface defining an interior cavity. A stator is arranged within the interior cavity. The stator includes an outer surface portion, a first end turn and a second end turn. A coolant annulus extends about at least a portion of the stator housing. The coolant annulus includes at least one coolant spray passage arranged to direct a spray of coolant at one of the first end turn and the second end turn. A coolant seal and distributor is coupled to the stator housing at the first end sealing against the stator. The coolant seal and distributor includes one or more coolant spray nozzles arranged to direct a spray of coolant onto the other of the first end turn and the second end turn. |
US10516319B2 |
External fan and drive end housing for an air cooled alternator
An external centrifugal fan and drive end frame for use in an air cooled alternator are provided. Also provided is a vented pulley. |
US10516316B2 |
Housing for an electric machine
A housing for an electric machine may include an outer housing (2), an inner housing (3) arranged in the outer housing (2) and an intermediate casing space (5) formed between the outer housing (2) and the inner housing (3) as seen in a radial direction with respect to a stator axis (4). The outer housing and the inner housing (2, 3) may be pot-shaped and in each case have a base (9, 10) such that a base intermediate space (11) is formed between the base (9) of the outer housing (2) and the base (10) of the inner housing (3). The housing may further include a plurality of cooling ribs (8) running in an axial direction in the intermediate casing space (5) such that the cooling ribs extend into the base intermediate space (11) and run in a radial direction in the base intermediate space (11). |
US10516313B2 |
Insulator for armature, motor
An insulator for an armature has holes and guide portions. The holes are penetrated by pins. The pins are connected to one ends of corresponding coils, respectively. The guide portions respectively guide the jumper lines in a circumferential direction with respect to an axis. |
US10516301B2 |
System and methods for using sound waves to wirelessly deliver power to electronic devices
Wireless charging systems, and methods of use thereof, are disclosed herein. As an example, a method includes: receiving, by a radio of a transmitter, a communication signal from a wireless-power-receiving device, the communication signal containing location data indicating a location of the wireless-power-receiving device. The method further includes, in response determining that the location of the wireless-power-receiving device is within a predetermined range from the transmitter: (i) generating sound waves from a sound wave integrated circuit of the transmitter and (ii) transmitting the sound waves through a plurality of transducer elements to the location of the wireless-power-receiving device, wherein the sound waves are transmitted so that they converge constructively to form a controlled constructive interference pattern in three-dimensional (3-D) space at the location of the wireless-power-receiving device. |
US10516299B2 |
Power reception device and power reception method for non-contact power transmission
A power reception control device provided in a power reception device of a non-contact power transmission system includes a power-reception-side control circuit that controls an operation of the power reception device, and a power supply control signal output terminal that supplies a power supply control signal to a charge control device, the power supply control signal controlling power supply to a battery. The power-reception-side control circuit controls a timing at which the power supply control signal (ICUTX) is output from the power supply control signal output terminal. The operation of the charge control device is compulsorily controlled using the power supply control signal (ICUTX). |
US10516297B2 |
Wireless power transfer pad and ground assembly having the same
A wireless power transmission pad for transmitting wireless power to a reception pad including a secondary coil includes: a rectangular-shaped primary coil having an X-width defined in an x-direction and a Y-width defined in a y-direction and having a central space; a ferrite coupled to the primary coil; and a housing supporting the primary coil and the ferrite. A first cross-sectional area of a first portion including the X-width of the primary coil is smaller than a second cross-sectional area of a second portion including the Y-width of the primary coil. |
US10516291B2 |
Dongle having rechargeable, supercapacitor based power supply
A backup power system is disclosed which has a first port in communication with a server. The server includes first and second ports, and the backup power system is in communication with the second port of the server and receives a first voltage signal from the second port of the server. A second communications port of the system is in communication with a peripheral. The peripheral is powered by a separate connection to the first port of the server. A controller of the system detects when power being provided by the server through the server's second port has dropped below a threshold level. A power storage component responsive to the controller supplies power to the peripheral when the power provided from the server's second port drops below the threshold level. |
US10516288B2 |
Wireless charging system and method
Each wireless charging device of the wireless charging system has a Bluetooth module for detecting signal strength between the wireless charging device and an electronic device. The signal strength information is shared among the wireless charging devices by their data transceiver units. An analysis module of each wireless charging device automatically determines one wireless charging device having the best connection, and a decision module of the determined wireless charging device transmits a charging permit to the electronic device. Cross connection of the electronic device to multiple wireless charging devices is therefore avoided. |
US10516284B2 |
Voltage controlled charge pump and battery charger
Certain aspects of the present disclosure relate to methods and apparatus for a voltage controlled charge pump and battery charger. Certain aspects of the present disclosure provide a method for operating a voltage controlled charge pump. The method includes selectively opening and closing a plurality of switches based on a voltage on a feedback path. The plurality of switches are coupled between a voltage input terminal and a voltage output terminal. A first capacitor is coupled between at least a first switch and a second switch of the plurality of switches. A second capacitor is coupled to the voltage output terminal. The feedback path is coupled to at least one of the voltage output terminal, the first capacitor, and the second capacitor. |
US10516281B2 |
Charging apparatus for wireless earphone
A charging apparatus for wireless earphones includes a rechargeable battery, first and second electrical cables, and first and second charging receptacles. The first charging receptacle is electrically connected to the rechargeable battery by the first electrical cable and includes a cavity for receiving a first one of the wireless earphones. The first charging receptacle further includes first electrical contacts to electrically interface to electrical contacts of the first wireless earphone and a first audio path between an outer surface of the first charging receptacle and an inner surface of the cavity. The second charging receptacle is electrically connected to the rechargeable battery by the second electrical cable and includes a cavity for receiving a second one of the wireless earphones. The second charging receptacle further includes second electrical contacts to electrically interface to electrical contacts of the second wireless earphone. The second charging receptacle also includes an audio path. |
US10516277B2 |
Battery connection method and apparatus
An improved electrical connector for electrically connecting a rechargeable battery with an electrically powered device as well as methods of operation for use of an electrically powered device comprising the improved connector are provided. The connector may comprise one or more features including: integration of both first terminals for transmitting charging or discharging signals to and from the battery as well as one or more signal terminals for transmitting one or more balancing signals to and from the battery; implementation of communication means allowing for one or more signals comprising battery specific information to be received by the electrically powered device upon making an electrical connection with the battery; and, one or more safety features for preventing unsupported electrical connections between incompatible connector configurations. An electrically powered implemented with the improved electrical connector may detect one or more characteristics of a battery upon electrically connecting with the battery and may reconfigure one or more operational settings of the electrically powered device in response to the detected characteristics to safely charge or discharge the battery. |
US10516276B2 |
Secondary battery protecting integrated circuit, secondary battery protecting circuit, charge control circuit, and battery pack
A secondary battery protecting integrated circuit protects a secondary battery by controlling a switch circuit inserted in series on a path connected to a first electrode of the secondary battery. The secondary battery protecting integrated circuit includes: a sense terminal connected to a monitor terminal provided so that a first electric potential of the first electrode is monitorable; a first power supply terminal connected to the path; a second power supply terminal connected to a second electrode of the secondary battery; an internal wiring line configured to connect the first power supply terminal and the sense terminal; an internal switch on the internal wiring line; an abnormality detecting circuit configured to detect a predetermined abnormality; and a switch control circuit configured to turn on the internal switch when the predetermined abnormality is not detected, and configured to turn off the internal switch when the predetermined abnormality is detected. |
US10516274B2 |
Simultaneous transmission and reception of guided surface waves
Disclosed are various embodiments of a guided surface wave transmitter/receiver configured to transmit a guided surface wave at a first frequency and to receive guided surface waves at a second frequency, concurrently with the transmission of guided surface waves at the first frequency. The various embodiments can be configured to retransmit received power and applied the received power to an electrical load. The various embodiments of the guided surface wave transmitter/receiver also can be configured as an amplitude modulation (AM) repeater. |
US10516269B2 |
Real time feedback-based optimization of distributed energy resources
An example device includes a processor configured to receive a plurality of voltage values corresponding to voltage nodes in a first portion of a power system and determine, for each voltage node, a respective value of first and second voltage-constraint coefficients. The processor is also configured to receive a power value corresponding to a connection point of the first portion of the power system with a second portion of the power system and determine for the connection point, a respective value of first and second power-constraint coefficients. The processor is also configured to cause at least one energy resource connected to the first portion of the power system to modify an output power of the at least one energy resource based on the value of the first and second voltage-constraint coefficients for each voltage node and the value of the first and second power-constraint coefficients. |
US10516267B2 |
Method and its system of management of priority-based energy distribution
Disclosed are a priority-based energy distribution method and a priority-based energy distribution system for performing the priority-based energy distribution method. The method may include receiving an energy distribution request including information on demand energy amounts from energy consumers, determining a priority of each of the energy consumers with respect to each of energy suppliers, determining an optimal energy amount of each of the energy consumers based on the determined priority, the demand energy amounts, and available distribution energy resources of the energy suppliers, and distributing energies of the available distribution energy resources to the respective energy consumers based on the determined optimal energy amount. |
US10516266B2 |
Power supply network control system and method
A method or system for controlling an energy or power supply network having a coordination centre, a plurality of local end-user units and a communications network linking the local units and the coordination centre and a supply network connecting the local units and the coordination centre for energy or power supply. The supply network has constraints that limits power or energy consumption at at least one of the local end-user units. The method or system is adapted so that the coordination centre transmits a control signal indicating a degree of imbalance of the system to the at least one of the local end-user units, and the at least one local end-user unit is adapted to transmit a reaction signal to the coordination centre indicative of a power schedule for the local unit. |
US10516258B2 |
Retractable cable assembly in use with electrical devices
A retractable cable assembly in use with an electrical charger, power adapter, or other power supply. A cable wound on a spool within the cable assembly housing may be extracted by manually pulling on the cable or pressing of a release switch until the desired length of the cord is drawn. As the cord is drawn a torsional spring rotatably coupled to the spool and located within the core of the spool is compressed. An engaged pawl-ratchet mechanism is used to keep the spool, torsional spring and cord in place during and after extraction of the cord until which time retraction of the cord is desired. Rotation or twisting of the housing lid or of the main housing of the retractable cable assembly housing disengages the pawl-ratchet mechanism, thereby freeing the spool and torsional spring. The compressed torsional spring within the core of the spool rotates immediately as it decompresses causing the coupled spool to rotate and retract the cable, thereby winding it back around the spool within the housing. |
US10516256B2 |
Enclosure and face plate support member for use with the enclosure
An enclosure system includes a box with a base and four sidewalls, and a support member having opposite first and second ends and defining a longitudinal axis between the opposite first and second ends for supporting components within the box. A component interface portion is formed on the first end, and an enclosure interface portion is formed on the second end. The component interface portion defines a first connection region for selective connection with a component to be located in the box, and the enclosure interface portion defines a non-circular cylindrical locating region for engagement with a corresponding oppositely formed non-circular cylindrical locating region on the base of the box. The engagement between the non-circular cylindrical locating region and the oppositely formed non-circular cylindrical locating region on the base of the box prevents rotational movement of the elongate body member about the longitudinal axis relative to the box. |
US10516250B1 |
Near-infrared vertical-cavity surface-emitting laser and transfer method thereof
A near-infrared vertical-cavity surface-emitting laser is provided, which utilizes a conventional distributed Bragg reflector and a complex Bragg reflector which consists of a dielectric Bragg reflector and a reflective metal layer to construct a cavity. With the disposition of a confining layer, the light emitted from an active layer is confined in the cavity to resonate so as to emit a laser light. The thickness of the complex Bragg reflector is much thinner than that of the conventional distributed Bragg reflector, thereby lowering the cost of manufacture. In addition, with the transfer method, the laser is transferred to the substrate with high thermal conductivity to increase the heat dissipation efficiency. Therefore, the present invention can maintain operation while emitting a high-power laser. |
US10516244B1 |
Adapter and adaptation method for hand-held electronic data processing device
An adapter for a hand-held electronic data processing device includes an electrical male connector insertable and configured to fit into a female connector of the electronic data processing device, wherein electrical connector elements, on a surface of the adapter, are coupleable with elements of an external connector, and the surface of the electrical connector elements are at least approximately averagely parallel to the surface of the adapter adjacent to them. The electrical male connector and the connector elements are in electrical connection with each other on or within the adapter for electrical adaptation between the external connector and the female connector of the electronic data processing device. |
US10516243B2 |
Wire harness connecting structure for two circuit assemblies
A wire harness connecting structure for two circuit assemblies is provided. The structure allows a wire harness to be easily connected to two circuit assemblies with high space efficiency, and can reduce noise in the wire harness. A first connection terminal is provided in a first circuit assembly and a second connection terminal is provided in a second circuit assembly are located adjacent to each other. Two electrical wire-side connection terminals are respectively provided at an end of a first electrical wire and an end of a second electrical wire are housed and positioned in a shared connector housing, and thus a single harness end connector is formed. A wire harness is constituted by the first electrical wire and the second electrical wire. The electrical wire-side connection terminals of the wire harness are configured to be electrically connected to the first connection terminal and the second connection terminal. |
US10516242B2 |
Multistage signal transmission connector
A multistage signal transmission connector for connecting with a multi-signal plug and a plurality of signal lines includes a socket, a signal terminal unit, and an insertion space. The signal terminal unit is mounted to a side of the socket. The socket includes an axial insertion hole into which the multi-signal plug is inserted. The insertion space is surrounded and defined by the signal terminal unit and extends axially to intercommunicate with the axial insertion hole. The signal terminal unit includes a plurality of signal terminals. Each of the plurality of signal terminals includes a body having an elastic contact portion and an external signal portion. The elastic contact portion protrudes inwards into the insertion space and bends. The external signal portion axially extends towards an outer edge of the insertion space and is electrically connected to the elastic contact portion. |
US10516241B2 |
Audio intercom plug connector
Presented and described is, amongst other items, an intercom plug-in connector (10) for audio connections, comprising a cylindrical housing (19) extending in the axial direction (27), in particular with a circular, or essentially circular, cross-section, whose first axial end (20) is formed by a plug-in extension (22) that on its front face (39) has a plurality of sockets (23a, 23b, 23c, 23d), in particular four sockets positioned relative to one another in an approximately V-shape, for contact pins (24a, 24b), and which at its second axial end (21) has a phone jack (25) for a phone plug (14). |
US10516240B1 |
Functional indoor coaxial wall outlet cover
An indoor coaxial wall outlet cover permitting functional use of a coaxial wall outlet while fully concealing the coaxial connector plug of the coaxial wall outlet. The cover has a hidden, functional coaxial connector plug that inserts into the coaxial connector plug attached to the underlying coaxial outlet box in the wall and is connected to an extended coaxial cable having at its distal end one or more functional coaxial connector plugs for use of the wall outlet to connect to a wide variety of home entertainment equipment such as televisions, DVRs, CATV, and satellite TV receivers. The cover can be essentially featureless in outward appearance, and when positioned over a wall coaxial outlet box, the cover can fully hide that box. The cover is thin so that furniture may be positioned effectively flush against the wall in front of the covered coaxial outlet box. |
US10516233B2 |
Configurable strain relieve plate
A configurable strain relief plate assembly having a bracket member having a pair of arms and a support member between the two arms. The support member has a plurality of holes for connecting a plurality of tie down plates. The assembly has one or more captive screws or other means for connecting the bracket member to an interface module. The assembly further has one or more tie down plates connected to the support member, for example, with screws. Each tie down plate has one or more holes for connecting wires or contacts to the tie down plate, for example, with one or more zip ties or clips. |
US10516230B2 |
Electrical connector assembly
An electrical connector assembly includes a housing having cavities for receiving electric contact elements and a fastening device to fasten a cable harness that includes the electrical contact elements. The electrical connector assembly also includes a cover attached to the housing. A housing transition portion of the housing and a cover transition portion of the cover cooperate with each other to define a tube shaped guiding channel for guiding the cable harness. The fastening device is arranged inside the guiding channel. The fastening device comprises means configured to cooperate with a cable tie such that it guides and holds the cable tie in a holding direction perpendicular to an extension direction of the guiding channel. |
US10516228B2 |
Connector having a mechanism which prevents plastic deformation of a terminal
A connector is mateable with a mating connector along an upper-lower direction (Z-direction). The connector comprises a housing and a terminal. The housing has a holding portion and an upstanding portion which are apart from each other in a width direction (Y-direction). The upstanding portion has a stop portion. The terminal has a held portion held by the holding portion and a spring portion extending from the held portion. The spring portion has a base portion and an upward extending portion extending upward from the base portion. The upward extending portion has a facing portion which faces the upstanding portion in the width direction. The facing portion has a stopped portion. Under a mated state where the connector and the mating connector are mated with each other, the stop portion is located above the stopped portion and faces the stopped portion in the upper-lower direction. |
US10516227B2 |
Connector and communications device
A connector (100) and a communications device is disclosed. The connector includes a connector body (41) and three connecting ends disposed on the connector body. M signal interfaces (51a) inside a first connecting end (42) are in communication with M signal interfaces (51b) inside a second connecting end (43) in a one-to-one correspondence. The first connecting end is connected to a backplane connector (32) on a backplane (31). The second connecting end is connected to one end (45a) of a transmission cable (45), and the other end (45b) of the transmission cable is connected to a communications component (46) on a target board (33a). The backplane is configured to implement communication between X boards (33), and the target board is any one of X boards, where M≥1 and X≥1. A third connecting end (44) is configured to secure the connector body to the target board. |
US10516224B1 |
Edge launch connector for electronics assemblies
An edge launch signal connector (e.g., RF connector) comprises a connector body having a support aperture, and one or more interface surfaces operable to interface with an edge launch connector support portion of a first circuit board. A plurality of ground contact pins can be supported by the connector body and can be arrayed about the support aperture of the connector body, and a signal pin can be supported within the support aperture. In response to the edge launch signal connector engaging a second circuit board, the signal pin interfaces with a signal contact pad of the second circuit board, and the plurality of ground contact pins interface with at least one ground contact pad. A first circuit board assembly can support a plurality of edge launch signal connectors for blind-mate coupling first and second circuit board assemblies together to accommodate for positional tolerances. |
US10516223B2 |
LGA socket with improved high-speed differential signal performance
Embodiments are directed to an electrical contact for use in an LGA connector having a split beam cantilever. The contact includes a base adapted for retention in an LGA connector. The contact also includes two cantilever beams extending from the base. The cantilever beams are each connected to the base at a first end of each respective cantilever beam. The contact includes a neck defining a region where a second end of each the two cantilever beams are connected. A contact tip extends from the neck. |
US10516220B2 |
Method for cohesive joining to a cable end, and also configured cable
The invention proposes a method for cohesive joining to a cable end (1), in which method a welding tool element (30, 37, 41, 43, 45, 48, 53) is fitted on an open bundle end of individual cores (2, 15) of the cable end (1), welding energy is fed into the individual cores (2, 15), and the welding tool element (30, 37, 41, 43, 45, 48, 53) is removed from the bundle end. In the process, an engagement recess (7, 21) can be formed in the open bundle end, an engagement pin (6, 20, 31, 38, 42, 44, 46, 49, 54) of the welding tool element (30, 37, 41, 43, 45, 48, 53) can engage into the engagement recess (7, 21), and at least a portion of the welding energy can be fed via the engagement recess (7, 21). A configured cable comprising individual cores (2, 15) with a receiving sleeve (4, 16, 33) is also presented, wherein the receiving sleeve (4, 16, 33) has an inlet opening (9) for a bundle (3) of the individual cores (2, 15), the receiving sleeve (4, 16, 33) has an end piece (5, 18) which is widened in relation to the inlet opening (9), and there is, at least also in the widened end piece (5, 18), a cohesive connection between at least one subset of the individual cores (2, 15) with respect to one another and/or between at least a subset of the individual cores (2, 15) and the receiving sleeve (4, 16, 33). |
US10516209B2 |
Phased array antenna device
Synthesizers (32, 24) for synthesizing feedback signals output from a plurality of antenna modules (4) are provided. A distortion compensation signal output unit (15) derives, from a difference between a feedback signal synthesized by the synthesizers (32, 24) and a base band signal output from a modulation unit (12), a distortion compensation coefficient that provides, to the base band signal, distortion characteristics opposite to distortion characteristics of a signal radiated from the phased array antenna and outputs a predistortion signal representing the distortion compensation coefficient to a PD unit (13). |
US10516208B2 |
Electronic device including shielding structure
An electronic device, of the present disclosure, may include: a housing; an antenna unit disposed inside the housing and including a conductive pattern configured to generate a magnetic field; a plate comprising at least a part of the housing and including a material through which at least a part of the magnetic field generated by the conductive pattern can pass; and a control circuit configured to transmit at least one piece of payment information to an external device using the conductive pattern, wherein the antenna unit including the conductive pattern includes: a first coil having a first plurality of turns that is substantially perpendicular to one surface of the plate; and a second coil having a second plurality of turns that is substantially parallel to the surface of the plate, and a shielding structure comprising a shielding material is disposed inside the first coil or below the second coil. The electronic device, according to various example embodiments of the present disclosure, can implement various read-out methods (for example, a Near Field Communication (NFC) method and a Magnetic Secure Transmission (MST) method) with one module due to the shape of the shielding structure disposed in the antenna unit. |
US10516196B2 |
Dual mode cavity filter and system comprising such filter
A dual mode cavity filter installed aboard a satellite having a first and a second waveguide cavity, a first coupling waveguide iris having an input slot and followed by the first waveguide cavity, a second coupling waveguide iris having a coupling slot, following the first waveguide cavity and followed by the second waveguide cavity, and a third coupling waveguide iris having an output slot and following the second waveguide cavity. The dual mode cavity filter is associated with a plurality of devices having at least one respective commanded rod having a certain insertion length with respect of the waveguide cavities and of the slots. The devices are placed in predetermined positions of the cavities and/or of the irises and are arranged to perform a tuning modification and/or a coupling modification of the filter by controlling the insertion length of the rods in outer space. |
US10516195B2 |
Anaerobic aluminum-water electrochemical cell
An anaerobic aluminum-water electrochemical cell is provided. The electrochemical cell includes: a plurality of electrode stacks, each electrode stack featuring an aluminum or aluminum alloy anode, and at least one cathode configured to be electrically coupled to the anode; one or more physical separators between each electrode stack adjacent to the cathode; a housing configured to hold the electrode stacks, an electrolyte, and the physical separators; a water injection port, in the housing, configured to introduce water into the housing; and an amount of hydroxide base sufficient to form an electrolyte having a hydroxide base concentration of at least 0.5% to at most 13% of the saturation concentration when water is introduced between the anode and the least one cathode. |
US10516192B2 |
Battery pack thermal regulation device
The invention relates to a device for the thermal regulation of a motor vehicle battery pack (1) comprising at least one battery (5) contained in a housing (3), the thermal regulation device comprising: at least one heat exchanger (9) in contact with the battery (5), at least one elastic element (15) arranged in the bottom (14) of the housing (3) so as to hold the heat exchanger (9) against the battery (5). An insulator (13) is interposed between the elastic element (15) and the heat exchanger (9). |
US10516191B2 |
Methods and systems for busbar cooling
A rechargeable battery system, a battery pack, and methods of manufacturing the same are disclosed herein. The rechargeable battery system and/or battery pack can be for an electric vehicle. The rechargeable battery system and/or battery pack can include a plurality of battery cells arranged into one or more rows and a busbar. The battery cells can each include a first terminal and a second terminal, and the plurality of battery cells can include a subset of battery cells with the first terminal oriented in a same direction. The busbar can be conductive so as to be able to conduct electrical energy to and from at least the subset of battery cells. The busbar can define a busbar cooling duct having an entrance and an exit. The busbar cooling duct can in thermal connection with a plurality of contacts of the busbar. |
US10516190B2 |
Surface mount battery and portable electronic device with integrated battery cell
Systems and methods are provided for battery cells including solid electrolytes. Solid electrolyte cells may be integrated with electronic devices. For example, a solid electrolyte cell may be integrated with a metal surface of a circuit board or an electrically conductive surface of a chassis. Surface-mountable solid electrolyte cells may be electrically coupled to circuit traces using, for example, a reflow soldering process. |
US10516186B2 |
Negative electrode active material including titanium-based composite, method of preparing the same and lithium secondary battery including the same
The present invention provides a lithium secondary battery, including a positive electrode including a positive electrode active material, a negative electrode including a negative electrode active material, and a separator provided between the positive electrode and the negative electrode, wherein the negative electrode active material may include a titanium-based composite, wherein, when the lithium secondary battery is charged to SOC 50 under C-rate conditions of 0.1 to 40 C, the titanium-based composite has a ratio of the peak area of a plane (400) and the peak area of a plane (111) of 0.76 or more in a measured X-ray diffraction spectrum (XRD). Therefore, the present invention may provide a lithium secondary battery having excellent output characteristics and a battery pack in which a BMS prediction algorithm is simplified. |
US10516180B2 |
Carbon dioxide removal system for anode exhaust of a fuel cell
A carbon dioxide removal system includes: an absorption system including a first absorption stage and a second absorption stage. The first absorption stage includes: a first compressor configured to receive and compress a first carbon dioxide-containing exhaust stream from an anode of a fuel cell, and a first direct contact absorption cooling tower configured to absorb carbon dioxide from the compressed first exhaust stream and lower a temperature of the compressed first exhaust stream using a first solvent stream containing a physical solvent, to generate a second exhaust stream. The second absorption stage includes: a second compressor configured to receive and compress the second exhaust stream from the first absorption stage, and a second direct contact absorption cooling tower configured to absorb carbon dioxide from the compressed second exhaust stream and lower a temperature of the compressed second exhaust stream using a second solvent stream containing a physical solvent. |
US10516179B2 |
Fuel cell system and method of controlling the same
A fuel cell system includes a fuel cell stack having a plurality of cells each having hydrogen channels, a hydrogen channel inlet, and a hydrogen channel outlet, a load supplied with power from the fuel cell stack, a circulation passage connecting the channel inlet with the channel outlet, a hydrogen pump provided in the circulation passage, and a controller. The controller rotates the hydrogen pump in a positive direction so as to feed the hydrogen gas in a first amount into each cell through the channel inlet, at a flow rate larger than a minimum flow rate required for power generation, and then rotate the hydrogen pump in a negative direction so as to feed the hydrogen gas into each cell through the channel outlet, during a period from stop of power supply to the load, to the next start of power supply. |
US10516177B2 |
Fuel cell purge systems and related processes
A fuel cell purge system includes a primary fuel cell in fluid communication with a purge cell. Fuel and oxidant purged with inert gas impurities from the primary fuel cell react in the purge cell, thereby decreasing the volume of purged gases and facilitating storage while maintaining fuel cell electrochemical performance. |
US10516175B2 |
Fuel cell system, a fire fighting system, and an aircraft
A fuel cell system for an aircraft includes a fuel cell, wherein at the cathode side a cathode inlet and a cathode outlet is provided, and wherein at the anode side an anode inlet and an anode outlet is provided, and a cathode recirculation channel for passing the cathode product fluid from the cathode outlet to the cathode inlet. In the fuel cell system, the water content of the cathode product fluid in the cathode recirculation channel can be reduced or at least stabilized in a possibly effective way, because the cathode recirculation channel includes a water extraction device for extracting water from the cathode product fluid. |
US10516166B2 |
Anode of lithium battery and lithium battery using the same
An anode of lithium battery comprises a current collector and an anode material layer. The anode material layer is located in at least one surface of the current collector. The current collector is a three-dimensional porous composite structure. The three-dimensional porous composite structure comprises a porous structure and at least one carbon nanotube structure. The porous structure has a plurality of metal ligaments and a plurality of pores. The at least one carbon nanotube structure is embedded in the porous structure and comprising a plurality of carbon nanotubes joined end to end by van der Waals attractive force, wherein the plurality of carbon nanotubes are arranged along a same direction. |
US10516153B2 |
Negative-electrode active material for non-aqueous electrolyte secondary battery and non-aqueous electrolyte secondary battery
The initial charge/discharge efficiency and cycle characteristics of a non-aqueous electrolyte secondary battery that contains a silicon material as a negative-electrode active material are improved. A negative-electrode active material particle (10) according to an embodiment includes a lithium silicate phase (11) represented by Li2zSiO(2+z) {0 |
US10516148B2 |
Nonaqueous electrolyte secondary battery insulating porous layer
The present invention improves productivity of production of a nonaqueous electrolyte secondary battery. A nonaqueous electrolyte secondary battery insulating porous layer in accordance with an embodiment of the present invention is a constituent member of a nonaqueous electrolyte secondary battery laminated separator, includes a thermoplastic resin, has a porosity of 25% to 80%, and has a peeling strength of above 0 N/m to 2.0 N/m when press-bonded to a nonaqueous electrolyte secondary battery electrode at 25° C. through two one-minute 30 kN applications, the nonaqueous electrolyte secondary battery electrode containing an electrode active material, an electrically conductive agent, and a binding agent in a mass fraction of 92:2.7:5.3. |
US10516147B2 |
Battery pack with reduced magnetic field emission
Implementations of a battery pack with reduced magnetic field emission are provided. In some implementations, the battery pack may be configured to reduce and/or eliminate the magnetic field normally generated while electrical current is being drawn from one or more cylindrical-steel electrochemical cells (e.g., AA batteries) by a connected electrical device. In some implementations, each electrochemical cell of a battery pack may include a conductive sleeve comprised of four conductive strips that are separated from the electrochemical cell by a thin insulating layer of material. In this way, the conductive sleeve provides a return path for electrical current that minimizes the loop area between the electrochemical cell and the conductive sleeve thereof. In some implementations, the four conductive strips of a conductive sleeve may be equally spaced 90 degrees apart and/or positioned longitudinally on a cylindrical-steel electrochemical cell, separated therefrom by the insulating layer of material. |
US10516145B2 |
Battery pack array retention
An exemplary battery assembly includes an endplate of a battery array, and an enclosure wall secured directly to the endplate from outside an open area of a battery pack enclosure. An exemplary method of securing a battery array includes positioning a battery array within an open area of an enclosure and, from a position outside the open area, securing an endplate of a battery array directly to a wall of a battery pack enclosure. |
US10516144B2 |
Energy storage apparatus
Provides is an energy storage apparatus which includes: a plurality of energy storage devices disposed in a row in a first direction, and a bus bar configured to connect external terminals of energy storage devices to each other, wherein the bus bar includes a first member having a first connection portion connected to the external terminal of one energy storage device and a first extension portion extending from the first connection portion; and a second member having a second connection portion connected to the external terminal of another energy storage device and a second extension portion extending from the second connection portion, and the first extension portion has a first conductive surface, and the second extension portion has a second conductive surface which is made to overlap with the first conductive surface in a separable manner in a state where the second conductive surface faces the first conductive surface. |
US10516143B2 |
Sealing system for a terminal feed-through
A battery includes an outer wall having a through-hole defined by a peripheral opening edge, at least one cell having a positive electrode and a negative electrode, an electrically conductive terminal stud connected to the positive electrode or the negative electrode, including a shaft extending through the through-hole, and at least one clamping element sitting on the shaft and covering the through-hole, and forming an annular gap together with the outer wall, an electrically insulating and annular support element surrounding the shaft of the terminal stud in a sleeve-like manner, and having an outward-facing peripheral contact surface against which the opening edge of the through-hole lies, wherein the support element includes a glass or a ceramic, or a glass- or ceramic-based composite material, and a sealing element arranged concentrically around the support element in the gap between the clamping element and the outer wall. |
US10516142B2 |
Battery module and battery pack including same
Provided are a battery module capable of preventing damage of a battery cell in as case when the battery cell is mounted and accommodated in a cell cartridge, and a battery pack including the battery module. The battery module according to the present disclosure includes a plurality of battery cells, at least one cell cartridge configured to guide stacking of the plurality of battery cells and to mount therein at least one battery cell among the plurality of battery cells, and a sheet member provided between the battery cell and the cell cartridge, and the sheet member is adhered to the battery cell on a surface where the sheet member contacts the battery cell and is adhered to the cell cartridge on a surface where the sheet member contacts the cell cartridge, to fix the battery cell and the cell cartridge to each other via the sheet member. |
US10516139B2 |
Organic light emitting display
An organic light emitting display including a back plane including an active area on which an image is displayed, and a bezel area outside the active area; a pixel array on the active area and configured to display the image; an encapsulation plate encapsulating the pixel array; a transparent adhesive film free of a moisture absorption filler, formed on the active area and disposed between the encapsulation plate and the back plane; and a dam including a sealant with a moisture absorption filler formed in the bezel area and adjoining the adhesive layer so as to limit moisture from penetrating into the pixel array. |
US10516138B2 |
Display device having a density of the first inorganic layer in the first region is higher than in the second region
A display device includes a light-emitting element layer that emits light with a luminance controlled for each of a plurality of unit pixels constituting an image, and a sealing layer provided on the light-emitting element layer and including a plurality of layers. The plurality of layers of the sealing layer includes at least an inorganic layer provided on the light-emitting element layer, an organic layer provided on the inorganic layer, and an inorganic layer that is an uppermost layer. A density of the inorganic layer that is the uppermost layer in a thickness direction changes in the thickness direction. |
US10516136B2 |
Multilayer thin film encapsulation structure for a organic electroluminescent device
An organic electroluminescent device (100) includes a substrate (1), a driving circuit layer (2), an inorganic protective layer (Pa), an organic flattening layer (Pb), an organic electroluminescent element layer (3), and a TFE structure (10). The TFE structure includes a first inorganic barrier layer (12), an organic barrier layer (14), and a second inorganic barrier layer (16). As seen in a direction of normal to the substrate, the organic flattening layer (Pb) is formed in a region where the inorganic protective layer (Pa) is formed, organic electroluminescent elements are located in a region where the organic flattening layer (Pb) is formed, and an outer perimeter of the TFE structure (10) crosses lead wires (32) and is present between an outer perimeter of the organic flattening layer (Pb) and an outer perimeter of the inorganic protective layer (Pa). In a region where the inorganic protective layer (Pb) and the first inorganic barrier layer (12) are in direct contact with each other on the lead wires (32), a tapering angle θ(12) of a side surface of a cross-section of the first inorganic barrier layer (12) taken along a plane parallel to a width direction of the lead wires (32) is smaller than 90 degrees. |
US10516134B2 |
Organic EL display device and organic EL display device manufacturing method
In an organic EL display device, a taper angle of a separation layer surrounding edges of an organic EL layer disposed in each pixel and being disposed between adjacent pixels is different from a taper angle of a frame-shaped bank surrounding edges of an organic layer. As a result, qualities required for layers surrounded by the separation layer and the frame-shaped bank respectively are satisfied. |
US10516133B2 |
Organic EL display panel and method of manufacturing organic EL display panel
An organic EL display panel includes a substrate, a plurality of pixel electrodes disposed in a matrix pattern over the substrate, a first current feeding auxiliary electrode layer disposed to extend in a column or row direction in at least one of gaps between adjacent ones of the pixel electrodes over the substrate, a second current feeding auxiliary electrode layer that contains aluminum as a main constituent and is disposed to be superposed on the first current feeding auxiliary electrode layer, a plurality of light emitting layers disposed on the plurality of pixel electrodes, and a common electrode layer disposed continuously to cover the first current feeding auxiliary electrode layer and the second current feeding auxiliary electrode layer as well as an upper side of the plurality of light emitting layers. |
US10516130B2 |
Light emitting apparatus with optical interference layer having a larger refractive index than a light emitting layer
A display apparatus includes on a substrate a plurality of light emitting elements in which an organic layer including a white light emitting layer is sandwiched between a lower transparent electrode and an upper electrode, and further includes a reflection layer and an optical interference layer provided between the light emitting elements and the substrate, wherein the optical interference layer is made of a material having a lower refractive index than the refractive index of the light emitting layer and the ratio (nr/nb) of a refractive index (nr) with respect to a red wavelength region to a refractive index (nb) with respect to a blue wavelength region is less than 0.95, and the orders of interference m for blue, green, and red wavelength regions are 5, 4, and 3, respectively, when the optical distance from the light emitting layer to the reflection layer is (2m+1)λ/4±(⅛)λ. |
US10516127B2 |
Quantum rod panel and quantum rod display device
A quantum rod panel includes a first substrate and a second substrate facing each other, a pixel electrode and a common electrode over the first substrate and spaced apart from each other, and a quantum rod layer between the pixel electrode and the common electrode and including quantum rods and metal particles. |
US10516124B2 |
Photoelectric conversion elements, method of manufacturing photoelectric conversion element, and solid-state imaging device
A photoelectric conversion element includes: a first electrode; a photoelectric conversion layer provided on the first electrode, and including an organic semiconductor with quantum efficiency of 1% or less; and a second electrode provided on the photoelectric conversion layer. |
US10516122B2 |
Display apparatus and electronic apparatus
Disclosed herein is a display apparatus, including: a foldable substrate; a pixel array section including a plurality of pixels disposed on the substrate and each including an electro-optical device; the foldable substrate being folded at a substrate end portion at least on one side thereof around the pixel array section; a peripheral circuit section disposed on the substrate end portion and adapted to drive the pixels of the pixel array section; and a pad section provided on the substrate end portion on which the peripheral circuit section is provided and adapted to electrically connect the peripheral circuit section to the outside of the substrate. |
US10516118B2 |
Electronic device, display device, method for manufacturing the same, and system including a plurality of display devices
A power saving system using a plurality of flexible display devices placed on various places is provided. A structure of a bendable portion in a display device is improved. Specifically, a wiring partly including a metal nanoparticle is used. Openings are formed in an insulating layer so that the wiring becomes substantially longer by meandering in cross section. When a plurality of openings are formed and aligned, a portion that is easy to bend is formed along the line where they are aligned. A plurality of display panels are used for one display portion. The flexible display portion can be provided on a surface, specifically, a curved surface of furniture such as a chair or a sofa. |
US10516117B2 |
Metal-assisted delayed fluorescent emttters employing benzo-imidazo-phenanthridine and analogues
Metal-assisted delayed fluorescent emitters employing benzo-imidazo-phenanthridine and analogues for full color displays and lighting applications. |
US10516116B2 |
Organic compound, and organic thin film and electronic device
An organic compound is represented by Chemical Formula 1, and an organic thin film, an organic thin film transistor, and an electronic device include the organic compound. |
US10516107B2 |
Memory cell having resistance variable film and method of making the same
A manufacture includes a first electrode having an upper surface and a side surface, a resistance variable film over the first electrode, and a second electrode over the resistance variable film. The resistance variable film extends along the upper surface and the side surface of the first electrode. The second electrode has a side surface. A portion of the side surface of the first electrode and a portion of the side surface of the second electrode sandwich a portion of the resistance variable film. |
US10516105B2 |
Resistive memory device containing oxygen-modulated hafnium oxide material and methods of making thereof
A resistive memory device includes a first electrode, a second electrode spaced from the first electrode along a spacing direction, and a hafnium oxide resistive material portion of a resistive memory cell located between the first electrode and the second electrode and having a compositional modulation in oxygen concentration within directions that are perpendicular to the spacing direction. |
US10516103B1 |
Magnetoresistive stack and method of fabricating same
A magnetoresistive element (e.g., a spin-torque magnetoresistive memory element) includes a fixed magnetic layer, a free magnetic layer, having a high-iron alloy interface region located along a surface of the free magnetic layer, wherein the high-iron alloy interface region has at least 50% iron by atomic composition, and a first dielectric, disposed between the fixed magnetic layer and the free magnetic layer. The magnetoresistive element further includes a second dielectric, having a first surface that is in contact with the surface of the free magnetic layer, and an electrode, disposed between the second dielectric and a conductor. The electrode includes: (i) a non-ferromagnetic portion having a surface that is in contact with a second surface of the second dielectric, and (ii) a second portion having at least one ferromagnetic material disposed between the non-ferromagnetic portion of the electrode and the conductor. |
US10516102B1 |
Multiple spacer assisted physical etching of sub 60nm MRAM devices
A MTJ stack is deposited on a bottom electrode. A top electrode layer and hard mask are deposited on the MTJ stack. The top electrode layer not covered by the hard mask is etched. Thereafter, a first spacer layer is deposited over the patterned top electrode layer and the hard mask. The first spacer layer is etched away on horizontal surfaces leaving first spacers on sidewalls of the patterned top electrode layer. The free layer not covered by the hard mask and first spacers is etched. Thereafter, the steps of depositing a subsequent spacer layer over patterned previous layers, etching away the subsequent spacer layer on horizontal surfaces leaving subsequent spacers on sidewalls of the patterned previous layers, and thereafter etching a next layer not covered by the hard mask and subsequent spacers are repeated until all layers of the MTJ stack have been etched to complete the MTJ structure. |
US10516101B2 |
Physical cleaning with in-situ dielectric encapsulation layer for spintronic device application
A method for etching a magnetic tunneling junction (MTJ) structure is described. A stack of MTJ layers is provided on a bottom electrode in a substrate. The MTJ stack is etched to form a MTJ structure wherein portions of sidewalls of the MTJ structure are damaged by the etching. Thereafter, the substrate is removed from an etching chamber wherein sidewalls of the MTJ structure are oxidized. A physical cleaning of the MTJ structure removes damaged portions and oxidized portions of the MTJ sidewalls. Thereafter, without breaking vacuum, an encapsulation layer is deposited on the MTJ structure and bottom electrode. |
US10516100B2 |
Silicon oxynitride based encapsulation layer for magnetic tunnel junctions
A plasma enhanced chemical vapor deposition (PECVD) method is disclosed for forming a SiON encapsulation layer on a magnetic tunnel junction (MTJ) sidewall that minimizes attack on the MTJ sidewall during the PECVD or subsequent processes. The PECVD method provides a higher magnetoresistive ratio for the MTJ than conventional methods after a 400° C. anneal. In one embodiment, the SiON encapsulation layer is deposited using a N2O:silane flow rate ratio of at least 1:1 but less than 15:1. A N2O plasma treatment may be performed immediately following the PECVD to ensure there is no residual silane in the SiON encapsulation layer. In another embodiment, a first (lower) SiON sub-layer has a greater Si content than a second (upper) SiON sub-layer. A second encapsulation layer is formed on the SiON encapsulation layer so that the encapsulation layers completely fill the gaps between adjacent MTJs. |
US10516098B2 |
Apparatus for spin injection enhancement and method of making the same
A switching device is disclosed. The switching device includes a spin-orbit coupling (SOC) layer, a pure spin conductor (PSC) layer disposed atop the SOC layer, a ferromagnetic (FM) layer disposed atop the PSC layer, and a normal metal (NM) layer sandwiched between the PSC layer and the FM layer. The PSC layer is a ferromagnetic insulator (FMI) is configured to funnel spins from the SOC layer onto the NM layer and to further provide a charge insulation so as to substantially eliminate current shunting from the SOC layer while allowing spins to pass through. The NM layer is configured to funnel spins from the PSC layer into the FM layer. |
US10516096B2 |
Magnetic random access memory structures, integrated circuits, and methods for fabricating the same
Spin transfer torque magnetic random access memory structures, integrated circuits, and methods for fabricating integrated circuits are provided. An exemplary spin transfer torque magnetic random access memory structure has a perpendicular magnetic orientation, and includes a bottom electrode and a base layer over the bottom electrode. The base layer includes a seed layer and a roughness suppression layer. The spin transfer torque magnetic random access memory structure further includes a hard layer over the base layer. Also, the spin transfer torque magnetic random access memory structure includes a magnetic tunnel junction (MTJ) element with a perpendicular orientation over the hard layer and a top electrode over the MTJ element. |
US10516093B2 |
Piezoelectric material, piezoelectric element, and electronic apparatus
The present invention provides a piezoelectric material not containing lead and potassium, showing satisfactory insulation and piezoelectricity, and having a high Curie temperature. The invention relates to a piezoelectric material includes a main component containing a perovskite-type metal oxide represented by Formula (1): (NaxBa1-y)(NbyTi1-y)O3 (wherein, 0.80≤x≤0.94 and 0.83≤y≤0.94), and an additive component containing at least one element selected from Mn and Ni, wherein the content of the Ni is 0 mol or more and 0.05 mol or less based on 1 mol of the perovskite-type metal oxide, and the content of the Mn is 0 mol or more and 0.005 mol or less based on 1 mol of the perovskite-type metal oxide. |
US10516091B2 |
Ultrasonic motor, drive control system, optical apparatus, and vibrator
An ultrasonic motor, usable in a drive control system and the like, includes an annular vibrator and an annular moving member arranged so as to be brought into pressure-contact with the vibrator. The vibrator includes an annular vibrating plate and an annular piezoelectric element. The piezoelectric element includes an annular piezoelectric ceramic piece, a common electrode arranged on one surface of the piezoelectric ceramic piece, and a plurality of electrodes arranged on the other surface of the piezoelectric ceramic piece. The piezoelectric ceramic piece contains lead in a content of less than 1,000 ppm. The plurality of electrodes include two drive phase electrodes, one or more non-drive phase electrodes, and one or more detection phase electrodes. |
US10516089B2 |
Memory cell comprising coupled Josephson junctions
Methods and apparatus are disclosed for operating a memory cell formed from the plurality of coupled Josephson junctions. The memory cell is configured such that applying an electrical signal to the junctions can cause at least one, but not all, of the junctions to change their respective phase states. Subsequent writes to the memory cell using substantially the same electrical pulse do not change the phase state of the plurality of junctions. The memory cell can be ready by providing another electrical pulse to one of the junctions and receiving an output electrical pulse generated in response by a different Josephson junction of the memory cell. A set of phase states are selected to represent the logic values that are stable across anticipated operating conditions for the memory cell. Methods of selecting electrical parameters and manufacturing memory cells are further disclosed. |
US10516088B2 |
Pin coupling based thermoelectric device
A hybrid solar-thermoelectric device includes a solar device and a thermoelectric device coupled thereto. The thermoelectric device includes a flexible first substrate, and a number of sets of N and P thermoelectric legs coupled to the first substrate. Each set includes an N and a P thermoelectric leg electrically contacting each other through a conductive material on the first substrate. The thermoelectric device also includes a rigid second substrate, a conductive thin film formed on the second substrate, and a number of pins corresponding to the number of sets of N and P thermoelectric legs. Each pin couples the each set on an end thereof away from the first substrate to the conductive thin film formed on the second substrate, and is several times longer than a height of the N and P thermoelectric legs. |
US10516081B1 |
High efficiency hexagon LED for micro LED application
Light emitting structures are described in which vertical inorganic semiconductor-based light emitting diodes (LEDs) with hexagon shaped sidewalls are mounted within corresponding circular reflective well structures. Diffuser layers may additionally laterally surround the hexagon shaped sidewalls within the circular reflective well structures. |
US10516079B2 |
Method for producing an optoelectronic semiconductor component, and optoelectronic semiconductor component
A method is specified for producing an optoelectronic semiconductor component, comprising the following steps: A) providing a structured semiconductor layer sequence (21, 22, 23) having a first semiconductor layer (21) with a base region (21c), at least one well (211), and a first cover region (21a) in the region of the well (211) facing away from the base surface (21c), an active layer (23), and a second semiconductor layer (22) on a side of the active layer (23) facing away from the first semiconductor layer (21), wherein the active layer (23) and the second semiconductor layer (22) are structured jointly in a plurality of regions (221, 231) and each region (221, 231) forms, together with the first semiconductor layer (21), an emission region (3), B) simultaneous application of a first contact layer (41) on the first cover surface (21a) and a second contact layer (42) on a second cover surface (3a) of the emission regions (3) facing away from the first semiconductor layer (21) in such a way that the first contact layer (41) and the second contact layer (42) are electrically separated from each other, and the first contact layer (41) and the second contact layer (42) run parallel to each other. |
US10516074B2 |
Semiconductor device, light emission element array, optical print head, and method of producing semiconductor device
A semiconductor device includes: a p type first semiconductor layer that contains acceptors as impurities; an n type second semiconductor layer that is provided on the first semiconductor layer and contains donors as impurities; and a p type first diffusion portion that includes a contact portion in contact with the first semiconductor layer, the contact portion containing acceptors whose concentration is higher than that in the first semiconductor layer. |