最新美国发明专利第2016-06-14期 - 专利汇|PatentHub专利检索|专利查询网|发明专利查询分析

Document	Document Title
US09365598B2	Phosphine derivatives of fluorescent compounds A phosphine derivative of DyLight dyes modified with ethylene glycol or (poly)ethylene glycol groups. In one embodiment, the compounds are useful in chemoselective ligation reactions.
US09365596B2	Method for preparing quaternary phosphonium salts A two-step pathway for preparing high pure quaternary phosphonium salts is disclosed. In the first step, hydrogen phosphide (PH3) or a higher phosphine reacts with a protonic compound to produce a phosphonium salt, which then reacts with a carbonic acid diester to produce a quaternary phosphonium salt in the second step. On one hand, hydrogen phosphide (PH3) and higher phosphines, including primary phosphines, secondary phosphines, and tertiary phosphines, after neutralization with protonic compound, become sufficiently reactive and can be alkylated by carbonic acid diester to form quaternary phosphonium cations. On the other hand, as an anion-exchange procedure is completely avoided, the process not only gives quaternary phosphonium salts of high purity, but also gives people freedom to design the cation and the anion of a quaternary phosphonium salt synchronously by choosing a preferred phosphine and a protonic compound that can supply a desired anion.
US09365592B2	Bonding composition To provide a bonding composition where high joint strength can be obtained due to joining at a comparatively low temperature and under a pressureless condition, and, that is also equipped with thermal resistance that is difficult to cause a reduction of joint strength due to decomposition, deterioration and/or the like of a resin component at the time of an increase of an operating temperature, and to provide a bonding composition particularly containing metallic particles. A bonding composition containing inorganic metallic particles and organic components including unsaturated hydrocarbon and amine with 4 to 7 of carbon number
US09365590B2	Selenophene-fused aromatic compound and manufacturing method thereof The present disclosure relates to a method for more easily and economically producing a selenophene-fused aromatic compound derivative containing various substituents and the selenophene-fused aromatic compound produced according to the method, and the selenophene-fused aromatic compound can be used for various purposes such as an intermediate of an anti-bacterial or anticancer substance, an indicator of which color is changed depending on a solvent, or a fluorescent substance.
US09365587B2	Synthesis of carbamoylpyridone HIV integrase inhibitors and intermediates The invention is a process for the preparation of a compound of the following formula (I): wherein R is —CHO, —CH(OH)2 or —CH(OH)(OR4); P1 is H or a hydroxyl protecting group; P3 is H or a carboxy protecting group; R3 is H, halogen, hydroxy, optionally substituted lower alkyl, optionally substituted cycloalkyl, etc.; Rx is H, halogen or R2—X—NR1—C(O)—; etc. as defined in the specification. The compounds are useful as intermediates in synthesizing compounds having HIV integrase inhibitory activity.
US09365586B2	Method for producing dithiine tetracarboximides The present invention relates to a process for preparing dithiinetetracarboximides by reaction of succinic monoamides with thionyl chloride, with continuous performance of at least one of the process steps.
US09365585B2	Semiconducting polymers The invention relates to novel polymers containing repeating units based on benzodithiophene or derivatives thereof, monomers and methods for their preparation, their use as semiconductors in organic electronic (OE) devices, especially in organic photovoltaic (OPV) devices, and to OE and OPV devices comprising these polymers.
US09365582B2	Macrocyclic inhibitors of hepatitis C virus Inhibitors of HCV replication of formula (I) and the salts and stereoisomers thereof, wherein each dashed line (represented by - - - - -) represents an optional double bond; X is N, CH and where X bears a double bond it is C; R1 is —OR7, —NH—SO2R8; R2 is hydrogen, and where X is C or CH, R2 may also be C1-6alkyl; R3 is hydrogen, C1-6alkyl, C1-6alkoxyC1-6alkyl, C3-7cycloalkyl; n is 3, 4, 5, or 6; R4 is C1-6alkyl or C3-7cycloalkyl; R5 is hydrogen, halo, C1-6alkyl, hydroxy, C1-6alkoxy, polyhaloC1-6alkyl; R6 is hydrogen, C1-6alkoxy, mono- or diC1-6alkylamino; or R5 and R6 may form a 5- or 6-membered unsaturated or partially unsaturated ring, optionally comprising one or two selected from O, N and S; R7 is hydrogen; C3-7cycloalkyl optionally substituted with C1-6alkyl; or C1-6alkyl optionally substituted with C3-7cycloalkyl; R8 is C3-7cycloalkyl optionally substituted with C1-6alkyl; C1-6alkyl optionally substituted with C3-7cycloalkyl; or —NR8aR8b; R8a and R8b are C1-6alkyl, or both may form a 5- or 6-membered saturated heterocyclic ring; pharmaceutical compositions containing compounds (I) and processes for preparing compounds (I).
US09365579B2	Tricyclic compounds The invention provide a compound of Formula (I) pharmaceutically acceptable salts, pro-drugs, biologically active metabolites, stereoisomer and isomer thereof wherein the variable are defined herein. The compound of the invention are useful for treating immunological and oncological conditions.
US09365574B2	Soluble guanylate cyclase activators A compound of Formula (I): or a pharmaceutically acceptable salt thereof, are capable of modulating the body's production of cyclic guanosine monophosphate (“cGMP”) and are generally suitable for the therapy and prophylaxis of diseases which are associated with a disturbed cGMP balance. The invention furthermore relates to processes for preparing compounds of Formula I, or a pharmaceutically acceptable salt thereof, for their use in the therapy and prophylaxis of the abovementioned diseases and for preparing pharmaceuticals for this purpose, and to pharmaceutical preparations which comprise compounds of Formula (I) or a pharmaceutically acceptable salt thereof.
US09365572B2	PI3K and/or mTOR inhibitor The present invention relates to a compound of formula (I), or a pharmaceutically acceptable salt, a stereoisomer or a solvate thereof, wherein R1, R2, R3, R4, X, Y, A and B are as defined in the specification. The present invention further relates to a method for preparing these compounds, a pharmaceutical composition containing these compounds, and a use of these compounds in manufacture of a medicament for treating and/or preventing proliferative diseases.
US09365571B2	Piperidino-pyrimidine derivatives for the treatment of viral infections This invention relates to piperidino-pyrimidine derivatives, processes for their preparation, pharmaceutical compositions, and their use in treating viral infections.
US09365570B2	Substituted 6, 5-fused bicyclic heteroaryl compounds The present invention relates to azole bicyclic heteroaryl compounds. The present invention also relates to pharmaceutical compositions containing these compounds and methods of treating cancer by administering these compounds and pharmaceutical compositions to subjects in need thereof. The present invention also relates to the use of such compounds for research or other non-therapeutic purposes.
US09365568B2	Pyrrolopyridines as kinase inhibitors Compounds of Formula I are useful for inhibition of CHK1 and/or CHK2. Methods of using compounds of Formula I and stereoisomers and pharmaceutically acceptable salts thereof, for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions are disclosed.
US09365567B2	Alkoxy substituted imidazoquinolines Imidazoquinoline compounds with an alkoxy substituent at the 6, 7, 8, or 9-position, pharmaceutical compositions containing the compounds, intermediates, methods of making, and methods of use of these compounds as immunomodulators, for inducing or inhibiting cytokine biosynthesis in animals and in the treatment of diseases including viral, and neoplastic, are disclosed.
US09365565B2	Salts of aza-bicyclic di-aryl ethers and pharmaceuticals thereof The present invention relates to salts of (R)-3-(6-(4-methylphenyl)-pyridin-3-yloxy)-1-aza-bicyclo[2.2.2]octane, to methods for making them or their precursors, to pharmaceutical compositions comprising them, and to their use as medicaments.
US09365563B2	TRPV1 antagonists including dihydroxy substituent and uses thereof The invention relates to compounds of formula IA and pharmaceutically acceptable derivatives thereof, compositions comprising an effective amount of a compound of formula IA or a pharmaceutically acceptable derivative thereof, and methods for treating or preventing a condition such as pain, UI, an ulcer, IBD and IBS, comprising administering to an animal in need thereof an effective amount of a compound of formula IA or a pharmaceutically acceptable derivative thereof.
US09365562B2	1,3 substituted azetidine PDE10 inhibitors The present invention is directed to substituted azetidine compounds which are useful as therapeutic agents for the treatment of central nervous system disorders associated with phosphodiesterase 10 (PDE10). The present invention also relates to the use of such compounds for treating neurological and psychiatric disorders, such as schizophrenia, psychosis or Huntington's disease, and those associated with striatal hypofunction or basal ganglia dysfunction.
US09365561B2	C5 benzothiazolyl sulfone compound, method of preparing preparing the same, method of preparing polyene dialdehyde compound using the same, and method of synthesizing lycopene using the same Disclosed are a novel C5 benzothiazolyl sulfone compound having an acetal protecting group, a method of preparing the same, and a method of efficiently preparing an apo-carotene dialdehyde compound having a polyene dialdehyde structure using the same. Also, a method of efficiently preparing lycopene by olefination (Julia-Kocienski) between the apo-carotene dialdehyde compound (C20 crocetin dialdehyde) and C10 benzothiazolyl geranyl sulfone is provided.
US09365559B2	Crystal form of Dabrafenib and preparation method of use thereof The invention relates to Crystal Hydrate Form VI of Dabrafenib and preparation method thereof, wherein Crystal Hydrate Form VI of Dabrafenib has the advantage of being more stable at room temperature or in aqueous systems, and has low hygroscopicity, and thus is more suitable for a wet granulation process or being prepared into a suspension; and the present invention also relates to a pharmaceutical composition and formulations comprising Crystal Hydrate Form VI of Dabrafenib, and their use in the treatment of Raf family kinase-related diseases.
US09365558B2	Dihydropyridinone MGAT2 inhibitors The present invention provides compounds of Formula (I): or a stereoisomer, or a pharmaceutically acceptable salt thereof, wherein all of the variables are as defined herein. These compounds are monoacylglycerol acyltransferase type 2 (MGAT2) inhibitors which may be used as medicaments.
US09365555B2	PRMT5 inhibitors and uses thereof Described herein are compounds of Formula (I), pharmaceutically acceptable salts thereof, and pharmaceutical compositions thereof. Compounds of the present invention are useful for inhibiting PRMT5 activity. Methods of using the compounds for treating PRMT5-mediated disorders are also described.
US09365551B2	2-(benzyloxy) benzamides as LRRK2 kinase inhibitors The present invention relates to novel compounds that inhibit LRRK2 kinase activity, processes for their preparation, to compositions containing them and to their use in the treatment of diseases characterized by LRRK2 kinase activity, for example Parkinson's disease or Alzheimer's disease.
US09365550B2	Benzimidazoles as CNS active agents The present invention relates to compounds of general formula wherein R1 hydrogen, lower alkyl, halogen or lower alkyl substituted by halogen; R2 is hydrogen or halogen; X1 is N or CH; X2 is N or CH; with the proviso that only one of X1 or X2 is N; X3 is C(R) or N; and R is hydrogen, lower alkyl, halogen, lower alkyl substituted by halogen, lower alkoxy or SO2-lower alkyl; or to a pharmaceutically acceptable acid addition salt, to a racemic mixture or to its corresponding enantiomer and/or optical isomers thereof. The compounds may be used for the treatment of schizophrenia, obsessive-compulsive personality disorder, major depression, bipolar disorders, anxiety disorders, normal aging, epilepsy, retinal degeneration, traumatic brain injury, spinal cord injury, post-traumatic stress disorder, panic disorder, Parkinson's disease, dementia, Alzheimer's disease, mild cognitive impairment, chemotherapy-induced cognitive dysfunction, Down syndrome, autism spectrum disorders, hearing loss, tinnitus, spinocerebellar ataxia, amyotrophic lateral sclerosis, multiple sclerosis, Huntington's disease, stroke, radiation therapy, chronic stress, abuse of neuro-active drugs, such as alcohol, opiates, methamphetamine, phencyclidine and cocaine.
US09365549B2	Hepatitis C virus inhibitors The invention provides compounds of formulas (I) or (II): wherein the variables are defined in the specification, or a pharmaceutically-acceptable salt thereof, that are inhibitors of replication of the hepatitis C virus. The invention also provides pharmaceutical compositions comprising such compounds, methods of using such compounds to treat hepatitis C viral infections, and processes and intermediates useful for preparing such compounds.
US09365547B2	Substituted pyridinone-pyridinyl compounds The present disclosure provides pyridinone-pyridinyl compounds useful in the treatment of p38 kinase mediated diseases, such as lymphoma and auto-inflammatory disease, having the structure of Formula (I): wherein R1, R2, R3, R4, R5, X and Y are as defined in the detailed description; pharmaceutical compositions comprising at least one of the compounds; and methods for treating p38 kinase mediated diseases using the compound.
US09365546B2	Substituted pyridinone-pyridinyl compounds The present disclosure provides pyridinone-pyridinyl compounds useful in the treatment of p38 kinase mediated diseases, such as lymphoma and auto-inflammatory disease, having the structure of Formula (I): wherein R1, R2, R3, R4, R5, X and Y are as defined in the detailed description; pharmaceutical compositions comprising at least one of the compounds; and methods for treating p38 kinase mediated diseases using the compound.
US09365544B2	Process for the preparation of intermediates for the synthesis of Dabigatran Etexilate, and crystalline forms of said intermediates The present invention relates to new processes for the preparation of synthesis intermediate products useful in the preparation of Dabigatran Etexilate on an industrial scale. The invention also relates to new crystalline forms of intermediate products thus obtained.
US09365538B2	Polymorphic forms of 3-(4-amino-1-oxo-1,3 dihydro-isoindol-2-yl)-piperidine-2,6-dione Polymorphic forms of 3-(4-amino-1-oxo-1,3 dihydro-isoindol-2-yl)-piperidine-2,6-dione are disclosed. Compositions comprising the polymorphic forms, methods of making the polymorphic forms and methods of their use are also disclosed.
US09365537B2	Process for recycling polyacetals A process for recycling polyoxymethylene polymers is disclosed. A polyoxymethylene polymer is at least partially dissolved in an aprotic compound. The resulting solution or suspension (liquid mixture) is then contacted with a catalyst which causes the polyoxymethylene polymer to be converted into a cyclic acetal. The cyclic acetal can be separated, collected and used in other processes. In one embodiment, the cyclic acetal may be used to produce a polyoxymethylene polymer.
US09365532B1	Synthesis, composition and use of novel therapeutic and cosmetic Schiff base products formed by reaction of a carbonyl containing moeity with a transimination nucleophilic catalyst and the use of transimination nucleophilic catalysts to increase the rate at which carbonyl containing therapeutic and cosmetic actives form Schiff base products with biological amines The present invention relates to the synthesis, composition and use of novel moieties formed by reacting a transimination nucleophilic catalyst, molecular or polymeric, with carbonyl-containing therapeutic or cosmetic moieties. The resultant Schiff base product is highly reactive towards transimination with a biological amine. The catalyst and carbonyl-containing moiety can be molecular or polymeric, and the resultant chemical and physical properties of the Schiff base products can be engineered by appropriate selection of said catalyst. The present invention also relates to the synthesis, composition and use of novel moieties that are used as actives in sunless tanning preparations. The present invention also relates to the use of transimination nucleophilic catalysts to increase the rate at which a carbonyl-containing moiety reacts with a biological amine. The present invention also relates to the use of transimination nucleophilic catalysts to increase the rate and efficacy of commercial sunless tanning preparations. Improvements on stability and efficacy of said preparations are disclosed. While the invention has been described in terms of its preferred embodiments, those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the appended claims. Accordingly, the present invention should not be limited to the embodiments as described above, but should further include all modifications and equivalents thereof within the spirit and scope of the description provided herein.
US09365531B2	Method for selectively oxidizing 5-hydroxymethyl furaldehyde A method for oxidizing 5-hydroxymethyl furaldehyde, includes at least one step of oxidation in the presence of an organic acid, a nitroxyl radical, an oxygen source, and an oxygen transfer agent.
US09365528B2	Derivatives of sulindac, use thereof and preparation thereof Derivatives of sulindac that lack cyclooxygenase inhibitory activity are provided along with pharmaceutical compositions containing them and use for treatment or prevention of cancer. The derivatives of sulindac are also suitable for treating chronic inflammatory conditions. A method for preparing the derivatives is also provided.
US09365520B2	Heterocyclic compound The present invention provides a heterocyclic compound having a RORγt inhibitory action.The present invention relates to a compound represented by the formula (I): wherein each symbol is as defined in the specification. or a salt thereof.
US09365513B2	Fullerene derivative, and method of preparing the same A fullerene derivative having 60 or more carbon atoms, includes at least one specific structure.
US09365511B2	Biphenyl-ethyl-pyrrolidine derivatives as histamine H3 receptor modulators for the treatment of cognitive disorders The present invention relates to compounds of Formula (Ia) and pharmaceutically acceptable salts, solvates, and hydrates thereof, that modulate the activity of the histamine H3 receptor (Ia). Compounds of the present invention and pharmaceutical compositions thereof are directed to methods useful in the treatment of histamine H3-associated disorders.
US09365510B2	Aziridine bisphenol ethers and related compounds and methods for their use Compounds having a structure of Formula I: or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein R, R1, R2, R3, R4, M1, M2, X, L1, L2, J1, J2, a1, a2, b1 and b2 are as defined herein, and wherein at least one of M2 or L2 is a moiety comprising an aziridine, acrylamide or sulfonate functional group, are provided. Uses of such compounds for treatment of various indications, including prostate cancer as well as methods of treatment involving such compounds are also provided.
US09365508B2	Aroyl thiourea derivatives The invention provides compounds according to formula (I): (wherein X, Y, Z1 R1, R2, R3, Ar and Ar′ are as defined herein), and physiologically acceptable salts, solvates, esters or amides thereof, pharmaceutical compositions comprising these compounds and the compounds for use in medicine, for example for the treatment or prophylaxis of diseases involving cell proliferation, such as cancer, and for the treatment or prophylaxis of other diseases.
US09365506B2	Compounds and compositions as TLR2 agonists The invention provides a novel class of compounds, immunogenic compositions and pharmaceutical compositions comprising such compounds and methods of using such compounds to treat or prevent diseases or disorders associated with Toll-Like Receptors 2. In one aspect, the compounds are useful as adjuvants for enhancing the effectiveness of a vaccine.
US09365503B2	Process for the preparation of isocyanates in the gas phase Meta-toluene-diisocyanate is produced by reacting meta-toluenediamine with phosgene in the gas phase. The meta-toluenediamine to be vaporized for use in this phosgenation process must contain less than 0.5 wt. % of toluenediamine residue, a total of less than 0.2 wt. % of ammonia and cycloaliphatic amines, and less than 20 ppm of heavy metals. At least 0.1 wt. % of the liquid meta-toluenediamine being to be vaporized must not be vaporized. This non-vaporized content of the meta-toluenediamine must not be fed to the phosgenation reactor.
US09365502B2	Neuroactive substituted cyclopenta[b]phenanthrenes as modulators for GABA type-A receptors The present disclosure is generally directed to neuroactive substituted cyclopenta[b]phenanthrenes as referenced herein, and pharmaceutically acceptable salts thereof, for use as, for example, an anesthetic, and/or in the treatment of disorders relating to GABA function and activity. The present disclosure is further directed to pharmaceutical compositions comprising such compounds.
US09365498B2	Inhibitors of histone deacetylase The present invention relates to compounds of formula (I): or a pharmaceutically acceptable salt, hydrate, solvate, or prodrug thereof, wherein U, J, V, X, R2a, R2b, R2c, R5 and t are as described herein. The present invention relates generally to inhibitors of histone deacetylase and to methods of making and using them. These compounds are useful for promoting cognitive function and enhancing learning and memory formation. In addition, these compounds are useful for treating, alleviating, and/or preventing various conditions, including for example, neurological disorders, memory and cognitive function disorders/impairments, extinction learning disorders, fungal diseases and infections, inflammatory diseases, hematological diseases, and neoplastic diseases in humans and animals.
US09365494B2	Process for synthesis of amino-methyl tetralin derivatives Methods for producing a compound of formula k1 or k2 by reducing a dihydronapthalene amide compound of formula i with hydrogen gas in the presence of a ruthenium catalyst of formula j1 or j2 Ru(Z)2(L) j1; Ru(E)(E′)(L)(D) j2; wherein m, n, Ar, Y, R1E, E′, D, Z and L are as defined herein.
US09365489B2	Nitrooxy alkanoic acids and derivatives thereof in feed for reducing methane emission in ruminants, and/or to improve ruminant performance The present invention relates to a method for reducing the production of methane emanating from the digestive activities of a ruminant and or for improving ruminant animal performance by using, as active compound at least one nitrooxy alkanoic acid and/or derivative thereof, which is administrated to the animal together with the feed. The invention also relates to the use of these compounds in feed and feed additives such as premix, concentrates and total mixed ration (TMR) or in the form of a bolus.
US09365485B2	Substituted arylcyclopentenes as therapeutic agents Disclosed herein is a compound of the formula Therapeutic methods, compositions, and medicaments, related thereto are also disclosed.
US09365483B2	Process for the production of acetic acid and dimethyl ether Process for producing acetic acid and dimethyl ether by contacting a mixture of methanol and methyl acetate with a zeolite catalyst. The zeolite has a 2-dimensional channel system having at least one channel with a 10-membered ring and containing at least 5% of its cation exchange capacity occupied by one or more alkali metal cations.
US09365481B2	Cyclohexenone compositions and process for making thereof Provided herein are processes of preparing cyclohexenone compounds useful for cancer treatments and/or diseases.
US09365478B2	Method for directly synthesizing unsaturated aldehydes from alcohol mixtures The present invention concerns a method for directly synthesizing acrolein or methacrolein from a mixture of methanol and ethanol or propanol. The method of the invention comprises two successive phases: oxidation in the presence of a selective oxidation catalyst of the light alcohols of the feedstock, then condensation by aldolization of the aldehydes formed during oxidation in the presence of a condensation catalyst (aldolization). Alternatively, the two phases can be carried out in the presence of a single catalyst, in particular in the presence of a molybdenum-based selective oxidation catalyst. These two phases can be conducted in a single reactor or in two cascade reactors.
US09365473B2	Carbon supported cobalt and molybdenum catalyst and use thereof for producing lower alcohols The present invention relates to a method for preparing a catalyst composition comprising cobalt and molybdenum on a carbon support, characterized in that the cobalt- and molybdenum-source are dissolved in an organic solvent that is miscible with water. Moreover, a carbon supported cobalt molybdenum catalyst composition obtainable by said method and a process for producing alcohols from syngas using said carbon supported cobalt molybdenum catalyst composition is provided.
US09365470B2	Simulated countercurrent chromatographic separation process and device with low pressure drop and high number of zones A simulated moving bed separation process is characterized in that the feed and desorbant injection streams are each divided into N streams (N being a whole number strictly greater than 1) injected respectively at N distinct feed injection points and at N distinct desorbant injection points, and in that the extract and raffinate withdrawal points are also each divided into N streams each withdrawn from N distinct withdrawal points, the device being constituted by 4×N chromatographic zones.
US09365468B2	Methods and systems for reforming and transalkylating hydrocarbons Methods and systems for reforming and transalkylating hydrocarbons are disclosed. A method for processing a hydrocarbon stream includes the steps of separating para-xylene from a first mixed-xylene and ethylbenzene-containing stream to produce a first non-equilibrium xylene and ethylbenzene stream and isomerizing the first non-equilibrium xylene and ethylbenzene stream to produce additional para-xylene. The method further includes transalkylating a toluene stream to produce a second mixed-xylene and ethylbenzene-containing stream, separating para-xylene from the second mixed-xylene and ethylbenzene-containing stream to produce a second non-equilibrium xylene and ethylbenzene stream, and isomerizing the second non-equilibrium xylene and ethylbenzene stream using an ethylbenzene dealkylation type xylene isomerization process to produce additional para-xylene.
US09365465B2	Illumination compositions, illumination flares including the illumination compositions, and related methods An illumination composition comprising at least one oxidizer, at least one of a fuel and a binder, and at least one combustion rate modifier. The at least one oxidizer is selected from the group consisting of a potassium-containing oxidizer and a rubidium-containing oxidizer, the at least one oxidizer present in the illumination composition at from about 50 wt % to about 70 wt % and comprising particles each independently having a size within a range of from about 25 μm to about 325 μm. Additional illumination compositions, illumination flares, and methods of illuminating a target are also disclosed.
US09365463B1	Rotating and oscillating breaching device with reactive material A breaching device for cutting through a substrate. There are several embodiments of the breaching device. In one embodiment, the device includes a hub assembly with a rotatable ring and a plurality of RM feed assemblies attached to the ring. In another embodiment, the device includes a disc, wherein the disc is rotatable and includes a plurality of slots, a shaft joined to the disc about which the disc rotates and a plurality of RM feed assemblies attached to the disc and arranged in the slots thereof. In another embodiment, the device includes a plurality of carts linked together, wherein each of the carts includes a cart body to which is coupled to an idler wheel, a wheel with an in-wheel motor and a platform and for each cart, a RM feed assembly retained on the platform. The RM feed assemblies include ejecta nozzles that may be positioned at selectable angles.
US09365461B2	Integrated processes for producing fuels and biofertilizers from biomass and products produced An IBTL system having a low GHG footprint for converting biomass to liquid fuels in which a biomass feed is converted to liquids by direct liquefaction and the liquids are upgraded to produce premium fuels. Biomass residues from the direct liquefaction, and optionally additional biomass is pyrolyzed to produce structured biochar, hydrogen for the liquefaction and upgrading, and CO2 for conversion to algae, including blue green algae (cyanobacteria) in a photobioreactor (PBR). Produced algae and diazotrophic microorganisms are used to produce a biofertilizer that also contains structured biochar. The structured biochar acts as a nucleation agent for the algae in the PBR, as a absorption agent to absorb inorganics from the biomass feed to direct liquefaction or from the liquids produced thereby, and as a water retention agent in the biofertilizer. The ratio of cyanobacteria to diazotrophic microorganisms in the biofertilizer can be selected to optimize the so as to achieve desired total chemically active carbon and nitrogen contents in the soil for a given crop.
US09365460B2	Pigment dispersion The invention relates to a method of producing a substantially aqueous pigment dispersion substantially free from an organic binder comprising mixing at least one water-soluble or water-dispersible silane compound and colloidal silica particles to form silanized colloidal silica particles in an aqueous dispersion whereby said at least one silane compound is mixed with colloidal silica particles in a weight ratio of silane to silica of from about 0.2 to about 1.5, mixing said silanized colloidal silica particles with an organic and/or inorganic pigment, wherein the weight ratio of silica to pigment is from about 0.001 to about 0.8 to form said substantially aqueous pigment dispersion. The invention also relates to an aqueous pigment dispersion obtained from the method defined herein.
US09365446B2	Systems and methods for altering stress profiles of glass Methods for processing glass using select wavelength radiation in a convective environment, broadly referred to as “Local Temporary Annealing”, “LASER Edge Strengthening” and “LASER Enhanced Thermal Strengthening.” Local Temporary Annealing allows strengthened glass to be brought to a neutral stress state so daughter units can be cut from strengthened glass and other processes usually only performed on annealed glass. LASER Edge Strengthening allows surface compression to be thermally imparted to the edges of a whole sheet or daughter units cut from annealed glass, or modification of residual edge stress profiles in strengthened glass to produce stable, strengthened edges. LASER Enhanced Thermal Strengthening allows surface compression to be imparted to a sheet of annealed glass whilst maintaining reduced surface temperatures so the glass has superior geometric stability and surface compression can be imparted at levels not conventionally possible.
US09365439B1	Processing unit and method utilizing the simultaneous application of electromagnetics, oxidation and electrolytics, (EMOERU), to remove contaminants from an aqueous waste stream An improved method and apparatus for the removal of both suspended and dissolved contaminants be they heavy metals, organics, inorganics, hydrocarbons and others from various types of waste stream, wash water, ground water, leach waters, process waters and etc. is illustrated. The method combines passing the aqueous waste stream through an electromagnetic field, an ozone/oxygen venturi injector for oxidation and then through a horizontal flow and vertical fall with a horizontal plate maze unit of alternately electrically charged plates, anode and cathode. The plates will be charged, selectively: by either DC or AC Voltage and Current. There will be provisions for installation of a framework to mount and support a polar/bi-polar membrane, divider or separator as may be required to enhance special treatment of particular aqueous waste streams.
US09365432B2	Titanate and titania nanostructures and nanostructure assemblies, and methods of making same The invention relates to nanomaterials and assemblies including, a micrometer-scale spherical aggregate comprising: a plurality of one-dimensional nanostructures comprising titanium and oxygen, wherein the one-dimensional nanostructures radiate from a hollow central core thereby forming a spherical aggregate.
US09365431B2	Synthesis of ZSM-58 crystals with improved morphology Methods are provided for synthesizing ZSM-58 crystals with an improved morphology and/or an improved size distribution. By controlling the conditions during synthesis of the ZSM-58 crystals, crystals of a useful size with a narrow size distribution can be generated. Additionally, by controlling the ratio of water content to silica content in the synthesis mixture, it has unexpectedly been found that ZSM-58 crystals can be formed with an improved morphology. The improved morphology can result in ZSM-58 crystals with a more uniform size across the various dimensions of the crystal, which allows for more uniform diffusion within the crystal. This is in contrast to conventionally synthesized crystals, where the size of the crystal can vary along different axes of the crystals.
US09365430B2	Method of making M41S family molecular sieve This disclosure relates to a novel method of making and recovering M41S family molecular sieve materials using synthesis mixtures having high solids-content and without a purification step. The solids-content, for example, is in a range from about 20 wt. % to 50 wt. %. The method also includes the step of mixing at least a portion of the M41S made with another material to form a composition, wherein the amount of said material to be mixed with said M41S product is such that said composition having less than 10 wt. % free fluid. The material mixed with the M41S made includes metal oxides, metal nitrides, metal carbides and mixtures thereof, as well as absorptive material capable of absorbing mother liquor and selected from the group consisting of carbon silica, alumina, titania, zirconia and mixtures thereof. The amount of the wastewater generated by this novel method is reduced by at least 50% to as much as 100% as comparing with conventional method of making M41S materials. By reducing and/or eliminating at least a portion of the wastewater generated in the synthesis product, the new method reduces cost of making of M41S materials and provides a more environmentally-friendly synthesis product.
US09365429B2	Graphene screening and separation method and device A graphene screening and separation method comprises the following steps. At least one pair of electrodes and an energy barrier layer is provided, wherein the pair of electrodes is a first electrode and a second electrode, and the energy barrier layer is formed on the first electrode. The pair of electrodes and the energy barrier layer are covered with a graphene suspension. When a graphene sheet in the graphene suspension materially couples the second electrode and the energy barrier layer and is located above the first electrode, a bias voltage between the first electrode and the second electrode of the pair of electrodes is changed and a corresponding tunneling current is measured. Screening and separation are performed by using differential conductance (i.e., the derivative of the tunneling current with respect to the bias voltage) of different layers of graphene.
US09365426B2	Process for the production of nanostructured carbon materials A process for producing a nanostructured carbon material including the steps of providing a metal or metalloid carbide substrate and reacting the carbide substrate with a reactive gas to form the nanostructured carbon material, the reactive gas and the carbide substrate being added during the reacting step.
US09365425B2	High pressure dissolved oxygen generation Dissolved oxygen may be generated by adding a peroxide to a fluid stream and then catalytically decomposing the peroxide to generate oxygen. As the peroxide is catalytically decomposed, the oxygen may solubilize in a surrounding fluid so as to provide dissolved oxygen. In some examples, the amount of peroxide added to the fluid stream is controlled such that substantially all of the hydrogen peroxide added to the fluid stream catalytically decomposes and yet the dissolved oxygen concentration of the fluid stream does not exceed a dissolved oxygen saturation limit for the fluid stream.
US09365422B2	Method and system for producing a synthesis gas in an oxygen transport membrane based reforming system with recycling of the produced synthesis gas A method and system for producing a synthesis gas in an oxygen transport membrane based reforming system that utilizes a combined feed stream having a steam to carbon ratio between about 1.6 and 3.0 and a temperature between about 500° C. and 750° C. The combined feed stream is comprised a pre-reformed hydrocarbon feed, superheated steam, and a reaction product stream created by the reaction of a hydrogen containing stream reacted with the permeated oxygen at the permeate side of the oxygen transport membrane elements and wherein the hydrogen containing stream is a recycled portion of the synthesis gas.
US09365418B2	Universal hardware platform and toolset for operating and fabricating microfluidic devices A microfluidic device platform may include a valve manifold adapted to deliver a programmable pressure to a plurality of ports, a cell chamber having programmable environmental control, and a chip-to-world interface.
US09365410B2	Method for producing a micromechanical component, and micromechanical component A method for producing a micromechanical component, and a micromechanical component, includes providing a substrate having first and second outer surfaces, the second surface facing away from the first surface; forming a through-hole through the substrate from the first outer surface up to the second outer surface; attaching an optical functional layer, on the second outer surface, to cover the through-hole; removing a first segment of the substrate on the first surface of the substrate so that there arises a third outer surface inclined relative to the second surface, the third surface facing away from the second surface, the inclined surface enclosing the through-hole; and separating the micromechanical component by separating a first part of the substrate, having the through-hole, and a second part, attached to the first part, of the optical functional layer from a remaining part of the substrate and a remaining part of the optical functional layer.
US09365400B1	Automatic rope brake and lowering device Linear brake systems are provided. For example, in one embodiment, a baseplate having a linear brake housing mounted thereto is provided. A linear brake is partially disposed within the brake housing. The linear brake includes a braided cable; a collar attached to the proximal end of the braided cable; a member attached to the distal end of the braided cable; a rope having a portion that passes into a bore in the collar, through a tunnel formed by the braided cable and the collar, and exits the braided cable by passing between cable strands; and an interface mounted to the baseplate to extend the braided cable and constrict the braided cable upon the rope. The collar secures the proximal of the braided cable to the brake housing and the member secures the distal end of the braided cable to the interface.
US09365398B2	Outrigger pad monitoring system An outrigger pad monitoring system for determining crane stability includes a plurality of outriggers having sensors for measuring a load placed on the outriggers. A crane control system utilizes the measured load on the outriggers to determine the stability of the crane. A crane control system utilizes the measured load on the outriggers with positional information for the crane boom to determine if the crane boom is in a side-load condition. The outrigger pad monitoring system may be used during the setup of the crane and to verify the proper operation of a rated capacity limiter.
US09365397B2	Quay crane Provided is a quay crane which includes a seismic isolation device formed from laminated rubber, and which is capable of withstanding a large-scale earthquake. Particularly, provided is a quay crane including a seismic isolation device with a slide length of 1000 mm or over. In a quay crane including a seismic isolation device, the seismic isolation device includes: laminated rubber formed by laminating a steel plate and a rubber material; and an auxiliary support mechanism. The auxiliary support mechanism includes: a supporting body fixed to one of a top plate side and a bottom plate side of the seismic isolation device; and a contacting plate fixed to the other thereof. The supporting body and the contacting plate constituting the auxiliary support mechanism come into contact with each other at least in the event of an earthquake, and the auxiliary support mechanism supports a weight of the quay crane.
US09365396B2	Apparatus and method for performing a timed and controlled movement and positioning of an object A method and apparatus for lowering a display object in synchronization with a particular timing or event. The display object is lowered by a lifting apparatus. In particular, the display object is a guitar and the lifting apparatus is a crane.
US09365393B2	Conveying system having a detection area A conveying system and a method for registering service requests in a conveying system, including at least one transport device, is provided. A detection area bounded on a floor surface is in connection with the transport device, in which detection area the identification data contained in the personal identifiers of passengers is read. The service profiles of passengers who have arrived in the detection area and/or who have left the detection area are determined on the basis of the identification data, and a service request according to the service profiles is registered for transporting and/or admitting passengers in the detection area to the location indicated by the service request.
US09365391B2	Elevator control device An elevator control device includes a non-service function prohibiting registration of call to each of floors and a non-service level setting part which sets two non-service levels of level 1 and level 2 for each floor, a call registration part for a user to perform a call registration operation for a desired floor, and a call registration control part in which when the call registration part is operated, in the case level 1 or level 2 has been set for the desired floor, prohibits a registration of call to that floor, and in the case neither level 1 nor level 2 has been set for the desired floor, performs the registration of call to that floor. Even if level 1 has been set for the desired floor, in the case a temporary cancel signal designating that floor has been inputted, the call to that floor is registered.
US09365388B2	Apparatus for continuously winding up a thread An apparatus for continuously winding up a thread is described and includes two winding spindles that are held in a projecting manner on a rotary table and are associated with spindle drives to allow the thread to be alternately wound to form a bobbin. The rotary table can be activated in order to exchange the winding spindles between a winding region and a changing region. A moveable changing device transfers the thread between the winding spindles and during the exchange of the winding spindles, guides the thread between the winding spindles for transferring to a catching device on one of the winding spindles. The changing device has at least one deflecting thread guide and a movable feeding thread guide, which can be positioned in a deflecting position, the thread being guided at a distance from the winding spindle which receives the thread.
US09365387B2	Motorized tensioning system with sensors A tensioning system for articles of footwear and articles of apparel is disclosed. The tensioning system includes a tensioning member that is tightened or loosened using a motorized tensioning device for winding and unwinding the tensioning member on a spool. The tensioning system may be used with various sensors to determine how the motorized tensioning device should be controlled.
US09365380B2	Image formation apparatus that laterally shifts a continuous web An image formation apparatus includes: an image formation unit that forms an image on continuous paper; a paper conveyance unit that conveys the paper through a conveyance path; a deviation correction unit that corrects deviation of the continuous paper by moving the paper on the conveyance path in a paper feed intersecting direction; a paper position measurement unit that measures a paper position in the paper feed intersecting direction of the paper on the conveyance path; and a control unit that controls the image formation unit and the deviation correction unit, wherein during stop of a conveyance operation, the control unit moves the paper to a predetermined position in the paper feed intersecting direction by deviation correction by the deviation correction unit, and during the conveyance operation, the control unit decides an image formation position in a main scanning direction in the image formation.
US09365378B2	Rewind system A winder for winding continuous webs or interleaved web segments having a machine direction and a cross-machine direction coplanar and orthogonal thereto into rolls is disclosed. The winder provides a plurality of winding spindles orbiting about a winding turret axis and a plurality of surface contact rolls cooperatively associated with a respective winding spindle. Each surface contact roll is capable of cooperative engagement with the respective winding spindle when the web material is disposed therebetween. The longitudinal axis of each surface contact roll is adjustable relative to the axis generally parallel to the winding turret axis when the web material is received by the winding spindle cooperatively associated thereto.
US09365376B2	Coreless tissue rolls and method of making the same Coreless tissue rolls can be produced without having to use an adhesive to form a hollow center. Instead, moisture can be used to promote light hydrogen bonding between the layers of the tissue web that line the hollow center. The hydrogen bonding provides sufficient structure to maintain the shape of the hollow center without rendering the tissue web surrounding the passageway unusable. Passageways can also be formed in accordance with the present disclosure that are substantially circular so that the rolls will easily spin on a spindle. In an alternative embodiment, moisture is not used in constructing the wound tissue roll.
US09365375B2	Image forming apparatus An image forming apparatus reflecting one aspect of the present invention includes a deviation detecting portion, a registration roller, and a leading end detecting portion. The deviation detecting portion detects a deviation amount of the sheet being fed from a reference position in a sheet width direction orthogonal to a feeding direction. The registration roller modifies deviation by swinging the sheet being fed in the sheet width direction in accordance with the deviation amount detected by the deviation detecting portion. The leading end detecting portion is disposed on the downstream side in the sheet feeding direction of the registration roller and detects a leading end of the sheet being fed. The leading end detecting portion detects the leading end of the sheet after deviation is modified by the registration roller.
US09365372B2	Printing medium supplying apparatus and image forming apparatus having the same A printing medium supplying apparatus may include a body, a feed tray configured to rotate between a first position in which the feed tray forms an external appearance of the body and a second position in which a printing medium is loaded, a knock-up plate provided on the feed tray configured to ascend and descend, a pickup roller configured to make contact with the loaded printing medium as the knock-up plate ascends, and a rotating lever configured to allow the knock-up plate to be restricted at a side of the feed tray when the feed tray rotates from the first position to the second position. Accordingly, the knock-up plate are restricted and released together with operations of the pickup roller and the feed tray.
US09365371B2	Sheet width aligning device and sheet feeding device A sheet width aligning device includes an elevator tray, a pair of guides, and a pinion. The pinion is rotatably supported by inserting a shaft portion into a shaft hole formed in the pinion. The shaft portion projects from the elevator tray. The sheet width aligning device is configured to move the pair of guides so as to increase or decrease the distance between the guides in operative association with the pair of racks meshed with the pinion. The sheet width aligning device includes a pressing mechanism. The pressing mechanism is provided on the back face side of the elevator tray and includes an abutment member that abuts against the pinion. The pressing mechanism separates the abutment member away from the pinion at the lower position, while abutting the abutment member against the pinion to press the pinion at the upper position.
US09365370B2	Bulk material storage and reclaim system Systems and methods for reclaiming bulk solid material from storage stockpiles or from watercraft. A storage and reclaim system includes a support surface for supporting a stockpile of bulk material. The support surface is defined by a plurality of individual material support structures geometrically arranged and positioned with reference to each other so that the support surface is essentially continuous. Each of the material support structures in turn includes a dish or funnel-like structure having a generally conical floor surface sloping towards an individual discharge opening fitted with a discharge control gate. An array of vibrators is mechanically connected to each of the material support structures so as to introduce vibrational energy into the dish or funnel-like structures sufficient to either avoid a stable reclaim cone or to destabilize a stable reclaim cone which may form in order to maintain material discharge flow.
US09365369B2	Apparatus and method for stacking items A method and apparatus are disclosed that allow items to be placed on a stack of items in a manner that minimizes interference with the existing stack. Further, a method and apparatus are disclosed for stacking items such that marking of the items is minimized while the item is stacked. In some embodiments, the method and apparatus may include employing a plurality of forks, where a first fork in the plurality includes a belt that rotates at least partially within a tapered housing of the fork. In some embodiments, the plurality of forks is vertically movable, and the method and apparatus may include a squaring mechanism that is separate from the plurality of forks. The overall throughput of the method and apparatus may be increased by employing this independent squaring mechanism.
US09365365B2	Wood veneer diverter and processing system A wood veneer diverter system comprises a plurality of veneer diverters operable to divert veneer downwardly and away from a belt based on the category or grade of the veneer. These veneer diverters are desirably rotated so that they pass through a veneer flow path in the direction of veneer flow. The veneer diverters may be configured to enhance their effectiveness in diverting veneer away from belts that move the veneer.
US09365364B1	Controlled acceleration and transfer of items via a rotating platform A method and system for accelerating an item with a rotating platform having a center point, a perimeter, and a radius from the center point to the perimeter. The method and apparatus deliver the item to a center area of the rotating platform by delivering the item to a first radial distance on the rotating platform, wherein the item has a first speed at the center area and tangential to the first radial distance. Also while the rotating platform is rotating, the item is advanced, in an apparatus-controlled orderly path, from the center area to a point relative to the rotating platform that is adjacent a perimeter of the rotating platform and that is located at a second radial distance greater than the first radial distance, wherein the item has a second speed tangential to the second radial distance and the second speed is greater than the first speed. Also while the rotating platform is rotating, the item is advanced, from the point, to a location beyond the perimeter of the rotating platform.
US09365363B2	Baggage jamming prevention structure and belt conveyor device including same A structure for suppressing a baggage jam, includes: a jam suppressing unit which is provided at a gap between a first conveyor and a second conveyor to suppress baggage transferred from the first conveyor to the second conveyor from being jammed in the gap, and the jam suppressing unit may be provided to be protruded to a position higher than a jam threshold point having the narrowest space in the gap and to a position lower than a transport surface on which the baggage is transported by the first and second conveyors.
US09365362B2	Conveyer device A conveyer device, including a body; a first path member forming a part of conveyer path with a curve; and a second path member arranged on an inner side of the curve of the conveyer path and forming a part of the conveyer path, is provided. The first path member is movable between a first position forming the conveyer path in conjunction with the second path member and a second position separated farther from second path member than the first position. The body includes a first supporting part supporting the first path member at a widthwise end of the first path member and the second supporting part supporting the first path member at a widthwise inner-side position along the widthwise direction with respect to the first supporting part. The second supporting part supports the first path member from a side opposite from the conveyer path.
US09365361B1	90 degree cross transfer conveyor A transverse belt drive assembly has multiple belt drive frames spaced in a first direction and positioned between the rollers of a main conveyor which advances articles in the first direction. The belt drive frames support looped toothed belts which are advanced in a second direction perpendicular to the first direction. The belt drive frames are mounted to a platform which is driven on demand by an actuator to raise the belt drive frames to extend up above the roller surfaces of the main conveyor rollers causing the belts to engage articles carried on the conveyor rollers, lifting and advancing the articles in the first direction to transfer them off the conveyor rollers. Each belt has a body with converging walls and is received within a channel within a converging side wall track mounted to a belt drive frame. Rotatable bearings are mounted beneath each channel to support the belt.
US09365359B2	Method and system for feeding components A component feeder including a lift for elevating a selection of components from a bulk storage, and a pick surface adjacent to the lift for receiving the selection of components. A spreader gives the selection of components a push for spreading the selection of components from the lift on the pick surface. The combination of a vertical lift and a separate pick surface adjacent to the lift enables the bulk storage being positioned right below the pick surface. The area of the pick surface is large in relation to the total footprint of the component feeder.
US09365357B2	Conveyor system including tracking of the conveyed articles by using imaging and virtual sensors A postal sorting machine comprises a conveyor system having a conveyor adapted to move mailpieces along a certain conveyor path along sorting outlets of the sorting machine. The sorting machine includes at least one pass sensor to detect the mailpieces in motion on the conveyor going past at a certain point of the conveyor path and to respond to a detection of the mailpiece by delivering a pass detection signal to a monitoring and control unit which responds to the detection signal by delivering a control signal for an electromechanical actuator of the conveyor. The pass sensor is a virtual sensor. A movement tracking system generates digital images of the mailpieces. An emulator generates 3D-modeled mailpieces and detects interactions between the 3D-modeled mailpieces a 3D model of the conveyor to generate the pass detection signal.
US09365356B2	Floating hanger for assembling vehicle body roof A floating hanger for assembling a vehicle body roof sets a roof panel at a home position of a roof surface of a vehicle body which is transferred to a work position along a transfer line. The floating hanger includes: i) a fixing frame fixed to an arm of a robot; ii) a hanger frame configured to restrict the roof panel and installed at the fixing frame to be floatable in a width direction of the vehicle body, and iii) a position corrector installed at the hanger frame and configured to float the hanger frame to a set position of the roof panel by using pressure which is applied to both sides of the roof panel in a width direction.
US09365352B2	Conveyor A conveyor comprises a frame, an endless conveyor belt supported by the frame in a conveying direction along a helical path, a non-helical path and a transfer path. The helical path has an upright center line. The belt includes a plurality of plates movably coupled to each other. The frame comprises at least at the helical path a radial guide, wherein the radial guide supports a plate at a radial guide contact location thereof in radial direction with respect to the center line of the helical path, a bearing guide for upwardly supporting the plates, wherein the bearing guide supports a plate at a bearing guide contact location thereof, and an auxiliary guide for compensating a torque on a plate at the bearing guide contact location about an axis directed in the conveying direction. The auxiliary guide contacts a plate at an auxiliary guide contact location thereof.
US09365351B2	Conveying device, carrier, and feeding device for conveying bulk goods The conveying device (1) according to the invention has a conveying channel (4). The conveying channel (4) is formed in particular as a conveying pipe (5). At least one carrier (2) is arranged in the conveying channel (4). In particular, at least two carriers (2) are arranged in the conveying channel (4). The conveying device (1) has at least one drive (6) for driving the at least one carrier (2) in order to convey bulk goods along a conveying channel axis. The at least one carrier (2) is loosely arranged in the conveying channel (4) at least in some sections along the conveying channel axis.
US09365350B2	Inverted vacuum belt conveyor system This invention is a vacuum belt conveyor designed to operate inverted and move articles suspended from its lower side rather than laying on top. This is achieved by the use of a matching toothed drive roller and toothed belt having its teeth facing outward and pierced between strategic teeth with vacuum cups secured through the holes. Vacuum is applied when needed to sections of a vacuum rail spring loaded against the smooth inner surface of the belt, the rail having a machined vacuum groove in horizontal alignment with the holes in the belt to provide vacuum to the cups. The belt and suspended articles secured to it by suction are held to the main frame by two retaining rails having clearance allowing passage of the cups.
US09365349B1	Use of multiple storage caverns for product impurity control An inventory management method is also provided. This method includes removing and replacing the gas product from a first salt cavern as supply and demand dictate, analyzing the impurities in the gas product that is removed, predicting the duration until a maximum acceptable impurity limit is present, removing all the working gas from the first salt cavern when the maximum acceptable impurity limit is reached, then replacing the working gas in the first salt cavern, while concurrently, removing and replacing the gas product from a second salt cavern as supply and demand dictate, analyzing the impurities in the gas product that is removed, predicting the duration until a maximum acceptable impurity limit is present, removing all the working gas from the second salt cavern when the maximum acceptable impurity limit is reached, then replacing the working gas in the second salt cavern, while concurrently repeating steps a)-g).
US09365341B2	Distribution device and production method thereof A fluid dispenser device having at least one reservoir containing fluid to be dispensed and dispenser mechanism that is actuatable by a user so as to dispense the fluid through a dispenser orifice. The dispenser device having a plurality of assembled-together component parts, at least one of the component parts including a unique marking so that each individual dispenser device is identifiable and/or traceable by the unique marking.
US09365336B2	Tie strip A tie strip (1) comprising a strip of material having teeth (2) on at least one face thereof wherein along the length of the strip there is provided a plurality of apertures each covered by a flap, (3) wherein the tie strip is such that when an end thereof is passed through an aperture the flap engages with the teeth to inhibit withdrawal of the strip in the opposite direction.
US09365331B2	Tamper evident container A tamper evident and resistant container includes a tray, a cover and a hinge extending from the cover and tray defining a hinge axis about which the tray and cover relatively rotate between a closed position and an opened position. The container further includes a first tab provided on one of the cover or the tray and a second tab provided on the other of the cover or the tray. When the cover is in the closed position, the first and second tabs are spaced relative to each other such that a user may grasp the first tab with one hand and the second tab with another hand and relatively pull the first tab and the second tab away from each other to tear the hinge and separate the cover from the tray.
US09365328B1	Toothpaste tube rolling device A toothpaste tube rolling device including a single-piece clamp having a top and a bottom lever portion. A tongue extends from the front side of the bottom lever, and a tapered extension is disposed on each of the right and left sides of the top lever portion. A circular opening is disposed on each tapered extension proximal the front edge. A substantially cylindrical tube having a top and bottom wall is configured to fit within the circular opening of the tapered extension. A clamping ring having a C-shaped forward and rearward portion is disposed around the tube. A spring clamping tab with a top extension, a bottom extension, and a V-shaped central portion is centrally disposed between the forward and rearward portions. The spring clamping tab has an open position and an alternate closed position and is disposed within the space between the top and bottom wall of the tube.
US09365327B2	Packaging for a bouquet of flowers A packaging for a bouquet of flowers is disclosed. The packaging includes a packaging foil impermeable to water, designed to constitute a water reservoir, onto which is glued a reinforcing element designed to shape said packaging, said reinforcing element including a base around which are distributed, at an angle, arms directed in directions, specifically radial, around the base and articulated at said base. The arms are provided with loops in their upper part, said packaging including two independent drawstrings, called the first and second drawstring. In one embodiment, the two drawstrings pass successively through a number of the loops, and each drawstring exhibits an area for grasping. The two drawstrings pass respectively through two orifices of two diametrically opposed arms, such that the grasping areas are diametrically opposed.
US09365325B2	Child proof containers Child proof containers are provided. In some embodiments, the child proof container comprise: a removal tool having a first end; a pouch with a first edge and a second edge that together form an opening to the pouch; a first handle portion that is attached to the first edge and that includes an opening sized to receive the first end of the removal tool; a second handle portion that is attached to the second edge, that is configured to fit into a cavity in the first handle portion, that interlocks with the first handle portion when in the cavity, and that can be pushed out of the first handle portion using the first end of the removal tool.
US09365320B1	Attachable storage container apparatus A storage container apparatus comprises four elements. The first element is a top of a compartment with a substantially horizontal surface and an outer edge that is within 0.25 inches of the sides proximate the bottom of a commercial material container. The second element is sides of the compartment that joins the outer edge of the top, extends downward, and ends in a beaded edge. The third element is a base of the compartment with a top, bottom, and edge. The top of the base has a groove channel proximate the edge that is able to detachably attach to the beaded edge of the side and the edge of the base extends outward from the channel at least 0.13 inches. The fourth element is a joining element that affixes the top of the storage compartment to the bottom of one of at least two differently branded commercial material containers.
US09365319B2	Container, in particular a wide-mouthed jar, for containing a liquid or pasty material and combined with a system for collecting and dispensing without taking in air A container for containing a liquid or pasty material which is combined with a system for collecting and dispensing without taking in air. The container is rigid and includes a flexible bag which contains the material to be dispensed and which is combined with the collecting system. The bag is produced separately from the rigid container and has an overall cylindrical reservoir which is open at the top portion thereof and which is divided into four areas defined by a rigid upper sidewall, a flexible deformable lower sidewall, and a fillet connecting the flexible side wall to a base.
US09365317B2	Packaging device for a windscreen wiper comprising a curved blade and an integrated flexible structure A packaging device for a windscreen wiper blade includes a curved blade and an integrated flexible structure. The packaging device includes a housing, which is intended to receive the blade. The blade is immobilized inside the housing in a position more or less straightened out in relation to its resting position. A first support surface cooperates by contact with a portion of the upper part of the blade, a second support surface cooperates by contact with a first portion of the lower part of the blade, and a third support surface cooperates by contact with a second portion of the lower part of the blade. The first support surface extends opposite an area situated between the second support surface and the third support surface.
US09365312B2	Tamper evident seal Packaging (1) is provided with a frangible seal (180), together with a method of producing such packaging. The packaging comprises an outer packet part (100) and multiple inner packet parts (150) disposed within the outer packet part. The inner packet parts can move relative to the outer packet part between a closed position and an open position. The seal (180) comprises a body portion coupled to the outer packet part, and separable portions each coupled to one of the inner packet parts. When an inner packet part (150) is moved from the closed position to the open position, this causes the seal (180) to break.
US09365310B2	Label system and method for label alignment and placement The present invention is a label system and method for label alignment and placement on a container. The label system includes a first label or a container whereby the first label includes alignment symbology and a second label having an alignment area corresponding to the alignment symbology of the first label. The second label is positioned on the container whereby the alignment area of the second label is aligned with the alignment symbology of the first label. The method for label alignment and placement comprises the steps of (i) providing a container with identification information and a label bearing area; (ii) scanning the identification information; (iii) processing the identification information; (iv) printing indicia on a label at a position defined by the identification information; and (v) placing the label on the container with the indicia positioned at the desired predetermined location.
US09365307B2	Device and a method for packaging substantially flat products in a box A device for packaging products in a box, includes a frame having a moving conveyor, a guide for supporting the products from an entry end to an exit end of the guide, and a mechanism for holding a box at the exit end of the guide such that the opening of the box extends parallel to the guide at the other side thereof. The conveyor has support members extending perpendicular to the conveyor and towards the guide when they move along the guide. The device further includes a feeder for feeding the products at the entry end of the guide between two support members, wherein the products are stacked in parallel for moving the stack of products at the exit end past the edge of the exit end into-said the box, and a mechanism for transporting the box in a direction parallel to the guide.
US09365304B2	Container arrangement and method for filling flexible disposable bags A container arrangement includes a plurality of flexible disposable bags (20a, b, c) which each have an inlet element to which a flexible connecting tube (18a, b, c) is attached, wherein each connecting tube (18a, b, c) branches off from a flexible common main line (12, 14, 16) which has a common inlet section (12) on the intake end. The main line (12, 14, 16) has a common gas outlet section (14) at the discharge end. A non-return valve (146) which closes against the gas outlet direction and a gas-permeable, liquid-tight sterile filter (144) are arranged in the common gas outlet section.
US09365303B2	Position and elevation acquisition for orbit determination A known ground location (KGL) satellite transceiver can include a position and elevation acquisition module configured to determine a time of flight (TOF) of a pseudonoise (PN) signal and a Doppler shift in a KGL signal for use in determining an orbit of a satellite. The PN signal can include a transmitted PN signal and a transponded PN signal. The KGL signal can include a transmitted KGL signal and a transponded KGL signal. The transmitted PN signal and the transmitted KGL signal can be transmitted sequentially on a first frequency carrier from the KGL satellite transceiver to the satellite. The transponded PN signal and the transponded KGL signal can be retransmitted back sequentially on a second frequency carrier from the satellite to the KGL satellite transceiver. The first frequency carrier and the second frequency carrier use a same frequency carrier or a different frequency carrier from each other.
US09365302B2	Multi-dimensional damage detection Methods and systems may provide for a structure having a plurality of interconnected panels, wherein each panel has a plurality of detection layers separated from one another by one or more non-detection layers. The plurality of detection layers may form a grid of conductive traces. Additionally, a monitor may be coupled to each grid of conductive traces, wherein the monitor is configured to detect damage to the plurality of interconnected panels in response to an electrical property change with respect to one or more of the conductive traces. In one example, the structure is part of an inflatable space platform such as a spacecraft or habitat.
US09365292B2	Aircraft interior lavatory A lavatory for an aircraft cabin includes a wall having a forward wall portion disposed immediately aft of and substantially conforming to an exterior aft surface of an aircraft cabin structure, such as a passenger seat, that is substantially not flat in a vertical plane. The forward wall portion includes a forward projection over an aft portion of the adjacent passenger seat. The forward wall portion can define a secondary space in the interior lavatory space, which can provide an amenity stowage space, and can include design elements providing visual space.
US09365278B2	Variation compensating assembly An apparatus comprising an outer sleeve and an inner sleeve. The outer sleeve has a first channel with an inner wall with a first number of substantially planar surfaces. The inner sleeve has a second channel and an outer wall with a second number of substantially planar surfaces. The outer wall is configured to be received within the first channel. At least one of the second number of substantially planar surfaces on the outer wall of the inner sleeve is configured to slide against at least one of the first number of substantially planar surfaces.
US09365275B1	Outboard marine propulsion devices and exhaust systems for outboard marine propulsion devices An outboard marine propulsion device comprises an internal combustion engine having a cylinder head and a cylinder block; and an exhaust manifold that discharges exhaust gases from the engine towards a vertically extending catalyst housing. The exhaust manifold has a plurality of horizontally extending inlet runners upwardly that receive the exhaust gases from the engine, and a vertically extending collecting passage that conveys the exhaust gases from the plurality of horizontally extending inlet runners to a bend that redirects the exhaust gases downwardly towards the catalyst housing.
US09365274B1	Outboard marine propulsion devices having cooling systems An outboard marine propulsion device comprises an internal combustion engine having a cylinder head and a cylinder block and an exhaust manifold that discharges exhaust gases from the engine towards a vertically elongated exhaust tube. The exhaust manifold has a plurality of inlet runners that receive the exhaust gases from the engine, and a vertically extending collecting passage that conveys the exhaust gases from the plurality of inlet runners upwardly to a bend that redirects the exhaust gases downwardly towards the exhaust tube. A cooling water jacket is on the exhaust manifold and conveys cooling water alongside the exhaust manifold. A catalyst housing is coupled to the exhaust manifold and a cooling water jacket is on the catalyst housing and carries cooling water alongside the catalyst housing. A catalyst is disposed in the catalyst housing.
US09365272B1	Hand crank stand-up paddle board This invention pertains to an aquatic stand up board where the rider is standing on the board and provides propulsion by means of a manual hand crank. The hand crank operates two sprockets and a chain causing a double paddle wheel beneath the board to rotate thereby providing thrust. Forward or backward motion depends on whether the manual crank is rotated clockwise or counterclockwise. Steering is achieved by turning the crank in a horizontal plane, similar to a bicycle handlebar, which rotates the paddle wheels in the desired direction.
US09365271B2	Fluid injection system A system including a fluid injection system configured to removably couple to a mineral extraction system, wherein the fluid injection system includes a fluid injection system controller, a flow meter system coupled to the fluid injection system controller, wherein the flow meter system is configured to measure a fluid flow of a fluid through the fluid injection system, an adjustable valve configured to control the fluid flow through the fluid injection system, and a non-return valve configured to block reverse flow of the fluid through the fluid injection system, wherein the fluid injection system controller, the flow meter system, the adjustable valve, and the non-return valve are coupled to a common housing.
US09365269B2	Personal flotation device An improved personal flotation device is disclosed. The personal flotation device comprises a shirt with sleeves, a torso flotation pad attached to the shirt and positioned around a user's torso, and two flotation sleeves attached to the shirt's sleeves on a user's arms. The torso flotation pad comprises a front flotation pad which is raised above the midriff area of the user and two graduated side pads which are wrapped around a user's torso. The raised position of the front flotation pad keeps a user's center of buoyancy above the user's center of gravity, raising the user higher up out of the water and preventing the user from flipping over into the water. The flotation sleeves are positioned high on a user's arms to further increase a user's freeboard while permitting freedom of movement.
US09365267B2	Floating platform A floating platform is provided including the following: a covering element; at least three buoyant bodies, which are separated from each other, are fixedly mounted to the lower face of the covering element, are open toward the bottom, and are made of a gas-tight, pressure- and corrosion-resistant flexible material. The buoyant bodies enclose a closed hollow space when coming into contact with a liquid surface. At least one compressed-air generating device is also provided for generating an overpressure in the individual hollow spaces.
US09365256B2	Infant scooter A vehicle for infants includes a footboard, a chassis with front and rear chassis supports, two front wheels, at least one rear wheel, a bar extending vertically from the front chassis support, a handle extending from the bar to be gripped by the vehicle's user, and optionally a removable seat. The vehicle is steered by the user's particular application of weight applied to the footboard in which the application of more weight to one side of the footboard (or the shifting of weight) causes the front wheels of the vehicle to steer the vehicle in the direction of that side.
US09365255B1	Method and apparatus for raking a motorcycle frame The present invention is directed to an apparatus for, and method of, raking a motorcycle, and to a motorcycle with a raked frame.
US09365250B1	Attachable track overlay apparatus An attachable track overlay apparatus that includes a parallelepiped member sized appropriate to fit into a track bed of an extant track machine track, said parallelepiped member securable therein by hooked engagement of a first end around an interior side of said track, and rotational engagement of a lock member disposed at a second end of said parallelepiped member for selective engagement around an outer side of said track, whereby a rubberlike pad disposed atop the parallelepiped member is secured in a plane parallel with the track bed and elevated relative each of a pair of extant grouters disposed upon the track, whereby a tractable surface is installable covering a track for operation of a particular track machine over ground surfaces otherwise susceptible to damage by operation of the track machine thereupon.
US09365249B2	Vehicle front part structure with spats to restrain wind flow in front of the front wheel A vehicle front part structure includes: a spats having a mounting portion attached to an under wall that constitutes an under floor in front of a front wheel, and a main body portion extending from the mounting portion toward an underside of a vehicle to restrain a traveling wind under the under wall from hitting the front wheel; and a recess portion formed at the vehicular rearward portion on, the under wall and opening to a downward direction of the vehicle and to a rearward direction of the vehicle. A mounting wall is disposed above a front end portion of the under wall to attach the mounting portion to it. An inclined wall is disposed to ascend linearly toward an upper part of the vehicle and connects the mounting wall and the front end portion of the under wall.
US09365248B1	Telescopic trailer bed extension The telescopic trailer bed extension is an accessory that is installed on an existing trailer in order to extend the useful surface of a trailer bed by locking the tailgate in a parallel orientation with the trailer bed. The telescopic truck bed extension includes a pair of telescoping members that are slideably engaged on a bottom surface of the trailer bed. The telescoping members extend rearwardly so as to extend beyond the trailer bed, and enable the tailgate to rest thereon in a parallel orientation with respect to the trailer bed. The telescoping members are each further defined with an inner member and an outer member. The tailgate includes a pair of tailgate brackets that align with and secure to inner members of the telescoping members.
US09365247B1	Tailgate for extending the bed of a vehicle A tailgate for extending the length of the bed of a vehicle, with the tailgate comprising a tailgate panel that is rotatably and slidably connected to a tailgate housing, enabling the tailgate panel to be rotated into and upright position, thereby extending the length of the bed of the vehicle by the height of the tailgate panel, and by extending the bed of the vehicle further by sliding the upright tailgate panel away from the tailgate housing.
US09365240B2	Frontal collision impact absorbing device for vehicle A device for absorbing frontal collision impact for a vehicle includes side members extending in the length direction of the vehicle and impact-absorbing structures mounted on the side members and protruding outward in the width direction of the vehicle. The device can effectively cope with a frontal small offset collision of a vehicle.
US09365238B2	Electric power steering apparatus There is provided an electric power steering device capable of detecting steering torque with high accuracy without use of a torque sensor, and capable of performing appropriate steering assistance control. An alternative torque correction value (Tc) is operated by comparing alternative torque (T0) operated based on an angle signal at normal time of the torque sensor (3) with a torque detection value (Ti) detected by the torque sensor (3), and is then stored. Then, at normal time of the torque sensor (3), the steering assistance control is performed based on the torque detection value (Ti) detected by the torque sensor (3), whereas when an abnormality happens in the torque sensor (3), the steering assistance control is performed based on corrected alternative torque (T1) obtained by correcting the alternative torque (T0) by the alternative torque correction value (Tc).
US09365237B2	Steering control device A steering control device set a steering reaction force characteristic to coordinates so that the self-aligning torque increases as the steering reaction force increases. Upon applying a steering reaction force corresponding to the self-aligning torque to a steering unit based on the steering reaction force characteristic to offset the steering reaction force characteristic at coordinates more in a direction in which an absolute value of the steering reaction force increases as a lateral position of a host vehicle approaches to a white line, the offset of the steering reaction force characteristic is suppressed when a turn signal operation is started while suppression of the offset of the steering reaction force characteristic is released when the turn signal operation is ended so that an absolute value of an increase gradient when releasing suppression of the offset becomes smaller than an absolute value of a decrease gradient when suppressing the offset.
US09365234B2	Telescopic steering apparatus A telescopic steering apparatus includes a steering column having an outer column and an inner column. An inner peripheral surface of the outer column has a supporting portion that supports the inner column. An inner peripheral surface of the outer column further has a shock absorbing portion at a location shifted toward one side in an axial direction from an axial end face of the inner column, a diameter of an inscribed circle of the shock absorbing portion being smaller than an outer diameter of the inner column. The outer column, including the supporting portion and the shock absorbing portion, and a movable bracket are integrally formed by an expansion forming.
US09365232B2	Snowmobile and suspension assembly therefor A snowmobile ski comprises a body having a pair of rails laterally spaced from one another and interconnected at a tip. A spindle assembly connects the ski to suspension elements of the snowmobile. The spindle assembly has a pair of legs connected to respective rails to allow snow to pass between the legs.
US09365231B1	Wheeled baby carriage with an activity tray A wheeled baby carriage with an activity tray including a collapsible wheeled carriage having a handle, a foldable support frame, a plurality of wheels, a rearward facing storage compartment attached to the support frame, a forward facing beverage tray hingedly attached to the handle, and a sunshade hingedly attached to the support frame. A baby seat is rotatably attached to the support frame, and a circular tray is continuously disposed atop the baby seat. The tray has a first half and a removable second half selectively engaged with the first half. An adjustable foot stand is attached to the support frame underneath the baby seat. A removable storage tray is slidably disposed within the support frame underneath the foot stand.
US09365229B2	Tow type running stroller A two-wheeled stroller is disclosed and claimed. The stroller is a tow-type stroller to enable a child to accompany an attendant who is engaged in walking or running activity over a variety of ground surfaces and grades at various walking and running velocities. The stroller includes a carriage assembly, a tow bar assembly, and a harness assembly. The carriage assembly includes a seat upon which the child being transported is seated and two wheels, with the center of gravity of the carriage assembly and child (if present) positioned below the wheel axis of rotation. The harness assembly is adjustably affixed to the attendant, and is connected to the carriage assembly by the tow bar assembly.
US09365228B2	Coast control systems and methods In one embodiment, a coast control system, or dead-man brake inhibitor, is associated with a tiller arm that is used for steering a vehicle. A spring acts upon the tiller arm when an operator releases a control handle attached to the tiller arm to move the tiller arm to a braking position which causes an electronically or mechanically actuated brake to be applied. Before releasing the control handle, the operator may actuate the coast control system to inhibit movement of the tiller arm towards the braking position when the control handle is released. The operator may vertically reposition the tiller arm while the coast control system remains actuated by overcoming the inhibiting force applied by the coast control system when the tiller arm is moved toward the braking position and by overcoming the spring acting on the tiller arm when the tiller arm is moved away from the braking position.
US09365226B1	Transport dolly Aspects of a transport dolly for repositioning a drive unit are described. In one embodiment, the transport dolly includes a base frame, an elevated handgrip bar, and a wheel lock assembly that locks at least one jack wheel of the drive unit into an engaged position for manual displacement of the drive unit using the elevated handgrip bar. The transport dolly may be relied upon to assist an individual with manual movement of the drive unit, by engaging and locking one or more jack wheels of the drive unit into a position which lifts the drive unit off the drive wheels of the drive unit. Once the jack wheels are engaged and locked in position, the drive unit may be more easily repositioned manually.
US09365225B2	Transformative hand cart A transformative hand cart with a cart body, a first and second handle member translatably coupled to a first and second respective ends of the cart body, a left and right support rail translatably coupled to a left and right respective sides of the cart body, a first and second end support member translatably coupled to a first and second respective ends of the cart body, and a plurality of wheels coupled to the cart body, wherein the first and second handle members, the left and right support rails, and the first and second end support members are at least partially recessed into the upper surface of the cart body in a storing position and are operable to independently open in various positions.
US09365224B1	Collapsible carrying device A collapsible and expandable carrying device for pulling, carrying, or otherwise transporting luggage, cargo, or any other items. The carrying device comprises a frame comprised of and combined with additional telescopic rods for adjustment of parameters for ease of use. The frame is pivotally attached to a handle, support straps, shoulder straps, and/or a belt to be attached to a user's waist. The device is meant for both short and long travel, and it allows for a user to vary angles and lengths of the constituent parts in order to minimize gravitational load on the user and optimize the force of the center of gravity from the load being carried.
US09365223B2	System and method for monitoring railcar performance A system for monitoring operation of a railcar having one or more sensing units, mounted on the railcar, for monitoring operating parameters and or conditions of the railcar, and a communication management unit, in wireless communication with the sensing units, wherein the system can make a determination of an alarm condition based on data collected the sensing units. A temperature sensor device for use in such a system is also provided.
US09365220B2	Air hose hanger for a rail way vehicle An air hose hanger for supporting flexible air hoses of a trainline braking system of a rail car includes a head including a mounting plate for mounting the hanger to a coupler of a rail car, the mounting plate including first and second apertures for receiving first and second bolts for attaching the mounting plate to the coupler, and an arm removably attached to the head. The arm includes a first arm removably attached to the head extending in a substantially vertical direction away from the head, and a second arm integral with the first arm and extending in a horizontal direction substantially parallel to an axis of the coupler. The head is attached to the coupler at three preformed holes formed in the coupler, the three preformed holes including two lightener holes preformed in the coupler, and an aperture preformed in a tab on an underside of the coupler.
US09365219B2	Method and apparatus for controlling start of vehicle A method and system for controlling the start of a vehicle are provided. The method includes determining whether a high voltage battery of a vehicle is submerged and outputting a warning regarding the submersion when the high voltage battery is submerged. In addition, power is cut off and the vehicle ignition or the start of the vehicle is turned off after the warning signal is output.
US09365214B2	Systems and methods for determining the status of a turn lane traffic light Systems and methods use cameras to provide autonomous navigation features. In one implementation, a traffic light detection system is provided for a vehicle. One or more processing devices associated with the system receive at least one image of an area forward of the vehicle via a data interface, with the area including at least one traffic lamp fixture having at least one traffic light. The processing device(s) determine, based on at least one indicator of vehicle position, whether the vehicle is in a turn lane. Also, the processing device(s) process the received image(s) to determine the status of the traffic light, including whether the traffic light includes an arrow. Further, the system may cause a system response based on the determination of the status of the traffic light, whether the traffic light includes an arrow, and whether the vehicle is in a turn lane.
US09365209B2	Wheel torque disturbance suppression A method for controlling restart of an engine in a hybrid electric powertrain, includes engaging a gear of a transmission, releasing a brake pedal, maintaining fluid pressure at an adaptively determined magnitude in a wheel brake, initiating a restart the engine, and reducing fluid pressure in the wheel brake when the engine restarts.
US09365206B2	Method for non-microslip based dual clutch transmission power on up shift A method of controlling a dual clutch transmission power on up shift including an on-coming clutch and an off-going clutch. The method includes implementing a prep phase comprised of decreasing torque on the off-going clutch, monitoring the off-going clutch speed to determine a slip point, and adding a bump torque to the off-going clutch when the off-going clutch reaches the slip point. The method implements a torque phase transferring torque from the off-going clutch to the on-coming clutch by increasing torque on the on-coming clutch towards an engine torque, decreasing torque on the off-going clutch, and simultaneously keeping the combination of torques greater than the slip point.
US09365205B2	Hydraulic pressure control device for transmission A hydraulic pressure control device for a transmission, which operates a hydraulic apparatus by hydraulic pressure generated by an pump driven during operation of a driving force source, for which automatic stop control is performed, accumulates the hydraulic pressure in a pressure accumulator, and supplies the hydraulic pressure accumulated in the pressure accumulator to the hydraulic apparatus when the driving force source is automatically stopped is provided. The automatic stop control includes control to stop the driving force source when the vehicle speed is equal to or higher than a prescribed vehicle speed; and the hydraulic pressure control device performs a control to control an accumulated oil amount in the pressure accumulator and the automatic stop control in a manner to increase the accumulated oil amount of the pressure accumulator when the driving force source is automatically stopped.
US09365204B2	Method and apparatus for torque arbitration and shaping in a multi-mode powertrain system A method for operating a multi-mode powertrain system includes monitoring an operator request for tractive power, and arbitrating the operator request for tractive power with axle torque constraints and crankshaft torque constraints. An immediate tractive torque request and a predicted tractive torque request are determined based upon the arbitrated operator request for tractive power. The predicted tractive torque request is shaped based upon driveability torque constraints. Operation of torque-generative devices of the multi-mode powertrain system are controlled based upon the predicted tractive torque request and the driveability-shaped predicted tractive torque request.
US09365200B2	Safety apparatus for brake of vehicle The safety apparatus for a brake of a vehicle includes a first line and a second line. The first line includes an exhaust manifold, an engine, an intake manifold, a check valve, a vacuum hose, a vacuum switch, a booster, a check valve, a vacuum hose, a negative connection portion, a vacuum switch and a brake booster, and the second line includes a vacuum hose, a check valve, a booster, a check value, a vacuum hose and a vacuum pump, which are connected to the negative connection portion. The apparatus can isolate a supply of electric power to a fuel motor to stop starting of the engine when the brake booster lacks a vacuum because of a deterioration of a performance of an auxiliary vacuum pump, and enable the brake to normally operate so as to prevent an accident even though a sudden acceleration occurs or the engine suddenly stops.
US09365198B2	Braking device for vehicle A braking device for a vehicle includes an operating characteristics setting portion for setting an operating characteristic which is a relationship between the input electric power to the electro-magnetic valve and a pressure difference between a master cylinder side and a wheel cylinder side with respect to the electro-magnetic valve, based on the input electric power at the time when the accumulator pressure detected by the accumulator pressure detecting portion first falls to a value equal to or less than a threshold value accumulator pressure by changing the input electric power towards an opening side of the electro-magnetic valve in response to a time lapsed after a predetermined value of the pilot pressure has been generated by the pilot pressure generating portion by first closing the electro-magnetic valve thereby to suppress the manufacturing cost.
US09365196B2	Method for operating a wheel slip control apparatus with compensated wheel speeds A method and device for operating a wheel slip control apparatus, including determining wheel speeds of wheels compensated with respect to wheel speed differences during a turn as input variables for the wheel slip control apparatus, with which a) a neutral steering, understeering or oversteering driving condition of the vehicle is determined from the driving behavior during a turn, b) depending on the determined condition of the vehicle, either the reference or actual yaw rate is used to calculate a turn radius related to a selected point on the vehicle, c) wheel-related turn radii for at least some wheels are determined from the turn radius related to the selected point, d) reference factors are determined from the wheel-related turn radii and a common reference turn radius for at least some wheels, and e) the compensated wheel speeds are each determined from the reference factors and measured wheel speeds for at least some wheels, and f) the compensated wheel speeds are used as input variables for a wheel slip control apparatus.
US09365194B2	Drum brake S-cam having offset cam followers A drum brake is provided that improves the direction of the actuating forces to reduce stress, improve efficiency and permit thicker brake linings. First and second brake shoes each have a first end pivotally coupled to the same or different anchor pins on a brake spider. First and second cam followers are disposed at corresponding second ends of the brake shoes. A cam engages the cam followers with movement of the cam causing the brake shoes to move between positions of engagement and disengagement with a braking surface. The cam followers are offset such that distances between the centers of the first cam followers and the anchor pin or pins supporting the brake shoes differ so as to improve the direction of the cam force vector.
US09365193B2	Fixed caliper brake and brake pad for a fixed caliper brake A fixed caliper brake for a motor vehicle, including a housing with two housing limbs and a housing bridge connecting the housing limbs in a flexurally rigid manner at a defined distance from one another, pistons, which are received in bores in the housing limbs and are guided displaceably along an axis A in relation to the brake disk, and brake pads which are provided in pairs, are guided in an axially displaceable manner in the housing and arranged in the circumferential direction while being supported against circumferential forces, each brake pad being actuable directly by at least one piston. The brake pads are supported in a form-fitting manner on the housing bridge at least on the run-in side. At least each arm on the run-in side is configured with a hook shape open on the radially outer side and serves at least partially for form-fitting abutment against the housing.
US09365191B2	Tire inflator of a vehicle An inflator 300 for pumping compressed air supplied from a compressor 200 provided in a motor vehicle into a tire mounted to the motor vehicle, the inflator may include: an inflator port L6 to which compressed air supplied from the compressor 200 is entered; a control unit 320 provided with a pressure switch 321 which is actuated according to an internal pressure of the inflator port L6; and a supplying unit 310 coupled detachably with the inflator port L6 for pumping compressed air into the tire, wherein the control unit 320 is equipped with an ON/OFF switch 322 transmitting a signal to electronic control unit E according to an operation of the pressure switch 321.
US09365190B2	Connecting device of windshield wiper The present invention discloses a connecting device of a windshield wiper. The connecting device includes a connector main body. Through the connector main body to cooperate with other parts, a buckle cap, a resilient engaging member, a reverse U-like limit block, or a functional outer cap, the connecting device of the present invention can be applied to connect with nine windshield wiper arms when in use, so it can be used widely.
US09365184B2	Vehicle structure comprising seatbelt device Disclosed is a vehicle structure comprising a seatbelt device, in which diffusion of a hot gas produced in a pretensioner is easily minimized by a simple configuration. In the vehicle structure comprising a seatbelt device, the pretensioner is provided on a rear inner side panel, and an interior material covering the pretensioner is provided on the side facing the vehicle interior. The interior material has a dividing wall provided on the rear surface, the dividing wall protruding toward the rear inner side panel. The dividing wall encloses the pretensioner and partitions the gap between the rear inner side panel and the interior material.
US09365183B2	Inflator for an airbag, an airbag module and a vehicle comprising such an airbag module A vehicle air-bag inflator includes a container initially containing a pressurized gas and having a vent opening in a wall thereof. A rupturable element, attached to a container wall, covers the vent opening, sealing the interior of the container. The rupturable element is attached to a first support, which supports a region of the rupturable element and prevents the rupturable element from rupturing. A first support, attached to a container wall, is movable between a first and a second configuration, with respect to the container wall. In an initial configuration, a second support supports the first support and prevents the first support from moving from a first configuration to a second configuration. In a final configuration, a second support allows the first support to move from the first configuration to the second configuration. An activation mechanism moves the second support from an initial configuration to a final configuration when triggered.
US09365182B2	Wrap-around airbag device An airbag device for a vehicle including at least one airbag housing interface chamber that attaches to an airbag housing; at least one airbag cushion chamber downstream of the at least one interface chamber; an elbow that fluidly connects the housing interface chamber with the cushion chamber and configured so that it controllably regulates gas flow into the at least one airbag cushion chamber; the elbow having an internal configuration, which includes at least one opening that permits back and forth gas flow between the elbow and the at least one airbag cushion chamber, and which controls the directional deployment of the airbag cushion chamber so that upon deployment the downstream end of the cushion chamber exits an airbag housing outwardly in a first direction and then in at least one second direction, so that the direction of deployment of the cushion chamber changes in direction to thereby wrap at least partially around a structure of a vehicle of the vehicle and at least temporarily interpose the cushion chamber between any occupant and the vehicle structure.
US09365180B2	Vehicle passenger protection system A vehicle occupant protection system comprises an airbag (20) which in the folded state is accommodated in a backrest (14) of a vehicle seat (12) and in the deployed state extends between two seats (12, 52) of the vehicle. The airbag (20) includes a thorax zone (36) for laterally covering the thorax of a vehicle occupant (40) and a head zone (38) for laterally covering the head (42) of the vehicle occupant (40). The head zone (38) extends against the longitudinal vehicle direction (R) up to behind a headrest (18) of the vehicle seat (12) and completely covers the headrest (18) on the side.
US09365179B2	Lower limb protecting air bag A lower limb protecting air bag, folded stored in front of an occupant seated in a seat and inflatable to cover the front of the lower limbs of the occupant by inflation gas supplied therein, includes: a main body inflation part configured to cover the front of the lower limbs of the occupant when inflation is completed; and a shin protection part arranged at least on one end side of the main body inflation part in the horizontal direction and projectable backward from the main body inflation part for covering the lateral side of the shins of the occupant in the inflation completed time, wherein the shin protection part completes inflation with an internal pressure higher than that of the main body inflation part.
US09365178B2	Device for protecting passenger of vehicle Present invention relates to a device for protecting a passenger of a vehicle which includes curtain air bag (CAB) modules disposed at left and right sides of a roof panel inside the vehicle, a driver air bag (DAB) module disposed at a steering wheel inside the vehicle, and an eccentric impact preventing air bag module disposed to be unfolded toward an A-pillar disposed so as to divide a windshield glass disposed at a front side of the vehicle and side doors disposed at lateral sides of the vehicle, thereby effectively protects a driver seat passenger even when an unexpected front collision accident of a vehicle occurs.
US09365177B2	Method and device for the serial production of a vehicle assembly, bearing unit, vehicle steering wheel and horn module for a steering wheel assembly and steering wheel assembly A method for series production of a vehicle assembly, especially an interior assembly, including a vehicle-side support, especially a vehicle steering wheel (12), and a component to be fastened at the support, especially a horn module (14), wherein a module-side bearing unit (22) consisting of at least two bearing members (46, 50) is assigned to the component and/or a support-side bearing unit (24) consisting of at least two bearing members (26, 28) is assigned to the support, and wherein one of the bearing members (28, 50) of the respective bearing unit (22, 24) has a contact surface (34, 58) and the other one of the bearing members (26, 46) has at least one bearing surface (38, 54) includes the step of individually orientating the two bearing members (26, 28, 46, 50) of at least one bearing unit (22, 24) relative to each other as a function of the actual dimensions of the support installed and/or the component installed, fastening the two bearing members (26, 28, 46, 50) orientated relative to each other, and fastening the component to the support. The position of the support and the component relative to each other is defined by at least one bearing unit (22, 24).
US09365176B2	Active lower leg engagement system An active leg engagement system for a vehicle includes a selectively deployable leg-engaging member.
US09365175B2	Power supply system for vehicle A first DC/DC converter is provided between a rectifier for rectifying output of an electric generator driven by an engine, and a battery for supplying power to an in-vehicle load. An electric double layer capacitor and a second DC/DC converter for charge/discharge current control for the capacitor are provided between the rectifier and the first DC/DC converter. A control circuit sets a current target value which is a control target value for the second DC/DC converter, based on the voltage value of a battery bus, and when charging of the electric double layer capacitor is to be stopped based on a charge/discharge instruction signal, performs, before the charging is stopped, control of gradually attenuating the current target value for the second DC/DC converter, based on a voltage value VEDLC of the electric double layer capacitor.
US09365168B2	Collapsible support structure for flexible hoses A collapsible support structure for flexible hoses has a plurality of X-frames, each X-frame consisting of two opposing pairs of stringers, each pair of stringers is hingedly connected together at an axis point in the center region of each stringer, the pairs are connected at the distal ends of the stringers by bridge members (24), and adjacent X-frames are hingedly connected together at the distal ends of their stringers.
US09365163B2	Device for visually confirming forward direction A device for visually confirming a forward direction that allows a crew member to visually confirm a desired range on the forward side of a vehicle includes a first reflecting mirror that reflects the desired range and a second reflecting mirror that reflects a reflected image reflected on the first reflecting mirror toward the crew member, the first reflecting mirror is arranged on a dashboard that is located inside the vehicle, and the second reflecting mirror is arranged on a lower side of the dashboard, and a first light transmitting part and a second light transmitting part are disposed in an area that connects the first reflecting mirror and the second reflecting mirror and an area that connects the second reflecting mirror and an eye-point of the crew member.
US09365161B2	Panoramic extended windshield with integrated non-moving blind A vehicle windshield with a top edge extended such as to provide a lower drag coefficient and giving the driver a wider panoramic vertical viewing angle and having an integrated shading means, having no movable parts and utilizing a material which is capable changing its light transmittance electrically and with a controlling means which mimics the aesthetics of a conventional mechanical blind. Aspects of the various embodiments include: switchable segmented sun visors, integrated solid state lighting, a mounting means for attachment of a center console, mirrors, cameras and other devices, a controlling means capable of providing a variety of opening and closing sequences, a user programmable interface, a touch screen interface, touch sensitive activation, a sound emitting means to provide for the audible aesthetic of the blind, inclusion of substantially the entire roof, inclusion of substantially the entire roof and the rear window, and any combination of a tinted, heat reflecting, heat absorbing or photo-chromic coating, film or interlayer in all or a portion of the glazing area.
US09365160B2	Camera for vehicular applications A camera module for a vehicle vision system includes a circuit element including an imaging sensor, associated circuitry and a circuitry connector. A cable has a cable portion and a cable connector for connecting to the circuitry connector. A housing portion includes a lens receiving portion and a cable receiving portion that mate together to substantially house the circuit element. The lens receiving portion includes a lens assembly. The cable receiving portion includes a connector receiving portion configured to receive and retain the cable connector therein and a wire receiving portion configured to receive and retain the cable portion therein. The tube has an appropriate form for a given cable shape and the tube encompasses at least a portion of the wire receiving portion and the cable portion. The tube substantially seals around the portion of the wire receiving portion and the cable portion.
US09365159B2	Negative slope pointer A gauge assembly for a motor vehicle includes a gauge surface with graphics representing a vehicle operating parameter and a pointer supported for movement about an axis to indicate a current condition of the vehicle operating parameter by pointing to a specific location on the gauge surface. The pointer includes a pointer arm extending away from a hub and a bottom surface with a negative slope angled away from a plane normal to the axis toward the gauge surface.
US09365158B2	Engine sound enhancement based on vehicle selected mode A control system is provided for a vehicle having an engine which transitions between an activated mode and a deactivated mode. The control system includes a vehicle bus transmitting a signal indicating a vehicle selected mode and if the engine is operating in one of the activated mode and the deactivated mode. The control system also includes an engine sound enhancement (“ESE”) module configured to receive the signal. The ESE module is configured to select at least one ESE tone and a set of ancillary tones associated with one or more of the deactivated mode, the activated mode, and an activation transition. The ESE module selects a specific type of ancillary tones based on the vehicle selected mode.
US09365148B2	Truck body A truck body includes a front wall, side walls, and a floor. The floor has panels disposed at predetermined angles from the horizontal that, with the other parts of the body, form a payload volume within the body. The floor also includes a tail panel disposed at a lesser angle from the horizontal to facilitate the shedding of the payload when dumping, and further to maintain the center of mass of the payload in a generally forward position during dumping.
US09365145B2	Child car seat foot rest device A foot rest device for a child installed in a child car seat fixed to a seat or bench of a vehicle passenger compartment, includes an upright to be installed in a vertical median plane of the child car seat, a rotation-proof bar and a foot rest bar each transverse to the upright, elements for securing the device to the child car seat, and the upright having at its bottom end a foot for resting on the floor of the passenger compartment, the rotation-proof and foot rest bars being fixed in their middles substantially at right angles to the upright so that each forms two lateral parts symmetrical about the median plane, and the rotation-proof and foot rest bars being in vertical planes offset from one another, the rotation-proof bar being set back from the foot rest bar when the device is installed, with reference to a forward travel direction.
US09365141B2	Vehicle with a driver seat unit comprising a vertically suspended floor structure A vehicle with a driver's cab including a driver seat unit with a vertically suspended floor structure and including a steering control, a speed control, and a driver's seat. The cab is provided with a locking mechanism for preventing the floor structure from moving vertically in relation to the cab when the vehicle is immobile. The floor structure is able to move from a first position to a second position, lower than the first position, when the driver's door is opened and to move back to the first position when the driver's door is closed.
US09365139B2	Method and device for protecting and restraining a passenger and an evaluation and control unit for a protection and restraint device A method for protecting and restraining a passenger on a passenger seat of a vehicle in case of an accident, with the aid of at least one restraint element of a protection and restraint device, an evaluation and control unit for a protection and restraint device for carrying out the method, a protection and restraint device for protecting a passenger having such an evaluation and control unit, as well as a corresponding computer program and computer program product for carrying out the method are described. A positioning applied force is generated as a function of an ascertained current driving situation, the applied force accelerating the passenger away from a vehicle side structure in the direction of the middle of the vehicle if a predefined precrash situation is detected.
US09365136B2	Insert for a child's seat An insert for the seat of a child is provided. The insert has detachable elements which may be selectively added or changed depending on the size of the child. The insert has a head rest having a removable interior hollow sound channel or a two way traditional speaker system. The head rest has an internal Bluetooth, a micro SD/TF slot and/or an audio port which may connect to an external mp3 player. A plurality of parallel slits through the main body section of the insert allows harness hardware of a child's car seat (or other seat) to be inserted through the main body section of the insert at various locations; therein allowing the insert to be used in connection with various car seats.
US09365135B2	Infant car seat base with safety belt lock-off arm An infant car seat base has a body, a belt path on the body configured to accept a base anchoring strap there along, and a lock-off arm coupled to the body. The lock-off arm is movable between a blocking position and a lock-off position. The lock-off arm, when in the lock-off position, permits a child seat to be attached to the body. The lock-off arm, when in the blocking position, blocks, inhibits, or prevents attachment of the child seat to the body. A base anchoring strap is captured between the lock-off arm and the body of the base when the base is mounted and secured to a vehicle seat.
US09365127B2	Recharging electric vehicles A charge transfer apparatus having an input and an output includes: an AC/DC converter coupled to the input of the charge transfer apparatus and configured to receive AC power at a first power level; and a charge storage device coupled to the AC/DC converter, where the charge storage device is configured to receive charge at the first power level and to transfer charge to the output of the charge transfer apparatus at a second power level, and the second power level is greater than the first power level.
US09365122B2	Onboard power line conditioning system for an electric or hybrid vehicle A power line quality conditioning system for a vehicle includes an onboard rechargeable direct current (DC) energy storage system and an onboard electrical system coupled to the energy storage system. The energy storage system provides DC energy to drive an electric traction motor of the vehicle. The electrical system operates in a charging mode such that alternating current (AC) energy from a power grid external to the vehicle is converted to DC energy to charge the DC energy storage system. The electrical system also operates in a vehicle-to-grid power conditioning mode such that DC energy from the DC energy storage system is converted to AC energy to condition an AC voltage of the power grid.
US09365112B2	Accelerator-pedal-counterforce control device and vehicle An accelerator-pedal-counterforce control device for a vehicle, wherein a counterforce control means sets a value obtained by multiplying a prescribed quantity by a constant-speed position as a counterforce-increase position. The counterforce-increase position is a position of the accelerator pedal at which the counterforce on the accelerator pedal is increased from the base counterforce. The constant-speed position is a position of the accelerator pedal at which constant travel at the current vehicle speed is possible. The prescribed quantity is set as a value for achieving forward-rear acceleration according to each vehicle speed.
US09365108B2	Integrated anti-siphon fuel filler assembly and method of manufacturing the same One embodiment of an integrated anti-siphon fuel filler assembly includes a fuel tank and tube means including a first end region adapted to be secured directly to the fuel tank for allowing fuel to flow therethrough into an opening of the tank, and restriction means positioned in the tube and defining apertures for the flow of fuel there through.
US09365107B2	Fuel tank vent apparatus A fuel tank vent apparatus for controlling discharge of fuel vapor from an interior region in a fuel tank includes a housing and a valve received in the housing that moves between an open position and a closed position. The valve assumes the open position when the fuel level in the fuel tank is relatively low and the valve assumes the closed position when the fuel level in the fuel tank is relatively high.
US09365106B2	Device for regulating an air flow to a cooler device of a vehicle and front end element of a vehicle The invention relates to a device (1) for regulating an air flow to a cooler device of a vehicle, wherein the air flow is directed through at least one opening (21) in a bumper cover (20) onto the cooler device, and a shutter element (10) is provided which can be adjusted between a first (11) and at least one second position (12), wherein the shutter element (10) releases the opening (21) in the first position (11) and at least partially closes it in the at least one second position (12). According to the invention, a supporting element (22) is provided on and/or in the opening (21) which supports the shutter element (10) in the at least one second position (12).
US09365105B2	Gear train and clutch designs for multi-speed hub drives A multi-speed hub drive wheel (MDW) is provided. The MDW includes first and second gears; a clutch shaft having a clutch collar disposed thereon, wherein the clutch shaft drives the clutch collar between a first position in which the clutch collar engages the first gear, a second position in which the clutch collar engages the second gear, and a third position in which the clutch collar maintains the MDW in neutral; a drive shaft having a first spline disposed thereon; a clutch disk equipped with a yoke, wherein the yoke and the clutch disk slidingly engage the first spline; and a clutch motor which drives the clutch shaft.
US09365103B2	Torsion damper for hybrid electric transmission A vehicle powertrain includes an engine, a torsion damper connected to the engine, a torque converter, a housing enclosing a clutch, a motor and gearing, and a drive shell surrounding the torque converter, including an input connected to the damper, an output connected to the clutch, the clutch and the motor located between the torque converter and the gearing, the torsion damper located between the engine and the torque converter.
US09365102B2	Power transmission system of hybrid electric vehicle A power transmission system of a hybrid electric vehicle may include an input device including a first input shaft receiving torque of the engine and a second input shaft disposed without rotational interference with the first input shaft, a planetary gear set including a first rotation element directly connected to the second input shaft, a second rotation element directly connected to the first input shaft, and a third rotation element, a supplemental input device including a first intermediate shaft and a second intermediate shaft, a friction member selectively connecting the first intermediate shaft to a transmission housing, an output device operably connected to the input device and the supplemental input device and outputting torque transmitted from the input device or the supplemental input device, and a final reduction device decelerating torque transmitted from the output device and outputting the decelerated torque.
US09365101B2	Fluid-filled vibration damping device A fluid-filled vibration damping device including a main rubber elastic body composed of a first rubber elastic body and a second rubber elastic body which are overlapped in an axial direction, and a pair of axis-perpendicular liquid chambers formed between the first and second rubber elastic bodies. A pair of dividing walls which divide the axis-perpendicular liquid chambers are constituted by a first division piece protruding from the first rubber elastic body and a second division piece protruding from the second rubber elastic body being overlapped in a circumferential direction. The first rubber elastic body has a thickness, diameter and spring constant all set larger than those of the second rubber elastic body, while having a tapered shape. With the device mounted on a vibration transmission system, a static support load is input so as to compress the first rubber elastic body.
US09365100B2	Reduced powertrain vibration mounting system A vehicle includes a cradle having a structure substantially aligned along a horizontal plane, and a tower extending vertically upward from the structure. A powertrain is supported by the cradle, and includes an elastic axis, and a torque axis. An engine mounting system interconnects the powertrain and the cradle. The engine mounting system includes an engine mount that is attached to the tower, and a mounting bracket attached to the powertrain and the engine mount. An elastic center of the tower is laterally offset from the torque axis, and is vertically offset from the torque axis to position the engine mounting system, such that the elastic axis of the powertrain is substantially aligned with the torque axis of the powertrain.
US09365092B2	Console duct hook and snap feature An assembly for a console of a vehicle including a main body, a first hook connected to the main body wherein the hook is positioned adjacent and spaced apart from a second hook. A duct member having an aperture connects to the first hook and the second hook. During installation of the duct portion the aperture is first angled and positioned over a first hook then rotated downwards over the second hook wherein the second hook includes a ramped portion. The duct portion is snapped into place and is secured tightly over both the first hook and the second hook. During installation and rotation of the duct portion over the first hook and the second hook, the first hook and the second hook resiliently bend towards each other in compression and are relaxed once the aperture is fully over the first hook and the second hook.
US09365084B2	Self-inflating tire and pressure regulator A self-inflating tire assembly includes an air tube connected to a tire and defining an air passageway, the air tube being composed of a flexible material operative to allow an air tube segment opposite a tire footprint to flatten, closing the passageway, and resiliently unflatten into an original configuration. The air tube is sequentially flattened by the tire footprint in a direction opposite to a tire direction of rotation to pump air along the passageway to a regulator device. The regulator device regulates the inlet air flow to the air tube and the outlet air flow to the tire cavity.
US09365076B2	Omni-directional wheel and omni-directional vehicle including the same Provided is an omni-directional wheel including a substantially cylindrical hub provided so as to be rotatable around an axle; a plurality of rollers which have axes extending in a direction intersecting a radial direction of the hub and of each of which an outline has a curvature equal to a curvature of a circle centered at the axle; a support part which allows the rollers to be mounted so as to be rotatable around the respective axes, which supports the rollers such that the outlines are arranged on a single circumference; and rubber tubes which are held between and in contact between the outer circumferential surface of a cylindrical part of the hub and the inner circumferential surface of the support part in the radial direction.
US09365070B2	File binder, printed matter set, and printed matter A file binder 103 has a back side plate member 2, a projecting member 3, and a front side plate member 6. A lower end part 5 of the back side plate member 2 is bent forward. The projecting member 3 projects forward from a part of the back side plate member 2 higher than the lower end part 5. The front side plate member 6 extends downward from a front end part of the projecting member 3 beyond a front end edge 80 of the lower end part 5, and forms a gap 81 from the front end edge 80. Pillar shape protruding portions 15 protrude backward from the front side plate member 6 under a lowermost end of the back side plate member 2, and beyond the front end edge 80, and reach the substantially same plane as a back surface of a main body part 4 of the back side plate member 2.
US09365068B2	Image processing apparatus and image processing method According to one embodiment, an image processing apparatus includes an image processing unit and a control unit. The image processing unit acquires information of a printing rate representing a ratio of an image printed on a sheet from the sheet. The control unit determines a decoloring temperature used for a decoloring process based on the acquired information of the printing rate.
US09365067B2	Conductive thermal imaging receiving layer with receiver overcoat layer comprising a surfactant This invention relates to a conductive thermal image receiver element that has an aqueous-based coatable dye-receiving layer comprising a water-dispersible acrylic polymer, a water-dispersible polyester, a water-dispersible conductive polymeric material and a surfactant. This invention also relates to a method for making this thermal image receiver element as well as method for using it to provide a dye image by thermal transfer from a donor element.
US09365066B2	Recording medium and method for manufacturing recording medium A recording medium includes, in this order, a substrate, a first ink receiving layer containing inorganic particles, polyvinyl alcohol and a boric acid compound, and a resin layer containing a resin. In the first ink receiving layer, hydrated alumina accounts for 70% by mass or more of the inorganic particles. In the recording medium, the ratio of the boric acid compound content to the polyvinyl alcohol content is 30% by mass or more.
US09365063B1	Systems and methods for continuous waste ink filtration in image forming devices A filtration system, mechanism and method is proved that continuously filters waste fluid from variable data ink-based printing system cleaning subsystems. Waste fluid from a cleaning subsystem is forced through a bank of progressively finer filter media. Initial coarse filters remove large components of the ink and/or skin that would rapidly clog the later finer filters required to remove small components of the ink and/or skin. The filtered fluid is recycled for printing surface cleaning and filtration. To avoid clogging, the filter media are cleaned by reversing the flow of fluid through the filters. This back-flushing operation is accomplished with a relatively small volume of fluid that is routed as concentrated waste fluid to a waste container for disposal. To avoid disruption to the printing process, two or more filter banks are preferably used. While one filter bank is filtering the waste fluid any other bank(s) may be back-flushed.
US09365062B2	Display input device and image forming apparatus including the same as well as method for controlling the display input device A display input device, when it has been determined that a plurality of messages, display periods of which overlap with each other, are mutually similar, selects one of the plurality of mutually similar messages as a display message to be displayed, and displays the display message in a display mode corresponding to a highest one of respective importance levels of the plurality of mutually similar messages, while not displaying, among the plurality of mutually similar messages, a message other than the display message.
US09365061B2	External table height adjustment for printer systems An external table height adjustment technique for a printer system is disclosed. An operator can align an image gap between a printer table of the printer system and a printhead carriage via a height adjustment mechanism. The operator can perform the table height adjustment while a belt is installed on the printer table and media is loaded on top of the printer table. A height adjustment assembly is secured onto a supporting frame of the printer table such that an adjustment component exposed beyond an edge of the belt can raise or lower a portion of the printer table where the height adjustment assembly is secured.
US09365060B2	Apparatus for motor control of an apparatus with a motor An apparatus includes a driven object, a motor configured to function as a driving source of the driven object, a scanning unit configured to cause the driven object to move, and include a first pulley to which the motor is connected, a second pulley disposed opposing to the first pulley, and a member stretched around the first pulley and the second pulley, an acquisition unit configured to acquire position information of the driven object, and a signal generation unit configured to generate a periodic signal for controlling driving of the motor based on the position information acquired by the acquisition unit, wherein the signal generation unit increases a period of the signal to be generated, as a length of the member to which a pulling force is applied becomes shorter.
US09365055B2	Label and/or receipt printer The invention relates to a printer (11) for printing on printing media in the form of label and/or receipt rolls (23, 43), comprising a print head (27) and a top cover (17), which can be folded between a closed position and an open position and which provides access to an accommodating chamber (15) for a label or receipt roll in the open position. The printer (11) also comprises a drive roller (29) that can be driven by a drive of the printer for transporting the particular printing medium and a front cover (21), which can be folded between a closed position and an open position and which provides access to an additional accommodating chamber (19) for a receipt roll (29) in the open position, wherein the drive roller is provided on the front cover (21).
US09365051B2	Applying electric fields to erase regions of a print medium In an embodiment, an ink erasing system includes an erase fluid dispenser to apply erase fluid to a surface of a print medium. The system includes a plurality of nonadjacent pairs of electrodes positioned across a width of the print medium. The system also includes a controller to direct the erase fluid dispenser to apply the erase fluid in an erase region on the print medium, and to alternately electrify the nonadjacent pairs of electrodes to generate a moving electric field through the erase region.
US09365050B2	Light-emitting element array module and method of controlling light-emitting element array chips A light-emitting element array module includes a control driver configured to receive print data and operate, and light-emitting element array chips configured to receive a signal from the control driver, respectively, and operate, wherein the light-emitting element array chips are connected to the control driver through respective data lines, and the control driver controls an operation point in time of each of the light-emitting element array chips by adjusting input points in time of a start signal and a data signal according to a registration error of each of the light-emitting element array chips.
US09365045B2	Inkjet recording device An inkjet recording device includes: a head; an ink tank which is connected with the head through a supply channel and a collection channel; a deaeration module which is provided on a side of the supply channel; a main tank; and a supply control unit which controls supply and collection of the ink, where: a supplement flow rate from the main tank to the ink tank is assumed as L1 (ml/sec), a consumption flow rate of ejection from the head is assumed as L2 (ml/sec), and, in the case of L1
US09365040B2	Liquid ejection head and image forming apparatus including same A liquid ejection head includes a nozzle plate having a plurality of nozzles formed therein from which droplets are ejectable. The nozzle plate includes a nozzle substrate in which a plurality of nozzle holes each constituting a nozzle is formed, and a liquid-repellent film formed on a surface of the nozzle substrate on a droplet ejection side of the nozzle plate. A circumferential portion is formed around each nozzle on the droplet ejection side of the nozzle plate and is smoothly recessed toward an edge portion of the nozzle. The edge portion of the nozzle is smoothly continuous with an inner wall of the nozzle, and the liquid-repellent film having a uniform thickness is formed across the nozzle plate on the droplet ejection side of the nozzle plate to at least the edge portion of the nozzle.
US09365035B2	Printing apparatus, printing control system and control method of the printing apparatus A printing apparatus capable of continuously printing images on a recording medium, each of the images including a variable image of which an aspect is variable for each of the images to be continuously printed and a fixed image of which an aspect is the same for each of the images to be continuously printed, the printing apparatus includes a storage unit that associates and stores therein image data of the fixed image and a template having at least information about a position of printing an image, and a printing control unit that, when a control command which includes information for designating the template and instructs a printing of the variable image is input, superimposes the variable image and the fixed image associated with the designated template, on the basis of the template and print the superimposed image.
US09365033B1	Method for compensating failing nozzles A method is provided for controlling the ejection of ink drops from an inkjet printhead. The printhead comprises an array of ink chambers with nozzles arranged for applying a row of ink dots on a receiving medium using a control signal. The method comprises the steps of labeling a nozzle as a functioning nozzle if the nozzle, upon activation by a control signal, ejects an ink drop within predefined specifications, otherwise labeling the nozzle as a failing nozzle, and distributing a control signal associated with a failing nozzle to a neighboring nozzle to maintain a local optical density, wherein said control signal associated with a failing nozzle is not distributed to a neighboring nozzle, if a neighboring nozzle of said failing nozzle is also labeled as a failing nozzle.
US09365031B2	Inkjet recording device and inkjet head head-module replacing method A base frame, which supports head modules, is provided with a first storage device that stores information about the positions of support reference points of the head modules. The head module is provided with a second storage device that stores information about the positions of nozzles of the head module. An inkjet recording device is provided with a third storage device that stores information about the positions of the nozzles of the respective head modules provided on the base frame. When the head module is replaced, information about the correction of a position, which is required to mount the replaced head module at a normal position, is generated based on the information stored in the first storage device, the information stored in the second storage device, and the information stored in the third storage device. The mounting position of the replaced head module is corrected based on the generated information.
US09365029B2	Vacuum drum system in a printing material sheet processing machine and drying unit A vacuum drum system for a printing material sheet processing machine includes suction grooves for pneumatically holding a sheet of printing material and closing slides disposed in the suction grooves. A drying unit having the vacuum drum system is also provided.
US09365025B2	Method for forming fine patterns on a substrate with a disposable cliche A method for forming fine patterns includes (S1) closely contacting a cliche-forming film to a hard mold concavely patterned, thereby making a disposable cliche; (S2) coating an elastic blanket cylinder with ink or resin; (S3) compressing the elastic blanket cylinder to the disposable cliche to remove ink or resin on a surface of the elastic blanket cylinder at a portion contacting with a relatively protruded embossed portion of the disposable cliche; and (S4) transcribing ink or resin remaining on the surface of the elastic blanket cylinder to a substrate. This method allows simple and fast works and greatly reduces costs by adopting a disposable cliche that may be easily installed and removed. Also, this method may be effectively utilized to form a fine pattern of an electronic device or a display device such as color filter and electrode.
US09365023B2	Particle supplying apparatus and sheet article manufacturing apparatus An absorbent sheet manufacturing apparatus is provided with a cylinder part (21) having a plurality of through-holes (212) arranged in a circumferential direction. The cylinder part (21) is rotated, and therefore particles of high-absorbent resin are sequentially filled into the through-holes (212) from a particle storage space (217) in the cylinder part (21). In a particle supply region (210) of a lower portion of the cylinder part (21), the inner side surface (215) of the cylinder part (21) is covered with an isolation part (25) so that each through-hole (212) filled with particles is isolated from the particle storage space (217). And in this state, particles are ejected from the through-hole (212). As above, only particles filled in each through-hole (212) are ejected, and therefore a desired amount of particles can be easily supplied from the through-hole (212).
US09365020B2	Method for the dry production of a membrane electrode unit, membrane electrode unit, and roller arrangement A method for the dry production of a membrane-electrode unit includes assembling a layered configuration including a centrally positioned membrane produced by extrusion and pre-dried at a temperature between 80° C. and 100° C. for 15 min to 30 min, a substrate-electrode unit on each side of the membrane having an electrode layer applied to a substrate, an optional frame around each substrate-electrode unit for fixing the substrate-electrode unit, and two separating films on outer sides. The configuration is pressed together between two laminating rollers so that a pressure connection is produced at least between the membrane and the electrode layers. A short production time is achieved because it is not necessary to keep the membrane moist at high temperatures under pressure. A membrane electrode unit and a roller configuration are also provided.
US09365016B2	Fluorine-containing (meth) acrylic (co) polymer and molded body films thereof Provided are a fluorine-containing (meth)acrylic (co)polymer that scarcely generates gas when subjected to molding process, and is capable of supplying a molded body excellent in external appearance and transparency; a fluorine-containing (meth)acrylic resin film thereof; and a fluororesin laminated resin film having the same properties. The (co)polymer is a fluorine-containing (meth)acrylic (co)polymer obtained by polymerizing a monomer component including 100 to 70% by weight of a fluoroalkyl(meth)acrylate monomer, and 0 to 30% by weight of a different monomer copolymerizable therewith by effect of a radical polymerization initiator having a solubility in water of 0.1% or less by weight at 25 C, and having 8 to 14 carbon atoms.
US09365010B2	Method for digitally printing containers and container having at least one print or printed image A method for digitally printing on containers by producing a printed multi-colored image on a print layer disposed on a middle layer, the middle layer being one of an intermediate layer and a base layer. The method includes applying the middle layer on an outer surface of a substrate formed by a container wall. An adhesion characteristic between the middle layer and the print layer differs from an adhesion characteristic between the middle layer and the substrate, wherein the adhesion characteristic is selected from the group consisting of adhesion strength and adhesion rate, and wherein the different adhesion characteristics are set by at least one of choice of materials used for the layers and crosslinking of the intermediate layer and the print layer.
US09365008B1	Actuating device An actuating device comprising, in combination, a actuating body. There is an internal guide configured to be slidably received within the actuating body. The internal guide has a centrally located central push rod hole. There is a central push rod assembly located within the central push rod hole of the internal guide. There is a beveled slide collar within the interior surface of the actuating body, and the beveled slide collar contains a beveled slide. The beveled slide as having four like-configured components. There is at least one push rod contained within the internal guide.
US09365006B2	Process and plant for producing tyres A compound plant for processing elastomeric compounds for tires with both a high quality and a high throughput includes at least one batch mixing device in combination with at least one multi-shaft continuous mixing device having a high number of shafts. For example, the multi-shaft continuous mixing device could be a ring extruder having a plurality of co-rotating screws disposed to form a ring. In operation, a first elastomeric compound is discharged from the at least one batch mixing device and processed with the at least one multi-shaft continuous mixing device to obtain a second elastomeric compound.
US09365004B2	Flexible stretch hose having inwardly extending web portions connecting adjacent pairs of reinforcing coils, with hose properties enhanced by annealing A flexible, stretchable, crush resistant hose particularly well suited for supplying breathing gases to patients in medical applications and the like has a helix defined by reinforcing coils of thermoplastic material, and a web of thermoplastic material bonded or welded to adjacent ones of the coils, preferably near outer diameter portions of the coils. The web extends radially inwardly between the adjacent pairs of the reinforcing coils to define a helical reverse-direction crease that can be located closer to or farther from a centerline of the hose than is the inner diameter of the reinforcing coils. The thermoplastic material of the hose is stress relieved by an annealing process performed during axial compression of the hose at a time after the hose has been formed.
US09365001B2	Thermally conductive sheet and process for producing same A thermally conductive sheet has cut surfaces with low surface roughness and hence shows reduced thermal resistance at the interfaces, and high thermal conductivity in the thickness direction. Thus, the thermally conductive sheet can be interposed between any of various heat sources and a radiation member. The process for producing the thermally conductive sheet includes at least: an extrusion molding step in which a thermally conductive composition containing a polymer, an anisotropic thermally conductive filler, and a filler is extruded with an extruder to thereby mold an extrusion-molded product in which the anisotropic thermally conductive filler has been oriented along the extrusion direction; a curing step in which the extrusion-molded product is cured to obtain a cured object; and a slicing step in which the cured object is sliced into a given thickness with an ultrasonic cutter in the direction perpendicular to the extrusion direction.
US09364992B2	Thermoforming device and thermoforming method using hot plate heating A thermoforming device using a hot plate heating includes a frame; a hot plate; a decompression unit connected to the frame; a decompression unit which is connected to a hot plate; a unit which is connected to the hot plate and opens a heating surface side to an atmosphere or pressures the heating surface side; an adsorption and heating control unit which performs the adsorption and heating operation of the sheet by the hot plate; a decompression control unit which performs a decompression operation in the concave portion; and a molding operation control unit which concurrently performs the adsorption and heating operation and the decompression operation, stops the adsorption and heating operation of the sheet after a predetermined time from the start of the operation, and opens a portion between the hot plate and the sheet to the atmosphere or pressures the portion.
US09364987B2	Systems and methods for cooling extruded materials Systems, devices, and methods are described for cooling extruded materials. In certain embodiments, a quench tube is provided that includes an inner wall and an outer wall having a channel therebetween for transporting cooling fluid along the quench tube. A passage within the inner surface of the inner wall receives an extruded material through a nozzle formed at an end of the quench tube that delivers the cooling fluid to the extruded material. The channel may be angled at the nozzle to deliver the cooling fluid at an angle with respect to the quench tube, and the quench tube is configured to extend at least in part within an extrusion die.
US09364981B1	Braid capture overmolding The invention described herein relates to capturing a covering such as a braid on a exterior profile of a plastic tube by overmolding onto a plumbing tube, wherein a circumferentially surrounding covering or braid is modified prior to the overmolding process.
US09364977B2	Low constant pressure injection molding system with variable-position molding cavities A variable-position mold system with a plurality of injection systems operable to deliver molten material at a substantially constant pressure of between about 6.89 megapascals (1,000 psi) and about 103.42 megapascals (15,000 psi) to a set of mold cavities of at least one multi-cavity injection mold insert when in fluid communication therewith. The multi-cavity injection mold inserts have a thermal conductivity of greater than 30 BTU/HR FT ° F., and have little or no cooling channels therein.
US09364975B2	Method of molding composite plastic sheet material to form a compression molded, deep-drawn article A method of molding composite plastic sheet material to form a compression molded, deep-drawn article is provided. The method includes placing a heated blank of moldable, composite plastic sheet material over a female die having an article-defining cavity defined by inner surfaces of the die so that the heated blank has a predetermined position and orientation over the cavity. Then an inner portion of the heated blank is forced into the cavity along a substantially vertical axis and against the inner surfaces of the die to obtain deep-drawn material. Outer peripheral portions of the heated blank adjacent the cavity are controllably held with corresponding predetermined holding forces based on the size and shape of the article to resist movement of the outer peripheral portions towards the cavity during the step of forcing wherein the deep-drawn material controllably stretches during the step of forcing without wrinkling, tearing or ripping.
US09364970B2	Table cutting machine A table cutting machine includes a table for carrying an object to be cut; a cutting device, associated with the table, for cutting the object to be cut; a water tank for providing a cooling water to the cutting device; and a water level indicating device for indirectly indicating a water level of the cooling water from a top of the table or a side of the water tank. The device thus enables the user to observe the water level from the top of the table or the side of the water tank of the table cutting machine without removing the table during the observation.
US09364968B2	Chain tension adjustment device of chain saw To provide a chain tension adjustment device for a chain saw. When a first mechanism is rotated around an axis, a bevel gear of a second mechanism is engaged with a bevel gear of the first mechanism and rotated, and a bevel gear of a third mechanism is engaged with the other bevel gear of the second mechanism, so that a shaft portion is rotated. A plate portion integrated with a nut portion of a fourth mechanism screwed on a screw formed on the shaft portion moves in an axial direction, and a guide bar engaged with an engagement portion of the plate portion via an engagement hole moves in a longitudinal direction, to adjust tension of the chain saw by adjusting the movement amount. Thus, fine adjustment can be performed while reducing an operating force, and reducing the weight and the cost.
US09364966B2	Cutting plotter A cutting plotter includes a conveying mechanism, a guide shaft, a cutting head, a cutter moving mechanism, and a slidable contact. The conveying mechanism is configured to convey a sheet-like object in a first direction and includes one roller shaft and a driving roller. The roller shaft includes two rollers located at different positions. The conveying mechanism is configured to convey the object held between the rollers and the driving roller. The cutting head is slidably supported by the guide shaft and configured to be mounted with a cutter. The slidable contact is located in the cutting head and contacts the roller shaft between the rollers of the roller shaft so as to be slidable, maintaining a position of the cutting head. The slidable contact has a U-shaped cross section, and the roller shaft is disposed at an open side of the U-shape.
US09364961B2	Shaving device having a safe razor blade unit Razor blade unit for shaving a skin comprising a stretcher, a rear support and at least one blade (11) allocated in between the stretcher (9) and the rear support (10). The blade (11) is movable with respect to an exposure plane (14) from a rest position to a working position. The exposure plane (14) is defined as a tangential plane from the stretch surface to the support surface. An adjusting mechanism (15) is provided to adjust the movable blade from the rest position to the working position during a sliding movement of the razor blade unit over the skin in the shaving direction.
US09364958B2	Pen cutter The present invention generally relates to pen cutters. Specifically, embodiments of the present invention relate to a pen cutter apparatus with an auto-retractable blade. Embodiments of the pen cutter apparatus are further comprised of a tether-hole and a blade slider button.
US09364951B1	System for controlling motion and constraint forces in a robotic system Described is a system for controlling motion and constraint forces in a robotic system, the system infers constraints, at each time step, from a sensed state of robot/environment interactions. The inferred constraints are appended to known internal robot constraints to generate constrained dynamics. Properties associated with the constrained dynamics are determined provided to a controller. Inequality conditions associated with maintaining desired robot/environment interactions are also determined. A set of equality conditions based on the inequality conditions are then specified. The set of equality conditions are aggregated with any internal robot constraints to generate aggregated conditions that are provided to the controller. Joint torque commands are then generated for the robot based on the aggregated conditions and a specified task and null space motion command. Finally, the robot is actuated based on the joint torque commands.
US09364950B2	Trainable modular robotic methods Apparatus and methods for a modular robotic device with artificial intelligence that is receptive to training controls. In one implementation, modular robotic device architecture may be used to provide all or most high cost components in an autonomy module that is separate from the robotic body. The autonomy module may comprise controller, power, actuators that may be connected to controllable elements of the robotic body. The controller may position limbs of the toy in a target position. A user may utilize haptic training approach in order to enable the robotic toy to perform target action(s). Modular configuration of the disclosure enables users to replace one toy body (e.g., the bear) with another (e.g., a giraffe) while using hardware provided by the autonomy module. Modular architecture may enable users to purchase a single AM for use with multiple robotic bodies, thereby reducing the overall cost of ownership.
US09364948B1	Adjustable holder assembly for painting tools An adjustable holder assembly for removably holding, articulating, and rotating painting tools may include a handle assembly. An articulating arm may be pivotally coupled to a proximal end of the handle assembly and may be configured to allow both the articulating arm and a tool handle housing to be simultaneously angularly adjusted from a longitudinal axis of the holder assembly to any position from 0 degrees to 90 degrees. The tool handle housing may be configured to removably secure a handle of a painting tool at least partially therein. The tool handle housing may be removably coupled to the articulating arm such that the tool handle housing can be rotationally adjusted around a longitudinal axis of the holder assembly to any position from 0 degrees to 90 degrees; and a receiver end defining a channel.
US09364947B2	Storage compartment sleeve structure in a tool shank A storage compartment sleeve structure in a tool shank comprising: an operation unit with a pin; a tool shank linking the operation unit and developing at least a tool compartment; a tool shank sleeve enveloping the tool shank and developing a positioning through hole securely penetrated by the pin. As such, the storage compartment sleeve structure in a tool shank is easily and fast opened or closed for removal or accommodation of spare parts and provides a tool shank with flexible lengths based on operation states for adjustable and selectable torque.
US09364946B2	Lifting and transporting device A lifting and transporting device for lifting a load and transporting the same transversely to the lifting direction includes a frame (2) which for picking up and lifting a load (15) extends around a load space (13) of specified size and a holder (3) for holding the load (15). The holder (3) is movable in lifting direction (9) relative to the frame (2), and includes a hoist (4) which is attached to the frame (2) transversely to the lifting direction (9) beside the load space (13), and includes a portion (25) extending on the load space side thereof, to which the holder (3) is attached, and which is equipped for lifting and lowering the holder (3) with the load (15) attached thereto. The frame (2) is mounted on a first and a second support bearing (5, 6) whose support directions (5a, 6a) each extend perpendicular to the transport direction (10) and at a specified angle to each other, and which both in lifting direction (9) and perpendicular to the transport direction (10) and to the lifting direction (9) have a distance to each other. The support bearings (5, 6) include sliding members or rollers (32, 38) which can be shifted or rolled off in transport direction (10).
US09364944B2	Power tool Provided is a power tool which is capable of more reliably detecting excessive reaction torque acting on a tool body. More specifically, provided is a handheld power tool which causes a tip tool to rotate so as to carry out a predetermined machining operation, the handheld power tool comprising a tool body, a motor which is housed in the tool body and causes the tip tool to rotate, a first sensor which detects the torque state of the tip tool, a second sensor which detects the motion state of the tool body, and a torque cut-off mechanism which cuts off the transmission of torque between the motor and the tip tool. The torque cut-off mechanism is configured to cut off the transmission of torque on the condition that the first sensor and the second sensor respectively detect a preset threshold value for the first sensor and the second sensor.
US09364943B2	Quick rotatable wrench A quick rotatable wrench includes a first bar including a first position limit portion and a rotary connector, a second bar including a second position limit portion having a shape complementary to the first position limit portion and a recessed accommodation chamber, and a position limit device to secure the rotary connector to the inside of the recessed accommodation chamber in such a manner that the first bar is movable relative to the second bar between an engaged position where the first and second position limit portions are engaged together to secure the first bar and the second bar together and a released position where the first and second position limit portions are disengaged from each other and the rotary connector is rotatable in the recessed accommodation chamber for allowing relative rotation between the first bar and the second bar.
US09364939B2	Device for the temporary position fixing of aircraft structures to be interconnected A device for the temporary position fixing of adjacently arranged aircraft structures to be interconnected includes a support frame with at least one vacuum suction cup for temporary surface attachment and with clamping means for the position fixing of the aircraft structures to be interconnected. The support frame with the at least one vacuum suction cup in the region of a transverse gap is attached on the side of one aircraft structure. The support frame includes mechanical contact pressure means for the gap-bridging position fixing of the adjacent other aircraft structure. On the support frame there is a counter support to pressure elements of the contact pressure means.
US09364935B2	Apparatus, system and method for aero-contouring a surface of an aerodynamically functional coating An aero-contouring apparatus is provided. The aero-contouring apparatus has a housing assembly and a motor assembly disposed therein. The motor assembly has a motor unit and a drive unit. The aero-contouring apparatus further has an engagement force/tilt limiting member coupled to the housing assembly, which has a central opening and a bottom end configured to contact a surface to be aero-contoured of an aerodynamically functional coating applied to a structure. The aero-contouring apparatus further has an abrading unit coupled to the drive unit and inserted through the central opening in non-contact communication with the engagement force/tilt limiting member. The abrading unit is driven by the drive unit in a random orbit motion on the surface. The engagement force/tilt limiting member mechanically limits both an engagement force and any tilting motion of the abrading unit with respect to the surface.
US09364934B2	Clamping device An apparatus for clamping a work piece is provided. The apparatus includes a base plate to support the work piece; at least one clamp body fixed to the base plate, each clamp body having a hole that receives a corresponding screw, wherein the hole passes through the clamp body such that as the clamp screw is inserted through the clamp body an end of a body of the screw moves horizontally towards the work piece supported by the base plate at a downward angle; fastener fixing the at least one clamp body to the base plate; and the at least one corresponding screw, each screw having a hollow point tip where outer and inner lateral surfaces of the hollow point tip join to define a sharp circular edge at an end of a body of the screw.
US09364911B2	Working fluid supply device of electric discharge machine A working fluid supply device of an electric discharge machine draws up a cleaned fluid from a cleaned-fluid tank by means of a pump and supplies it to a working tank. The pump is connected with a first fluid circuit configured to supply the drawn cleaned fluid to the working tank and a second fluid circuit configured to supply the drawn cleaned fluid to an ion-exchange resin and a refrigerator. In supplying the cleaned fluid to the working tank, the first and second fluid circuits are opened and closed, respectively. In supplying the cleaned fluid to the ion-exchange resin and the refrigerator, the first and second fluid circuits are closed and opened, respectively.
US09364908B2	Deburring device Disclosed, herein is a deburring device for removing burrs generated on a joint between window frames. The deburring device includes: first and second scrapers (111) and (112) provided on an end of a scraper rod that is moved back and forth toward the joint; first scraper-guide bars (111) and second scraper-guide bars (112) assembled with left and right side surfaces of the first and second scrapers supports (131) and (132) respectively assembled with corresponding left and right outer surfaces of the scraper-guide bars; and push bar (141) and (142) provide to vary a distance between the first and second scrapers. Each push bar includes: on a front end thereof a contact member making contact with corresponding-upper and lower contact rollers provided on the first and second scraper-guide bars; and a guide member moving back and forth along a guide depression formed in the corresponding support.
US09364906B2	Power tool with high-speed electric motor A hand-held power tool includes a motor having a stator and a rotor, the motor being configured to rotate the rotor at a speed of at least 40,000 rpm, an output shaft directly driven by the rotor, a tool accessory shaft configured to support a tool accessory, and a two-stage speed reducing transmission operably connecting the output shaft to the tool accessory shaft. The two-stage speed reducing transmission is configured to drive the tool accessory shaft at a rate less than the rotor speed, for example, at a rate less than or equal to 37.5% of the rotor speed.
US09364904B2	Variable lead end mill A variable lead end mill has a plurality of peripheral cutting edges with different helix angles, the variable lead end mill having a flute bottom diameter of a plurality of helix flutes making up rake faces of the plurality of the peripheral cutting edges, the flute bottom diameter increasing in an axial direction from a tool tip toward a shank.
US09364902B1	Drill press circular pattern tool and router circle cutting tool assemblies A Drill Press Circular Pattern tool comprises a Table Mount which is attached to the drill press table; a Left Alignment Plate and a Right Alignment Plate; a Slide Plate with Centering Pin; a Lock Down Bolt; mounted on top of the Slide Plate is the Rotation Plate with a Degree Gear. A Router Circle Cutter tool comprises an Alignment Plate with an Alignment Pin and a Slide Plate with one or two Centering Pins; the Slide Plate with measuring surface is mechanically coupled to the Alignment Plate with two Slide Plate Brackets; the Alignment Plate is mechanically coupled to the Router Table with Alignment Plate Mounting Bolts/Nut Knobs; the Slide Plate with Centering Pin(s) attached slides on the Router Table top while attached to the Alignment Plate with the two Slide Plate Brackets.
US09364900B2	Locking chuck A chuck including a body with a nose section defining an axial bore formed therein, a plurality of jaws movably disposed with respect to the body, and a sleeve rotatably mounted about the body so that rotation of the sleeve moves the jaws relative to the axial bore. A bearing has a first race, a second race, and at least one bearing element disposed therebetween, one of the first race and the second race defining a ratchet and the other defining a pawl biased toward the ratchet. A biasing element is disposed between the pawl and the sleeve. The biasing element exerts a biasing force on the pawl toward the ratchet and the ratchet and the pawl prevent the second race from rotating in the opening direction with respect to the first race when engaged.
US09364899B2	Tool holder on which nonrotational tool of machining center is mounted A tool holder on which a nonrotational tool is mounted is mounted on a spindle of a machining center. A tool holder body of the tool holder includes a positioning pin that is inserted into the machining center and a locking mechanism. When the positioning pin is not inserted into the machining center, the locking mechanism locks the rotation of the tool holder body relative to a drive shaft. When the positioning pin is inserted into the machining center, the locking mechanism allows the rotation of the tool holder body relative to the drive shaft.
US09364895B2	System and method for making a structured magnetic material via layered particle deposition A system for making a material having domains with insulated boundaries is provided. The system includes a droplet spray subsystem configured to create molten alloy droplets and direct the molten alloy droplets to a surface, a spray subsystem configured to direct a spray of an agent at deposited droplets on the surface. The agent creates insulation layers on the deposited droplets such that the droplets form a material having domains with insulated boundaries on the surface.
US09364894B2	Method of treating the surface of a cavity of a die used for casting Disclosed is a method of processing the surface of a cavity a casting die wherein the fluidity is good even if the shape of the surface of the cavity (castings) has a complex shape, mold releasability are excellent, reprocessing is possible, and the life of the die can be prolonged. A step (A) for forming hemispherical first dimples (12) by the particles to be sprayed on the surface of the cavity (11), and a step (B) for forming second dimples (13) by the particles to be sprayed, which second dimples are smaller than the first dimples (12), are provided. A treating method (a) and a treating method (b) where either step (A) or step (B) is carried out depending on the requirements, and a method (c), where only the first dimples (12) are formed by carrying out only step (A) are also provided.
US09364892B2	Centrifugal casting machine for manufacturing rotor Disclosed herein is a centrifugal casting machine, including: a rotating plate rotating by means of a motor; a cylindrical sleeve installed on the rotating plate and having an internal diameter corresponding to an external diameter of silicon steel plates constituting a core in the sleeve; an upper mold internally installed on the sleeve to define a first molding space into which a molten metal is introduced to mold an end ring; a lower mold internally installed on the sleeve to define a second molding space into which a molten metal is introduced to mold an end ring; a dummy shaft fitted in the center of the core and coupled to the lower mold; a cap coupled to an upper end of the dummy shaft to press the core; and a hydraulic ram coupled to the lower mold to move the lower mold up and down and coupled to the rotating plate to rotate therewith.
US09364891B2	Molding device for continuous casting with stirring unit A molding device includes a mold that forms a casting by cooling received melt, and a stirring unit that applies a magnetic field to the melt in the mold and allows a current to flow in the melt. The mold forms a vertical casting space that includes an inlet into which the melt flows and an outlet from which a product is taken. A transition plate is disposed at the mold space inlet. The melt can flow into the casting space from a hole in the transition plate. The stirring unit includes a magnetic field unit making lines of magnetic force vertically run into the casting space, and a first electrode at the inlet side and a second electrode at the outlet side that can flow current through the melt in the casting space, and generate an electromagnetic force by making the flowing current cross the lines of magnetic force.
US09364889B2	Foam pattern techniques Various techniques are provided for creating fugitive foam patterns for use in investment casting operations. In certain illustrative embodiments, a fugitive foam pattern is assembled from independently formed portions. A first section is formed in a mold. Once cured, a mating surface of the first section is exposed to the cavity of a second mold and the section is formed. The second section integrally adheres to the first section. The process is repeated as necessary. In alternative embodiments, a channel is created in a foam pattern using a temporary core that is removed without chemical leaching. The core material comprises water-soluble materials, acid-soluble materials, low-melting point materials, or a combination thereof. A pattern may also be created by inserting foam around a core that remains with the foam pattern.
US09364881B2	Welded component comprising seamless bent pipe and seamless straight pipe sections and methods of manufacturing thereof Provided are a seamless bent pipe constituted by a bent section and straight pipe sections on both ends of the bent section, with the inside diameter at each pipe end portion being larger than the inside diameter of the bent section, and a welded component comprising a seamless bent pipe and a seamless straight pipe at one or each end of the seamless bent pipe, with the end of the seamless straight pipe to be welded to one or each end of the seamless bent pipe having the same inside diameter as the inside diameter of the seamless bent pipe, as well as methods of manufacturing them. As a result, elements suited for use in pipelines can be obtained, without unnecessarily increasing the wall thickness of the seamless bent pipe and without internal machining of the pipe end portions of the seamless bent pipe after the manufacturing thereof.
US09364878B2	Method, computer program and rolling mill train for rolling a metal strip The invention relates to a method, a computer program and a rolling mill train for cold rolling a metal strip (200). In order to achieve a shortening of undesired off-gauge lengths, the method according to the invention provides that the head (210) of the metal strip (200) already undergoes a thickness reduction at the first active rolling stand (n) in the rolling mill train, and then is transported on to the next rolling stand, in order to undergo a further thickness reduction there. The method according to the invention also provides for further reducing the initial pass thickness at the n-th rolling stand in accordance with the tensile stress that has built up in the meantime between the n+1-th and the n-th rolling stand.
US09364877B2	Soil box for evaporative desorption process Simple flow path with minimum turns for the vapor extraction flow paths can provide maximum air flow with minimal head loss, leading to higher efficiency in a thermal desorption process. Hot air vapor extraction arrangement can include large diameter vertical or horizontal trunk line or curved plate with continuous wire wrap well screens. The vapor extraction trunk can draw all vapors to the center of the soil box, which can reduce the treatment time by substantially removing condensation zone. The interior of the vapor extraction well screen and trunk can include porous material, which can reduce dust within the vapor stream, eliminate potential short circuiting in the event of a screen rupture and reduce potential explosion hazards.
US09364876B2	Cadaver disposal systems and techniques Apparatus and a method for decomposing a body of a deceased person, as an alternative to traditional cremation. The apparatus includes a primary vessel where the body is treated with a highly basic solvent to render the body into skeletal remains and liquid remains. A clamp is applied to the skull during processing for solvent access to the skull. A secondary vessel is used to receive the liquid remains from the primary vessel and further treat them. During this further treatment, the skeletal remains left in the primary vessel after the liquefied portion has been transferred to the secondary vessel, can be treated to be decolorized and deodorized, and then returned to the decedent's next of kin as ash-like material.
US09364875B2	Sash position sensor using image analysis Systems and methods for determining the area of a sash opening in a fume hood formed by at least one movable sash panel. Fume hoods have sash panels mounted over a hood opening to an enclosure structure of the fume hood. The sash panels are moved to open or close the fume hood at the sash opening for access to a work surface. A camera is mounted in a fume hood enclosure space to capture an image of the sash opening. An area determining function is configured to receive a digital representation of the image. The image is analyzed by detecting edges in the image. The image edges corresponding to edges of the sash opening are identified. The area of the sash opening is determined by applying a scaling value to the area formed by the image edges corresponding to the area of the sash opening.
US09364872B2	Single-dose applicator and method An applicator, related applicator system, and a method for delivering a self-adhesive material are provided. The applicator includes an outer surface, and an inner surface opposite the outer surface. The inner surface of the applicator defines a void that is operable to receive the self-adhesive material. At least a portion of the inner surface releasably adhere the applicator side of the self-adhesive material where the adhesive force between the portion of the inner surface and the applicator side being less than adhesive force between the substrate and the substrate side. The applicator is used by placing the applicator in contact with a substrate, pressing the applicator against the substrate such that the self-adhesive material adheres to the substrate, and releasing the applicator from the substrate.
US09364870B2	Ultrasonic cleaning method and apparatus therefore Ultrasonic cleaning apparatuses and methods of cleaning substantially planar articles. An apparatus comprises (i) a substantially circular tank; (ii) a plurality of cleaning fluid inlets for delivering a cleaning fluid to the tank; (iii) an intermediate support for receiving an article to be cleaned; and (iv) an ultrasonic generator coupled to the tank for generating ultrasonic waves in the tank and cleaning fluid received therein. The apparatus is configured to remove particles from a substantially planar article and have them carried by flow of cleaning fluid away from the article and out of the tank. Using such an apparatus, a cleaning method comprises introducing a substantially planar article to be cleaned into the tank; introducing a cleaning fluid into the tank through the plurality of cleaning fluid inlets; and exciting the cleaning fluid with ultrasonic waves.
US09364867B1	Cleaning apparatus A cleaning apparatus includes a supporting element, at least one button unit and a cleaning unit. The supporting element includes a space. The button unit is formed on the supporting element by making a U-shaped slit in the supporting element. The U-shaped slit is in communication with the space. The cleaning unit includes a shell, bristle and at least one hook. The shell includes a first end and a second end. The bristle is connected to an internal side of the shell via the first end. The hook extends from the second end of the shell. The hook is inserted in the space of the supporting element and the U-shaped slit of the button unit to engage the cleaning unit with the supporting element. The button unit is operable to move the hook out of the U-shaped slit to allow disengagement of the cleaning unit from the supporting element.
US09364863B2	Method for forming an ultrasound transducer array An ultrasound transducer array is formed with stealth dicing. A laser is used to form defects within the piezoelectric substrate and along the desired kerf locations. The substrate is fractured along the defects. A controlled expansion, such as using thermal expansion, may be used to establish the desired kerf width. Spacers may be used to maintain the desired kerf width. The kerfs are filled to create the ultrasound transducer array.
US09364852B2	Paint pad and paint pad tray assembly A painting kit includes one or more paint pads and a paint tray. The paint tray includes a reservoir for holding a supply of paint, and means for transferring paint to a paint pad. In one embodiment the paint tray includes a rotating cylinder to transfer paint from the paint reservoir to one or more paint pads. In another embodiment, one or more paint pedestal surfaces are coated with paint from the reservoir in order to transfer paint to paint pads. Each of the paint pads and the trays includes features to selectively apply paint to the paint pad and to avoid applying paint to selected longitudinal edges of the paint pad. The lack of paint along the longitudinal edges helps to prevent paint from dripping or being forced from the longitudinal edge onto adjacent dry surfaces, and thereby enables a user to paint uniformly near edges while avoiding adjacent areas.
US09364851B2	Roller coating method for production of patterned insulation board used for building exterior wall The present invention provides a roller coating method for production of patterned insulation board used for building exterior wall. In this method, a metal veneer and a substrate are produced firstly, and a pattern is printed on the metal veneer, and then an insulation layer is added between the metal veneer and the substrate to produce the patterned insulation board which is finally arranged onto the wall body. In this way, the defect that an decorative layer has to be arranged after installation of an insulation board is avoided (it is inconvenient to directly print a pattern on the insulation board arranged on the wall body by making use of the roller coating production line, so the existing insulation board is generally less decorative and unaesthetic), and the integration of decoration and insulation is realized.
US09364840B2	Powder distribution device A powder distribution device comprises a distribution chamber having a cylindrical shape, a powder introduction pipe extending along a central axis of the distribution chamber and adapted to introduce powder to an inside of the distribution chamber through an introduction port facing the distribution chamber, swirling gas flow generating unit that generates a swirling gas flow flowing about the central axis of the distribution chamber in the distribution chamber, a plurality of powder distribution paths communicating with an outer peripheral surface of the distribution chamber, and a slit formed at a communicating portion between each of the plurality of powder distribution paths and the distribution chamber.
US09364838B2	Head for dispensing a fluid product A fluid dispenser device comprising a pre-compression pump (6) and a dispenser head (T); the pump including an actuator rod (65) that is movable downwards and upwards, and a pre-compression spring (69) for increasing the pressure in a pump chamber (60); the head (T) including an inlet well (14) for connecting to the actuator rod (65), and a nozzle (4) for forming a spray through a dispenser orifice (43), the nozzle being mounted in an assembly housing (2); the dispenser device being characterized in that: the pre-compression spring (69) presents stiffness that is less than about 3 N/mm, e.g. of about 1 N/mm to 3 N/mm; and at least two feed ducts (15), each connecting the inlet well (14) to the assembly housing (2).
US09364836B2	Method and apparatus for removing metallic matter from an oil well circulating completion fluid stream A method and apparatus for removing metallic material from a circulating well fluid stream provides a treatment vessel that is divided into first and second sections. Each of the sections includes a magnetic field that can be in the form of one or more magnets. In one embodiment, multiple magnets are provided in each of the sections. Manifolds attach to an influent and to an effluent of the treatment vessel. Each manifold enables selective transfer of fluid to either of the selected sections. Similarly, discharge of circulating fluid can be from either of the sections via a discharge manifold. The treatment vessel enables continuous treatment by valving fluid flow so that only one section need be used at a time in order that the other section could be serviced for removing collected metallic material from the magnetic field or from the magnets.
US09364835B2	Unit for supplying sheet-like material for a document shredder The invention relates to a unit for supplying sheet-like material for a document shredder, wherein the unit has a main body on which a paper support having a support face is disposed such that by at least one conveying element in each case one sheet is successively drawn off a stack of paper/sheet-like material which is supported on the support face and conveyed toward a supply slot of the document shredder, wherein the at least one conveying element is a conveyor roller, the sleeve face of which includes a multiplicity of structured part-areas such that the static friction between this conveyor roller and the respective sheet is increased.
US09364832B2	Nanofluidic channels with gradual depth change for reducing entropic barrier of biopolymers A device for passing a biopolymer molecule includes a nanochannel formed between a surface relief structure, a patterned layer forming sidewalls of the nanochannel and a sealing layer formed over the patterned layer to encapsulate the nanochannel. The surface relief structure includes a three-dimensionally rounded surface that reduces a channel dimension of the nanochannel at a portion of nanochannel and gradually increases the dimension along the nanochannel toward an opening position, which is configured to receive a biopolymer.
US09364830B2	Functionalized microfluidic device for immunofluorescence It is described a microfluidic device, for use in the field of analytical fluorescence based assays and, in particular, in FISH assays.
US09364823B2	Activation and use of hydroalkylation catalysts In a process for activating a hydroalkylation catalyst, a catalyst precursor comprising a solid acid component and a compound of a hydrogenation metal is heated at a heating rate of less than 50° C./hour in the presence of hydrogen to an activation temperature in a range from 100° C. to 260° C. and then the heated catalyst precursor is treated with hydrogen for a duration effective to reduce at least a portion of the metal compound to an elemental form.
US09364817B2	Oxide catalyst and method for producing the same, and methods for producing unsaturated aldehyde, diolefin, and unsaturated nitrile An object of the present invention is to provide an oxide catalyst that prevents the reduction degradation of the catalyst even during industrial operation for a long time and less reduces unsaturated aldehyde yields, diolefin yields, or unsaturated nitrile yields, and a method for producing the same, and methods for producing unsaturated aldehyde, diolefin, and unsaturated nitrile using the oxide catalyst. The present invention provides an oxide catalyst for use in the production of unsaturated aldehyde, diolefin, or unsaturated nitrile from olefin and/or alcohol, the oxide catalyst satisfying the following (1) to (3): (1) the oxide catalyst comprises molybdenum, bismuth, iron, cobalt, and an element A having an ion radius larger than 0.96 Å (except for potassium, cesium, and rubidium); (2) an atomic ratio a of the bismuth to 12 atoms of the molybdenum is 1≦a≦5, an atomic ratio b of the iron to 12 atoms of the molybdenum is 1.5≦b≦6, an atomic ratio c of the element A to 12 atoms of the molybdenum is 1≦c≦5, and an atomic ratio d of the cobalt to 12 atoms of the molybdenum is 1≦d≦8; and (3) the oxide catalyst comprises a disordered phase consisting of a crystal system comprising the molybdenum, the bismuth, the iron, and the element A.
US09364816B2	Concentrated solutions comprising group VI metal, group VII metal, and phosphorus This invention provides processes for forming solution compositions, which processes comprises bringing together, in an aqueous medium, i) at least one phosphorus compound; ii) at least one Group VI metal compound; and iii) at least one Group VIII metal compound, such that a solution having a Group VI metal concentration of more than about 5.6 mol/L is formed. Also provided are compositions formed by such processes, processes for forming catalyst compositions from these compositions, and catalyst compositions formed by these processes.
US09364814B2	Extruded body devices including sheet material hole masking A method of making a fluidic device is provided. The method includes locating a meltable sheet material on a face of an extruded body including extended cells therein. At least some of the cells are interconnected by melting the sheet material such that the melted sheet material flows into the at least some of the cells to form a fluidic passage through the body defined within the at least some of the cells. The fluidic passageway may have a longitudinally serpentine path back and forth along the at least some of the cells.
US09364808B2	Apparatus and method for reducing carbon dioxide using solar light The present disclosure relates to an apparatus for a reduction reaction of carbon dioxide using solar energy and a reducing method of carbon dioxide for reacting carbon dioxide gas and hydrogen gas with each other by using solar energy.
US09364800B2	Aerosol generating device with a capillary interface There is provided an aerosol generating device including a storage portion configured to store an aerosol-forming substrate. The device includes a vaporizer configured to heat the aerosol-forming substrate, a capillary material configured to convey the liquid aerosol-forming substrate from the storage portion towards the vaporizer by capillary action, and a porous material between the capillary material and the vaporizer.
US09364795B2	Nano and microfluidic device for separating and concentrating particles present in a fluid A device for separating and concentrating particles present in a fluid, including: a first microchannel, having at least one first aperture; and at least one second microchannel, having at least one second aperture, and an end is disclosed. The first microchannel surrounds part or all of the second microchannel at the end. The first microchannel and the second microchannel are connected, at the end, by at least one nanochannel, the nanochannel(s) forming a restriction between the first microchannel and the second microchannel. A cap bounds the first microchannel, the second microchannel and the nanochannel at the end. The first microchannel and the second microchannel are made in a first substrate. The first aperture and the second aperture open into a same face of this substrate. The device may be used for separating and concentrating particles of biological samples, such as viruses, DNA or synthesic molecules.
US09364793B2	Exhaust gas-purifying catalyst An exhaust gas-purifying catalyst includes a substrate, and a catalytic layer facing the substrate and including a precious metal, alumina, an oxygen storage material, and a sulfate of an alkaline-earth metal having an average particle diameter falling within a range of 0.01 to 0.70 μm, the average particle diameter being obtained by observation using a scanning electron microscope. Another exhaust gas-purifying catalyst includes a substrate, and a catalytic layer formed on the substrate using slurry containing a precious metal, alumina, an oxygen storage material, and a sulfate of an alkaline-earth metal having an average particle diameter falling within a range of 0.01 to 0.70 μm, the average particle diameter being obtained by observation using a scanning electron microscope.
US09364790B2	Exhaust mixing assembly An exhaust treatment component including a mixing assembly located within a housing. The mixing assembly includes a decomposition tube having a first end and a second end, the first end being configured to receive the exhaust from the inlet and being configured to receive a reagent exhaust treatment fluid; a flow reversing device disposed proximate the second end, the flow reversing device configured to direct a mixture of the exhaust and reagent exhaust treatment fluid as the mixture exits the second end of the decomposition tube in a direction back toward the first end, the flow reversing device including a plurality of deflecting members for swirling and intermixing the exhaust and reagent exhaust treatment fluid; and a swirl arrester device configured to eliminate the swirling of the exhaust and reagent exhaust treatment fluid after exiting the flow reversing device.
US09364789B2	Method for recovering hydrogen from hydrogen sulfide The present invention provides a method for recovering hydrogen from hydrogen sulfide using a supported silver catalyst, and a method for purifying a gas stream containing hydrogen sulfide using such a catalyst.
US09364784B2	Emission gas treatment method and emission gas treatment apparatus An emission gas treatment apparatus recovers a recycle feed containing boron from emission gas discharged by a glass melting furnace. The apparatus includes a collection device for collecting a component containing boron from the emission gas by a wet process to obtain a collected liquid, a first filter for separating the collected liquid into a solid and a liquid, and an ion-exchange resin for forming a boron solution by removing an impurity from an extracted liquid obtained in the first filter. The apparatus also includes a mixing tank for mixing an extracted solid obtained in the first filter in the boron solution to form an extracted solid-containing solution, a second filter for separating the extracted solid-containing solution into a solid and a liquid, and a vacuum dryer for recovering the recycle feed from an extracted solid obtained in the second filter.
US09364781B2	Method and apparatus for wet desulfurization spray towers A method and apparatus or system is provided for cleaning a flue gas and/or cooling a flue gas with a dispersed finely divided absorption liquid. As such, the absorption liquid is dispersed in a wet scrubber through which flue gas flows for absorption liquid and flue gas intermingling and contact to produce a cleaned flue gas. The absorption liquid supplied to the wet scrubber is dispersed from upwardly spraying anti-clogging nozzles and downwardly spraying nozzles arranged to maximize absorption liquid and flue gas contact with minimal spray interference between nozzles.
US09364780B2	Apparatus for separating gas and liquid Disclosed is an apparatus for separating gas and liquid. The apparatus for separating gas and liquid includes a housing, a rotating shaft provided inside the housing, a drive unit configured to rotate the rotating shaft, a rotating cone mounted at the rotating shaft to rotate about the rotating shaft and having a diameter decreasing from an upper end to a lower end thereof, and a fixed cone formed by coupling at least two first unit members in a circumferential direction of the rotating shaft, disposed in the housing to be spaced apart from the rotating cone and having a diameter decreasing an upper end to a lower end thereof.
US09364779B2	Method and equipment for measuring the filter sectors in disc filters The method and equipment relates to the measurement of deflections of filter sectors in a disc filter. The filter discs in the disc filter are constituted by a number of filter sectors, and the distance between a position fixed relative to the filter, most commonly the scraper itself, and the filter surface is conventionally measured by manual measurement methods. The equipment is instead used that has a measuring head with a quick-release coupling for its mounting fixed in the filter, and a position sensor in the measuring head that measures the distance between the measurement arrangement and the surface of the filter disc in order to form momentary measurement results. The momentary measurement results are transferred by a data transfer link from the measurement arrangement to a data collection unit PC that has a memory.
US09364773B2	Method and system for removing hydrogen sulfide from sour oil and sour water Embodiments of the present invention are generally related to a system and method to remove hydrogen sulfide from sour water and sour oil. In particular, hydrogen sulfide is removed from sour water and sour oil without the need for special chemicals, such as catalyst chemicals, scavenger chemicals, hydrocarbon sources, or a large scale facility. The system and method in the present invention is particularly useful in exploratory oil and gas fields, where large facilities to remove hydrogen sulfide may be inaccessible. The present invention addresses the need for safe and cost effective transport of the deadly neurotoxin. Particular embodiments involve a system and method that can be executed both on a small and large scale to sweeten sour water and sour oil.
US09364764B2	Portable toddler swing A portable toddler swing is provided. The swing includes a compliant shell, an upper adjustable strap, a fastener coupled to the upper adjustable strap, a lower adjustable strap, a pair of support straps and a pair of safety fasteners. The shell defines an inner cavity, including an upper portion defining a top opening, a circumferential passage and a strap opening connected to the circumferential passage, a bottom portion, a front portion defining a pair of leg openings, a back portion, and a pair of side portions. The upper adjustable strap is disposed within the circumferential passage, and adjusts the size of the top opening of the shell. The lower adjustable strap is connected to the bottom portion of the shell, and secures the shell to a playground swing seat. The pair of safety fasteners are coupled to upper portions of the support straps, and secure the support straps to the playground swing chains.
US09364763B2	User assembly of lightweight user interface for games Technology is described for user assembly of lightweight user interfaces for games, e.g., massively multiplayer online games. The technology can include a set of pre-selectable action modules; an interface element, a messaging element, and a display element for each pre-selectable action module; and a component configured to enable a user to select a subset from the set of pre-selectable action modules. A first subset of the pre-selectable action modules can provide a different user interface than a second subset of the pre-selectable action modules when at least one pre-selectable action module is in the first subset but not the second subset. Action modules may be capable of communicating using a messaging platform with at least one server computing device and relates to a massively multiplayer online gaming system operating at a server computing device.
US09364760B2	System and method for detecting game client modification through script injection Script injection in game clients used to access an online, interactive game may be detected. This detection may be performed on behalf of the entity operating the game in order to reduce cheating by users that relies on client modification through script injection. Detection of script injection may be performed on a recurring basis.
US09364758B2	Automatic movement of a game character in a protected state An information processing device is configured to execute: setting a protective state for protecting a character from a danger in a game; setting a moving direction of the character in the protective state to a predetermined direction; detecting that the character in the protective state is overlapping with an obstacle in a virtual world; and correcting the moving direction that has been set by the action setting when the obstacle is detected.
US09364751B2	Interactive computer game A method for providing an interactive video game over a digital communications network. The method involves operating an interactive computer game on interconnected computer games terminals. The method includes receiving, at each of the computer games terminals, interactive user input data from a controller associated with the computer games terminal and also interactive user input data from a controller associated with each of the other of the plurality of computer game terminals. The method further includes rendering a graphical representation of the computer game based on the interactive user input data. Then, with at least one of the plurality of computer game terminals, non-interactive user input data is received from a controller associated with a further computer games terminal associated with a non-interactive user. The method continues with rendering the graphical representation of the computer game based on the interactive user input data and, selectively, the non-interactive user input data.
US09364748B2	System and method for detecting moment of impact and/or strength of a swing based on accelerometer data An example system and method is provided for detecting a moment of impact and/or strength of a swing based on moving a hand-held device including an accelerometer arrangement. A moment and a magnitude of simulated striking of the object are determined based on one or more accelerometer arrangement outputs resulting from the moving of the hand-held device. Using one or more of aural, visual and tactile outputs, the striking of the object is simulated in accordance with the determined moment of simulated striking and the determined magnitude of the simulated striking.
US09364747B2	3D sports playbook This document generally describes techniques, methods, systems, and computer program products for providing a three-dimensional (“3D”) sports playbook. Such a playbook may permit someone like a football, basketball, or soccer coach to see a play executed in a classic X's and O's overhead two-dimensional (“2D”) view, and also in a 3D view.
US09364742B2	Storage medium, game apparatus, game controlling method and game system A game apparatus includes a CPU, and the CPU sets a weapon to be transmittable according to an instruction by a player. More specifically, a seed is generated from a weapon, and transmittable seed data corresponding to the generated seed is stored in a memory for saved data. When a game apparatus is carried in a sleep state by a player, it makes a communication with another game apparatus to thereby transmit and receive the transmittable seed data with the other game apparatus. Accordingly, the transmittable and receivable seed data, that is, the seeds are exchanged. During the game, the received two seeds are fused to thereby generate a weapon.
US09364741B2	Toy projectile launching system A toy projectile launching system including at least one toy projectile, and at least one toy launcher, each including a receptacle into which a projectile is loaded, a launching mechanism for physically launching a projectile after it is loaded into the receptacle, a target area sensitive to being hit by a projectile, and a display for presenting a message when a projectile, launched by another launcher, hits the target area.
US09364739B2	Adjustable fastening system for sliding boards and board equipped with such a system The present invention relates to a fastening system for a sliding board comprising, respectively, a base delimiting a housing in which a shoe is designed to be immobilized, means for adjusting the position of said base on the board, and a vertical locking pivot cooperating on the one hand with an anchoring element secured to the board, and on the other hand bearing rotational blocking elements supported by a calibrating disc, characterized in that said pivot is made up of an assembly secured to the base comprising a central slug whereof the lower end is designed to be retractably housed in said anchor element and the upper end is connected to at least one rotating maneuvering member ensuring the rotation of said lower end in the anchor element.The invention also relates to a sliding board equipped with said fastening system.
US09364738B2	Recreational board riser A riser for mounting to a rider-support surface of a recreational board and having a binding connected thereto comprises a first plate and a second plate selectively connectable to the first plate along a length of the first plate so as to define a connection location. A plurality of separate and interchangeable dampening members is connectable to each of the first plate and second plate. The plurality of dampening members is spaced along a portion of each first and second plate which is opposite the connection location of the first and second plates. The plurality of dampening members includes a first dampening member and a second dampening member, each having a differing hardness.
US09364730B2	Methods and apparatuses for enhancing performance in racket sports A racket assembly may include a racket, and at least one sensor operatively coupled to the racket. The at least one sensor may be configured to generate a signal indicative of at least one parameter related to use of the racket. The racket assembly may also include a processor configured to receive the signal as an input and generate an output based on the signal.
US09364729B2	Golf club head with adjustable center of gravity A golf club head comprising a channel and an expandable weight that can be removably fixed at any point within the channel is disclosed herein. The weight comprises at least an upper portion, a lower portion, and a bolt, and preferably is formed of a metal material co-molded with a polymeric material such as rubber. The channel has an opening with a width that is less than the width of both an inner part of the channel and the weight, such that the weight cannot fall out of the channel during use. The channel may also have an end that opens into a port, which can be filled with a plug or weight screw to prevent the weight from falling out of the channel, and also can be removed so that the weight can be removed and replaced with another expandable weight.
US09364728B1	Golf club head with adjustable center of gravity A golf club head comprising a slidable weight for adjusting the location of the golf club head center of gravity, as well as the golf club head bias, is disclosed herein. In particular, the golf club head, which may be a wood or iron-type head, comprises a pair of rails extending along at least one surface, such as a rear surface of an iron type head or a channel disposed in a wood-type head, and a slidable weight comprising a pair of grooves sized to receive the rails. In some embodiments, an applique or one or more clips are applied over or to the rails to prevent the weight from disengaging from the golf club head.
US09364723B2	Interchangeable shaft system A golf club incorporating an interchangeable shaft system includes a shaft, a shaft sleeve, a club head. The shaft sleeve is coupled to an end of the shaft and is received in a hosel included in the club head. The shaft sleeve is removably coupled to the club head. Hosel and shaft sleeve alignment features provide discrete orientations between the shaft and club head.
US09364719B2	Golf balls having dual cores made of polybutadiene rubber/ionomer blends A multi-piece golf ball comprising at least one component made of a polybutadiene rubber/ionomer resin blend is provided. The ball preferably contains a dual-core comprising an inner core and surrounding outer core layer. Preferably, the polybutadiene rubber/ionomer resin blend is used to form the outer core layer. The center hardness of the inner core is preferably greater than the outer surface hardness of the outer cover layer. The resulting ball has high resiliency and good impact durability.
US09364718B1	Goggles with retroscopic lens angle for enhanced forward vision Swimming goggles are provided with a retroscopic lens angle and broad peripheral viewing angles to enhance a swimmer's forward-to-cranial-looking vision and peripheral vision both above and below the waterline during swimming activity.
US09364716B2	Portable multipurpose fitness device An exercise board with interchangeable center and lateral exercise accessories. The center modules include several different types of devices, each designed to be used for different exercises. The center modules can include a bounce ball, a base that makes the deck unstable, for core workout, and a flat unit that is flush with the deck. The side accessories can include handgrips, skateboard trucks, foot straps, or flat units.
US09364713B2	Device and method to configure gym exercises Described herein is a gym exercise controller device that configures workout routines. The controller allows the user to create a daily workout regimen and also incorporates a workout skip calculation. The controller tracks the performance of a user on the respective exercises apparatuses and provides the user an option to change his/her workout routine based on a performance parameter of the user as well as a comparison of the user's performance parameter to the performance parameter of a group of users.
US09364712B2	Torque detecting assembly A torque detecting assembly connected to a torque acting assembly and a controller, the torque detecting assembly has a passive rotating member and a rotating angle detecting member. The passive rotating member is mounted on a pivot shaft of a torque bracket of the torque acting assembly and is capable of rotating synchronously with the pivot shaft and the torque bracket in an angular extent. The rotating angle detecting member is mounted on the torque acting assembly and is capable of detecting a signal according to rotating angle variation of the passive rotating member to calculate out a torque value. The torque detecting assembly may detect slight rotation of the passive rotating member and calculate out a corresponding torque value.
US09364711B1	Muscle actuation apparatus and method A muscle exercising apparatus including an elongated housing having two interrelated longitudinally elongated parts movable relatively away from one another to push laterally against body muscle, and a spring and slider combination operatively connected with the housing and relatively movable to control spread positioning of two housing parts, as the slider is displaced lengthwise of the housing parts.
US09364703B1	Multi-grip exercise weight apparatus A multi-grip exercise weight apparatus includes a weight plate pivotally attached to a bar handle such that the weight plate is pivotable in both angular directions. A grip ring is disposed around the perimeter of the weight plate. A plurality of support spokes extend from a central hub on the weight plate radially outwardly to the grip ring. A plurality of different grip regions are defined on the grip ring between adjacent support spokes. An end handle may be attached to the weight plate to provide a looped kettlebell-type grip.
US09364700B2	Waist twisting station A waist twisting station includes a base, a rotating unit for waist twisting, and at least one spring to generate resistance force. The rotating unit has a hoop linked with a spring, which can be pushed away by user's body movement. The inside layer of the hoop has a row of massage balls so that the body movement can exercise the waist and lags as well as receive body massage at the same time to accelerate calorie burning. In addition to the waist twisting hoop, a handle bar with or without spring connected to the base can give user a unique whole body exercise experience.
US09364695B2	Trolley comprising a fall arrest actuator The trolley is used in a fall arrest system and comprises a frame, a channel formed within the frame for engagement therein of a lifeline, and a self-blocking mechanism carried by the frame. The self-blocking mechanism comprises a brake movable between a braking position wherein the brake extends within the channel for frictionally engaging the lifeline; and an enabling position wherein the brake clears the channel for clearing the lifeline. The self-blocking mechanism also comprises a manually operable enabling actuator connected to the brake and capable of forcing the brake towards the enabling position. The self-blocking actuator further comprises a fall arrest actuator distinct from the brake and from the enabling actuator, and connected to the brake, the fall arrest actuator being movable with respect to the frame in a direction transversal to the channel between a fall position wherein the fall arrest actuator forces the brake towards the braking position and an idle position wherein the fall arrest actuator does not force the brake towards the braking position, with the fall arrest actuator capable of overriding the enabling actuator to force the brake towards the braking position.
US09364693B2	Glass breaking tool A glass breaking tool for breaking glass mounted in a window, may include an attachment plate for attaching the glass breaking tool to an interior wall adjacent to the glass and a sliding shaft cooperating with the attachment plate to rotate and extend and retract with respect to the attachment plate in order to break the glass. The sliding shaft may include a cutting edge to break the glass.
US09364688B2	Method and apparatus for monitoring the range of a particle beam The invention is related to a method for monitoring a range of a particle beam in a target. The method is using gamma detectors for detecting prompt gammas produced in the target. The time differences between the time of detecting a gamma quantum and a time of emission of a particle or a bunch of particles from the radiation device are determined. A statistical distribution of those time difference is used to deduce information related to the range of the beam. The invention is also related to an apparatus for monitoring a range based on measured time profiles of detected prompt gammas.
US09364684B2	Aesthetic treatment device and method An aesthetic treatment device including: a multi illumination system having at least one source in the visible region, disposed around a periphery of a predetermined area of skin; an imaging device, sensitive to the illumination system, to discern features on or in the skin within the predetermined area of skin to be treated; multiple treatment light sources mounted on an optical bench and aimed and focused to a point of treatment in the predetermined area of skin; a mechanical guidance system to guide the multiple treatment light sources; and a pulse generator to control power output of the multiple treatment light sources based upon the treatment to be applied to the predetermined area of skin.
US09364682B2	Emergency monitor-defibrillator with telemedicine capability In embodiments, an emergency external defibrillator system is configured for use by a local rescuer in cooperation with a remote rescuer to assist a patient. The external defibrillator system includes a sensor to generate a patient value that represents a physiological parameter of the patient. The system also includes a communication module to transmit the patient value to another device of a remote rescuer, and to receive in response an incoming message that contains an encoded sound. For the local rescuer, the system also includes a screen to display the patient value, and a speaker to play the sound concurrently with the screen displaying the patient value. An advantage is that the local rescuer can receive guidance from the remote rescuer.
US09364679B2	System for providing therapy to a patient Systems and methods are described for adjusting the operation of implantable stimulation devices used to provide medical monitoring and treatment. Several hierarchical algorithms are described which operate according to conditionally obtaining a patient response to an alert signal. In one such strategy semi-automatic therapy adjustment occurs by automatically issuing patient alert messages when selected operations are to occur, and using a patient's response to the alert message that is provided within a selected time limit in order to contingently adjust therapy. Methods are also described for resolving conflicts which may occur when time information and sensed data information each indicate different patient states are occurring. Although treatment of neural and cardiac disorders is emphasized, the techniques can be applied to the monitoring and treatment of any medical disorder with an implanted device.
US09364676B2	Biventricular cardiac stimulator A biventricular cardiac stimulator has a right-ventricular sensing unit, having or connected to a terminal for a right-ventricular sensing electrode, a left-ventricular sensing unit, having or connected to a terminal for a left-ventricular sensing electrode, and a pacemaker timer, which is connected to the right-ventricular sensing unit and the left-ventricular sensing unit. The cardiac stimulator has a programmable automatic switch, which is effectively connected to the pacemaker timer to switch the pacemaker timer optionally between a primarily right-ventricular control and a primarily left-ventricular control, as well as an evaluation unit, which is effectively connected to the switch and is designed to detect and evaluate at least one stability parameter that is characteristic of the stability of the electrode position of the left-ventricular sensing electrode, whereby the programmable automatic switch is designed to automatically switch the pacemaker timer control as a function of a value of the detected stability parameter.
US09364674B2	Pulse generator for cranial nerve stimulation A system for trigeminal nerve stimulation includes a storage medium, a pulse generator in communication with the storage medium, a power source coupled to the pulse generator, and at least one electrode communicatively coupled to the pulse generator. The pulse generator includes a microcontroller which executes instructions from the storage medium and the microcontroller is configured to perform at least one of the following operations: produce electrical pulses having defined characteristics, record a log of use and anomalous events, restrict use to a specified individual, interface with electrodes, provide a signal to the specified individual indicating operational conditions and trouble conditions, and provide a signal to the specified individual indicating an end of a treatment period.
US09364670B2	Selection of spinal cord stimulation electrodes for use in cardiac therapy Methods, systems, and/or devices for selecting spinal cord stimulation (SCS) electrode array configurations to provide effective cardiac therapy. Physiological parameters related to the heart may be monitored and analyzed during the delivery of SCS using various SCS electrode array configurations to determine an effect SCS electrode array configuration.
US09364668B2	Apparatus, systems, and methods for treating body organ aging One aspect of the present disclosure relates to a method for treating body organ aging in a mammal. One step of the method includes identifying at least one target organ in need of a therapy signal. Next, a therapy delivery device is placed into electrical communication with an autonomic nervous system (ANS) nerve target and/or a central nervous system (CNS) nerve target associated with the at least one target organ. The therapy delivery device is then activated to deliver the therapy signal to the ANS nerve target and/or the CNS nerve target in an amount and for a time sufficient to effect a change in sympathetic and/or parasympathetic activity associated with the at least one target organ.
US09364662B2	Implantable lead having a lumen with a wear-resistant liner An implantable lead includes a lead body having a proximal end portion and a distal end portion. The lead body includes an insulative member having a lumen extending longitudinally between the proximal end portion and the distal end portion. The lead body also includes a generally tubular liner disposed coaxially with the lumen within the insulative member. The implantable lead also includes an electrode disposed along the lead body in the distal end portion thereof, and a conductor disposed within the lumen and electrically coupled to the electrode. A terminal connector is coupled to the proximal end portion of the lead body and to the conductor.
US09364661B2	Adjustable nerve electrode Example adjustable electrodes are described. One example adjustable electrode includes two or more contacts configured to selectively deliver high frequency alternating current (HFAC) to a nerve in an amount sufficient to produce an HFAC nerve conduction block in the nerve. The example adjustable electrode may also include a logic configured to selectively control which of the two or more contacts deliver HFAC to the nerve to control whether the nerve electrode is in a first (e.g., onset response mitigating) configuration or in a second (e.g., HFAC nerve conduction block maintenance) configuration. The electrode may be used in applications including, but not limited to, nerve block applications, and nerve stimulation applications. The electrode may be adjusted by changing attributes including, but not limited to, the number, length, orientation, distance between, surface area, and distance from a nerve of contacts to be used to deliver the HFAC.
US09364657B2	Cuff unit for a functional electrical stimulation system Various embodiments are described herein for a cuff unit that may be used with a Functional Electrical Stimulation (FES) orthotic system. One example embodiment includes a flexible housing that is releasably mountable on a user including a frame and a plurality of panels entirely contained within the frame. A battery module having one or more batteries is contained within a one or more of the panels. A stimulation module is coupled to the battery module and contained in one or more of the panels is operable to generate stimulation signals to be applied to the user. At least two contact members that are coupled to the frame and in electrical communication with the stimulation module are operable to apply the stimulation signals to the user.
US09364653B2	Aseptic coupling devices An aseptic coupling arrangement includes a first coupling device and a second aseptic coupling device. In one example, the first and second coupling devices are substantially similar, each having a main body having a front face and a fluid passageway therethrough. A first connecting feature on the main body of each coupling device may be provided for aligning and coupling the aseptic devices together. Each coupling device may also include a sealing member received in the main body and a membrane removably coupled to the main body front face to cover the sealing member. The first aseptic coupling device may also include a rotatable protective cover that is removably attached to the main body and connected to the membrane. In one example, the removal of the protective covers away from two coupled main bodies, in a direction parallel to the front faces, causes removal of the membranes.
US09364651B2	Adapter with special fitting A clam shell shaped adapter for connecting a fluid output device and a fluid input device to establish a fluid path between the fluid output and input devices has first and second shells integrally connected by a living hinge. The first shell has a connector fitting end and a catheter end connected by a tubing. The fluid output device may be a catheter that is matable to the catheter end. A retainer structure in the adapter fixedly retains the catheter when the first and second shells close upon each other. Respective latch mechanisms provided at the first and second shells lockingly couple the first and second shells to each other. The fitting end has a given configuration that prevents the fitting end from mating with a counterpart conventional luer fitting but enables the fitting end to mate with a counterpart connector fitting that has a special configuration that mirrors the given configuration.
US09364650B2	Method for removing pigments from a pigmented section of skin The present invention relates to a method for removing pigments from a pigmented section of a skin by puncturing the skin at the pigmented section, with a skin puncturing device which is provided with at least one needle, and then bandaging the punctured section with a suitable adsorbing pad. The pad contains one or more materials, such as saline, which will cause the pigments at the punctured section to migrate into the outer layer of the skin.
US09364647B1	Shunt catheter system A shunt catheter system and method of use thereof. The system generally includes an open-ended ventricular catheter with drainage apertures and safety flap valves, a reservoir with inline filter, and a peritoneal catheter. After insertion, for example into the ventricles of the brain, cerebrospinal fluid would pass into the ventricular catheter, through the inline filter in the reservoir, and into the peritoneal catheter, subsequently exiting the shunt catheter system. During insertion of the ventricular catheter, a catheter stylet or wire/string and plug stylet can be positioned therein to occlude the open end. The ventricular catheter may be positioned perpendicular to the peritoneal catheter and can be coupled to one another through the reservoir and inline filter or valve.
US09364646B2	Tool for adjusting an implantable adjustable fluid flow control valve Tools for determining and adjusting the setting of an adjustable valve are disclosed. These tools allow a medical professional to locate and non-invasively determine the setting of an implanted valve. After the valve has been located and the setting of the valve determined, the valve may be re-adjusted non-invasively. There are three tools: a locator tool, an indicator tool and an adjustment tool. The locator tool allows the physician to locate the adjustable valve of interest and align the locator tool with a specific orientation of the valve. The indicator tool indicates the current setting of the adjustable valve and confirms new settings of the valve after the new settings have been implemented. The adjustment tool interacts magnetically with the implanted adjustable valve to couple with a movable internal element to change the setting of the valve. The indicator tool and the adjustment tool physically cooperate with the locator tool to accomplish the respective functions of the tools.
US09364645B2	Balloon catheter A balloon catheter includes a proximal shaft, a distal shaft, an intermediate shaft positioned between the proximal shaft and the distal shaft, lumens that penetrate through the proximal shaft, the intermediate shaft, and the distal shaft and introduce and discharge a dilation fluid for a balloon, an inner tube shaft having a guide wire opening arranged at a boundary between the intermediate shaft and the distal shaft and through which the lumen extends, and a reinforcement member arranged in the lumen so as to suppress an occurrence of a kink. The reinforcement member has a tapered proximal portion fixed to the proximal shaft and arranged inside the lumen positioned in the intermediate shaft, a tapered distal portion arranged inside the lumen positioned in the distal shaft, and a straight transition portion positioned between the proximal portion and the distal portion. The transition portion is aligned with the guide wire opening.
US09364643B2	Operating a vessel occlusion catheter Some systems and methods for operating a vessel occlusion catheter may include a control and inflation device to control the filling of the balloon in such a manner that the vessel wall will not be overstressed while the safe occlusion of the blood vessel is achieved.
US09364639B2	Moveable cuff Embodiments of the disclosed positioning systems can include a catheter assembly having a catheter with an external surface and an outer diameter, and a movable cuff assembly engaged around the circumference of the catheter. An exemplary movable cuff assembly includes a sleeve, a tissue ingrowth cuff affixed to the sleeve, and a clamp affixed to the sleeve, where when the first clamp is engaged, the movable cuff assembly is substantially fixed in position on the external surface of the catheter and wherein when the first clamp is disengaged, the movable cuff assembly is slidably movable over the external surface of the catheter.
US09364635B2	Computer controlled steerable tip guide catheter A catheter system is provided. The system includes a catheter having an elongated flexible body and one or more electroactive polymer actuators disposed along the elongated flexible body. The electroactive polymer actuators are adapted to cause a change in configuration of the elongated flexible body. The system also includes a controller adapted to transmit the control signal to the electroactive polymer actuators. The controller includes a memory storing a plurality of control signals corresponding to a plurality of predetermined configurations of the catheter and a user-interface coupled to the memory. The user-interface is configured to select one or more configurations from the plurality of predetermined configurations in response to user input.
US09364631B2	Intubating forceps and associated method Forceps having arms pivotally connected for relative movement between an opened position and a closed position include a tube guide formed by arcuate guide portions on each arm. The tube guide includes an inwardly facing arcuate inside wall surface sized for slidable engagement with a tube. The tube guide is fixed at a right angle to the arms and includes a gap formed between tip ends of each of the arcuate guide portions when the arms are in the closed position. Each arm includes a bend fixed at distal ends, wherein the bend is positioned at a distance from the tube guide to form a distal arm portion for each arm permitting an improved view during use of the forceps.
US09364630B2	Tracheostomy valves and related methods The embodiments of the present tracheostomy valves include a flexible diaphragm abutting a rib shaped substantially as a flat plate. Opposite the rib, the diaphragm abuts a boss and forms an uninterrupted seal therewith. As the tracheostomized patient inhales, the diaphragm bends about the rib, interrupting the seal and allowing air to flow smoothly into the valve. The features of the various embodiments contribute to a positive seal at all times except during inhalation, and low resistance to airflow through the valve during inhalation.
US09364628B2	Curvature-adjustable endotracheal tube Provided is a curvature-adjustable endotracheal tube. The curvature-adjustable endotracheal tube includes: a hollow cylindrical tube body configured to maintain a patient's airway; and a curvature-adjusting wire configured to allow an operator to freely adjust the curvature of the tube body to correspond to the curvature of the patient's airway into which the tube body is inserted. Both ends of the curvature-adjusting wire are respectively fixed to a distal portion and a proximal portion of the tube body such that the distal portion is pulled and bent when the proximal portion is bent by the operator.
US09364623B2	Method and device for administering oxygen to a patient and monitoring the patient A method for administering a gas containing oxygen to a patient. The method includes: measuring an oxygen-dependent physiological parameter in the patient; determining an optimal gas delivery parameter based on the oxygen-dependent physiological parameter; and administering the gas to the patient in accordance with the optimal gas delivery parameter. In some embodiment of the invention, the method also includes monitoring the oxygen-dependent physiological parameter.
US09364617B2	Medicament delivery device and actuation mechanism for a drug delivery device Described is an actuation mechanism for a medicament delivery device having a needle with a distal tip. The actuation mechanism comprises an outer sleeve telescopically relative to the delivery device and an inner sleeve telescopically arranged relative to the outer sleeve. The outer sleeve is axially translatable relative to the delivery device, and the inner sleeve is axially translatable relative to the outer sleeve. In a first state, the inner sleeve protrudes distally from the outer sleeve and the outer sleeve protrudes distally from the delivery device. In a second state, the inner sleeve is contained within the outer sleeve. Movement of the outer sleeve proximally relative to the delivery device in the second state initiates delivery of a medicament in the delivery device.
US09364613B2	Mounting arrangement and coupling assembly for a drug-delivery device A mounting arrangement for a drug-delivery device is proposed, the mounting arrangement comprising: a plug element with a longitudinal axis (L) and a housing part having a recess with a side wall which is adapted to receive the plug element. At least one of the plug element or the side wall of the recess are provided with a protrusion for fixing the plug element in a given position relative to the housing part by a force-fit engagement. Furthermore, a coupling assembly is proposed, the coupling assembly comprising the plug element and the housing part being mechanically coupled to each other.
US09364611B2	Needle assisted jet injection device having reduced trigger force An exemplary embodiment of an injector includes a trigger mechanism, an energy source, and a user-operable firing-initiation member. The trigger mechanism can include a floating trigger member having a retaining portion, a ram assembly having a ram configured to pressurize a medicament container for expelling a medicament therefrom, the ram assembly further having a floating trigger engagement member configured to engage the retaining portion of the floating trigger member when the floating trigger member is in a pre-firing condition. The energy source can be associated with the ram for powering the ram to expel the medicament, and the user-operable firing-initiation member can be operable for causing an axial rotation of the floating trigger member from the pre-firing condition to a firing condition in which the floating trigger engagement member is released from the retaining portion to allow the energy source to fire the ram.
US09364610B2	Injection device with cammed ram assembly An exemplary embodiment of injector includes a trigger mechanism, an energy source, and a user-operable firing-initiation member. The trigger member can include a trigger member having a retainer portion, and a ram assembly having a ram configured to pressurize a medicament container for expelling a medicament therefrom and a trigger engagement member configured to engage the retainer portion of the trigger member in a pre-firing condition. The energy source can be associated with the ram for powering the ram to expel the medicament, and the user-operable firing-initiation member can be operable for causing an axial rotation between the trigger engagement member and the retainer portion from the pre-firing condition to a firing condition in which the trigger engagement member is released from the retainer portion to allow the energy source to fire the ram.
US09364608B2	Method and apparatus for detecting occlusions in an ambulatory infusion pump An improved pump, reservoir and reservoir piston are provided for controlled delivery of fluids. A motor is operably coupled to a drive member, such as a drive screw, which is adapted to advance a plunger slide in response to operation of the motor. The plunger slide is removably coupled to the piston. A method, system, and an article of manufacture for automatically detecting an occlusion in a medication infusion pump is provided. The electrical current to an infusion pump is measured. Based on a series of measurements of one or more variables, the infusion pump detects whether there is an occlusion in the system.
US09364605B2	Hand piece assembly for a disposable flushing nozzle unit for cleansing and/or irrigating surgical wounds The invention relates to a hand piece for a disposable flushing nozzle unit for cleansing and/or irrigating surgical wounds, comprising a housing with one first connecting unit for holding the disposable flushing nozzle unit, a drive mechanism and an electric motor interacting with said drive mechanism. In an especially advantageous embodiment the hand piece comprises a second connecting unit for connecting an external electric power supply.
US09364602B2	Systems and methods for priming sorbent-based hemodialysis using dialysis fluid A method for priming a hemodialysis treatment includes: providing a sorbent cartridge for cleaning spent dialysate fluid returning from a dialyzer; preparing a batch of dialysate in a quantity commensurate with being recycled through the sorbent cartridge multiple times; priming a dialysate circuit in fluid communication with the dialyzer using the batch of dialysate; and priming a blood circuit in fluid communication with the dialyzer using the batch of dialysate.
US09364601B2	Extracorporeal removal of microvesicular particles The invention described herein teaches methods of removing microvesicular particles, which include but are not limited to exosomes, from the systemic circulation of a subject in need thereof with the goal of reversing antigen-specific and antigen-nonspecific immune suppression. Said microvesicular particles could be generated by host cells that have been reprogrammed by neoplastic tissue, or the neoplastic tissue itself. Compositions of matter, medical devices, and novel utilities of existing medical devices are disclosed.
US09364599B2	Portable hemodialysis machine and disposable cartridge A portable hemodialysis system is provided including a disposable cartridge and a reused dialysis machine. The disposable cartridge includes a dialyzer, and a dialysate flow path and a blood flow path which flow in opposing directions through the dialyzer. The disposable cartridge includes a filter for removing waste products from the dialysate, and pressure and fluid flow sensors for measuring the pressure and fluid flow in the dialysate flow path and blood flow path. In addition, the disposable cartridge possesses pump actuators (but not pump motors) for pumping dialysate and blood through their respective flow paths. The reused dialysis machine possesses a reservoir for dialysate, a level sensor, a blood leak sensor, an ammonia sensor, a venous blood line pressure sensor, a venous blood line bubble detector, pump motors, and a processor connected to the motors and sensors for controlling and monitoring hemodialysis treatment.
US09364589B2	Method of making a coated wire guide In a method for making a wire guide, a fluoropolymer coating is removed from a distal section of an FP coated core wire to expose a metallic portion. A polymer coating is applied to a proximal section of the FP coated core wire such that the polymer coating overlays at least a portion of the FP coating, and to the distal section of the FP coated core wire including the exposed metal portion. The polymer coating is removed from the FP coating to form the wire guide having a proximal portion with the FP coating and a distal portion with the polymer coating. A hydrophilic coating may be applied to the distal portion over the polymer coating.
US09364588B2	Drug delivery scaffold or stent with a novolimus and lactide based coating such that novolimus has a minimum amount of bonding to the coating Disclosed herein are drug delivery medical devices. A polymer coating for a medical device is provided which comprises a minimum amount of a drug bonded to the polymer in the coating.
US09364586B2	Method and apparatus for improving delivery of an agent to a kidney Methods for more uniformly delivering drugs or other treatment agents locally to the vasculature of a mammal are disclosed. These methods use one or more strategies to facilitate rapid mixing with the blood flowing past a device or otherwise improve the uniformity of drug delivery. Some of these strategies employ medical devices with diffusion members.
US09364584B2	Demineralized cancellous bone scaffolds The present invention provides a cancellous bone scaffold to use in the replacement or repair of connective tissue such as ligaments and tendons. The cancellous bone scaffold has a fully demineralized segment with at least one adjacent mineralized end segment.
US09364583B2	Osteoinductive demineralized bone implant A bone graft delivery device is provided comprising: a porous biodegradable graft body for inducing bone growth at a surgical site, the porous biodegradable graft body having demineralized bone matrix (DBM) fibers disposed within the porous biodegradable body, and DBM powder disposed adjacent to, on or in the DBM fibers, wherein the porous biodegradable graft body facilitates transfer of cells into and out of the porous biodegradable graft body to induce bone growth at the surgical site. Methods of making the device and using the device are also disclosed.
US09364581B2	Medical implant comprising a biodegradable magnesium-based alloy and method for its manufacture A medical implant comprises a biodegradable magnesium-based alloy of which at least a part of its surface layer comprises a magnesium carbonate. A method for the manufacture of a biocompatible, corrosion-inhibiting protective surface layer on a medical implant comprising a magnesium-based alloy, comprises: providing an implant comprising a magnesium-based alloy to be coated; placing the implant into a reactor chamber; exposing at least part of the surface of said implant to an atmosphere comprising humid carbon dioxide to produce a coating on the surface of the implant comprising a magnesium carbonate of the formula x MgCO3.y Mg(OH)2, whereby x+y=1; removing the implant from the reactor chamber; and drying the surface of the implant.
US09364578B2	Hemostatic agent for topical and internal use This invention relates to deployable hemostatic materials comprising chitosan fibers. The hemostatic materials are suitable for use in sealing or controlling active bleeding from artery and vein lacerations and punctures, and for controlling oozing from tissue.
US09364577B2	Hydrophilic polyurethane foam with low volume swelling The invention relates to a specific composition comprising A) isocyanate-functional prepolymers obtainable by reaction of A1) aliphatic diisocyanates with A2) di- to hexa-functional polyalkylene oxides having an ethylene oxide content of 50 to 100 mol %, based on the total amount of the oxyalkylene groups present, B) an aqueous polyurethane suspension, an aqueous polyacrylate suspension or aqueous silica sols, especially for production of hydrophilic, aliphatic polyurethane foams. The invention further provides a process for producing a hydrophilic, aliphatic polyurethane foam, based on the inventive composition, a polyurethane foam obtainable by the process and a wound dressing comprising the polyurethane foam.
US09364576B2	Absorbent article having blood slipping agent on a top sheet thereof An absorbent article includes a liquid-permeable top sheet, a liquid-impermeable back sheet, and an absorbent body arranged between the top sheet and the back sheet. An excretory orifice contact area of the liquid-permeable top sheet has an area containing a blood slipping agent. The blood slipping agent has a kinematic viscosity of 0.01-80 mm2/s at 40° C., a water hold percentage of 0.01-4.0 mass %, and a weight average molecular weight of less than 1,000. An amount of the blood slipping agent on the clothing-side surface of the top sheet is greater than an amount of the blood slipping agent on the skin-side surface of the top sheet at a location in the area containing the blood slipping agent where the surfaces overlap in the thickness direction of the absorbent article.
US09364574B2	Wearable chemical dispenser Wearable devices for dispensing insect repellents, fragrances, and/or other chemicals along the outside of the clothing of a human are disclosed. They are of the type that are clipped onto a belt or the like, and use a powered fan to dispense active. They are configured with fan rotor arrangements to minimize power use while still achieving acceptable air flow rates. These changes permit use of smaller batteries and more compact arrangements for battery positioning. This in turn permits a much more compact and lightweight construction to achieve the desired results. The devices are also provided with a rotatable clip structure to render use of the device more comfortable when the user is seated and to provide greater control over the direction of the dispensing. Further, they are provided with modified lids to facilitate active refill replacement.
US09364573B2	Methods, systems, and devices for high-level disinfection A disinfection device includes a disinfection chamber into which a radiation source emits ultraviolet-C (UV-C) radiation. A radiation sensor detects the amount of UV-C radiation within the disinfection chamber, and a temperature sensor produces temperature values of a temperature within the disinfection chamber. A processing unit generates accumulated UV-C radiation values and verifies that the accumulated UV-C radiation value in the disinfection chamber reaches a first radiation threshold while also verifying that the temperature in the disinfection chamber stays below a first temperature threshold. The UV-C radiation may be emitted into the disinfection chamber over one or more fixed periods of time while the total time for the disinfection process is limited to a primary time interval. The process may terminate successfully if the first radiation threshold is exceeded before the primary time interval expires. The disinfection device provides high level disinfection of contaminated articles in a short time and at a low temperature.
US09364570B2	Functionalisation of cage amine ligands for metallo-radiopharmaceuticals The present invention relates to compounds that are useful as metal ligands and which contain a moiety capable of binding to a biological entity and methods of making these compounds. These compounds are of interest as they can be bound to a biological entity and then coordinated with a suitable metallic radionuclide. The coordinated compounds are useful as radiopharmaceuticals in the areas of radiotherapy and diagnostic imaging.
US09364569B2	Ultrasound contrast agents and process for the preparation thereof Method for preparing a lyophilized matrix and, upon reconstitution of the same, a respective injectable contrast agent comprising a liquid aqueous suspension of gas-filled microbubbles stabilized predominantly by a phospholipid. The method comprises preparing an emulsion from an aqueous medium, a phospholipid and a water immiscible organic solvent. The emulsion is then freeze-dried and subsequently reconstituted in an aqueous suspension of gas-filled microbubbles. The method allows to obtain suspensions comprising microbubbles having a relatively small diameter and a narrow size distribution.
US09364566B2	Aqueous formulation for selective targeting and delivering gene to cancer cells The present invention relates to a cationic lipid based aqueous formulation comprising cationic lipid, dexamethasone and a neutral co-lipid, wherein the said formulation is useful for selective targeting and delivering gene to glucocorticoid receptor expressing cancer cells. Glucorticoid receptors (GR) express in various normal and cancer cells. A lot of ligand activated physiological functions are known involving GR but its role in cancer progression (if any) is not clearly understood. Synthetic GR antagonist, dexamethasone (Dex) finds use as anti-inflammatory drug and is known to induce apoptosis in cancer cells. This Dex is included in a cationic lipid-based formulation as a co-lipid to deliver to and express genes specifically in cancer cells possibly through expressed GR. Gene delivery to cancer cells is independent of the gene construct, and tumor cell line. Normal transformed cells expressing GR but with no cancer lineage show much smaller level of transfection. The composition of the formulation is optimized. The formulation may have particular application to the enhanced delivery of anticancer genetic constructs to cancer, with the synergistic effect of Dex in inducing apoptosis as such.
US09364565B2	Medical device with coating for capturing genetically-altered cells and methods of using same Therapeutic and drug delivery systems are provided in the form of medical devices with coatings for capturing and immobilizing target cells such as circulating progenitor or genetically-altered mammalian cells in vivo. The genetically-altered cells are transfected with genetic material for expressing a marker gene and at least one therapeutic gene in a constitutively or controlled manner. The marker gene is a cell membrane antigen not found in circulating cells in the blood stream and therapeutic gene encodes a peptide for the treatment of disease, such as, vascular disease and cancer. The coating on the medical device may be a biocompatible matrix comprising at least one type of ligand, such as antibodies, antibody fragments, other peptides and small molecules, which recognize and bind the target cells. The therapeutic and/or drug delivery systems may be provided with a signal source such as activator molecules for stimulating the modified cells to express and secrete the desired marker and therapeutic gene products.
US09364563B2	Methods and compositions for liposomal formulation of antigens and uses thereof The present invention relates to liposomal vaccine compositions, methods for the manufacture thereof, and methods for the use thereof to stimulate an immune response in an animal. These compositions comprise dimyristoylphosphatidylcholine (“DMPC”); either dimyristoylphosphatidylglycerol (“DMPG”) or dimyristoyltrimethylammonium propane (“DMTAP”) or both DMPC and DMTAP; and at least one sterol derivative providing a covalent anchor for one or more immunogenic polypeptide(s) or carbohydrate(s).
US09364557B2	Fold-back diabody diphtheria toxin immunotoxin and methods of use Provided are methods and compositions related to diphtheria toxin diabody immunotoxins.
US09364555B2	Pederin and psymberin agents Compounds that include a pederin, psymberin or pederin/psymberin chimera scaffold. The pederin scaffold includes a substituent at the C10 and/or C13 position that may include a linker that may be conjugated to a targeting moiety. The psymberin scaffold includes a substituent at the C8 and/or C11 positions that may include a linker that may be conjugated to a targeting moiety. The pederin/psymberin chimera scaffold includes a substituent at the C10 and/or C13 position that may include a linker that may be conjugated to a targeting moiety. The pederin, psymberin or pederin/psymberin chimera scaffold may be modified to include substituents at positions other than the C10 or C13 of pederin, or the C8 and C11 of psymberin.
US09364549B2	Hydrophobic drug-delivery material, method for manufacturing thereof and methods for delivery of a drug-delivery composition A method for manufacturing a drug-delivery composition includes providing at least a pharmaceutically active composition, providing a hydrophobic matrix; and mixing the hydrophobic matrix and the pharmaceutically active composition to form a paste-like or semi-solid drug-delivery composition.
US09364547B2	17-hydroxyprogesterone ester containing oral compositions and related methods The present invention provides for bioavailable oral dosage forms containing esters of 17-hydroxyprogesterone as well as related methods. The oral dosage forms can be formulated for pregnancy support and can include a therapeutically effective amount of an ester of 17-hydroxyprogesterone and a pharmaceutically acceptable carrier. In another embodiment, a pharmaceutically acceptable oral dosage form for pregnancy support is provided. The pharmaceutically acceptable oral dosage can include a therapeutically effective amount of an ester of 17-hydroxyprogesterone and a pharmaceutically acceptable carrier. The oral dosage form can, when measured using a USP Type-II dissolution apparatus in 900 mL of deionized water with 0.5 (w/v) of sodium lauryl sulfate at 50 RPM at 37° C., release at least 20 wt % of the dose of the ester of 17-hydroxyprogesterone after 60 minutes, or in the alternative release at least 20 wt % more after 60 minutes than an equivalently dosed oral dosage form without the carrier.
US09364543B2	Visible light curable hydrogels and methods for using This disclosure provides compositions comprising a visible light-curable mixture capable of forming a biocompatible hydrogel, hydrogels prepared from the hydrogel precursor mixtures, and a biocompatible delivery system comprising a hydrogel. The disclosure also provides a process for preparing a multi layer hydrogel delivery system.
US09364539B2	Pharmaceutical compositions and methods to vaccinate against candidiasis A Candida albicans bloodstream infections cause significant morbidity and mortality in hospitalized patients. Filament formation and adherence to host cells are critical virulence factors of C. albicans. Multiple filamentation regulatory pathways have been discovered, however the downstream effectors of these regulatory pathways remain unknown. The cell surface proteins in the ALS group are downstream effectors of the filamentation regulatory pathway. Particularly, Als1p mediates adherence to endothelial cells in vitro and is required for virulence. The blocking of adherence by the organism is described resulting from the use of a composition and method disclosed herein. Specifically, a pharmaceutical composition comprised of a gene, gene product, or specific antibody to the ALS gene family is administered as a vaccine to generate an immune response capable of blocking adherence of the organism.
US09364533B2	Polyanionic polymer adjuvants for Haemophilus influenzae B saccharide vaccines The present invention relates to methods of reducing flocculation in an immunogenic composition, where said immunogenic composition comprises (a) Haemophilus influenzae B capsular polysaccharide or oligosaccharide (PRP) and (b) at least one non-PRP antigen. The invention further relates to kits comprising (i) a first composition comprising a Haemophilus influenzae B capsular polysaccharide or oligosaccharide (PRP) and a polyanionic polymer, and (ii) a second composition comprising a non-PRP antigen adsorbed onto an adjuvant with a zero point charge greater than 8.
US09364526B2	Diagnostic, therapeutic and a vaccine against treponemes The development of a diagnostic, therapeutic and making and administering a vaccine against ungulate diseases which involves spirochete bacteria in particular, Treponemes.
US09364525B2	Vaccines for malaria The present invention relates to a novel lipoprotein particle, methods for preparing and purifying the same, its use in medicine, particularly in the prevention of malarial infections, compositions/vaccines containing the particle or antibodies against the protein particle such as monoclonal or polyclonal antibodies and use of the same, particularly in therapy. In particular it relates to an immunogenic protein particle comprising the following monomers: a. a fusion protein comprising sequences derived from a CS protein of P. vivax and the S antigen of Hepatitis B (CSV-S), and b. a fusion protein comprising sequences derived from CS protein of P. falciparum and S antigen of Hepatitis B (RTS), and c. optionally the S antigen derived from Hepatitis B.
US09364524B2	Pharmaceutical composition using gonadotropin-releasing hormone (GNRH) combined variants as immunogen A pharmaceutical composition using natural gonadotropin—releasing hormone (GnRH), and/or some of its mimetic peptides, indistinctly bound by its amino or carboxyl extremes to a carrier molecule; in one case by its carboxyl extreme and in the other case by the amino terminal extreme, thus eliciting a faster and more potent immunological response against the endogenous GnRH hormone. This finally leads to the ablation of the GnRH and consequently of the rest of the involved hormones in the stream GnRH/LH-FSH/Testosterone-(estrogens). An advantage of this formulation consists on facilitating the exposition to the immune system of a greater number of epitopes of the GnRH or its mimetics, minimizing thus the steric hindrance produced by the carriers. This invention has a direct application in the castration of pets and animals of economic interest, in the control of human fertility as well as in the treatment of hormone-sensitive tumors, such as that of the prostate, the breast, ovary, the endometry, testicles, hypophysis, salivary glands and other kinds of human tumors.
US09364523B2	Chimeric nucleic acid molecule with non-AUG translation initiation sequences The present disclosure relates to nucleic acid vaccine compositions and methods for preventing or treating pathological conditions, such as cancer or infectious disease. Further, the disclosure provides methods for more efficient production of antigens via mRNA containing one or more non-conventional start codons to promote multiplex initiation of translation in eukaryotic cells.
US09364517B2	Method of treatment of lymphoma with pegylated IL-10 Provided are methods of treatment for tumors. In particular, methods are provided for use of a chemically modified IL-10 to treat tumors.
US09364515B2	Therapeutic process for the treatment of the metabolic syndrome and associated metabolic disorders The present invention is directed to a method of treating a patient suffering from the metabolic syndrome and/or related disorders including obesity, Type 2 diabetes, pre-diabetes, hypertension, dyslipidemia, insulin resistance, endothelial dysfunction, pro-inflammatory state, and pro-coagulative state, and comprising the steps of (a) providing to the patient a dietary regimen that decreases overactive CNS noradrenergic tone; followed by (b) providing to the patient a dietary regimen that increases dopaminergic tone while maintaining the above decreased overactive CNS noradrenergic tone. The present invention is also directed to food products useful in implementing the dietary regimens.
US09364513B2	Compositions and methods for promoting hemostasis and other physiological activities Compositions that include nanoscale structured materials or precursors thereof (e.g., self-assembling peptides) are described. The compositions can include other substances (e.g., a vasoconstrictor). Also described are methods for using the compositions to promote hemostasis, to protect the skin or wounds from contamination, to decontaminate a site upon removal of previously applied compositions that provided a protective coating, and to inhibit the movement of bodily substances other than blood. The compositions are also useful in isolating tissue, removing tissue, preserving tissue (for, e.g., subsequent transplantation or reattachment), and as bulking, stabilizing or hydrating agents. Medical devices that include the compositions (e.g., a stent or catheter), bandages or other wound dressings, sutures, and kits that include the compositions are also described.
US09364511B2	Antiviral preparations obtained from a natural cinnamon extract The present application provides a natural aqueous extract obtainable from a cinnamon bark (Cinnamon sp.) which has antiviral activity against enveloped viruses including influenza A, Parainfluenza (Sendai) virus and HSV-1 viruses, as well as in vivo activity in inhibition of Influenza A and Parainfluenza viruses. The present application also concerns a method for the extraction of said cinnamon extract and applications thereof.
US09364507B2	Probiotic enhancement of steroid and immune suppressor activity in mammals with chronic diseases This invention relates to use of probiotics, particularly P acidilactici and S boulardii, for use in conjunction with steroids and other immune suppressor agents to ameliorate symptoms of autoimmune diseases, especially disease symptoms arising from the body's production of antibodies against autologous blood cells. The practice of the invention sustains ameliorative response associated with immune suppressor agents while lowering the amount of immune suppressor agents required for treatment.
US09364505B2	Therapeutic composition for treatment of glioblastoma The present invention is directed to compositions and methods for treating an animal diagnosed with Glioblastoma multiforme (GBM).
US09364499B2	Use of dextran sulfate A graft composition intended for transplantation into a patient comprises an injection solution comprising an isolated cell transplant and dextran sulfate, or a pharmaceutically acceptable salt thereof.
US09364497B2	Treatment of cognitive disorders The invention relates to treatments of cognitive disorders e.g. Mild Cognitive Disorder comprising the use of agents which are capable of lowering homocysteine levels in a subject, preferably a human subject. Aspects of the invention relate to a method of treating such disorders comprising administering one or more B vitamins e.g. folic acid, Vitamin B6 and/or Vitamin B12 or derivatives thereof.
US09364496B2	Custirsen treatment with reduced toxicity The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg. The present invention also provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of myeloma.
US09364493B2	Methods and compositions for enhancing the uptake of therapeutic agents by target cells The present invention relates to a new use of a known medicament. Specifically, the invention relates to methods and compositions for enhancing the therapeutic efficacy of a therapeutic agent by increasing the uptake of the therapeutic agent by target cells, and in particular relates to a pharmaceutical composition comprising a regulating agent of lipid raft/caveolae-dependent endocytic pathway and some therapeutic agents, such as anti-tumor agents. The invention also relates to a method for screening a regulating agent of lipid raft/caveolae-dependent endocytic pathway capable of enhancing the therapeutic efficacy of anti-tumor agents.
US09364486B2	6-substituted estradiol derivatives for use in remyelination of nerve axons Disclosed is a method of remyelinating axons with 6-substituted estradiol compounds of the formula The methods can be used to treat a variety of demyelinating diseases.
US09364485B2	Topical formulations comprising a steroid The application provides formulations for the topical administration of an active agent comprising at least one steroid, in the form of topical sprays that are propellant-free, and/or substantially non-foaming, and/or alcohol-free. The present application also provides processes for preparing such compositions and methods of using them in management of skin diseases or disorders such as psoriasis, dermatoses, and other associated skin diseases or disorders.
US09364480B2	Pharmaceutical composition for preventing or treating cancer, containing enoblock as active ingredient The present invention relates to ENOblock, which is a non-substrate analog having an enolase inhibitory activity, and a pharmaceutical composition for preventing or treating cancer or enolase-associated diseases, containing the same. The ENOblock of the present invention directly binds to enolase so as to inhibit an activity thereof, and the inhibition is more effective in hypoxia than in normoxia. In addition, the ENOblock of the present invention inhibits migration, metastasis and invasion of cancer cells. Furthermore, the ENOblock of the present invention induces glucose uptake into cells, down-regulates the expression of PEPCK, and inhibits adipogenesis and foam cell formation. Therefore, a composition containing the ENOblock of the present invention can be very effectively applied to prevent or treat cancer or enolase-associated diseases.
US09364474B2	Method for treatment of neurologic dysfunction A method for treatment of the symptoms of neurologic dysfunctions, including major depression, an autism spectrum disorder (ASD), and schizophrenia. The patient is administered an amount of a compound that increases the catalytic activity of MAO-A. The effective compound is preferably reserpine, administered in a dosage of less than about 0.03 mg per day. The reserpine may be administered topically or transdermally at a dosage in the range from about 0.002 mg per day to about 0.02 mg per day. In homeopathic use, the reserpine may be administered in the form of a homeopathic dilution, preferably as a 12 C homeopathic dilution of reserpine.
US09364471B2	Compositions and methods of treating retinal disease Compositions and methods for treating macular degeneration and other forms of retinal disease whose etiology involves the accumulation of A2E and/or lipofuscin, and, more specifically, for preventing the formation and/or accumulation of A2E are disclosed.
US09364470B2	Methods for treating disorders or diseases associated with hyperlipidemia and hypercholesterolemia while minimizing side-effects The present invention provides methods and compositions for treating hyperlipidemia and/or hypercholesterolemia comprising administering to the subject an effective amount of an MTP inhibitor to inhibit hyperlipidemia and/or hypercholesterolemia in said subject, wherein said administration comprises an escalating series of doses of the MTP inhibitor. In some embodiments the method comprises administering at least three step-wise, increasing dosages of the MTP inhibitor to the subject. In some embodiments, the method further comprises the administration of one or more other lipid modifying compounds.
US09364468B2	Pharmaceutical composition for preventing or treating tuberculosis The present invention relates to a pharmaceutical composition for preventing or treating tuberculosis, comprising: (a) a pharmaceutically effective amount of a compound represented by the following chemical formula 1; and (b) a pharmaceutically acceptable carrier. Chemical formula 1 The compound contained as an active ingredient of the present invention inhibits the expression and activity of CO-DH in tubercle bacillus so as to effectively block the detoxification of carbon monoxide, which is an important survival factor of tubercle bacillus, and is safe for the human body since the compound targets CO-DH which does not exist in the human body. In addition, the compound creates a synergistic effect when combined with a conventional tuberculostatic drug, and thus can be more effective for treating tuberculosis.
US09364465B2	Thiazolidinediones of omega-3 polyunsaturated acids as new insulin sensitizers for treating type2 diabetes The present invention relates to thiazolidinedione derivatives of omega-3 fatty acids as insulin sensitizers, and their use in treating Type2 diabetes, obesity, hypertriglyceridemia, cardiovascular diseases, metabolic diseases, inflammation, renal anemia, and/or Alzheimer's disease: and for modulating activity of peroxisome proliferator-activated receptors (PPARs).
US09364464B2	Compositions and methods for treating extracellular parasitic infections There is disclosed herein a composition for treating extracellular parasitic infections, the composition comprising one or more of the following combinations: at least one quinolone or fluoroquinolone together with at least one tetracycline, iodoquinol, an azole or imidazole; or at least two agents selected from the group consisting of iodoquinol, thiazolidones, tetracycline, nitroimidazoles, cotrimoxazole and diloxanide furoate. There is also disclosed herein a method for treating extracellular parasitic infections in a vertebrate in need of said treatment, wherein said treatment comprises administering to said vertebrate a therapeutically effective amount of (i) a composition comprising a quinolone or fluoroquinolone together with a pharmaceutically acceptable carrier or (ii) a composition of the invention or (iii) a combination of at least one quinolone or fluoroquinolone optionally together with at least one tetracycline, iodoquinol, an azole or imidazole; or (iv) a combination of at least two agents selected from the group consisting of iodoquinol, thiazolidones, tetracycline, nitroimidazoles, cotrimoxazole and diloxanide furoate.
US09364463B2	Use of amino acid supplementation for improved muscle recovery The present invention encompasses an amino acid composition for recovery of muscle strength and function.
US09364462B2	Alpha-1-adrenergic receptor agonist therapy Presented herein inter alia are novel methods of treating heart and brain diseases.
US09364461B2	Process for manufacturing ophthalmic oil-in-water emulsions The present invention relates to new processes for the preparation of oil-in-water emulsions useful in ophthalmic applications. In particular, processes are provided that include preparing a pre-concentrate of the oil-in-water emulsion, and diluting the pre-concentrate obtained to form the desired oil-in-water emulsion. The present invention also provides pharmaceutical compositions comprising an oil-in-water emulsion prepared by an inventive process, and methods of using these compositions for the treatment of an eye disease or condition.
US09364456B1	Ketone esters for treatment of angelman syndrome The invention concerns a method of treating Angelman Syndrome (AS) in a subject, comprising inducing ketosis in the subject by administering a therapeutically effective amount of a ketone ester, such as an R,S-1,3-butanediol acetoacetate ester, wherein administration of the ketone ester elevates the blood ketone level in the subject. Other aspects of the invention include a method of increasing cognitive function and/or motor function in a subject with AS; and a method of decreasing seizures and increasing the latency to seize in a subject with AS.
US09364455B2	Combination of a prostaglandin receptor agonist and an MC1R receptor agonist for the treatment and/or prevention of pigmentation disorders A combination of compounds is described for the treatment and/or prevention of skin conditions linked to hypopigmentation. Also described, is a combination product that includes at least one prostaglandin receptor agonist and at least one MC1R receptor agonist, as a medicament for use simultaneously, separately or spread out over time for the treatment and/or prevention of skin conditions linked to hypopigmentation, such as vitiligo.
US09364452B2	Pharmaceutical composition for preventing or treating hepatic fibrosis and cirrhosis containing ramalin There is provided a novel use of ramalin for preventing or treating liver diseases, and more specifically, a pharmaceutical composition for preventing or treating hepatic fibrosis or cirrhosis containing ramalin or a pharmaceutically acceptable salt thereof, and a functional food containing the same. It was confirmed that at the time of applying ramalin, which is a compound derived from Ramalina terebrata according to the present invention, to animal models, ramalin may remarkably suppress hepatic fibrosis and lower liver cirrhosis levels as compared to silymarin known as a liver cell protecting ingredient without cytotoxicity to normal liver cells, such that ramalin may be effectively used for preventing or treating hepatic fibrosis and liver cirrhosis.
US09364450B2	Clenbuterol for use in treatment of autism Clenbuterol or its salt for use in the treatment of autism, in particular pediatric autism. Improved contact with surroundings, better concentration, improved ability to plan a specific task, improved understanding, calming, and reduced psychomotor anxiety were observed.
US09364442B2	Biodegradable phase separated segmented multi block co-polymers and release of biologically active polypeptides The invention is directed to biodegradable, thermoplastic, phase separated segmented multi-block copolymers. The copolymers of the present invention find use in various biomedical applications as well as in pharmaceutical applications. Provided is a composition for the controlled release of at least one biologically active polypeptide to a host, comprising the at least one biologically active polypeptide encapsulated in a matrix comprising at least one phase separated, thermoplastic multi-block copolymer, the copolymer being characterized in that (i) it comprises at least two hydrolysable segments chosen from prepolymer (A) and prepolymer (B), prepolymer (A) having a Tg lower than 37° C. and prepolymer (B) having a Tm of 40° C.-100° C. under physiological conditions; (ii) the segments being linked by a multifunctional chain-extender; (iii) the segments are randomly distributed over the polymer chain; and (iv) prepolymer (A) contains a segment that is derived from a water soluble polymer.
US09364438B2	Process for producing solid particles A method of producing crystal of a poorly water-soluble pharmaceutical compound, including mixing a solution of a poorly water-soluble pharmaceutical compound in a good solvent and nanobubble water or an aqueous nanobubble solution to precipitate crystal of the poorly water-soluble pharmaceutical compound. The crystal of a poorly water-soluble pharmaceutical compound obtained by the method is microparticulate and has more uniform particle size distribution, and is superior in the absorbability and sustainability.
US09364437B2	Diaminooxidase-containing pharmaceutical compositions The present invention relates to pharmaceutical compositions, food supplement compositions and cosmetic compositions comprising diaminooxidase, and to the use thereof.
US09364436B2	High capacity diketopiperazine microparticles and methods Disclosed herein are diketopiperazine microparticles having high capacity for adsorbing a drug or active agent. In particular, the diketopiperazine microparticle are formed using fumaryl diketopiperazine and can comprise a drug in large doses for the treatment of disease or disorders by pulmonary delivery via oral inhalation.
US09364428B2	Herb medicine composition in the form of jelly A Chinese herbal medical composition in the form of jelly, wherein a Chinese herbal medicine is contained in a base containing at least one substance selected from the group consisting of carrageenan, carob bean gum and xanthan gum and not containing phosphate buffer. The Chinese herbal medical composition hardly causes syneresis, is superior in the preservative stability, is broadly applicable to a Chinese herbal medicine and is orally taken without taking care of the bitter of a Chinese herbal medicine.
US09364427B2	Implantable therapy system for treating a living being with an active factor The invention provides a device for Encapsulated Cell Therapy. The device includes an implantable capsule containing cells which secrete a biologically active compound for providing a biological function. The capsule has a semi permeable outer membrane for delivery of the compound e.g. at a site in the central nervous system or the spinal cord, e.g. in the brain of a patient. The capsule is connected to a tether which e.g. facilitates removal of the capsule from the patient. To facilitate insertion of the capsule into the patient, a stiffener may be attached to the tether to make the tether more rigid. The invention further provides a container for storing a cell therapy device and a method of locating the device in the body of a patient.
US09364426B2	Method of making coated microstructures Coated microneedle devices and methods of making such devices are provided. In one aspect, a method for coating includes providing a microstructure having at least one surface in need of coating; and applying a coating liquid, which includes at least one drug, to the at least one surface of the microstructure, wherein the surface energy of the coating liquid is less than the surface energy of the surface of the microstructure. The coating liquid may include a viscosity enhancer and surfactant. Microneedles having heterogeneous coatings, pockets, or both are also provided.
US09364422B2	Styrene maleic anhydride polymers in cosmetics and personal care products The invention relates generally to pigmented compositions that, upon the application of water and pressure, exhibit a visible change in one or more optical attributes such as color.
US09364421B2	Hair cosmetic It is an object of the present invention to provide a hair cosmetic achieving a hair-setting property without causing flaking and further having an excellent hair-rearranging property and non-stickiness. The hair cosmetic of the present invention includes the following components (A) to (D): (A) a (meth)acrylic silicone-based graft copolymer; (B) at least one film-forming polymer selected from nonionic, amphoteric, and cationic polymers; (C) a monohydric lower alcohol; and (D) at least one selected from polyalkylene glycols and sugar alcohols, wherein the component (A) and the component (B) preferably have a content ratio (A):(B) within a mass ratio range of 1:10 to 2:1; and the hair cosmetic preferably has a viscosity at 25° C. of 1000 mPa·s or less.
US09364420B2	Hair conditioning compositions Compositions for providing hair care benefits, such as smoothing, anti-static control, color protection, frizz control and moisturization are disclosed. The compositions maintain clarity, show no separation upon standing, and remain flowable liquids at room temperature. The compositions comprise a premix consisting essentially of (a) siloxane polymers containing one or more functional groups selected from amino, phenyl, methoxy, hydroxyl, fatty alcohol, fatty acid, alkyl and combinations thereof; and (b) materials selected from dimethicones having a viscosity of from about 20 to about 10,000 centipoise, mono-esters containing 20 or fewer carbon atoms, ethers containing 20 or fewer carbon atoms, linear or branched hydrocarbons containing 12 to 20 carbon atoms, and combinations thereof. The compositions can be applied directly to hair (i.e., “neat”) or via conventional hair treatment compositions, such as shampoos or conditioners.
US09364417B2	Compositions for delivering perfume to the skin A cleansing composition comprising at least 5% of a surfactant, at least about 25% water, a cyclodextrin complex comprising a perfume, wherein 80% of the plurality of perfume raw materials comprise a FDV of at least 0.69.
US09364416B2	Leave-on compositions containing cellulose materials The compositions and methods of this invention relate to a leave-on skin care composition containing hydrophobic, linear cellulose particles having an average length of from about 1 to about 500 μm, a particle aspect ratio from about 2 to about 25 and an average thickness of from about 1 to about 500 μm; and a cosmetically acceptable carrier.
US09364413B2	Method for anti-aging treatment by surfactin in cosmetics via enhancing sirtuin Surfactin is a biosurfactant produced by Bacillus subtilis and is a natural cycloaliphatic peptide having a ring structure made of 7 amino acids. The surfactin has various functions including anti-aging, anti-wrinkle, increasing skin penetration of cosmetic products (skin penetration agent), foaming agent, and emulsifier.
US09364411B2	Use of monosaccharides and composition therefor The present invention relates to the use, especially the cosmetic use, of at least one monosaccharide chosen from mannose, rhamnose and a mixture thereof, for reducing or preventing the signs of ageing of the skin or its integuments. The present invention also relates to a cosmetic composition and a device containing it.
US09364409B2	Compositions comprising an efficient perfume bloom The present invention provides personal care compositions having efficient perfume blooms or bursts. The personal care compositions include shampoo and body wash compositions, and comprise perfume materials having high perceived odor intensity at low concentrations of perfume materials.
US09364406B2	Open chained or fused 1,1′-alkylene-bis-uracil derivatives, useful in skin UV-protection The invention provides compounds of formula I; or a salt thereof as described herein. The invention also provides dermatological compositions comprising a compound of formula I or mixtures of one or more compounds of formula I, processes for preparing compounds of formula I, intermediates useful for preparing compounds of formula I and therapeutic methods for protecting skin or DNA from photodamage or repairing photodamaged skin or DNA.
US09364405B2	Tyrosinase inhibitors The compositions and methods of described herein comprise novel ingredients effective to reduce unwanted pigmentation, such as skin discoloration, freckles, age spots, liver spots, sun damage, tans, pigmented acne marks, scars, pigmented birthmarks, hyperpigmentation, post-inflammatory hyperpigmentation, post-injury hyperpigmentation, melasma, cholasma, after-burn scar, nail stain, yellowing of skin, dark circles under eyes, and the like. The composition may include additional ingredients accordingly for a colored cosmetic, moisturizer, cleanser, toner, and the like.
US09364404B2	Dye composition comprising a cationic O-alkyl-substituted meta-phenylenediamine derivative The invention relates to a meta-phenylenediamine compound of formula (I) below, the addition salts thereof with an acid and the solvates thereof: in which: R represents a hydrogen or halogen atom; a C1-C4 alkyl radical; a carboxyl radical or a (C1-C4) alkoxycarbonyl radical, R1 represents a linear C1-C10 alkyl radical substituted with a cationic radical, said alkyl radical being optionally interrupted with one or more oxygen atoms and/or with one or more NR6 groups, said cationic radical being optionally substituted with one or more radicals chosen from C1-C4 alkoxy or C1-C4 (hydroxy)alkyl; R6 represents a hydrogen atom or a linear or branched C1-C4 alkyl radical; An− represents an anion or a mixture of anions which are organic or inorganic and cosmetically acceptable.
US09364402B1	Analgesic cleansing composition Composition and methods are provided for analgesic cleansing compositions, which may be either wash-off or leave-on cleansing compositions. Such compositions comprise a number of surfactants and a number of analgesic compounds, and may optionally comprise antibacterial agents and/or a cosmetically suitable carrier. A method of making an analgesic soap composition is also provided. A method of using a wash-off analgesic cleansing composition is also provided.
US09364395B2	Cartridge syringe A cartridge syringe has a housing with an opening for inserting the cartridge having a cylinder filled with a medication and closed at its ends by a piercing membrane and a stopper having a blind hole. A ram is provided for pressing the stopper for injecting the medication in the cylinder after piercing the membrane. The ram has an actuating element and can be attached in the blind hole of the stopper for aspiration. The ram has an outer sleeve with a core. The outer sleeve is displaceably guided in a rotatable manner and the core in a rotationally fixed manner. A front end of the outer sleeve is provided with at least one fixing hook which is spring-loaded inwardly A cam is engageable with the fixing hook such that, upon rotation of the outer sleeve, the fixing hook is movable either to the fixing position or to the unlocked position.
US09364393B1	Packaging system for liquid medications A dosing system for analgesic liquid suspensions including unit dose containers made using blow-fill-seal (BFS) technology. The containers come in various sizes and hold appropriate doses for specific weight ranges. Each container has body with a compartment for holding the liquid, finger rests for squeezing the container to expel the liquid, a tab at one end for labeling, and a twist-off closure at the other end. In the larger containers, the opening end has a lip rest, which is a flattened section that includes opposed, curved depressions. In the smallest container, the opening end has a long tapered neck. The suspension has a relatively low viscosity to ensure more complete dose evacuation from the container. The containers will be sold in assemblages of various combinations of sizes.
US09364388B2	Methods of treatment with nitric oxide at pressures greater than one atmosphere The present invention provides methods of treatment by delivering nitric oxide at a pressure greater than 1 atmosphere (atm) to a subject in need thereof. Thus, the present invention provides an improved method of treating the skin surface of a subject, and below the skin surface of a subject.
US09364387B2	Isolation chamber with cellular influence system A cellular influence system. The novel cellular influence system includes an isolation chamber, a solution disposed within the chamber for supporting a user in a state of floatation, and a source generator for applying cymatic frequencies to the user via the floatation solution. In an illustrative embodiment, the system is adapted to apply cymatic frequencies that stimulate activity in a specific region or regions of the brain to induce a higher state of consciousness capable of increased learning abilities, and a visual display unit designed to minimize splay such that the interior of the isolation chamber remains dark is provided within the chamber for delivering information to be learned to the user during the induced state. Optionally, the system may also include a neural monitor for measuring neural activity in the user and adaptively adjusting the cymatic frequencies applied to the user based on the measured activity.
US09364382B1	Multi-planar device for stretching portions of a foot and lower leg A stretching device and method of use for stretching the foot and lower leg muscles of a user. The stretching device may include a base and an adjustable incline support that can be adjusted at various angles relative to the base. The incline support may further be divided into separate fingers that can be adjusted to different angular positions relative to one another. A support member may extend across and support the incline support.
US09364381B1	Handy handle systems A casket carrying device that is designed to allow for much easier transporting of the coffin from a funeral to a graveside service allowing it to be maneuvered more easily, even up and down flights of stairs as necessary. The handle members may be about five inches wide. The handles may have two top slightly curved portions measuring about two inches across. The handy handle features a pivot rod about 18 inches in length and 1-1½ inches in diameter that allows for the handle to be used on either side of the casket. The handle may fold when not used (when not in extension) to become parallel with the casket. The handles when properly used put less strain on the casket bearers since they provide functionally accessible handles.
US09364380B2	Patient positioning support structure A patient support system includes independently adjustable end columns supporting a centrally hinged, jointed or breaking patient support structure. At least one column includes a powered rotation assembly. The patient support includes at least two sections. A coordinated drive system provides for both upwardly and downwardly breaking or jointed orientations of the two sections in various inclined and tilted positions. Cable, cantilevered and pull-rod systems are included.
US09364376B2	System and method for transferring a wheeled load into a transport vehicle A simple, adjustable lift system to load a cot bearing a patient into and out of an ambulance and a method of transferring a load on a transport into a vehicle is provided. More specifically, the lift system provides a pair of rails that may be adjusted to accommodate any cot currently in use by an ambulance. The rail system is extendable and is operated by a linear actuator to couple to a cot or other transport and lift the cot or other transport to a height from which the cot may be laterally inserted into the ambulance without undue strain on the EMT, firefighter, or other user.
US09364374B2	Absorbent article with bonded web material An absorbent article to be worn the lower torso is provided. The absorbent article comprises a chassis comprising a topsheet, a backsheet, an absorbent core, and a pair of longitudinal barrier cuffs attached to the chassis. Each of the longitudinal barrier cuffs comprises a web of material. The web of material comprises a first nonwoven component layer, and a second nonwoven component layer. Each of the longitudinal barrier cuffs comprises a longitudinal zone of attachment where each of the longitudinal barrier cuff attaches to the chassis, a longitudinal free edge, and a plurality of mechanical bonds disposed between the longitudinal zone of attachment and the free edge. The plurality of mechanical bonds attach one of a first portion of the web of material to a second portion of the web of material, and the web of material to a portion of the absorbent article.
US09364369B2	Head and neck support apparatus In accordance with one embodiment, a head and neck support apparatus is provided that comprises a seat attachment portion and a portion which is worn by the child passenger. The worn portion comprises an elastic member that will, when worn, encircle the child's head. The rear of the worn portion will further comprise a first engagement member which will removably connect to a second engagement member connected to the seat where the child may foreseeably fall asleep.
US09364365B2	Progressive force strap assembly for use with an orthopedic device A progressive strap assembly includes an elongate, inelastic body having first and second ends, and an elastic body having first and second ends, the first end of the elastic body anchored to the second end of the inelastic body. The elastic body is arranged to stretch a plurality of lengths and has a maximum stretchable length. A tension limiter is connected to the first and second ends of the elastic body and is arranged to inhibit a predetermined stretchable length of the elastic body short of the maximum stretchable length.
US09364362B2	Implantable device system An implantable device system is disclosed. The implantable device system includes, a first energy transceiver system, a second energy transceiver system at least partially implanted within an organic tissue and capable of communication with the first energy transceiver system, and a sensing system capable of communication with the second energy transceiver system. An implantable device system array is also disclosed. A method of monitoring a physical parameter is also disclosed.
US09364361B2	Striped sheaths for medical devices A sheath used to protect a medical device has one or more strips formed over a portion thereof. The medical device is a scaffold crimped to a balloon and mounted to a catheter. The sheath is two-piece, including a protecting and constraining sheath part. The strips facilitate removal of the constraining sheath from the scaffold in manner that reduces instances of damage caused by improper removal of the sheath from the medical device.
US09364360B2	Catheter systems and methods for manufacture A method for manufacturing a catheter, includes forming a mandrel by arranging at least first and second elongate members in an at least partial longitudinal juxtaposed relation with respect to a longitudinal axis defined by the mandrel, mounting an inner liner having an internal surface about the mandrel, treating the inner liner whereby the first and second elongate members of the mandrel cause irregularities within the internal surface of the inner liner, positioning an outer member about the inner liner and removing at least the inner liner from the mandrel, thereby forming a catheter having the inner liner with irregularities.
US09364358B2	Catheter with retractable cover and pressurized fluid Apparatus and method for delivering and deploying an intravascular device into the vessel including an outer and inner tube that are axially linked by a housing structure at the proximal end of the catheter, and a retractable sleeve structure having a middle tube and sleeve tip. The sleeve tip is sealed to the inner tube at the distal end, and continuously extends into the middle tube. At the proximal end of the sleeve structure, the middle tube is sealed to either a housing structure or slideable proximal ring, forming a sealed chamber between the inner tube and the sleeve structure. A radial space is formed between the sleeve tip and the inner tube optimized for intravascular device placement. During retraction of the sleeve structure, the fold of the sleeve tip peels away from the device, which expands to its deployed state while minimizing axial forces and friction.
US09364357B2	Delivery catheter including collapsible sleeve and method of operating same A catheter system includes an introducer sheath and a delivery catheter having an external surface. A sleeve connector is supported on and axially movable relative to the external surface of the delivery catheter. A collapsible sleeve has a first end attached to the external surface of the delivery catheter at a first attachment and a second end attached to the sleeve connector at a second attachment. The catheter system includes a medical device placement configuration in which the delivery catheter is received through the introducer sheath, the sleeve connector is removably attached to the introducer sheath, and the collapsible sleeve is positioned radially between the external surface of the delivery catheter and an internal surface of the introducer sheath.
US09364352B1	Controlling circumference of concentric spiral wires by length of control wire in control tube Ends of an outer spiral and an inner spiral of similar dimensions but wound in opposite directions are joined to form a double spiral stent which may be covered to make it a stent graft. The dimensions are related by the formula of C=(Lw−Ls)/N where C is circumference of the spiral, Lw the length of the wire, N the number of turns and Ls the length of the spiral. Thus when length of spiral (Ls) is increased and decreased by compression and stretching, circumference (C) inversely varies with Ls, as N and Lw do not change. Ls and thus C are controlled by a control wire in a control tube attached to the ends of the double spiral being changed either by screwing male threads on the control wire into and out of female threads in the control tube.
US09364351B2	Method for forming a stent A method of forming a stent includes forming a wave form from a formable material. The wave form includes a plurality of substantially straight portions and a plurality of curved portions, each curved portion connecting adjacent substantially straight portions. The method includes wrapping the wave form around a mandrel at an angle to form a helical coil comprising a plurality of turns, connecting a first curved portion of a first turn to an adjacent second curved portion of a second turn at a position along the wave form to define an end of the stent, and removing excess material from an end of the wave form extending past the first curved portion while smoothing the end of the stent.
US09364350B2	Stent with eased corner feature An implantable stent includes a plurality of rings. At least a distal end ring has an eased corner feature formed in the polymer substrate at a radially outward, distal-facing corner of the ring while relatively sharp corners of the polymer substrate are maintained in radially inward corners of the ring.
US09364349B2	Coating application system with shaped mandrel The invention relates to systems and methods for applying coatings to devices. In an embodiment, the invention includes a coating apparatus including a mandrel having a lengthwise axis and an exterior surface, the exterior surface of the mandrel defining a plurality of channels disposed parallel to the lengthwise axis, the mandrel configured to rotate around the lengthwise axis; and a spray head configured to direct a stream of material at the mandrel. In an embodiment the invention includes a method of applying a coating to a medical device. Other embodiments are also included herein.
US09364346B2	Midline referencing femoral sizing caliper A sizing caliper for facilitating the selection of a femoral component of a knee prosthesis includes a caliper body, two drill guide bodies, a stylus tower configured to be slidably linked to each other wherein as the caliper body and the stylus tower are linearly displaced at an equal rate relative to the drill guide body portions and the drill guide holes remain located at the midpoint of an anterior/posterior dimension defined by the distance between the tip of the stylus and the base portion. The caliper body comprises a base portion configured to couple and decouple from the caliper body using a sliding mechanism.
US09364342B2	Modular anchor bone fusion cage A modular anchor bone fusion cage is provided. The cage includes a spacer configured to fit into a space between the faces of two bones that are to be fused together. A fusion plate having at least a main body portion is coupled to the spacer. Fasteners extend through the fusion plate to engage the bone. At least some of the fasteners also extend through the spacer to engage the opposed faces of the bone. A cover plate is coupled to the fusion plate to inhibit the fasteners from backing out prior to fusion of the bones.
US09364340B2	Low profile plate The present application generally relates to orthopedic systems, and in particular, to systems including independent plates and spacers. A plating system can include a spacer and a plate that is independent from the spacer. A number of locking mechanisms can be provided to secure the plate to the spacer. In some cases, the spacer includes a pair of notches that extend on an outer surface of the spacer. The plate can include a pair of lateral extensions that can engage the notches to secure the plate to the spacer. In other cases, the spacer includes an opening including a pair of inlets. The plate can include an enclosed posterior extension that can be received in the pair of inlets to secure the plate to the spacer.
US09364331B2	Method of designing orthopedic implants using in vivo data A reconfigurable orthopedic implant trial comprising: (a) a first orthopedic component; (b) a second orthopedic component that includes a second sensor on a second articulating surface thereof, the second orthopedic component configured to removably mount to the first orthopedic component; (c) a third orthopedic component that includes a third sensor on a third articulating; surface thereof, the third orthopedic component configured to removably mount to the first orthopedic component, where the second sensor and the third sensor are configured to generate kinematic data.
US09364326B2	Heart valve repair devices and methods Devices and methods for the repair of the functioning of heart valves are provided. A device may comprise a first section having a generally spiral shape and a second section connected to the first section. A method involves positioning the device such that chords associated with the heart valve are positioned within the path of the generally spiral shape of the first section and positioning the second section on an opposite side of the heart valve. The first section may be turned in a manner such that the chords move closer to the center of the first section. The first section draws the chords closer together, thereby pulling the valve leaflets closer together in order to facilitate their coaptation and proper closing.
US09364322B2	Post-implant expandable surgical heart valve configurations Disclosed herein is a prosthetic heart valve, and associated methods therefore, configured to replace a native heart valve, and having a support frame configured to be reshaped into an expanded form in order to receive and/or support an expandable prosthetic heart valve therein. The prosthetic heart valve is configured to have an expansion-resistant configuration when initially implanted to replace a native valve (or other prosthetic heart valve), but to assume a generally expanded form when subjected to an outward force such as that provided by a dilation balloon or other mechanical expander.
US09364321B2	Collapsible/expandable prosthetic heart valves with native calcified leaflet retention features A prosthetic heart valve is circumferentially collapsible for less invasive delivery into a patient. The valve re-expands to operating size at the implant site in the patient. A frame structure of the valve includes restraining structure that can help to push one or more of the patient's native heart valve leaflets radially outwardly so that this native leaflet tissue does not interfere with the operation or service life of the prosthetic valve.
US09364319B2	Refractive-diffractive switchable optical element A lens in accordance with the present invention includes an switchable cell consisting of optical substrate with diffraction surface, elastic film in contact with the diffraction surface of the substrate, optical fluid that fills the space between the film and diffraction surface and the mean to transfer the optical fluid in and out of the space between the film and diffraction surface. The refractive index of the optical fluid matches the refractive index of the optical substrate. The switchable cell changes focus positions between refractive focus in relaxed state when the pressure at both sides of the film is the same and diffraction focus when the optical fluid is transported from the space between the film and optical substrate for the film to largely conform to the diffraction surface shape of the optical substrate.
US09364308B2	Implant systems with tensioning feedback Pelvic or other types of implants are provided that can include tensioning feedback components or portions, such as color changing polymer materials, such as polyacetylene. The color changing polymer can be included with, coated on or otherwise provided with a portion of slings or implant devices to provide targeted feedback to the user or physician of the tension applied to a particular device. A first color can be used to indicate a first (initial) tension or compression stage, and a second color can be used to indicate tensioning of the device beyond a predefined threshold.
US09364307B2	Meshes of variable construction According to one aspect, the present invention provides a substantially two-dimensional surgical mesh comprising a base material, a first area having a first characteristic and a second area having a second characteristic that differs from the first characteristic. The surgical mesh may further comprise a third area having a third characteristic that may be the same as or different from the first and second characteristics, and so on.
US09364288B2	Sterile battery containment An apparatus for delivering electrical power to an electrically powered medical device includes a battery, a first compartment, and a second compartment where the second compartment can hold the first compartment and the first compartment can hold the battery. A sterile space is defined between the first compartment and the second compartment. The first compartment and the battery may be selectively electrically coupled with the electrically powered medical device such that the first compartment does not compromise the sterility of the electrically powered medical device.
US09364287B2	Method for reducing pain of dermatological treatments A method of reducing the level of pain experienced by a patient during a pain-inducing dermatological treatment by using non-pharmacologic means is described. The method employs the use of multiple bursts of a gas to stimulate a touch sensation in or near the tissue to be treated using the dermatological treatment in order to reduce and/or relieve pain. The method can be used alone or can be used in combination with other non-pharmacologic and/or pharmacologic methods of relieving pain in order to make a patient more comfortable during or following the dermatological treatment.
US09364285B2	Sealed two-way magnetic manifold An irrigated medical device, including an inlet tube configured to receive an irrigation fluid from a pressurized fluid source, at least first and second outlet tubes configured to deliver the irrigation fluid to respective outlets of the device, a manifold containing a chamber coupled between the inlet tube and at least the first and second outlet tubes, and a ball including a magnetic material contained inside the chamber. The irrigated medical device also includes a magnetic field generator disposed outside the chamber and configured to generate a variable magnetic field within the chamber so as to move the ball between at least a first position in which the first outlet tube is blocked, a second position in which the second outlet tube is blocked, and a third position, in which neither of the outlet tubes is blocked.
US09364278B2	Limited reuse ablation needles and ablation devices for use therewith A surgical instrument includes a reusable component and a limited-use component releasably engagable with the reusable component. The limited-use component is configured for one or more uses and includes a clocking mechanism configured to count each engagement of the reusable component and the limited-use component to one another. The clocking mechanism is incrementally transitionable upon each successive count from one or more uses state, wherein the clocking mechanism permits both mechanical engagement and electrical coupling of the reusable component and the limited-use component to one another, to a spent state, wherein the clocking mechanism inhibits both mechanical engagement and electrical coupling of the limited-use component and the reusable component to one another.
US09364276B2	Tissue graft anchor assembly and instrumentation for use therewith The present disclosure relates to a soft tissue graft anchor. The anchor includes a plurality of prongs, each prong including a distal end and a proximal end, wherein the prongs are coupled at their distal ends to form an inner cavity having an opening, at least one of the prongs including a fin, the fin extending perpendicular to a longitudinal axis of the prong and including a pointed end. A tissue graft anchor assembly, a method for tissue repair, and instrumentation for use therewith are also disclosed.
US09364271B2	Intraosseous intramedullary fixation assembly and method of use An intramedullary assembly for intraosseous bone fusion includes a lag screw member and a tapered screw member. The lag screw member includes a first elongated body, where the first elongated body includes a first threaded portion at a first end and a bulbous portion at a second end. The tapered screw member is coupled to the lag screw member, and the tapered screw member includes a second elongated body, where the second elongated body includes a second threaded portion at a third end, and an opening at a fourth end.
US09364270B2	Surgical tool A battery pack for a use with a powered surgical tool. The battery pack may include a housing with an outer wall and opposing first and second ends. The housing may include an elongated shape that extends between the first and second ends. A first member may extend across the first end of the housing and include a first aperture, and a second end member may extend across the second end of the housing and may include a second aperture. A passage may extend through the housing with a first end that aligns with the first aperture and a second end that aligns with the second aperture. The housing may be sized for a plurality of storage locations positioned between the first and second members and around the passage, and each of the storage locations may be configured to store a power cell.
US09364267B2	Dynamic and non-dynamic interspinous fusion implant and bone growth stimulation system An interspinous fusion device is described. The interspinous fusion device includes a spacer member and an anchor member. The spacer member has a ring with two or more anchor assemblies projecting laterally from substantially opposite sides of the spacer member ring. The spacer member further has a first zip lock flange and a second zip lock flange, each of the first and second zip lock flanges extends transversely from the spacer member ring wherein each of the first and second zip lock flanges each comprises a series of teeth protruding from it. The anchor member has a ring with two or more anchor assemblies projecting laterally from substantially opposite sides of the anchor member ring. The anchor member further has a barrel extending transversely from the anchor member ring. The barrel comprises a first column of recesses adapted to mate with the teeth of the first zip lock flange and a second column of recesses adapted to mate with the teeth of the second zip lock flange. The spacer member is adapted to slide over the barrel of the anchor member such that the series of teeth of the first zip lock flange mates with the recesses in the first column of recesses of the barrel, and the series of teeth of the second zip lock flange mates with the recesses in the second column of recesses of the barrel to secure the spacer member to the anchor member.
US09364265B2	Spinal implant with a flexible extension element A spinal implant with at least one flexible elongated extension element is provided. The spinal implant has a profile that is lower than standard spinal implants. The spinal implant includes a bone anchor with a head portion and a shaft extending along a longitudinal axis of the bone anchor. A head plate is coupled to the bone anchor. The head plate includes a first elongated extension element and a second elongated extension element. The first elongated extension element and the second elongated extension element may be formed as a single monolithic element that is attached to the head plate by passing through a pair of openings provided on the head plate. At least one of the first elongated extension element and the second elongated extension element is flexible.
US09364261B2	Apparatus and method for removing a foreign object from a rectal cavity A new and useful apparatus and method are provided for removing a foreign object from a rectal cavity. An anoscope is configured for insertion through the anus into a rectal cavity. The anoscope has a base and introducer with guides that route flexible members and a flexible sheath that are carried by actions of the operator through the anoscope beyond the guide and further into a rectal cavity and to expand about a foreign object in the rectal cavity. The anoscope also carries a noose that is manipulatable from outside the patient's rectal cavity to tighten and stricture the flexible sheath above the foreign object and capture the foreign object within the flexible sheath, so that the foreign object can be manipulated by the noose and the flexible sheath to remove the foreign object from the rectal cavity once the anoscope and flexible ribs are removed from the anus.
US09364247B2	Endoscopic electrosurgical jaws with offset knife A forceps includes an end effector assembly having first and second jaw members. Each jaw member includes a proximal flange having an inwardly-facing surface. The proximal flanges are coupled to one another for moving the jaw members relative to one another between a first position and a second position for grasping tissue therebetween. The inwardly-facing surfaces of the proximal flanges are disposed in abutting relation relative to one another. A knife is configured to move along a knife path defined along an outwardly-facing surface of one of the proximal flanges. The knife is movable between a retracted position and an extended position, wherein the knife extends between the jaw members to cut tissue grasped therebetween.
US09364246B2	Dissection handpiece and method for reducing the appearance of cellulite A dermatological skin treatment device is provided. The device comprises a handpiece and a cutting tool, wherein the tool is inserted through the conduit and percutaneously inserted into a tissue disposed within a recessed area of the handpiece. The device and method cut the fibrous structures under the skin that cause cellulite at an angle substantially parallel to the surface of the skin and replace these structures with a non-cellulite forming structure by deploying a highly fibrous mesh through a single needle hole to create a highly fibrous layer directly or through wound healing processes.
US09364244B2	Reconstruction of anterior cruciate ligaments Apparatus for locating an attachment position for a reconstructed anterior cruciate ligament on an attachment surface of a bone comprises locating means 51, 61 arranged to locate at least one reference surface 4 of the bone and guide means 53, 54 arranged to define the attachment position in two dimensions on the attachment surface relative to the reference surface.
US09364239B2	Jaw closure mechanism for a surgical clip applier A jaw closure mechanism for use in a surgical clip applier having first and second jaws movable relative to one another between a spaced-apart position and an approximated position to form a surgical clip about tissue. The jaw closure mechanism includes first and second eccentric wheels rotatably coupled to the respective first and second jaws. Each of the wheels includes a center and a pivot point that is offset relative to the center. A cable is disposed about each of the wheels. The cable is engaged to the first wheel at a first engagement point and to the second wheel at a second engagement point such that, upon application of a drive force to the cable, the wheels are rotated and displaced relative to the respective jaws from a first position to a second position to urge the jaws from the spaced-apart position to the approximated position.
US09364234B2	Interlocking buttress material retention system A surgical stapler is provided having a pair of jaws including a staple containing cartridge and an anvil. Buttress material is releasable affixed to the staple containing cartridge and the anvil. One of the jaws includes a pair of longitudinal projections at a first end of the jaw and configured to frictionally engage corresponding slots in a first end the buttress material. One of the jaws includes a post at a second end of the jaw. The buttress material includes a hole in a second end of the buttress material for receipt of the post.
US09364232B2	Tissue stop for surgical instrument A surgical instrument including a handle assembly, an elongated portion, an end effector, and a stop member is disclosed. The end effector is disposed adjacent a distal portion of the elongated portion and includes a first jaw member and a second jaw member. At least one jaw member is movable with respect to the other jaw member between spaced and approximated positions. The first jaw member includes an upper tissue-contacting surface and a lower shelf portion. The shelf portion includes a groove disposed therein. The stop member is disposed adjacent a distal portion of the first jaw member and is pivotable with respect to the first jaw member between a first position, a significant portion of the stop member being positioned external to the first jaw member, and a second position where a lower portion of the stop member being positioned at least partially within the groove.
US09364231B2	System and method of using simulation reload to optimize staple formation The present disclosure is directed to a testing systems and methods for testing a powered surgical instrument. The powered surgical instrument includes a processor configured to control operation of the powered surgical instrument, a memory configured to store a tissue compression program, a reload configured to clamp tissue, a motor configured to control the reload to apply a compressive force to the tissue by the reload, and at least one sensor configured to measure a current draw on the motor. The processor executes the simulation program to measure the current draw on the motor through a nominal thickness firing and the measured current draw is used to adjust the tissue compression program.
US09364230B2	Surgical stapling instruments with rotary joint assemblies A rotary support joint assembly for coupling a first portion of a surgical instrument to a second portion of a surgical instrument. In various forms the joint assembly includes a first annular race in the first portion and a second annular race in the second portion. The second race is configured for substantial registration with the first annular race when the second portion is joined with the first portion. A ring-like bearing is supported within the registered first and second annular races.
US09364228B2	Applicator instruments having distal end caps for facilitating the accurate placement of surgical fasteners during open repair procedures An applicator instrument for dispensing surgical fasteners includes a housing, a firing system disposed in the housing, an actuator coupled with the housing for actuating the firing system, an elongated shaft extending from the housing, the elongated shaft having an outer diameter, and a cap secured to the distal end of the elongated shaft, whereby the cap has a lower distal edge that extends laterally beyond the outer diameter of the elongated shaft. The lower distal edge of the cap has a length that is greater than the outer diameter of the elongated shaft. The cap has a distal end face that slopes upwardly and proximally from the lower distal edge, and the cap has a surgical fastener delivery window formed in the distal end face for dispensing surgical fasteners. The delivery window has a lower end that is spaced from the lower distal edge.
US09364226B2	Powered surgical instrument A powered surgical apparatus, which is configured to engage tissue includes a handle assembly having proximal and distal portions, a movable portion operatively connected to the distal portion of the handle assembly, a tool assembly operatively coupled to the movable portion, a power source configured to supply electrical power, and a transmission system operatively associated with the power source. The movable portion is movable with respect to the handle assembly. The tool assembly is adapted to engage tissue. The transmission system is configured to transmit electrical power or signals between the handle assembly and the movable portion.
US09364223B2	Surgical instrument having a multi-layered drive beam A surgical instrument including a handle portion, a body portion, a movable handle, a tool assembly, a drive beam and a closure apparatus is disclosed. The movable handle is in mechanical cooperation with a drive member. The tool assembly includes an anvil, a cartridge assembly and a contact surface. The drive beam includes a plurality of layers and at least one layer has a proximal engagement portion and is configured to engage a portion of the drive member. The closure apparatus is configured to engage the contact surface of the tool assembly. At least a partial actuation of the movable handle moves the closure apparatus distally into engagement with the contact surface to approximate the anvil and the cartridge assembly. At least one of the layers of the drive beam is affixed to an adjacent layer of the drive beam via at least one spot weld.
US09364221B2	Surgical stapling device with captive anvil A device for clamping tissue includes a first jaw having a distal portion for communicating with tissue and a proximal portion having a first wing and a second wing. The device also includes a second jaw having a distal portion for communicating with tissue and a proximal portion having a first slot and a second slot, the first slot disposed between a middle structure and a first lateral structure, the second slot disposed between the middle structure and a second lateral structure. The first jaw is rotatably coupleable to the second jaw with the first wing extending into the first slot and the second wing extending into the second slot.
US09364219B2	Staple drive assembly A staple drive assembly includes an actuation sled and at least one staple pusher. The staple drive assembly is adapted to fit within a staple cartridge having a plurality of staples and a corresponding number of retention slots. The at least one staple pusher includes at least one pusher plate for releasably engaging a backspan of a staple. The staple pusher may include a plurality of pusher plates that may be laterally and longitudinally spaced apart. An actuation member has at least one angled camming surface for engaging a complimentary angled surface of the at least one staple pusher. Camming engagement between the actuation member and the at least one staple pusher causes vertical movement of the at least one staple pusher. Lateral and longitudinal offset of the actuation member camming surfaces and the corresponding staple pusher following surfaces improves stability and control of the staple pusher during firing.
US09364218B2	Grasping jaw mechanism A surgical device is disclosed which includes a handle assembly, an elongated member and a disposable loading unit. The handle assembly includes a mode selection mechanism configured to alternate the surgical device between a first grasping mode of operation and a second clamping mode of operation. The handle assembly includes a rotation control member and an articulation lever. The rotation control member is configured to facilitate rotation of the elongated member with respect to the handle assembly. The articulation lever is configured to facilitate articulation of the tool assembly about an axis substantially perpendicular to the longitudinal axis of elongated member. In one embodiment, the tool assembly includes a cartridge assembly having a plurality of staples and an anvil assembly configured to clamp and staple tissue in the second clamping mode of operation of the device.
US09364217B2	In-situ loaded stapler In one aspect of the present disclosure a surgical stapling apparatus is disclosed including a cartridge assembly. The cartridge assembly includes at least one cartridge having a first half and a second half, a first row of retention slots disposed in the first half, a second row of retention slots disposed in the second half, a third row of retention slots being alternately disposed in the first half and the second half of the at least one cartridge between the first and second rows of staple receiving slots, a plurality of fasteners disposed in the retention slots of the first, second and third rows, and a plurality of pushers disposed in each of the first and second halves of the cartridge.
US09364214B2	Cannulated instrument with curved shaft for passing suture through tissue A surgical instrument for manipulating suture within a patient. The surgical instrument includes a short cannulated handle and a cannulated shaft having a curved configuration. A Nitinol loop is inserted through the cannulation of the instrument for passing and shuttling suture through tissue. The curved shaped of the instrument allows it to be introduced into the shoulder for rotator cuff repair, for example, using the Neviaser Portal.
US09364212B2	Suture anchoring devices and methods for use A system and associated method for manipulating tissues and anatomical or other structures in medical applications for the purpose of treating diseases or disorders or other purposes. An implant for attachment of soft tissue to bone, an insertion tool for anchoring suture anchors to bone, and a method for anchoring a suture anchor to bone.
US09364211B2	Knotless suture anchor A suture anchor comprises a tubular body having an axial bore therethrough and having one or more purchase enhancements on an exterior surface of the body adapted to enhance purchase of the body within a bone hole, such as threads. A lateral port passes through the body from the bore to the exterior surface and is formed of a slot entering the body from its proximal end. A length of suture for attaching soft tissue to bone passes down along the exterior surface over the one or more purchase enhancements, over a distal end of the body, up into the bore through and then back out of the bore and up along the exterior surface over the one or more purchase enhancements.
US09364204B2	Atraumatic arthroscopic instrument sheath A method of performing arthroscopic surgery using an arthroscopic inflow and outflow sheath which provides an improved inflow and outflow system reducing the diameter of a continuous flow system while eliminating the need for a third portal during arthroscopy. The improved arthroscopic inflow and outflow sheath comprises an elongated atraumatic sheath having an inner surface, outer surface, proximal end, and distal end. The atraumatic sheath further comprises plurality of ribs extending from the inner surface of the sheath and designed to contact an outer surface of the arthroscope creating outer lumens facilitating the inflow and outflow of fluid to a surgical site. The atraumatic sheath further comprises a ridge to prevent the sheath from being easily removed from a surgical site.
US09364199B2	Medical devices The present disclosure provides medical devices possessing reactants thereon, which further promote adherence of the device to tissue in vivo and/or release of bioactive agents from the device.
US09364198B2	Ultrasound probe diagnosing apparatus, ultrasound diagnostic apparatus, and ultrasound probe diagnosing method An ultrasound probe diagnosing apparatus which diagnoses an ultrasound probe having an array of a plurality of ultrasound transducing elements on the basis of how the ultrasound probe receives reflected ultrasound waves from a test object placed to face the ultrasound probe, includes a part which detects a posture of the ultrasound probe with respect to the test object by comparing reflected ultrasound signals received by at least some of the plurality of ultrasound transducing elements, and a presenting part which presents information based on the detected posture.
US09364196B2	Method and apparatus for ultrasonic measurement of volume of bodily structures A method and apparatus for determining the volume of a bodily structure including the steps of acquiring at least two ultrasound images, estimating the location of the perimeter of a structure of interest as viewed in cross section in each said ultrasound image, calculating the cross sectional area of such structure as so viewed, and combining the perimeter and area information from the at least two images to calculate the volume of the structure.
US09364195B2	Deep vein thrombosis therapeutic methods using therapeutic delivery devices and systems Methods and devices are disclosed that, in various embodiments and permutations and combinations of inventions, diagnose and treat Deep Vein Thrombosis or associated symptoms. In one series of embodiments, the invention consists of methods and devices for identifying patients whose Deep Vein Thrombosis or associated symptoms are caused or exacerbated, at least in part, by blockages of one or more of the patient's internal peripheral veins. In some instances, stenoses or other flow limiting structures or lesions in the patient's affected veins are identified. Further, in some instances the nature of such lesions and whether there is a significant disruption of blood pressure, or both, is ascertained. In some embodiments, methods and devices for applying one or more therapies to the blockages in the patient's peripheral veins are provided.
US09364194B2	Systems and methods for detecting regions of altered stiffness An ultrasound imaging method for detecting a target region of altered stiffness is provided. The method comprises delivering at least one reference pulse to the target region to detect an initial position of the target region, delivering a first pushing pulse having a first value of a variable parameter to a target region to displace the target region to a first displaced position, delivering a first tracking pulse to detect the first displaced position of the target region, delivering a second pushing pulse having a second value of the variable parameter to the target region to displace the target region to a second displaced position, and delivering a second tracking pulse to detect the second displaced position of the target region. An ultrasound imaging system for detecting a region of altered stiffness is also provided.
US09364193B2	Heart sound tracking system and method A system and method provide heart sound tracking, including an input circuit, configured to receive heart sound information, and a heart sound recognition circuit. The heart sound recognition circuit can be coupled to the input circuit and can be configured to recognize, within a particular heart sound of a particular heart sound waveform, a first intra heart sound energy indication and a corresponding first intra heart sound time indication using the heart sound information from the particular heart sound waveform and the heart sound information from at least one other heart sound waveform. The particular heart sound can include at least a portion of one of S1, S2, S3, and S4. Further, the first intra heart sound energy indication and the corresponding first intra heart sound time indication can correspond to the at least a portion of one of S1, S2, S3, and S4, respectively.
US09364189B2	Portable x-ray image system and operating table using the same Provided is an X-ray image photographing device, and more particularly, a portable X-ray image system available for multiple uses. In addition, disclosed is an X-ray image photographing device, and more particularly, an operating table which may be coupled to a portable X-ray image device.
US09364188B2	X-ray apparatus for round visit With an X-ray apparatus for round visit of this invention, when a brake operation is carried out, a CPU performs deceleration control (braking current control at c and short brake control at e) of a movable carriage instead of immediately driving electromagnetic brakes, and drives the electromagnetic brakes at time f. Therefore, a great shock does not occur to the apparatus, and there is no possibility of the operator colliding with the apparatus. Since the deceleration control of the movable carriage is carried out in advance, the apparatus does not stop suddenly and does not impair the floor. As a result, the X-ray apparatus for round visit is realized, in which no great shock occurs to the apparatus at times of deceleration, and which is also safe for the operator.
US09364187B2	Packaging design for CT detector A CT system includes a gantry having an opening for receiving an object to be scanned, an x-ray tube attached to the gantry, and a detector assembly. The detector assembly is positioned to receive x-rays that pass through the object and includes a light-sealed enclosure formed by at least first and second rails, a back support, and a light seal structure, and a plurality of liquid-cooled modules positioned in the enclosure. Each module includes a digital cable that passes from inside the enclosure, and each module is configured to convert the x-rays to a digital signal and output the signal via a digital cable.
US09364186B2	Dose reconstruction during radiation therapy A method for the reconstruction of a dose administered in an object to be irradiated includes providing a radiation therapy device. The radiation therapy device includes a therapeutic radiation source for emitting a therapeutic treatment beam, a portal detector opposing the therapeutic radiation source for recording measurement data of the treatment beam once the therapeutic radiation source has left the object to be irradiated, and a single or multi slice computed tomography scanner having a kV x-ray source and an opposing kV detector for producing a computed tomography of the object positioned in the radiation therapy device. The method also includes recording a computed tomography image of the object to be irradiated with the computed tomography scanner, and using the computed tomography image in order to reconstruct a dose administered to the object from measurement data of the portal detector.
US09364185B2	Low energy wireless communication systems and methods for medical devices A method performed by a medical device for transmitting data packets includes: removing select data fields from a data packet defined in accordance with IEEE standard 11073 to form a modified data packet; determining a length of the modified data packet; determining whether the length of the modified data packet is greater than a predetermined maximum length of data packets under the Bluetooth low energy protocol, as defined in Bluetooth Core Specification version 4.0 or higher; when the length of the modified data packet is greater than the predetermined maximum length of data packets defined under the Bluetooth low energy protocol, partitioning the modified data packet into a plurality of individual data packets, wherein each of the individual data packets includes a portion of the modified data packet; and transmitting the individual data packets via an antenna in accordance with the Bluetooth low energy protocol.
US09364184B2	Method of processing cardiovascular sound signals A math model envelope of a single heartbeat between primary and secondary peaks of an autocorrelation of a received cardiovascular sound signal comprises an S1 lobe and a like-polarity S2 lobe. A bootstrap filter envelope is generated by averaging data from a plurality of heart cycles within heart cycle boundaries located responsive to a convolution of the envelope with the cardiovascular sound signal. Start points of a plurality of heart cycle signals are located from a convolution of the bootstrap filter envelope with the cardiovascular sound signal. The S1 and S2 regions are located within a cardiovascular sound signal responsive to peak and valley locations thereof and responsive to a phase window signal generated by filtering an average of a plurality of heart cycle signals, wherein the peak and valley locations are located responsive to a second derivative of the phase window signal and responsive to the start points.
US09364183B2	Haptic glucometer guide A glucometer guide is provided to address the difficulty that blind or visually impaired diabetic patients have when attempting to independently use a glucometer. The guide provides haptic cues for the effective transfer of blood onto a test strip.
US09364181B2	Physiological sensor combination A physiological sensor combination has a flexible substrate configured to attach to a tissue site. Multiple sensors are disposed on the substrate, which generate physiological signals. Each of the signals is responsive to a different physiological parameter. Conductors are carried on the substrate and routed between the sensors and at least one connector. The connector is configured to communicate the physiological signals to at least one monitor, which derives measurements of the parameters.
US09364173B2	Signal processing for continuous analyte sensor Systems and methods for dynamically and intelligently estimating analyte data from a continuous analyte sensor, including receiving a data stream, selecting one of a plurality of algorithms, and employing the selected algorithm to estimate analyte values. Additional data processing includes evaluating the selected estimative algorithms, analyzing a variation of the estimated analyte values based on statistical, clinical, or physiological parameters, comparing the estimated analyte values with corresponding measure analyte values, and providing output to a user. Estimation can be used to compensate for time lag, match sensor data with corresponding reference data, warn of upcoming clinical risk, replace erroneous sensor data signals, and provide more timely analyte information encourage proactive behavior and preempt clinical risk.
US09364170B2	Method and system to characterize motion data based on neighboring map points A method and system are provided for characterizing motion data. The method and system obtain point specific (PS) motion data for a plurality of map points. The PS motion data indicates an amount of motion that occurred at the corresponding map point on a wall of the heart during at least one cardiac cycle. The method and system, calculate mechanical activation times (MAT) for the map points, identifying a group of neighbor map points for a current map point, and modifying the MAT corresponding to the current map point based on the MATs corresponding to at least a portion of the group of neighboring map points. Further, the method and system repeat the identifying and modifying operations for at least a subset of the map points.
US09364165B2	Apparatus and method for moving and activating an active agent The present invention relates to an apparatus for moving a target element which comprises a magnetic material and an active agent, through an object, placing the target element at a predetermined position within the object and activating the active agent. The apparatus comprises: a selection unit comprising a selection field signal generator unit and selection field elements, such as selection field magnets or coils, for generating a magnetic selection field having a pattern in space of its magnetic field strength such that a first sub-zone having a low magnetic field strength and a second sub-zone having a higher magnetic field strength are formed in a field of view, a drive unit comprising a drive field signal generator unit and drive field coils for changing the position in space of the two sub-zones in the field of view (28) by a magnetic drive field unit so that the magnetization of the magnetic material changes locally, and a control unit for controlling the signal generator units to generate and provide control currents to the respective field coils to generate appropriate magnetic fields for moving the target element through the object in a direction instructed by movement commands, for placing the target element at the desired position within the object and for activating the active agent when the target element has reached the desired position.
US09364151B2	Quantified-self machines and circuits reflexively related to food-and-nutrition machines and circuits A method substantially as shown and described in the detailed description and/or drawings and/or elsewhere herein. A device substantially as shown and described in the detailed description and/or drawings and/or elsewhere herein.
US09364150B2	System and method for wireless generation of standard ECG leads and an ECG sensing unit therefor A system for wireless generation of at least one standard ECG lead comprises a plurality of electrodes for application to a subject at separate points thereof and a remote receiver station for generating at least one standard ECG lead from signals detected by a first group of said plurality of electrodes. The system further comprises a wireless sensing unit for generating at least two non-standard ECG signals from bipolar signals detected by a second group of the plurality of electrodes, a processor in the remote receiver station for calculation of a transform synthesizing each generated standard ECG lead from at least two of the non-standard ECG signals, a disconnection unit for disconnection of the first group of electrodes from the subject following the calculation, and a transfer unit for wireless transferring of the non-standard ECG signals to the remote receiver station following the disconnection of the first group of electrodes.
US09364147B2	System, method and device for automatic noninvasive screening for diabetes and pre-diabetes A system for an automatic noninvasive screening for diabetes and pre-diabetes using a device to take at least one image of a patient's eye, executing non-transitory instructions executable on a processor for analyzing the image and displaying an indication if the patient has diabetes.
US09364142B2	Simulation device, simulation system, simulation method and simulation program There is provided a simulation device including: first blur component generating unit configured to generate a first blur component based on distance data included in observation scene data in which the distance data is added to a computer graphics image, and a parameter regarding the non-progressive component included in the trial lens; second blur component generating unit configured to generate a second blur component based on distance data included in the observation scene data and a parameter regarding a progressive component included in the progressive addition lens; a display blur component generating unit configured to generate display blur component, based on first blur component and second blur component; a display blur component adding unit configured to add display blur component to the observation scene data; and display unit configured to display an observation image obtained by display blur component adding unit, to a wearer wearing the trial lens.
US09364141B2	Sharp fixation target A device for stabilizing the constant accommodation of an eye comprises a target object, an optical unit, and an additional optical unit. The target object is set up to be fixated by a patient along an optical axis. The optical unit is set up along the optical axis to compensate for a spherical ametropia of the eye. The additional optical unit is set up along the optical axis to compensate for an astigmatic ametropia of the eye. The additional optical unit comprises at least two cylindrical lenses and at least four deflection prisms. At least one cylindrical lens is rotatably arranged about the optical axis. At least one deflection prism can be adjusted to change the optical path length of the light path from the target object to the eye.
US09364140B2	Video laryngoscope Disclosed is a video laryngoscope having a body, an insertion section extending from the body generally parallel to a median plane of the laryngoscope extending through the body, and a display screen assembly extending from the body generally perpendicular to the median plane, the body comprising a grip portion intermediate the display screen assembly and the insertion section. The display screen assembly, comprising a display screen, extends laterally from the body and the inner edge of the display screen falls within the lateral extent of the body. The grip portion is also of a minimum size to allow an adult to grip the laryngoscope, the hand abutting the screen assembly. Thus, the laryngoscope is of a minimum overall size, the screen is positioned as close as possible to the line of sight of a user directly viewing the distal end of the insertion section, during a medical procedure, facilitating the user alternating between direct and indirect viewing, whereas the screen does not prevent the user from manipulating the laryngoscope by applying thumb pressure to the body. The laryngoscope may optionally be provided with thumb operable controls on the body or the screen. The screen may be adjustable about an axis, and, by virtue of the configuration and size of the laryngoscope, adjustment may be effected by the user's thumb, without the need to adjust the grip of the remaining digits.
US09364137B2	Endoscope image-acquisition unit and endoscope apparatus Positioning precision between an image-acquisition device and an objective lens is enhanced by suppressing manufacturing errors. Provided is an endoscope image-acquisition unit equipped with an objective-lens-unit frame that holds an objective lens and an image-acquisition-device holding frame that is fitted to the objective-lens-unit frame and that holds an image-acquisition device, wherein the objective-lens-unit frame and the image-acquisition-device holding frame are attached and secured to each other by means of thermosetting resin that is applied to fitting portions therebetween and in which polar-molecule materials are mixed, and one of the objective-lens-unit frame and the image-acquisition-device holding frame, whichever one is positioned outside at the fitting portions, is formed of a material that allows microwaves to pass therethrough.
US09364125B2	Backpack power apparatus A backpack power apparatus is comprised of a back carrier frame for being piggybacked by a user, a blower unit including a fan driven by a drive motor for sucking in or blowing out air through an airflow duct, and an airflow tube fluidically communicating with the airflow duct of the blower unit for sucking in or blowing out air through the airflow tube. The blower unit is mounted on the back carrier frame via a vibration isolating means, and the airflow tube is supported on the back carrier frame and adapted for being held and operated by the user when in use. The airflow tube is floatingly coupled to the airflow duct of the blower unit.
US09364124B2	Waterless toilet system and methods of use An environmentally-friendly portable toilet that is waterless, odorless and cost efficient, that uses specially-lined bags that kill pathogens and are sealed and released into a base section, which is connected to a hard plastic sitting unit, forming an integral, closed system for waterless sanitation.
US09364121B2	Sliding shower door assembly A fully frameless sliding shower door assembly includes a sliding panel of sufficient strength to be fully self-supporting and includes a stationary panel. The need for an upper horizontal header member is eliminated by using an upper guide assembly having a guide which is fixed to the sliding panel and configured to slide about a top edge of the stationary panel. A self-centering roller assembly is attachable to the sliding panel without the need for a rail member. The roller assembly and a track therefore feature matching inverted and non-inverted generally U-shaped profiles. The shower door assembly further features inboard and outboard roller finger guards, as well as a track leveling feature which improves ease of installation.
US09364120B2	Caulkless seal A bathing enclosure includes a base, one or more wall panels, and a compliant member. The base includes a first flange extending outward from an upper end thereof to define an upper surface. The wall panels include a second flange extending outward from a lower end thereof to define a lower surface. The compliant member has a length and a width, the length being greater than the width. The base and the one or more wall panels at least in part define a forward entrance into an interior of the enclosure. A generally horizontal interface is formed between the first flange and the second flange. The compliant member is coupled to a first of the one or more wall panels proximate the entrance. The compliant member forms a seal with the first flange, the length of the compliant member extending outward relative to the interior of the enclosure.
US09364118B2	Sifter with pull cord The sifter of the present disclosure uses a pull cord in communication to assist with the sifting of a powdered substance (e.g., flour, sugar). A user places the substance to be sifted into the open end of a top container and actuates the pull cord, which in turn rotates a blade to agitate the powder and help it pass through a screen into a lower container. This design allows a user to keep their hands from touching the powdered product, and for simple cleanup.
US09364114B2	Device and method of creating a beverage recipe for an integrated system for dispensing and blending/mixing beverage ingredients A method and device for creating a beverage recipe for an integrated beverage blending system includes a dispenser and at least one blending/mixing/cleaning module. The method creates the beverage recipe with recipe program running on a computer interactively with a user making recipe entry parameters for the dispensing, blending and mixing operations. The recipe can be stored on a portable memory and inserted into a user interface controller of the integrated system or into an associated point of sale device.
US09364112B2	Secure and portable apparatus for accepting parcels and deliveries This invention is a secure and portable apparatus and is of parcel bag-type receptacle that can be placed for a limited time, outside a front-door or place of access to a mail carrier. The apparatus can be securely connected to a pre-existing doorknob of the front door or pre-existing door handle on or near the front door for a mail carrier to deliver a package, lock up the parcel bag, so that only the resident or authorized recipient can access the parcel upon their return. The locking mechanism in the parcel bag is one-way, thereby, once locked; even the package delivery person will not be able to access the package. The secure storage system neither damages nor requires any permanent alterations to the property structures at or near the front-door. It is portable and can be carried along during one's travel.
US09364110B2	Beverage container closure with venting A beverage container closure or lid adapted for closing an open end of a beverage container. The lid is couplable to the beverage container and includes a selectively openable stopper that when closed, creates a fluid-tight seal between the beverage container and the environment. The stopper may be opened by pressing a button disposed on a side of the beverage container closure. The stopper is subsequently automatically closed when the button is released. Thus, the user may open and close the beverage container closure using a single hand without the need to remove the beverage container closure from the beverage container. The beverage container closure includes an actuating lever configured to press the button when a user applies a force to the lever. By utilizing the mechanical advantage provided by the lever, a user is able to selectively open and close the stopper using a relatively low amount of force.
US09364106B1	Apparatus and method for identifying, measuring and analyzing food nutritional values and consumer eating behaviors System and method for identifying, measuring and analyzing food nutritional values and consumer eating behaviors is disclosed. A food container, having weight sensors and food identification sensors, identifies weight, type, and preparation status of the food item being consumed by the user from the food container. Based on the identified information, the nutritional value of the food item is determined and observed. The food container in communication with the system components may provide the user a recommended meal plan to improve the user's health condition. In addition, the food container issues an alert to the user when the user puts too much, too less, or the right amount of food items in the food container or eats the food items too fast.
US09364101B1	Glass door for display case A display case having a novel glass door. The glass door includes a top panel and a front panel bonded to one another, and a pair of spaced rails reinforcing the interconnection of the top and front panels. Each of the panels is secured to each of the rails. The glass door provides enhanced viewing of products within the display cabinet.
US09364100B2	Inductively coupled shelving system A shelving system for the display of items, such as retail products and merchandise, is disclosed. The shelving system includes a first sheet that forms a bottom layer. This first sheet rests on top of an existing display shelf. A second sheet is placed over the first sheet. The second sheet forms a top layer, and supports the products on the shelf. At least one inductive transmission coil is located between the first and second sheets. The coil is located along the front edge of the display shelf. A circuit board is electrically coupled to the transmission coil, and to a power source. The shelving display system provides a retrofit solution to provide power to the front edge of an existing display shelf. In an alternate embodiment, a ramp is used at the front of the existing display shelf to replace the first and second sheets.
US09364098B2	Reversible child holding device A child holding accessory can be desirably installed on a rigid support frame, and has two opposite regions adapted to receive a child in different configurations of use. Examples of construction for these holding regions can include, without limitation, a changing table and a child sleep bed. The child holding accessory can be attached with the support frame via one or more fixtures that is adjustable to turn upward either of the first and second regions for use.
US09364096B2	Bed pad with insect repellant An insect-repelling bed pad to be located between the mattress and a box spring of a bed or laid upon the ground inside and out of doors for use by individuals and pets during sleep. The bed pad is manufactured from a porous or loosely-woven material (e.g., burlap) and includes a plurality of chambers. The chambers contain a natural (i.e., green) insect-repelling substance (e.g., cedar wood chips and/or dust) having a scent that is adapted to drive away insects without the use of chemicals. The scent and/or the dust is blown from the chambers of the bed pad to repel insects which may reside between the box spring and the mattress or around the bed site when a compressive force is applied by a user to the bed pad to correspondingly squeeze the chambers.

1 2 3 4 5 6 7 8 9 10