Document | Document Title |
---|---|
US10512973B2 |
Cutting tool replacement member and cutting tool body
A cutting tool replacement member including: a lower surface which serves as a seating surface; an upper surface opposed to the lower surface; and a side surface connected to the upper surface and the lower surface. In a top view, the upper surface includes, in an intersection between the upper surface and the side surface, a reference side edge and an inclined side edge inclined relative to the reference side edge. The side surface includes a first side surface part connected to the reference side edge of the upper surface, and a second side surface part connected to the inclined side edge of the upper surface. At least one of the first side surface part and the second side surface part is provided with an overhanging part that, in a top view, protrudes outwardly with respect to the reference side edge or the inclined side edge. |
US10512972B2 |
Tooth formations and arrangement for a saw blade
A saw blade can include a blade body having a cutting edge defined by multiple teeth. The teeth can be disposed in a repeating pattern including a raker tooth, a first set tooth having a light offset to a right side of the blade body, a second set tooth having a heavy offset to the left side of the blade body, a second raker tooth, a third set tooth having a light offset to the left side, and a fourth set tooth having a heavy offset to the right side of the blade body. Each tooth can include a tip, rake face, gullet having a gullet depth, and one or more clearance surfaces. The pitch distance and gullet depth of the heavy offset teeth can be less than the pitch distances and gullet depths of the remaining teeth to provide an increased amount of strength for the heavy offset teeth. |
US10512968B2 |
Method for managing casting process based on properties of molding sand
A method for managing a casting process based on measured properties of molding sand is provided so that casting defects or energy used can be reduced by changing the molding conditions for the mold to be produced or changing the steps after molding. The method for managing a casting process based on the properties of the molding sand includes a step (1) of measuring the properties of the molding sand just before the molding sand is supplied to a molding machine (40) and a step (2) of determining if the measured properties of the molding sand comply with predetermined properties so as to then switch between a step of molding a mold when the measured properties do comply with the predetermined properties and a step of molding a mold when the measured properties do not comply with the predetermined properties. |
US10512966B2 |
Joining means
In the invention, a joining means having a ram tool, a countertool and a holder with an opening to accommodate the ram tool or the countertool, is described. The two tools are arranged coaxial with each other at different ends of a C-bracket. The holder comprises at least one plane contact surface arranged on the outer surface of the holder, resting in contact with at least one plane face of the corresponding end of the C-bracket and detachably fastened thereto. Between the contact surface and the face, at least one interlay is arranged, determining the information and/or the distance of the contact surface from the face. |
US10512965B2 |
Device and method for mutual separation of two workpiece components of a plate-like workpiece
Devices for separating two workpiece parts, e.g., metal sheets, from one another are described and include a workpiece mounting, a lifting device arranged on one side of the workpiece mounting, and a counter-holder arranged on the opposite side of the workpiece mounting. The counter-holder can be transferred into a fixing state and into a releasing state. One of the workpiece parts to be separated from one another is provided as a removal part, the other as a remaining part. For separating the two workpiece parts, the removal part, which is acted upon by the lifting device and supported by the counter-holder, can be moved by means of the lifting device perpendicular to the mounting in relation to the remaining part by a removal movement. At least in the releasing state, the counter-holder forms a rigid abutment in the lifting direction for the removal part. The rigid abutment has the effect that the removal part is aligned parallel to the mounting. Machine-based systems include a processing unit for producing two workpiece parts from a sheet-like workpiece and a separating device as described herein. Methods for separating two workpiece parts of a sheet-like workpiece are carried out by means of the devices described herein and can be part of a machine-based process. |
US10512964B2 |
Electrically powered crimp tool
Electrically powered crimp tools are described. Also described are methods of operating the tools and methods of crimping. The tools include a housing, an electric motor, a roller screw assembly, and a jaw assembly. In particular versions of the tools the jaw assembly includes a cam linkage member that is manually displaced by a user to more easily open the jaws after performing a crimp. |
US10512963B2 |
Methods and punch handling apparatuses for the production of a workpiece
This disclosure relates to methods and apparatuses for production of a workpiece. A first workpiece part is cut free from a first plate-shaped material by a separating cut made via the punch-handling tool. The first workpiece part is held in at least one of a clamped manner and tensioned manner via at least one of an upper tool and a lower tool of a punch-handling tool while being cut free. The workpiece part is aligned with the first plate-shaped material, a further plate-shaped material that differs from a material of the first workpiece part, and a second workpiece part and the aligned pieces are clinching with a clinch tool to connect the pieces at a connection point that is free from a filler material. |
US10512959B2 |
Method for manufacturing single-crystalline metal ultrafine wire
A method for manufacturing an ultrafine single-crystalline metal wire is presented. The method continuously manufactures an ultrafine long single-crystalline wire by shaping a grown single-crystalline metal to have a circular or rectangular cross section and then by drawing the shape-processed single-crystalline metal using a drawing machine. Therefore, the method simplifies manufacturing procedures to reduce manufacturing costs and lowers electrical resistance of a produced metal wire to improve the quality of the produced metal wire. The method includes: a first step of growing a single-crystalline metal ingot using a Czochralski or a Bridgman method; a second step of subjecting the single-crystalline metal ingot to a shaping process such that the single-crystalline metal ingot has a certain shape; and a third step of completing the manufacture of an ultrafine single-crystalline metal wire by drawing the shape-processed single-crystalline metal. |
US10512957B2 |
Colloidal agents for aquifer and metals remediation
Compositions and methods for treating contaminated soil and/or ground water in situ. The compositions and methods comprise stabilized forms of colloidal remediation agents that are used to remediate contaminants, namely, organic and inorganic contaminants. The compositions and methods of the present invention are operative to transport particulate remediation agent materials through a matrix of soil and groundwater upon application by injection, gravity feed, or percolation into soil and groundwater, which in turn sequester, destroy or stabilize contaminants out of water to thus decontaminate groundwater in place without the cost or disruption associated with digging the contaminated soil and groundwater out of the ground for on-site purification or disposal at a hazardous waste landfill. |
US10512955B2 |
System and method to control a biogas collection plant
System to control a biogas collection plant having a manifold and a plurality of collection units connecting respective capturing wells to the manifold and having respective biogas flow rate regulation valves; the system having a control board with a pressure sensor, a methane sensor, an oxygen sensor, a biogas pressure monitoring network connecting the pressure sensor to the collection units by means of respective control valves, and a chemical biogas monitoring network connecting the methane sensor and the oxygen sensor to the collection units by means of as many control valves; the control board selectively controlling the control valves to measure pressure, methane concentration and oxygen concentration of the biogas in the collection units and controlling the regulation valves as a function of the pressure and methane and oxygen concentration values measured. |
US10512952B2 |
Intra-pipe turbine blast system
The object of the invention is to provide a device which can, with high efficiency, polish and clean the inner surface of a pipe, dry the wet inner surface of the pipe, and perform coating, wherein the device does not require a large pump or a large motive force, and does not require a blast hose or a suction hose. More specifically, provided is an intra-pipe turbine blast system that moves along the inside of a pipe and performs work by spraying a fluid toward the inside of the pipe, wherein: a gas injected from a fluid supply device to the upstream-side end inside the pipe imparts speed to a mixed phase fluid consisting of a liquid and solid particles which are likewise injected into the pipe; the flow speed of the mixed phase fluid is set to 3 m per second which is the critical speed at which solid particles can float without precipitating in the liquid, and as a result of such setting, there is a great effect on reducing the energy required for causing the mixed phase fluid to move; and the mixed phase fluid with such setting is injected at a high speed from a rotation nozzle of a turbine crawler which moves inside the pipe, thereby polishing the inner surface of the pipe, and following the polishing work, the turbine crawler can clean, dry and coat the inner surface of the pipe. |
US10512949B2 |
Micro dry ice snow spray type cleaning device
The present invention relates to a dry cleaning technology for a cleaning a surface of an object to be cleaned by adiabatically expanding liquid carbon dioxide to generate sublimable dry ice particles and carrying the dry ice particles on high-speed carrier gas to be sprayed onto the surface of the object to be cleaned, wherein an end of a liquid carbon dioxide nozzle further protrudes to the outside relative to an end of a carrier gas nozzle to prevent a growth of dry ice particles in the carrier gas nozzle, a hydrophobic coating is formed on a surface of the liquid carbon dioxide nozzle to prevent a formation of water droplets and to prevent an occurrence of irregular dry ice particles, thereby effectively preventing damage to a surface of an object to be cleaned and being advantageous in an economical aspect by significantly reducing consumption of liquid carbon dioxide. |
US10512948B2 |
Gas purge unit and gas purge apparatus
A gas purge unit 20 introduces a cleaning gas into a purging container 2 with an opening 2b therethrough. The gas purge unit 20 includes a first nozzle outlet 26 and a second nozzle outlet 28. The first nozzle outlet 26 blows out the cleaning gas from a lateral side line part of the opening 2b toward the inside of the purging container 2. The second nozzle outlet 28 blows out the cleaning gas from the lateral side line part of the opening 2b toward an opening surface of the opening 2b. |
US10512944B2 |
Power washer with pulsing boost power mode
An electric power washer contains a main body having a pump and an electric power source, a hose, a handle, and a control circuit. The hose contains a first end fluidly-connected to the pump and a second end fluidly-connected to the handle, which has a button operatively-connected to the control circuit, which is operatively-connected to the pump and the electric power source. The control circuit controls the pump output and contains a timer. The control circuit permits the pump to normally operate at up to 100% normal power. However, when the button is activated, the control circuit permits the pump to operate at a boost power mode of from about 103% normal power to about 300% normal power. The control circuit intermittently pulses the boost power mode and terminates the boost power mode after a predetermined period of time or when the button is no longer activated, whichever is shorter. |
US10512937B2 |
Vibration motor
A vibration motor includes a stationary portion, a vibrating body, an elastic member, and a damper member. The elastic member includes a first extending portion, a second extending portion, a first connection portion, a second connection portion, a third extending portion, a fourth extending portion, a third connection portion, a fourth connection portion, and a fifth connection portion. The damper member includes a first longitudinal portion and a second longitudinal portion. An inner section including the first extending portion, the third extending portion, and the fifth connection portion directly opposes an upper surface of a weight in plan view in an up-down direction. |
US10512933B2 |
System and method for dispensing a liquid
A method, computer program product, and apparatus for receiving, at a fluid dispensing apparatus, a control signal, wherein the control signal may be received from a base station, wherein the control signal, when received, may cause the fluid dispensing apparatus to perform operations. The operations may include generating a positive pressure within a fluid cartridge of the fluid dispensing apparatus by adjusting, via a motor of the fluid dispensing apparatus, a drive rod and piston of the fluid dispensing apparatus in a first direction relative to the fluid cartridge to dispense fluid in the fluid cartridge via a nozzle of the fluid dispensing apparatus. The operations may include generating a negative pressure within the fluid cartridge by adjusting, via the motor, the drive rod and piston in a second direction relative to the fluid cartridge to draw fluid into the fluid cartridge via the nozzle. |
US10512927B2 |
Thread dosing feeder for extracting creams
A thread dosing feeder for extracting creams or gelatinous products contained within a tube from the tube whereby the dosing feeder tube can be applied to the tube, the thread dosing feeder comprises a rotary gate feeder (1), the rotary gate feeder (1) has a metering chamber, the metering chamber operates in conjunction with a plunger (3), the rotary gate feeder (1) is pivot-mounted on the thread dosing feeder and the thread dosing feeder has an outlet, and the thread dosing feeder has a re-circulation valve (11, 14, 20), the rotary gate feeder (1) has a concave finger receptor and is formed in one piece, whereby the metering chamber is locked and has an intake and discharge valve (6). |
US10512926B2 |
Finger spray pump and nozzle head for spray pump
A finger spray pump for spraying a medium has a finger-actuated pump head movable between a spraying position and an initial position. The pump has an outlet nozzle and a pump chamber with an inlet valve and an outlet valve, a piston rod, a pump piston, a first spring acting between the piston rod and the pump piston, and a second spring acting between the piston rod and the pump housing. The pump piston is movable between a sealed position and an open position, to form the outlet valve, wherein the pump piston in the sealed position lies on a sealing extension of the piston rod and in the open position allows the passage of medium between the sealing extension and the pump piston. The pump piston is supported on two zones of an outer surface of the piston rod that are axially spaced apart. |
US10512925B2 |
Trigger sprayer
To provide a trigger sprayer that can maintain uniformity of a chemical solution containing fine powder and is superior in flow efficiency. The trigger sprayer of the present invention is designed such that a piston part 5 is moved by a pivotal movement of a trigger part, while being attached to a container, so as to apply a pressure to a liquid inside a cylinder part 42A of a cylinder structural part 4 so that the liquid in the container is jetted from a nozzle part 3 through a passage P.An F valve 2 attached to a bottom part of the cylinder part 42A serving a passage between the cylinder part 42A and the container and an S valve 1 installed in a passage part P between the cylinder part 42A and the nozzle part 3 are installed, and the F valve 2 is constituted by a cylinder-shaped base part 22 and a second valve body 21 having a sealing function as well as a small spring 22A coupling the cylinder-shaped base part 22 and the second valve body 21 to each other, and the second valve body 21 is further provided with a lower face part and a tilt part 21A on an opposite side, and the lower face part is fitted into the bottom part of the cylinder part 42A to be fixed therein, with the second valve body 21 being resiliently made in contact with a second valve mount 42A1 formed on the bottom part of the cylinder part 42A, and by pushing the tilt part 21A of the second valve body 21 by the bottom part of the piston part 5, the second valve body 21 is tilted so that one portion thereof is separated from the second valve mount 42A1, thereby opening the valve. |
US10512924B2 |
Portable misting system with combined air/water nozzle assembly
A portable misting system includes a housing, an air pump carried by the housing to provide a flow of air, a water reservoir carried by the housing to hold a supply of water, and a water pump carried by the water reservoir to provide a flow of water droplets. An air/water nozzle assembly is carried by the housing and includes a nozzle body and a misting nozzle coupled to an output of the nozzle body. The nozzle body has an air input coupled to the air pump to receive the flow of air, and a water input coupled to the water pump to receive the flow of water droplets. |
US10512913B2 |
Microfluidic methods for passive separation of cells and particles
A method of separating a plurality of particles (14) from a portion of fluid, comprising directing the plurality of particles (14) into a microchannel (12). A first portion (16) of particles (14) is focused into an equilibrium position in the microchannel (12). The focused first portion (16) is directed into a first outlet (18) aligned with the equilibrium position. A portion of the fluid is directed into one or more outlets (20, 22). A microfluidic device (10) for separating a plurality of particles (14) from a portion of fluid, comprising a microchannel (12) having a first aspect ratio and a length L, thereby focusing the particles (14) directed therein into an equilibrium position in the microchannel, wherein at least a first portion (16) of the particles (14) focuses at distance X from a beginning of the microchannel (12). A first outlet (18) disposed after distance X and aligned with the equilibrium position to receive at least the first portion (16) of the particles (14) after the first portion (16) focuses into an equilibrium position in the microchannel (12). At least a second outlet (20) for receiving a second portion of the particles (14) before the second portion focuses into an equilibrium position. |
US10512907B2 |
Resin having anion-exchange group, and resin-containing liquid, multilayer body, member, electrochemical element, and electrochemical device that include the same
Provided is a resin including a copolymer having a first structural unit and/or second structural unit and a structural unit having a polar group. R1, R2, R5, and R6 are each independently a hydrogen atom or an alkyl group having 1 to 8 carbon atoms, R3 and R4 are each independently a hydrogen atom or an alkyl group having 1 to 18 carbon atoms, A1 is a saturated carbon chain having 3 to 7 carbon atoms or a structure resulting from substitution of a heteroatom for a part of the carbon atoms of the saturated carbon chain, m and n are each independently 0 or 1, and X1 and X2 are each independently a halide ion, a hydroxide ion, or an anion of an organic or inorganic acid. |
US10512906B2 |
In-situ washing procedure to recover the catalytic activity of a deactivated hydrodesulfurization catalyst
The present invention is an in-situ cleaning procedure for the recovery of catalytic activity of a based alumina HDS catalyst, molybdenum, nickel coated coke and contaminants and it has an HDS activity seriously diminished. The catalyst under study had between 13 and 18 wt % total carbon. Reformate, half the total volume, industrial toluene=35 volume % and Iso-propylic alcohol, 15 volume %, in order to reactivate a deactivated catalyst, a solvent mixture with the following volumetric ratio is prepared. Or it can also be used only reformate (100% volume). The solvent mixture is passed using a LHSV of 2 hr−1 for 72 hours at 50° C. or also using a recirculating three 24-hour cycles at 50° C. Option lasts 24 hours pure reformate LHSV=2h−1 to 50° C. The washed catalyst is fed back to the load reaction conditions maintained for 36 hours at 340° C., to initiate HDS activity balances. During this treatment oxides of molybdenum and nickel in the active phase are re-sulfided by increasing the HDS activity. The In-Situ Cleaning procedure to reactivate deactivated hydrotreating catalysts used to partially remove the carbon and increase the active phase of molybdenum di-sulphide, and also retrieve specific area, and hydrogenation sites that promote higher hydrodesulfurization activity of gasoil after this treatment. |
US10512903B2 |
Modified crystalline aluminosilicate for dehydration of alcohols
The present invention relates to a catalyst composition comprising a modified crystalline aluminosilicate of the Framework Type FER having Si/Al framework molar ratio greater than 20 characterized in that in said modified crystalline aluminosilicate the ratio between the strong acid sites and the weak acid sites, S/W, is lower than 1.0 and having the extra framework aluminum (EFAL) content lowered to less than 10 wt % preferably 5 wt % even more preferably less than 2 wt % measured by 27 Al MAS NMR. The present invention further relates to a process for producing olefins from alcohols in presence of said catalyst composition. |
US10512901B2 |
Selective catalytic reduction catalyst system
Described are SCR catalyst systems comprising a first SCR catalyst composition and a second SCR catalyst composition arranged in the system, the first SCR catalyst composition promoting higher N2 formation and lower N2O formation than the second SCR catalyst composition, and the second SCR catalyst composition having a different composition than the first SCR catalyst composition, the second SCR catalyst composition promoting lower N2 formation and higher N2O formation than the first SCR catalyst composition. The SCR catalyst systems are useful in methods and systems to catalyze the reduction of nitrogen oxides in the presence of a reductant. |
US10512899B2 |
Noble metal-free catalyst compositions
A composition of formula Ce1-a-b-cNaMbDcOx I wherein M stands for one or more elements from the group of alkaline metals, except sodium, N is Bi and/or Sb, D is present, or is not present, and if present is selected from one or more of Mg, Ca, Sr, Ba; Y, La, Pr, Nd, Sm, Gd, Er; Fe, Zr, Nb, Al; a is a number within the range of 0 |
US10512897B2 |
Micron-scale cerium oxide particle having multi-core single-shell structure and preparation method therefor
The present invention involves micron-scale cerium oxide particles having a multi-cores single-shell structure, comprising: a cerium oxide shell, the shell being composed of crystalline and/or amorphous nano-scale cerium oxide particles; and a plurality of nano-scale cerium oxide grain cores aggregates located in the interior of the shell. Also involved is a preparation method for the micron-scale cerium oxide particle having a multi-cores single-shell structure. A supported catalyst with the micron-scale cerium oxide particles according to the invention as the support have good hydrothermal stability and good sulfur resistance, and the active components of the supported catalyst are not easily embedded, and the supported catalyst has a great application prospect in the field of catalytic oxidation of exhaust emissions such as CO, NO or volatile organic compounds. |
US10512893B2 |
Structured adsorbent beds, methods of producing the same and uses thereof
Structured adsorbent beds comprising a high cell density substrate, such as greater than about 1040 cpsi, and a coating comprising adsorbent particles, such as DDR and a binder, such as SiO2 are provided herein. Methods of preparing the structured adsorbent bed and gas separation processes using the structured adsorbent bed are also provided herein. |
US10512888B2 |
Multiple identification point automated parameter assurance method
Systems and methods provide automated parameter assurance features and results for consumables used in bioprocessing and particularly for purifying, filtering, harvesting and collecting bioprocessing fluids. Consumables having these features are sized, shaped, configured and constructed to interface with and be a component of such a bioprocessing system that includes a multi-use component or device with which it operatively engages such as by docking, engagement with a connector or other approach that allows for insertion and removal of the consumable. The consumable may be a component having a single-use life or a limited life. Each consumable has a median by which information, which can include use limits and specifications, is associated with that specific consumable, and those limits and specifications are communicated to the multi-use component which indicates any inappropriateness for use with the multi-use component. |
US10512887B2 |
Fluidized bed reactor with pinching fittings for producing polysilicon granulate, and method and use for same
Control of the flow of granular polysilicon granules is effected by employing an elastomeric pinch sleeve valve. The flow control by this method is especially useful for controlling the flow of silicon seed particles and granular polysilicon product in the fluidized bed method for producing polysilicon. The flow may be stopped without gas leakage, and is suitable for use over long operating campaigns. |
US10512886B2 |
Granulating ammonium sulfate
A device for producing granules that include ammonium sulfate may include a mixing device, an atomizing device and a fluidized bed. The mixing device may be utilized to produce a composition comprising ammonium sulfate and aluminum sulfate. The atomizing device may be disposed downstream of the mixing device and may be utilized to atomize the composition produced in the mixing device. The fluidized bed may also be disposed downstream of the mixing device. The fluidized bed may be utilized for producing the granules. Further, with respect to a process for producing granules comprising ammonium sulfate, a step of granulating a composition comprising ammonium sulfate and aluminum sulfate may involve providing ammonium sulfate-containing nuclei, fluidizing the ammonium sulfate-containing nuclei, and atomizing the composition onto the nuclei. |
US10512883B2 |
Process for dehumidifying moist gas mixtures
The invention relates to a process for dehumidifying a moist gas mixture. The invention further relates to an apparatus for dehumidifying a moist gas mixture and to the use of said apparatus in the process according to the invention. |
US10512879B2 |
Photocatalytic filtration system and method of reducing hazardous gases
The disclosure provides a system and a method for reducing hazardous gases, including PHGs, through one or more photocatalysts in a filter system. A microstructure of the photocatalytic filter can be formed using biological systems as a template for the photocatalysts to be deposited thereon. The biological system can be removed by heat, oxidation, or by chemical processes to leave the photocatalytic template as a filter for the gases. In various embodiments, multiple photocatalysts can be activated at different wavelengths to filter different gases, or multiple photocatalysts can be activated at the same wavelength to filter different gases, or a photocatalyst can be activated at different wavelengths to filter different gases, or some combination thereof. The activation can be sequential or concurrent. For multiple layers of photocatalysts, the sequence of the photocatalysts can be arranged to reduce damaging output from an upstream photocatalyst to one or more downstream photocatalysts. |
US10512871B2 |
Dust collector control system
A control system integrated into an industrial dust collector. The system has at least one programmable processing unit that communicates with a plurality of sensors located in the dust collector to provide data of the collector's behavior with feedback allowing real-time modifications to the operating parameters defined during the design. Additionally, a service-life prediction element of used-filters based on a reference chart is included. |
US10512865B2 |
Devices and methods for aligning filters in a holding frame
A filtration system for a gas turbine engine is provided. The filtration system may include a holding frame with a positioning element extending therefrom and a filter element for mounting within the holding frame. The frame of the filter element may include a positioning slot therein such that the positioning element extends into the positioning slot when the filter element is mounted within the holding frame. |
US10512861B2 |
Electret fiber sheet
A fiber sheet is densely charged with electric charge and provides an electret fiber sheet that has excellent dust collecting performance. The electret fiber sheet is an electret fiber sheet in which averages of a* values and b* values satisfy all requirements of the following (a) to (c): (a) 10≤average of (a* values)≤40; (b) −25≤average of (b* values)≤0; and (c) −5≤average of [(a* values)+(b* values)]≤40; wherein a* and b* are values measured by a spectrophotometer when a red positive charge toner and a blue negative charge toner are attached. |
US10512859B2 |
Housing for filter element; filter element; methods of use and making
A filter assembly includes a filter head and filter cartridge. The filter cartridge includes a housing and element. The housing includes a can with an open mouth. An interface ring is secured to the can adjacent to the open mouth. The outer ring surface is against the inner wall of the can. The ring wall is angled between the first and second ends greater than one degree and less than 6 degrees. Methods of filtering and making the housing are provided. |
US10512858B2 |
Membrane plate, filter plate and filter press
A membrane plate, a filter plate, and a filter press. The membrane plate is outfitted with a filter element on top of the membrane on both side surfaces, and the membrane plate has retaining elements at a distance from the margin on which the filter elements are removably secured. The filter plate also has retaining elements at a distance from the margin on which the filter elements are removably secured. |
US10512856B1 |
Method of extracting one or more chemical extracts from a plant product
Disclosed is a method for extracting one or more chemical extracts from a plant product. The chemical extracts are purified and extracted by first separating at least a phytochemical bearing part of a plant product from one or more other portions of the plant product. A carrier oil is then heated at a target temperature to be used as the vehicle for extraction and then mixed with the at least a phytochemical bearing part while the target temperature is maintained. The process may be streamlined by having heating and mixing occur in a press device. The mixed carrier oil and the at least a phytochemical bearing part are then passed through the press device to produce an oil mixture. At least a chemical extract may be extracted from the oil mixture, and in some cases may be further purified by evaporation and/or centrifugation. |
US10512855B2 |
Method for extracting oil from a water and solids composition, method for the production of ethanol, and ethanol production facility
The present disclosure includes a method for processing a beer stream for the recovery of oil. The method include a step of extracting oil from a beer stream into an organic phase comprising an organic solvent to provide in the organic phase at least a portion of the oil. In general, a beer stream refers to a composition containing alcohol, water, oil, and particulates, and can be a result of a fermentation process. When the beer stream is a beer stream from a fermentation process, it can be referred to as a fermentation broth even if it is no longer being subjected to fermentation. The beer stream can contain other components commonly found in a stream coming off a fermentation process such as, for example, glycerol and acetic acid. A method for producing ethanol, and an ethanol production facility are provided. |
US10512853B2 |
Circuit blocks
Circuit blocks are provided. A circuit block may include a substrate and at least one electrical component mounted on the substrate. The circuit block may also include a non-conductive frame coupled to the substrate, and at least one post coupled to the substrate and extending from the substrate and through at least a portion of the frame in a first direction substantially perpendicular to the major surface of the substrate. Moreover, the circuit block may include a contact coupled to a second, opposite surface of the substrate and including a corner section projecting outwardly from the frame and extending in at least two directions substantially perpendicular to a longitudinal axis of the at least one post. The block may also include at least one magnet positioned proximate the flexible corner section of the contact and configured to magnetically attract at least one other circuit block. |
US10512852B2 |
Toy vehicle track set
A track for a toy vehicle includes several track units. Each track unit has an upper layer and a spaced apart lower layer. Each of the adjacent units comprises two sections. A first section has an upper side for supporting the toy vehicle and a bottom side. A second section has an upper layer having a top side for supporting the toy vehicle and a lower base. The first section has a first connector, and the second section has a mating second connector. The first and second connectors are connectable so that first and second sections are connectable in an adjacent unit to form an adjacency relationship. Each unit includes a first section and two second sections. Two second sections are located at opposite longitudinal ends of the first section. The first section is bendable in a longitudinal sense substantially parallel to a plane on which a track is directed from one end to the other end in a track running direction. The second section is bendable in a transverse sense substantially transverse to a plane on which a track is directed from one end to the other end in a track running direction. |
US10512847B2 |
Motion detecting balance, coordination, mobility and fitness rehabilitation and wellness therapeutic virtual environment
Systems and methods for providing a Digital Health Platform (“DHP”) game for execution on a computing device. The methods comprise: running code on the computing device to facilitate lower extremity tracking in a low light condition and the provision of the DHP game having a virtual environment in which a person is to interact with at least one virtual object; using the code to obtain tracked data defining tracked movements of at least the person's lower extremities as the person plays the DHP game in the low light condition; increasing an accuracy of at least position data contained in the tracked data by performing coarse filtering operations and fine filtering operations using the position data; and recreating the person's lower extremity movement in the virtual environment using the position data which has been coarse and fine filtered. |
US10512846B2 |
Emulating player behavior after player departure
Multiplayer video games involve multiple players playing using either a single computer system or multiple computer systems connected together. While a first player of the multiplayer game is playing the multiplayer game, the first player's actions are tracked and stored. When the first player quits or stops responding before the multiplayer game has completed, the first player is replaced by a computer-simulated version of the first player that selects its actions based on probabilities calculated from the tracked actions of the first player. The multiplayer game is thus able to continue without interruption or disruption, and the first player's playstyle is preserved. |
US10512845B2 |
Real-time manipulation of gameplay through synchronous signal consumption in non-interactive media
Systems, methods and articles of manufacture for manipulating an interactive gameplay of a mobile device in real-time based on a state of a physical environment in which the mobile device is located. Embodiments include receiving, from one or more sensor devices of the mobile device during an interactive gameplay of an application on the mobile device, data characteristic of operating conditions of the environment in which the mobile device is located. Once the application determines that data received from the sensors satisfies conditions configured on the application for each type of sensor device, embodiments determine whether to manipulate the interactive gameplay by querying a remote database for one or more gameplay effects corresponding to the data. Once a response identifying at least one gameplay effect associated with the data is received, embodiments manipulate the interactive gameplay based on the identified gameplay effect. |
US10512838B2 |
Uniform game display across multiple devices
A gaming system has a game server executing software managing a game based on a virtual environment, the game server interacting with a plurality of gaming platforms used by players, receiving update commands from players, updating the virtual environment and serving updated display data to the platforms, and a plurality of game-play behavioral profiles stored in a data repository accessible to the game server, the behavioral profiles specific to individual ones of the players and gaming platforms used by the players, and storing predictive responses associated with circumstances of update commands received. Upon receiving an update command from a player concerning an object controlled by that player, the game server, through the software, poses a query conditioned by the circumstances to the behavioral profile of the player, and if a predictive response is returned, conditions updated predictive display data sent to all players according to the predictive response. |
US10512832B2 |
System and method for a golf event using artificial reality
A system and method for creating content such as artificial reality (AR) messages at an event, particularly among members on a social network, thereby enhancing and expanding the event experience. Typically, a participant shares an event with spectators, such as friends or a subset of friends in the participant's social network. The AR message may include geo-referenced artificial reality words, products or symbols and appear in a perspective view of the event to the participant or spectators. In addition to creating an active gallery for an event, messages, audio and video can be exchanged among participants and spectators, and virtual goods, money, bets, applause, other feedback, and donations exchanged. |
US10512831B2 |
Golf aid including heads up display for green reading
An electronic golf aid system for assisting users with reading greens on golf courses includes a camera that captures images of the user's field of view, and an electronic display device with a display screen that displays captured images. A processor, which communicates with the camera and display device, is programmed to: receive signals from the camera indicative of images of a golf ball and a cup on the green; determine respective locations for the golf ball and cup; determine a perspective view of the topology of the green between the golf ball and cup from the user's point of view; determine, based on the green's topology, a proposed trajectory line from the golf ball's location to the cup's location; and direct the electronic display device to display the proposed trajectory line superimposed on the surface of the green as the green is shown in real-time on the display screen. |
US10512829B2 |
Golf club heads and methods to manufacture golf club heads
Embodiments of golf club heads and methods to manufacture golf club heads are generally described herein. In one example, a golf club head may include a body portion having an interior cavity, a port connected to the interior cavity, a toe portion, a heel portion, a top portion, a sole portion, a back portion, a port, and a front portion having a perimeter ledge portion defining at least a portion of an outer boundary of the front portion. The example golf club head may also include a face portion having a front surface with at least one groove and a back surface opposite the front surface and associated with a total back surface area. The back surface may include a first back surface region associated with a first back surface area and a second back surface region associated with a second back surface area. The total back surface area may equal to the sum of the first back surface area and the second back surface area. The first back surface region may be located at or proximate to a perimeter portion of the back surface and coupled to the perimeter ledge portion. Other examples and embodiments may be described and claimed. |
US10512828B2 |
Manufacture method for partial structure refinement of a forged iron golf club head
A manufacture method for partial structure refinement of a forged iron golf club head includes a preparing step, a first preforming step, a second preforming step, a fine-forging shaping step, a partial structure refinement step, and a final shaping step. The manufacture method is capable of partially refining the particle structure of the final workpiece. The hardness of a hitting surface of the final workpiece is reinforced to generate clear and loud sounds and to achieve better hitting performance and experience. |
US10512825B1 |
Multi-component golf club head having a hollow body face
The invention provides a golf club head constructed from multiple components formed of different materials. In particular, a club head of the present disclosure includes a club head body, such as a cast or forged body portion, made from a first metal, and at least one removable component configured to be releasably attached to the club head body, the removable component being made from a second metal that is different than the first metal. The golf club head includes a semi-hollow, or completely hollow-bodied, ball-striking face cartridge made from at least titanium. In some embodiments, the hollow face cartridge may be integrally formed with the club head body. In other embodiments, the hollow face cartridge may be formed separately from the club head body and may be removed from and re-attached to the club head body. |
US10512820B2 |
Balance exercise device
A multi-purpose balance exercise device designed to be used in multiple positions and for diverse exercises. For example, various embodiments allow for the device to be used as an aerobic step device as well as the ability to easily adjust the device to various heights to easily decrease the level of difficulty of the device for use during various exercises. The balance exercise device can provide a plurality of handles and grab points both horizontally and vertically, which allow for an enhanced number of exercises or movements using either the top and/or bottom of the device. The exercise device includes a flexible bladder filled with air, other gases, or gels attached to a substantially rigid base. The base can include an interior within which features such as handles are disposed to provide a gripping or lifting exercise for which the balance exercise device can be used. |
US10512818B2 |
Portable compact cycling trainer
A micro, compact cycling utility with an adjustable and modifiable structure that can perform as cycling or exercise equipment. The invention encompasses a housing that can be used as a case and/or attachment, crank arms, pedals and a stand. In the exemplary embodiment, the crank arms and pedals and stand are modifiable and adjustable. |
US10512809B2 |
Fire monitoring and suppression system
A system for detecting and extinguishing fires occurring within a predetermined observation area in response to commands received from a monitoring center. The system includes a source of fire retardant liquid and a monitor for selectively directing liquid to the observation area. A valve is disposed in fluid communication between the source and the monitor and is selectively movable between a closed position wherein liquid is prevented from flowing through the valve, and an open position wherein liquid can flow through the valve. An infrared camera generates a signal in response to temperature changes occurring in the observation area. A network switch is provided for communicating with the monitoring center. A control unit in communication with the valve, the camera, and the network switch relays the signal to the monitoring center and moves the valve between the positions in response to commands received from the monitoring center. |
US10512807B2 |
Portable fire hose dewatering device
A portable fire hose dewatering device made of durable materials and used by one or more persons. It is considered fire fighting equipment and more specifically for efficiently removing the water from fire hoses prior to the hoses being rolled and stored. The device includes a mounting base, a rotatable shaft, bearings at the shaft ends, a pair of side structures/flanges on the mounting base, a spacer bar, and a set of pull handles connected to the side flanges. |
US10512806B2 |
Fire suppression system
A fire suppression system comprising a polymer housing and an internal channel arranged to communicate a fluid from a fluid inlet to a fluid outlet. The fluid outlet is in the form of at least one aperture extending through a portion of the polymer housing into said channel. |
US10512804B2 |
Fluid delivery system and method of use
Systems and methods of dispensing fluids such as fire suppressant include a fire suppressant delivery system having at least one fire suppressant delivery apparatus. The fire suppressant delivery apparatus includes a tower member, at least one dispensing mechanism mounted to the tower member and operable to adjust at least one of a dispensing angle relative to a horizontal plane and a dispensing angle circumferentially about the tower member, at least one fire monitoring device mounted to the tower member and operable to detect fire, and a flow regulator automatically operable to control flow of a fire suppressant to the at least one dispensing mechanism in response to fire detected by the at least one fire monitoring device. |
US10512802B2 |
Energy absorber cover and horizontal lifeline system including the same
A cover for an energy absorber for use in a horizontal lifeline system includes four cover pieces structured to interlock together to form the cover. Each cover piece includes an interlocking section structured to slide into the interlocking section of another one of the cover pieces, a number of tabs, and a number of tab receivers. The number of tabs are structured to snap together with the tab receivers of another one of the cover pieces and the number of tab receivers are structured to snap together with the tabs of another one of the cover pieces. |
US10512798B2 |
Method and apparatus for providing air flow
Provided is a powered air blower unit for delivering air flow to a user with constant air flow or varying speeds of air flow. The air blower unit may also include a filter for purifying the air. |
US10512797B2 |
Data communication and displays for breathing apparatus facepieces and pressure regulators
A system includes a pressure regulator including a housing, an inlet for connection to a pressurized gas comprising oxygen, and at least one energy transfer element. The system further includes a respiration facepiece including at least one seal system to form a sealing engagement with the face of a user to encompass the nose and mouth of the user, thereby creating a volume of sealing engagement between the respiration facepiece and the user, an opening into the volume of sealing engagement of the respiration facepiece in communicative connection with an interface for removable attachment of the pressure regulator to the respiration facepiece, and an inspiration port in fluid connection with the interface and in fluid connection with the volume of sealing engagement. The pressure regulator interface includes at least one cooperating energy transfer element such that energy can be transferred between the at least one energy transfer element and the at least one cooperating energy transfer element to transfer at least one of data or power into the volume of sealing engagement. |
US10512793B2 |
Radiation fluoroscopy apparatus
A radiation fluoroscopy apparatus detects a marker and includes a control element, an image generation element 61 that generates an image including an embedded marker inside the body of the subject based on a transmitted X-ray. A device candidate detection element 62 detects the candidate of the marker, the local structure detection element 63 detects the local structure in the target region in a proximity of the candidate point of the marker, the device determination element 64 determines whether the local structure is the device such as the marker or not, the device location acquisition element 66 acquires the gravity center coordinate of the local structure, and the device tracking element 67 tracks the marker based on the location of the marker in each frame. |
US10512792B2 |
Automatic plan optimization for changing patient anatomy in the presence of mapped delivered dose from delivered fractions
A therapy planning system and method generate an optimal treatment plan accounting for changes in anatomy. Therapy is delivered to the subject according to a first auto-planned optimal treatment plan based on a first image of a subject. A second image of the subject is received after a period of time. The second image is registered with the first image to generate a deformation map accounting for physiological changes. The second image is segmented into regions of interest using the deformation map. A mapped delivered dose is computed for each region of interest using the dose delivery goals and the deformation map. The first treatment plan is merged with the segmented regions of the second image and the mapped delivered dose during optimization. |
US10512790B2 |
Systems and methods for generating radiation treatment plans
Target values for quality metrics associated with the radiation treatment plan are accessed. Cost function contours are generated; each of the cost function contours includes a respective first set of values of the quality metrics calculated with a respective cost function based on a respective one of the target values. A region that includes a second set of values of the quality metrics is defined; the region is bounded by the cost function contours. A final (optimized) radiation treatment plan is selected from a set of radiation treatment plans that have values of the quality metrics that are within the region. |
US10512781B2 |
Reduction or elimination of pace polarization effects
The present disclosure relates to cardiac evoked response detection and, more particularly, reducing polarization effects in order to detect an evoked response following delivery of a stimulation pulse. An implantable medical device (IMD) is configured to deliver a ventricular pacing pulse. A signal is sensed in response to the ventricular pacing stimulus. A window is placed over the sensed signal to obtain a set of data from the signal after a paced event. The set of data extracted from the sensed signal comprises a maximum amplitude, a maximum time associated with the maximum amplitude, a minimum amplitude, and a minimum time associated with the minimum amplitude. Responsive to processing the extracted data, the window is delayed to avoid polarization effects. A determination is then made as to whether the ventricular pacing stimulus is capturing the paced ventricle in response to determining whether the maximum time is greater than the minimum time. |
US10512778B2 |
System and method for delivering modulated sub-threshold therapy to a patient
A neuromodulation system configured for providing sub-threshold neuromodulation therapy to a patient. The neuromodulation system comprises a neuromodulation lead having at least one electrode configured for being implanted along a spinal cord of a patient, a plurality of electrical terminals configured for being respectively coupled to the at least one electrode, modulation output circuitry configured for delivering sub-threshold modulation energy to active ones of the at least one electrode, and control/processing circuitry configured for selecting a percentage from a plurality of percentages based on a known longitudinal location of the neuromodulation lead relative to the spinal cord, computing an amplitude value as a function of the selected percentage, and controlling the modulation output circuitry to deliver sub-threshold modulation energy to the patient at the computed amplitude value. |
US10512777B2 |
Spinal cord stimulator system
Spinal cord stimulation (SCS) system having a recharging system with self-alignment, a system for mapping current fields using a completely wireless system, multiple independent electrode stimulation outsource, and [PG control through software on Smartphone/mobile device and tablet hardware during trial and permanent implants. SCS system can include multiple electrodes, multiple, independently programmable, stimulation channels within an implantable pulse generator (IPG) providing concurrent, but unique stimulation fields. SCS system can include a replenishable power source, rechargeable using transcutaneous power transmissions between antenna coil pairs. An external charger unit, having its own rechargeable battery, can charge the IPG replenishable power source. A real-time clock can provide an auto-run schedule for daily stimulation. A bi-directional telemetry link informs the patient or clinician the status of the system, including the state of charge of the IPG battery. Other processing circuitry in current IPG allows electrode impedance measurements to be made. |
US10512775B2 |
Noise reduction for implantable hearing prostheses
Presented herein are techniques for time interleaving the sampling of input signals with the delivery of stimulation signals to a recipient of an implantable electrically-stimulating hearing prosthesis. The input signals, which are received via one or more input channels and sampled by a sound processing unit, are susceptible to electrical feedback from the stimulation signals. As such, in accordance with embodiments presented herein, the sampling of the input signals by the sound processing unit, and the delivery of the stimulation signals to the recipient, are synchronized with one another so as to avoid stimulation-evoked electrical feedback within the input signals. |
US10512769B2 |
Non-invasive magnetic or electrical nerve stimulation to treat or prevent autism spectrum disorders and other disorders of psychological development
Devices, systems and methods are disclosed for treating or preventing an autism spectrum disorder, a pervasive developmental disorder, or a disorder of psychological development. The methods comprise transmitting impulses of energy non-invasively to selected nerve fibers, particularly those in a vagus nerve. The nerve stimulation may be used as a behavior conditioning tool, by producing euphoria in an autistic individual. Vagus nerve stimulation is also used to modulate circulating serotonin levels in a pregnant woman so as to reduce the risk of having an autistic child; modulate the levels of growth factors within a child; promote balance of neuronal excitation/inhibition; modulate the activity of abnormal resting state neuronal networks; increase respiratory sinus arrhythmia; and avert episodes of motor stereotypies with the aid of forecasting methods. |
US10512768B2 |
Clamp device for flexible tube
A clamp device for a flexible tube which can minimize the sealing area and prevent leakage of fluid and achieve easy release of the clamp device of a flexible tube. A clamp device for a flexible tube comprising: one branch formed with a first projection; the other branch formed with a second projection opposing to the first projection; an intermediate part connecting the one branch and the other branch each other; and an engaging part formed on a tip end of the other branch adapted to be engaged with an engaged part formed on a tip end of the one branch; flow of fluid within the flexible tube laid between the first projection and the second projection being able to be blocked by elastically bending the intermediate part and engaging the engaging part and the engaged part each other to clamp the flexible tube between the first and second projection wherein the clamp device comprises a positioning part for positioning the first and second projections in the longitudinal direction of the flexible tube under the clamped state of the flexible tube with engaging the engaging part and the engaged part each other. |
US10512765B2 |
Method of manufacturing sheet with needle like protrusions
The method includes the steps of: preparing a mold and a liquid filling device; and filling needle-like recessed portions with a liquid medicine by repeating the following: a filling operation in which the liquid medicine is supplied to the mold from the liquid filling device and the needle-like recessed portions are filled with the liquid medicine while a nozzle tip is brought into pressed contact with a surface of the mold; and a moving operation in which a nozzle is relatively moved with respect to the mold while the nozzle tip and the surface of the mold are in contact with each other, wherein the nozzle is held in a Z-axis drive unit configured to vertically move the nozzle while an elastic body is provided in the Z-axis drive unit, while the nozzle tip is brought into pressed contact with the surface of the mold. |
US10512763B2 |
Dilation catheter with expandable stop element
A catheter system includes a balloon dilation catheter. The balloon dilation catheter includes an elongate shaft, an expandable dilation balloon, and an expandable stop element. The elongate shaft has a dilation balloon lumen that is configured to couple with a first fluid supply. The expandable dilation balloon is coupled to the elongate shaft and is fluidly connected to the dilation balloon lumen. The expandable dilation balloon is configured to transition between an inflated state and a non-inflated state. The expandable stop element is distal to the expandable dilation balloon. The expandable stop element is configured to transition between an expanded state and a non-expanded state. The expanded dilation balloon is configured to define a larger outer diameter in the inflated state than an outer diameter defined by the expandable stop element in the expanded state. |
US10512755B2 |
Septum securement
A catheter assembly may include a catheter adapter, which may include a proximal end, a distal end, and a lumen extending between the proximal end and the distal end. The distal end may include a catheter configured to be inserted into vasculature of a patient. The catheter assembly may also include a septum, which may be disposed within the lumen of the catheter adapter. The septum may be secured within the lumen in response to increased pressure by one or more of the following: one or more septum stoppers, a retention disc of a needle assembly, a U-shaped washer, and a conical washer. |
US10512754B2 |
Sensor-bearing tip and medical device including the same
A tip for a medical device includes a hollow body having a window, a sensor positioned within the hollow body and oriented such that its active surface is pointed towards the window, and a membrane positioned within a beam path of the sensor. The membrane passes energy without preventing an outer surface of the hollow body of the tip from coming in contact with tissue, thus allowing the hollow body to deliver therapy to an adjacent tissue and/or diagnose adjacent tissue. The membrane can cover the window or the sensor. The membrane is desirably permeable to an irrigant, such that a suitable level of irrigant outflow from the window is maintained, and thin enough that it minimizes attenuation of energy passing to and/or from the sensor. |
US10512753B1 |
Composite catheter shafts and methods and apparatus for making the same
A medical device includes an elongate shaft including a multifilar coil comprising a first strand and a second strand wound in the same winding direction, the multifilar coil comprising a first section having a first end and a second end wherein the first strand and the second strand are wound with identical pitch patterns between the first end and the second end of the first section, the multifilar coil further comprising a second section having a first end and a second end, wherein the first strand and the second strand are wound with different pitch patterns from each other between the first end and second end of the second section, and a polymeric tubular member coextending with the multifilar coil. |
US10512752B2 |
Catheter tray, packaging system, and associated methods
A tray (100) for accommodating a coiled medical device, such as a catheter assembly (700), includes a first compartment (101), a second compartment (102), and a third compartment (103). The catheter assembly (700) and devices associated with a catheterization procedure, such as syringes (701,702) containing sterile water and lubricating jelly and a specimen container (703) can be disposed within the tray. Printed instructions (1001) can be included with the tray (100). When a CSR wrap (1000) is disposed about the tray (100), the printed instructions can be placed atop the CSR wrap (1000) but beneath an outer sterile wrap (1002). The printed instructions (1001) can include a patient portion (1202) that is detachably coupled to a health care services portion (1201) such that it can be taken home with the patient after the procedure. |
US10512745B2 |
Patient interface systems
A patient interface is configured to deliver a flow of pressurized breathable gas to a patient's airways. The patient interface includes a central portion with an opening configured to deliver the pressurized breathable gas to the patient's nares. A first stabilizing portion extends from the central portion and is structured to engage an outer side of a respective one of the patient's nostrils. A second stabilizing portion is opposite the first stabilizing portion and extends from the central portion. In addition, the second stabilizing surface is structured to engage an outer side of a respective one of the patient's nostrils. The central portion, the first stabilizing portion and the second stabilizing portion cooperate to form a U-shape configured to cradle the patient's nose so that the tip of the patient's nose remains exposed when the patient interface is mounted on the patient's face. |
US10512741B2 |
Clinical decision support system and methods
The present invention provides clinical decision support that can be used with non-portable and portable systems when delivering and/or monitoring delivery of a therapeutic gas comprising nitric oxide to a patient. Further, clinical decision support can be used with non-portable and portable systems during delivery and/or monitoring of delivery of therapeutic gas when nebulized drugs may and/or may not be being delivered to a patient (e.g., when nebulizers are delivered upstream in the inspiratory limb of the breathing circuit, into a breathing gas delivery system, etc.). |
US10512739B2 |
Inhalation device for use in aerosol therapy of respiratory diseases
An inhalation device, assembly or system can include a kit and a pharmaceutical composition. The device can be adapted for administering therapeutic aerosols to pediatric patients, including neonates, infants or toddlers. The device can further include a vibrating mesh aerosol generator that can be insertable into a flow channel of the inhalation device through a lateral opening, and a valved face mask. The device can be connectable to a gas source through which a gas, such as oxygen, can be received into the flow channel at a low flow rate. |
US10512735B2 |
Fluid warming device
A fluid warming device for warming fluids and delivering the fluids to a patient comprises an electrical heating component, a temperature sensor, and a control unit. The electrical heating component warms fluid passing through a fluid-carrying tube and may be positioned along the fluid-carrying tube at a desired location or embedded in the fluid-carrying tube while the control unit is positioned such that the display and user inputs are accessible to a caregiver. The control unit activates the electrical heating component until the fluid-carrying tube is warmed to a desired temperature within a Thermal Neutral Zone (TNZ) as sensed by the temperature sensor. |
US10512730B2 |
Piston washer for a drug delivery device and drug delivery device incorporating such piston washer
The present invention relates to a piston washer (109, 209) for use in a drug delivery device for transferring a distally directed axial force from a piston rod (107, 207) towards a piston (199, 299) of a held cartridge (189, 289). The piston washer (109, 209) defines a proximal surface portion (109a) adapted for engagement with the distal portion of a piston rod (107, 207) and a distal surface portion (109b) configured to engage and abut a piston (199, 299). An axial distance defining device (19a1, 109b1, 109c, 209c) is positioned between the proximal surface portion (109a) and the distal surface portion (109b), wherein the axial distance defining device (19a1, 109b1, 109c, 209c) is configured to be shifted from a first axial compressible state into a second axial non-compressible state. The invention further relates to a drug delivery device incorporating such piston washer (109, 209). |
US10512729B2 |
Priming arrangement for drug delivery device
An injection device (100) for injection of a medicament from a pre-filled container (10) having a container body (12) for containing the medicament, a needle (16) disposed at a distal end of the container body (12), a removable needle shield (30) and a stopper (22) for expelling medicament from the container (100), the device comprising a housing (110) for housing the container (10), a plunger (142) for driving the stopper (22) of the container (10) in a distal direction to expel the medicament, and a priming mechanism having an operating member (152) which is movable with respect to the housing (110). The priming mechanism is arranged to release the needle shield (30) from the needle (16) and to move the container body (12) in a proximal direction with respect to the plunger (142) upon movement of the operating member (152) from a first position to a second position during an operating sequence of the device. |
US10512728B2 |
Filtering needle cap with a seal around a needle
A filtered needle for use in administering a liquid payload, including a needle and connector portion and a filtering needle cap. The filtering needle cap including a distal open end in fluid communication via an internal channel with a proximal open end of the filtering needle cap. The filtering needle cap proximal end sized to receive the distal end of the hub within the proximal end of the filtering needle cap to reversibly engage the hub when needle distal end is inserted into the internal channel. The filtering needle cap including a filter element and a seal to seal around an outside diameter of the hollow needle so that liquid payload is drawn into the lumen in the hollow needle as liquid payload is filtered and drawn into the fluid fitting. The filtering needle cap is designed to limit a dead volume of liquid payload drawn into the filtering needle cap but not entering into the distal end of the hollow needle. |
US10512725B1 |
Information transmitter attached to medication container
The present disclosure relates to an information transmitter having an electronics circuit, said electronics circuit has a transmitter; an antenna operably connected to said transmitter. Memory storage elements are also included having unique identification data with at least one activation element capable of activating said electronics circuit to transmit said unique identification data to external receivers. The present disclosure also relates to a medicament delivery device utilizing the information transmitter. |
US10512723B1 |
Control of a peripheral device with a bandage-type analyte sensor
An example system includes a flexible substrate configured to be mounted to a skin surface. The system includes a sensor probe that has a first end attached to the flexible substrate and a second end configured to extend beneath the skin surface to contact interstitial fluid. A sensor is configured to measure a physiological property and is disposed at the second end of the sensor probe. A transmitter is attached to the flexible substrate and is configured to provide information related to sensor measurements to a controller. The controller is configured to a drug delivery rate based on the information. |
US10512708B2 |
Bioadhesive hydrogels
A bioadhesive includes a crosslinked biodegradable hydrogel that includes a plurality of oxidized, acrylated or methacrylated, natural polymer. Bioadhesives are natural or synthetic materials that can be used for soft tissue repair to create a seal preventing leakage of biological fluids or to reinforce anatomic integrity as an attractive alternative to sutures and staples. The most widely used bioadhesives are fibrin, cyanoacrylates, and albumin-glutaraldehyde bioadhesives. |
US10512706B2 |
System and method for releasing flavor
A system for releasing flavor is disclosed. The system comprises: a plurality of compartments adapted to receive a respective plurality of capsules, each capsule containing therein a flavor material; a dispenser system configured for dispensing into an environment a fluid obtained from at least one flavor material; and a controller configured for receiving data pertaining to a selection of at least two of the compartments and for signaling the dispenser system to dispense fluids obtained from flavor materials contained in capsules of the selected compartments. |
US10512700B2 |
Radiohalide-labeled targeted diagnostics and therapeutics
Disclosed are chemical entities of formula (I) wherein R1, R2 and n are defined herein, and methods of use thereof. These chemical entities are radiative emitters and are useful, e.g., as therapeutic agents for the treatment of, or as diagnostic (e.g., imaging) agents for cancers, e.g., cancers in which PARP1 is overexpressed. |
US10512699B2 |
Optical method for the detection of Alzheimer's disease using curcumin
The present subject matter relates to a non-invasive optical imaging method for monitoring early pathological events specific to Alzheimer's disease (AD), such as the development, amount and location of amyloid plaques. The ability to monitor such events provides a basis for, among other things, AD diagnosis, prognosis and assessment of potential therapies. In addition, the present subject matter introduces novel methods for treating AD and retinal ailments associated with AD. Aβ-plaque detection in living brains is extremely limited, especially at high resolution; therefore the present invention is based on studies focusing on the eyes as an alternative to brain-derived tissue that can be imaged directly, repetitively and non-invasively. |
US10512693B2 |
Pharmaceutical compositions comprising meloxicam
Disclosed herein are compositions comprising an NSAID such as meloxicam and/or rizatriptan in combination with a cyclodextrin and/or a carbonate or a bicarbonate. These compositions may be orally administered, for example, to improve the bioavailability or pharmacokinetics of the NSAID for the treatment of pain such as migraine, arthritis, and other conditions. Also disclosed herein are methods of treating pain, such as migraine, comprising administering meloxicam and rizatriptan to a human being suffering from pain, such as migraine. For migraine, these methods may be particularly useful when the meloxicam and rizatriptan are administered while the human being is suffering from an acute attack of migraine pain or migraine aura. In some embodiments, the combination of meloxicam and rizatriptan may be administered in a manner that results in a Tmax of meloxicam of 3 hours or less. |
US10512687B2 |
Compositions and methods for enhanced innate immunity
The disclosed compositions and methods relate to an immunogenic composition that, in certain aspects, comprise cationic liposomes; a mixture of toll like receptor 3 (TLR3) and toll like receptor 9 (TLR9) ligands; and a cellular adhesion agent, and methods of using such compositions. In certain aspects, disclosed compositions are administered to a mammal to induce a non-specific innate immune response at mucosal surfaces. In further aspects, disclosed compositions are administered to a mammal in conjunction with an antigen to enhance the immune response of the mammal to the antigen. |
US10512681B2 |
Non-lipidated variants of Neisseria meningitidis ORF2086 antigens
The present invention relates to compositions including an isolated non-pyruvylated non-lipidated ORF2086 polypeptide, and methods thereof. In an exemplary embodiment, the compositions described herein are immunogenic. The present invention further relates to compositions that elicit a bactericidal immune response in a mammal against an ORF2086 subfamily B polypeptide from serogroup B Neisseria meningitidis, and methods related thereto. |
US10512671B2 |
IL-24 to treat inflammatory diseases
Methods are provided for treating ocular surface inflammation and/or uveitis in a subject. The methods can include selecting a subject with uveitis and/or ocular surface disease. The methods can then include administering to the subject a therapeutically effective amount of an interleukin 24 (IL-24) polypeptide or nucleic acid encoding the IL-24 polypeptide. In some examples, the administered IL-24 polypeptide suppresses production of effector cytokines by Th17 cells. A pharmaceutical composition is further provided here that includes an IL-24 polypeptide or nucleic acid encoding the polypeptide. In some examples, the IL-24 polypeptide is a variant of IL-24 or an Fc fusion protein that includes IL-24. The pharmaceutical composition can be used in any of the methods provided herein to treat ocular surface inflammation and/or uveitis. |
US10512669B2 |
Blockade of inflammatory proteases with cyclic peptides
Drug compositions for treatment of one or more inflammatory conditions can includes at least one of a θ-defensin, analog or derivative thereof. Inventive methods include researching θ-defensins, analogs or derivatives thereof for their efficacy with respect to anti-inflammatory effects, and providing such compositions to the marketplace for the purpose of treating inflammatory conditions. Of particular interest are drug compositions effective to produce clinically relevant inhibition of tumor necrosis factor alpha (TNF-α)-converting enzyme (TACE) or other proinflammatory proteases, and/or sheddases. it is contemplated that preferred compositions can be used to treat rheumatoid arthritis, inflammatory bowel disease, and other chronic inflammatory diseases, autoimmune diseases, cancer, and Alzheimer's, osteoarthritis, inflammation-related neurodegenerative and other inflammation-related diseases. |
US10512667B2 |
Compositions and methods for treating conditions related to adrenocortical activity and/or excessive steroid production
Provided herein are methods for treating subjects having conditions related to adrenocortical activity and/or excessive steroid production. In particular, provided herein are methods for treating subjects having conditions related to adrenocortical activity and/or excessive steroid production through administration of at least one of the following agents: 1) an agent capable of inhibiting cholesterol efflux related to ABCA1 and/or ABCG1; 2) an agent capable of inhibiting MDR1 related cortisol secretion and/or MDR1 P-glycoprotein multiple drug transporter activity; and 3) an agent capable of inhibiting mitochondrial activity. |
US10512666B2 |
Peptides for prevention of HIV infection
Two peptides that can selectively bind to SEVI and block the enhanced infectivity that results from the interaction of SEVI with HIV. The two peptides comprise the amino acid sequences FEEIVQEIEDFLENLV (SEQ. ID NO: 1) and GIGAVLEVLTTGLPALISWIEEEEQQ (SEQ. ID. NO: 2). The peptides may be administered topically, either alone or in combination with other prophylactics, agents, etc. |
US10512665B2 |
Methods and compositions related to inhibition of viral entry
Disclosed are compositions and methods for inhibiting viral entry. |
US10512664B2 |
Antiviral compositions and methods
In general, embodiments of the present invention provide antiviral essential oil compositions, and methods of making and using the same. Essential oil compositions can include one or more essential oils, such as thyme essential oil, oregano essential oil, and/or cinnamon essential, optionally in combination with one or more emulsifiers. Essential oil compositions can be in the form of an emulsion and have droplet sizes less than about 25 microns. The use of these compositions in organisms and systems provides beneficial antiviral effects, among others. |
US10512663B2 |
Gold kiwifruit compositions and methods of preparation and use therefor
The present disclosure encompasses compositions prepared from kiwifruit. In particular, the invention encompasses compositions prepared from gold varieties of Actinidia chinensis. Also encompassed are methods of preparing these compositions. Further encompassed are methods of using these compositions, in particular, for treating or preventing disorders of the gastrointestinal system, including amongst others: inflammation, constipation, bowel irregularity, microbiota imbalances, irritable bowel syndrome, and inflammatory bowel disease. |
US10512662B2 |
Replication competent attenuated vaccinia viruses with deletion of thymidine kinase with and without the expression of human Flt3L or GM-CSF for cancer immunotherapy
The present invention relates generally to the fields of oncology, virology and immunotherapy. More particularly, it concerns the use of poxviruses, specifically the replication competent attenuated vaccinia virus with deletion of thymidine kinase (VC-TK−) with and without the expression of human Flt3L or GM-CSF as oncolytic and immunotherapy. The foregoing poxviruses can also be used in combination with immune checkpoint blocking agents. The foregoing poxviruses can also be inactivated via Heat or UV-treatment and the inactivated virus can be used as immunotherapy either alone or in combination with immune checkpoint blocking agents. |
US10512658B2 |
Compositions for the treatment of sweating and methods for making same
The invention describes novel compositions and methods utilized for treating disorders and/or conditions associated with the epidermal and/or dermal level of the skin. Such disorders include hyperhidrosis, bromhidrosis, and chromhidrosis, One representative composition of the invention comprises; water, alcohol, aluminum sesquichlorohydrate, hydroxypropyl methyl cellulose, polysorbate 20, isopropyl myristate, eucalyptus oil, silicone oil, alkyl benzoate, glycerine, talc, a hydrophillic silica, a hydrophobic silica, phenoxyethanol and ethylhexyl glycerine. |
US10512654B2 |
Pharmaceutical composition including dutasteride and capsule formulation comprising the same
The present disclosure relates to a pharmaceutical composition comprising dutasteride and propylene glycol monolaurate, and a capsule formulation comprising the same. |
US10512653B2 |
Method for visual enhancement and post procedure treatment protocol
A new and novel method for determining post procedural treatment is disclosed herein. In one embodiment, the method includes the steps of: determining a depth at which a surgical procedure on at least one eye of a patient is to be performed or was performed; providing a first set of instructions for administering a first medication for a first length of time to said at least one eye of said patient, said first length of time based at least in part upon said depth; providing a second set of instructions for administering a second different pressure lowering medication for a second length of time to said at least one eye of said patient, and physically administering the first medication and second different pressure lowering medication based upon the instructions. |
US10512649B2 |
Methods and compositions for treatment of zika virus infection
Disclosed are 9-deazaaadenine derivatives of the general formula (I) and pharmaceutically acceptable salts thereof, wherein A is OH or NH2, and B is H or NH2. Methods for treating, preventing and/or suppressing a Zika virus infection with the compounds disclosed are also provided. Pharmaceutical compositions comprising the disclosed compounds are also provided. Such pharmaceutical compositions may optionally contain one or more additional active agents. |
US10512642B2 |
Therapeutic targeting of myeloproliferative neoplasms by DUSP1 inhibition
Methods and compositions disclosed herein generally relate to methods, compounds, and compositions for treating myeloproliferative neoplasms (MPNs) or a symptom thereof, comprising administering, to a subject in need thereof, a therapeutically effective amount of a DUSP1 inhibiting compound, or of a pharmaceutically acceptable salt, ester, solvate, pharmaceutically usable derivative, or prodrug thereof. Embodiments of the invention also relate to use of a compound, or pharmaceutically acceptable salt, ester, solvate, pharmaceutically usable derivative, or prodrug thereof, for the preparation of a composition or medicament for the treatment of a myeloproliferative neoplasm (MPN), wherein the compound is an inhibitor of DUSP1. |
US10512635B2 |
Uses of benzimidazole derivative for nocturnal acid breakthrough
The present invention relates to a use of benzimidazole derivative compounds for improvement and treatment of nocturnal acid breakthrough (NAB). The benzimidazole derivative compounds can mere effectively prevent and treat gastric acid-related diseases by effectively improving and treating nocturnal nocturnal acid breakthrough symptoms. |
US10512627B2 |
Anti-tumor compound and the medical use thereof
The invention disclose a compound of formula (I), wherein, R1 is selected from —H or C1-C6 hydrocarbon group, —NH2, —OH, —O(CH2)nCH3 (n=0, 1 or 2), —N(CH3)2, or —CH2N(CH3)2, R2 is selected from an amino acid or an hydroxy acid or —OH (R1, R2 are not —CH3 and —OH at the same time), wherein X, Y are —H, —CH3, —CH2OH, —CH(OH)CH3, —CH2SH, —CH(CH3)2, —CH2CH(CH3)2, —CH(CH3)CH2CH3, —CH2CH2SCH3, —CH2COOH, —CH2CONH2, —CH2CH2COOH, —CH2CH2CH2CH2NH2, or —CH2CH2CONH2, R3-R5 are H or C1-C6 hydrocarbon group. The compound has a low toxicity, can significantly inhibit the migration and invasion of tumor cells in vitro, and can inhibit tumor metastasis in vivo in mice at low concentration, while showing notable sensitizing effect on cytotoxic anti-tumor drugs such as Paclitaxel etc. |
US10512624B2 |
Long-chain amphipathic dicarboxylic acids for treatment of diabetes type-1
Disclosed are methods of treatment of type 1 diabetes (T1D) in subjects under standard-of-care T1D treatment, by administration of substituted long-chain amphipathic dicarboxylic acids. Also disclosed are methods of reducing standard-of-care administered dose of insulin or an insulin analogue and/or obviating the need for administration of insulin or an insulin analogue in a T1D subject by administration of substituted long-chain amphipathic dicarboxylic acids. |
US10512623B2 |
Pharmaceutically acceptable salts of B-Guanidinopropionic acid with improved properties and uses thereof
The present invention relates to new pharmaceutical salts of β-GPA which exhibit improved physical properties. In particular, the invention relates to salts of β-GPA with improved flow properties (e.g., improved Carr's index and/or Hausner ratio) such as fumarate salts, succinate salts, and oxalate salts. The invention also relates to pharmaceutical compositions including a pharmaceutically effective amount of one or more salts of β-GPA, as well as methods of treating cancer including administration of a formulation including a β-GPA salt of the invention to a subject in need thereof. |
US10512618B2 |
Mitoriboscins: mitochondrial-based therapeutics targeting cancer cells, bacteria, and pathogenic yeast
The present disclosure relates to inhibitors of mitochondrial function. Methods of screening compounds for mitochondrial inhibition are disclosed. Also described are methods of using mitochondrial inhibitors called mitoriboscins—mitochondrial-based therapeutic compounds having anti-cancer and antibiotic properties—to prevent or treat cancer, bacterial infections, and pathogenic yeast, as well as methods of using mitochondrial inhibitors to provide anti-aging benefits. Specific mitoriboscin compounds and groups of mitoriboscins are also disclosed. |
US10512614B2 |
Compositions comprising a cannabinoid and spilanthol
Provided herein are fixed-dose combination (FDC) compositions comprising therapeutically effective amounts of at least one cannabinoid and spilanthol whether as essentially pure isolates or synthetics or as components of essential oils or plant extracts or combinations thereof.The compositions are formulated as pharmaceutical compositions, nutraceuticals, cosmeceuticals, nutricosmetics, cosmetics, or food products.The pharmaceutical compositions are useful for the treatment of a gastro-enteric disease selected from the group consisting of irritable bowel disease, Crohn's disease, colitis, irritable bowel syndrome, and acute and chronic pancreatitis or of sepsis. Other pharmaceutical uses are as anti-allergic, anti-inflammatory, immunomodulator, antioxidant, anti-microbial, antibacterial, antifungal, antiviral, antinociceptive, analgesic, anesthetic, anti-cancer, apoptosis inducing, antiscorbutic, antipyretic, anti-malarial, addiction mitigatory, anxiolytic, anti-depressant, diuretic, anti-diarrheal, vasodilator or aphrodisiac agents.The pharmaceutical compositions of this invention exhibit a synergistic effect. |
US10512610B2 |
Pharmaceutical composition containing clomipramine and preparation method therefor
The present invention provides a pharmaceutical formulation comprising clomipramine or its pharmaceutically acceptable salt (preferably, clomipramine hydrochloride) as the first active ingredient, and sildenafil or its pharmaceutically acceptable salt (preferably, sildenafil citrate) as the second active ingredient, wherein stability of clomipramine is improved, and a method for manufacturing this pharmaceutical formulation. In particular, the present invention provides a pharmaceutical formulation comprising the above two active ingredients and manufactured by using a wet granulation method, wherein stability of clomipramine is improved, and a method for manufacturing this pharmaceutical formulation. |
US10512609B2 |
Formulations of (R)-2-amino-3-phenylpropyl carbamate
The present invention relates to immediate release formulations of (R)-2-amino-3-phenylpropyl carbamate and methods of using the same to treat disorders. |
US10512607B2 |
Polymeric particles, method for cytosolic delivery of cargo, methods of making the particles
Embodiments of the present disclosure include particles, methods of making particles, methods of delivering an active agent using the particle, and the like. |
US10512604B2 |
Radiation sensitizer or anti-cancer chemotherapy sensitizer
The present invention provides a novel radiosensitizer or anti-cancer chemotherapy sensitizer. In particular, the invention provides a radiosensitizer or anti-cancer chemotherapy sensitizer that can relieve the irritation of an affected area caused by hydrogen peroxide, is safe when injected into a human body, and can delay or reduce the degradation of hydrogen peroxide and thereby can efficiently exert a radiation sensitizing effect and an anti-cancer chemotherapy sensitizing effect. The radiosensitizer or anti-cancer chemotherapy sensitizer comprises a combination of (a) hydrogen peroxide and (b) hyaluronic acid or salt thereof. |
US10512601B2 |
Compositions having improved water resistance
Compositions containing at least one sunscreen active agent and having improved water resistance properties, as well as methods of improving water resistance properties of compositions containing at least one sunscreen active agent, are provided. |
US10512598B2 |
Liquid hair dye with optimized dying performance and care
The present disclosure relates to a liquid agent and/or hair dye for oxidative coloring of keratinous fibers with improved color performance and nourishing effect. In an embodiment, the agent comprises, in a hydrous cosmetic carrier: (a) a fatty acid which is liquid at 20° C. and has about 16-22 carbon atoms in an amount of about 0.1-15 wt. %, (b) an alkanolamine as an alkalizing agent, selected from monoethanolamine, 2-amino-2-methylpropanol and triethanolamine, in an amount such that at least one part of the fatty acid is present as soap, (c) an oil component different from (a) in an amount of about 0.05-5 wt. %, (d) an alkylamidoamine in an amount of about 0.05-6 wt. %, and (e) an oxidation dye precursor. The agent does not contain any branched fatty alcohols having about 7 or more carbon atoms, and does not contain any fatty alcohols having a melting point of about 25° C. or higher. |
US10512591B2 |
Cartridge assembly for an injection system
Methods and systems for a cartridge assembly for use with an injection system are provided. An example cartridge assembly may include an ampule containing a pharmaceutical product that is sealed at a distal end with a pierceable diaphragm. The cartridge assembly may also include a hub comprising a proximal portion defining a cavity that is configured to engage the distal end of the ampule and a piercing member positioned within the cavity. The piercing member may include a fluid pathway between a proximal end portion comprising an opening and a distal end in fluid communication with a distal opening of the hub. The proximal end portion may engage the pierceable diaphragm, and the piercing member may apply a force to the pierceable diaphragm in the inactivated position without penetrating the pierceable diaphragm. |
US10512589B1 |
Bubble generation system
Disclosed is a disposable for use with a structure having a vessel surface that defines a vessel for receiving liquid. The disposable includes a pad and a layer. The pad has a pair of surfaces spaced apart from one another by a tubular sidewall. The pad is permeable to air flow. One of the pair of surfaces is positioned, in use, against the vessel surface. The layer overlies the other of the pair of surfaces and is at least substantially impermeable to air flow. In use, gas is introduced into the pad and issues through the sidewall in the form of bubbles. The disposable is useful in association with foot spas and the like. |
US10512587B2 |
Method and apparatus for scalp thermal treatment
A head wrap includes a body. A first arm extends from the body. A second arm extends from the body oppositely from, and shares a common axis with, the first arm. A center section extends from the body generally perpendicular to the first arm and the second arm. A first panel and a second panel extend from the first arm. A third panel and a fourth panel extending from the second arm. A fluid bladder is defined by the body, the first arm, the second arm, the center section, the first panel, the second panel, the third panel, and the fourth panel. A compression bladder is disposed outwardly of the fluid bladder and coextensive with the fluid bladder. A first fluid port is fluidly coupled to the fluid bladder and a second fluid port is fluidly coupled to the fluid bladder. |
US10512582B2 |
Supporting module and motion assistance apparatus including the same
A supporting module and a motion assistance apparatus including the same, the supporting module including a supporting frame including a sliding guide, a sliding joint configured to slide along the sliding guide, and an elastic module provided in the supporting frame, and configured to provide an elastic force to the sliding joint, are provided. |
US10512581B2 |
Shoulder joint rehabilitation assistive device
A shoulder joint rehabilitation assistive device has an exoskeleton base, an actuating mechanism, a spherical mechanism, and an upper limb connecting mechanism. The actuating mechanism is mounted on the exoskeleton base and has a yaw spring actuating assembly and a pitch spring actuating assembly. The spherical mechanism is connected with the actuating mechanism and has a linking rod, a spherical yaw linking assembly, and a spherical pitch linking assembly. The linking rod is pivotally connected with the exoskeleton base. The spherical yaw linking assembly has two ends respectively provided with a first yaw actuating portion and a second yaw actuating portion. The spherical pitch linking assembly has two ends respectively provided with a first pitch actuating portion and a second pitch actuating portion. The upper limb connecting mechanism is connected with the linking rod and the second yaw actuating portion of the spherical yaw linking assembly. |
US10512578B2 |
Patient stabilization device and methods of use
Devices, systems and methods for patient stabilization are disclosed. |
US10512575B2 |
Dynamic support apparatus
A dynamic support apparatus. The dynamic support apparatus includes a cushion, at least one actuator wherein the at least one actuator defines an interior volume and wherein the interior volume may be configured to be at least partially filled with a fluid, and a support disposed in the interior volume wherein the support configured to support an occupant when the interior volume is not filled with the fluid such that the support is sufficient to support the occupant. |
US10512569B2 |
Wearable absorbent hygiene article comprising a magnetic switch
A wearable absorbent hygiene article includes an electronics unit, a power source and a magnetic switch. The magnetic switch operably couples the electronics unit to the power source. The magnetic switch is configured such that the power source supplies power to the electronics unit when the magnetic switch is in an ON state and such that the power source does not supply power to the electronics unit when the magnetic switch is in an OFF state. The magnetic switch is further configured such that a movement of a magnet relative to the magnetic switch switches the magnetic switch from the OFF state to the ON state. |
US10512567B2 |
Soft absorbent sandwich web comprising high concentrations of superabsorbent material, cellulosic fibers and surface applied binder
The present invention is a liquid absorbent sandwich web as can be used in absorbent products such as in disposable absorbent articles such as diapers, feminine hygiene articles or incontinence devices, and to the manufacturing of such webs. The liquid absorbent sandwich web provides high absorbent capacity without compromising softness. |
US10512566B2 |
Absorbent article with flat-back protection feature
An absorbent article includes a base-structure and an elevatable structure known as a flat-back protection feature, that is capable of rising above the base-structure during article use. The flat-back protection feature utilizes either differences in material length compared with the length of the adjacent base-structure, or elastic materials, to maintain the feature elevation above the base-structure, while the article is in an extended condition. The flat-back protection feature extends into the intergluteal cleft of a wearer during use. Embossment features on the absorbent article are used to facilitate folding of the absorbent article, enhance the functionality of the protection feature, and/or improve the ease of manufacture. |
US10512565B2 |
Scleral marker for surgical procedures
A surgical instrument for marking spots at locations on the scleral limbal surface of a human eye. The instrument includes an elongated handle dimension to be handheld. A first elongated pointer extends substantially axially outwardly from one end of the handle. This pointer has a pointed free end which, when pressed against the scleral limbal surface, creates a depression in the scleral surface having a first area. A second elongated pointer also extends substantially axially outwardly from the end of the handle. The second pointer has a blunt free end which, when pressed against the scleral limbal surface, creates a depression in the scleral surface having a second area which is several times in magnitude the area of the first area. |
US10512564B2 |
Combination treatments
A method of treating a subject in need thereof, is carried out by (a) administering said subject a therapeutic intervention (e.g., an active agent) in a treatment effective amount; and concurrently (b) administering said subject caloric vestibular stimulation in a treatment effective amount, said caloric vestibular stimulation administered so as to enhance the efficacy of said active agent. In some embodiments, the caloric vestibular stimulation is administered as an actively controlled time varying waveform. |
US10512561B2 |
Arm support
An arm support for transferring and supporting a force corresponding to at least a portion of the weight of a supported arm. The arm support including a force distribution portion and a support portion. The force distribution portion adapted to conform to the shoulder of the unsupported arm and to distribute the force to the shoulder girdle, while the support portion supports the affected arm. The force distribution portion extends from a first end portion to a second end portion. The support portion extends from a first end portion to a second end portion. The support portion first end portion is located adjacent the force distribution portion second end portion and the support portion second end portion is configured to be adjustably couplable to the force distribution portion first end portion. |
US10512560B1 |
Transferring a state of user interaction with an online content item to a computer program
A computer-based method for transferring a state of user interaction with an online content item to a computer program accessible by a user device is provided. The method is implemented using an application server in communication with a memory. The method includes hosting a first session associated with a computer program. The first session includes a session state. The method also includes associating a first session token with the first session of the plurality of sessions, receiving from a user device one or more user interactions with an interactive online content item, updating the session state for the first session based on the one or more user interactions, receiving a request for the session state for the first session after the computer program becomes accessible for use by the user device, and transmitting the session state for the first session to be applied to the computer program. |
US10512559B2 |
Cervical collar having height adjustment
A cervical collar has an anterior component including a lower support that is adjustable in angle relative to a main support. The lower support is hingedly connected to the main support at first and second end portions. An elongate element engages the first and second end portions. A lock mechanism is operatively connected to the elongate element, and is arranged for locking rotation of the lower support relative to the main support, by moving the elongate element between locked and unlocked conditions. An upper support is received by the main support at least at a front section of the main support, and is arranged to be fitted against a user's chin. |
US10512551B2 |
Methods and apparatus for implanting an interbody device
An interbody implant comprises one or more elongate members that have superior and inferior surfaces with a height, and medial and lateral surfaces having a width. The height is set so the implant fits into the intervertebral space. The width is less than the height. The interbody implant has a first configuration, a second configuration, and a third configuration. The interbody implant is inserted into the intervertebral space in the first configuration such that medial and lateral surfaces contact the vertebral bodies, and the interbody implant is then actuated into the second configuration such that superior and inferior surfaces engage the vertebral bodies. Actuation of the implant from the first configuration to the second configuration distracts the vertebral bodies. The implant is actuated into the third configuration where the width of the implant is greater than width of the implant in the first or the second configuration. |
US10512549B2 |
Implant with structural members arranged around a ring
An implant for use in a spine includes a body and a plurality of structural members. The superior and inferior surfaces each include a ring and structural members arranged in a web-like pattern around the ring. Bone contacting members are arranged radially away from the ring and support members are arranged in a circumferential direction around the ring. |
US10512545B2 |
Interbody spacer for spinal fusion
An interbody spacer for spinal fusion surgery includes first and second opposite side walls that have open-cell metal foam at upper and lower faces, and a three-dimensional lattice disposed between open-cell metal foam at the upper and lower faces. The open-cell metal foam is in communication with the three-dimensional lattice so that bone growth can enter the three-dimensional lattice from the open-cell metal foam. The interbody spacer may be formed by additive manufacturing. |
US10512542B2 |
Device, system, and method for transcatheter treatment of valve regurgitation
The invention relates to a device for use in the transcatheter treatment of mitral valve regurgitation, specifically a coaptation enhancement element for implantation across the valve; a system including the coaptation enhancement element and anchors for implantation; a system including the coaptation enhancement element, catheter and driver; and a method for transcatheter implantation of a coaptation element across a heart valve. |
US10512536B2 |
Collapsible cardiac implant and deployment system
A collapsible device, such as an annuloplasty ring or prosthetic heart valve, is configured to be collapsed prior to being introduced into a patient via minimally-invasive access points such as port holes or intercostal incisions. A holder is configured to hold the collapsible device, and to selectively collapse the device for introduction into the patient and then re-enlarge the device at the desired deployment site. Collapsible devices include devices that can hingedly fold about hinge lines, and devices that can elongate to form substantially spiral forms with reduced diameters. |
US10512532B2 |
Therapeutic device for the treatment methods and inguinal hernia
Provided is a method of treating inguinal hernia, in which a burden applied to a patient during treatment can be reduced. There is provided a method of treating inguinal hernia, in which a bowel is prevented from being exposed to an outside through a fascia. The method of treating inguinal hernia includes an introduction step of introducing a member configuring a structural body which restricts deformation of the bowel, through an anus toward a hernial site by using a transportation member; and a configuration step of configuring the structural body with respect to the bowel which stays medial to the fascia. |
US10512530B2 |
Electric toothbrush
An electric toothbrush including a handle, a head movable with respect to said handle, and a rotating working element having at least one brush located out of the geometric axis of said handle. The electric toothbrush further includes an electric motor for driving the working element in a rotary movement in a clockwise/counterclockwise direction, and a motor rotation direction switch coupled functionally with the head and the handle. The head and the handle are coupled with resilient technical means that enable, after exertion of the torque to the head, to rotate the head with respect to the handle into the left or right positions, where the motor rotation direction switch turns on the motor in the clockwise/counterclockwise rotation direction. After releasing said torque, the resilient technical means enable to maintain the head in a standby position relative to the handle, where the motor rotation direction switch turns off the motor. |
US10512529B2 |
Use of resonant systems to automatically modify power (amplitude) of an oral care appliance upon use in-mouth
An oral care appliance (100), such as an electric toothbrush, utilizing non-linear resonant systems is described herein. In one exemplary embodiment, the oral care appliance includes a longitudinal shaft (102), a brush head (130), and a handle (190). The handle includes a motor (140) that generates a first amplitude (404) for the brush head based on the brush head being outside of the user's mouth, when no mass is applied to the brush head. In response to the brush head being inside of the user's mouth, when mass is applied, such as by pressing the brush head against the teeth, the motor causes a second amplitude (410) to be generated for the brush head that is larger than the first amplitude. |
US10512522B2 |
Method and apparatus for virtual endoscopy
A surgical instrument navigation system is provided that visually simulates a virtual volumetric scene of a body cavity of a patient from a point of view of a surgical instrument residing in the cavity of the patient. The surgical instrument navigation system includes: a surgical instrument; an imaging device which is operable to capture scan data representative of an internal region of interest within a given patient; a tracking subsystem that employs electro-magnetic sensing to capture in real-time position data indicative of the position of the surgical instrument; a data processor which is operable to render a volumetric perspective image of the internal region of interest from a point of view of the surgical instrument; and a display which is operable to display the volumetric perspective image of the patient. |
US10512520B2 |
Methods and apparatus for coupling an optical input to an illumination device
A surgical illumination apparatus comprises a fiber optic input, and illuminated surgical instrument, and an optical coupling bracket for coupling the fiber optic input to the illuminated surgical instrument. The coupling bracket comprises an elongate frame having a proximal end, a distal end, and a central channel extending therebetween, wherein the central channel is sized to receive and support optical fibers of the fiber optic input. The proximal end of the bracket is coupled to the fiber optic input, and the distal end of the bracket is coupled to an illumination element of the illuminated surgical instrument. The apparatus may further comprise a shroud disposed around the illumination element that is coupled to the bracket. |
US10512519B2 |
Illuminated medical devices
A surgical retractor comprising a handle and a blade extending at an angle from the handle; an illumination assembly having a plurality of direct light sources provided on the blade, at least one of the light sources being angled differently relative to the blade than another one of the light sources; and a cover configured to enclose the illumination assembly, wherein the cover comprises a plurality of openings, each opening corresponding in position to a respective light source of the illumination assembly when the cover is attached to the blade. |
US10512518B2 |
Illuminated telescoping cannula
The illumination system includes an arthroscope, endoscope or other surgical tool and an attachable cannula including a transparent or semi-transparent material capable of carrying light from the proximal end to the distal end of the cannula, illuminating the surgical field through components that do not occupy space that may otherwise be used for the optics of an arthroscope. The arthroscopic illumination system further includes one or more illumination sources at the proximal end of the cannula. The illumination source may be optically coupled with the cannula at the hub or other location. The cannula includes a sterilizable polymer which functions as a waveguide, which is a material medium that confines and guides light. When in use, the light source connected to the hub provides light which may be guided to the distal end of the cannula or any other location. Thus, the sheath provides structure-guided illumination of the surgical site. |
US10512515B2 |
Systems and methods for steerable elongate device
Systems and methods for controlling an elongate device include a console. The console includes a first recess and a removable first input control for controlling motion of the medical device. The console also may include one or more first sensors located about the first recess that detect motion of the first input control and detect operator contact with the first input control. The console also may include an integrated display screen arranged to display status information for the medical device. In some embodiments, the first input control controls an insertion depth or steering of the medical device, and may be in the form of a scroll wheel forming a part of a removable control assembly. |
US10512507B2 |
Method and system for automatic estimation of utility of adaptive radiation therapy re-planning
A method and system determines a utility of performing a re-planning on a patient during a radiation therapy planning. Quality improvements which may be made possible by re-planning the patient are automatically estimated, independent of clinician bias. This enables the clinician to make an informed decision regarding whether to re-plan the patient in a fast and efficient manner. This achieves more uniformity and predictability in the adaptive re-planning. |
US10512506B2 |
Stabilization apparatuses and methods for medical procedures
The present invention teaches minimally invasive apparatuses and methods for stabilizing and/or guiding medical instruments used in a variety of medical procedures, including (a) introducing one or more substances into a subject's body, (b) removing one or more substances from a subject's body, (c) manipulating a region of a subject's body, or (d) combinations thereof. Among the many advantages of the inventive apparatuses are their simplicity and adaptability to attach to a variety of retractors. |
US10512502B2 |
Tissue scissors for biological tissue
The invention relates to tissue scissors (10) with improved stability and improved handling that have two structurally and electrically different branches (11, 12). While the sliding surface (25) of the first branch (11) has a metal-ceramic hard material layer (30), such as, for example, titanium nitride, the second sliding surface (34) of the second branch (12) has an electrically non-conductive ceramic layer (33). The material mating produces great mechanical resistance to abrasion in the bearing (17) and on the cutting edges (28, 35). At least one of the branches, in particular branch (12), can have a cermet body (36) to improve the cooling of the cutting edge (35 (28)) and/or keep it sharp, to prevent heating of the branches (11, 12) during coagulation and sticking of the tissue. |
US10512501B2 |
Electrosurgical apparatus
An electrosurgical forceps includes a first member including a first housing and a first jaw member with a tissue contacting surface. A second member includes a second jaw member with a tissue contacting surface configured to communicate electrosurgical energy with the tissue contacting surface of the first jaw member a fluid receptacle at least partially disposed within the first housing. The fluid receptacle defines first and second receptacle sections, the first receptacle section defining a first internal dimension and the second receptacle section defining a second internal dimension less than the first internal dimension. A fluid is disposed within the fluid receptacle. A trigger plunger is mounted within the fluid receptacle. A knife shaft is at least partially disposed within the fluid receptacle distal of the trigger plunger and the fluid. A knife blade is disposed adjacent the first and second jaw members. |
US10512499B2 |
Systems and methods for detecting opening of the jaws of a vessel sealer mid-seal
Disclosed are systems, devices, and methods for operating an electrosurgical generator, comprising an RF output stage configured to output an electrosurgical waveform through at least one pair of electrodes, sensing circuitry configured to measure an impedance between the at least one pair of electrodes configured to grasp tissue, and a controller configured to determine whether the impedance of the tissue disposed between the at least one pair of electrodes exceeds an impedance threshold, determine whether a change in the impedance is greater than an upper change in impedance threshold, and output an alarm indicative of the at least one pair of electrodes being at least partially open based on at least one of the impedance exceeding the impedance threshold or the change in impedance exceeding the change in impedance threshold. |
US10512498B2 |
Apparatus and methods for treating rhinitis
Apparatus and methods for treating conditions such as rhinitis are disclosed herein where a distal end of a probe shaft is introduced through the nasal cavity where the distal end has an end effector with a first configuration having a low-profile which is shaped to manipulate tissue within the nasal cavity. The distal end may be positioned into proximity of a tissue region having a post nasal nerve associated with a middle or inferior nasal turbinate. Once suitably positioned, the distal end may be reconfigured from the first configuration to a second configuration which is shaped to contact and follow the tissue region and the post nasal nerve may then be ablated via the distal end. Ablation may be performed using various mechanisms, such as cryotherapy, and optionally under direct visualization. |
US10512495B2 |
Method for fabricating medical device and applications thereof
A method for fabricating a medical device includes steps as follows: A degradable powder including at least one metal element is firstly provided on a target surface. A focused energy light bean is applied to sinter/cure the biodegradable powder within an oxygen-containing atmosphere; wherein the oxygen concentration of the oxygen-containing atmosphere is adjusted to provide a first oxygen concentration and a second concentration when the focused energy light is driven to a first location and second location of the target surface respectively. The aforementioned processes are then repeatedly carried out to form a three-dimensional (3D) structure of the medical device. |
US10512491B2 |
Surgical assembly for placing a pedicle-screw cap
The invention relates to a surgical assembly which comprises: a cap (2) comprising an outer thread (2c) and a central recess for inserting a screw bit; a cap-holder in the form of a hollow sleeve (10) comprising a connection end (11) for connecting with the cap (2), and a locking pin (15) slidably mounted in the hollow sleeve (10) between a neutral position and a locking position of the cap; the cap (2) comprises at least two diametrically opposed radial notches (7), arranged away from an outer side wall of said cap (2), each of the notches (7) comprising at least one side groove (8); the connection end (11) is extended longitudinally by two diametrically opposed lugs (12) capable of being inserted into the notches (7) and each including a side shoulder (12a) which complements the groove (8) of the notch (7) capable of being inserted into said groove in order to lock the sleeve (10) axially onto the cap. |
US10512490B2 |
Device and method for correcting a spinal deformity
A method for correcting a spinal deformity is provided. A spinal implant for correcting a spinal deformity includes a multipoint connector that connects to at least one vertebra of a spine at a plurality of locations and a force directing device that applies a force to the vertebra through the multipoint connector. The force directing device may include a rod which extends generally along an axis of the spine and a force directing member which is adjustably coupled to both the rod and the multipoint connector and which applies a corrective force to the at least one vertebra. |
US10512482B2 |
System and method for scoring the left ventricular endocardium to increase left ventricular compliance
In some embodiments, a system for scoring human endocardium tissue may include a first conduit and an activation system. The first conduit may include a first opening, a second opening, and a cutting device. The first opening may be positioned at a proximal end of the first conduit. The second opening may extend from adjacent to a closed distal end portion of the first conduit. The cutting device, when activated, may cut through a portion of a depth of endocardium tissue positioned adjacent the second opening. The cutting device may selectively cut or score the endocardium to a specified depth and length in the endocardium of a left ventricle of a human heart. |
US10512480B2 |
Tools for a tongue manipulation system
A connection tool for a tongue manipulation system includes a connector configured to be coupled to a tongue advancer tether, a connection tool body, and a separable removal cannula part. The separable removal cannula part is configured to follow a tongue advancer tether line in order to enable a removal sleeve located at least partially within the separable removal cannula part to contact the tongue advancer. The separable removal cannula part is configured to be separated from the connection tool body following the removal sleeve contacting the tongue advancer and to expose a proximal end of the removal sleeve. |
US10512479B2 |
Axial lengthening thrombus capture system
Systems and methods can remove material of interest, including blood clots, from a body region, including but not limited to the circulatory system for the treatment of pulmonary embolism (PE), deep vein thrombosis (DVT), cerebrovascular embolism, and other vascular occlusions. |
US10512478B2 |
Clot-engulfing mechanical thrombectomy apparatuses
Mechanical thrombectomy systems including an elongate catheter configured as an elongate inversion support, a flexible tractor configured to roll and invert over the distal end of the elongate inversion support, and a clot engaging member on the distal end of an elongate manipulator are described herein. These systems may capture a clot using the clot engaging member and draw the clot and clot engaging member and roll the flexible tractor into the catheter to remove the clot and clot engaging member from a vessel. |
US10512475B2 |
Cross pinning guide devices and methods
Methods and devices are provided for implanting a cross-pin through a bone tunnel, such as in an arthroscopic surgical procedure. In general, the methods and devices allow a cross-pin hole to be formed in a medial side of a knee bone such that it intersects a bone tunnel formed in the knee bone. In one embodiment, a cross-pinning guide device is provided that can be configured to angularly position the cross-pin hole relative to the bone tunnel to allow the cross-pin hole to intersect the bone tunnel without passing through another side, e.g., a lateral side, of the knee bone. The knee bone can be a femur or a tibia such that the cross-pin hole and the bone tunnel can each be entirely formed in the femur or in the tibia. |
US10512473B2 |
Surgical tool
A hand-held surgical tool having at least one pad of vibration-absorbent material thereon, the pad being of hydrophobic polyurethane foam made from a polyol and isocyanate composition in which the weight ratio of polyol to isocyanate is from 2.5:1 to 1.5:1. Also a hand-held surgical tool having at least one pad of vibration-absorbent material thereon, the pad having an irrigation duct therethrough connected to means for supplying irrigation fluid to the duct. Also a pad for a hand-held surgical tool, wherein the pad has an irrigation duct therethrough connected to means for supplying irrigation fluid to the duct. |
US10512472B2 |
Surgical cutting instruments
Surgical cutting instruments and methods of use are described. The surgical cutting instrument (100) comprises an instrument body (102) with a first attachment mechanism (106) at a distal end. A cutter (104) has a central core (110), a plurality of cutting formations (130, 136) and a plurality of lobes (112, 114, 116) extending from the central core. The central core has side walls (118, 120, 122) which define an entirely open mouth and the side walls include a second attachment mechanism (140, 142, 144) which can interact with the first attachment mechanism to releasably attach the cutter to the distal end of the instrument body. At least one cutting formation (136) is provided on an end outer face (138) of the cutter opposite the entirely open mouth. |
US10512470B1 |
Osteotomy procedure for correcting bone misalignment
An osteotomy procedure may be performed to correct a misalignment of a bone, such as a bunion deformity. In some examples, the osteotomy procedure involves making a first crescentic-shaped cut transecting a first metatarsal, thereby forming a concave-shaped end and a convex-shaped end on opposed bone portions. The method further involves making a second crescentic-shaped cut across the concave-shaped end of one bone portion and thereafter moving the bone portions relative to each other in multiple planes to correct an anatomical misalignment. |
US10512467B2 |
Motor driven rotary input circular stapler with modular end effector
A surgical stapling device comprises a handle assembly, a shaft assembly, and a stapling head assembly. The shaft assembly comprises a rotary drive shaft that translates between two longitudinal positions to alternate between a tissue clamping mode and a tissue cutting/stapling mode. The stapling head assembly includes a first set of rotary drive elements that convert rotary motion of the drive shaft into a tissue clamping action when the drive shaft is in a distal position. The stapling head assembly also includes a second set of rotary drive elements that convert rotary motion of the drive shaft into a tissue cutting/stapling action when the drive shaft is in a proximal position. The drive shaft may be driven manually or by a motor. The stapling head assembly may be provided in a cartridge form that is removable from the shaft assembly. |
US10512466B2 |
Adapter assembly for surgical device
An adapter assembly for connecting an end effector to a surgical instrument includes first and second drive assemblies configured for converting rotational motion into linear motion, and an actuation assembly. The second drive assembly includes a pair of push/pull cables for longitudinally advancing and retracting a drive member. |
US10512460B2 |
Surgical method and system for performing the same
A system (10) including an helicoidal member (16); an elongated guide (26) positionable at least partially through the helicoidal member (16) along the longitudinal axis of helicoidal member (16), the guide (26) defining a longitudinally extending peripheral surface cooled portion (32); a cooling subsystem (33) for cooling the peripheral surface cooled portion (32); and a driver (34) for mounting the helicoidal member (16) thereto and rotating the helicoidal member (16) along the helicoidal member longitudinal axis while allowing the helicoidal member (16) to advance along the guide (26) in a distally oriented direction. |
US10512455B2 |
Apparatus and methods for sealing a vascular puncture
Apparatus and methods for sealing a puncture through tissue includes an introducer sheath sized for introduction into a puncture, cartridge sized for insertion into the introducer carrying a sealant, and a locking element for coupling the introducer sheath to the cartridge. When the cartridge is advanced into the introducer sheath, the locking element couples the introducer sheath to the cartridge such that subsequent retraction of the cartridge causes the introducer sheath to retract, thereby deploying the sealant from the cartridge within the puncture beyond the introducer sheath. |
US10512454B2 |
Needle and snare guide apparatus for passing suture
A trocar wound closure system includes a suture passing needle and a guide for directing the needle through the wound site. A distal portion of the needle includes a capture rod with a slot. An obturator tube with a cutout section can be axially actuated to align the cutout section with the slot, and then moved out of alignment so as to capture the suture. The guide includes at least two tracks for directing the needle through the tissue track. A snare loop is located adjacent to the exit of each track, and configured to be actuated from a radially extended configuration to a retracted configuration so as to capture the suture section inserted through each loop. Radially expandable arms at distal section are movable between an expanded configuration and a slender configuration. |
US10512452B2 |
Tissue characterization in medical diagnostic ultrasound
For estimating attenuation in ultrasound imaging, displacements at different locations along an acoustic radiation force impulse (ARFI) beam are used measured. The on-axis displacements and displacements from a phantom using a same ARFI focus as a reference are used to cancel out focusing effects. A single ARFI beam may be used to estimate the attenuation for a location. |
US10512450B2 |
Shear wave estimation from analytic data
Shear wave characteristics are estimated from analytic data. Measures of displacement are converted into complex representations. The magnitude and/or phase components of the complex representation may be used for estimating various characteristics, such as velocity, center frequency, attenuation, shear modulus, or shear viscosity. The zero-phase of the phase component represents an occurrence of the shear wave at that location. |
US10512447B2 |
Probe holding table and medical device
The disclosure provides a probe holding table and a medical equipment. The probe holding table comprises a faceplate and a fixing plate for supporting the faceplate. The faceplate is rotatably connected to the fixing plate. A plurality of probe placement units for installing probes are disposed on the faceplate, and each of the probe placement units is in electrical communication with an external power. The user may turn the faceplate to take the probes on the corresponding position, in particular, when more probes need to be used, the structure of the probe holding table is simpler than the normal fixed table, and easier to take the probes. Therefore, the medical equipment adopted the above probe holding table provides with the above advantages. |
US10512444B2 |
Ultrasonic color flow map for analysis of mitral regurgitation
An ultrasonic diagnostic imaging system is described which assesses regurgitant flow through a mitral valve by color-flow imaging. A Doppler processor produces Doppler velocity measurements of blood flow around a regurgitant valve to identify an iso-velocity surface to be used in the PISA method of regurgitant flow quantification. The velocity measurements are used to color pixels in the colorflow image and are mapped to a plurality of colors for a color bar used with the image. The color bar exhibits distinct color transitions at one or more velocities in the velocity range of the color bar which distinctively identify an iso-velocity surface in the colorflow image. The color bar may be formed with an aliasing velocity in the middle of the bar, between a zero velocity reference color of the bar and an end of the bar, and the aliasing velocity aligned with a desired iso-velocity and used to create the color transition. |
US10512440B2 |
Radiography system, image processing method, and image processing program
A radiography system includes: a radiography apparatus including a first radiation detector and a second radiation detector which is provided so on a side of the first radiation detector from which the radiation is transmitted and emitted, and a grid that is configured to remove scattered radiation included in the radiation transmitted through a subject; and an acquisition unit that is configured to acquire, using the grid, a first radiographic image captured by the first radiation detector and a second radiographic image captured by the second radiation detector; and a removal unit that is configured to detect and remove a first grid image, which is an image of the grid, from the first radiographic image acquired by the acquisition unit, and to remove the image of the grid from the second radiographic image acquired by the acquisition unit, using the first grid image. |
US10512437B2 |
Tomography apparatus and method of reconstructing tomography image thereof
A tomography apparatus that may reduce partial scan artifacts includes: a data acquirer configured to acquire tomography data when X-rays are emitted as a cone beam to an object while rotating by one cycle angular section that is less than one rotation; and an image reconstructor configured to reconstruct a tomography image by using corrected tomography data that is obtained by applying to the tomography data a weight that is set based on at least one of a view that is included in the one cycle angular section and a cone angle in the cone beam. |
US10512433B2 |
Correction data generation method and correction data generation apparatus
Provided is a correction data generation method that includes acquiring captured image data by imaging an indicator that is related to a predetermined illness; plotting a real imaging data point that corresponds to the acquired captured image data in a predetermined color space that is associated with the predetermined illness in accordance with a color component of the data point; calculating a correction value for correcting the values of pixels that make up a captured image captured by an electronic endoscope based on the distance between the data point and a predetermined target point in the predetermined color space; and storing the calculated correction value. |
US10512430B1 |
Animal health tracking assembly
An animal health tracking assembly for tracking the physiological condition of an animal includes a collar that is wearable around a neck of an animal thereby placing the collar in physical contact with the animal. A control circuit is coupled to the collar and an electronic memory is coupled to the collar for storing a database. An allergen detector is coupled to the collar for detecting airborne allergens thereby tracking the animal's exposure to the airborne allergens. The allergen detector is electrically coupled to the control circuit and the control circuit communicates an identity of the airborne allergens to the electronic memory for storage in the database. In this way the electronic memory can track all of the airborne allergens to which the animal was exposed. |
US10512429B2 |
Discrimination of cheyne-stokes breathing patterns by use of oximetry signals
Methods and apparatus provide Cheyne-Stokes respiration (“CSR”) detection based on a blood gas measurements such as oximetry. In some embodiments, a duration, such as a mean duration of contiguous periods of changing saturation or re-saturation occurring in an epoch taken from a processed oximetry signal, is determined. An occurrence of CSR may be detected from a comparison of the duration and a threshold derived to differentiate saturation changes due to CSR respiration and saturation changes due to obstructive sleep apnea. The threshold may be a discriminant function derived as a classifier by an automated training method. The discriminant function may be further implemented to characterize the epoch for CSR based on a frequency analysis of the oximetry data. Distance from the discriminant function may be utilized to generate probability values for the CSR detection. |
US10512426B2 |
Biological information acquisition device and biological information acquisition method
A storage unit stores a cumulative light emitting frequency or a cumulative light emitting time of a light emitting element. In a case where the cumulative light emitting frequency is greater than a predetermined light emitting frequency or the cumulative light emitting time is longer than a predetermined light emitting time, a control unit causes the light emitting element to emit light toward a living body by increasing the light emitting frequency or the light emitting time at which the light emitting element emits the light in order to acquire a light receiving result once, compared to a setting light emitting frequency or a setting light emitting time. A light receiving unit acquires information of the living body, based on a light receiving result obtained by receiving the light which is emitted toward the living body and transmitted through the living body. |
US10512422B2 |
Location detection systems and methods
A location detection system identifies the locations of medical devices such as patient support apparatuses and/or patient care devices within a medical facility. The devices communicate via a wired connection to one or more medical facility systems (e.g. nurse call system, computer network, etc.), and/or via a wireless connection to such systems. The location detection system automatically determines location information of the devices and communicates the location information so that the recipient of any outgoing alerts and/or other information sent from the devices is apprised of the location of the particular device sending the alert or other information. Caregivers are thereby able to respond to the correct location of an alert, and software systems such as EMR systems, admission discharge and transfer (ADT) systems, etc. are able to correlate transmitted device data with the location and/or patient assigned to that location. |
US10512416B2 |
Estimation of blood flow rates
Disclosed are various embodiments for estimating the flow of blood through a blood vessel in a region of interest. Passage of a bolus of fluid through an imaged blood vessel over a period of time is tracked by a computing device. The computing device fits the tracked passage of the bolus of fluid to a modeled passage of the bolus of fluid. The computing device then estimates a volume of blood flow through the imaged blood vessel based at least in part on a fit of the tracked passage of the bolus of fluid to the modeled passage of the bolus of fluid. |
US10512415B2 |
Multi-phase flow decomposition using electrical capacitance volume tomography sensors
The present invention provides a system and method for multi-phase flow decomposition using electrical capacitance imaging techniques. The present invention provides a system and method to obtain permittivity distributions at a plurality of frequency markers using volume tomography image reconstruction to determine volume fraction of each phase and to produce images of the volume fraction for each phase. |
US10512411B2 |
Brain mapping system and method thereof
A brain mapping system includes a brain signal acquisition device for collecting brain signals corresponding to different locations of the brain, a stimulator for generating a stimulus based upon a pseudorandom sequence, and a processor for segmenting the brain signals into a plurality of epochs and correlating features extracted from the epochs with the pseudorandom sequence to generate correlation functions, wherein a brain map is constructed by the correlation functions. |
US10512408B2 |
System and method for characterizing circulatory blood flow
A computer-implemented method for characterizing circulatory blood volume is disclosed. The method has the steps of acquiring a biological signal that emulates the arterial pulse wave from a sensor. Two derived parameters, circulatory stress, which reflects a harmonic of heart rate, and circulatory blood flow, which reflects the amplitude of the unprocessed biological signal, are extrapolated from the biological signal, and are each compared to a threshold value and assessed to determine an adequacy of circulatory blood volume. In embodiments, the assessment of circulatory blood volume is used to manage a patient's cardiovascular autoregulatory function or the adequacy of transfer of fluids to and from the circulatory system, with the ultimate goal of achieving a circulatory blood volume that adequately supplies the demands of the patient's tissues and organs. |
US10512406B2 |
Systems and methods for determining an intensity level of an exercise using photoplethysmogram (PPG)
Disclosed systems and methods relate to determining an intensity level of an exercise using a photoplethysmogram (PPG) sensor. A method of determining an intensity level of an exercise for a user according to one embodiment of the present disclosure includes detecting, by a device, body signals from the user using a PPG sensor. The method includes determining, by the device, a heart rate of the user based on the body signals. The method includes determining, by the device, an error in the heart rate. The method also includes determining, by the device, the intensity level of the exercise for the user based at least on the error. |
US10512396B2 |
Ocular tear film peak detection and stabilization detection systems and methods for determining tear film layer characteristics
Ocular surface interferometry (OSI) devices, systems, and methods are disclosed for peak detection and/or determining stabilization of an ocular tear film. Embodiments disclosed herein also include various image capturing and processing methods and related systems for providing various information about a patient's ocular tear film (e.g., the lipid and aqueous layers) and a patient's meibomian glands that can be used to analyze tear film layer thickness(es) (TFLT), and related characteristics as it relates to dry eye. |
US10512394B2 |
Endoscopic-enabled mouth gag and associated method of use
The present invention discloses a new and improved endoscopic-enabled mouth gag for routine ENT procedures, such as adenoidectomy and nasopharyngeal biopsy. The invention modifies the existing mouth gag, provides a stable and adjustable placement for an endoscopic device potentially employed during an ENT procedure, and is to replace the outdated surgical method where the surgical field is visualized indirectly via a handheld mirror (with or without the preexisting mouth gag). The inventive endoscopic-enabled mouth gag not only provides enhanced visualization of the surgical field for a clinician, assistants, and trainees, but also enables a clinician to perform the procedure bimanually (with both hands). |
US10512391B2 |
Flexible-rigid hybrid endoscope and instrument attachments
The disclosure describes a flexible-rigid hybrid design for an endoscope and attachment mechanisms for removably coupling and decoupling the endoscope to a handle portion and/or a tool portion of a variety of different instruments. Some implementations describe designs for instruments that may be coupled to the flexible-rigid endoscope described herein or other endoscopes. Such instruments may include sinus and laryngeal forceps, a laryngeal syringe gun, an endoscopic Eustachian tube balloon dilator, an endoscopic tracheal dilator, and an endoscopic trans-oral esophageal balloon dilator. Some implementations describe an endoscope that may be removably coupled to a portable control box using a connector cable. |
US10512389B2 |
Image processing device, image processing method, and endoscope system
The present technology relates to an image processing device, an image processing method, a program, and an endoscope system that can reduce a burden on a user. A parallax amount adjustment unit adjusts the parallax amount of a three-dimensional (3D) biological image of an imaged living organism, depending on whether the parallax of the 3D biological image puts a burden on a user. The present technology can be applied to an endoscope system or the like that captures an image of a living organism with an endoscope, for example. |
US10512386B2 |
Dishwasher appliance and filter
A dishwasher appliance includes a tub defining a wash chamber with a sump positioned at a bottom of the wash chamber for receiving fluid from the wash chamber. A filtering system is positioned between the wash chamber and an outlet of the sump portion. The filtering system includes a first filter and a second filter. The second filter includes a hollow annular base portion and a filter body extending between the base portion and the first filter. The second filter also includes a plurality of nozzles circumferentially arranged about the hollow annular base portion, each nozzle of the plurality of nozzles in fluid communication with the hollow annular base portion and oriented towards the filter body for cleaning the filter body. An inlet in fluid communication with the hollow annular base portion may also be provided. |
US10512381B2 |
System comprising a vacuum cleaner and a base station, vacuum cleaner, base station, and method for emptying a dust chamber of a vacuum cleaner
A system comprising a vacuum cleaner and a base station, wherein the vacuum cleaner has a suction opening for sucking up dirt and/or dust from a floor by a suction air flow, a fan for producing the suction air flow, a dust chamber for holding dirt and/or dust, and an air outlet opening such that air sucked in together with the dirt and/or dust can be discharged again. The base station can be connected to the vacuum cleaner in such a way that the dust chamber can be emptied into the base station by means of an air flow. The air flow used to empty the dust chamber can be produced and blown into the dust chamber by the fan for producing the suction air flow. The base station has a return channel, through which the air flow exiting the dust chamber can be guided back into the vacuum cleaner. |
US10512372B2 |
Toilet accessory holder
A toilet system includes a toilet accessory and an accessory holder means. The toilet accessory is adapted for use with a toilet. The toilet accessory includes a head and a grip sized to be held in the hand of a user. The accessory holder means is configured to mount the toilet accessory to a water tank of the toilet. |
US10512369B2 |
Toilet paper roll holder attachment system
A toilet paper roll holder attachment system is disclosed for supporting the holding of at least two toilet paper rolls in either horizontal or vertical configuration or for supporting the holding of large or jumbo toilet paper rolls. The toilet paper roll holder attachment system has a hollow cylindrical body with two substantially round apertures which are adapted for holding a toilet paper roll spindle. There is a vertical support arm or support bracket extending perpendicularly downward from the hollow cylindrical body. At the lower end of the vertical support arm or support bracket is a horizontal rod for holding the toilet paper rolls. There is(are) stopper(s) at the end(s) of the horizontal rod for the purpose of preventing the toilet paper rolls from sliding out of the horizontal rod. |
US10512367B2 |
System for washing and treating newborn infants
A system for washing and treating infants includes components for keeping an infant under controlled sterile and warm conditions. The system also includes a device for washing the infant, which has a support frame and a flexible laminar element adapted to be secured thereto. The frame and the laminar element define a housing for receiving the infant while he/she is being washed and/or treated. The housing is adapted to be introduced into the washing and treating components and is accessible from outside. The frame has a single-unit structure composed of tubular members made of a medical-grade sterilizable metal or non-metal material. |
US10512366B1 |
Multiple food ingredient dispensing device
Multiple food ingredient dispensing device that include a body having a dispensing opening and an internal orifice plate that supports a release mechanism. The device either includes a carousel unit on a central axle or a carrier that turns on a bearing. The carousel unit or carrier hold a plurality of ingredient pods that contain food ingredients, and which rotate relative to the body. Rotating the ingredient pods can cause a selected one to rotate over the release mechanism. The release mechanism can then cause a controlled volume of the food ingredient to fall from associated ingredient pod. Also included are a viewing window with measurement indicia and a measurement adjust knob that adjusts the amount that falls when the release mechanism is opened. A dispensing opening then allows the food ingredient to fall out of the dispensing device. |
US10512360B2 |
Temperature homogenization, protection, and grease guide structure of barbecue grill
Disclosed is a temperature homogenization, protection, and grease guide structure of a barbecue grill, including at least one burner, a grate, and a grease guide and temperature barrier board. The burner includes a heat generation section and is arranged in an inclined, upward-facing manner in a barbecue grill. The grate is arranged in a top opening of the barbecue grill. The grate includes ribs that are provided with at least one temperature homogenization protection section, which is located above and corresponds to the heat generation section. The grease guide and temperature barrier board is configured in an M-shape and is arranged below the burner. |
US10512357B2 |
Liquid flow control and beverage preparation apparatuses, methods and systems
Apparatuses, methods and systems for liquid flow control and beverage preparation are disclosed. The apparatuses, methods and systems of the present invention include liquid flow control and beverage preparation capsules, pods, cartridges, pouches, systems, and modules for controlling and directing flow streams of liquid through a beverage preparation process. The apparatuses, methods and systems of the present invention may be used in combination with or included as an integral assembly of any apparatus, method or system for liquid dispension. |
US10512356B2 |
Apparatus and method for controlling the taste of coffee, and a coffee maker comprising the apparatus
An apparatus for controlling the taste of coffee, a method of controlling the taste of coffee and a coffee maker including the apparatus. The apparatus includes a control unit, configured to determine a target pH value of water corresponding to a desired coffee taste, and a corresponding adjustment control signal; and a pH adjustment unit, configured to adjust, in response to the adjustment control signal applied to the pH adjustment unit, the pH value of water to be fed into a brewing unit of a coffee maker to the target pH value. In accordance with embodiments of the present disclosure, the pH value of water to be fed to a brewing unit of a coffee maker may be adjusted for a desired coffee taste. |
US10512354B2 |
Modular tree with electrical connector
A lighted artificial tree, including a first tree portion having a first electrical connector having a first electrical terminal positioned in line with a central vertical axis, and a second electrical terminal. The tree also includes a second tree portion that includes a second electrical connector having a first electrical terminal and a second electrical terminal, the second electrical terminal defining a ring shape that encircles the first electrical terminal. When the first tree portion is coupled to the second tree portion, the first electrical connector is coupled to the second electrical connector, such that the first electrical terminal of the first electrical connector is electrically connected to the first electrical terminal of the second electrical connector, and the second electrical terminal of the first electrical connector is electrically connected to the second electrical terminal of the second electrical connector. |
US10512349B2 |
Electric wine decanter
An electric wine decanter comprises a housing, an air pump, a spout, the retaining base and a control switch. The retaining base is provided with a vent hole for communicating with the air in the wine container and a wine guide tube for extending to a bottom of the wine container. The housing further includes a directional control valve therein for controlling an air flow switch of the air pump and a drive device for controlling the operation of the directional control valve. The directional control valve includes a valve body and a valve seat mounted to a bottom of the valve body. It is only necessary to install the electric wine decanter on the mouth of the wine container. By the opening and closing of the different valve mouths, the flow path of the air flow is changed to realize the functions of pressure-holding, vacuumizing and decanting. |
US10512347B1 |
Dual-dispensing lid
A dual-dispensing lid includes a pour orifice, a pour spout corresponding with the pour orifice, and a pour cap selectively detachable from direct contact with the pour spout. The pour cap seals the pour spout from fluid exiting the fluid container through the pour spout. The lid also includes a sip orifice and an elongated and resilient sip spout inserted through the sip orifice. A sip cap is selectively releasable from compression against the sip spout and selectively compressible against the sip spout in a manner that seals the sip spout from fluid exiting the fluid container through the sip spout. |
US10512346B2 |
Supporting base of drinking container
A supporting base of a drinking container is connectable with a bowl, wherein the bowl has an opening and an outer periphery circumferentially provided with an annular groove adjacent to the bottom side of the bowl. The supporting base includes a connecting portion, whose top and bottom ends are provided with a top portion and a bottom portion respectively. The top portion includes a coupling portion for coupling with the annular groove of the bowl. The bottom portion can be placed flat on a flat surface and has a bottom side concavely provided with an upwardly extending receiving room. The receiving room includes a positioning portion configured to press against and thereby secure in position the rim of the opening of the bowl. |
US10512344B2 |
Ventilation and temperature adjustment opening for sleeping bags
A sleeping bag with one more ventilation/temperature adjustment openings. The sleeping bag includes a length and width and the one more ventilation/temperature adjustment openings extend along a length of the front or upper side of the sleeping bag. A first more ventilation/temperature adjustment opening is located on a first side of a central opening access and a second more ventilation/temperature adjustment opening is located on a second side of the central opening access. Each more ventilation/temperature adjustment openings includes a fastening mechanism that when opened, a crevice is formed in the outer layer and insulative material of the sleeping bag, allowing the sleeping bag to vent better, thereby cooling an occupant of the sleeping bag and offering temperature regulation. |
US10512342B2 |
Apparatus for moving articles
Apparatus for moving articles comprising a conveyor member, a shelf provided with a guide cavity defining at least partly a movement path and a drive unit associated with the conveyor member and configured to move the conveyor member along the movement path. The conveyor member is provided with a support zone, a drawing zone, and an intermediate zone. |
US10512341B2 |
Museum showcase having drawers with a motorized actuation system
This showcase (10) for conserving and displaying objects in a protective environment comprises a frame (20), at least one drawer (30), a pair of sliding guides (40) for each drawer (30), and a motorised actuation system (50) formed by a first arm (51) and an actuator (52). The showcase (10) with this motorised actuation system (50) makes it possible to minimise the vibrations and the sudden movements of the drawers (30) when opening and closing, hence it limits accelerations at any point of the travel, thus allowing the correct conservation of the objects displayed in the drawers (30). |
US10512340B2 |
Pocketed spring assembly comprising strings of springs with tabs
A pocketed spring assembly comprises a plurality of parallel strings of springs held together with tabs. Longitudinal seams joining overlapping tabs extend generally the same direction as the strings of springs. Pockets are formed along a string of springs by aligned separating seams. At least one spring is positioned in each pocket. Each separating seam joins opposed plies of the string and keeps the spring in its pocket. Ends of aligned separating seams are spaced from each other, thereby improving airflow between pockets. |
US10512339B2 |
Electric support system for headrest
An electric support system for headrest includes a linear drive device and at least one connecting rod assembly. The connecting rod assembly includes a first fastener, a second fastener, a first connecting rod, a second connecting rod, a curved third connecting rod, and a curved fourth connecting rod between the two fasteners. The linear drive device is connected to the first fastener. An output end is connected to the third connecting rod and movable to drive the connecting rod assembly to expand to make the second fastener to a topmost position where an middle part of the third connecting rod coincides with the fourth connecting rod, or drive the connecting rod assembly to fold to make the second fastener to a bottommost position. Thus, the connecting rod assembly will be hidden between the sofa body and the headrest, which makes sofa more beautiful and in line with consumer aesthetic. |
US10512338B1 |
Furniture assembly with metal seat stretcher
A metal seat stretcher that is configured for easy mounting to the seat box, and furniture items including the same. The disclosed stretcher may be mounted in such a way so as not be directly mounted to the forward or rearward rails, thus preserving the strength and integrity of the rails by not subjecting them to perforation from a multitude of staples. Instead, the front end of the metal seat stretcher mounts to a clip rail that is secured to the inside of the front rail, and back end of the stretcher is secured to a seat back upright. In some embodiments, securing of the disclosed seat stretcher is done with a single screw at the front end and a single self-tapping bolt at the back end (though more fasteners may also be utilized). This provides for rapid and easy assembly of the furniture item. |
US10512337B2 |
Sofa bed
A sofa bed includes a mattress frame, a back frame, two arm frames and two cross beams, two arm frames are connected by the two cross beams, wherein the mattress frame and the back frame are rotatably pivoted. The inner side of the arm frame is disposed with a linking mechanism. The linking mechanism has a front connecting piece, rear connecting piece and a bridge connecting piece. Two ends of the bridge connecting piece are respectively pivoted to the front connecting piece and the rear connecting piece. The bottom end of the front connecting piece is pivoted to the arm frame. The bottom end of the rear connecting piece is pivoted to the arm frame. The linking mechanism has a front connecting piece, rear connecting piece and a bridge connecting piece. |
US10512334B1 |
Furniture height adjustment device
A height adjustment device used on furniture includes an inner tube having multiple clamp portions and multiple contact portions extending from the inner periphery thereof. Multiple grooves are defined in the outer periphery of the inner tube. A pneumatic tube is inserted into the inner tube and clamped by the contact portions. The inner tube is located in an outer tube that has a bottom cap and a top cap. Multiple ridges extend from the inner periphery of the outer tube. Each reduced opening accommodates the ridge corresponding thereto. The pneumatic tube has a piston rod and is connected to the bottom cap of the outer tube. The piston rod drives the inner tube to move relative to the outer tube. Multiple roller units are connected to ridges and roll the grooves of the inner tube to reduce friction between the inner tube and the outer tube. |
US10512332B2 |
Recliner and legrest mechanism for a furniture member
A furniture member may include a stationary base frame, a seat bottom frame, a seat bottom cushion, a seatback frame, and a seatback cushion. The base frame may include a forward support, an aft support, and a pair of armrests that extend between the forward support and the aft support. The forward, aft and lateral supports are stationary and fixed relative to each other. The seat bottom frame may be supported by the base frame. An upper end of the seatback frame may be pivotably coupled to the aft support such that the seatback frame is rotatable relative to the aft support and the seat bottom frame between a first position and a second position. A lower end of the seatback cushion has a greater range of motion than an upper end of the seatback cushion when the seatback frame moves between the first and second positions. |
US10512330B2 |
Furniture member with compliant legrest mechanism
A legrest mechanism including a seat base rail, a mechanism rail, a drive assembly, a pivot plate link, a pivot plate, a main drive link, and a parallelogram legrest link assembly. The drive assembly moves the mechanism rail relative to the seat base rail, which drives movement of the parallelogram legrest link assembly between a retracted position and an extended position. The parallelogram legrest link assembly includes first and second legrest links, footrest and legrest drive arms, and a legrest bracket. The main drive link has a pin that is slidingly received in a slot in one of the first legrest link, second legrest link, or main drive link such that movement of the parallelogram legrest link assembly is decoupled from movement of the main drive link when the legrest and/or parallelogram legrest link assembly encounters an obstruction while moving from the extended position to the retracted position. |
US10512326B2 |
Stackable storage rack
A stackable storage rack, which includes a base with multiple sockets for connecting a respective pair of vertical support members in a manner that permits multiple storage racks to be stacked on-site with their respective vertical support members attached and in a standard shipping container without their respective vertical support members attached. The storage rack also maximizes the storage capacity in a standard shipping container when it is loaded in a standard shipping container with its vertical support members attached. |
US10512324B2 |
Scrubbing brush head assembly
A scrubbing brush head assembly for cleaning an animal includes a shell. A wall coupled to the shell defines an upper chamber and a lower chamber. A pipe is coupled to the shell and is in fluidic communication with the lower chamber. A connector is configured to couple the pipe to a water source. A valve is configured to control a flow of water. A regulator fluidically couples the upper chamber to the lower chamber and the pipe. Tubes extend from a bottom of the shell and are in fluidic communication with the lower chamber. An actuator selectively actuates the regulator to fluidically couple the upper chamber to the lower chamber and the pipe. The water is partially directed to the upper chamber to dispense shampoo from the upper chamber to the lower chamber. The tubes direct the shampoo and the water to a body of an animal. |
US10512323B2 |
Oral care implement
A toothbrush includes a handle and a head mounted to the handle. In one aspect, the head may extend from a proximal end to a distal end along a longitudinal axis, the head having a base portion formed of a rigid plastic material and a flexible portion formed of an elastomeric material, a first longitudinal section of the flexible portion spaced apart from the base portion by a gap. The flexible portion of the head may have an upper surface and an opposing lower surface such that within the first longitudinal section of the flexible portion the upper surface and the lower surface are substantially planar and parallel to one another. Furthermore, tooth cleaning elements may be secured to the flexible portion of the head by in-molded technology to extend from the upper surface of the flexible portion. |
US10512317B2 |
Mobile device containing bag
Disclosed is a mobile device containing bag having a flat first baffle member and a flat second baffle member extending in parallel. A connector is configured to connect opposite edges of the first and the second baffle members together, so that a mobile device accommodation space is defined by the first baffle member, the second baffle member, and the connector. The mobile device containing bag can effectively prevent mobile device from vibrating or shaking in the mobile device accommodation space. |
US10512312B2 |
Slider for slide fastener
A slider may include a slider body, a pull-tab attachment portion provided at the slider body, and a resin-made pull tab attached to the pull-tab attachment portion. The pull tab may include an axial portion and a pair of bars extending from respective ends of the axial portion. The pull-tab attachment portion may include a pair of claws that axially support the axial portion of the pull tab. Each claw may be held by and between the respective paired bars while the pull tab pivots. A width of a terminal end of each claw in an axial direction of the axial portion may be less than a width of a base end of each claw in the axial direction. |
US10512310B2 |
Noise dampening tongues for use in a seat belt restraining system and methods of making the same
A noise dampening tongue assembly for use as part of a seat belt restraining system includes a base plate, a cover material, and a soft touch material. The base plate has a surface with a lower portion for engagement with a clamping member and an upper portion with a slot through which a belt webbing extends. The lower portion defines a bottom perimeter for the tongue assembly. The cover material contacts the base plate, such that it defines at least a portion of a top perimeter, a front-side, and a back-side of the tongue assembly. The soft touch material contacts the surface of the cover material, such that the soft touch material defines at least a portion of a right perimeter and left perimeter of the tongue assembly and extends horizontally across the surface of the cover material to connect the soft touch material located at right and left perimeters. |
US10512306B2 |
Sole structure with visual effects
A multi-colored effect for a sole structure for an article of footwear is disclosed. The sole structure comprises a sole member having a first color and an exterior layer having a second color that is different from the sole member. A plurality of slots are formed in the sole structure and the second color is visible on an outer surface of the sole structure through the plurality of slots. |
US10512304B2 |
Lace adjuster with interchangeable covers
A lace adjuster (14) includes an adjuster assembly (16); and a first cover (18) that is selectively attachable to the adjuster assembly (16). The first cover (18) is selectively movable between (i) an attached position, wherein the first cover (18) is attached to the adjuster assembly (16), and (ii) a detached position, wherein the first cover (18) is detached from the adjuster assembly (16). The first cover (18) can be moved between the attached position and the detached position without damaging the first cover (18) and the adjuster assembly (16). Additionally, the lace adjuster (14) can further include a second cover (18) that is alternatively, selectively attachable to the adjuster assembly (16). |
US10512301B2 |
Cushioning assembly for an article of footwear
A cushioning assembly for an article of footwear includes a first bladder wall and a second bladder wall disposed opposite the first bladder wall. At least one of the first bladder wall and/or the second bladder wall defines a plurality of domes defining a fluid-filled cavity between the first bladder wall and the second bladder wall. The domes include a base portion defining a generally hemispherical segment having a base radius, and a cap portion defining a generally hemispherical cap having a cap radius. The cap radius is less than the base radius. The cushioning assembly may include a load distribution structure positioned adjacent the cap portions of the domes to distribute an applied load across the domes. |
US10512296B2 |
Article of footwear incorporating a trimmed knitted upper
An upper for an article of footwear associated with one of a first foot size and a second foot size. The upper includes a knitted component including a trim region that defines a trimmed outer edge of the knitted component. The trimmed outer edge is associated with a first dimension of the upper that corresponds to the first foot size, and the trim region includes a trim line that is spaced from the trimmed outer edge in an inboard direction on the knitted component. The trim line defines a second dimension of the upper that corresponds to the second foot size. The second foot size is smaller than the first foot size. The knitted component includes a knit element having a first layer and a second layer. |
US10512288B2 |
Male undergarment with self-adjusting pouch
Disclosed is a male undergarment that has an expandable pouch. The pouch expands as needed depending on the male's genitalia. The pouch has a horizontal elastic band one and two-third inches below the garment's waistband which enables the pouch to adjust as needed. This horizontal elastic band is to be a half an inch long and one cm width depending on the size of the pouch. This pouch also has a four technique fold of material to increase comfort in the pouch. The two components combined creates a pouch that expands to the male's need. |
US10512287B2 |
Smoking article for selective delivery of an aerosol precursor composition, a cartridge, and a related method
A smoking article for on-demand delivery of an increased quantity of an aerosol precursor composition, a cartridge, and a method are disclosed. In some aspects, the cartridge includes a housing, and a reservoir disposed within the housing and defining two or more chambers each having an aerosol precursor composition therein. The reservoir is in fluid communication with an aerosol forming arrangement configured to form an aerosol from any of the aerosol precursor compositions, with the respective aerosol precursor compositions of the two or more chambers being directed to the aerosol forming arrangement in substantially equal normal quantities. The cartridge further includes an actuator configured to selectively and operably engage any one of the chambers and to direct an increased quantity of the aerosol precursor composition from the chamber engaged therewith to the aerosol forming arrangement, the increased quantity being greater than the normal quantity of the aerosol precursor compositions. |
US10512280B2 |
Method and apparatus for shaping substantially flat continuous material
The apparatus for shaping substantially flat continuous material comprises a shaping device (500) for gathering substantially flat continuous material transverse to a longitudinal direction of the continuous material to form a gathered continuous material. The apparatus further comprises a cooling device (75) for cooling the gathered continuous material. The shaping device and the cooling device are combined such as to immediately cool the gathered continuous material. |
US10512278B2 |
Inline mixing injector for liquid products
An apparatus for reducing the temperature of a liquid product in a processing line includes a polymer member having a passageway formed therein for receiving a liquid product in the passageway; an inlet and an outlet each in fluid communication with a corresponding opposed end of the passageway; a plurality of delivery channels formed in the polymer member, each one of the plurality of delivery channels having an opening in fluid communication with a different location of the passageway and constructed to provide a chilling medium into the passageway; and a support member for the polymer member, the support member constructed to mount the polymer member in the processing line. A related method is also provided. |
US10512275B2 |
Baked goods-like texture without baking
Compositions and methods for preparing a multi-texture, non-baked foodstuff having a first component with a first soluble solids ratio; and a second component with a second soluble solids ratio, wherein the second component is a non-baked foodstuff having at least 1% weight fraction of particulate matter having a particle size of about at least 100 μm, including at least one setting agent and at least one texture-modifying particulate ingredient and having a gel strength of about at least 100 and a liquid weight fraction of about at least 35%. |
US10512274B2 |
Apparatus for filling tubular cases
An apparatus for filling tubular cases with a pasty material, such as gathered sausage skin casings with sausage meat, is provided. The apparatus includes at least one filling tube, which is rotatable and drivable about its longitudinal axis and on to which a case which can be filled with the material can be pulled, a receiving portion at which the filling tube is rotatably received, and a drive unit for driving the filling tube. The apparatus advantageously includes a magnetic coupling for making and breaking an at least force-locking torque transmission between the drive unit and the filling tube, which has a drive rotor and a driven roller that is displaceable relative to the drive rotor in the longitudinal direction of the filling tube. Thus, the positioning during filling is reliable and performed with simplified structure. A filling machine including the apparatus is also provided. |
US10512271B2 |
Method for preventing or treating microbial growth on a manufactured product
The invention provides a method for preventing or treating microbial growth on a manufactured material or product. A composition comprising a cyclic decapeptide which is a tyrocidine, trypocidine, phenycidine or gramicidin S having an amino acid sequence of cyclo(valine-X1-leucine-D-phenylalanine-proline-X2-X3-X4-X5-X6) (SEQ ID NO: 1) is applied to the product and the cyclic decapeptides are adsorbed onto the product. Suitable products include medical devices (e.g. a catheter), wound dressings, food packaging, containers, wrappings, surfaces or devices used in the processing, transport or storage of food, filters, composites, paper, wrapping materials, walls, work surfaces, floors, pipes or the like. The composition could be used to disinfect or sterilise a material, surface or product or to inhibit formation of biofilms and/or biofouling on the surface of the product to which it is applied. |
US10512270B2 |
Acid tablet composition and methods of preparing and using the same
Compositions, tablets, prills and granules are provided including (a) about 95 to about 99.999 weight percent of at least one alkali metal hydrogen sulfate; and (b) about 0.001 to less than 0.08 weight percent of at least one alkali metal salt of a fatty carboxylic acid and/or at least one alkaline earth metal salt of a fatty carboxylic acid; wherein the composition includes less than 1 weight percent of chlorite and/or hypochlorite and less than 1 weight percent of alkali metal salt and/or alkaline earth metal salt that is chemically different from the at least one alkali metal hydrogen sulfate, the at least one alkali metal salt of a fatty carboxylic acid and the at least one alkaline earth metal salt of a fatty carboxylic acid, on a basis of total weight of the composition. Methods of use also are provided. |
US10512269B2 |
Herbicidal compounds
The present invention relates to herbicidal heteroaryl-alkyl-oxy-substituted heteroaryl/phenyl derivatives of formula (I), as well as to processes and intermediates used for the preparation of such derivatives. The invention further extends to herbicidal compositions comprising such derivatives, as well as to the use of such compounds and compositions in controlling undesirable plant growth; in particular the use in controlling weeds in crops of useful plants. |
US10512265B2 |
Pesticidally active heterocyclic derivatives with sulphur containing substituents
Compounds of formula (I) wherein the substituents are as defined in claim 1, and the agrochemically acceptable salts, stereoismers, enantiomers, tautomers and N-oxides of those compounds, can be used as insecticides and can be prepared in a manner known per se. |
US10512264B2 |
Herbicidal mixtures
The present invention provides a composition comprising (A) a compound of formula (I) wherein R1 is methyl, methoxy or chloro, R2 is methyl or chloro and A is a substituted heteroaryl group, or an N-oxide or salt form thereof, and (B) one or more further herbicides; as well as the use of such compositions in controlling plants or inhibiting plant growth. |
US10512263B2 |
Aqueous suspension agrochemical composition
An aqueous suspension agrochemical composition is provided containing fenpyrazamine and an acid component. The composition has no problem of emission of odor and has excellent storage stability. The composition has a pH at 25° C. in a range of 2.5 to 6.5. |
US10512261B2 |
Containers for liquid nitrogen storage of semen straws
Designs of improved canisters for animal semen straw storage in Dewars with cryogenic liquid are described. In some embodiments, the canisters include a layer of cryogen-absorbent material and an inner layer of thermally conductive material including apertures oriented and positioned to direct cryogen vapor into the interior of the container. |
US10512260B2 |
Method and apparatus for automated animal trapping
Methods and apparatuses are shown for selectively capturing a targeted animal that are directed to capturing an animal in a capture module having a one way capture mechanism and, using instructions executing in a controller, sensing the animal in an identification module and, responsive thereto, capturing an image of the animal, analyzing the captured image to identify whether the animal is a targeted animal, if the animal is the targeted animal, processing the animal, and releasing the animal. Additional examples involve performing chromatic or pattern analysis on the captured image, using the chromatic or patent analysis results, searching a database for machine recognized animal colors or patterns, generating a probabilistic assessment based on color or pattern of whether the animal in the identification module is the targeted animal, and generating a target determination indication based on the probabilistic assessment based on color or pattern. Processing the animal may include injecting the animal using a syringe. |
US10512258B2 |
Animal trap with animal entrance encouraging means
An animal trap features entrance encouraging mechanism for urging an animal into an enclosure of the trap. The mechanism features a pushing unit pivotally supported outside the interior space of the enclosure adjacent an access-way that opens into same. The pushing unit is pivotal about an axis generally parallel to a plane of the access-way for movement between a withdrawn position in which the access-way is unobstructed and a working position in which the pushing unit substantially obstructs the access-way. An actuator coupled to the pushing unit is triggered by an animal detection device at an approach area outside the enclosure within a travel path followed by the pushing unit, whereby the pushing unit urges the animal toward and through the access-way into the interior space of the enclosure. A one way gate prevents exit of the trapped animal after return of the pushing unit to the withdrawn position. |
US10512255B2 |
Furniture protector against crawling arthropods
A barrier device to prevent crawling arthropods such as bedbugs from accessing an item of furniture, said barrier device comprising a furniture riser, a deep fluid-filled moat, and a smooth wall around the moat. |
US10512254B2 |
Multi-function fishing tool
A multi-function tool includes a body, a clearing pin fastener, and a line holder assembly. The body includes a through-hole extending from a first surface to a second surface and defined by a threaded sidewall. The clearing pin fastener includes a head, a pointed end portion, and a threaded shank that is located between the head and the pointed end portion. The line holder assembly includes a line holder including a slit formed between a top portion and a bottom portion and configured to receive a line and a frame including a pair of opposing surfaces configured to hold the line holder in compression. The threaded shank is removably attached to the threaded sidewall so that the head is adjacent the first surface and the pointed end portion extends outward from the second surface. The line holder assembly is configured to rotate relative to the body about a pivoting axis. |
US10512253B2 |
DNA sequence that increases odorant receptor representation in the olfactory system
A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA. |
US10512251B2 |
Methods and compositions for inducing hygienic behavior in honey bees
The presently disclosed subject matter provides tritriacontene compositions for inducing hygienic behavior in honey bees; mite-infested brood extract compositions for inducing hygienic behavior in honey bees; methods of inducing hygienic behavior in honey bees; methods of selecting one or more honey bee(s) exhibiting hygienic behavior, and methods for assessing the degree of hygienic behavior within a honey bee colony. |
US10512248B1 |
Dog waste collection assembly
A dog waste collection assembly includes a handle that has a downward angle between a grip and a head. Thus, the head can be positioned beneath a dog when the dog is defecating and the grip being gripped. A pair of jaws is each pivotally coupled to the head. Each of the jaws is positionable between a closed and an open position. A pair of bag openers is each coupled to a respective one of the jaws and a bag can be positioned around each of the bag openers. An opening unit is movably coupled to the handle and the opening unit is in mechanical communication with the jaws. The opening unit urges the jaws into the open position when the opening unit is manipulated. Thus, the jaws open the bag for receiving the dog waste. |
US10512247B2 |
Systems and methods for a light-up object with enhanced features for animals
A light-up object includes a rubberized outer body; a plug in a cavity of the outer body; and a lighting device located in the plug. The light-up object further includes a first inner capsule piece, the first inner capsule piece located in the plug, and a second inner capsule piece located in the cavity of the outer body, the second inner capsule piece shaped to engage with the first inner capsule piece. The first and second inner capsules are threaded to fit together. The outer body includes grooves, running around multiple circumferences of the outer body. The outer body has a size of approximately a baseball; the outer body is shaped approximately like a sphere; and the grooves are at least 5 mm deep in the outer body. |
US10512246B2 |
Nail or claw trimmer for use with pets
An improved trimmer is structured to be held in the palm of a user's hand. The trimmer has a grinding drum that is advantageously structured to be situated in a palmar region of the user's hand that can be said to extend from the palm and to be generally bounded by the fingertips. When the trimmer is held in the palmar region, the thumb and certain fingers can support the trimmer, and other fingers that are not necessarily employed in supporting the trimmer are usable to operate a control switch of the trimmer. The control switch controls operation of a drive motor that is connected with a grinding drum which provides abrasive surfaces that are engageable with the animal nail or claw. |
US10512243B2 |
Automated cluster remover
A system includes a cylinder and a piston that moves within the cylinder from a retracted position to an extended position. A vacuum port facilitates application of a vacuum pressure to the cylinder that results in a vacuum force being applied to the piston, which causes the piston to move toward a top end of the cylinder to the retracted position. A spring member applies a spring force to the piston when the piston is in the retracted position. The spring force offsets at least a portion of the vacuum force. A sensor generates a displacement signal in response to detecting movement of the piston from the retracted position toward the extended position. A control unit receives the displacement signal generated by the sensor and generates a valve control signal to be communicated to a valve located on a vacuum line connecting a vacuum source to the vacuum port. |
US10512242B1 |
Soybean variety 01077436
The invention relates to the soybean variety designated 01077436. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01077436. Also provided by the invention are tissue cultures of the soybean variety 01077436 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01077436 with itself or another soybean variety and plants produced by such methods. |
US10512241B1 |
Soybean variety 01072232
The invention relates to the soybean variety designated 01072232. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01072232. Also provided by the invention are tissue cultures of the soybean variety 01072232 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01072232 with itself or another soybean variety and plants produced by such methods. |
US10512239B1 |
Soybean variety 01072273
The invention relates to the soybean variety designated 01072273. Provided by the invention are the seeds, plants and derivatives of the soybean variety 01072273. Also provided by the invention are tissue cultures of the soybean variety 01072273 and the plants regenerated therefrom. Still further provided by the invention are methods for producing soybean plants by crossing the soybean variety 01072273 with itself or another soybean variety and plants produced by such methods. |
US10512237B1 |
Soybean variety 5PFDN24
A novel soybean variety, designated 5PFDN24 is provided. Also provided are the seeds of soybean variety 5PFDN24, cells from soybean variety 5PFDN24, plants of soybean 5PFDN24, and plant parts of soybean variety 5PFDN24. Methods provided include producing a soybean plant by crossing soybean variety 5PFDN24 with another soybean plant, methods for introgressing a transgenic trait, a mutant trait, and/or a native trait into soybean variety 5PFDN24, methods for producing other soybean varieties or plant parts derived from soybean variety 5PFDN24, and methods of characterizing soybean variety 5PFDN24. Soybean seed, cells, plants, germplasm, breeding lines, varieties, and plant parts produced by these methods and/or derived from soybean variety 5PFDN24 are further provided. |
US10512234B1 |
Maize hybrid X03M278
A novel maize variety designated X03M278 and seed, plants and plant parts thereof are produced by crossing inbred maize varieties. Methods for producing a maize plant by crossing hybrid maize variety X03M278 with another maize plant are disclosed. Methods for producing a maize plant containing in its genetic material one or more traits introgressed into X03M278 through backcrossing or genetic transformation, and to the maize seed, plant and plant part produced thereby are described. Maize variety X03M278, the seed, the plant produced from the seed, and variants, mutants, and minor modifications of maize variety X03M278 are provided. Methods for producing maize varieties derived from maize variety X03M278 and methods of using maize variety X03M278 are disclosed. |
US10512231B2 |
Catnip cultivar ‘CR3’
The disclosure provides seed, tissue cultures, essential oil extracts, and plants of catnip hybrid ‘CR3’, as well as methods for producing a catnip plants by crossing ‘CR3’ plants with themselves or with another catnip plant, such as a plant of another genotype, variety, or cultivar. The disclosure further provides seed, tissue cultures, essential oil extracts, and plants produced by such crossing. Methods of using the plants and extracts as insect repellents and in pet toys, are also provided. |
US10512230B1 |
Soybean cultivar S170055
A soybean cultivar designated S170055 is disclosed. The invention relates to the seeds of soybean cultivar S170055, to the plants of soybean cultivar S170055, to the plant parts of soybean cultivar S170055, and to methods for producing progeny of soybean cultivar S170055. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. The invention also relates to soybean cultivars or breeding cultivars, and plant parts derived from soybean cultivar S170055. The invention also relates to methods for producing other soybean cultivars, lines, or plant parts derived from soybean cultivar S170055, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing cultivar S170055 with another soybean cultivar. |
US10512225B2 |
Tree sap line connector and assembly
A tree sap line connector having a fluid transfer body with interconnected walls defining a hollow inner chamber. The inner chamber is in fluid communication with a plurality of sap conduits, each of which extends from one of the walls. Each sap conduit is engageable with a sap collection line to convey sap to and from the inner chamber. At least one of the walls has a groove therein, which extends a depth into the wall and is accessible from an exterior of the fluid transfer body. The groove removably receives therein a connector piece of a sealing member. The sealing member is removably mounted to the line connector when the connector piece is received in the groove. |
US10512222B1 |
Steam treatment of soil
A soil treatment system, including heat treatment apparatus configured to travel in a forward direction along a plot of ground having a soil surface and configured for disturbing the soil surface and treating associated soil with steam as the heat treatment apparatus travels to provide steam treated soil, and a source of steam in flow communication with the heat treatment apparatus for supplying steam to the heat treatment apparatus. The heat treatment apparatus includes a first heat treatment section having a plurality of rotating blades configured to contact the soil surface and lift and circulate the soil and return the soil to the ground, and a plurality of first steam outlets proximate the rotating blades configured to expose the soil lifted and circulated by the rotating blades to steam from the first steam outlets. The heat treatment apparatus also includes a second heat treatment section having a conveyor configured to receive soil and to return the soil to the ground, a plurality of second steam outlets proximate the conveyor and a blade configured to contact the soil surface and lift the soil onto the conveyor for exposure of the soil on the conveyor to steam from the second steam outlets. |
US10512219B2 |
Rotary plant stripper and related methods
Disclosed is a plant stripper for separating buds or fruit from the stems or branches of a plant. In one embodiment, the plant stripper is defined by a housing that contains a face plate, bladed rollers, and motor and gear system for counter turning the rollers. In operation, a plant stem bearing buds or fruit may be provided through a plant hole in the face plate and gripped by the counter turning rollers so that continued counter turning of the rollers pulls the stems or plants through the plant hole of the face plate. Suitably, the plant hole is gauged so that only the stem may pass through the hole but not the buds or fruit whereby the buds or fruit of the plant are stripped from the plant via action of the stem through the plant hole. In one embodiment, the plant stripper features a guide tray for catching stripped buds or fruit and guiding the same to a collection bin. |
US10512218B2 |
Mower having collection system with quick connect vacuum hose adapter
A quick connect hose adapter connects a flexible transfer hose from a mower deck to an inlet tube on a container for storing debris. The adapter includes a first cylindrical portion fixed in the discharge end of the flexible hose, and a second portion with a clamp assembly that clamps to the inlet tube. The clamp assembly has first and second semi-cylindrical segments connected together on one side by a continuous hinge, and at least one latch for latching the other side of the semi-cylindrical segments together to cause the clamp assembly to be clamped to the inlet tube. When the latch is released, the second semi-cylindrical segment can be moved from a closed position to an open position. In the open position, the adapter is easily removable from the inlet tube. A seal ring provides a smooth inner surface and seal between the adapter and the inlet tube. |
US10512216B2 |
Combine harvester with grain culm sensor
The combine harvester includes a harvest frame that receives grain culms cut by a reaping device and a rake-in auger disposed within the harvest frame so as to be rotatable about a rotary axis extending in a right/left direction of the harvester body. The rake-in auger conveys the grain culms inside the harvest frame in a right/left direction of the harvester body and rakes in the grain culms toward the rear of the harvester body. The combine harvester further includes a feeder that is communicatively connected to a rear wall of the harvest frame, and that conveys the grain culms raked in by the rake-in auger toward the rear of the harvester body. A grain culm sensor that detects the presence of the grain culms when coming in contact with the grain culms is disposed at a grain culm feed port in the feeder. |
US10512214B2 |
Lawn mower with waterproofed driving source
A lawn mower includes a driving source mounting portion formed in a traveling frame, a driving source mounted in the driving source mounting portion, and a lawn mowing unit attached to the driving source. A bottom surface of the traveling frame includes a frame-side seal surface surrounding the lower end of the driving source mounting portion, and a lawn mowing unit peripheral surface surrounding the frame-side seal surface. A waterproof member is in tight contact with the frame-side seal surface. The lawn mowing unit peripheral surface is formed over a range from an outer circumferential edge of the frame-side seal surface to an outer circumferential edge of the lawn mowing unit. A boundary between the frame-side seal surface and lawn mowing unit peripheral surface is formed into the shape of a step. |
US10512213B2 |
Double deck boots
A double deck boot attachment for a lawn maintenance tool includes a smaller deck boot and a larger deck boot including an interior volume. The smaller deck boot is an attachment for at least one first lawn maintenance tool and the larger deck boot is an attachment for at least one second lawn maintenance tool. At least a portion of the smaller deck boot is configured to slide within the interior volume of the larger deck boot from a separated position to an assembled position and the double deck boot is configured to be stored and shipped as one deck boot with one stock keeping unit code. |
US10512210B2 |
Agricultural row unit systems, methods, and apparatus
A row unit for an agricultural planter having features for releasably operably coupling a seed meter of the row unit to a seed deposition apparatus of the row unit such as a seed conveyor, seed tube or the like. Apparatus may be used for tipping a seed meter of the hopper for disengagement from the seed deposition apparatus or for biasing the seed deposition apparatus into operative engagement with the seed meter. The row unit includes features such as latches for releasably operably coupling the row unit to crop input and vacuum supply lines. Apparatus may also be used for tipping a seed meter of the hopper for disengagement from the crop input and vacuum supply lines. Systems are used for supplying vacuum and crop inputs to the seed meter via the releasably engageable apparatus. |
US10512205B2 |
Agricultural tillage implement wheel control
An agricultural tillage implement includes a main section including a hitch extending in a travel direction, a plurality of foldable wing sections coupled with the main section, a plurality of ground engaging tilling elements, a plurality of wheel assemblies and a control system. The tilling elements are coupled to the main section and wing sections. Each of the wheel assemblies include an actuator. The wheel assemblies include a first plurality of wheel assemblies associated with the main section and a second plurality of wheel assemblies associated with the plurality of wing sections. The actuators of the first plurality of wheel assemblies being independent of the actuators of the second plurality of wheel assemblies. The control system is configured to actuate the actuators to effect a profile minimizing operation of the foldable wing sections when the implement is being transitioned into a transport mode. |
US10512203B2 |
Vehicle control system
A tractor control system, which controls an operating condition of an implement attached to the tractor. The control system includes a sensing means providing a force signal which indicates the pull force necessary to pull an implement in a desired position; a control which receives the force signal; and means for measuring at least one parameter associated with the tractor mode and/or the implement mode and the implement position is adjusted to a new position when the force signal varies. The control system includes pre-determined values associated with certain tractor and/or implement modes. A measured parameter is compared with a pre-determined parameter value and if the measured parameter would result in an undesired movement of the implement, the force signal is deactivated, or the response to the force signal is deactivated to prevent undesired movement of the attachment. |
US10517201B2 |
Control device for component mounting machine
A control device for the component mounting machine is provided with an error detecting section configured to detect a pickup error in which the electronic component was not picked up during pickup operation; a recovery control section configured to perform recovery processing of picking up the electronic component by performing the pickup operation again in a case in which a quantity of the pickup errors that has occurred consecutively during multiple attempts at the pickup operation is less than a threshold value; a tape management section configured to acquire a remaining amount of the carrier tape at the feeder; and a threshold changing section configured to change the threshold value in accordance with the acquired remaining amount of the carrier tape. |
US10517198B1 |
Cable having shielding tape with conductive shielding segments
A cable includes a first twisted pair of insulated conductors, a second twisted pair of insulated conductors, a shielding tape, and an outer jacket surrounding the first twisted pair of insulated conductors, the second twisted pair of insulated conductors and the shielding tape. The shielding tape includes a substrate and a plurality of conductive shielding segments. The plurality of conductive shielding segments is disposed on the substrate. Each conductive shielding segment is spaced from each immediately adjacent conductive shielding segment in a longitudinal direction. |
US10517197B2 |
Shielded isolation chamber
Apparatus and techniques for implementing an isolation chamber, and more particularly for implementing an EMF shielded isolation chamber. In various embodiments, an isolation tank includes a shell having an upper cover and a lower tank portion having one or more sidewalls connected to a floor. The lower tank portion is configured to hold liquid and the lower tank portion and the upper cover together define an interior chamber configured to receive a user. The isolation tank further includes a conductive shield associated with at least a portion of the shell and configured to shield at least a portion of the interior chamber from external electromagnetic fields. In various additional embodiments, the isolation tank includes a shield ground for electrically grounding the shield and/or a liquid ground for electrically grounding the liquid. |
US10517194B2 |
Changing air flow direction on air-cooled electronic devices
Embodiments of the present disclosure include systems and methods for controlling the direction of cooling air flow across components of an electronic devices. An air-cooled electronic device includes: an air flow generator that is able to generate air flow in either first or second direction across the device; a sensor that measures first and second temperatures of air in the device when the air flows in the first and second directions, respectively; and a controller coupled to the mechanism and the sensor. The controller compares the first temperature to the second temperature and controls the air flow generator to generate the air flow in one of the first and second directions based on comparison of the first temperature to the second temperature. |
US10517193B2 |
Regulation method for an electrical enclosure cooling device
The invention relates to a regulation method for an electrical enclosure cooling device, which has a refrigerating machine and a heat pipe arrangement, wherein the method comprises measuring a current internal electrical enclosure temperature and determining a target temperature for the internal electrical enclosure temperature, wherein said internal electrical enclosure temperature and target temperature form input signals of a regulator for actuating the electrical enclosure cooling device, and wherein said regulator outputs a control signal for determining manipulated variables of the refrigerating machine; determining the regulator control signal as a measured variable which is proportional to the respective current required cooling power; measuring the ambient electrical enclosure temperature and determining a respective energy efficiency for the refrigerating machine and the heat pipe arrangement either in the event that the required cooling power is to be provided by the refrigerating machine or in the event that the required cooling power is to be provided by the heat pipe arrangement; and selecting and activating that one of the two coolant circuits that can provide the required cooling power with greater energy efficiency. |
US10517190B2 |
Electronic device and control method thereof
A fan module includes a first casing, a driving motor disposed in the first casing, a first rotor connected to the first driving motor, a second casing, a second rotor pivotally configured in the second casing, at least one guiding member and a shift apparatus connected to the first casing and the second casing, the first rotor includes a first rotating shaft and a plurality of first blades, the second rotor includes a second rotating shaft and a plurality of second blades, the guiding member is disposed on the first blade and the second blade. The whole height of the blade is adjusted by adjusting the distance between the two group blades, then the efficiency of the fan is improved effectively to optimize the noise level and the air flow. |
US10517188B2 |
Power distribution unit with cord storage cartridge
Systems, methods, and devices are provided in which cord storage cartridges are removably connected to a power distribution unit (PDU). The cord storage cartridge may include a cartridge housing having at least one aperture, a PDU interface associated with the cartridge housing and configured to removably connect the cord storage device to a mateable interface of the PDU, and a power output cord having a proximal end in electrical communication with the PDU interface and a distal end coupled with an output connector that is configured to connect to electronic equipment. The power output cord may be stowed at least partially within the cartridge housing in a retracted state and moveable through the at least one aperture to an extended state at least partially external to the cartridge housing. |
US10517183B1 |
Holding and release device for sliding chassis in server
A hold and release device of reduced size allowing the sliding of a server chassis relative to a rack includes a mounting assembly mounted to the server chassis. A fixing member is rotatably coupled to the mounting assembly and comprises a first protrusion to fasten the server chassis to the rack. A latching button is configured to latch the fixing member to the mounting assembly. A guiding member is connected to a button stage receives the latching button and has a sliding tunnel, and a handle slidably coupled to the guiding member is located in the sliding tunnel. |
US10517182B2 |
Wearable electronics device
A wearable electronic device is provided. The wearable electronic device includes a main body and a wearing unit that allows the main body to be worn on a user's body. The wearing unit may include a first wearing member extending from the main body, a binding member coupled to the first wearing member to be moved in a longitudinal direction of the first wearing member, and a driving member installed in the first wearing member to move the binding member. |
US10517181B2 |
Electronic control device and manufacturing method for same
Providing an electronic control device excellent in reliability with low cost. An electronic control device includes: an electronic component; a control substrate on which the electronic component is mounted; a sealing resin for sealing the control substrate; and a metal housing case at least a portion of which is sealed with the sealing resin; a terminal for electrically connecting the control substrate with an external device; and a fixing plate for positioning and fixing the terminal with respect to the housing case. After the terminal is fixed to the housing case by the fixing plate, the terminal is electrically connected to the control substrate and subsequently a portion of the terminal and the control substrate are sealed with the sealing resin. |
US10517175B2 |
Bracket for electronic component, electronic component assembly and mobile terminal
The present disclosure provides a bracket for an electronic component. The bracket includes a bearing part configured to bear an electronic component and two side walls. The two side walls are oppositely arranged and disposed at the same side of the bearing part. The two side walls of the bracket are configured to be disposed on a mainboard and define together with the mainboard and the two side walls an accommodating space. The present disclosure further provides an electronic component assembly and a mobile terminal. |
US10517173B2 |
Display device having display panel and back cover
A display panel includes a first substrate and a second substrate; a source printed circuit board on the second substrate of the display panel, the source printed circuit board electrically connected to the display panel; a control printed circuit board electrically connected to the source printed circuit board by a signal cable; and a back cover accommodating the display panel including the first and second substrates and the source printed circuit board, and disposed between the source printed circuit board and the control printed circuit board, the back cover including a penetrating hole, through which the signal cable passes and maintaining a space by the signal cable with respect to the display panel, wherein the penetrating hole of the back cover is disposed at a mid-portion of the second substrate in a vertical direction. |
US10517172B2 |
Flexible circuit board
An embodiment of the present invention relates to a flexible printed circuit board (FPCB), which is applied to various electronic display devices, and may provide the FPCB, including a base, a first metal layer and a second metal layer on both surfaces of the base, a first plating layer on the first metal layer, a second plating layer on the second metal layer, and a first insulating pattern and a second insulating pattern respectively disposed on some region of the first plating layer and the second plating layer, wherein the first plating layer and the second plating layer may have different thicknesses. |
US10517171B2 |
Method for fabricating flexible substrate
The present invention relates to a method for producing a flexible substrate. According to the method of the present invention, a flexible substrate layer can be easily separated from a carrier substrate even without the need for laser or light irradiation so that a device can be prevented from deterioration of reliability and occurrence of defects caused by laser or light irradiation. In addition, according to the method of the present invention, a flexible substrate can be continuously produced in an easier manner based on a roll-to-roll process. |
US10517166B2 |
Optical transceiver including heat dissipation structure
An optical transceiver according to one example comprises: a housing having an inner surface therein; a first printed circuit board on which a CDR, which generates heat by consuming electric power, is mounted; a second printed circuit board arranged between the inner surface and the first printed circuit board; a protection member arranged to surround the periphery of the CDR in parallel with the inner surface; a thermal conductive gel in contact with each of the CDR, the protection member and the second printed circuit board; a heat dissipation sheet arranged between the second printed circuit board and the inner surface; and a heat dissipation sheet arranged between the first printed circuit board and the inner surface, wherein the protection member has an opening in contact with a part of the thermal conductive gel. |
US10517162B2 |
Lighting system and communication terminal
A lighting system includes: a luminaire; a brightness sensor that controls the luminaire via wireless communication and detects brightness of the luminaire; a controller that performs control of the luminaire via the brightness sensor; and an operation terminal. The operation terminal wirelessly transmits setting information related to the control of the luminaire to the brightness sensor, and the brightness sensor relays the setting information to the controller via wired communication. |
US10517158B2 |
Systems and methods for detection and illumination of regions of interest
An illumination system for a lighting assembly comprises a light assembly configured to selectively illuminate an operating region in a surgical suite and a plurality of light sources positioned within the light assembly and configured to emit light. The system further comprises at least one imager configured to capture image data and a controller. The controller is configured to scan the image data for at least one region of interest comprising at least one of a shaded region and a contaminated region and identify a location of the region of interest in the operating region. The controller is further configured to control the light assembly to activate at least one of the light sources to emit light on the region of interest. |
US10517154B2 |
Load control device having a wide output range
A load control device (e.g., an LED driver) for controlling the intensity of a lighting load (e.g., an LED light source) may provide a wide output range and flicker-free adjustment of the intensity of the lighting load. The load control device may comprise a load regulation circuit, a control circuit, and a filter circuit (e.g., a boxcar filter circuit) that operates in a different manner in dependence upon a target current. When the intensity of the lighting load is near a low-end intensity, the control circuit may adjust an operating frequency of the load regulation circuit in response to the target current, and may control the filter circuit to filter a current feedback signal during a filter window that repeats on periodic basis. When the intensity of the lighting load is near a high-end intensity, the control circuit may control the filter circuit to constantly filter the current feedback signal. |
US10517151B1 |
Linear constant-current LED light circuit
A linear constant-current LED light circuit that can automatically adapt to a change of an input voltage according to changes of a quantity of dedicated constant-current circuits and a quantity of LEDs in series, so that a total voltage of the LEDs is always close to the input voltage, thereby reducing a voltage drop of a constant-current transistor and reducing power loss of the constant-current transistor, so as to achieve energy saving. The dedicated constant-current circuits make the LEDs work in a rated current range, without generating overcurrent to cause damage, and a progressive decrease of a resistance of n stage dedicated constant-current circuits is set to implement a progressive increase of currents of the n stage dedicated constant-current circuits, so that a working current of the circuit can follow the input voltage. Therefore, the circuit has a relatively high power factor, relatively low harmonic distortion, and good electrical performance. |
US10517149B2 |
AC light emitting diode and AC LED drive methods and apparatus
An LED Lighting System for use with AC voltage power source configured such that a driver, and LED circuit is combined, the driver having an input of a first AC voltage and first frequency and an output of a second voltage and frequency delivered to the LED circuit. Embodiments include the LED circuit, driver and at least one capacitor mounted to a reflective substrate. |
US10517148B2 |
Induction heat cooking apparatus and method for driving the same
An electronic induction heat cooking apparatus is provided. The electronic induction heat cooking apparatus includes a rectifier for rectifying an input voltage and outputting a direct current (DC) voltage, a plurality of switching elements for switching the DC voltage output through the rectifier, a cooling fan for cooling the plurality of switching elements, a plurality of heating coils for heating a cooking utensil by controlling the plurality of switching elements, and a controller for controlling the plurality of switching elements according to a plurality of operation modes. In an operation mode for generating maximum heat among the plurality of operation modes, a switching element for generating maximum heat among the plurality of switching elements is arranged closer to the cooling fan than at least one of the other switching elements. |
US10517145B2 |
Chemical liquid thermostat control device
A chemical liquid thermostat control device is provided, and has a chemical tank for accommodating a chemical liquid, PTC resistor patterns for heating and maintaining the chemical liquid in a constant temperature, a current limit circuit for controlling the PTC resistor patterns to heat or to stop heating according to a real-time resistance value of each of the PTC resistor patterns, so as to maintain the chemical liquid at the constant temperature. The PTC resistor patterns are uniformly spaced in the chemical tank and immersed in the chemical liquid. Each of the PTC resistor patterns is connected with the current limit circuit through a wire. A heating power of a heating device can be real-time adjusted for intelligently heating. Thus, it is safer and a fire risk can be prevented. The life time of the PTC resistor patterns is more than a decade, and doesn't need be replaced frequently. |
US10517144B2 |
Cooktop appliance and temperature switch
A cooktop appliance having a temperature switch is generally provided herein. The cooktop appliance may include a panel, an electric heating element, an infinite switch, and the temperature switch. The electric heating element may be positioned at the panel and include a first terminal and a second terminal. The infinite switch may be electrically coupled to the electric heating element to control power thereto. The infinite switch may include a primary voltage path and an auxiliary voltage path independent from the primary voltage path. The temperature switch disposed in thermal communication with the electric heating element, the temperature switch being in alternate communication with the primary voltage path below a predetermined threshold temperature and with the auxiliary voltage path at or above the predetermined threshold temperature. |
US10517143B2 |
Base station system
A base station system includes a base station device (1), a wireless transmission device (2) and a data transfer device (3), each of which can be installed outdoors. Enclosures (12, 22 and 32) of the devices (1-3) each provide a degree of protection from water and dust ingress necessary for being installed outdoors. The enclosure (12) of the base station device (1) accommodates electronic equipment (11) functioning as a base station. The enclosure (22) of the wireless transmission device (2) accommodates electronic equipment (21) functioning as a radio station to perform wireless transmission with the other device for connecting the base station device (1) to a mobile backhaul network. The enclosure (32) of the data transfer device (3) accommodates electronic equipment (31) functioning as a router or a switch to transfer data packets or data flames between the base station device (1) and the wireless transmission device (2). This eliminates the need for construction of a building/shelter to install the base station system. |
US10517142B2 |
Method for transmitting and receiving frame in wireless LAN system, and apparatus therefor
A method for transmitting a frame by a STA in a wireless LAN system according to an embodiment of the present invention may comprise: receiving a first frame from an AP; determining, on the basis of the first frame, a TXOP duration value to be included in a SIG field of a second frame that the STA is to transmit; and transmitting the second frame, in determining the TXOP duration value, the STA calculates a residual TXOP duration that may retain after the second frame is transmitted, on the basis of a TXOP duration indicated through the first frame, and when the residual TXOP duration is not a multiple of a granularity of a time unit used by the SIG field, the STA approximates the residual TXOP duration to be a first TXOP duration value which is a multiple of the granularity. |
US10517139B2 |
Systems and methods for intelligent event response
A system for coordinating a response comprising a plurality of mobile devices for use by persons responding to an event; a mobile application configured to send, via the corresponding mobile device, information concerning a response to the event of the person using the corresponding mobile device; and a server configured to receive and share the information with each of the other mobile devices so as to provide continuously updated information concerning the response of each person to the event for use in coordinating a collective response to the event by the persons. A method for coordinating a response comprising sending, via a plurality of mobile devices, information concerning a response to the event by a corresponding user of the corresponding mobile device; sharing the information with each of the other mobile devices; and displaying the shared information for facilitating coordination of a collective response to the event by the persons. |
US10517135B2 |
Method and apparatus for transmitting a handover report and an RLF report
A method for transmitting a handover report and for transmitting a radio link failure (RLF) report are provided. The method includes obtaining, by a target base station, at least one of location information of a source cell or location information of a user equipment (UE) history cell during a handover procedure, and transmitting, by the target base station, the handover report to at least one of a source base station or to a base station where the UE history cell is located, according to the obtained at least one of location information of the source cell or the location information of the UE history cell, wherein the handover report including at least one of an unnecessary handover report, a too early handover report, or a handover to wrong cell report. |
US10517132B2 |
Terminal devices, network nodes and methods of operating the same
According to an exemplary embodiment, there is provided a method of operating a terminal device, the terminal device being configured to communicate with a first network operating according to a first radio access technology, RAT, and network nodes operating according to a second RAT, wherein the terminal device has a mobility set comprising identifiers for one or more network nodes operating according to the second RAT that can be used for access network selection, traffic steering and/or traffic aggregation, the method comprising on occurrence of a failure condition with respect to a connection to one or more network nodes operating according to the second RAT having an identifier in the mobility set, sending a failure indication message to the first network to signal the occurrence of the failure condition to the first network. |
US10517128B2 |
Method and apparatus for transmitting and receiving signal in communication system supporting device to device scheme
The present disclosure relates to a pre-5th-generation (5G) or 5G communication system to be provided for supporting higher data rates beyond 4th-generation (4G) communication system such as a long term evolution (LTE). A method for transmitting a device to device (D2D) discovery signal by a user equipment (UE) in a communication system supporting a D2D scheme is provided. The method includes determining transmission power for D2D discovery signal transmission, and transmitting a D2D discovery signal using the transmission power, wherein the transmission power is determined by considering a cell at which the D2D discovery signal is transmitted. |
US10517127B2 |
Techniques for encoding beacon signals in wireless power delivery environments
Embodiments of the present disclosure describe techniques for encoding beacon signals in wireless power delivery environments. More specifically, techniques are disclosed for encoding beacon signals to isolate client devices for wireless power delivery in wireless power delivery environments. The beacon signals can be encoded or modulated with a transmission code that is provided to selected clients in the wireless power delivery environment. In this manner, beacon signals from the select clients can be identified and the corresponding client devices isolated for wireless power delivery. In some embodiments, the transmission code can be a pseudorandom sequence that is used by the wireless power delivery clients to encode transmitted beacon signals. |
US10517125B1 |
System, method, and computer program for selecting a communication network to utilize based on knowledge and artificial intelligence (AI)
A system, method, and computer program product are provided for selecting a communication network to utilize based on knowledge and at least one artificial intelligence (AI) algorithm. In operation, a user device identifies a plurality of communication networks to which to potentially connect. The user device accesses knowledge associated with the plurality of communication networks to determine a communication network to utilize. The knowledge includes information associated with historical data, present data, and future data. The user device selects the communication network to utilize based on the knowledge and at least one algorithm (e.g. an artificial intelligence algorithm, etc.). Moreover, the user device connects to the communication network for performing at least one activity. |
US10517124B2 |
Location and navigation path-assisted beam management
Systems, apparatuses and methods may provide for technology that determines line of sight information for a plurality of base stations based on relative signal strengths, a location and a planned navigation path of a mobile system. Additionally, the technology may favor a base station from the plurality of base stations based on the line of sight information, select a beam combination that is optimal for the favored base station, and form a communication link on a beam combination corresponding to the mobile system and the favored base station. |
US10517123B2 |
Radio network node, network node and methods performed therein
Embodiments herein relate to a method performed by a network node for enabling communication between the network node and a radio network node comprised in a communication network. The network node supports a first set of functionalities out of a total set of functionalities in the communication network, which first set of functionalities is separated from a different set of functionalities out of the total set of functionalities in the communication network. The network node initiates a transmission of an indication to the radio network node, which indication indicates the supported first set of functionalities. |
US10517121B2 |
Service processing method, related apparatus, and system
Embodiments of the present invention provide a service processing method, a related apparatus, and a system. The method includes: UE adds a service type indication of a service initiated by the UE to an RRC connection request and sends the RRC connection request to a base station, and adds the service type indication of the service initiated by the UE to a non-access stratum NAS request and sends the NAS request to a mobility management network element. In this way, when a network side performs congestion control or overload control, the base station may determine, according to the service type indication, that the service initiated by the UE is a voice service, a video service, or a short message service, accept the RRC connection request. Similarly, the mobility management network element may accept, according to the service type indication, the NAS request. |
US10517119B2 |
Apparatuses, systems, and methods for probabilistic transmission of device-to-device (D2D) discovery messages
Embodiments described herein relate generally to techniques for device discovery for device-to-device (D2D) communications. A user equipment (UE) may receive a transmission probability (e.g., from an evolved Node B (eNB)) for transmission of a discovery medium access control (MAC) protocol data unit (PDU) for D2D communications. The UE may determine a pseudo-random number based on an identifier of the UE, information in the discovery MAC PDU, or information associated with a discovery period. The UE may compare the pseudo-random number with the transmission probability to determine whether to transmit the discovery MAC PDU in the discovery period. Another UE may also determine the pseudo-random number to determine whether the UE is to transmit the discovery MAC PDU in the discovery period. Other embodiments may be described and claimed. |
US10517118B2 |
Transmission resource determining method and related device
The present invention provides a transmission resource determining method and a related device. The method includes: receiving, by a first device, status information sent by all devices in a region; determining, by the first device, an idle resource in a resource pool according to a transmission pattern and resources in the resource pool that are used when all the devices in the region send the status information; and determining, by the first device according to a first rule, a first transmission resource from the idle resource as a resource for sending status information of the first device. |
US10517116B2 |
Contention-based data transmissions on return link
Methods and apparatuses are disclosed for a network controller to receive data from a user terminal (UT) via a satellite in a satellite system. The network controller may allocate contention-based resources of the satellite system to a plurality of UTs, and may activate the allocated contention-based resources by transmitting an activation signal to the plurality of UTs. The network controller may receive, from a first UT via a satellite of the satellite system, a first portion of data on a plurality of subframes of the contention-based resources during a time period, and may suspend the allocation of contention-based resources after an expiration of the time period or upon a grant of scheduled return link resources to the first UT, irrespective of collisions on the contention-based resources. |
US10517115B2 |
Method for performing random access, and associated terminal device
The present disclosure relates to a method used in a terminal device for performing random access to a network device, and the associated terminal device. The method comprises: obtaining access related information from a predefined Minimum Common Entry Set (MCES) stored in the terminal device; and performing random access to the network device based on the access related information. |
US10517110B2 |
Cell configuration for V2X communications in a wireless network
A base station receives, from a wireless device, a message comprising a first sequence of a plurality of parameters. A first parameter in the first sequence indicates whether a V2X transmission configuration is supported in a first band combination. The first band combination may be in a second sequence of a plurality of band combinations associated with the wireless device. An index of the first parameter in the first sequence identifies the first band combination in the second sequence. A second message may be transmitted based on the message. The second message comprises configuration parameters of at least one cell for V2X communications. The at least one cell operates in one of the plurality of band combinations that supports the V2X transmission configuration. |
US10517106B1 |
Systems, methods, and devices for network request scheduling
Systems, methods, and devices schedule requests associated with wireless communications devices. Methods include receiving a plurality of requests from a plurality of wireless communications devices that is compatible with an 802.11 transmission protocol, where each request of the plurality of requests includes a proposed service period and proposed service interval. Methods further include generating, using a processing device, a plurality of quantization factors by quantizing the proposed service interval included in each of the plurality of requests, determining, using the processing device, a common service interval based, at least in part, on the plurality of quantization factors and a basic service unit, and generating, using the processing device, an allocation pattern to allocate the proposed service periods within the common service interval. |
US10517104B2 |
Interference management for networks with variable transmission time intervals
Methods, systems, and devices for wireless communication are described. A first cell may receive a message indicating that a second cell has a priority transmission scheduled using a transmit time interval (TTI) that is shorter than a TTI used by the first cell. The first cell may limit, based on the message, a communication parameter associated with communications between the first cell and a user equipment (UE) during the scheduled priority transmission. |
US10517096B2 |
Method for sending control information, user equipment, and base station
An embodiment method includes method includes receiving, by a user equipment, a plurality of pieces of first downlink control information sent by a base station, wherein pieces of the plurality of pieces of first downlink control information carry downlink assignment indexes, and wherein at least one piece of the plurality of pieces of first downlink control information further carries a total downlink assignment indexes. The method also includes generating, by the user equipment, a hybrid automatic repeat request response message according to the total downlink assignment indexes, according to the downlink assignment indexes of the pieces of the plurality of pieces of first downlink control information, and according to a physical downlink shared channel corresponding to the pieces of the plurality of pieces of first downlink control information. Additionally, the method includes ending, by the user equipment, the hybrid automatic repeat request response message to the base station. |
US10517089B2 |
Reception apparatus and reception method
Method of scrambling signals, transmission point device, and user equipment using the method are provided. The method includes: sending an ID table to a user equipment through higher layer signaling, the ID table being a subset of the whole ID space and containing available IDs for the user equipment; notifying the user equipment an ID in the ID table to be used through physical layer signaling or UE specific higher layer signaling; generating a random seed based on the notified ID; initializing a scrambling sequence by the random seed; and scrambling the signals with the initialized scrambling sequence. The method of the disclosure, by combining physical layer signaling and higher layer signaling, may notify the used group ID and the blind detection space to a UE, wherein the blind detection for the UE is enabled and the signaling overhead is reduced. |
US10517083B2 |
Method and user equipment for receiving downlink control information, and method and base station for transmitting downlink control information
A search space (hereinafter, CSS) for a control channel for scheduling a random access response may be configured by a system information block. A user equipment (UE) may attempt to receive a control channel for a random access response on the assumption that CSS is configured in accordance with a configuration based on the system information block. The UE may attempt to receive the control channel within a UE-specific search space (USS) by assuming that the USS is configured in accordance with the configuration of the CSS until a configuration for the USS is received. |
US10517082B2 |
Mechanisms for multi-tier distributed co-operative multi-point technology
Embodiments of the present disclosure provide mechanisms for the following procedures: network signaling for user equipment (UE) measurements; UE measurements; UE feedback; feedback adjustment at network nodes; scheduling; Acknowledgements/Negative Acknowledgements; and network-wide planning. Some or all of these mechanisms can be used in implementing distributed open-loop multi-user co-operative multi-point (MU-CoMP) technology as well as other non-CoMP, one-tier or centralized wireless transmission technologies. The mechanisms are in line with proposed no-cell technology for 5G communication networks. |
US10517080B2 |
Terminal device and transmission method
A control unit (208) transmits a response signal on an uplink control channel on the basis of a rule. In the rule, error detection result pattern candidates are associated with multiple resources of the uplink control channel used in the transmission of the response signal and with phase points within each resource, and at least a specific pattern candidate, wherein the pattern for a specific error detection result with respect to downlink data of a first unit band is identical to the error detection result pattern when communication with the base station (100) occurs using only the first unit band, and the error detection results other than the specific error detection result are all NACK or DTX, is associated with the first resource of the multiple resources. In addition, at least the first resource of the multiple resources is arranged within the first unit band. |
US10517078B2 |
Method for transmitting/receiving uplink signal between base station and terminal in wireless communication system, and device for supporting same
Disclosed are a method for transmitting/receiving an uplink signal between a base station and a terminal, and a device for supporting the same. More specifically, disclosed are a method for transmitting/receiving a signal between a terminal and a base station for the coexistence of terminals to which different transmission time intervals (TTIs) are applied when the terminals to which the different TTIs are applied send an uplink signal on the same resource, and a device for supporting the same. |
US10517076B2 |
Method and user equipment (UE) for managing HARQ feedback transmission in wireless communication network
A method for managing Hybrid Automatic Repeat Request (HARQ) feedback transmission by a Dual Sim Dual Standby (DSDS) User Equipment (UE) in a wireless communication network, is provided. The method includes determining, by the DSDS UE, whether a first parameter associated with a primary packet data is identical to a second parameter associated with a secondary packet data. Each of the first parameter and the second parameter comprises a reordering timer value, a New Data Indicator (NDI), a HARQ process number, and a DSDS Radio Frequency (RF) gap duration. The method further includes, in response to the first parameter associated with the primary packet data being determined to be identical to the second parameter associated with the secondary packet data and the primary packet data being successfully decoded at the DSDS UE, performing, by the DSDS UE, the HARQ feedback transmission with the wireless communication network. |
US10517074B2 |
Methods for allocating data channel resources in a wireless communication system and apparatuses
Methods may be provided for allocating up/downlink data channel (that is, PDSCH and PUSCH) resource for a machine type communication (MTC) terminal in 3GPP LTE/LTE advanced system and for configuring a Downlink Control Information (DCI) for it. Further, a method may be provided for allocating up/downlink data channel resource for further enhanced MTC terminal which supports a up/downlink data channel (that is, PDSCH and PUSCH) bandwidth enhanced as compared with the MTC terminal (BL/CE UE) defined in LTE rel-13. |
US10517071B2 |
Wireless communication device, wireless communication system, wireless communication method and program
Provided is a wireless communication device which includes a notification information transmitting unit for transmitting, via a wireless communication network, notification information of the wireless communication device, a notification information receiving unit for receiving notification information transmitted from another device, a frequency switching unit for successively switching, at random cycles, a frequency at which the notification information is transmitted or a frequency at which the notification information is received, and a transmission processing unit for performing a data transmission process after transmitting or receiving an acknowledgement to the notification information to/from such other device. |
US10517068B2 |
Method and apparatus for transmitting group message to user equipment (UE)
The present disclosure relates to a communication method and system for converging a 5th-Generation (5G) communication system for supporting higher data rates beyond a 4th-Generation (4G) system with a technology for Internet of Things (IoT). The present disclosure may be applied to intelligent services based on the 5G communication technology and the IoT-related technology, such as smart home, smart building, smart city, smart car, connected car, health care, digital education, smart retail, security and safety services. A method and apparatus of a wireless network are disclosed. The method includes transmitting a first request message to request allocation of a multimedia broadcast multicast service (MBMS) group identifier from a service capability server/application server (SCS/AS) to a service capability exposure function (SCEF), the first request message including an external group identifier and an SCS/AS identifier, and receiving a first response message including the MBMS group identifier from the SCEF to the SCS/AS. |
US10517067B2 |
Techniques and apparatuses for providing notifications in short paging messages
Various aspects of the present disclosure generally relate to wireless communication. In some aspects, a user equipment (UE) may receive a paging grant that includes a short paging message and a notification of a reason that the short paging message was triggered; determine that the paging grant includes the short paging message; and obtain the notification of the reason that the short paging message was triggered based at least in part on determining that the paging grant includes the short paging message. Numerous other aspects are provided. |
US10517066B2 |
Method and device for handling paging extension
Handling of a paging extension in a wireless communication network. A terminal device in the wireless communication network receives, from a base station in the wireless communication network, a message including an indication of a paging extension for the terminal device. The terminal device is associated with a first coverage class. Based on the message, the terminal device determines a second coverage class of a downlink transmission from the base station to a further terminal device. Then, the terminal device determines a target paging group for the paging extension based on the first coverage class and the second coverage class. |
US10517060B2 |
Wireless communication network with distributed device location determination
There are disclosed methods and access points for estimating a location of a user device in a wireless communications network. A plurality of access points define respective received signal strength indicator (RSSI) values for transmissions received from the user device. Each of the plurality of access points sends the respective RSSI values to the other access points of the plurality of access points. One of the plurality of access points self-elects to estimate the location of the user device. The self-elected access point estimates a location of the user device based, at least in part, on the RSSI values. |
US10517058B2 |
Transport of multihoming service related information between user equipment and 3GPP evolved packet core
In an embodiment, there is provided a method for the transport of multihoming service related information between User Equipement UE and 3GPP Evolved Packet Core EPC through untrusted non 3GPP Access Network, said method comprising a step of: transporting multihoming service related information using signaling exchanged for security procedures between UE and an evolved Packet Data Gateway ePDG of said untrusted non 3GPP Access Network. |
US10517054B2 |
Clock synchronisation in wireless mesh communication networks
A technique for providing a synchronised clock signal across a wireless mesh network is described. The technique includes choosing one of a plurality received radio frequency signals to provide a synchronisation signal to which a local clock signal can be synchronised. |
US10517049B2 |
Uplink scheduling apparatus and method based on uplink report in wireless communication system
A method and an apparatus for scheduling uplink transmissions according to a maximum transmission power and Power Headrooms (PHs) reported by a User Equipment (UE) are provided. A method for reporting the PHs for carriers used by a terminal in a mobile communication system supporting carrier aggregation includes generating a message including the PHs along with indicators indicating whether a real transmission is scheduled on an uplink data channel of corresponding carrier, and including, when the real transmission is scheduled, a maximum transmission power used for calculating the PHs in the generated message. |
US10517046B2 |
Wireless communication terminal device, wireless communication method and integrated circuit for controlling transmission power of sounding reference signal (SRS)
A radio terminal is provided that can provide a flexible transmission power control for an SRS without restrictions due to the transmission power control of a PUSCH, for the purpose of enabling use of an SRS for various purposes in a HetNet CoMP environment. The radio terminal receives a control signal including a transmission power control command (TPC command) to be applied to an aperiodic sounding reference signal (A-SRS), through a physical downlink control channel (PDCCH), updates a transmission power value of the A-SRS using the TPC command, and transmits the A-SRS using the updated transmission power value in accordance with a transmission request included in a control signal indicating assignment of a physical downlink data channel (PDSCH) or assignment of a physical uplink data channel (PUSCH). |
US10517043B2 |
Mobile telephone, apparatus, method and computer implementable instructions product
A communication system (100) is disclosed which uses system frames of a first and a second type. In a system frame of the first type communication with a mobile telephone (3) is subject to a restriction and in a system frame of the second type communication with said mobile telephone (3) is not subject to said restriction. It is determined whether or not to communicate with said mobile telephone (3), in a current system frame, in dependence on whether the current system frame is a first type of system frame or a second type of system frame. |
US10517041B2 |
Small cell thermal control
A method of controlling a temperature of a femtocell includes receiving, at data processing hardware of the femtocell, temperature measurements from a temperature sensor configured to measure a temperature of at least one of the data processing hardware or a power amplifier of the femtocell. The method further includes determining, by the data processing hardware, whether the femtocell is operating above a threshold temperature based on the temperature measurements. When the femtocell is operating above the threshold temperature, the method includes modifying, by the data processing hardware, a power consumption characteristic of the femtocell that results in a power consumption reduction of at least one of the data processing hardware or the power amplifier. |
US10517030B2 |
Method and apparatus for transferring radio service between transmission points in a wireless communication service
One aspect of the teachings herein involves the temporary transfer of radio identities from one service area of a wireless communication network to another service area, where the individual radio identities are used to differentiate individual radio connections between the network and respective wireless nodes supported by the network. In particular, the temporary transfer of a given radio identity from its default service area for use in another service is limited temporally and/or geographically. Limiting the temporal and/or geographic scope of the radio identity transfer allows the network to substantially maintain default associations of radio identities and their respective service areas, which allows the network to prevent or reduce the use of conflicting radio identities in the same service area. Transfer signaling may be used to transfer radio identities. Such signaling may include the temporal and/or geographic restrictions, to control the migration or spread of borrowed identities in the network. |
US10517029B2 |
Method and apparatus for applying resources in heterogeneous network system
The present invention relates to a method and an apparatus for applying wireless resources in order to control inter-cell interference in a heterogeneous network system. The method for applying wireless resources provided by the present invention generates an almost blank subframe (ABS) pattern on the basis of the type of data transmitted from at least one of a first base station and a second base station, applies a non-ABS or an ABS to wireless resources of the first base station according to the generated ABS pattern, and performs data communication by using the wireless resources to which the ABS has been applied. |
US10517027B2 |
Communications related methods and apparatus
Methods and apparatus for efficiently communicating network connectivity information in a communications system are described. Two types of signals with different characteristics, e.g., long range synchronous beacons, e.g., LTE-D beacons, and short range asynchronous beacons, e.g., WiFi beacons, are used in combination to advertise network connectivity information and accelerate the acquisition of a routing path for a communications device to a device serving as a gateway for a infrastructure network. Reception of a first type signal triggers monitoring for a second type signal, and a received second type signal communicates information used to determine a communications path to a gateway device. |
US10517026B2 |
Method for reporting a measurement report of a measurement event
The present disclosure discloses a method for reporting a measurement report of a measurement event, including: determining that a measurement event is generated in a user equipment (UE) in an activated state of discontinuous reception (DRX) mode; judging whether a first time to trigger corresponding to the measurement event is valid when it is determined that there is a measurement event generated; using, when it is judged that the first time to trigger is valid, the first time to trigger to time the measurement event; using, when it is judged that the first time to trigger is invalid, a second time to trigger to time the measurement event, such that the UE is in next one or next several activated states of DRX mode after the generation of the measurement event. The present disclosure can improve a success rate of mobility handover between cells or wireless link quality. |
US10517025B2 |
Method and device for performing handover in mobile communication system
A method for transmitting a channel state by a terminal in a communication system, according to one embodiment, comprises the steps of: receiving discontinuous reception (DRX) configuration information from a base station; determining whether the terminal is set to transmit channel state information only in onDuration according to a DRX operation; determining whether an arbitrary subframe to be received is a subframe included in onDuration if the terminal is set to transmit the channel state information only in onDuration according to the configuration; and not transmitting the channel state information on the arbitrary subframe if the arbitrary subframe is not a subframe included in onDuration. According to the embodiment, the terminal can efficiently report channel state information. |
US10517024B2 |
Wireless device handoff between wireless networks
Examples are disclosed for a wireless device handoff between a first wireless network and a second wireless network. |
US10517023B2 |
Methods and arrangements for supporting mobility of a communication device in a wireless communication network
Support of mobility for a communication device (120) being served in a serving beam (115a) transmitted by a first network node (110) comprised in a wireless communication network (100). The first network node (110) and the communication device (120) obtains (301a, 302; 701, 901) a first information set comprising predetermined identifiers identifying reference signals, respectively. The first network node (110) maintains (310; 904) a third information set that associates one or more candidate beams (115b, 116a-c), other than the serving beam (115a), with one or more predetermined identifiers of the first information set, which one or more predetermined identifiers identify reference signals that are being transmitted in said one or more candidate beams (115, 116a-c). |
US10517022B2 |
Method for enabling terminal access to cell, terminal and computer storage medium
Disclosed are a method for enabling a terminal access to a cell, a terminal and a storage medium. The method includes: when performing a Circuit Switched Domain Fallback (CSFB) service, a terminal sends a location update request to a base station of a first cell; when receiving a location update reject message, which is returned by the base station of the first cell in response to the location update request, and determining that a reason for reject is Location Area Not Allowed according to the location update reject message, the terminal puts a Location Area Identification (LAI) of the first cell into a forbidden location areas (LAs) for roaming list; and in response to putting the LAI of the first cell into the forbidden LAs for roaming list, the terminal searches one or more second cells except the first cell and performs an access operation. |
US10517021B2 |
Long term evolution-primary WiFi (LTE-PW)
A system and method of communication, comprising establishing a first connection between the user equipment and a first non-public packet switched network which assigns a first non-public packet switched network address to user equipment; establishing an open signaling channel which communicates between the user equipment and a remote server through a cellular telephone network according to a public switched telephone network address associated with an International mobile subscriber identity; communicating an identification of the first non-public network and the first non-public packet switched network address over the open signaling channel to the remote server; and establishing a real time voice communication from the remote server to the user equipment through the first connection based on a call routed through the remote server to the public switched telephone network address. |
US10517019B2 |
Radio resource optimization and management method, centralized controller and device
The present invention provides a radio resource optimization and management method, a centralized controller, and a base station. In the method, the centralized controller determines a work status series and a work policy series of each cell during a first time period; and sends the work status series and the work policy series of each cell to each cell, so that each cell adjusts resources of this cell according to the work status series and the work policy series, thereby enhancing a network KPI at a large time granularity by means of distributed cell coordination while ensuring local KPI performance of each cell. In contrast with distributed coordination optimization in a single coordination state, the present invention provides a higher degree of freedom in terms of a time dimension, and therefore provides better performance in terms of a network KPI at a large time granularity. |
US10517017B2 |
Apparatus and method for load balancing in multi-cell wireless access system
An apparatus and method provide load balancing in a multi-cell wireless access system. The method includes determining a change value of a TX power, determining a handover candidate set including at least one MS to be handed over, calculating expected gains after TX power control for each MS classification, and determining whether to control the TX power based on the expected gains. The change value is zero or a positive real number. |
US10517015B2 |
Power consumption optimization of wireless communication systems for content delivery
A device implementing the subject wireless communication system may include one or more memories, and one or more processors coupled to the one or more memories. In some aspects, the one or more processors are configured to cause receiving a first frame comprising an indication that the station has data buffered at an access point, determining, in response to the first frame, whether a measured buffer depth exceeds a predetermined threshold, receiving a second frame comprising a predetermined amount of buffered data based on the measured buffer depth, transitioning, after the predetermined amount of buffered data is received, into a sleep mode for a first predetermined duration when the measured buffer depth exceeds the predetermined threshold, and transitioning into the sleep mode for a second predetermined duration less than the first predetermined duration when the measured buffer depth does not exceed the predetermined threshold. |
US10517013B2 |
Method and apparatus for generating connection in wireless communication system
A method for transmitting and receiving a signal in a packet data network gateway (PGW) of a mobile communication system according to an embodiment of the present specification comprises the steps of: receiving a first request message which includes an identifier of a terminal and is associated with a packet data network connection; sending a second request message to a policy and charging rules function (PCRF) server on the basis of the received first request message; and if quality of service (QoS) related information is included in a response message received in response to the second request message from the PCRF, performing a control associated with the packet data network connection on the basis of the QoS related information. In a wireless communication system using a PMIP according to the present invention, it is possible to generate a PDN connection in accordance with the default QoS. |
US10517010B2 |
Wireless local area network WLAN measurement and reporting method and related device
Embodiments of the present invention provide a wireless local area network WLAN measurement and reporting method, and a related device. The method includes: acquiring, by a user terminal, WLAN group information, where the WLAN group information indicates at least one WLAN group; determining, by the user terminal, whether at least one WLAN in the WLAN group satisfies WLAN measurement configuration information; and reporting, by the user terminal, a measurement result of the at least one WLAN in the WLAN group to a base station when the at least one WLAN in the WLAN group satisfies the WLAN measurement configuration information. Therefore, a signaling resource can be saved, thereby reducing signaling load caused by simultaneous reporting of a large quantity of WLAN measurement results. |
US10517009B2 |
Network, network node, user equipment and method therein for establishing active mode beam to idle mode cells neighbour relations in a wireless communication network
Method and apparatus in a wireless communication network (100) for establishing active mode beam to idle mode cells neighbour relations are disclosed. A first network node (111) and other network nodes, a second and a third network nodes (112, 113) operate in the wireless communication network (100). The first network node (111) is a serving network node for the user equipment (130) with the active mode beam, and the idle mode cells are synchronization signal broadcast areas provided by the other network nodes (112, 113). The first network node (111) obtains information on synchronization signals transmitted from the other network nodes and stores information on active mode beam to idle mode cell relations, wherein the active mode beam is the beam serving the user equipment (130) when a new synchronization signal is detected, and the idle mode cell is the cell with the synchronization signal broadcast area provided by the network node transmitting the detected synchronization signal. |
US10517004B2 |
Application modules (AMs) with multi-carrier subscriber identity modules (MSIMs) for diagnostic mode monitoring of signals within wireless distributed communications systems
Application modules (AMs) with multi-carrier subscriber identity modules (MSIMs) for diagnostic mode monitoring of signals within wireless distributed communications systems (WDCSs), including but not limited to distributed antenna systems (DASs). Related systems and methods are also disclosed. The MSIMs comprise circuitry configured to implement multiple SIM instances, each SIM instance containing carrier-specific data to enable the AM to register with a carrier to perform diagnostic mode monitoring of signals from the respective carrier. In one embodiment, AMs may be associated with components of a WDCS. By associating the AMs into components of a WDCS, live signals in the WDCS can be monitored and measured for monitoring the performance of components within the WDCS. The AMs may include one or more application level applications configured to receive and monitor signals in the WDCS, and to provide application-level information about such monitored signals to other components or systems, or technicians. |
US10517003B2 |
Systems and methods for maintaining service on multiple SIMs in a wireless communication device operating in a multi-SIM multi-standby (MSMS) mode
A wireless communication device having a first SIM and a second SIM and a radio frequency (RF) resource including multiple receive chains and at least one transmit chain may detect, during a connection to a first network associated with the first SIM, a start of a communication activity associated with the second SIM that uses one or more transmit chains and one or more of the receive chains. The wireless communication device may determine whether a carrier frequency of a cell serving the network associated with the first SIM is within a downlink frequency range supported by an unused receive chain of the RF resource. If not, the wireless communication device may identify a neighbor cell of the first network with a carrier frequency within a downlink frequency range supported by an unused receive chain of the RF resource, and attempt to camp the first SIM on that neighbor cell. |
US10516997B2 |
Authentication with secondary approver
Techniques are provided for giving access to restricted content on a first device from a second device through a wireless network. In one embodiment, the first device transmits an authorization request signal to the second device or to a server in the wireless network. The second device, having received the authorization request, prompts an authorized user to give authorization to the first device by inputting an authentication key such as a password or gesture on the second device. Upon verification of the authentication key, an authorization signal may be wirelessly transmitted to the first device, permitting access to the restricted content or functions on the first device. In some embodiments, the second device may be alerted to an authorization request and may select a request for authorization from a selectable queue of requests. |
US10516994B2 |
Authentication with privacy identity
Methods, systems, and devices for wireless communication are described. A user equipment (UE) may perform authentication procedures using an alternative identity (e.g., a privacy mobile subscriber identity (PMSI)) instead of an international mobile subscriber identity (IMSI) to protect the privacy of the user. If the UE does not have a PMSI, it may include a request for a PMSI initialization in an attach request. In some cases, the PMSI may be used once, and a new PMSI may be generated for the next attachment procedure. In some cases, a universal subscriber identity module (USIM) of the UE may not support storage of a PMSI. So a privacy module of the UE may communicate with the USIM according to the USIM's capabilities and may maintain a PMSI separately for communication with the network. |
US10516993B2 |
Method and apparatus for establishing wireless communications connection
Provided are methods and apparatuses for establishing a wireless communications connection by using biometric information of a user. A method of operating an electronic device includes operations of: acquiring first biometric information; transmitting first sub-information of the first biometric information to a terminal within a certain time from an instant of acquiring the first biometric information; receiving from the terminal second sub-information of second biometric information of a user who uses the terminal; and comparing second sub-information of the first biometric information corresponding to the second sub-information of the second biometric information with the second sub-information of the second biometric information. If it is determined as a result of the comparing that the second sub-information of the first biometric information matches the second sub-information of the second biometric information, a pairing with the terminal is established through a wireless network. |
US10516982B2 |
Match Bluetooth low energy (BLE) moving patterns
An example system comprising: a processing resource; and a memory resource storing machine readable instructions executable to cause the processing resource to: receive a Bluetooth Low Energy (BLE) signal transmitted from a user device; generate, from the BLE signal, a BLE moving pattern of the user device, wherein the BLE moving pattern is generated at a different entity than an entity that transmits the BLE signal; track an object carrying the user device via visual information of the object such that a visual moving pattern of the object is generated from the tracking; determine the visual moving pattern matches the BLE moving pattern; and assign, responsive to the determination, an identity obtained from the user device to the object being tracked via the visual information. |
US10516980B2 |
Automatic redisplay of a user interface including a visualization
An example system and method for selectively conveying content via User Interface (UI) display screen sections of Business Intelligence (BI) software. An example method includes displaying a UI display screen section within a UI display screen; providing a UI mechanism that allow specification of a condition; determining when the condition is met; and automatically redisplaying at least a portion of the UI display screen section in response to the determining, resulting in a redisplayed UI display screen section in response to the condition being met. The UI display screen section may include blogs or other activity feeds, visualizations, UI controls for manipulating the visualizations; for specifying conditions for redisplaying, i.e., bringing back the visualizations, etc. |
US10516977B2 |
Data packet transmission method and device
Embodiments of the present invention provide a data packet transmission method and a device, which relate to the communications field, so as to reduce a storage burden on a base station in a data transmission process. The method includes: acquiring, by a base station that serves a UE, instruction information of a small data packet; and after receiving a radio resource control message sent from the UE, acquiring, by the base station that serves the UE, the small data packet from a core network device according to the instruction information of the small data packet, and sending the small data packet to the UE. The embodiments of the present invention are used for data packet transmission. |
US10516971B2 |
Systems and methods for supporting control plane location in a fifth generation wireless network
Methods and techniques are described for supporting location services for a user equipment (UE) in a Fifth Generation wireless network using a Location Management Function (LMF) based control plane (CP) location solution. The LMF serves as the main anchor point for location support instead of an Access and Mobility Management Function (AMF). The LMF may be in either a serving Public Land Mobile Network (PLMN) for a UE or in a Home PLMN for a roaming UE. The LMF may obtain location information for a UE via an AMF from a Next Generation Radio Access Network or the UE and may interact with a Gateway Mobile Location Center to receive location requests from and return location information to an external client. The LMF solution may be more efficient and require less implementation than an AMF based CP location solution. |
US10516966B2 |
Configuring mobile device applications based on location
Various implementations monitor a parent geofence that geographically encompasses a plurality of child geofences, each respective child geofence of the child geofences associated with a respective physical location within the parent geofence. One or more implementations receive location data that indicates a current location of a mobile device. In turn, the current location can be used to determine that the mobile device has entered a particular child geofence of the plurality of child geofences. In response to determining that the mobile device has entered the particular child geofence, one or more implementations select an application configuration for a mobile application on the mobile device, where the application configuration corresponds to the particular child geofence. One or more implementations transmit the application configuration to the mobile device effective to alter a functionality of the mobile application at the mobile device based on the current location. |
US10516964B2 |
Inferring user availability for a communication
The technology described herein manages communications received by a mobile computing device by ascertaining a user's availability to receive an incoming communication. The technology described herein can optimize the use of notification resources on a computing device to provide notifications only when a user is available to respond to a communication the notification announces. The user's availability to receive a communication can be inferred through the analysis of signal data that describes a present context of the mobile device and/or the mobile device's user. Upon determining a present level of availability, the technology described herein can take several different actions. The actions include generating an alternative notification for a newly received communication, generating no notification for a newly received communication, and communicating an automated “not available” message to the originator of a newly received communication. |
US10516962B2 |
Multi-channel binaural recording and dynamic playback
Methods and systems are provided for enhanced audio experiences in VR/AR applications. The apparatuses of this disclosure are adapted to record multiple binaural stereo pairs and play back select binaural pairs corresponding to users' head positions. A substantially spherical microarray is utilized in various embodiments for recording multiple binaural stereo pairs. A VR/AR headset is further adapted to track a user's head positions and dynamically play back binaural sound pairs corresponding to the head positions. |
US10516961B2 |
Preferential rendering of multi-user free-viewpoint audio for improved coverage of interest
A method including, determining, for each of at least two listening positions, a default rendering, determining an overlap for at least one audio source for the default rendering based on the at least two listening positions, determining at least one audio source rendering modification associated with at least one of the at least two listening positions based on the determined overlap, and providing a modified rendering for at least one of the at least two listening positions by processing the at least one audio source rendering so as to improve audibility of the at least one audio source during the audio rendering for at least one of the at least two listening positions. |
US10516953B2 |
Implantable auditory stimulation system and method with offset implanted microphones
An improved implantable auditory stimulation system includes two or more implanted microphones for transcutaneous detection of acoustic signals. Each of the implanted microphones provides an output signal. The microphone output signals may be combinatively utilized by an implanted processor to generate a signal for driving an implanted auditory stimulation device. The implanted microphones may be located at offset subcutaneous locations and/or may be provided with different design sensitivities, wherein combinative processing of the microphone output signals may yield an improved drive signal. In one embodiment, the microphone signal may be processed for beamforming and/or directionality purposes. |
US10516950B2 |
Multifunction system and method for integrated hearing and communication with noise cancellation and feedback management
Systems, devices, and methods for communication include an ear canal microphone configured for placement in the ear canal to detect high frequency sound localization cues. An external microphone positioned away from the ear canal can detect low frequency sound, such that feedback can be substantially reduced. The canal microphone and the external microphone are coupled to a transducer, such that the user perceives sound from the external microphone and the canal microphone with high frequency localization cues and decreased feedback. Wireless circuitry can be configured to connect to many devices with a wireless protocol, such that the user can receive and transmit audio signals. A bone conduction sensor can detect near-end speech of the user for transmission with the wireless circuitry in a noisy environment. Noise cancellation of background sounds near the user can be provided. |
US10516939B1 |
Systems and methods for steering speaker array and microphone array with encoded light rays
Described is a way to steer speaker array or microphone array based on direction outputs of tiny light sensors attached to TV viewers, noisy-environment workers, or AR/VR system users. More specifically, a light projector is disposed on a ceiling, which sends out different sequential on/off signals for each pixel. Two light sensors are attached to each speaker array or microphone array, and one or more light sensors are attached to each user. Because each projector pixel corresponds to a specific direction, when a light sensor receives sequential signal from the projector, the light sensor can determine its direction corresponding to the projector and report that to the central station. With the speaker/microphone array direction and user direction known, the system can generate proper phase shifts for different speaker signals and generate directional sound for each individual. Similarly, the central station can determine phase shifts for combining audios from different microphones. |
US10516936B1 |
Speaker
A speaker includes a frame and a partition wall coupled with the frame to define a boundary between a high-pitched sound zone and a low-pitched sound zone. The high-pitched sound zone includes an electromagnetic component accommodating area and plural discontinuous sound chamber extension areas. The electromagnetic component accommodating area and the plural discontinuous sound chamber extension areas are fluid-communicable. |
US10516932B2 |
Wire control earphone
Disclosed is a wire control earphone, comprising a USB plug, an earphone wire, left and right ear receivers and a volume adjuster. The USB plug has a power-supply pin, a grounding pin and two signal pins. The earphone wire has a power-supply wire, two receiver wires and a ground wire which are correspondingly connected with the pins of the USB plug. The right ear receiver is connected between the right ear receiver wire and the ground wire. The volume adjuster is powered via the power-supply wire and comprises an adjustment triggering unit for outputting a volume adjustment signal, a processing unit for determining a voltage adjustment value according to the volume adjustment signal and outputting a digital voltage adjustment value, and a digital-to-analog conversion unit for converting the digital voltage adjustment value into an analog voltage adjustment value and applying the analog voltage adjustment value to the two receiver wires. |
US10516929B2 |
Audio device
A headphone includes an electro-acoustic transducer for creating audio output, the electro-acoustic transducer comprising a transducer magnet that produces a transducer magnetic field having a magnetic field strength, structure that is constructed and arranged to be positioned so as to direct the audio output at the ear canal of the ear of a wearer of the headphone, a magnetic field sensor constructed and arranged to sense the Earth's magnetic field, and a nulling magnet constructed and arranged to produce a nulling magnetic field that reduces the strength of the transducer magnetic field at the magnetic field sensor. |
US10516923B2 |
Dynamic bandwidth assignment method and apparatus, and passive optical network system
A bandwidth assignment method and apparatus, and an optical network system are disclosed. The method includes: setting a maximum bandwidth grant size and a maximum burst bandwidth grant size for an optical network unit; receiving a bandwidth assignment request of the optical network unit; and when an optical line terminal determines, according to the bandwidth assignment request, that a bandwidth grant size requested to be assigned in the bandwidth request is greater than the set maximum bandwidth grant size and less than or equal to the set maximum burst bandwidth grant size, determining, by the optical line terminal, in response to the request, to assign the requested bandwidth grant size to the optical network unit. Therefore, timely and accurate transmission of massive uplink burst data traffic is ensured, a transmission delay is reduced, service performance is improved, and system bandwidth utilization is greatly increased. |
US10516922B2 |
Coherent gigabit ethernet and passive optical network coexistence in optical communications module link extender related systems and methods
This disclosure describes devices and methods related to multiplexing optical data signals. A method may be disclosed for multiplexing one or more optical data signals. The method may comprise receiving, by a dense wave division multiplexer (DWDM), one or more optical data signals. The method may comprise combining, by the DWDM, the one or more optical data signals. The method may comprise outputting, by the DWDM, the combined one or more optical data signals to one or more wave division multiplexer (WDM). The method may comprise combining, by the one or more WDM, the combined one or more optical data signals and one or more second optical data signals, and outputting an egress optical data signal comprising the combined one or more optical data signals and one or more second optical data signals. |
US10516914B2 |
Method and system for implementing automatic audio optimization for streaming services
Novel tools and techniques are provided for implementing media content streaming or playback, and, in particular, automatic audio optimization. In some embodiments, a computing system might receive user input indicating a request for presentation of media content, initiate database lookup in a database for audio parameter settings associated with the requested media content, and determine whether the database contains audio parameter settings specifically associated with the requested media content. If so, the computing system retrieves the audio parameter settings and automatically reconfigures an audio playback device(s) with the retrieved audio parameter settings. If not, the computing system determines whether the database contains audio parameter settings associated with a content category to which the requested media content belongs. If so, such audio parameter settings are retrieved and the audio playback device(s) are reconfigured with the audio parameter settings. If not, the audio playback device(s) are reconfigured with default audio parameter settings. |
US10516913B2 |
Receiving device and method, transmitting device and method, and program
The present disclosure provides a receiving device including, a receiver that receives AV content, a detector, an acquirer, a tentative reservation registering part, and a definitive reservation registering part. |
US10516912B2 |
Digital contents receiver, digital contents receiving method and digital contents transmitting and receiving method
In a digital contents receiver for receiving transmitted digital contents, the digital contents include at least component information indicating an element which constitutes a program of the contents. When the component information indicates that the received digital contents are a 3D component, it is determined whether a display part corresponds to display of the 3D component. If the display part corresponds to display of the 3D component, the received digital contents are displayed in 3D. |
US10516910B2 |
Device pairing
A method for pairing a first device with a second device includes receiving, by the first device, a dynamic graphic pattern having a shape that changes over time. The dynamic graphic pattern being associated with the second device for pairing with the second device. The first device recognizes the dynamic graphic pattern associated with the second device. The second device is paired if the dynamic graphic pattern associated with the second device is recognized. |
US10516909B2 |
Method and system for recommending dynamic, adaptive and non-sequentially assembled videos
The present disclosure provides a system and method for recommending dynamic, adaptive and non-sequentially assembled videos. The method includes reception of a set of preference data and a set of user authentication data. The method includes development of an interest profile of the user. The method includes fetching of the one or more tagged videos. The method includes fragmentation of each tagged video into the one or more tagged fragments and segregation of one or more mapped fragments into one or more logical sets of mapped fragments. The method includes mining of semantic context information from each mapped fragment and each logical set of mapped fragments. The method includes clustering of the one or more logical sets of mapped fragments and assembling of the one or more logical clusters of mapped fragments to obtain a set of assembled videos. The method includes recommendation of the set of assembled videos. |
US10516907B2 |
Device and method for processing video
Provided is a video processing device and method capable of managing a security level of content included in a video. The video processing method includes: receiving an identifier of a video and information about a security policy to be set to the video; receiving security information related to the security policy; preparing the video by using the received identifier of the video; and updating security information of the prepared video by using the received security information according to the security policy. |
US10516906B2 |
Systems, methods, and computer products for recommending media suitable for a designated style of use
Media suitable for a designated style of use are recommended from among a database of media objects. A prediction engine is trained using a plurality of media object lists, each of the media object lists containing metadata associated with a plurality of media objects, the media object lists corresponding to the designated style of use, and the prediction engine being trained to calculate the likelihood that a media object is suitable for the designated style of use. The prediction engine includes a binomial classification model trained with feature vectors that include behavioral data, acoustic data and cultural data for the plurality of media objects. The trained prediction engine is applied to media objects in the database of media objects so as to calculate likelihoods that the media objects are suitable for the designated style of use. One or more media objects are recommended using the calculated likelihoods. |
US10516905B2 |
Dynamic service flow creation for packet cable quality of service guarantee in a distributed cable management system
Some embodiments provide a method for dynamically creating a service flow for an Ethernet node (EN) in a distributed cable management system that includes a cable headend and several in-the-field ENs for connecting several service nodes to the headend. For a particular device of a particular service node, the method receives a request to create a set of parameters for a service flow that is to be dynamically created. In some embodiments, the received request is in response to a request for a phone call that is to have a quality of service (QoS) guarantee and the service flow is for a PacketCable (PC) connection session. For the service-flow parameter request, the method identifies the EN that connects to the particular service node from a group of several EN that the method manages. The method then forwards a set of authorized dynamic QoS (DQoS) parameters to the identified EN, so that the identified EN can use the forwarded DQoS parameter set to validate a service flow request from the particular device to the EN to create the service flow. The forwarded DQoS parameter set is part of a pre service-flow request that the method sends to the identified EN in some embodiments to direct the identified EN to prepare for a possible service flow request from the particular device. |
US10516902B1 |
Control of content broadcasting
A method adjusts a broadcasting system according to properties of content being broadcast. One or more processors receive a proposed content that is designed to be a component of an electronic broadcast by a broadcast system. The processor(s) determine a broadcast analysis pattern (BAP) for the proposed content, where the BAP describes the proposed content and an intended target of the electronic broadcast. The processor(s) retrieve a set of rules that describe a tone and format for particular content that is broadcast to the intended target, and determine whether the proposed content conforms to the set of rules. In response to determining that the proposed content does not conform to the set of rules, the processor(s) adjust the broadcasting system, where adjusting the broadcasting system modifies how content is broadcast to the intended target. |
US10516900B2 |
Addressable advertising insertion for playout delay
A computer implemented method for inserting advertisement content into a program content stream includes receiving, by a headend content server, the program content stream. The program content stream includes an advertisement insertion cue. The method further includes detecting the advertisement insertion cue in the program content stream, and the advertisement insertion cue indicates an insertion point in the program content stream for inserting an advertisement. The method further includes modifying the advertisement insertion cue to indicate an expiration date and time for playout of a first advertisement content to be inserted into the program content stream, and inserting the first advertisement content into the program content stream. |
US10516895B2 |
Method for encoding and decoding image and device using same
The method for deriving a temporal motion vector predictor according to the present invention comprises the steps of: selecting a reference picture for a current block; deciding a predictor block corresponding to a predetermined storage unit block, as a reference prediction unit for the current block, in the reference picture; and deriving the temporal motion vector predictor from motion information of the decided reference prediction unit. The present invention enhances image compression efficiency. |
US10516894B2 |
Image processing device and method
An image processing device including a predicted vector generation section configured to generate a predicted vector for use in encoding of a motion vector (MV) of a current block by scaling the MV of a reference block, which is a block of a position shifted from a position of the current block in an image of a different view, by a disparity obtained from a periphery of the current block in an image of a non-base view according to a reference destination of the current block and a reference destination of the reference block, an MV encoding section configured to encode the MV of the current block using the predicted vector generated by the predicted vector generation section, and an encoding section configured to generate an encoded stream by encoding the image in units having a hierarchical structure. |
US10516893B2 |
Geospatial media referencing system
A computer implemented program executable to display a graphical user interface on a display surface of a computing device which by user indications retrieves a video and a geospatial representation in which one or more coordinate location indicators can be selected, and further functions to match location coordinates associated with selected coordinate location indicators with the plurality of images occurring between a beginning video image and an ending video image of the video. |
US10516888B2 |
Implicit signaling of scalability dimension identifier information in a parameter set
A system for decoding a video bitstream includes receiving a frame of the video that includes at least one slice and at least one tile and where each of the at least one slice and the at least one tile are not all aligned with one another. |
US10516886B2 |
Image decoding method and apparatus using same
An image decoding method according to the present invention includes: receiving information on a set of reference pictures for configuring a set of reference pictures of a current picture, wherein the information on the set of reference pictures includes the most significant bit (MSB) information that may calculate the MSB of the picture order count (POC) of a long-term reference picture relative to the current picture, and flag information that represents whether there is MSB information; and eliciting the set of reference pictures by using received MSB information when the flag information is 1, and performing marking on the reference picture, wherein the flag information may be 1 when a temporal sub-layer identifier is 0, and there is at least one POC value for which a remainder obtained by dividing by a maximum value MaxPicOrderCntLsb capable of being represented by the LSB is the same as the least significant bit (LSB) of the POC of the long-term reference picture, in a set of POCs of a previous picture including POC values related to the previous picture that may not be discarded without affecting whether other pictures of the same temporal layer may be decoded. |
US10516885B1 |
Method and apparatus for video coding
Aspects of the disclosure provide a method and an apparatus for video coding. In some embodiments, the apparatus includes processing circuitry. The processing circuitry decodes encoding information associated with a block of a picture in a coded video bitstream. The encoding information indicates a position of a sub-region in the block, and an area of the sub-region is ¼ of an area of the block. The processing circuitry further reconstructs first samples of the block that are inside the sub-region using residual data of the first samples, and reconstructs second samples of the block that are outside of the sub-region without residue data. |
US10516884B2 |
Method for encoding/decoding image on basis of polygon unit and apparatus therefor
The present invention relates to a method for encoding/decoding a still image or a video based on a polygon unit and an apparatus for supporting the same. Particularly, a method for encoding an image based on a polygon unit may include partitioning an input image by a unit of block, determining a position of at least one point within the block, determining a position of at least one point in each side of the block, partitioning the block into at least one polygon unit using a vertex of the block, at least two points among the points determined in the side of the block, and a point determined within the block and coding the input image by a unit of the polygon unit. |
US10516881B2 |
Method, device, and system for testing video quality
A method and apparatus that tests video quality includes a superimposing of at least one code to a video that is to be transmitted by a communication device to another communication device. The at least one code is transmitted such that the superimposed at least one code is extractable and readable from the decoded video by the device that receives the transmitted video. The extracted at least one code may then be read to determine the quality level of the transmitted video. The determination of quality for the received video may be based upon one or more tests performed using at least one code extracted from the received video. |
US10516877B2 |
Light field collection control methods and apparatuses, light field collection devices
Embodiments of the present application disclose light field collection control methods and apparatuses and light field collection devices, wherein one light field collection control method comprises: acquiring an aperture parameter of a main lens of a light field camera; determining, according to the main lens aperture parameter, in an image sensor of the light field camera, a local part of an imaging region corresponding to at least one sub-lens in a sub-lens array of the light field camera as a first imaging region; adjusting pixel density distribution of the image sensor, to cause pixel density of the first imaging region after adjustment to be distinguished from that of other parts of the imaging region; and performing light field collection on a scene via the adjusted light field camera. The embodiments of the present application may improve utilization of image sensor pixels in a process of performing light field collection on a scene based on a light field camera, and improve imaging quality of light field images. |
US10516874B2 |
Enhancing imaging performance through the use of active illumination
A system includes a camera and a projector for capturing spatial detail having resolution exceeding that afforded by the imaging optics, and recovering topographic information lost to the projective nature of imaging. The projector projects a spatial pattern onto the scene to be captured. The spatial patterns may include any pattern or combination of patterns that result in complex sinusoidal modulation. Spatial detail such as texture on the objects in the scene modulate the amplitude of the spatial pattern, and produce Moiré fringes that shifts previously unresolved spatial frequencies into the camera's optical passband. The images may be demodulated, and the demodulated components may be combined with the un-modulated components. The resulting image has spatial detail previously inaccessible to the camera owing to the band-limited nature of the camera optics. A spatial pattern may also be projected and received by the camera to estimate topographic information about the scene. |
US10516873B2 |
Depth imaging device and driving method thereof
A depth imaging device is provided. A first camera and a second camera form a first depth imaging system. A projection element and a second camera form a second depth imaging system. The control unit is configured to instruct one of the first and second depth imaging systems to acquire a depth map and a confidence map, and determine whether each of confidence values in the confidence map is less than a confidence threshold value. If each of the confidence values is less than the confidence threshold value, then the control unit turns on the other of the first and second depth imaging systems. If at least one of the confidence values is not less the confidence threshold value, then the control unit determines whether a closest distance in the depth map falls within a predetermined range or not. A driving method of a depth imaging device is also provided. |
US10516871B2 |
Depth based modification of captured images
An imaging system processes images of a plurality of objects which have been captured by an image capture device for display. Normal processing of the images is modified as either a function of a depth corresponding to one or more of the plurality of objects appearing in the captured images relative to the image capture device or as a function of the depth and one or more image characteristics extracted from the captured images. A depth threshold may be used to avoid inadvertent modifications due to noise. |
US10516869B2 |
Real-time 3D virtual or physical model generating apparatus for HoloPortal and HoloCloud system
A novel electronic system provides fast three-dimensional model generation, social content sharing of dynamic three-dimensional models, and monetization of the dynamic three-dimensional models created by casual consumers. In one embodiment, a casual consumer utilizes a dedicated real-time 3D model reconstruction studio with multiple camera angles, and then rapidly create dynamic 3D models with novel computational methods performed in scalable graphics processing units. In another embodiment, uncalibrated multiple sources of video recording of a targeted object are provided by a plurality of commonly-available consumer video recording devices (e.g. a smart phone, a camcorder, a digital camera, etc.) located at different angles, after which the uncalibrated multiple sources of video recording are transmitted to a novel cloud computing system for real-time temporal, spatial, and photometrical calibration and 3D model reconstruction. The dynamic 3D models can be uploaded, listed, and shared among content creators and viewers in an electronic sharing platform. |
US10516868B2 |
HoloPortal and HoloCloud system and method of operation
A novel electronic system provides fast three-dimensional model generation, social content sharing of dynamic three-dimensional models, and monetization of the dynamic three-dimensional models created by casual consumers. In one embodiment, a casual consumer utilizes a dedicated real-time 3D model reconstruction studio with multiple camera angles, and then rapidly create dynamic 3D models with novel computational methods performed in scalable graphics processing units. In another embodiment, uncalibrated multiple sources of video recording of a targeted object are provided by a plurality of commonly-available consumer video recording devices (e.g. a smart phone, a camcorder, a digital camera, etc.) located at different angles, after which the uncalibrated multiple sources of video recording are transmitted to a novel cloud computing system for real-time temporal, spatial, and photometrical calibration and 3D model reconstruction. The dynamic 3D models can be uploaded, listed, and shared among content creators and viewers in an electronic sharing platform. |
US10516866B2 |
Imaging device and endoscope device
An imaging device includes a first substrate with a pixel array having a plurality of first pixels; a second substrate stacked with the first substrate on a side opposite to a light-receiving surface of the pixel array; a filter for narrowing a band of light of a first wavelength; and a plurality of second pixels included in the second substrate for receiving light whose band is narrowed by the filter, wherein the filter configured by a first Fabry-Perot filter or a second Fabry-Perot filter, the first Fabry-Perot filter and the second Fabry-Perot filter have different transmission wavelength bands, a peak wavelength of the transmission wavelength band of the first Fabry-Perot filter is narrow band light in the vicinity of 600 nm, and a peak wavelength of the transmission wavelength band of the second Fabry-Perot filter is narrow band light in the vicinity of 630 nm. |
US10516863B1 |
Miniature portable projector device
The present invention is a miniature portable projector device that is compatible with multiple file types and formats, and is small enough to fit on a keychain. It comprises of at least one I/O interface to receive/transfer data to/from a data source. A format processing unit converts the received data stored in a memory into a format adapted to be projected on a surface using the optical projection imaging component, provided at one end of device. Said device also features a fingerprint scanner that allows only the authentic user to unlock the device. |
US10516862B2 |
Display system of robot
The invention discloses a display system of a robot. The robot's housing comprises: a main body having an annular curved surface; a top portion, located above and integral with the main body, and having a curved surface protruding upwards; and a base located below and connected to the main body. A display system located inside the housing comprises a receiving unit configured to receive a video signal; a screen embedded at the housing's surface; a projection unit, located opposite to the screen, and configured to project an image onto a back side of the screen; and a cover disposed between the projection unit and the screen and having a conical shape, wherein a narrow end of the cover is connected to the projection unit, a wide end of the cover is connected to the screen, and the wide end's exterior shape matches the screen's peripheral size. |
US10516856B2 |
Network video recorder cluster and method of operation
A video recorder cluster for use in a video surveillance system includes multiple recorder nodes that can each participate in processing of user-specified operations such as playback, recording, and analysis of the video streams. The video recorder cluster determines the required resources for processing the video data of streams, determines the available resources on each of the recorder nodes, and forwards the video data of the streams to recorder nodes that either include the required resources or include a preferred set of available resources in accordance with the required resources. The video recorder cluster presents a single cluster address for client user devices to access the resources of the video recorder cluster, thereby enabling the video recorder cluster to appear as a single virtual network video recorder to clients. |
US10516843B2 |
Pixel array with internal coarse digitization
A pixel of a pixel array is provided. The pixel includes a low frequency path configured to receive an input signal from a corresponding photodetector. The low frequency path includes a passive imaging circuit provided along the low frequency path, the passive imaging circuit configured to output an analog imaging signal and a flash analog to digital converter (ADC) that receives the analog imaging signal and processes the analog imaging signal to output a coarse digitized signal. |
US10516841B2 |
Pixel, pixel driving circuit, and vision sensor including the same
A pixel includes a photoelectric device, a current readout unit configured to detect an electric current flowing in the photoelectric device to generate an input voltage, an event determination unit configured to determine an event occurrence and an event type responsive to the input voltage, and configured to output an event detection signal, and an event output unit configured to store the event detection signal for an event-storage period and configured to output the stored event detection signal responsive to an expiration of the event-storage period. |
US10516838B2 |
Event-based sensor and event-based sensing method
An event-based sensor includes: a pixel array configured to output activation signals in response to an input to the pixel array; and a controller configured to output a control signal for supplying a first photocurrent generated in a first pixel of the pixel array to a second pixel of the pixel array. |
US10516835B2 |
Image apparatus and method for receiving video signal in multiple video modes
An image apparatus and a method for receiving a video signal are provided. The image apparatus includes dedicated input terminals for receiving only particular video signals, and a common input terminal for receiving diverse video signals, and determines the format of video signals input through a corresponding input terminal and then displays the determined format on a screen. Accordingly, the number of input terminals can be reduced and the user can identify the format of the video signal input through the common input terminal. |
US10516833B2 |
Virtual linebuffers for image signal processors
In a general aspect, an apparatus can include image processing logic (IPL) configured to perform an image processing operation on pixel data corresponding with an image having a width of W pixels and a height of H pixels to produce output pixel data in vertical slices of K pixels using K vertically overlapping stencils of S×S pixels, K being greater than 1 and less than H, S being greater than or equal to 2, and W being greater than S. The apparatus can also include a linebuffer operationally coupled with the IPL, the linebuffer configured to buffer the pixel data for the IPL. The linebuffer can include a full-size buffer having a width of W and a height of (S−1). The linebuffer can also include a sliding buffer having a width of SB and a height of K, SB being greater than or equal to S and less than W. |
US10516832B2 |
Information communication method
An information communication method obtains information from a subject using a terminal device that includes an image sensor having a plurality of exposure lines. The method includes setting an exposure time of the image sensor so that a bright line corresponding to each of the plurality of exposure lines included in the image sensor appears according to a change in luminance of the subject. The method also includes obtaining a bright line image including a plurality of bright lines, and obtaining identification information of the subject. In obtaining of the bright line image, an exposure time of each of the plurality of exposure lines partially overlaps with an exposure time of an adjacent one of the plurality of exposure lines. A pattern of a change in luminance of the subject is the same as a pattern of a change in luminance of another adjacent subject. |
US10516830B2 |
Guided image composition on mobile devices
Various embodiments describe facilitating real-time crops on an image. In an example, an image processing application executed on a device receives image data corresponding to a field of view of a camera of the device. The image processing application renders a major view on a display of the device in a preview mode. The major view presents a previewed image based on the image data. The image processing application receives a composition score of a cropped image from a deep-learning system. The image processing application renders a sub-view presenting the cropped image based on the composition score in a preview mode. Based on a user interaction, the image processing application renders the cropped image in the major view with the sub-view in the preview mode. |
US10516828B2 |
Mobile terminal and control method thereof
A mobile terminal and a control method thereof are disclosed. The mobile terminal includes a display, and a controller configured to display, on the display, a home screen on which at least one icon is displayed, to execute an application corresponding to an icon selected from the at least one icon, and to display at least one of a shape, color and size of the at least one icon depending on an execution environment of the application. According to the present invention, a user can intuitively recognize an execution state of an application since an icon corresponding to the application can be displayed differently according to application execution environments. |
US10516822B2 |
Method and device for merging images of calibration devices
The present disclosure provides an image merging method. The image merging method includes the following step. First, the calibration unit is provided, wherein a calibration device of the calibration unit includes a plurality of known characteristic information. The calibration device is captured. A conversion relationship is created. A relationship of positions of the images is analysis according to the conversion relationship. The images are formed. In additional, an image merging device is provided. |
US10516821B2 |
Focus detection apparatus and control method therefor
A focus detection apparatus includes an image pickup unit configured to perform photoelectric conversion on a luminous flux having passed through an imaging optical system, a focus detection unit configured to detect a focusing state based on a signal generated by the image pickup unit, a setting unit configured to set a first region within an image generated by the image pickup unit, a display controller configured to control such that an index representing the focusing state detected by the focus detection unit within the first region can be superimposed on the image, and an obtaining unit configured to obtain information regarding a predetermined subject in the image. In this case, the setting unit sets a position of the first region based on information regarding at least one of a position, a size, and a direction of the predetermined subject in the image. |
US10516820B2 |
Electronic device for controlling focus of lens and method for controlling the same
An electronic device includes a camera and a processor. The processor is configured to: obtain a first image from the camera with respect to an external object, move a lens device depending on a specified amount of movement using a lens driver, obtain a second image corresponding to a position to which the lens device moves with respect to the external object, determine a first partial area of the first image corresponding to a specified portion of the external object, determine a second partial area of the second image corresponding to the first partial area based on the first partial area and the specified movement amount, determine a focus position with respect to the lens device based on a defocus difference between the first partial area and the second partial area and the specified movement amount, and move the lens device to the focus position using the lens driver. |
US10516817B2 |
Information processing apparatus, information processing method, and information processing system for controlling plurality of image pickup devices
There is provided an information processing apparatus including a correspondence relationship information change unit for changing a correspondence relationship information indicating each correspondence relationship between a plurality of image pickup devices and a plurality of controllers, the image pickup devices and the controllers being associated with each other, the controller being used to operate at least one of the plurality of image pickup devices, and the controller being capable of operating the image pickup device associated with the controller. |
US10516815B2 |
Image processing system
Higher-resolution imagery of an airport runway can be provided from the pilot's point of view. Pilot point of view images may be generated using images captured by higher-resolution ground-based cameras. The images from the ground-based cameras are fed to a point of view processor that generates the pilot point of view images using aircraft position information. The pilot point of view images are transmitted to a display on the aircraft. |
US10516813B2 |
Sensor assembly
A sensor assembly includes a housing having an airfoil shape and including a pressure surface and a suction surface, a sensor attached to the housing and disposed on the suction surface, and a nozzle attached to the housing and directed toward the sensor. A vehicle may include an exterior panel, and the sensor assembly may be attached to the exterior panel. |
US10516810B2 |
Method of gamut mapping and related image conversion system
A method of performing gamut mapping on an input image for an image output device includes receiving the input image to analyze a color distribution of the input image; determining a protect range corresponding to a first percentage of color codes of the input image and a compression range corresponding to a second percentage of the color codes of the input image based on the color distribution of the input image; and moving at least one of the color codes of the input image outside the protect range of the color codes to the compression range by a compression algorithm to perform gamut mapping on the input image. |
US10516809B2 |
Optimizing number of grid points in multi-dimensional color lookup table
A printing system is disclosed. The printing system includes a color management unit including optimization logic to generate a multi-dimensional color management lookup table derived from an input color to output color mapping, wherein the multi-dimensional color management lookup table has a non-uniform spacing of grid points specifying a correspondence between each of a plurality of input color space dimensions and output color space dimensions, and a color engine to receive an input color in an input color space, perform a multi-dimensional interpolation via the multi-dimensional color management lookup table to map the input color to an output color in an output color space; and return the output color. |
US10516808B2 |
Scanner, method of producing scan data, and scan control program
A scanner reads an original and generates a read image, specifies a first region having a pattern on a wrinkle and a second region having a wrinkle and no pattern from the read image, and performs a wrinkle reduction process in which the wrinkle is not reduced in the first region and the wrinkle is reduced in the second region, included in the read image. |
US10516804B2 |
Image processing device, image processing system, and non-transitory computer readable medium
A technique capable of keeping image quality and speeding up a halftone process is provided. An image processing device performs the halftone process on image data in which a pixel has a pixel value conforming to a bit count N. Bits conforming to the bit count N include higher H bits (where H is an integer satisfying an inequality of 1≤H |
US10516803B2 |
Information processing apparatus, and storage medium
An apparatus that executes a driver program generating an electronic document in a predetermined format based on drawing data in a predetermined type converted by a conversion module, wherein the conversion module converts a drawing command, for an object with a text attribute that satisfies a predetermined condition, of drawing commands making up drawing data of a document into a drawing command with a non-text attribute and delivers text information the type-converted drawing command both relating to the object and to the driver program; and the driver program generates, in the case of receiving the text information and the type-converted drawing command, an electronic document in the predetermined format by representing the object whose attribute has been converted into the non-text attribute of the type-converted drawing command by an object with a text attribute based on the received text information. |
US10516799B2 |
Automated definition of system behavior or user experience by recording, sharing, and processing information associated with wide-angle image
Systems and methods in accordance with the invention allow automatic recording, sharing, and communicating of different parameters associated with images and their imager to define a specific system behavior of a display device or an algorithm unit. Examples of information include imager parameters, environment parameters, image processing and enhancement parameters, coordinates of a section of wide-angle scene image content, display parameters, defined user experience, defined system behavior or any information to be recorded, shared, and communicated. To avoid loss of information, the information is encoded directly in the picture using a marker. This way, the information is robustly transferred from the imager to the display unit. According to the information, the final image can be automatically corrected and enhanced before display, different associated parameters can be displayed on final image or be used with another output. The end user experience or system behavior can thus be defined and be reproduced. |
US10516798B2 |
Image reading apparatus for detecting a shadow region formed by end of conveyed document
An image processing apparatus includes a transparent member, a white reference member, an imaging device, a conveyance member, a light source, and a processor for detecting a dirt substance from the input image. The light source is provided such that a shadow of a leading end or rear end of the document conveyed on the transparent member is formed on the white reference member at the imaging position. The processor detects a shadow region formed by the leading end or rear end of the conveyed document from the input image and detects a dirt substance from within the detected shadow region. |
US10516797B2 |
Imaging device
An imager is provided. The imager has an imaging platen which presents an imaging surface against which an object to be imaged can be placed. The imaging platen has a photodetector layer and a light guiding layer operable to guide light towards the object. The imager includes a light source operable to emit light into the light guiding layer. The light source is located at an edge of the light guiding layer, to guide light into the light guiding layer of the imaging platen. |
US10516789B2 |
Information processing apparatus and image processing apparatus that perform transmission and reception of data, and method of controlling information processing apparatus
A information processing apparatus capable of avoiding deadlock between transmission and reception operations of data. A transmission section transmits a data block including a predetermined amount of data and a sequence number. A reception section receives the data block. A packet inspection controller of the reception section determines whether the received data block is correct or wrong, based on a result of detection of an error in the data and a result of comparison between an expected value of the sequence number and a value of the sequence number included in the data block. The expected value of the sequence number is changed to a next value when it is determined that the data block is wrong a predetermined number of times. |
US10516782B2 |
Conference searching and playback of search results
Various disclosed implementations involve processing and/or playback of a recording of a conference involving a plurality of conference participants. Some implementations disclosed herein involve receiving audio data corresponding to a recording of at least one conference involving a plurality of conference participants. The audio data may include conference participant speech data from multiple endpoints, recorded separately and/or conference participant speech data from a single endpoint corresponding to multiple conference participants and including spatial information for each conference participant of the multiple conference participants. A search of the audio data may be based on one or more search parameters. The search may be a concurrent search for multiple features of the audio data. Instances of conference participant speech may be rendered to at least two different virtual conference participant positions of a virtual acoustic space. |
US10516780B2 |
Emergency 9-1-1 portal and application
A computer aided prioritization (CAP) system may receive, from the emergency event reporter device, an emergency event including a priority selected from a set of event priorities and a type of event selected from a set of event types associated with the selected event priority; determine, based on the emergency event and without querying the emergency event reporter device for additional information, whether the emergency event indicates a higher priority emergency event to be handled by a computer aided dispatch (CAD) system or a lower priority emergency event to be handled automatically by a computer aided event module (CAEM); and selectively route the emergency event report to at least one of the CAD system and the CAEM according to the determination. |
US10516776B2 |
Volume adjusting method, system, apparatus and computer storage medium
Embodiments of the present disclosure provide a volume adjusting method, system, apparatus and computer storage medium. In one aspect, in the embodiments of the present disclosure, the audio signal in the environment where the terminal lies is acquired, and then the volume of the information output by the terminal is adjusted according to the attributes of the audio signal. Hence, technical solutions provided by embodiments of the present disclosure can automatically adjust the volume of the information output by the terminal, lower volume adjustment operation costs and improve the volume adjusting efficiency. |
US10516772B2 |
Antenna and electronic device including the same
An electronic device is provided. The electronic device includes a housing including a first surface, a second surface disposed facing an opposite side of the first surface, and a side surface configured to surround at least a portion of a space between the first surface and the second surface, a first elongated metal member configured to form a first portion of the side surface and including a first end and a second end, at least one communication circuit electrically connected to a first point of the first elongated metal member through a capacitive element, at least one ground member disposed in an interior of the housing, and a first conductive member configured to electrically connect a second point of the first elongated metal member to the ground member. The second point of the first elongated metal member is disposed closer to the second end than to the first point. |
US10516757B2 |
Server-side scheduling for media transmissions
A server that incorporates the subject disclosure may perform, for example, operations including monitoring current transport characteristics of an internet protocol network communicatively coupled to the server and to a mobile device. Data packets are transported to the device according to a dynamic adaptive streaming over hypertext transfer protocol. A future transport characteristic of the network is predicted according to the trajectory of the device. A request is received from the device for transmission of a data packet, and a time for fulfilling the request is scheduled according to the current and predicted transport characteristics. The operations further comprise selecting a transmission rate for transmission of the data packet to the mobile device responsive to detecting the time for fulfilling the request. The device performs buffering of the data packet for a future presentation of the media content. Other embodiments are disclosed. |
US10516752B2 |
Edge caching shared devices
Disclosed are systems, methods, devices and non-transitory, computer-readable storage mediums for edge caching shared devices. In some implementations, a method comprises: receiving, by a client device on a local area network (LAN), a request for data transfer from a user of the client device; determining, by the client device, if one of a plurality of edge cache servers on the LAN has established server affinity with the user; if an edge cache server has established server affinity with the user, initiating, by the client device, data transfer between the client device and the edge cache server; and if no edge cache server on the LAN has established server affinity with the user, establishing, by the client device, server affinity between the user and one of the plurality of edge cache servers. |
US10516750B2 |
Display control method, display control device, and recording medium
A non-transitory computer-readable recording medium stores a display control program that causes a computer to execute a process. The process includes, receiving a notification from a terminal in one-way communication, when identification information included in the received notification is detected, extracting data included in the notification, and updating display contents of a display device from first display contents to second display contents based on the extracted data. |
US10516749B1 |
Mobile device content navigation
Systems and methods for communicating and displaying collections of images according to a user-selected queue are described. In some example embodiments, a system aggregates content items organized into collections for display to a user on a device. The system receives a selection from the user of a desired order of collection display, based on the user selecting queue request elements associated with the content collections. In response to receiving a playlist request from the user. the system causes display of the content collections in the order selected by the user. In some example embodiments, the system automatically queues one or more pieces of autoforward content to automatically play after the completion of the queued content. |
US10516748B2 |
IoT device identification
Providing an interested party with network availability of certain devices may provide a method including one or more of receiving user requirements for a user device, identifying IoT devices based on a degree of matching between manufacturer-defined capabilities of the IoT devices and the user requirements, verifying the manufacturer-defined capabilities based on tests that expose risks with the manufacturer-defined capabilities of the IoT devices in comparison to current operating features of the IoT devices, determining that no single IoT device satisfies the user requirements based on the verifying, identifying a group of IoT devices which meet or exceed the user requirements, and outputting information about the group of IoT devices including information about exposed risks with manufacturer-defined capabilities of the group of IoT devices via a user interface which enables selection and use of IoT devices included within the group of IoT devices. |
US10516746B2 |
Correlating media consumption data with user profiles
In one embodiment, one or more computer systems of a social-networking system retrieve a user profile for a user associated with a media device. The one or more computer systems of a social-networking system receive media consumption. The one or more computer systems of a social-networking system correlates the user profile and the media consumption data to determine device-based media consumption data associated with content being consumed on the media device. The one or more computer systems of a social-networking system store data that associates the user profile with the device-based media consumption data. |
US10516745B2 |
Information processing method and service platform
The present invention relates to the field of communications technologies, and discloses an information processing method and a service platform, so as to resolve a problem that information in which a current user is interested cannot be pushed to user equipment, and further user experience is lowered. The method provided by the present invention may specifically include: receiving, by a service platform, feature information of a current user sent by an application, where the current user is a user that is currently using the application; processing the feature information by using a demography model, to obtain personal information of the current user; and sending the personal information to the application, so that the application outputs corresponding content for the current user according to the personal information. The method and the service platform may be applied to information processing. |
US10516743B1 |
Systems and methods for facilitating portable user sessions
In an embodiment, a method is performed by a computer system. The method includes automatically receiving, from an agent on a client device that is physically distinct from the computer system, a cookie corresponding to an active user session on a website. The active user session is previously established on the website in response to the website receiving valid user credentials from the client device. The method also includes storing the cookie in memory. In addition, the method includes, via the cookie, collecting information from the website over the active user session, thereby reusing the active user session. Further, the method includes periodically sending a dummy request comprising the cookie to the website, thereby preserving the active user session. |
US10516742B2 |
Access session management
A method includes the following: creating trunk status data for each user account, in response to detecting a plurality of concurrent access sessions relating to a single user account, creating respective branch status data for each access session; updating the branch status data in accordance with user access operations; and when an access session relating to a user account ends, updating the trunk status data for said user account based on a comparison of the branch status data of the access session which has ended with the trunk status data for said user account. |
US10516738B2 |
Sensor lifecycle management system
One embodiment provides an apparatus. The apparatus includes a sensor module. The sensor module includes a sensor; and a sensor controller. The sensor controller is to enumerate the sensor to a sensor processing unit in response to being powered on. The enumerating includes communicating enumeration data to the sensor processing unit. The enumeration data includes one or more of a sensor name, a sensor manufacturer name, a sensor serial number, a hardware version, a firmware version, and/or one or more sensor characteristics. The sensor controller is further to monitor operation of the sensor and to provide sensor lifecycle information to the sensor processing unit over the lifecycle of the sensor. |
US10516737B2 |
Monitoring and controlling of distributed machines
According to various aspects, exemplary embodiments are disclosed of apparatus and methods for monitoring and controlling distributed machines. In an exemplary embodiment, a network includes machines each having sensor(s) and/or actuator(s). Each machine has a node resident on the machine and/or in communication with the machine and that provides raw data from the sensor(s) and/or actuator(s). Each node has a network interface, and a processor and memory configured as a node agent to embed the raw data in message(s) without reformatting the raw data. An engine receives and reformats messages from the node agents without reformatting raw data embedded in the messages. The engine directs the reformatted messages including the raw data to user device(s) for use in managing machine activity and/or status. The engine also sends a message from a user device to a node of a given machine, for use in controlling activity and/or status of the given machine. |
US10516736B2 |
Internet of things
Methods and requestor devices for receiving data generated by a virtual device at a virtual requestor device. The method comprises registering the virtual requestor device with a registrar computer using a first application interface. The virtual requestor then transmits a data feed request to the registrar. The data feed request includes information identifying a data feed and information enabling communication with the virtual requestor device. The virtual requestor device then receives, at a second application interface, the data feed from a virtual device via the information enabling communication with the virtual device. |
US10516735B2 |
Internet of things
Methods and virtual devices for providing data from a virtual device to a virtual requestor device. The method comprises registering the virtual device with a registrar computer using a first application interface. The virtual device then receives a data feed request from the registrar at a second application interface. The data feed request comprises information enabling communication between the virtual device and a virtual requestor device and information identifying a data feed. In response to determining the request is to be granted, the virtual device provides the data feed to the requestor device using the information enabling communication between the two devices. |
US10516733B2 |
Multi-tenancy via code encapsulated in server requests
A multitenant infrastructure server (MTIS) is configured to provide an environment to execute a computer routine of an arbitrary application. The MTIS receives a request from a webtask server to execute the computer routine in a webtask container. The computer routine is executed in the webtask container at the MTIS. Upon successful execution of the computer routine, a result set is returned to the webtask server. If the execution of the computer routine is unsuccessful, an error notification is returned to the webtask server. The resources consumed during the execution of the computer routine are determined. The webtask container is destroyed to prevent persistent storage of the computer routine on the MTIS. |
US10516731B2 |
Reusable multimodal application
A method and system are disclosed herein for accepting multimodal inputs and deriving synchronized and processed information. A reusable multimodal application is provided on the mobile device. A user transmits a multimodal command to the multimodal platform via the mobile network. The one or more modes of communication that are inputted are transmitted to the multimodal platform(s) via the mobile network(s) and thereafter synchronized and processed at the multimodal platform. The synchronized and processed information is transmitted to the multimodal application. If required, the user verifies and appropriately modifies the synchronized and processed information. The verified and modified information are transferred from the multimodal application to the visual application. The final result(s) are derived by inputting the verified and modified results into the visual application. |
US10516728B2 |
Virtual filtering platform in distributed computing systems
Computing systems, devices, and associated methods of operation of filtering packets at virtual switches implemented at hosts in a distributed computing system are disclosed herein. In one embodiment, a method includes receiving, at the virtual switch, a packet having a header and a payload and processing, at the virtual switch, the received packet based on multiple match action tables arranged in a hierarchy in which first and second layers individually contain one or more match action tables that individually contain one or more entries each containing a condition and a corresponding processing action. |
US10516727B2 |
Adaptive communication method among components based on Linux
An adaptive communication method among components based on Linux, related to a technical field of network communication in a distributed environment, includes steps of: creating a unidirection persistent connection between each two communication hosts with a service program; generating a component address list after a distributed component is launched; during communication, packaging a message into a JSON format, searching the address list to find an address, and sending the message to a target component via a Linux local socket or the created unidirection persistent connection according to a location relationship; and, when the component stops, deleting information about the component from the component address list. |
US10516724B2 |
Information processing apparatus and inputting apparatus
An image generation unit generates image data to be displayed on an outputting apparatus. An acceptance unit accepts operation information of inputting units provided in an inputting apparatus. A sharing processing unit carries out, when the acceptance unit accepts operation information of particular one of the inputting units provided in the inputting apparatus, a process of sharing the image data generated by the image generation unit or information relating to the image data. The particular inputting unit provided in the inputting apparatus is used by a user to input operation information to system software of an information processing apparatus, and the sharing processing unit carries out the sharing process only when the acceptance unit accepts the operation information of the particular inputting unit. |
US10516723B2 |
Distributing subscriber data in a mobile data network
A mobile data network supports making subscriber data addressable as devices in a mobile data network. Each data chunk is assigned a device address in the mobile data network. The data chunk can then be addressed as a device in the mobile data network. Data chunks corresponding to a subscriber are distributed across multiple devices in the mobile data network. The location of the subscriber's data chunks is tracked by the subscriber's mobile device and also by a tracking table in the mobile data network. |
US10516721B2 |
Remote process management
Embodiments of the present invention provide a process-management interface on a companion device that allows a user to control characteristics of an application running on a primary device. The interface can change a size or position of a viewport and change the primary device's control focus to or away from viewport. The process-management interface also allows a user to target a process on the companion device. |
US10516720B2 |
Method and system for transmitting browser web page information
A method and a system for transmitting browser web page information includes receiving, by a web server, a web page transmission request from a sending party browser. The web page transmission request includes a receiving party account and a link address. The link address is a website address of a web page currently displayed by the sending party browser. The method includes determining, by the web server, that a receiving party has logged in by using (1) the receiving party account and (2) a browser provided with an inter-screen transmission entrance and is online. The method includes sending, by the web server, the link address to a receiving party browser corresponding to the receiving party account for web page access. |
US10516706B2 |
Systems and methods for providing automated progress updates in a contact center
Providing automated progress updates in a contact center including detecting an activity by a resource of the contact center related to a customer interaction occurring via a customer communications channel between the resource and a customer. The activity comprises an interaction between the resource and one or more additional resources associated with the contact center occurring via a second communications channel. In response to detecting the activity by the resource, a notification comprising a progress update related to the customer interaction is automatically generated. The notification is transmitted, via the customer communications channel, to a customer device associated with the customer interaction. |
US10516704B2 |
Relaying multimedia conferencing utilizing software defined networking architecture
Various embodiments for implementing a multimedia conference session utilizing a software defined networking (SDN) architecture are described. Various embodiments include a SDN media controller (SDNMC) that initially receives a request to establish a multimedia conferencing session between a plurality of endpoints. Based on the request, the SDNMC allocates at least one virtual media address for the multimedia conferencing session and creates a stream table based on the at least one virtual media address. After processing the request, the SDNMC transmits one or more SDN commands that includes the stream table to the SDN controller. The SDN controller receives the SDN commands at a northbound interface and sends one or more SDN instructions to one or more SDN devices at a southbound interface. The SDN devices update their routing information in order to relay media traffic corresponding to the virtual media address directly between the endpoints. |
US10516703B2 |
Monitoring and controlling the status of a communication session
Embodiments are directed to a communication-session (CS) module that monitors the status of a communication session and at least partially controls the status. The CS module provides a party participating in a communication session an indication of whether a status of a microphone the user is employing to participate in an audio and/or video communication session is in a mute (or off) state, or whether the microphone status is in a live (or on) state. Likewise, a CS module may indicate to a user whether a status of a camera that the user is employing to participate in a video communication session is in an off state, or whether the camera status is in an on (or live) state. As such, a CS module provides users reminders of whether or not the microphone and/or camera, is in a live state, a mute state, or is otherwise turned on or off. |
US10516701B2 |
Natural language processing artificial intelligence network and data security system
According to an embodiment, a natural language processing artificial intelligence network and data security system determines an emotions model for one or more users from electronic natural language interactions of the users. The system includes a natural language processing decoder to determine textual features from the electronic natural language interactions that may be indicative of emotional states of the users. They system includes an emotions model encoder that generates an emotions model based on the emotional states of the users in the electronic natural language interactions retrieved from the data storage. The system also includes an artificial intelligence network and data security subsystem. The artificial intelligence network and data security subsystem may use the emotions model as a primitive for artificial intelligence based tasks including computer system security, network security, data security, proactive monitoring and preventive actions, that are moderated using the context provided by the emotional state of a user. |
US10516700B2 |
Synchronous interface to asynchronous processes
Examples of methods, apparatus, and computer program products are disclosed for facilitating access to one or more services in a network environment. At a host, a request is received from a client machine in communication with the host over a network. An asynchronous service description file indicates one or more asynchronous communication techniques configured to be performed to access or communicate with a service over the network. The asynchronous service description file is a conversion of a synchronous service description file indicating one or more synchronous communication techniques for accessing or communicating with a synchronous service. The asynchronous service description file is provided to the client machine. |
US10516696B2 |
Method and system to dynamically obfuscate a web services interface
The present application relates to the handling of what are generally referred to as denial of service (DoS) attacks. More specifically, the present application relates to a method and system for protecting one or more on-line Web service application servers from DoS and/or distributed DoS (DDoS) attacks. |
US10516694B1 |
Hierarchical mitigation of denial of service attacks on communication networks
Systems and methods are described to enable mitigation of network attacks in communication networks. When a network attack is detected, packets within the communication network are routed through a hierarchical mitigation system, which includes at least two tiers of mitigation devices configured to apply mitigation techniques to the packets. Outer tiers of the hierarchical mitigation system (e.g., closer to an edge of the communication network) can apply simple mitigation techniques that are efficient even when distributed, and which provide early mitigation for attack packets while not requiring large amounts of computing resources. Inner tiers of the hierarchical mitigation system (e.g., closer to a destination device) can apply more complex mitigation systems that may require centralized application, and which provide more robust mitigation at a potentially higher computing resource cost. |
US10516690B2 |
Physical device detection for a mobile application
Techniques to facilitate detection of whether or not applications are executed on physical devices are disclosed herein. In at least one implementation, a mobile application that generates a web service request is executed on a computing system. The computing system executes a client security component of the mobile application to collect attributes associated with the computing system and an operating environment on which the mobile application is executing, and utilizes a mobile application programming interface to transfer the web service request including the attributes for delivery to a web server. The web server executes a server security component of a web service to extract the attributes from the web service request and process the attributes to determine whether or not the mobile application is being executed on a physical mobile device. |
US10516688B2 |
Ransomware resilient cloud services
An anti-ransomware system protects data in cloud storage of a cloud services provider against a ransomware attack. A backup handler is configured to at least one of: selectively retrieve backup data generated by the cloud services provider from the cloud storage; and selectively generate backup data based on the data in the cloud storage and output the backup data to a storage device. A ransomware detector is configured to detect data changes to the data resulting from a ransomware attack. A ransomware remediator communicates with the ransomware detector and the backup handler and is configured to restore the data to a state prior to the ransomware attack based upon the backup data. |
US10516687B1 |
Network traffic spike detection and management
Systems and methods are described to predict spikes in requests for content on a computing network based on referrer field values of prior requests associated with spikes. Specifically, a traffic spike prediction service is disclosed that can analyze information regarding past requests on the computing network to detect a spike in requests to a content item, where a significant number of request within the spike include a common referrer field value. The traffic spike prediction service can then detect a request to a second content also including the common referrer field value, and predict that a spike is expected to occur with respect to the second content. The traffic spike prediction service can manage the expected spike by increasing an amount of computing resources available to service requests to the second content and by marking traffic of the expected spike as likely legitimate, as opposed to malicious. |
US10516682B2 |
Forensic analysis of computing activity
A data recorder stores endpoint activity on an ongoing basis as sequences of events that causally relate computer objects such as processes and files. When a security event is detected, an event graph may be generated based on these causal relationships among the computing objects. For a root cause analysis, the event graph may be traversed in a reverse order from the point of an identified security event (e.g., a malware detection event) to preceding computing objects, while applying one or more cause identification rules to identify a root cause of the security event. Once a root cause is identified, the event graph may be traversed forward from the root cause to identify other computing objects that are potentially compromised by the root cause. |
US10516681B2 |
Vehicle correlation system for cyber attacks detection and method thereof
A system and method for detection of at least one cyber-attack on one or more vehicles including steps of transmitting and/or receiving by a first on-board agent module installed within one or more vehicles and/or a second on-board agent module installed within road infrastructure and in a range of communication with said first on-board agent module metadata to and/or from an on-site and/or remote cloud-based detection server including a correlation engine; detecting cyberattacks based on correlation calculation between the metadata received from one or more first agent module installed within vehicles and/or from one or more second agent modules installed within road infrastructure; indicating a probability of a cyber-attack against one or more vehicle based on correlation calculation; initiating blocking of vehicle-to-vehicle communication to present and/or stop a spread of an identified threat. |
US10516678B2 |
Determining the legitimacy of messages using a message verification process
A server computer receives an indication of an interaction between a first user device of a first user and a second user device of a second user, where the interaction includes a message for transmission from the first user to the second user. The server computer performs a verification process on the message, including performing one or more binary checks on the message. The server computer then generates a response indicating whether the message is a legitimate message based on the verification process. When the response indicates that the message is a legitimate message, the server computer transmits the message to the second user device of the second user for display. |
US10516674B2 |
Method and systems for virtual file storage and encryption
The present invention discloses an intelligent cloud server for cloud storage information management and encryption. In some embodiments, the intelligent cloud server can save and store documents without the need of first saving them in a local drive for upload. Upon storage, the document can be scanned and classified in a security level according to pre-determined settings and parameters. In some embodiments, depending on the classification, the system can encrypt portions of the document in order to facilitate the sharing and access of information in a secure way. Encryption keys and access to the encrypted portions are only provided upon authentication of the user, network, and/or need, according to corresponding protocols for the information. |
US10516672B2 |
Service discovery for a multi-tenant identity and data security management cloud service
A system provides cloud-based identity and access management. The system receives a request for an identity management service, authenticates the request, and forwards the request to a microservice configured to perform the identity management service, where the microservice is implemented by a microservice virtual machine provisioned by a provisioning framework, and the forwarding is according to routing information configured based on metadata information stored in a registry by the provisioning framework. The system then performs the identity management service by the microservice. |
US10516666B2 |
Authentication method, apparatus, and system
An authentication method is provided. The authentication method includes receiving a login request from a client terminal. The login request may be generated based on an identification feature of the client terminal, and the login request may include account information associated with the client terminal. The method may further include identifying the identification feature based on the login request, determining whether a database associated with a server includes the identification feature and the account information, generating login status information based on a result of the determination and sending the login status information to the client terminal, and if the login status information indicates a login success of the client terminal, initiating data communications with the client terminal. |
US10516665B2 |
Network management apparatus, network management method, and recording medium
A network management apparatus that connects to a terminal by way of a communication apparatus, includes: a legitimate information generation unit configured to generate legitimate identification information that is identification information to identify the terminal on a network that the network management apparatus manages, the legitimate identification information being managed as legitimate information by the network management apparatus; a fake information generation unit configured to generate fake identification information that is different from the legitimate identification information and that cannot be used as it is for communication with another terminal; a management unit configured to manage the legitimate identification information and the fake identification information in association with each other; and a registration unit configured to register the fake identification information to the terminal. |
US10516662B2 |
System and method for authenticating the legitimacy of a request for a resource by a user
A method of authenticating the legitimacy of a request for a resource from a resource provider by a user, including providing an authentication process in which a resource provider message is received and de-assembled, the integrity of the user request message is confirmed, a result indicator as to the legitimacy of the resource provider message is created by performing two or more authenticity checks, and an authentication result is sent. |
US10516661B2 |
Virtual electronic security perimeter using deterministic networking
In one embodiment, a supervisory device for a network of a power substation identifies a plurality of nodes in the network of the power substation. The supervisory device associates each of the nodes with one or more security certificates. A particular security certificate authenticates a particular node to the supervisory device and authorizes the particular node to communicate in the network of the power substation. The supervisory device determines a security perimeter for the nodes in the network. The supervisory device schedules communications among the nodes using the one or more security certificates and based on the determined security perimeter. |
US10516660B2 |
Methods, systems, devices and products for authentication
A communication device having a controller transmits to a communication system a PKI certificate. Encrypted communications may commence responsive to receiving a public key. The communication system can have a plurality of network elements that integrate operations of a circuit-switched communication network and a packet-switched communication network. |
US10516652B1 |
Security association management
A system (and method) includes a plurality of compute devices configured to execute an endpoint node and a provisioning service. The endpoint node is configured to establish an encrypted communication channel over a public network. The provisioning service is configured to retrieve configuration parameters from a database. The configuration parameters define a security association for the encrypted communication channel and include an encryption key and an identifier of an encryption algorithm. The provisioning service is configured to transmit the configuration parameters to the endpoint node for use in implementation of a security association for the encrypted communication channel. |
US10516650B2 |
Dynamic, user-configurable virtual private network
Some embodiments described herein relate managing communications between an origin and a destination using end-user and/or administrator configurable virtual private network(s) (VPN(s)). A first VPN that defines a first data path between an origin and a destination can be defined at a first time. A second VPN that defines a second, different data path between the origin and the destination can defined at a second time. Each packet sent across the first VPN and each packet sent across the second VPN can follow the same data path for that VPN, such each packet can be sent across the first VPN or the second VPN in the order it was received, and the transition between the first VPN and the second VPN can be “seamless,” and communications between the origin and the destination are not disrupted between the first time period and the second time period. |
US10516643B2 |
Client side social network response tracking
Embodiments of the present invention address deficiencies of the art in respect to response subscriptions and provide a method, system and computer program product for response tracking across social networks. In one embodiment of the invention, a social networking response tracking method can be provided. The method can be performed by client-side logic and can include associating subscribers with a user or a group of users based upon a posting by the user or a user in the group of users within a client computing device for the user, aggregating different postings from the user to correspondingly different forums disposed about a global computer communications network, and, notifying the subscribers of the aggregated postings. |
US10516641B2 |
System and method for automated evaluation system routing
Systems and methods for automated evaluation system routing are described herein. The system can include a memory, which can include a model database and a correlation database. The system can include a first user device and a second user device. The system can include at least one server. The at least one server can: receive a response communication from the user device; generate an initial evaluation value according to an AI model; determine a correlation between the initial evaluation value and evaluation range data; accept the initial evaluation value when the correlation exceeds a threshold value; and route the response communication to the second user device for generation of an elevated evaluation value when the correlation does not exceed the threshold value. |
US10516634B2 |
Information processing device, display method and computer program for associating comments with video content
A video displaying section displays video content in a video display region on a viewing screen. A comment acquiring section acquires a comment with regard to the currently displayed video content. A comment displaying section causes the viewing screen currently displaying the video content to scroll a comment acquired by the comment acquiring section. The comment displaying section displays a comment when the position of the comment does not overlap with the video display region and hides from view a comment when the position of the comment overlaps with the video display region. |
US10516629B2 |
Systems and methods implementing user interface objects
According to one aspect, a system including a memory, at least one processor coupled to the memory, and a user interface component executed by the at least one processor is provided. The user interface component may be configured to present a representation of a first object within a message thread, receive, from a user, a first user interface action associated with the representation of the first object, receive, from the user, an input that causes the first user interface action to be applied to a target element associated with the chat interface, and execute the first user interface action on the target element associated with the chat interface. |
US10516628B2 |
Transfer device, transfer system, and transfer method
A transfer device includes a memory and a processor configured to, when a plurality of packets are received from a client apparatus, register each of identifiers uniquely identifying each of the plurality of packets into sequence information in a reception order of the plurality of packets, when a first packet is received from the client apparatus, transmit the first packet to a destination apparatus and specify first identifier of a second packet next to the first packet in accordance with an order of the identifiers registered in the sequence information, and transmit the second packet corresponding to the specified first identifier to the destination apparatus. |
US10516627B2 |
Ethernet frame injector
Frame injection apparatus for injecting frames from a host device into a switched Ethernet network comprises a frame memory operable to receive and store one host frame at a time and to inject the frame onto the Ethernet switched network between network frames and to buffer network frames received during the time that the host frame is being injected onto the network. |
US10516625B2 |
Network entities on ring networks
Examples described herein relate to a network entity on a ring network. In an example, a method includes receiving a first packet by a first network entity via a ring network. It is determined from the first packet that the ring network has a plurality of management entities each claiming a respective network entity. Based on the ring network having the plurality of management entities each claiming the respective network entity, the first network entity is transitioned from an unclaimed state to a dummyclaim state, and the first network entity is isolated from a portion of the ring network. |
US10516621B2 |
Systems and methods to minimize packet discard in case of spiky receive traffic
Described embodiments provide for minimizing packet discarding in case of spiky traffic reception by using adaptive buffers. Transmission buffers may be adjusted based on traffic behavior, with the buffer size dynamically expanding or shrinking as needed, providing a cushion to hold extra packets when a buffer drain rate is slower than the buffer arrival rate. |
US10516620B2 |
Congestion avoidance in a network device
A network device receives a packet is received from a network, and determines at least one port, among a plurality of ports of the network device, via which the packet is to be transmitted. The network device also determines an amount of free buffer space in a buffer memory of the network device, and dynamically determines, based at least in part on the amount of free buffer space, respective thresholds for triggering ones of multiple traffic management operations to be performed based on the packet. Using the respective thresholds, the network device determines whether or not to trigger ones of the multiple traffic management operations with respect to the packet. The network device performs one or more of the traffic management operations with respect to the packet determined to be triggered based on the corresponding one of the respective thresholds. |
US10516619B2 |
TCP window sizing
An example system for Transmission Control Protocol (TCP) window sizing is disclosed. The example disclosed herein comprises a data flow detection engine, a TCP connection engine, a feedback engine, and a TCP window sizing engine. The data flow detection engine is to detect the number of data flows received by a buffer from a network component. The TCP connection engine is to determine a number of TCP connections within the network component from the number of data flows. The feedback engine is to send a feedback signal to a source of at least one of the number of TCP connections based on a state of the buffer and the number of TCP connections. The TCP window sizing engine is to adjust a TCP window size based on the feedback signal. |
US10516616B2 |
Method and apparatus for network congestion control based on transmission rate gradients
A method for congestion control in a data communication protocol employing acknowledged communication may include measuring a flight size. A transmission rate may be measured. A trend of the flight size may be determined. A trend of the transmission rate may be determined, and the trend may be derived from a transmission rate gradient calculation, in which either the transmission rate measurements or the transmission rate gradient calculations or both may be filtered to reduce their temporal variability. Whether there is a congestion may be detected according to the determined trend of the transmission rate and the trend of the flight size. Upon detection of the congestion, a change may be made from a current congestion control state to a new congestion control state. Data may be transmitted while respecting a maximum amount of unacknowledged data which the transmitting node may transmit. An apparatus is also disclosed. |
US10516612B2 |
System and method for identification of large-data flows
Apparatus, systems and methods may be used to monitor data flows and to select and track particularly large data flows. A method of tracking data flows and identifying large-data (“elephant”) flows comprises extracting fields from a packet of data to construct a flow key, computing a hash value on the flow key to provide a hashed flow signature, entering and/or comparing the hashed flow signature with entries in a flow hash table. Each hash table entry includes a byte count for a respective flow. When the byte count for a flow exceeds a threshold value, the flow is added to a large-data flow (“elephant”) table and the flow is then tracked in the large-data flow table. |
US10516609B1 |
Stateful packet inspection and classification
Stateful inspection and classification of packets is disclosed. For a first packet associated with a network traffic flow, a differentiated services header value (DSHV) is determined to associate with the first packet. The DSHV is used to perform a lookup of a quality of service treatment associated with the DSHV. The treatment is applied to the first packet. A determination is made, for a second packet associated with the network traffic flow, to associate a second DSHV with the second, where the second DSHV is different from the first DSHV. |
US10516604B2 |
Packet forwarding system, control apparatus, and control method and program for relay device
A control apparatus sets, in a relay device: first control information that forwards, when a packet for flooding is received by a representative port of a trunk, the packet to a prescribed forwarding destination port and to a representative port of another trunk; second control information that executes, when the packet for flooding is received by a nonrepresentative port of the truck, forwarding of the packet to a stack link port associated with the same trunk group as the trunk of the port that received the packet for flooding, and forwarding to a nonrepresentative port of another trunk in the trunk group; and third control information that forwards, when the packet for flooding is received by the stack link port, the packet to a prescribed forwarding destination port and to a representative port of a trunk not belonging to the same trunk group. |
US10516600B2 |
Detecting and preventing network loops
Systems, methods, and non-transitory computer-readable storage media for detecting network loops. In some embodiments, a system can identify a port that is in a blocking state. The blocking state can be for dropping one or more types of packets and preventing the port from forwarding the one or more types of packets. The system can determine a number of packets transmitted through the port by a hardware layer on the system and a number of control packets transmitted through the port by a software layer on the system. The system can determine whether the number of packets is greater than the number of control packets. When the number of packets is greater than the number of control packets, the system can determine that the blocking state has failed to prevent the port from forwarding the one or more types of packets. |
US10516599B1 |
Link priority for loop-protect
This disclosure is directed to a method, system, and device for disabling links within a computer network based on a loop link priority parameter. The method includes detecting a loop in a network in a network communication device having multiple interfaces associated with different priorities. The device may transmit a first network packet as a loop check packet outbound from the network communication device via a first interface port. The device may then receive a second network packet (which may be the first outbound packet returning inappropriately to the device) as an inbound network communication via a second interface port. If the device identifies return of a sent loop check packet, it may disable one of the first interface port or the second interface port based on a comparison of loop link priority parameters to remove the loop in the network. |
US10516596B2 |
Information processing apparatus, method and non-transitory computer-readable storage medium
A system includes spine switches, leaf switches, information processing apparatuses, and a processor configured to allocate a first leaf switch group to a first job, the first leaf switch group corresponding to a first column in a lattice part including points other than points at infinity of a finite projective plane corresponding to a Latin square fat-tree, and allocate a second leaf switch group to a second job, the second leaf switch group corresponding a second column, and transmit first schedule information on first communication related to the first job to a first information processing apparatus coupled to the first leaf switch group, and transmit second schedule information on second communication related to the second job to a second information processing apparatus coupled to the second leaf switch group, wherein the first and second communication are collective communication in which each of the information processing apparatuses communicates with others. |
US10516594B2 |
Systems and methods for changing the frequency of monitoring data
The present invention discloses methods and systems for monitoring a network connected device by a monitoring server. The monitoring server sends notifications to the network connected device periodically according to a time interval. The time interval is set to a normal value and the notifications include a request for the monitoring data. Then the network connected device sends the monitoring data to monitoring server upon receiving the notifications. Monitoring server receives and stores the monitoring data from the network connected device. When one condition is satisfied, the time interval is changed to a lower value. Therefore, the frequency of sending notifications to network connected device from monitoring server is changed. |
US10516593B2 |
Method and network monitoring device for calculating throughput of traffic flows in communication networks
The present invention relates to a network monitoring device and methods for calculating average throughput of subscribers in a communication network. |
US10516590B2 |
External health checking of virtual private cloud network environments
Systems and methods are described to enable health checking of computing devices within a virtual private cloud (VPC) networking environment, without requiring that the devices be accessible via a public network address. An endpoint is placed within the VPC, which enables interaction with an external health checking system via a substrate network. The endpoint handles communications between the heath checking system and the VPC, and can modify data originating from the health checking system such that it appears to originate from the endpoint. From the viewpoint of the VPC, the endpoint itself may appear to be conducting health checking. Thus, external health checking can be used on a VPC without compromising the security of the VPC by requiring that a portion of the VPC be externally addressable. |
US10516589B2 |
Sensor web management system for internet of things sensor devices with physically imprinted unique frequency keys
Concepts and technologies are disclosed herein for a sensor web for Internet of Things (“IoT”) devices. According to one aspect disclosed herein, a system can monitor a health status of an IoT sensor device of a plurality of IoT sensor devices. The system can determine that the health status of the IoT sensor device indicates a sensor malfunction experienced by the IoT sensor device, and in response, can generate and send an alert to a forensic analytics module. The alert can identify the sensor malfunction. In response to the alert, the forensic analytics module can determine a last known location of the IoT sensor device. The system can obtain a set of satellite images of the last known location of the IoT sensor device, and can utilize the set of satellite images of the last known location to determine a cause of the sensor malfunction. |
US10516587B2 |
Systems and methods for node resolution using multiple fields with dynamically determined priorities based on field values
The systems and methods described herein can use multiple fields with dynamically determined priorities based on field values for node resolution. The system can generate activity field-value pairs including an activity value associated with an activity field from an electronic activity. The system can determine a frequency score based on a first count of node field-value pairs that match the activity value. The system can assign a weight to the activity value based on the frequency score. The system can generate a match score of a candidate node profile indicating a likelihood that the electronic activity is transmitted or received by an account corresponding to the candidate node profile. The system can store an association between the electronic activity and the node profile selected based on the match score. |
US10516584B2 |
Systems and methods for efficient network conversation bandwidth statistics gathering
Computer networks are monitored for usage and security purposes. A network intercept device (NID) monitors network traffic such as conversations between source and destination endpoints in the network. Bandwidth usage statistics may be maintained for each monitored endpoint (e.g. by source IP address). Rather than determining statistics for all active conversations during a particular monitoring period, which comprehensive statistics determining may tax NID processing and storage resources, statistics for a “top” number of conversations (N) may be determined. A lossy approach may be used to gather statistics over the period for up to N conversations of each monitored endpoint. When a new conversation commences during the period for which statistics are not being gathered, each of the monitored endpoint's conversations may be decayed. The new conversation is added for statistics gathering, replacing one of the N conversations, when the one conversation has sufficiently decayed to or below a threshold. |
US10516582B2 |
Managing client access for storage cluster performance guarantees
Performance of a distributed storage system with data distributed substantially, evenly across a cluster of storage devices can be dynamically managed of the distributed storage system with respect to performance guarantees to clients of the distributed storage system. Capacity of the distributed storage system in terms of one or more metrics can be determined. This measured capacity can then be compared with allocations of the metric(s) to clients of the distributed storage system. The allocations are determined based on quality of service parameters specified for the clients. The quality of service parameters at least include a maximum value and a minimum value for each of the one or more metrics, and can also include burst credits allocated to the clients. Access to the distributed storage system by the clients can be throttled to ensure the performance guarantees corresponding to the quality of service parameters are fulfilled. |
US10516576B2 |
Connection device and connection method using priority level information for a plurality of processes
Provided is a technology for enabling smooth execution of a plurality of pieces of application software which perform communication via a communication path. A connection device includes: a storage unit which stores type priority level information for specifying a priority level assigned in advance for each type of a process, usable communication system information for specifying a usable communication system for each process, and sharing propriety information for specifying whether or not the communication system is sharable among a plurality of processes during the same period of time; a plurality of communication units which communicate to and from another device with use of the communication systems different from one another; and a communication system allocation control unit configured to: use the usable communication system information to identify the communication system usable by the process to be started to be executed; and allocate, when the identified communication system is not sharable and a process in execution that is different from the process already uses the identified communication system, the process to use the communication system based on the priority levels. |
US10516575B2 |
Method and system for efficiently processing command line interface (CLI) instructions on a network element
A method and system for efficiently processing command line interface (CLI) instructions on a network element. Specifically, the disclosed method and system analyze CLI statements to determine whether a given CLI statement should be processed by a command specific sub-agent or a non-specific sub-agent. The presence of a bypass statement included in the CLI statement may indicate that the CLI statement should be processed by a command specific sub-agent to reduce the computational load of executing the command specified by the CLI statement. The presence of a regular statement, rather than a bypass statement, in the CLI statement may indicate that the CLI statement should be processed by a nonspecific sub-agent. Processing of a CLI statement that includes a bypass statement may be expedited by bypassing generic runtime processes performed by a nonspecific sub-agent. |
US10516569B2 |
Configuration of network nodes
There is provided configuration of a secondary network node in a carrier aggregation enabled communications network The secondary network node supports radio transmission using a cellular radio access technology (RAT) for deployment as a network node serving a secondary serving cell associated with a primary serving cell in a carrier aggregation enabled communications network using the cellular RAT and a non-cellular RAT for deployment as a network node serving a non-cellular RAT hotspot using the non-cellular RAT. After receiving an indication from a cellular primary network node associated with the primary serving cell the secondary network node starts scanning an unlicensed frequency band for deployment of the network node. The secondary network node determines at least one frequency interval of the at least one unlicensed frequency band substantially free from transmitting interferers. Based on information received from the cellular primary network node the secondary network node deploys the network node using the cellular RAT or the non-cellular RAT by configuring the secondary network node for transmission in one of the at least one frequency interval according to the configuration information. |
US10516565B2 |
Transformation and transmission of event messages
Messages indicative of events are transmitted from a computer network to a management system using an agent device. The agent device receives a web service event collector from the management system. The web service event collector includes event message transformation instructions and an endpoint definition. After the web service event collector is initialized, an event message transmitted from an event source is received using the web service event collector. The event message indicates an event associated with the computer network. Using the event message transformation instructions, the event message is transformed into a format usable by the management system. The transformed event message is then transmitted to the management system. |
US10516563B2 |
Apparatus and a method for generating a radio frequency signal
An apparatus for generating a radio frequency signal based on a symbol within a constellation diagram is provided. The constellation diagram is spanned by a first axis representing an in-phase component and an orthogonal second axis representing a quadrature component. The apparatus includes a processing unit configured to select a segment of a plurality of segments of the constellation diagram containing the symbol. The segment is delimited by a third axis and a fourth axis each crossing the origin of the constellation diagram and spanning an opening angle of the segment of less than about 90°. The processing unit is further configured to calculate a first coordinate of the symbol with respect to the third axis, and a second coordinate of the symbol with respect to the fourth axis. The apparatus further includes a plurality of digital-to-analog converter cells configured to generate the radio frequency signal using the first coordinate and the second coordinate. |
US10516560B2 |
Efficient multiplexing of control information and data transmission
The present disclosure pertains to a transmitter terminal (10), the transmitter terminal (10) being adapted for D2D communication and/or transmission. The transmitter terminal (10) is further being adapted for transmitting multiplexed control information and data, wherein the control information and data are multiplexed based on a mapping. The present disclosure also pertains to related devices and methods. |
US10516553B2 |
Integration of physical and virtual LMR networks
Integration of a land mobile radio (LMR) communications system and other wireless IP based systems such as LTE by way of a virtual router and virtual base stations. The LMR system may be either trunked or conventional. The virtual router maintains LMR IDs and also IP addresses for both physical and virtual base stations, multi bearer terminals and other components of the integrated system. Physical LMR base stations form a physical network. Virtual LMR base stations form a virtual network. These physical and virtual LMR networks communicate using ISSI, AIS or DFSI for example. |
US10516552B2 |
Electronic device and method for setting communication protocol
An electronic device is provided. The electronic device includes one or more antennas that resonate within a licensed band and an unlicensed band, a first communication circuit electrically connected with at least part of the one or more antennas and processing an LTE signal, a second communication circuit electrically connected with at least part of the one or more antennas and processing a Wi-Fi signal, and a processor electrically connected with the first communication circuit and the second communication circuit. The processor is configured to obtain first data indicating a state of a first channel corresponding to a first communication protocol, obtain second data indicating a state of a second channel corresponding to a second communication protocol, select at least one communication protocol based on the first data and the second data, and perform communication through a communication circuit, which corresponds to the selected at least one communication protocol. |
US10516551B2 |
In-band telemetry with limited extra bytes
A method for performing in-band operations, administration, and management (OAM) using fixed bytes. According to one aspect, data packets are selected from a packet flow according to a sampling rate. A network device's OAM information is inserted into a fixed length field of each selected packet as a selected packet is processed by the network device. |
US10516549B2 |
Multicast service with is-is spine-leaf extension in a fabric network
Aspects of the embodiments are directed to systems, methods, and network elements executing instructions stored thereon. Aspects are directed to, for each spine node connected to a leaf node network element, identifying a spine router identifier, identifying a multicast group address, computing a plurality of hash values based on a hash function using the spine router identifier and the multicast group address, identifying a root spine node based on a highest hash value from the plurality of hash values; and transmitting an IS-IS message to root spine node indicating election of spine node as the root spine node. |
US10516546B2 |
Load control device user interface and database management using Near Field Communication (NFC)
An energy control network may include a number of load control devices, such as dimmer switches, multi-button selector switch, occupancy sensors, and remote controllers, among others. These load control devices may be configured for wireless communication. Other wireless devices, such as laptops, tablets, and “smart” cellular phones may be configured to communicate with the load control devices of the energy control network. The load control devices and the other wireless communication devices may also be configured for Near Field Communication (NFC). NFC may be used to provide a load control device with its initial default configuration and/or an application specific configuration. Also, NFC may be used to transfer a configuration from one load control device that may have become faulty, to a replacement load control device. And NFC may be used to provide and trigger commands that may cause a load control load device to operate in a predetermined manner. |
US10516545B2 |
Congestion management in a multicast communication network
It is disclosed a method for managing a congestion in a communication network supporting the transmission of multicast data flows. The method comprises, upon detection of a congestion at a transmission interface of a router: identifying a multicast data flow being forwarded through the transmission interface and suffering a packet loss; interrupting the transmission of the data flow through the transmission interface downstream the router and, in case the data flow would be transmitted downstream the router trough the transmission interface only, sending a request to an upstream router for interrupting the transmission of the data flow from the upstream router to the router; and inhibiting, for a given period of time, any request to forward the data flow via the transmission interface. |
US10516544B2 |
Extranet connectivity in LISP networks
A Location/Identifier Separation Protocol (LISP) mapping server, including: a network interface for communicating with a LISP-enabled network; a mapping database; an extranet policy table; and a shared subnetwork mapping engine (SSME), including at least a hardware platform, configured to: receive a map request from a first endpoint serviced by a first xTR, the first endpoint on a first subnetwork, the map request for a second endpoint; determine that the second endpoint is not a member of the first subnetwork; query the extranet policy table to identify a second subnetwork that the first subnetwork subscribes to, and to determine that the second endpoint is a member of the second subnetwork; and provide to the first subnetwork a routing locator (RLOC) of an xTR servicing the second endpoint. |
US10516543B2 |
Communication protocol using implicit certificates
A first entity and a second entity establish a protected authenticated communication channel using an implicit certificate issued by a certificate authority. In some examples, the implicit certificate is generated based at least in part on the ring learning with errors (“RLWE”) problem. Using the implicit certificate, the first entity and the second entity exchange information that enables the entities to negotiate a shared secret. The shared secret may be used to establish a cryptographically protected communication channel. Successful use of the shared secret authenticates the identity of the first entity and the second entity. |
US10516540B2 |
Management of profiles in an embedded universal integrated circuit card (eUICC)
Consumer/enterprise and machine-to-machine functions in wireless devices have led to a need for end user consent, security of profile data while permitting remote profile management, and mixed profile types in a shared embedded Universal Integrated Circuit Card (eUICC). User consent is provided by the device or by the eUICC parsing an incoming profile management command and triggering a user prompt on a user interface. Security of profile data while permitting operation of remote profile management commands is obtained by authentication procedures. In some embodiments, control of command influence is also obtained by providing policy control functions at the profile level. Mixed profile types are supported by creating multiple security domains within the eUICC. Authentication is performed on a public key infrastructure (PKI) basis or on a pre-shared symmetric key basis. |
US10516534B2 |
Cryptographic system and key generation apparatus
A cryptographic system implements a functional encryption scheme that is based on the lattice theory. In the cryptographic system, a key generation apparatus generates, as a secret key skv for a predicate vector v, a secret key skv including a matrix e as a key element, wherein a product of the matrix e and a matrix AY determined by the predicate vector v being input parameter Y forms a matrix uj for a value j in a set [N] including a plurality of values, the matrix uj being among a plurality of matrices u obtained from public parameters PP. |
US10516530B2 |
Secure data handling and storage
Apparatuses, methods, systems, and program products are disclosed for secure data handling and storage. A method includes receiving a plurality of keys for unlocking an encryption engine. Each key may be associated with a key holder. At least a subset of the plurality of keys are combined to generate a master key. An encryption engine is unlocked using the master key. Encrypted data is received at the encryption engine on a continuous basis. The encrypted data is encrypted using a first encryption key, and includes sensitive information for one or more users. The encrypted data is decrypted using the first encryption key. The decrypted data is re-encrypted using a second encryption key that is newer than the first encryption key. |
US10516529B2 |
Information processing apparatus and information processing method
An information processing system includes circuitry that stores at least one secret key that corresponds to a public key. The circuitry causes display, on a screen, of information corresponding to the public key and information corresponding to the secret key. The circuitry also modifies the display of the first information corresponding to the public key when the public key is used and the display of the second information corresponding to the secret key when the secret key is used. |
US10516527B1 |
Split-key based cryptography system for data protection and synchronization across multiple computing devices
Split-key based cryptography techniques are provided for data protection and synchronization across multiple computing devices of a user. A method performed by a first device of a user comprises encrypting a data using a randomly-generated data encryption key; wrapping the data encryption key with a public key of a second device of the user; and sending the encrypted data and the wrapped data encryption key of the first device wrapped with the public key of the second device to a server. The server sends the encrypted data and the wrapped data encryption key of the first device wrapped with the public key of the second device to the second device. The first device or the second device can access the encrypted data by reconstructing their respective private key using a predefined number of shares obtained using a key splitting scheme. |
US10516524B1 |
Transmitting content to promote privacy
An example process includes breaking content into multiple fragments; and transmitting at least two of the multiple fragments over different physical channels in order to isolate the at least two fragments during transmission. The example process may include generating session keys; encrypting at least some of the fragments using different session keys; and associating, with each fragment, a session key used to encrypt a different fragment to produce fragment/session key pairs. |
US10516518B2 |
Adaptive control channel design for balancing data payload size and decoding time
A method of wireless communication includes determining a control region for transmitting control information to a receiver based on a transport block size. In one configuration, the control region is determined based on an enhanced physical downlink control channel (ePDDCH) decoding time, symbol pre-processing time, multiple input multiple output (MIMO) mode, transmission rank, and/or user equipment (UE) interference cancellation factors. The method also includes transmitting the control information in the determined control region. |
US10516517B2 |
System and methods for support of frequency hopping for UEs with reduced bandwidth support
An eNodeB (eNB), Machine Type Communications (MTC) user equipment (UE) and method using a physical uplink control channel (PUCCH) in a non-legacy PUCCH region are generally described. The UE may be in an enhanced coverage (EC) mode. The UE may receive higher layer signaling indicating physical resource blocks in the PUCCH region and offsets in a cell- or UE-specific manner on a per-slot basis or, when in EC mode, per-set of N subframes basis. The UE may receive a resource allocation for a PUCCH in a PUCCH region separate from a legacy PUCCH region and reserved for non-legacy UEs. The UE may transmit a frequency hopping PUCCH in the PUCCH region and use shortened PUCCH format to accommodate an extended retuning time by puncturing a first and/or last symbol of at least one slot. If retuning, the UE may drop a sounding reference signal transmission in the next subframe. |
US10516511B2 |
Reception device, transmission device, reception method, transmission method, and program related to allocation of parameters to signals
A transmission device that: allocates at least partially shared transmission parameters to at least a subset of a plurality of signals to which resource blocks are allocated, the resource blocks having at least partially overlapping frequency resources or time resources; and controls a transmission process of the plurality of signals based on the shared transmission parameters. |